>emb|AL606619.3|OSJN00032 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0043A12,
complete sequence
Length = 190432
Score = 91.7 bits (46), Expect = 3e-15
Identities = 58/62 (93%)
Strand = Plus / Plus
Query: 502 gtggctaaactacaagaagccttgtgcttccttgcagatccacaagagcactccttggtt 561
||||||||| ||||||||| |||||||||||| ||||||||||||||||| |||||||||
Sbjct: 147546 gtggctaaattacaagaaggcttgtgcttcctagcagatccacaagagcattccttggtt 147605
Query: 562 tt 563
||
Sbjct: 147606 tt 147607
Score = 65.9 bits (33), Expect = 2e-07
Identities = 50/55 (90%), Gaps = 3/55 (5%)
Strand = Plus / Plus
Query: 410 cttgttctttcttcttttgcttcgccttccctttctggcccttcccttggccacc 464
|||||||||||||||||||||| |||||| |||||||| ||||||||||||||
Sbjct: 146810 cttgttctttcttcttttgctt---cttccccttctggcctttcccttggccacc 146861
>emb|AL732346.2| Oryza sativa genomic DNA, chromosome 4, BAC clone: H0818H01, complete
sequence
Length = 101125
Score = 91.7 bits (46), Expect = 3e-15
Identities = 58/62 (93%)
Strand = Plus / Plus
Query: 502 gtggctaaactacaagaagccttgtgcttccttgcagatccacaagagcactccttggtt 561
||||||||| ||||||||| |||||||||||| ||||||||||||||||| |||||||||
Sbjct: 98958 gtggctaaattacaagaaggcttgtgcttcctagcagatccacaagagcattccttggtt 99017
Query: 562 tt 563
||
Sbjct: 99018 tt 99019
Score = 65.9 bits (33), Expect = 2e-07
Identities = 50/55 (90%), Gaps = 3/55 (5%)
Strand = Plus / Plus
Query: 410 cttgttctttcttcttttgcttcgccttccctttctggcccttcccttggccacc 464
|||||||||||||||||||||| |||||| |||||||| ||||||||||||||
Sbjct: 98222 cttgttctttcttcttttgctt---cttccccttctggcctttcccttggccacc 98273
>emb|AL732356.2| Oryza sativa genomic DNA, chromosome 4, BAC clone: H0624F09, complete
sequence
Length = 95419
Score = 91.7 bits (46), Expect = 3e-15
Identities = 58/62 (93%)
Strand = Plus / Plus
Query: 502 gtggctaaactacaagaagccttgtgcttccttgcagatccacaagagcactccttggtt 561
||||||||| ||||||||| |||||||||||| ||||||||||||||||| |||||||||
Sbjct: 18803 gtggctaaattacaagaaggcttgtgcttcctagcagatccacaagagcattccttggtt 18862
Query: 562 tt 563
||
Sbjct: 18863 tt 18864
Score = 65.9 bits (33), Expect = 2e-07
Identities = 50/55 (90%), Gaps = 3/55 (5%)
Strand = Plus / Plus
Query: 410 cttgttctttcttcttttgcttcgccttccctttctggcccttcccttggccacc 464
|||||||||||||||||||||| |||||| |||||||| ||||||||||||||
Sbjct: 18067 cttgttctttcttcttttgctt---cttccccttctggcctttcccttggccacc 18118
>gb|AC108150.4| Homo sapiens BAC clone RP11-492E24 from 2, complete sequence
Length = 75818
Score = 42.1 bits (21), Expect = 2.5
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 582 atgtggatttttggatttctg 602
|||||||||||||||||||||
Sbjct: 48659 atgtggatttttggatttctg 48679
Database: nt
Posted date: May 29, 2006 11:10 AM
Number of letters in database: 3,984,495,279
Number of sequences in database: 917,343
Database: /shigen/export/home/twatanab/db/nt/nt.01
Posted date: May 29, 2006 11:16 AM
Number of letters in database: 3,988,174,986
Number of sequences in database: 835,257
Database: /shigen/export/home/twatanab/db/nt/nt.02
Posted date: May 29, 2006 11:21 AM
Number of letters in database: 3,991,246,324
Number of sequences in database: 771,481
Database: /shigen/export/home/twatanab/db/nt/nt.03
Posted date: May 29, 2006 11:27 AM
Number of letters in database: 3,990,718,311
Number of sequences in database: 977,174
Database: /shigen/export/home/twatanab/db/nt/nt.04
Posted date: May 29, 2006 11:29 AM
Number of letters in database: 1,278,410,368
Number of sequences in database: 400,813
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 6,819,653
Number of Sequences: 3902068
Number of extensions: 6819653
Number of successful extensions: 139521
Number of sequences better than 10.0: 11
Number of HSP's better than 10.0 without gapping: 11
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 139410
Number of HSP's gapped (non-prelim): 105
length of query: 731
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 708
effective length of database: 17,143,297,704
effective search space: 12137454774432
effective search space used: 12137454774432
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 21 (42.1 bits)