ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbags20g04
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AY846823.1| Triticum aestivum ribosomal protein L13a mRNA, co... 850 0.0
2ref|XM_469814.1| Oryza sativa (japonica cultivar-group), mRNA 595 e-167
3dbj|AK106078.1| Oryza sativa (japonica cultivar-group) cDNA clon... 595 e-167
4dbj|AK103893.1| Oryza sativa (japonica cultivar-group) cDNA clon... 595 e-167
5gb|BT016389.1| Zea mays clone Contig222 mRNA sequence 484 e-133
6gb|BT017778.1| Zea mays clone EL01N0503C05.c mRNA sequence 400 e-108
7ref|XM_469811.1| Oryza sativa (japonica cultivar-group), mRNA 363 4e-97
8gb|AY109365.1| Zea mays CL4861_1 mRNA sequence 351 2e-93
9ref|XM_476399.1| Oryza sativa (japonica cultivar-group), mRNA 289 5e-75
10ref|XM_506141.1| PREDICTED Oryza sativa (japonica cultivar-group... 289 5e-75
11dbj|AK103048.1| Oryza sativa (japonica cultivar-group) cDNA clon... 289 5e-75
12dbj|AK063806.1| Oryza sativa (japonica cultivar-group) cDNA clon... 289 5e-75
13dbj|AK066603.1| Oryza sativa (japonica cultivar-group) cDNA clon... 246 7e-62
14gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 184 2e-43
15gb|AC120509.3| Oryza sativa chromosome 3 BAC OSJNBb0081K01 genom... 184 2e-43
16dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 184 2e-43
17gb|AY013245.2| Oryza sativa (japonica cultivar-group) chromosome... 176 5e-41
18dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic D... 172 9e-40
19dbj|AP004342.5| Oryza sativa (japonica cultivar-group) genomic D... 172 9e-40
20dbj|AP003759.2| Oryza sativa (japonica cultivar-group) genomic D... 172 9e-40
21gb|AF503433.1| Sorghum bicolor BAC 170F8, complete sequence 155 2e-34
22gb|AC146913.2| Oryza sativa (japonica cultivar-group) chromosome... 135 2e-28
23gb|AC145327.2| Oryza sativa (japonica cultivar-group) chromosome... 135 2e-28
24dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic D... 135 2e-28
25gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome... 135 2e-28
26gb|DQ099054.1| Arachis stenosperma clone AS1RN3B12 microsatellit... 78 4e-11
27ref|NM_111591.2| Arabidopsis thaliana structural constituent of ... 72 2e-09
28ref|NM_001035577.1| Arabidopsis thaliana structural constituent ... 72 2e-09
29gb|AY114589.1| Arabidopsis thaliana putative 60S ribosomal prote... 72 2e-09
30gb|AY062793.1| Arabidopsis thaliana putative 60S ribosomal prote... 72 2e-09
31gb|AY057551.1| Arabidopsis thaliana AT3g07110/T1B9_24 mRNA, comp... 72 2e-09
32gb|AF325041.2|AF325041 Arabidopsis thaliana AT3g07110 (AT3g07110... 72 2e-09
33emb|BX822336.1|CNS0A5ZO Arabidopsis thaliana Full-length cDNA Co... 72 2e-09
34emb|BX824368.1|CNS0A5OL Arabidopsis thaliana Full-length cDNA Co... 72 2e-09
35emb|BX822519.1|CNS0A5UA Arabidopsis thaliana Full-length cDNA Co... 72 2e-09
36emb|BX822098.1|CNS0A5TD Arabidopsis thaliana Full-length cDNA Co... 72 2e-09
37gb|AF521144.1| Kandelia candel 60S ribosomal protein mRNA, parti... 66 1e-07
38gb|AY498745.1| Capsicum annuum 60S ribosomal protein L13a (RpL13... 62 2e-06
39gb|DQ200397.1| Solanum tuberosum clone 070F10 60S ribosomal prot... 60 9e-06
40emb|Y09971.1|CPRPL13A C.paradoxa mRNA for ribosomal protein L13a 54 5e-04
41ref|NM_124253.2| Arabidopsis thaliana structural constituent of ... 52 0.002
42ref|XM_509965.1| PREDICTED: Pan troglodytes similar to ribosomal... 52 0.002
43ref|XM_526928.1| PREDICTED: Pan troglodytes integrin alpha 2 (LO... 52 0.002
44ref|XM_514152.1| PREDICTED: Pan troglodytes similar to ribosomal... 52 0.002
45gb|AC125807.9| Homo sapiens 12 BAC RP11-253E3 (Roswell Park Canc... 52 0.002
46gb|AY090359.1| Arabidopsis thaliana AT5g48760/K24G6_9 mRNA, comp... 52 0.002
47gb|AC020750.4| Homo sapiens chromosome 3 clone RP11-105H19 map 3... 52 0.002
48gb|AY088191.1| Arabidopsis thaliana clone 4275 mRNA, complete se... 52 0.002
49gb|AY122902.1| Arabidopsis thaliana At5g48760/K24G6_9 mRNA, comp... 52 0.002
50gb|AC083855.3| Homo sapiens chromosome 3 clone RP11-622I12 map 3... 52 0.002
51gb|AC003072.1|AC003072 Human BAC clone CTA-963H5 from 22q12.1-qt... 52 0.002
52gb|U18488.1|STU18488 Salmo trutta transplantation antigen mRNA, ... 50 0.009
53dbj|AB049716.1| Pisum sativum ssa-6 mRNA for putative senescence... 50 0.009
54gb|AC140724.4| Mus musculus chromosome 8, clone RP24-291N1, comp... 48 0.034
55gb|AC134323.3| Mus musculus BAC clone RP24-512P7 from chromosome... 48 0.034
56gb|AF109186.1| Homo sapiens FWP004 mRNA, complete cds 46 0.13
57ref|XM_512821.1| PREDICTED: Pan troglodytes similar to ribosomal... 46 0.13
58ref|XM_511050.1| PREDICTED: Pan troglodytes similar to ribosomal... 46 0.13
59gb|AC156572.3| Mus musculus BAC clone RP23-216C6 from chromosome... 46 0.13
60ref|XM_527683.1| PREDICTED: Pan troglodytes similar to ribosomal... 46 0.13
61ref|NM_012423.2| Homo sapiens ribosomal protein L13a (RPL13A), mRNA 46 0.13
62gb|BC070223.1| Homo sapiens ribosomal protein L13a, mRNA (cDNA c... 46 0.13
63gb|BC065236.1| Homo sapiens ribosomal protein L13a, mRNA (cDNA c... 46 0.13
64gb|BC000514.2| Homo sapiens ribosomal protein L13a, mRNA (cDNA c... 46 0.13
65ref|XM_751980.1| Ustilago maydis 521 hypothetical protein (UM009... 46 0.13
66gb|BC013230.1| Homo sapiens ribosomal protein L13a, mRNA (cDNA c... 46 0.13
67gb|BC004900.2| Homo sapiens ribosomal protein L13a, mRNA (cDNA c... 46 0.13
68gb|BC071921.1| Homo sapiens cDNA clone IMAGE:6423605, **** WARNI... 46 0.13
69gb|BC021568.1| Homo sapiens cDNA clone IMAGE:3343061, **** WARNI... 46 0.13
70emb|X56932.1|HS23KDHBP H.sapiens mRNA for 23 kD highly basic pro... 46 0.13
71emb|AJ388525.1|CFA388525 Canis familiaris mRNA for partial Ribos... 46 0.13
72gb|AC068898.8| Homo sapiens chromosome 10 clone RP11-534L6, comp... 46 0.13
73emb|CR624659.1| full-length cDNA clone CS0DI065YH07 of Placenta ... 46 0.13
74emb|CR625138.1| full-length cDNA clone CS0DI071YK05 of Placenta ... 46 0.13
75emb|CR623949.1| full-length cDNA clone CS0DE014YH06 of Placenta ... 46 0.13
76emb|CR622930.1| full-length cDNA clone CS0DE004YD03 of Placenta ... 46 0.13
77emb|CR622697.1| full-length cDNA clone CS0DL002YH12 of B cells (... 46 0.13
78emb|CR622347.1| full-length cDNA clone CS0DI069YJ19 of Placenta ... 46 0.13
79emb|CR622131.1| full-length cDNA clone CS0DI075YJ21 of Placenta ... 46 0.13
80emb|CR619845.1| full-length cDNA clone CS0DI058YC16 of Placenta ... 46 0.13
81emb|CR620187.1| full-length cDNA clone CS0DE001YC16 of Placenta ... 46 0.13
82emb|CR618372.1| full-length cDNA clone CS0DD008YF03 of Neuroblas... 46 0.13
83emb|CR618336.1| full-length cDNA clone CS0DC008YA18 of Neuroblas... 46 0.13
84emb|CR618182.1| full-length cDNA clone CS0DG002YE04 of B cells (... 46 0.13
85emb|CR616905.1| full-length cDNA clone CS0DI065YB06 of Placenta ... 46 0.13
86emb|CR615101.1| full-length cDNA clone CS0DI074YD18 of Placenta ... 46 0.13
87emb|CR613935.1| full-length cDNA clone CS0DJ010YF15 of T cells (... 46 0.13
88emb|CR612270.1| full-length cDNA clone CS0DI068YN06 of Placenta ... 46 0.13
89emb|CR613016.1| full-length cDNA clone CS0DI065YK06 of Placenta ... 46 0.13
90gb|AC035139.11| Homo sapiens chromosome 10 clone RP11-563N6, com... 46 0.13
91emb|CR607854.1| full-length cDNA clone CS0DI035YD15 of Placenta ... 46 0.13
92emb|CR607799.1| full-length cDNA clone CS0DI067YC06 of Placenta ... 46 0.13
93emb|CR608676.1| full-length cDNA clone CS0CAP006YO09 of Thymus o... 46 0.13
94emb|CR607407.1| full-length cDNA clone CS0DI008YJ20 of Placenta ... 46 0.13
95emb|CR607352.1| full-length cDNA clone CS0DF034YJ13 of Fetal bra... 46 0.13
96emb|CR606179.1| full-length cDNA clone CS0DM013YA03 of Fetal liv... 46 0.13
97emb|CR603453.1| full-length cDNA clone CS0DB008YK16 of Neuroblas... 46 0.13
98emb|CR599383.1| full-length cDNA clone CS0DM006YN06 of Fetal liv... 46 0.13
99dbj|AK056837.1| Homo sapiens cDNA FLJ32275 fis, clone PROST20000... 46 0.13
100emb|CR596607.1| full-length cDNA clone CS0DI029YH03 of Placenta ... 46 0.13
101emb|CR595200.1| full-length cDNA clone CS0DI035YJ24 of Placenta ... 46 0.13
102gb|AC010619.7| Homo sapiens chromosome 19 clone CTD-3148I10, com... 46 0.13
103emb|CR592554.1| full-length cDNA clone CS0DC029YN07 of Neuroblas... 46 0.13
104emb|CR591518.1| full-length cDNA clone CS0DB008YJ02 of Neuroblas... 46 0.13
105emb|CR591301.1| full-length cDNA clone CS0DL008YK19 of B cells (... 46 0.13
106gb|AC022533.10| Homo sapiens chromosome 10 clone RP11-230D19, co... 46 0.13
107gb|AC012346.9|AC012346 Homo sapiens chromosome , clone RP11-15N2... 46 0.13
108gb|AC025519.10|AC025519 Homo sapiens, clone RP11-484J3, complete... 46 0.13
109dbj|AK222747.1| Homo sapiens mRNA for ribosomal protein L13a var... 46 0.13
110dbj|AK130605.1| Homo sapiens cDNA FLJ27095 fis, clone SPL04438, ... 46 0.13
111gb|BC062537.1| Homo sapiens ribosomal protein L13a, mRNA (cDNA c... 46 0.13
112gb|BC071929.1| Homo sapiens ribosomal protein L13a, mRNA (cDNA c... 46 0.13
113gb|AC161811.6| Mus musculus chromosome 5, clone RP23-456E9, comp... 46 0.13
114dbj|AB082924.1| Homo sapiens RPL13a mRNA for ribosomal protein L... 46 0.13
115emb|CT030185.11| Mouse DNA sequence from clone RP23-204L16 on ch... 46 0.13
116gb|BC032107.2| Homo sapiens ribosomal protein L13a, mRNA (cDNA c... 46 0.13
117gb|AC138365.16| Mus musculus chromosome 5, clone RP23-262B5, com... 46 0.13
118gb|BC001836.2| Homo sapiens ribosomal protein L13a, mRNA (cDNA c... 46 0.13
119gb|BC001675.2| Homo sapiens ribosomal protein L13a, mRNA (cDNA c... 46 0.13
120dbj|AB028893.1| Homo sapiens RPL13A, U32, U33, U34, U35, RPS11, ... 46 0.13
121ref|XM_520729.1| PREDICTED: Pan troglodytes similar to ribosomal... 44 0.53
122ref|XM_508935.1| PREDICTED: Pan troglodytes similar to ribosomal... 44 0.53
123gb|DQ216006.1| Taeniopygia guttata clone 0061P0024G09 ribosomal ... 44 0.53
124gb|DQ216003.1| Taeniopygia guttata clone 0058P0045E08 ribosomal ... 44 0.53
125gb|DQ216001.1| Taeniopygia guttata clone 0058P0049C02 ribosomal ... 44 0.53
126ref|XM_526130.1| PREDICTED: Pan troglodytes similar to APG7 auto... 44 0.53
127gb|AC167134.5| Mus musculus chromosome 1, clone RP23-59E7, compl... 44 0.53
128ref|XM_533620.2| PREDICTED: Canis familiaris Ribosomal protein L... 44 0.53
129gb|AC012395.5|ATAC012395 Arabidopsis thaliana chromosome III BAC... 44 0.53
130emb|CR721854.2|CNS0GJXG Tetraodon nigroviridis full-length cDNA 44 0.53
131emb|CR734531.2|CNS0GTJM Tetraodon nigroviridis full-length cDNA 44 0.53
132emb|CR734420.2|CNS0GTGJ Tetraodon nigroviridis full-length cDNA 44 0.53
133emb|CR733634.2|CNS0GSUP Tetraodon nigroviridis full-length cDNA 44 0.53
134emb|CR733589.2|CNS0GSTG Tetraodon nigroviridis full-length cDNA 44 0.53
135emb|CR733845.2|CNS0GT0K Tetraodon nigroviridis full-length cDNA 44 0.53
136emb|CR731687.2|CNS0GRIK Tetraodon nigroviridis full-length cDNA 44 0.53
137gb|BC043976.1| Xenopus laevis ribosomal protein L13a, mRNA (cDNA... 44 0.53
138emb|CR720193.2|CNS0GINB Tetraodon nigroviridis full-length cDNA 44 0.53
139emb|CR720089.2|CNS0GIKF Tetraodon nigroviridis full-length cDNA 44 0.53
140emb|CR723864.2|CNS0GLHA Tetraodon nigroviridis full-length cDNA 44 0.53
141emb|CR723621.2|CNS0GLAJ Tetraodon nigroviridis full-length cDNA 44 0.53
142emb|CR723218.2|CNS0GKZC Tetraodon nigroviridis full-length cDNA 44 0.53
143emb|CR722644.2|CNS0GKJE Tetraodon nigroviridis full-length cDNA 44 0.53
144emb|CR722480.2|CNS0GKEU Tetraodon nigroviridis full-length cDNA 44 0.53
145emb|CR721533.2|CNS0GJOJ Tetraodon nigroviridis full-length cDNA 44 0.53
146emb|CR721501.2|CNS0GJNN Tetraodon nigroviridis full-length cDNA 44 0.53
147emb|CR721288.2|CNS0GJHQ Tetraodon nigroviridis full-length cDNA 44 0.53
148emb|CR720827.2|CNS0GJ4X Tetraodon nigroviridis full-length cDNA 44 0.53
149emb|CR720439.2|CNS0GIU5 Tetraodon nigroviridis full-length cDNA 44 0.53
150emb|CR719991.2|CNS0GIHP Tetraodon nigroviridis full-length cDNA 44 0.53
151emb|CR719238.2|CNS0GHWS Tetraodon nigroviridis full-length cDNA 44 0.53
152emb|CR718042.2|CNS0GGZK Tetraodon nigroviridis full-length cDNA 44 0.53
153emb|CR717997.2|CNS0GGYB Tetraodon nigroviridis full-length cDNA 44 0.53
154emb|CR717797.2|CNS0GGSR Tetraodon nigroviridis full-length cDNA 44 0.53
155emb|CR716489.2|CNS0GFSI Tetraodon nigroviridis full-length cDNA 44 0.53
156emb|CR715865.2|CNS0GFB9 Tetraodon nigroviridis full-length cDNA 44 0.53
157emb|CR715675.2|CNS0GF5Z Tetraodon nigroviridis full-length cDNA 44 0.53
158emb|CR715331.2|CNS0GEWF Tetraodon nigroviridis full-length cDNA 44 0.53
159emb|CR715244.2|CNS0GEU0 Tetraodon nigroviridis full-length cDNA 44 0.53
160emb|CR715237.2|CNS0GETT Tetraodon nigroviridis full-length cDNA 44 0.53
161emb|CR712946.2|CNS0GD26 Tetraodon nigroviridis full-length cDNA 44 0.53
162emb|CR711952.2|CNS0GCAK Tetraodon nigroviridis full-length cDNA 44 0.53
163emb|CR711062.2|CNS0GBLU Tetraodon nigroviridis full-length cDNA 44 0.53
164emb|CR710952.2|CNS0GBIS Tetraodon nigroviridis full-length cDNA 44 0.53
165emb|CR708821.2|CNS0G9VL Tetraodon nigroviridis full-length cDNA 44 0.53
166emb|CR708798.2|CNS0G9UY Tetraodon nigroviridis full-length cDNA 44 0.53
167emb|CR707968.2|CNS0G97W Tetraodon nigroviridis full-length cDNA 44 0.53
168emb|CR707793.2|CNS0G931 Tetraodon nigroviridis full-length cDNA 44 0.53
169emb|CR706714.2|CNS0G892 Tetraodon nigroviridis full-length cDNA 44 0.53
170emb|CR706088.2|CNS0G7RO Tetraodon nigroviridis full-length cDNA 44 0.53
171emb|CR705737.2|CNS0G7HX Tetraodon nigroviridis full-length cDNA 44 0.53
172emb|CR704066.2|CNS0G67I Tetraodon nigroviridis full-length cDNA 44 0.53
173emb|CR703887.2|CNS0G62J Tetraodon nigroviridis full-length cDNA 44 0.53
174emb|CR691280.2|CNS0FWCC Tetraodon nigroviridis full-length cDNA 44 0.53
175emb|CR698886.2|CNS0G27M Tetraodon nigroviridis full-length cDNA 44 0.53
176emb|CR697448.2|CNS0G13O Tetraodon nigroviridis full-length cDNA 44 0.53
177emb|CR691171.2|CNS0FW9B Tetraodon nigroviridis full-length cDNA 44 0.53
178emb|CR685825.2|CNS0FS4T Tetraodon nigroviridis full-length cDNA 44 0.53
179emb|CR690814.2|CNS0FVZE Tetraodon nigroviridis full-length cDNA 44 0.53
180emb|CR689971.2|CNS0FVBZ Tetraodon nigroviridis full-length cDNA 44 0.53
181emb|CR689406.2|CNS0FUWA Tetraodon nigroviridis full-length cDNA 44 0.53
182emb|CR687735.2|CNS0FTLV Tetraodon nigroviridis full-length cDNA 44 0.53
183emb|CR686749.2|CNS0FSUH Tetraodon nigroviridis full-length cDNA 44 0.53
184emb|CR685068.2|CNS0FRJS Tetraodon nigroviridis full-length cDNA 44 0.53
185emb|CR684046.2|CNS0FQRE Tetraodon nigroviridis full-length cDNA 44 0.53
186emb|CR682457.2|CNS0FPJ9 Tetraodon nigroviridis full-length cDNA 44 0.53
187emb|CR679961.2|CNS0FNLX Tetraodon nigroviridis full-length cDNA 44 0.53
188emb|CR679201.2|CNS0FN0T Tetraodon nigroviridis full-length cDNA 44 0.53
189emb|CR679149.2|CNS0FMZD Tetraodon nigroviridis full-length cDNA 44 0.53
190emb|CR677571.2|CNS0FLRY Tetraodon nigroviridis full-length cDNA 44 0.53
191emb|CR677193.2|CNS0FLHH Tetraodon nigroviridis full-length cDNA 44 0.53
192emb|CR675541.2|CNS0FK7V Tetraodon nigroviridis full-length cDNA 44 0.53
193emb|CR672882.2|CNS0FI60 Tetraodon nigroviridis full-length cDNA 44 0.53
194emb|CR672163.2|CNS0FHM1 Tetraodon nigroviridis full-length cDNA 44 0.53
195emb|CR671303.2|CNS0FGY5 Tetraodon nigroviridis full-length cDNA 44 0.53
196emb|CR669634.2|CNS0FFNS Tetraodon nigroviridis full-length cDNA 44 0.53
197emb|CR669188.2|CNS0FFBE Tetraodon nigroviridis full-length cDNA 44 0.53
198emb|CR668979.2|CNS0FF5L Tetraodon nigroviridis full-length cDNA 44 0.53
199emb|CR664501.2|CNS0FBP7 Tetraodon nigroviridis full-length cDNA 44 0.53
200emb|CR662473.2|CNS0FA4V Tetraodon nigroviridis full-length cDNA 44 0.53
201emb|CR661668.2|CNS0F9II Tetraodon nigroviridis full-length cDNA 44 0.53
202emb|CR660204.2|CNS0F8DU Tetraodon nigroviridis full-length cDNA 44 0.53
203emb|CR656627.2|CNS0F5MH Tetraodon nigroviridis full-length cDNA 44 0.53
204emb|CR654883.2|CNS0F4A1 Tetraodon nigroviridis full-length cDNA 44 0.53
205emb|CR653693.2|CNS0F3CZ Tetraodon nigroviridis full-length cDNA 44 0.53
206emb|CR649395.2|CNS0F01L Tetraodon nigroviridis full-length cDNA 44 0.53
207emb|CR649309.2|CNS0EZZ7 Tetraodon nigroviridis full-length cDNA 44 0.53
208emb|CR649016.2|CNS0EZR2 Tetraodon nigroviridis full-length cDNA 44 0.53
209gb|AC166831.3| Mus musculus BAC clone RP23-270P14 from chromosom... 44 0.53
210emb|CR646191.2|CNS0EXKL Tetraodon nigroviridis full-length cDNA 44 0.53
211emb|CR641493.2|CNS0ETY3 Tetraodon nigroviridis full-length cDNA 44 0.53
212emb|CR638774.2|CNS0ERUK Tetraodon nigroviridis full-length cDNA 44 0.53
213emb|CR638669.2|CNS0ERRN Tetraodon nigroviridis full-length cDNA 44 0.53
214emb|CR638020.2|CNS0ER9M Tetraodon nigroviridis full-length cDNA 44 0.53
215emb|CR637133.2|CNS0EQKZ Tetraodon nigroviridis full-length cDNA 44 0.53
216emb|CR635244.2|CNS0EP4I Tetraodon nigroviridis full-length cDNA 44 0.53
217emb|CR634492.2|CNS0EOJM Tetraodon nigroviridis full-length cDNA 44 0.53
218emb|CR632869.2|CNS0ENAJ Tetraodon nigroviridis full-length cDNA 44 0.53
219emb|CR633646.2|CNS0ENW4 Tetraodon nigroviridis full-length cDNA 44 0.53
220emb|CR633029.2|CNS0ENEZ Tetraodon nigroviridis full-length cDNA 44 0.53
221emb|CR632663.2|CNS0EN4T Tetraodon nigroviridis full-length cDNA 44 0.53
222emb|CR632233.2|CNS0EMSV Tetraodon nigroviridis full-length cDNA 44 0.53
223emb|CR632230.2|CNS0EMSS Tetraodon nigroviridis full-length cDNA 44 0.53
224emb|AL391822.12| Human DNA sequence from clone RP11-494K3 on chr... 44 0.53
225emb|AJ843089.1| Platichthys flesus mRNA for 60S ribosomal protei... 44 0.53
226gb|BC067891.1| Homo sapiens cDNA clone MGC:87657 IMAGE:5271409, ... 44 0.53
227gb|AC092768.6| Homo sapiens chromosome 11, clone RP11-1149L18, c... 44 0.53
228gb|BC103039.1| Bos taurus cDNA clone MGC:128198 IMAGE:7984430, c... 44 0.53
229gb|AC084878.12| Homo sapiens 12q BAC RP11-101K23 (Roswell Park C... 44 0.53
230gb|AC098935.2| Homo sapiens chromosome 1 clone RP11-564A8, compl... 44 0.53
231gb|AC074250.6| Homo sapiens BAC clone RP11-622A1 from 4, complet... 44 0.53
232ref|XM_936627.1| PREDICTED: Homo sapiens similar to ribosomal pr... 44 0.53
233ref|XM_928691.1| PREDICTED: Homo sapiens similar to ribosomal pr... 44 0.53
234gb|BC105558.1| Bos taurus cDNA clone IMAGE:8120112, with apparen... 44 0.53
235gb|AC129776.3| Mus musculus BAC clone RP23-197A15 from chromosom... 44 0.53
236ref|NG_002538.1| Homo sapiens ribosomal protein L13a pseudogene ... 44 0.53
237gb|AC018523.9|AC018523 Homo sapiens chromosome , clone RP11-140L... 44 0.53
238gb|AC107675.13| Mus musculus chromosome 1, clone RP24-471N7, com... 44 0.53
239emb|AL157792.3|CNS01RG7 Human chromosome 14 DNA sequence BAC R-3... 44 0.53
240emb|AL355773.4|CNS05TCO Human chromosome 14 DNA sequence BAC R-8... 44 0.53
241emb|X56933.1|BTAPAS B.taurus mRNA, alternative polyadenylation s... 44 0.53
242gb|AY650304.1| Macaca fascicularis ribosomal protein L13A mRNA, ... 42 2.1
243ref|NM_113395.2| Arabidopsis thaliana structural constituent of ... 42 2.1
244ref|NM_001016486.2| Xenopus tropicalis hypothetical protein LOC5... 42 2.1
245ref|XM_418218.1| PREDICTED: Gallus gallus similar to chromosome ... 42 2.1
246gb|AC006043.1| Homo sapiens BAC clone RP11-538D15 from 7, comple... 42 2.1
247emb|BX000688.11| Human DNA sequence from clone DAQB-36F16 on chr... 42 2.1
248emb|AL662826.11| Human DNA sequence from clone XXbac-101I20 on c... 42 2.1
249emb|AL645936.5| Human DNA sequence from clone XXbac-126D10 on ch... 42 2.1
250emb|AL109827.8|HSJ309K20 Human DNA sequence from clone RP1-309K2... 42 2.1
251gb|AY150392.1| Arabidopsis thaliana putative 60S ribosomal prote... 42 2.1
252emb|CR759766.5| Human DNA sequence from clone DAMA-BMC177C8 on c... 42 2.1
253emb|AL645748.9| Mouse DNA sequence from clone RP23-241E24 on chr... 42 2.1
254emb|CR759870.6| Human DNA sequence from clone DADB-225M10 on chr... 42 2.1
255emb|CR788300.6| Human DNA sequence from clone DAAP-188P13 on chr... 42 2.1
256gb|AC161626.6| Pan troglodytes BAC clone CH251-114C24 from chrom... 42 2.1
257gb|DP000062.1| Sus scrofa target 117 genomic scaffold 42 2.1
258ref|NM_203308.1| Homo sapiens ribosomal protein L13A-like (MGC34... 42 2.1
259gb|AC006137.3|AC006137 Homo sapiens clone SCb-254N2 (UWGC:rg254N... 42 2.1
260emb|BX927223.9| Human DNA sequence from clone DAMA-380P17 on chr... 42 2.1
261dbj|AB168305.1| Macaca fascicularis testis cDNA clone: QtsA-1110... 42 2.1
262gb|AC091989.3| Homo sapiens chromosome 5 clone RP11-76H13, compl... 42 2.1
263gb|AC148698.1| Macaca mulatta Major Histocompatibility Complex B... 42 2.1
264gb|AC148689.1| Macaca mulatta Major Histocompatibility Complex B... 42 2.1
265emb|BX825905.1|CNS0A58U Arabidopsis thaliana Full-length cDNA Co... 42 2.1
266gb|AY086819.1| Arabidopsis thaliana clone 28093 mRNA, complete s... 42 2.1
267gb|AY855164.1| Callithrix jacchus RPGR mRNA, partial cds 42 2.1
268gb|BC027852.1| Homo sapiens ribosomal protein L13A-like, mRNA (c... 42 2.1
269emb|BX842691.5| Zebrafish DNA sequence from clone DKEY-239I20 in... 42 2.1
270emb|BX255937.13| Zebrafish DNA sequence from clone CH211-191D7 i... 42 2.1
271emb|CR760846.2| Xenopus tropicalis finished cDNA, clone TTpA004d22 42 2.1
272emb|AL031983.2|HS271M21 Human DNA sequence from clone RP1-271M21... 42 2.1
273ref|NM_118865.2| Arabidopsis thaliana transcription factor/ zinc... 40 8.2
274gb|AC099743.3| Papio anubis clone RP41-450I16, complete sequence 40 8.2
275gb|AC115061.20| Mus musculus chromosome 1, clone RP24-399G3, com... 40 8.2
276gb|AC126115.5| Rattus norvegicus 4 BAC CH230-213L22 (Children's ... 40 8.2
277gb|AY168655.3| Porella platyphylla tRNA-Lys (trnK) gene, intron;... 40 8.2
278gb|BC052385.1| Mus musculus chromodomain helicase DNA binding pr... 40 8.2
279ref|XM_952952.1| Neurospora crassa OR74A hypothetical protein (N... 40 8.2
280ref|XM_327224.1| Neurospora crassa OR74A hypothetical protein (N... 40 8.2
281ref|NM_026539.1| Mus musculus chromodomain helicase DNA binding ... 40 8.2
282gb|AC146171.2| Pan troglodytes BAC clone RP43-24K1 from 7, compl... 40 8.2
283ref|XR_002787.1| PREDICTED: Mus musculus similar to ribosomal pr... 40 8.2
284ref|XR_004732.1| PREDICTED: Mus musculus similar to ribosomal pr... 40 8.2
285gb|AC146025.2| Pan troglodytes BAC clone RP43-119E9 from 7, comp... 40 8.2
286emb|AM039952.1| Xanthomonas campestris pv. vesicatoria complete ... 40 8.2
287ref|XM_568754.1| Cryptococcus neoformans var. neoformans JEC21 e... 40 8.2
288gb|AC130541.4| Mus musculus BAC clone RP24-124P9 from chromosome... 40 8.2
289gb|AC134901.4| Mus musculus BAC clone RP23-287E23 from chromosom... 40 8.2
290gb|AC122213.4| Mus musculus BAC clone RP23-104C8 from chromosome... 40 8.2
291gb|BC020486.1| Mus musculus chromodomain helicase DNA binding pr... 40 8.2
292gb|AC099668.2| Homo sapiens chromosome 3 clone RP11-901L6, compl... 40 8.2
293gb|AC127369.4| Mus musculus BAC clone RP23-26A15 from 8, complet... 40 8.2
294gb|AC131652.2| Mus musculus BAC clone RP23-216A20 from 16, compl... 40 8.2
295gb|AC121768.2| Mus musculus BAC clone RP23-339H16 from 15, compl... 40 8.2
296emb|CR727990.2|CNS0GONW Tetraodon nigroviridis full-length cDNA 40 8.2
297emb|CR725716.2|CNS0GMWQ Tetraodon nigroviridis full-length cDNA 40 8.2
298gb|AC073424.8| Homo sapiens BAC clone RP11-653O17 from 7, comple... 40 8.2
299emb|CR656562.2|CNS0F5KO Tetraodon nigroviridis full-length cDNA 40 8.2
300emb|CR651266.2|CNS0F1HK Tetraodon nigroviridis full-length cDNA 40 8.2
301gb|AC112926.7| Mus musculus chromosome 3, clone RP23-215M7, comp... 40 8.2
302emb|Z93096.1|HS390B3 Human DNA sequence from clone CTA-390B3 on ... 40 8.2
303ref|XM_504032.1| Yarrowia lipolytica CLIB122, YALI0E16665g predi... 40 8.2
304emb|AL161566.2|ATCHRIV66 Arabidopsis thaliana DNA chromosome 4, ... 40 8.2
305emb|AL030978.1|ATM4I22 Arabidopsis thaliana DNA chromosome 4, P1... 40 8.2
306gb|BC057567.1| Mus musculus chromodomain helicase DNA binding pr... 40 8.2
307gb|AE017342.1| Cryptococcus neoformans var. neoformans JEC21 chr... 40 8.2
308gb|AC104452.2| Homo sapiens chromosome 3 clone RP11-949J7, compl... 40 8.2
309gb|AC024940.39| Homo sapiens 12 BAC RP11-627K11 (Roswell Park Ca... 40 8.2
310gb|AC183545.2| Pan troglodytes BAC clone CH251-233G24 from chrom... 40 8.2
311ref|NM_079920.2| Drosophila melanogaster gomdanji CG6727-RA (gom... 40 8.2
312gb|AC098839.3| Genomic sequence for Mus musculus, clone RP23-469... 40 8.2
313gb|AC010265.5| Homo sapiens chromosome 5 clone CTC-470E21, compl... 40 8.2
314gb|AC104126.2| Homo sapiens chromosome 5 clone RP11-526F3, compl... 40 8.2
315gb|AY070721.1| Arabidopsis thaliana AT4g27310/M4I22_120 mRNA, co... 40 8.2
316dbj|AK165656.1| Mus musculus kidney CCL-142 RAG cDNA, RIKEN full... 40 8.2
317ref|XM_944672.1| PREDICTED: Homo sapiens similar to ribosomal pr... 40 8.2
318ref|XM_944670.1| PREDICTED: Homo sapiens similar to ribosomal pr... 40 8.2
319ref|XM_940589.1| PREDICTED: Homo sapiens similar to ribosomal pr... 40 8.2
320ref|XM_944666.1| PREDICTED: Homo sapiens similar to ribosomal pr... 40 8.2
321ref|XM_933780.1| PREDICTED: Homo sapiens similar to ribosomal pr... 40 8.2
322ref|XM_497335.2| PREDICTED: Homo sapiens similar to ribosomal pr... 40 8.2
323ref|XM_929566.1| PREDICTED: Homo sapiens similar to ribosomal pr... 40 8.2
324ref|XM_933775.1| PREDICTED: Homo sapiens similar to ribosomal pr... 40 8.2
325gb|AC060766.8| Homo sapiens chromosome 17, clone RP11-686D22, co... 40 8.2
326gb|AC099019.1| Drosophila melanogaster, chromosome 2R, region 58... 40 8.2
327gb|AC073850.4| Homo sapiens BAC clone RP11-697H17 from 7, comple... 40 8.2
328gb|AC182810.1| Gasterosteus aculeatus clone VMRC28-119K03, compl... 40 8.2
329gb|AC121357.14| Mus musculus chromosome 15, clone RP23-56D7, com... 40 8.2
330gb|S48758.1| cyclin B [goldfish, oocytes, mRNA, 1425 nt] 40 8.2
331gb|AC154231.2| Mus musculus BAC clone RP24-339I11 from chromosom... 40 8.2
332gb|BC066506.1| Danio rerio tropomyosin 1 (alpha), mRNA (cDNA clo... 40 8.2
333gb|BC045504.1| Danio rerio tropomyosin 1 (alpha), mRNA (cDNA clo... 40 8.2
334dbj|AK014473.1| Mus musculus 14 days embryo liver cDNA, RIKEN fu... 40 8.2
335dbj|AK047492.1| Mus musculus 10 days neonate cerebellum cDNA, RI... 40 8.2
336emb|AL115562.1|CNS01CIA Botrytis cinerea strain T4 cDNA library 40 8.2
337emb|AL115066.1|CNS01C4I Botrytis cinerea strain T4 cDNA library 40 8.2
338emb|AL112631.1|CNS01A8V Botrytis cinerea strain T4 cDNA library 40 8.2
339emb|AL112484.1|CNS01A4S Botrytis cinerea strain T4 cDNA library 40 8.2
340emb|AL111732.1|CNS019JW Botrytis cinerea strain T4 cDNA library 40 8.2
341emb|AL111210.1|CNS0195E Botrytis cinerea strain T4 cDNA library 40 8.2
342emb|AL110945.1|CNS018Y2 Botrytis cinerea strain T4 cDNA library 40 8.2
343dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic D... 40 8.2
344gb|DP000027.1| Rattus norvegicus target 1 genomic scaffold 40 8.2
345gb|AC147097.3| Pan troglodytes BAC clone RP43-51D4 from chromoso... 40 8.2
346gb|AC017048.6| Homo sapiens BAC clone RP11-324L17 from 2, comple... 40 8.2
347gb|AC005539.1| Homo sapiens BAC clone RP11-335J18 from 2, comple... 40 8.2
348ref|XM_342921.2| PREDICTED: Rattus norvegicus similar to RIKEN c... 40 8.2
349gb|AC136603.3| Homo sapiens chromosome 16 clone RP11-133M8, comp... 40 8.2
350gb|AC012156.14|AC012156 Homo sapiens 12p11-37.2-54.4 BAC RP11-43... 40 8.2
351gb|AC009141.7| Homo sapiens chromosome 16 clone RP11-543G23, com... 40 8.2
352gb|AF273495.1|AF273495 Carassius auratus cyclin B mRNA, complete... 40 8.2
353emb|AL671536.8| Mouse DNA sequence from clone RP23-291O10 on chr... 40 8.2
354gb|AF045470.1|AF045470 Drosophila melanogaster Gom (gom) mRNA, c... 40 8.2
355gb|AC151896.3| Mus musculus BAC clone RP24-501F15 from 18, compl... 40 8.2
356gb|AE003456.3| Drosophila melanogaster chromosome 2R, section 64... 40 8.2
357gb|AC140839.9| Mus musculus chromosome 3, clone RP24-316D12, com... 40 8.2
358gb|AC146916.3| Rattus norvegicus strain Brown Norway clone CH230... 40 8.2
359dbj|AP001972.4| Homo sapiens genomic DNA, chromosome 11q, clone:... 40 8.2
360dbj|AP003175.2| Homo sapiens genomic DNA, chromosome 11q clone:R... 40 8.2
361gb|AC154565.2| Mus musculus BAC clone RP23-403J19 from chromosom... 40 8.2
362ref|NM_200934.2| Danio rerio tropomyosin 1 (alpha) (tpm1), mRNA 40 8.2
363gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome... 40 8.2
364emb|AL772424.5|CNS08CA2 Oryza sativa chromosome 12, . BAC OJ1118... 40 8.2
365gb|AC003054.1|AC003054 Drosophila melanogaster DNA sequence (P1 ... 40 8.2
366gb|BC062966.1| Mus musculus chromodomain helicase DNA binding pr... 40 8.2
367emb|CR382131.1| Yarrowia lipolytica chromosome E of strain CLIB ... 40 8.2
368gb|AC171072.2| Rhesus Macaque CHR7 BAC CH250-508E7 (Children's H... 40 8.2
369dbj|D50327.1|HRSIASP Horse mRNA for inhibin alpha subunit precur... 40 8.2

>gb|AY846823.1| Triticum aestivum ribosomal protein L13a mRNA, complete cds
          Length = 666

 Score =  850 bits (429), Expect = 0.0
 Identities = 477/493 (96%)
 Strand = Plus / Minus

                                                                       
Query: 113 gatggcgcacaaaagctctgatctctcttagtatttgatcggggccaggatctccagctg 172
           ||||||||||  ||||||| ||||||||||||||||||||||||| ||||||||||||||
Sbjct: 666 gatggcgcacggaagctctaatctctcttagtatttgatcggggctaggatctccagctg 607

                                                                       
Query: 173 agttcccaacttctcctcggctgccttctcggccttgacgcggagcttcgccagctgctt 232
           ||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||
Sbjct: 606 agttcccaacttctcctcggccgccttctcggccttgacgcggagcttcgccagttgctt 547

                                                                       
Query: 233 tctcctgtcgtacgagaccttggccttctccttcctcttttcctccagctccctgatggt 292
           |||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||
Sbjct: 546 tctcctgtcgtaggagaccttggccttctcctttctcttttcctccagctccctgatggt 487

                                                                       
Query: 293 gtcggcgtagttccatccgacctccttggagagctggcccaggaggcagtacctgtgccc 352
           ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||
Sbjct: 486 gtcggcgtagttccatccgacctccttggagagctggccgaggaggcagtacctgtgccc 427

                                                                       
Query: 353 aggctgcagcctcagaaccttgagcgcgtcgggaatgaccatgcgcttggtcctgtcgta 412
           ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||
Sbjct: 426 aggctgcagcctcagaaccttgagcgcgtcggggatgaccatgcgcttggtcctgtcgta 367

                                                                       
Query: 413 cggcggcggcacaccctcgtacgccttgagcctggcaagcgcggcctcgcccctcgcggt 472
           ||||||||| || ||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct: 366 cggcggcgggacgccctcgtacgccttgagcctggcgagcgcggcctcgcccctcgcggt 307

                                                                       
Query: 473 cttgtgcggaatcataccgcggatggtgcgccagaggatcttggccggggcgcggaagtg 532
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 306 cttgtgcggaatcataccgcggatggtgcgccagaggatcttggccggggcgcggaagtg 247

                                                                       
Query: 533 gatggggccgtgggatggcttggtgttcatcctcttacggaggaagcggaggtacttcat 592
           ||||||||||||||| |||||||||||||||| ||| |||||||||||||||||||||||
Sbjct: 246 gatggggccgtgggagggcttggtgttcatccgcttgcggaggaagcggaggtacttcat 187

                        
Query: 593 cttctggcggacg 605
           |||||||||||||
Sbjct: 186 cttctggcggacg 174



to top

>ref|XM_469814.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 935

 Score =  595 bits (300), Expect = e-167
 Identities = 423/464 (91%)
 Strand = Plus / Minus

                                                                       
Query: 142 agtatttgatcggggccaggatctccagctgagttcccaacttctcctcggctgccttct 201
           ||||||||||||| || || |||||||||||||  |||| ||||||||||||||||||||
Sbjct: 692 agtatttgatcggagcaagaatctccagctgaggacccagcttctcctcggctgccttct 633

                                                                       
Query: 202 cggccttgacgcggagcttcgccagctgctttctcctgtcgtacgagaccttggccttct 261
           | |||||||| || ||||||||||| ||||| |||||||| || |  |||||||||||||
Sbjct: 632 cagccttgacacgcagcttcgccagttgcttcctcctgtcataggcaaccttggccttct 573

                                                                       
Query: 262 ccttcctcttttcctccagctccctgatggtgtcggcgtagttccatccgacctccttgg 321
           |||||||||| ||||| |||||||||||||||||   ||||||||| || ||||||||||
Sbjct: 572 ccttcctcttctcctcaagctccctgatggtgtcatagtagttccagccaacctccttgg 513

                                                                       
Query: 322 agagctggcccaggaggcagtacctgtgcccaggctgcagcctcagaaccttgagcgcgt 381
           |||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 512 agagctggccgaggaggcagtacttgtgcccaggctgcagcctcagaaccttgagcgcgt 453

                                                                       
Query: 382 cgggaatgaccatgcgcttggtcctgtcgtacggcggcggcacaccctcgtacgccttga 441
           |||| |||||||||||||||||||||||||||||||||||||| |||||||||||||| |
Sbjct: 452 cggggatgaccatgcgcttggtcctgtcgtacggcggcggcacgccctcgtacgccttca 393

                                                                       
Query: 442 gcctggcaagcgcggcctcgcccctcgcggtcttgtgcggaatcataccgcggatggtgc 501
           |||| || ||||| ||||| ||||||  |||||||||||| ||||| ||||||| |||||
Sbjct: 392 gccttgccagcgccgcctctcccctcttggtcttgtgcgggatcatgccgcggacggtgc 333

                                                                       
Query: 502 gccagaggatcttggccggggcgcggaagtggatggggccgtgggatggcttggtgttca 561
           |||||||||||||||| |||| |||||||||||||||||| ||||| |||||||||||||
Sbjct: 332 gccagaggatcttggcgggggagcggaagtggatggggccatgggagggcttggtgttca 273

                                                       
Query: 562 tcctcttacggaggaagcggaggtacttcatcttctggcggacg 605
           ||||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 272 tcctcttgcggaggaagcggaggtacttcatcttctggcggacg 229



to top

>dbj|AK106078.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-207-A04, full
           insert sequence
          Length = 1048

 Score =  595 bits (300), Expect = e-167
 Identities = 423/464 (91%)
 Strand = Plus / Minus

                                                                       
Query: 142 agtatttgatcggggccaggatctccagctgagttcccaacttctcctcggctgccttct 201
           ||||||||||||| || || |||||||||||||  |||| ||||||||||||||||||||
Sbjct: 702 agtatttgatcggagcaagaatctccagctgaggacccagcttctcctcggctgccttct 643

                                                                       
Query: 202 cggccttgacgcggagcttcgccagctgctttctcctgtcgtacgagaccttggccttct 261
           | |||||||| || ||||||||||| ||||| |||||||| || |  |||||||||||||
Sbjct: 642 cagccttgacacgcagcttcgccagttgcttcctcctgtcataggcaaccttggccttct 583

                                                                       
Query: 262 ccttcctcttttcctccagctccctgatggtgtcggcgtagttccatccgacctccttgg 321
           |||||||||| ||||| |||||||||||||||||   ||||||||| || ||||||||||
Sbjct: 582 ccttcctcttctcctcaagctccctgatggtgtcatagtagttccagccaacctccttgg 523

                                                                       
Query: 322 agagctggcccaggaggcagtacctgtgcccaggctgcagcctcagaaccttgagcgcgt 381
           |||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 522 agagctggccgaggaggcagtacttgtgcccaggctgcagcctcagaaccttgagcgcgt 463

                                                                       
Query: 382 cgggaatgaccatgcgcttggtcctgtcgtacggcggcggcacaccctcgtacgccttga 441
           |||| |||||||||||||||||||||||||||||||||||||| |||||||||||||| |
Sbjct: 462 cggggatgaccatgcgcttggtcctgtcgtacggcggcggcacgccctcgtacgccttca 403

                                                                       
Query: 442 gcctggcaagcgcggcctcgcccctcgcggtcttgtgcggaatcataccgcggatggtgc 501
           |||| || ||||| ||||| ||||||  |||||||||||| ||||| ||||||| |||||
Sbjct: 402 gccttgccagcgccgcctctcccctcttggtcttgtgcgggatcatgccgcggacggtgc 343

                                                                       
Query: 502 gccagaggatcttggccggggcgcggaagtggatggggccgtgggatggcttggtgttca 561
           |||||||||||||||| |||| |||||||||||||||||| ||||| |||||||||||||
Sbjct: 342 gccagaggatcttggcgggggagcggaagtggatggggccatgggagggcttggtgttca 283

                                                       
Query: 562 tcctcttacggaggaagcggaggtacttcatcttctggcggacg 605
           ||||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 282 tcctcttgcggaggaagcggaggtacttcatcttctggcggacg 239



to top

>dbj|AK103893.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033150E09, full
           insert sequence
          Length = 943

 Score =  595 bits (300), Expect = e-167
 Identities = 423/464 (91%)
 Strand = Plus / Minus

                                                                       
Query: 142 agtatttgatcggggccaggatctccagctgagttcccaacttctcctcggctgccttct 201
           ||||||||||||| || || |||||||||||||  |||| ||||||||||||||||||||
Sbjct: 702 agtatttgatcggagcaagaatctccagctgaggacccagcttctcctcggctgccttct 643

                                                                       
Query: 202 cggccttgacgcggagcttcgccagctgctttctcctgtcgtacgagaccttggccttct 261
           | |||||||| || ||||||||||| ||||| |||||||| || |  |||||||||||||
Sbjct: 642 cagccttgacacgcagcttcgccagttgcttcctcctgtcataggcaaccttggccttct 583

                                                                       
Query: 262 ccttcctcttttcctccagctccctgatggtgtcggcgtagttccatccgacctccttgg 321
           |||||||||| ||||| |||||||||||||||||   ||||||||| || ||||||||||
Sbjct: 582 ccttcctcttctcctcaagctccctgatggtgtcatagtagttccagccaacctccttgg 523

                                                                       
Query: 322 agagctggcccaggaggcagtacctgtgcccaggctgcagcctcagaaccttgagcgcgt 381
           |||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 522 agagctggccgaggaggcagtacttgtgcccaggctgcagcctcagaaccttgagcgcgt 463

                                                                       
Query: 382 cgggaatgaccatgcgcttggtcctgtcgtacggcggcggcacaccctcgtacgccttga 441
           |||| |||||||||||||||||||||||||||||||||||||| |||||||||||||| |
Sbjct: 462 cggggatgaccatgcgcttggtcctgtcgtacggcggcggcacgccctcgtacgccttca 403

                                                                       
Query: 442 gcctggcaagcgcggcctcgcccctcgcggtcttgtgcggaatcataccgcggatggtgc 501
           |||| || ||||| ||||| ||||||  |||||||||||| ||||| ||||||| |||||
Sbjct: 402 gccttgccagcgccgcctctcccctcttggtcttgtgcgggatcatgccgcggacggtgc 343

                                                                       
Query: 502 gccagaggatcttggccggggcgcggaagtggatggggccgtgggatggcttggtgttca 561
           |||||||||||||||| |||| |||||||||||||||||| ||||| |||||||||||||
Sbjct: 342 gccagaggatcttggcgggggagcggaagtggatggggccatgggagggcttggtgttca 283

                                                       
Query: 562 tcctcttacggaggaagcggaggtacttcatcttctggcggacg 605
           ||||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 282 tcctcttgcggaggaagcggaggtacttcatcttctggcggacg 239



to top

>gb|BT016389.1| Zea mays clone Contig222 mRNA sequence
          Length = 880

 Score =  484 bits (244), Expect = e-133
 Identities = 409/464 (88%)
 Strand = Plus / Minus

                                                                       
Query: 142 agtatttgatcggggccaggatctccagctgagttcccaacttctcctcggctgccttct 201
           |||| ||||| ||||| || ||||||| |||||  |||||||||||||||||||||||||
Sbjct: 678 agtacttgataggggcaagaatctccaactgagaccccaacttctcctcggctgccttct 619

                                                                       
Query: 202 cggccttgacgcggagcttcgccagctgctttctcctgtcgtacgagaccttggccttct 261
           |||||||||| || ||||| ||||  |||||  |||| ||||| |  |||||||||||||
Sbjct: 618 cggccttgacacgcagcttggccaattgcttcttcctctcgtaggcaaccttggccttct 559

                                                                       
Query: 262 ccttcctcttttcctccagctccctgatggtgtcggcgtagttccatccgacctccttgg 321
           |||||||||| ||||| || ||||||||||||||   ||||||||| ||||||||||| |
Sbjct: 558 ccttcctcttctcctcaagttccctgatggtgtcatggtagttccacccgacctccttag 499

                                                                       
Query: 322 agagctggcccaggaggcagtacctgtgcccaggctgcagcctcagaaccttgagcgcgt 381
           |||||| ||| |||||||||||| |||| |||||||| |||||||||||||| || ||||
Sbjct: 498 agagctcgccgaggaggcagtacttgtgtccaggctgtagcctcagaaccttaagagcgt 439

                                                                       
Query: 382 cgggaatgaccatgcgcttggtcctgtcgtacggcggcggcacaccctcgtacgccttga 441
           | || |||||||| ||||||||| |||||||||||||||| || |||||||||| |||||
Sbjct: 438 cagggatgaccatacgcttggtcttgtcgtacggcggcgggacgccctcgtacgtcttga 379

                                                                       
Query: 442 gcctggcaagcgcggcctcgcccctcgcggtcttgtgcggaatcataccgcggatggtgc 501
           |||| || || || ||||| ||||||  |||||||||||||||||| |||||||||||||
Sbjct: 378 gcctcgccagagccgcctcccccctcttggtcttgtgcggaatcatcccgcggatggtgc 319

                                                                       
Query: 502 gccagaggatcttggccggggcgcggaagtggatggggccgtgggatggcttggtgttca 561
           |||| ||||||||||| |||||||||||||||||||| |||||||| |||||||||||||
Sbjct: 318 gccacaggatcttggcgggggcgcggaagtggatgggcccgtgggacggcttggtgttca 259

                                                       
Query: 562 tcctcttacggaggaagcggaggtacttcatcttctggcggacg 605
           ||| ||| ||||||||||||||||||||||||||||| ||||||
Sbjct: 258 tccgcttgcggaggaagcggaggtacttcatcttctgacggacg 215



to top

>gb|BT017778.1| Zea mays clone EL01N0503C05.c mRNA sequence
          Length = 826

 Score =  400 bits (202), Expect = e-108
 Identities = 340/386 (88%)
 Strand = Plus / Minus

                                                                       
Query: 216 agcttcgccagctgctttctcctgtcgtacgagaccttggccttctccttcctcttttcc 275
           ||||| ||||||||||| ||||| || || |  ||||| ||||||||||||||||| |||
Sbjct: 593 agcttggccagctgcttcctcctctcataggccaccttagccttctccttcctcttctcc 534

                                                                       
Query: 276 tccagctccctgatggtgtcggcgtagttccatccgacctccttggagagctggcccagg 335
           || |||||||||||||||||   ||||||||||||||||||||| || ||||  || |||
Sbjct: 533 tcaagctccctgatggtgtcatggtagttccatccgacctccttagaaagctccccaagg 474

                                                                       
Query: 336 aggcagtacctgtgcccaggctgcagcctcagaaccttgagcgcgtcgggaatgaccatg 395
           ||||||||| |||| || || ||||||||||||||||| || ||||| || ||||||| |
Sbjct: 473 aggcagtacttgtgtcctggttgcagcctcagaaccttaagagcgtcagggatgaccagg 414

                                                                       
Query: 396 cgcttggtcctgtcgtacggcggcggcacaccctcgtacgccttgagcctggcaagcgcg 455
           ||||||||| |||||||||||||||| || |||||||||| ||||||||| || || || 
Sbjct: 413 cgcttggtcttgtcgtacggcggcgggacgccctcgtacgtcttgagcctcgccagagcc 354

                                                                       
Query: 456 gcctcgcccctcgcggtcttgtgcggaatcataccgcggatggtgcgccagaggatcttg 515
           ||||| ||||||  |||||||||||||||||| ||||||||||||||||| |||||||||
Sbjct: 353 gcctcccccctcttggtcttgtgcggaatcatcccgcggatggtgcgccacaggatcttg 294

                                                                       
Query: 516 gccggggcgcggaagtggatggggccgtgggatggcttggtgttcatcctcttacggagg 575
           | ||||||||||||||||||||| || |||||||||||||||||||||| ||| ||||| 
Sbjct: 293 gacggggcgcggaagtggatgggcccatgggatggcttggtgttcatccgcttgcggaga 234

                                     
Query: 576 aagcggaggtacttcatcttctggcg 601
           ||||||||||||||||||||||||||
Sbjct: 233 aagcggaggtacttcatcttctggcg 208



to top

>ref|XM_469811.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 947

 Score =  363 bits (183), Expect = 4e-97
 Identities = 258/283 (91%)
 Strand = Plus / Minus

                                                                       
Query: 284 cctgatggtgtcggcgtagttccatccgacctccttggagagctggcccaggaggcagta 343
           ||||||||||||   ||||||||| || |||||||||||||||||||| |||||||||||
Sbjct: 399 cctgatggtgtcatagtagttccagccaacctccttggagagctggccgaggaggcagta 340

                                                                       
Query: 344 cctgtgcccaggctgcagcctcagaaccttgagcgcgtcgggaatgaccatgcgcttggt 403
           | |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||
Sbjct: 339 cttgtgcccaggctgcagcctcagaaccttgagcgcgtcggggatgaccatgcgcttggt 280

                                                                       
Query: 404 cctgtcgtacggcggcggcacaccctcgtacgccttgagcctggcaagcgcggcctcgcc 463
           ||||||||||||||||| |||  ||||||||||||| ||||| || ||||| ||||| ||
Sbjct: 279 cctgtcgtacggcggcgtcacgacctcgtacgccttcagccttgccagcgccgcctctcc 220

                                                                       
Query: 464 cctcgcggtcttgtgcggaatcataccgcggatggtgcgccagaggatcttggccggggc 523
           ||||  |||||||||||| ||||| ||||||| ||||||||||||||||||||| |||| 
Sbjct: 219 cctcttggtcttgtgcgggatcatgccgcggacggtgcgccagaggatcttggcggggga 160

                                                      
Query: 524 gcggaagtggatggggccgtgggatggcttggtgttcatcctc 566
           |||||||||||||||||| ||||| ||||||||||||||||||
Sbjct: 159 gcggaagtggatggggccatgggagggcttggtgttcatcctc 117



to top

>gb|AY109365.1| Zea mays CL4861_1 mRNA sequence
          Length = 1506

 Score =  351 bits (177), Expect = 2e-93
 Identities = 286/324 (88%)
 Strand = Plus / Minus

                                                                        
Query: 282  tccctgatggtgtcggcgtagttccatccgacctccttggagagctggcccaggaggcag 341
            ||||||||||||||   ||||||||| ||||||||||| ||||||| ||| |||||||||
Sbjct: 1026 tccctgatggtgtcatggtagttccacccgacctccttagagagctcgccgaggaggcag 967

                                                                        
Query: 342  tacctgtgcccaggctgcagcctcagaaccttgagcgcgtcgggaatgaccatgcgcttg 401
            ||| |||| |||||||| |||||||||||||| || ||||| || |||||||| ||||||
Sbjct: 966  tacttgtgtccaggctgtagcctcagaaccttaagagcgtcagggatgaccatacgcttg 907

                                                                        
Query: 402  gtcctgtcgtacggcggcggcacaccctcgtacgccttgagcctggcaagcgcggcctcg 461
            ||| |||||||||||||||| || |||||||||| ||||||||| || || || ||||  
Sbjct: 906  gtcttgtcgtacggcggcgggacgccctcgtacgtcttgagcctcgccagagccgccttn 847

                                                                        
Query: 462  cccctcgcggtcttgtgcggaatcataccgcggatggtgcgccagaggatcttggccggg 521
                |   |||||||||||||||||| ||||||||||||||||| |||||||||||||||
Sbjct: 846  nnnnttttggtcttgtgcggaatcatcccgcggatggtgcgccacaggatcttggccggg 787

                                                                        
Query: 522  gcgcggaagtggatggggccgtgggatggcttggtgttcatcctcttacggaggaagcgg 581
            |||||||||||||||||||||||||| |||||||||||||||| ||| ||||||||||||
Sbjct: 786  gcgcggaagtggatggggccgtgggacggcttggtgttcatccgcttgcggaggaagcgg 727

                                    
Query: 582  aggtacttcatcttctggcggacg 605
            ||||||||||||||||| ||||||
Sbjct: 726  aggtacttcatcttctgacggacg 703



 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 74/84 (88%)
 Strand = Plus / Minus

                                                                        
Query: 142  agtatttgatcggggccaggatctccagctgagttcccaacttctcctcggctgccttct 201
            |||| ||||| ||||| || ||||||| |||||  |||||||||||||||||||||||||
Sbjct: 1166 agtacttgataggggcaagaatctccaactgagaccccaacttctcctcggctgccttct 1107

                                    
Query: 202  cggccttgacgcggagcttcgcca 225
            |||||||||| || ||||| ||||
Sbjct: 1106 cggccttgacacgcagcttggcca 1083



to top

>ref|XM_476399.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 859

 Score =  289 bits (146), Expect = 5e-75
 Identities = 320/378 (84%)
 Strand = Plus / Minus

                                                                       
Query: 228 tgctttctcctgtcgtacgagaccttggccttctccttcctcttttcctccagctccctg 287
           ||||| ||||| ||||| |  ||||| ||||||||||| ||||| |||||||  ||||||
Sbjct: 617 tgcttcctcctctcgtatgcaaccttagccttctcctttctcttctcctccaattccctg 558

                                                                       
Query: 288 atggtgtcggcgtagttccatccgacctccttggagagctggcccaggaggcagtacctg 347
           |||||||||  ||||||||| ||||||||||||||||||||||| |||||||||||| ||
Sbjct: 557 atggtgtcgtggtagttccagccgacctccttggagagctggccgaggaggcagtacttg 498

                                                                       
Query: 348 tgcccaggctgcagcctcagaaccttgagcgcgtcgggaatgaccatgcgcttggtcctg 407
           || || ||||| || |  ||||||||||| |||||||| | ||||||||||||||| | |
Sbjct: 497 tggccgggctggaggcgaagaaccttgagggcgtcggggacgaccatgcgcttggtgcgg 438

                                                                       
Query: 408 tcgtacggcggcggcacaccctcgtacgccttgagcctggcaagcgcggcctcgcccctc 467
           ||||| || || || || || ||| | ||||||||  |||| || ||||||||||| |  
Sbjct: 437 tcgtagggaggggggacgccgtcgaaggccttgaggttggcgagggcggcctcgccgcgg 378

                                                                       
Query: 468 gcggtcttgtgcggaatcataccgcggatggtgcgccagaggatcttggccggggcgcgg 527
           | ||||||||| || ||||| ||||||| ||||||||||| |||   ||  |||||||||
Sbjct: 377 ggggtcttgtgggggatcatgccgcggacggtgcgccagaagatgcgggagggggcgcgg 318

                                                                       
Query: 528 aagtggatggggccgtgggatggcttggtgttcatcctcttacggaggaagcggaggtac 587
           |||||||||||||| ||||| |||||||||||||||| ||| |||||||| |||||||||
Sbjct: 317 aagtggatggggccatgggagggcttggtgttcatccgcttgcggaggaaccggaggtac 258

                             
Query: 588 ttcatcttctggcggacg 605
           ||||||||||| ||||||
Sbjct: 257 ttcatcttctgccggacg 240



to top

>ref|XM_506141.1| PREDICTED Oryza sativa (japonica cultivar-group), OJ1567_G09.119
           mRNA
          Length = 863

 Score =  289 bits (146), Expect = 5e-75
 Identities = 320/378 (84%)
 Strand = Plus / Minus

                                                                       
Query: 228 tgctttctcctgtcgtacgagaccttggccttctccttcctcttttcctccagctccctg 287
           ||||| ||||| ||||| |  ||||| ||||||||||| ||||| |||||||  ||||||
Sbjct: 621 tgcttcctcctctcgtatgcaaccttagccttctcctttctcttctcctccaattccctg 562

                                                                       
Query: 288 atggtgtcggcgtagttccatccgacctccttggagagctggcccaggaggcagtacctg 347
           |||||||||  ||||||||| ||||||||||||||||||||||| |||||||||||| ||
Sbjct: 561 atggtgtcgtggtagttccagccgacctccttggagagctggccgaggaggcagtacttg 502

                                                                       
Query: 348 tgcccaggctgcagcctcagaaccttgagcgcgtcgggaatgaccatgcgcttggtcctg 407
           || || ||||| || |  ||||||||||| |||||||| | ||||||||||||||| | |
Sbjct: 501 tggccgggctggaggcgaagaaccttgagggcgtcggggacgaccatgcgcttggtgcgg 442

                                                                       
Query: 408 tcgtacggcggcggcacaccctcgtacgccttgagcctggcaagcgcggcctcgcccctc 467
           ||||| || || || || || ||| | ||||||||  |||| || ||||||||||| |  
Sbjct: 441 tcgtagggaggggggacgccgtcgaaggccttgaggttggcgagggcggcctcgccgcgg 382

                                                                       
Query: 468 gcggtcttgtgcggaatcataccgcggatggtgcgccagaggatcttggccggggcgcgg 527
           | ||||||||| || ||||| ||||||| ||||||||||| |||   ||  |||||||||
Sbjct: 381 ggggtcttgtgggggatcatgccgcggacggtgcgccagaagatgcgggagggggcgcgg 322

                                                                       
Query: 528 aagtggatggggccgtgggatggcttggtgttcatcctcttacggaggaagcggaggtac 587
           |||||||||||||| ||||| |||||||||||||||| ||| |||||||| |||||||||
Sbjct: 321 aagtggatggggccatgggagggcttggtgttcatccgcttgcggaggaaccggaggtac 262

                             
Query: 588 ttcatcttctggcggacg 605
           ||||||||||| ||||||
Sbjct: 261 ttcatcttctgccggacg 244



to top

>dbj|AK103048.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033117G12, full
           insert sequence
          Length = 859

 Score =  289 bits (146), Expect = 5e-75
 Identities = 320/378 (84%)
 Strand = Plus / Minus

                                                                       
Query: 228 tgctttctcctgtcgtacgagaccttggccttctccttcctcttttcctccagctccctg 287
           ||||| ||||| ||||| |  ||||| ||||||||||| ||||| |||||||  ||||||
Sbjct: 617 tgcttcctcctctcgtatgcaaccttagccttctcctttctcttctcctccaattccctg 558

                                                                       
Query: 288 atggtgtcggcgtagttccatccgacctccttggagagctggcccaggaggcagtacctg 347
           |||||||||  ||||||||| ||||||||||||||||||||||| |||||||||||| ||
Sbjct: 557 atggtgtcgtggtagttccagccgacctccttggagagctggccgaggaggcagtacttg 498

                                                                       
Query: 348 tgcccaggctgcagcctcagaaccttgagcgcgtcgggaatgaccatgcgcttggtcctg 407
           || || ||||| || |  ||||||||||| |||||||| | ||||||||||||||| | |
Sbjct: 497 tggccgggctggaggcgaagaaccttgagggcgtcggggacgaccatgcgcttggtgcgg 438

                                                                       
Query: 408 tcgtacggcggcggcacaccctcgtacgccttgagcctggcaagcgcggcctcgcccctc 467
           ||||| || || || || || ||| | ||||||||  |||| || ||||||||||| |  
Sbjct: 437 tcgtagggaggggggacgccgtcgaaggccttgaggttggcgagggcggcctcgccgcgg 378

                                                                       
Query: 468 gcggtcttgtgcggaatcataccgcggatggtgcgccagaggatcttggccggggcgcgg 527
           | ||||||||| || ||||| ||||||| ||||||||||| |||   ||  |||||||||
Sbjct: 377 ggggtcttgtgggggatcatgccgcggacggtgcgccagaagatgcgggagggggcgcgg 318

                                                                       
Query: 528 aagtggatggggccgtgggatggcttggtgttcatcctcttacggaggaagcggaggtac 587
           |||||||||||||| ||||| |||||||||||||||| ||| |||||||| |||||||||
Sbjct: 317 aagtggatggggccatgggagggcttggtgttcatccgcttgcggaggaaccggaggtac 258

                             
Query: 588 ttcatcttctggcggacg 605
           ||||||||||| ||||||
Sbjct: 257 ttcatcttctgccggacg 240



to top

>dbj|AK063806.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-121-G03, full
           insert sequence
          Length = 863

 Score =  289 bits (146), Expect = 5e-75
 Identities = 320/378 (84%)
 Strand = Plus / Minus

                                                                       
Query: 228 tgctttctcctgtcgtacgagaccttggccttctccttcctcttttcctccagctccctg 287
           ||||| ||||| ||||| |  ||||| ||||||||||| ||||| |||||||  ||||||
Sbjct: 621 tgcttcctcctctcgtatgcaaccttagccttctcctttctcttctcctccaattccctg 562

                                                                       
Query: 288 atggtgtcggcgtagttccatccgacctccttggagagctggcccaggaggcagtacctg 347
           |||||||||  ||||||||| ||||||||||||||||||||||| |||||||||||| ||
Sbjct: 561 atggtgtcgtggtagttccagccgacctccttggagagctggccgaggaggcagtacttg 502

                                                                       
Query: 348 tgcccaggctgcagcctcagaaccttgagcgcgtcgggaatgaccatgcgcttggtcctg 407
           || || ||||| || |  ||||||||||| |||||||| | ||||||||||||||| | |
Sbjct: 501 tggccgggctggaggcgaagaaccttgagggcgtcggggacgaccatgcgcttggtgcgg 442

                                                                       
Query: 408 tcgtacggcggcggcacaccctcgtacgccttgagcctggcaagcgcggcctcgcccctc 467
           ||||| || || || || || ||| | ||||||||  |||| || ||||||||||| |  
Sbjct: 441 tcgtagggaggggggacgccgtcgaaggccttgaggttggcgagggcggcctcgccgcgg 382

                                                                       
Query: 468 gcggtcttgtgcggaatcataccgcggatggtgcgccagaggatcttggccggggcgcgg 527
           | ||||||||| || ||||| ||||||| ||||||||||| |||   ||  |||||||||
Sbjct: 381 ggggtcttgtgggggatcatgccgcggacggtgcgccagaagatgcgggagggggcgcgg 322

                                                                       
Query: 528 aagtggatggggccgtgggatggcttggtgttcatcctcttacggaggaagcggaggtac 587
           |||||||||||||| ||||| |||||||||||||||| ||| |||||||| |||||||||
Sbjct: 321 aagtggatggggccatgggagggcttggtgttcatccgcttgcggaggaaccggaggtac 262

                             
Query: 588 ttcatcttctggcggacg 605
           ||||||||||| ||||||
Sbjct: 261 ttcatcttctgccggacg 244



to top

>dbj|AK066603.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013071H21, full
           insert sequence
          Length = 2212

 Score =  246 bits (124), Expect = 7e-62
 Identities = 157/168 (93%)
 Strand = Plus / Minus

                                                                       
Query: 299 gtagttccatccgacctccttggagagctggcccaggaggcagtacctgtgcccaggctg 358
           ||||||||| || |||||||||||||||||||| |||||||||||| |||||||||||||
Sbjct: 576 gtagttccagccaacctccttggagagctggccgaggaggcagtacttgtgcccaggctg 517

                                                                       
Query: 359 cagcctcagaaccttgagcgcgtcgggaatgaccatgcgcttggtcctgtcgtacggcgg 418
           ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||
Sbjct: 516 cagcctcagaaccttgagcgcgtcggggatgaccatgcgcttggtcctgtcgtacggcgg 457

                                                           
Query: 419 cggcacaccctcgtacgccttgagcctggcaagcgcggcctcgcccct 466
           |||||| |||||||||||||| ||||| || ||||| ||||| |||||
Sbjct: 456 cggcacgccctcgtacgccttcagccttgccagcgccgcctctcccct 409



to top

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score =  184 bits (93), Expect = 2e-43
 Identities = 111/117 (94%)
 Strand = Plus / Minus

                                                                            
Query: 489      ccgcggatggtgcgccagaggatcttggccggggcgcggaagtggatggggccgtgggat 548
                ||||||| ||||||||||||||||||||| |||| |||||||||||||||||| ||||| 
Sbjct: 30899750 ccgcggacggtgcgccagaggatcttggcgggggagcggaagtggatggggccatgggag 30899691

                                                                         
Query: 549      ggcttggtgttcatcctcttacggaggaagcggaggtacttcatcttctggcggacg 605
                |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 30899690 ggcttggtgttcatcctcttgcggaggaagcggaggtacttcatcttctggcggacg 30899634



 Score =  176 bits (89), Expect = 5e-41
 Identities = 111/117 (94%), Gaps = 1/117 (0%)
 Strand = Plus / Plus

                                                                            
Query: 489      ccgcggatggtgcgccagaggatcttggccggggcgcggaagtggatggggccgtgggat 548
                ||||||| ||||||||||||||||||||| |||| |||||||||||||||||| ||||| 
Sbjct: 30886558 ccgcggacggtgcgccagaggatcttggcgggggagcggaagtggatggggccatgggag 30886617

                                                                         
Query: 549      ggcttggtgttcatcctcttacggaggaagcggaggtacttcatcttctggcggacg 605
                |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 30886618 ggcttggtgttcatcctctt-cggaggaagcggaggtacttcatcttctggcggacg 30886673



 Score =  153 bits (77), Expect = 8e-34
 Identities = 107/117 (91%)
 Strand = Plus / Minus

                                                                            
Query: 371      cttgagcgcgtcgggaatgaccatgcgcttggtcctgtcgtacggcggcggcacaccctc 430
                ||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||
Sbjct: 30899966 cttgagcgcgtcggggatgaccatgcgcttggtcctgtcgtacggcggcggcacgccctc 30899907

                                                                         
Query: 431      gtacgccttgagcctggcaagcgcggcctcgcccctcgcggtcttgtgcggaatcat 487
                ||||||||| ||||| || ||||| ||||| ||||||  |||||||||||| |||||
Sbjct: 30899906 gtacgccttcagccttgccagcgccgcctctcccctcttggtcttgtgcgggatcat 30899850



 Score =  149 bits (75), Expect = 1e-32
 Identities = 126/143 (88%)
 Strand = Plus / Minus

                                                                            
Query: 142      agtatttgatcggggccaggatctccagctgagttcccaacttctcctcggctgccttct 201
                ||||||||||||| || || |||||||||||||  |||| ||||||||||||||||||||
Sbjct: 30901123 agtatttgatcggagcaagaatctccagctgaggacccagcttctcctcggctgccttct 30901064

                                                                            
Query: 202      cggccttgacgcggagcttcgccagctgctttctcctgtcgtacgagaccttggccttct 261
                | |||||||| || ||||||||||| ||||| |||||||| || |  |||||||||||||
Sbjct: 30901063 cagccttgacacgcagcttcgccagttgcttcctcctgtcataggcaaccttggccttct 30901004

                                       
Query: 262      ccttcctcttttcctccagctcc 284
                |||||||||| ||||| ||||||
Sbjct: 30901003 ccttcctcttctcctcaagctcc 30900981



 Score =  137 bits (69), Expect = 5e-29
 Identities = 105/117 (89%)
 Strand = Plus / Plus

                                                                            
Query: 371      cttgagcgcgtcgggaatgaccatgcgcttggtcctgtcgtacggcggcggcacaccctc 430
                ||||||||||||||| |||||||||||||||||||||||||||||||||| |||  ||||
Sbjct: 30886326 cttgagcgcgtcggggatgaccatgcgcttggtcctgtcgtacggcggcgtcacgacctc 30886385

                                                                         
Query: 431      gtacgccttgagcctggcaagcgcggcctcgcccctcgcggtcttgtgcggaatcat 487
                ||||||||| ||||| || ||||| ||||| ||||||  |||||||||||| |||||
Sbjct: 30886386 gtacgccttcagccttgccagcgccgcctctcccctcttggtcttgtgcgggatcat 30886442



 Score =  121 bits (61), Expect = 3e-24
 Identities = 82/89 (92%)
 Strand = Plus / Minus

                                                                            
Query: 283      ccctgatggtgtcggcgtagttccatccgacctccttggagagctggcccaggaggcagt 342
                |||||||||||||   ||||||||| || |||||||||||||||||||| ||||||||||
Sbjct: 30900146 ccctgatggtgtcatagtagttccagccaacctccttggagagctggccgaggaggcagt 30900087

                                             
Query: 343      acctgtgcccaggctgcagcctcagaacc 371
                || ||||||||||||||||||||||||||
Sbjct: 30900086 acttgtgcccaggctgcagcctcagaacc 30900058



 Score =  121 bits (61), Expect = 3e-24
 Identities = 82/89 (92%)
 Strand = Plus / Plus

                                                                            
Query: 283      ccctgatggtgtcggcgtagttccatccgacctccttggagagctggcccaggaggcagt 342
                |||||||||||||   ||||||||| || |||||||||||||||||||| ||||||||||
Sbjct: 30886136 ccctgatggtgtcatagtagttccagccaacctccttggagagctggccgaggaggcagt 30886195

                                             
Query: 343      acctgtgcccaggctgcagcctcagaacc 371
                || ||||||||||||||||||||||||||
Sbjct: 30886196 acttgtgcccaggctgcagcctcagaacc 30886224



to top

>gb|AC120509.3| Oryza sativa chromosome 3 BAC OSJNBb0081K01 genomic sequence, complete
             sequence
          Length = 122496

 Score =  184 bits (93), Expect = 2e-43
 Identities = 111/117 (94%)
 Strand = Plus / Plus

                                                                         
Query: 489   ccgcggatggtgcgccagaggatcttggccggggcgcggaagtggatggggccgtgggat 548
             ||||||| ||||||||||||||||||||| |||| |||||||||||||||||| ||||| 
Sbjct: 43340 ccgcggacggtgcgccagaggatcttggcgggggagcggaagtggatggggccatgggag 43399

                                                                      
Query: 549   ggcttggtgttcatcctcttacggaggaagcggaggtacttcatcttctggcggacg 605
             |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 43400 ggcttggtgttcatcctcttgcggaggaagcggaggtacttcatcttctggcggacg 43456



 Score =  176 bits (89), Expect = 5e-41
 Identities = 111/117 (94%), Gaps = 1/117 (0%)
 Strand = Plus / Minus

                                                                         
Query: 489   ccgcggatggtgcgccagaggatcttggccggggcgcggaagtggatggggccgtgggat 548
             ||||||| ||||||||||||||||||||| |||| |||||||||||||||||| ||||| 
Sbjct: 56532 ccgcggacggtgcgccagaggatcttggcgggggagcggaagtggatggggccatgggag 56473

                                                                      
Query: 549   ggcttggtgttcatcctcttacggaggaagcggaggtacttcatcttctggcggacg 605
             |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 56472 ggcttggtgttcatcctctt-cggaggaagcggaggtacttcatcttctggcggacg 56417



 Score =  153 bits (77), Expect = 8e-34
 Identities = 107/117 (91%)
 Strand = Plus / Plus

                                                                         
Query: 371   cttgagcgcgtcgggaatgaccatgcgcttggtcctgtcgtacggcggcggcacaccctc 430
             ||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||
Sbjct: 43124 cttgagcgcgtcggggatgaccatgcgcttggtcctgtcgtacggcggcggcacgccctc 43183

                                                                      
Query: 431   gtacgccttgagcctggcaagcgcggcctcgcccctcgcggtcttgtgcggaatcat 487
             ||||||||| ||||| || ||||| ||||| ||||||  |||||||||||| |||||
Sbjct: 43184 gtacgccttcagccttgccagcgccgcctctcccctcttggtcttgtgcgggatcat 43240



 Score =  149 bits (75), Expect = 1e-32
 Identities = 126/143 (88%)
 Strand = Plus / Plus

                                                                         
Query: 142   agtatttgatcggggccaggatctccagctgagttcccaacttctcctcggctgccttct 201
             ||||||||||||| || || |||||||||||||  |||| ||||||||||||||||||||
Sbjct: 41967 agtatttgatcggagcaagaatctccagctgaggacccagcttctcctcggctgccttct 42026

                                                                         
Query: 202   cggccttgacgcggagcttcgccagctgctttctcctgtcgtacgagaccttggccttct 261
             | |||||||| || ||||||||||| ||||| |||||||| || |  |||||||||||||
Sbjct: 42027 cagccttgacacgcagcttcgccagttgcttcctcctgtcataggcaaccttggccttct 42086

                                    
Query: 262   ccttcctcttttcctccagctcc 284
             |||||||||| ||||| ||||||
Sbjct: 42087 ccttcctcttctcctcaagctcc 42109



 Score =  137 bits (69), Expect = 5e-29
 Identities = 105/117 (89%)
 Strand = Plus / Minus

                                                                         
Query: 371   cttgagcgcgtcgggaatgaccatgcgcttggtcctgtcgtacggcggcggcacaccctc 430
             ||||||||||||||| |||||||||||||||||||||||||||||||||| |||  ||||
Sbjct: 56764 cttgagcgcgtcggggatgaccatgcgcttggtcctgtcgtacggcggcgtcacgacctc 56705

                                                                      
Query: 431   gtacgccttgagcctggcaagcgcggcctcgcccctcgcggtcttgtgcggaatcat 487
             ||||||||| ||||| || ||||| ||||| ||||||  |||||||||||| |||||
Sbjct: 56704 gtacgccttcagccttgccagcgccgcctctcccctcttggtcttgtgcgggatcat 56648



 Score =  121 bits (61), Expect = 3e-24
 Identities = 82/89 (92%)
 Strand = Plus / Minus

                                                                         
Query: 283   ccctgatggtgtcggcgtagttccatccgacctccttggagagctggcccaggaggcagt 342
             |||||||||||||   ||||||||| || |||||||||||||||||||| ||||||||||
Sbjct: 56954 ccctgatggtgtcatagtagttccagccaacctccttggagagctggccgaggaggcagt 56895

                                          
Query: 343   acctgtgcccaggctgcagcctcagaacc 371
             || ||||||||||||||||||||||||||
Sbjct: 56894 acttgtgcccaggctgcagcctcagaacc 56866



 Score =  121 bits (61), Expect = 3e-24
 Identities = 82/89 (92%)
 Strand = Plus / Plus

                                                                         
Query: 283   ccctgatggtgtcggcgtagttccatccgacctccttggagagctggcccaggaggcagt 342
             |||||||||||||   ||||||||| || |||||||||||||||||||| ||||||||||
Sbjct: 42944 ccctgatggtgtcatagtagttccagccaacctccttggagagctggccgaggaggcagt 43003

                                          
Query: 343   acctgtgcccaggctgcagcctcagaacc 371
             || ||||||||||||||||||||||||||
Sbjct: 43004 acttgtgcccaggctgcagcctcagaacc 43032



to top

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
                sequence
          Length = 36192742

 Score =  184 bits (93), Expect = 2e-43
 Identities = 111/117 (94%)
 Strand = Plus / Minus

                                                                            
Query: 489      ccgcggatggtgcgccagaggatcttggccggggcgcggaagtggatggggccgtgggat 548
                ||||||| ||||||||||||||||||||| |||| |||||||||||||||||| ||||| 
Sbjct: 30990273 ccgcggacggtgcgccagaggatcttggcgggggagcggaagtggatggggccatgggag 30990214

                                                                         
Query: 549      ggcttggtgttcatcctcttacggaggaagcggaggtacttcatcttctggcggacg 605
                |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 30990213 ggcttggtgttcatcctcttgcggaggaagcggaggtacttcatcttctggcggacg 30990157



 Score =  176 bits (89), Expect = 5e-41
 Identities = 111/117 (94%), Gaps = 1/117 (0%)
 Strand = Plus / Plus

                                                                            
Query: 489      ccgcggatggtgcgccagaggatcttggccggggcgcggaagtggatggggccgtgggat 548
                ||||||| ||||||||||||||||||||| |||| |||||||||||||||||| ||||| 
Sbjct: 30977081 ccgcggacggtgcgccagaggatcttggcgggggagcggaagtggatggggccatgggag 30977140

                                                                         
Query: 549      ggcttggtgttcatcctcttacggaggaagcggaggtacttcatcttctggcggacg 605
                |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 30977141 ggcttggtgttcatcctctt-cggaggaagcggaggtacttcatcttctggcggacg 30977196



 Score =  153 bits (77), Expect = 8e-34
 Identities = 107/117 (91%)
 Strand = Plus / Minus

                                                                            
Query: 371      cttgagcgcgtcgggaatgaccatgcgcttggtcctgtcgtacggcggcggcacaccctc 430
                ||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||
Sbjct: 30990489 cttgagcgcgtcggggatgaccatgcgcttggtcctgtcgtacggcggcggcacgccctc 30990430

                                                                         
Query: 431      gtacgccttgagcctggcaagcgcggcctcgcccctcgcggtcttgtgcggaatcat 487
                ||||||||| ||||| || ||||| ||||| ||||||  |||||||||||| |||||
Sbjct: 30990429 gtacgccttcagccttgccagcgccgcctctcccctcttggtcttgtgcgggatcat 30990373



 Score =  149 bits (75), Expect = 1e-32
 Identities = 126/143 (88%)
 Strand = Plus / Minus

                                                                            
Query: 142      agtatttgatcggggccaggatctccagctgagttcccaacttctcctcggctgccttct 201
                ||||||||||||| || || |||||||||||||  |||| ||||||||||||||||||||
Sbjct: 30991646 agtatttgatcggagcaagaatctccagctgaggacccagcttctcctcggctgccttct 30991587

                                                                            
Query: 202      cggccttgacgcggagcttcgccagctgctttctcctgtcgtacgagaccttggccttct 261
                | |||||||| || ||||||||||| ||||| |||||||| || |  |||||||||||||
Sbjct: 30991586 cagccttgacacgcagcttcgccagttgcttcctcctgtcataggcaaccttggccttct 30991527

                                       
Query: 262      ccttcctcttttcctccagctcc 284
                |||||||||| ||||| ||||||
Sbjct: 30991526 ccttcctcttctcctcaagctcc 30991504



 Score =  137 bits (69), Expect = 5e-29
 Identities = 105/117 (89%)
 Strand = Plus / Plus

                                                                            
Query: 371      cttgagcgcgtcgggaatgaccatgcgcttggtcctgtcgtacggcggcggcacaccctc 430
                ||||||||||||||| |||||||||||||||||||||||||||||||||| |||  ||||
Sbjct: 30976849 cttgagcgcgtcggggatgaccatgcgcttggtcctgtcgtacggcggcgtcacgacctc 30976908

                                                                         
Query: 431      gtacgccttgagcctggcaagcgcggcctcgcccctcgcggtcttgtgcggaatcat 487
                ||||||||| ||||| || ||||| ||||| ||||||  |||||||||||| |||||
Sbjct: 30976909 gtacgccttcagccttgccagcgccgcctctcccctcttggtcttgtgcgggatcat 30976965



 Score =  121 bits (61), Expect = 3e-24
 Identities = 82/89 (92%)
 Strand = Plus / Minus

                                                                            
Query: 283      ccctgatggtgtcggcgtagttccatccgacctccttggagagctggcccaggaggcagt 342
                |||||||||||||   ||||||||| || |||||||||||||||||||| ||||||||||
Sbjct: 30990669 ccctgatggtgtcatagtagttccagccaacctccttggagagctggccgaggaggcagt 30990610

                                             
Query: 343      acctgtgcccaggctgcagcctcagaacc 371
                || ||||||||||||||||||||||||||
Sbjct: 30990609 acttgtgcccaggctgcagcctcagaacc 30990581



 Score =  121 bits (61), Expect = 3e-24
 Identities = 82/89 (92%)
 Strand = Plus / Plus

                                                                            
Query: 283      ccctgatggtgtcggcgtagttccatccgacctccttggagagctggcccaggaggcagt 342
                |||||||||||||   ||||||||| || |||||||||||||||||||| ||||||||||
Sbjct: 30976659 ccctgatggtgtcatagtagttccagccaacctccttggagagctggccgaggaggcagt 30976718

                                             
Query: 343      acctgtgcccaggctgcagcctcagaacc 371
                || ||||||||||||||||||||||||||
Sbjct: 30976719 acttgtgcccaggctgcagcctcagaacc 30976747



to top

>gb|AY013245.2| Oryza sativa (japonica cultivar-group) chromosome 3 BAC 36I5, partial
             sequence
          Length = 65547

 Score =  176 bits (89), Expect = 5e-41
 Identities = 111/117 (94%), Gaps = 1/117 (0%)
 Strand = Plus / Minus

                                                                         
Query: 489   ccgcggatggtgcgccagaggatcttggccggggcgcggaagtggatggggccgtgggat 548
             ||||||| ||||||||||||||||||||| |||| |||||||||||||||||| ||||| 
Sbjct: 54558 ccgcggacggtgcgccagaggatcttggcgggggagcggaagtggatggggccatgggag 54499

                                                                      
Query: 549   ggcttggtgttcatcctcttacggaggaagcggaggtacttcatcttctggcggacg 605
             |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 54498 ggcttggtgttcatcctctt-cggaggaagcggaggtacttcatcttctggcggacg 54443



 Score =  137 bits (69), Expect = 5e-29
 Identities = 105/117 (89%)
 Strand = Plus / Minus

                                                                         
Query: 371   cttgagcgcgtcgggaatgaccatgcgcttggtcctgtcgtacggcggcggcacaccctc 430
             ||||||||||||||| |||||||||||||||||||||||||||||||||| |||  ||||
Sbjct: 54790 cttgagcgcgtcggggatgaccatgcgcttggtcctgtcgtacggcggcgtcacgacctc 54731

                                                                      
Query: 431   gtacgccttgagcctggcaagcgcggcctcgcccctcgcggtcttgtgcggaatcat 487
             ||||||||| ||||| || ||||| ||||| ||||||  |||||||||||| |||||
Sbjct: 54730 gtacgccttcagccttgccagcgccgcctctcccctcttggtcttgtgcgggatcat 54674



 Score =  121 bits (61), Expect = 3e-24
 Identities = 82/89 (92%)
 Strand = Plus / Minus

                                                                         
Query: 283   ccctgatggtgtcggcgtagttccatccgacctccttggagagctggcccaggaggcagt 342
             |||||||||||||   ||||||||| || |||||||||||||||||||| ||||||||||
Sbjct: 54980 ccctgatggtgtcatagtagttccagccaacctccttggagagctggccgaggaggcagt 54921

                                          
Query: 343   acctgtgcccaggctgcagcctcagaacc 371
             || ||||||||||||||||||||||||||
Sbjct: 54920 acttgtgcccaggctgcagcctcagaacc 54892



to top

>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7,
              complete sequence
          Length = 29644043

 Score =  172 bits (87), Expect = 9e-40
 Identities = 198/235 (84%)
 Strand = Plus / Plus

                                                                          
Query: 371    cttgagcgcgtcgggaatgaccatgcgcttggtcctgtcgtacggcggcggcacaccctc 430
              |||||| |||||||| | ||||||||||||||| | |||||| || || || || || ||
Sbjct: 524288 cttgagggcgtcggggacgaccatgcgcttggtgcggtcgtagggaggggggacgccgtc 524347

                                                                          
Query: 431    gtacgccttgagcctggcaagcgcggcctcgcccctcgcggtcttgtgcggaatcatacc 490
              | | ||||||||  |||| || ||||||||||| |  | ||||||||| || ||||| ||
Sbjct: 524348 gaaggccttgaggttggcgagggcggcctcgccgcggggggtcttgtgggggatcatgcc 524407

                                                                          
Query: 491    gcggatggtgcgccagaggatcttggccggggcgcggaagtggatggggccgtgggatgg 550
              ||||| ||||||||||| |||   ||  ||||||||||||||||||||||| ||||| ||
Sbjct: 524408 gcggacggtgcgccagaagatgcgggagggggcgcggaagtggatggggccatgggaggg 524467

                                                                     
Query: 551    cttggtgttcatcctcttacggaggaagcggaggtacttcatcttctggcggacg 605
              |||||||||||||| ||| |||||||| |||||||||||||||||||| ||||||
Sbjct: 524468 cttggtgttcatccgcttgcggaggaaccggaggtacttcatcttctgccggacg 524522



 Score = 95.6 bits (48), Expect = 2e-16
 Identities = 69/76 (90%)
 Strand = Plus / Plus

                                                                          
Query: 283    ccctgatggtgtcggcgtagttccatccgacctccttggagagctggcccaggaggcagt 342
              ||||||||||||||  ||||||||| ||||||||||||||||||||||| ||||||||||
Sbjct: 524124 ccctgatggtgtcgtggtagttccagccgacctccttggagagctggccgaggaggcagt 524183

                              
Query: 343    acctgtgcccaggctg 358
              || |||| || |||||
Sbjct: 524184 acttgtggccgggctg 524199



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 44/52 (84%)
 Strand = Plus / Plus

                                                                  
Query: 228    tgctttctcctgtcgtacgagaccttggccttctccttcctcttttcctcca 279
              ||||| ||||| ||||| |  ||||| ||||||||||| ||||| |||||||
Sbjct: 523008 tgcttcctcctctcgtatgcaaccttagccttctcctttctcttctcctcca 523059



to top

>dbj|AP004342.5| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC
              clone:P0585H11
          Length = 149371

 Score =  172 bits (87), Expect = 9e-40
 Identities = 198/235 (84%)
 Strand = Plus / Plus

                                                                          
Query: 371    cttgagcgcgtcgggaatgaccatgcgcttggtcctgtcgtacggcggcggcacaccctc 430
              |||||| |||||||| | ||||||||||||||| | |||||| || || || || || ||
Sbjct: 126452 cttgagggcgtcggggacgaccatgcgcttggtgcggtcgtagggaggggggacgccgtc 126511

                                                                          
Query: 431    gtacgccttgagcctggcaagcgcggcctcgcccctcgcggtcttgtgcggaatcatacc 490
              | | ||||||||  |||| || ||||||||||| |  | ||||||||| || ||||| ||
Sbjct: 126512 gaaggccttgaggttggcgagggcggcctcgccgcggggggtcttgtgggggatcatgcc 126571

                                                                          
Query: 491    gcggatggtgcgccagaggatcttggccggggcgcggaagtggatggggccgtgggatgg 550
              ||||| ||||||||||| |||   ||  ||||||||||||||||||||||| ||||| ||
Sbjct: 126572 gcggacggtgcgccagaagatgcgggagggggcgcggaagtggatggggccatgggaggg 126631

                                                                     
Query: 551    cttggtgttcatcctcttacggaggaagcggaggtacttcatcttctggcggacg 605
              |||||||||||||| ||| |||||||| |||||||||||||||||||| ||||||
Sbjct: 126632 cttggtgttcatccgcttgcggaggaaccggaggtacttcatcttctgccggacg 126686



 Score = 95.6 bits (48), Expect = 2e-16
 Identities = 69/76 (90%)
 Strand = Plus / Plus

                                                                          
Query: 283    ccctgatggtgtcggcgtagttccatccgacctccttggagagctggcccaggaggcagt 342
              ||||||||||||||  ||||||||| ||||||||||||||||||||||| ||||||||||
Sbjct: 126288 ccctgatggtgtcgtggtagttccagccgacctccttggagagctggccgaggaggcagt 126347

                              
Query: 343    acctgtgcccaggctg 358
              || |||| || |||||
Sbjct: 126348 acttgtggccgggctg 126363



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 44/52 (84%)
 Strand = Plus / Plus

                                                                  
Query: 228    tgctttctcctgtcgtacgagaccttggccttctccttcctcttttcctcca 279
              ||||| ||||| ||||| |  ||||| ||||||||||| ||||| |||||||
Sbjct: 125172 tgcttcctcctctcgtatgcaaccttagccttctcctttctcttctcctcca 125223



to top

>dbj|AP003759.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC
             clone:OJ1567_G09
          Length = 121388

 Score =  172 bits (87), Expect = 9e-40
 Identities = 198/235 (84%)
 Strand = Plus / Plus

                                                                         
Query: 371   cttgagcgcgtcgggaatgaccatgcgcttggtcctgtcgtacggcggcggcacaccctc 430
             |||||| |||||||| | ||||||||||||||| | |||||| || || || || || ||
Sbjct: 78200 cttgagggcgtcggggacgaccatgcgcttggtgcggtcgtagggaggggggacgccgtc 78259

                                                                         
Query: 431   gtacgccttgagcctggcaagcgcggcctcgcccctcgcggtcttgtgcggaatcatacc 490
             | | ||||||||  |||| || ||||||||||| |  | ||||||||| || ||||| ||
Sbjct: 78260 gaaggccttgaggttggcgagggcggcctcgccgcggggggtcttgtgggggatcatgcc 78319

                                                                         
Query: 491   gcggatggtgcgccagaggatcttggccggggcgcggaagtggatggggccgtgggatgg 550
             ||||| ||||||||||| |||   ||  ||||||||||||||||||||||| ||||| ||
Sbjct: 78320 gcggacggtgcgccagaagatgcgggagggggcgcggaagtggatggggccatgggaggg 78379

                                                                    
Query: 551   cttggtgttcatcctcttacggaggaagcggaggtacttcatcttctggcggacg 605
             |||||||||||||| ||| |||||||| |||||||||||||||||||| ||||||
Sbjct: 78380 cttggtgttcatccgcttgcggaggaaccggaggtacttcatcttctgccggacg 78434



 Score = 95.6 bits (48), Expect = 2e-16
 Identities = 69/76 (90%)
 Strand = Plus / Plus

                                                                         
Query: 283   ccctgatggtgtcggcgtagttccatccgacctccttggagagctggcccaggaggcagt 342
             ||||||||||||||  ||||||||| ||||||||||||||||||||||| ||||||||||
Sbjct: 78036 ccctgatggtgtcgtggtagttccagccgacctccttggagagctggccgaggaggcagt 78095

                             
Query: 343   acctgtgcccaggctg 358
             || |||| || |||||
Sbjct: 78096 acttgtggccgggctg 78111



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 44/52 (84%)
 Strand = Plus / Plus

                                                                 
Query: 228   tgctttctcctgtcgtacgagaccttggccttctccttcctcttttcctcca 279
             ||||| ||||| ||||| |  ||||| ||||||||||| ||||| |||||||
Sbjct: 76920 tgcttcctcctctcgtatgcaaccttagccttctcctttctcttctcctcca 76971



to top

>gb|AF503433.1| Sorghum bicolor BAC 170F8, complete sequence
          Length = 142376

 Score =  155 bits (78), Expect = 2e-34
 Identities = 105/114 (92%)
 Strand = Plus / Minus

                                                                         
Query: 492   cggatggtgcgccagaggatcttggccggggcgcggaagtggatggggccgtgggatggc 551
             |||||||||||||| |||||||||   ||||| |||||||| ||||||||||| || |||
Sbjct: 69148 cggatggtgcgccacaggatcttgctgggggcacggaagtgaatggggccgtgagacggc 69089

                                                                   
Query: 552   ttggtgttcatcctcttacggaggaagcggaggtacttcatcttctggcggacg 605
             ||||||||||||||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 69088 ttggtgttcatcctcttgcggaggaagcggaggtacttcatcttctggcggacg 69035



 Score =  141 bits (71), Expect = 3e-30
 Identities = 125/143 (87%)
 Strand = Plus / Minus

                                                                         
Query: 142   agtatttgatcggggccaggatctccagctgagttcccaacttctcctcggctgccttct 201
             |||||||||||||||| || ||||||||||||| ||||| |||||||||||||| |||||
Sbjct: 70475 agtatttgatcggggcaagaatctccagctgagatcccagcttctcctcggctgtcttct 70416

                                                                         
Query: 202   cggccttgacgcggagcttcgccagctgctttctcctgtcgtacgagaccttggccttct 261
             | |||||||| || ||||| ||||| ||||| ||||| || || |  |||||||||||||
Sbjct: 70415 cagccttgacacgcagcttggccagttgcttcctcctctcataggcaaccttggccttct 70356

                                    
Query: 262   ccttcctcttttcctccagctcc 284
             |||||||||| ||||| ||||||
Sbjct: 70355 ccttcctcttctcctcaagctcc 70333



 Score =  121 bits (61), Expect = 3e-24
 Identities = 82/89 (92%)
 Strand = Plus / Minus

                                                                         
Query: 283   ccctgatggtgtcggcgtagttccatccgacctccttggagagctggcccaggaggcagt 342
             |||||||||||||   ||||||||||||||||||||| ||||||| ||| ||||||||||
Sbjct: 69554 ccctgatggtgtcatggtagttccatccgacctccttagagagctcgccgaggaggcagt 69495

                                          
Query: 343   acctgtgcccaggctgcagcctcagaacc 371
             || ||||||||||||||||||||||||||
Sbjct: 69494 acttgtgcccaggctgcagcctcagaacc 69466



 Score = 99.6 bits (50), Expect = 1e-17
 Identities = 95/110 (86%)
 Strand = Plus / Minus

                                                                         
Query: 378   gcgtcgggaatgaccatgcgcttggtcctgtcgtacggcggcggcacaccctcgtacgcc 437
             ||||| || ||||||| |||||||||| |||||||||||||||| || |||||||| | |
Sbjct: 69361 gcgtcagggatgaccacgcgcttggtcttgtcgtacggcggcgggacgccctcgtaggtc 69302

                                                               
Query: 438   ttgagcctggcaagcgcggcctcgcccctcgcggtcttgtgcggaatcat 487
             |||||||| ||||| || ||||| ||||||  |||||| |||||||||||
Sbjct: 69301 ttgagccttgcaagagccgcctctcccctcttggtcttatgcggaatcat 69252



to top

>gb|AC146913.2| Oryza sativa (japonica cultivar-group) chromosome 11 clone OSJNBb0013C12
              map near S6115, complete sequence
          Length = 123718

 Score =  135 bits (68), Expect = 2e-28
 Identities = 89/96 (92%)
 Strand = Plus / Minus

                                                                          
Query: 371    cttgagcgcgtcgggaatgaccatgcgcttggtcctgtcgtacggcggcggcacaccctc 430
              ||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||
Sbjct: 110257 cttgagcgcgtcggggatgaccatgcgcttggtcctgtcgtacggcggcggcacgccctc 110198

                                                  
Query: 431    gtacgccttgagcctggcaagcgcggcctcgcccct 466
              ||||||||| ||||| || ||||| ||||| |||||
Sbjct: 110197 gtacgccttcagccttgccagcgccgcctctcccct 110162



 Score =  113 bits (57), Expect = 7e-22
 Identities = 69/73 (94%)
 Strand = Plus / Minus

                                                                          
Query: 299    gtagttccatccgacctccttggagagctggcccaggaggcagtacctgtgcccaggctg 358
              ||||||||| || |||||||||||||||||||| |||||||||||| |||||||||||||
Sbjct: 110430 gtagttccagccaacctccttggagagctggccgaggaggcagtacttgtgcccaggctg 110371

                           
Query: 359    cagcctcagaacc 371
              |||||||||||||
Sbjct: 110370 cagcctcagaacc 110358



to top

>gb|AC145327.2| Oryza sativa (japonica cultivar-group) chromosome 11 clone
             OSJNBb0095J10 map near S6115, complete sequence
          Length = 123717

 Score =  135 bits (68), Expect = 2e-28
 Identities = 89/96 (92%)
 Strand = Plus / Minus

                                                                         
Query: 371   cttgagcgcgtcgggaatgaccatgcgcttggtcctgtcgtacggcggcggcacaccctc 430
             ||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||
Sbjct: 14846 cttgagcgcgtcggggatgaccatgcgcttggtcctgtcgtacggcggcggcacgccctc 14787

                                                 
Query: 431   gtacgccttgagcctggcaagcgcggcctcgcccct 466
             ||||||||| ||||| || ||||| ||||| |||||
Sbjct: 14786 gtacgccttcagccttgccagcgccgcctctcccct 14751



 Score =  113 bits (57), Expect = 7e-22
 Identities = 69/73 (94%)
 Strand = Plus / Minus

                                                                         
Query: 299   gtagttccatccgacctccttggagagctggcccaggaggcagtacctgtgcccaggctg 358
             ||||||||| || |||||||||||||||||||| |||||||||||| |||||||||||||
Sbjct: 15019 gtagttccagccaacctccttggagagctggccgaggaggcagtacttgtgcccaggctg 14960

                          
Query: 359   cagcctcagaacc 371
             |||||||||||||
Sbjct: 14959 cagcctcagaacc 14947



to top

>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11, complete
                sequence
          Length = 28386948

 Score =  135 bits (68), Expect = 2e-28
 Identities = 89/96 (92%)
 Strand = Plus / Minus

                                                                            
Query: 371      cttgagcgcgtcgggaatgaccatgcgcttggtcctgtcgtacggcggcggcacaccctc 430
                ||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||
Sbjct: 12942921 cttgagcgcgtcggggatgaccatgcgcttggtcctgtcgtacggcggcggcacgccctc 12942862

                                                    
Query: 431      gtacgccttgagcctggcaagcgcggcctcgcccct 466
                ||||||||| ||||| || ||||| ||||| |||||
Sbjct: 12942861 gtacgccttcagccttgccagcgccgcctctcccct 12942826



 Score =  113 bits (57), Expect = 7e-22
 Identities = 69/73 (94%)
 Strand = Plus / Minus

                                                                            
Query: 299      gtagttccatccgacctccttggagagctggcccaggaggcagtacctgtgcccaggctg 358
                ||||||||| || |||||||||||||||||||| |||||||||||| |||||||||||||
Sbjct: 12943094 gtagttccagccaacctccttggagagctggccgaggaggcagtacttgtgcccaggctg 12943035

                             
Query: 359      cagcctcagaacc 371
                |||||||||||||
Sbjct: 12943034 cagcctcagaacc 12943022



to top

>gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome 11, complete sequence
          Length = 28369397

 Score =  135 bits (68), Expect = 2e-28
 Identities = 89/96 (92%)
 Strand = Plus / Minus

                                                                            
Query: 371      cttgagcgcgtcgggaatgaccatgcgcttggtcctgtcgtacggcggcggcacaccctc 430
                ||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||
Sbjct: 13023128 cttgagcgcgtcggggatgaccatgcgcttggtcctgtcgtacggcggcggcacgccctc 13023069

                                                    
Query: 431      gtacgccttgagcctggcaagcgcggcctcgcccct 466
                ||||||||| ||||| || ||||| ||||| |||||
Sbjct: 13023068 gtacgccttcagccttgccagcgccgcctctcccct 13023033



 Score =  113 bits (57), Expect = 7e-22
 Identities = 69/73 (94%)
 Strand = Plus / Minus

                                                                            
Query: 299      gtagttccatccgacctccttggagagctggcccaggaggcagtacctgtgcccaggctg 358
                ||||||||| || |||||||||||||||||||| |||||||||||| |||||||||||||
Sbjct: 13023301 gtagttccagccaacctccttggagagctggccgaggaggcagtacttgtgcccaggctg 13023242

                             
Query: 359      cagcctcagaacc 371
                |||||||||||||
Sbjct: 13023241 cagcctcagaacc 13023229



to top

>gb|DQ099054.1| Arachis stenosperma clone AS1RN3B12 microsatellite sequence
          Length = 758

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 90/107 (84%)
 Strand = Plus / Plus

                                                                       
Query: 471 gtcttgtgcggaatcataccgcggatggtgcgccagaggatcttggccggggcgcggaag 530
           |||||||| || |||||||| || | ||||||||||| |||||| |  || || ||||| 
Sbjct: 385 gtcttgtgtggtatcatacctcgaacggtgcgccagaagatcttagaaggagcacggaaa 444

                                                          
Query: 531 tggatggggccgtgggatggcttggtgttcatcctcttacggaggaa 577
           |||||||| || || || ||||| |||||||||||||||||||||||
Sbjct: 445 tggatgggaccatgagagggcttagtgttcatcctcttacggaggaa 491



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 53/62 (85%)
 Strand = Plus / Plus

                                                                       
Query: 255 gccttctccttcctcttttcctccagctccctgatggtgtcggcgtagttccatccgacc 314
           ||||||||||| ||||| | |||||||||  ||||||| |||  |||||||||||| |||
Sbjct: 169 gccttctcctttctcttcttctccagctcagtgatggtatcgtagtagttccatccaacc 228

             
Query: 315 tc 316
           ||
Sbjct: 229 tc 230



to top

>ref|NM_111591.2| Arabidopsis thaliana structural constituent of ribosome AT3G07110
           transcript variant AT3G07110.1 mRNA, complete cds
          Length = 881

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 105/128 (82%)
 Strand = Plus / Minus

                                                                       
Query: 471 gtcttgtgcggaatcataccgcggatggtgcgccagaggatcttggccggggcgcggaag 530
           |||||||| |||||||||||||| | ||| ||||||| ||||||||  || || ||||||
Sbjct: 354 gtcttgtgtggaatcataccgcgaacggtacgccagaagatcttggagggagcacggaag 295

                                                                       
Query: 531 tggatggggccgtgggatggcttggtgttcatcctcttacggaggaagcggaggtacttc 590
           || || || ||||| || || || |||||||| | ||||||||| || |  | |||||||
Sbjct: 294 tgaataggtccgtgagaaggtttagtgttcatacgcttacggagaaacctcatgtacttc 235

                   
Query: 591 atcttctg 598
           ||||||||
Sbjct: 234 atcttctg 227



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 45/53 (84%)
 Strand = Plus / Minus

                                                                
Query: 261 tccttcctcttttcctccagctccctgatggtgtcggcgtagttccatccgac 313
           ||||| ||||| | |||||||||| |||||||||||  || |||||| |||||
Sbjct: 564 tcctttctcttgttctccagctccttgatggtgtcgtagtggttccacccgac 512



to top

>ref|NM_001035577.1| Arabidopsis thaliana structural constituent of ribosome AT3G07110
           transcript variant AT3G07110.2 mRNA, complete cds
          Length = 893

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 105/128 (82%)
 Strand = Plus / Minus

                                                                       
Query: 471 gtcttgtgcggaatcataccgcggatggtgcgccagaggatcttggccggggcgcggaag 530
           |||||||| |||||||||||||| | ||| ||||||| ||||||||  || || ||||||
Sbjct: 363 gtcttgtgtggaatcataccgcgaacggtacgccagaagatcttggagggagcacggaag 304

                                                                       
Query: 531 tggatggggccgtgggatggcttggtgttcatcctcttacggaggaagcggaggtacttc 590
           || || || ||||| || || || |||||||| | ||||||||| || |  | |||||||
Sbjct: 303 tgaataggtccgtgagaaggtttagtgttcatacgcttacggagaaacctcatgtacttc 244

                   
Query: 591 atcttctg 598
           ||||||||
Sbjct: 243 atcttctg 236



to top

>gb|AY114589.1| Arabidopsis thaliana putative 60S ribosomal protein L13A
           (At3g07110) mRNA, complete cds
          Length = 667

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 105/128 (82%)
 Strand = Plus / Minus

                                                                       
Query: 471 gtcttgtgcggaatcataccgcggatggtgcgccagaggatcttggccggggcgcggaag 530
           |||||||| |||||||||||||| | ||| ||||||| ||||||||  || || ||||||
Sbjct: 290 gtcttgtgtggaatcataccgcgaacggtacgccagaagatcttggagggagcacggaag 231

                                                                       
Query: 531 tggatggggccgtgggatggcttggtgttcatcctcttacggaggaagcggaggtacttc 590
           || || || ||||| || || || |||||||| | ||||||||| || |  | |||||||
Sbjct: 230 tgaataggtccgtgagaaggtttagtgttcatacgcttacggagaaacctcatgtacttc 171

                   
Query: 591 atcttctg 598
           ||||||||
Sbjct: 170 atcttctg 163



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 45/53 (84%)
 Strand = Plus / Minus

                                                                
Query: 261 tccttcctcttttcctccagctccctgatggtgtcggcgtagttccatccgac 313
           ||||| ||||| | |||||||||| |||||||||||  || |||||| |||||
Sbjct: 500 tcctttctcttgttctccagctccttgatggtgtcgtagtggttccacccgac 448



to top

>gb|AY062793.1| Arabidopsis thaliana putative 60S ribosomal protein L13A
           (At3g07110; T1B9.24) mRNA, complete cds
          Length = 811

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 105/128 (82%)
 Strand = Plus / Minus

                                                                       
Query: 471 gtcttgtgcggaatcataccgcggatggtgcgccagaggatcttggccggggcgcggaag 530
           |||||||| |||||||||||||| | ||| ||||||| ||||||||  || || ||||||
Sbjct: 353 gtcttgtgtggaatcataccgcgaacggtacgccagaagatcttggagggagcacggaag 294

                                                                       
Query: 531 tggatggggccgtgggatggcttggtgttcatcctcttacggaggaagcggaggtacttc 590
           || || || ||||| || || || |||||||| | ||||||||| || |  | |||||||
Sbjct: 293 tgaataggtccgtgagaaggtttagtgttcatacgcttacggagaaacctcatgtacttc 234

                   
Query: 591 atcttctg 598
           ||||||||
Sbjct: 233 atcttctg 226



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 45/53 (84%)
 Strand = Plus / Minus

                                                                
Query: 261 tccttcctcttttcctccagctccctgatggtgtcggcgtagttccatccgac 313
           ||||| ||||| | |||||||||| |||||||||||  || |||||| |||||
Sbjct: 563 tcctttctcttgttctccagctccttgatggtgtcgtagtggttccacccgac 511



to top

>gb|AY057551.1| Arabidopsis thaliana AT3g07110/T1B9_24 mRNA, complete cds
          Length = 831

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 105/128 (82%)
 Strand = Plus / Minus

                                                                       
Query: 471 gtcttgtgcggaatcataccgcggatggtgcgccagaggatcttggccggggcgcggaag 530
           |||||||| |||||||||||||| | ||| ||||||| ||||||||  || || ||||||
Sbjct: 353 gtcttgtgtggaatcataccgcgaacggtacgccagaagatcttggagggagcacggaag 294

                                                                       
Query: 531 tggatggggccgtgggatggcttggtgttcatcctcttacggaggaagcggaggtacttc 590
           || || || ||||| || || || |||||||| | ||||||||| || |  | |||||||
Sbjct: 293 tgaataggtccgtgagaaggtttagtgttcatacgcttacggagaaacctcatgtacttc 234

                   
Query: 591 atcttctg 598
           ||||||||
Sbjct: 233 atcttctg 226



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 45/53 (84%)
 Strand = Plus / Minus

                                                                
Query: 261 tccttcctcttttcctccagctccctgatggtgtcggcgtagttccatccgac 313
           ||||| ||||| | |||||||||| |||||||||||  || |||||| |||||
Sbjct: 563 tcctttctcttgttctccagctccttgatggtgtcgtagtggttccacccgac 511



to top

>gb|AF325041.2|AF325041 Arabidopsis thaliana AT3g07110 (AT3g07110/T1B9_24) mRNA, complete
           cds
          Length = 829

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 105/128 (82%)
 Strand = Plus / Minus

                                                                       
Query: 471 gtcttgtgcggaatcataccgcggatggtgcgccagaggatcttggccggggcgcggaag 530
           |||||||| |||||||||||||| | ||| ||||||| ||||||||  || || ||||||
Sbjct: 353 gtcttgtgtggaatcataccgcgaacggtacgccagaagatcttggagggagcacggaag 294

                                                                       
Query: 531 tggatggggccgtgggatggcttggtgttcatcctcttacggaggaagcggaggtacttc 590
           || || || ||||| || || || |||||||| | ||||||||| || |  | |||||||
Sbjct: 293 tgaataggtccgtgagaaggtttagtgttcatacgcttacggagaaacctcatgtacttc 234

                   
Query: 591 atcttctg 598
           ||||||||
Sbjct: 233 atcttctg 226



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 45/53 (84%)
 Strand = Plus / Minus

                                                                
Query: 261 tccttcctcttttcctccagctccctgatggtgtcggcgtagttccatccgac 313
           ||||| ||||| | |||||||||| |||||||||||  || |||||| |||||
Sbjct: 563 tcctttctcttgttctccagctccttgatggtgtcgtagtggttccacccgac 511



to top

>emb|BX822336.1|CNS0A5ZO Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB2ZC08 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 788

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 105/128 (82%)
 Strand = Plus / Minus

                                                                       
Query: 471 gtcttgtgcggaatcataccgcggatggtgcgccagaggatcttggccggggcgcggaag 530
           |||||||| |||||||||||||| | ||| ||||||| ||||||||  || || ||||||
Sbjct: 337 gtcttgtgtggaatcataccgcgaacggtacgccagaagatcttggagggagcacggaag 278

                                                                       
Query: 531 tggatggggccgtgggatggcttggtgttcatcctcttacggaggaagcggaggtacttc 590
           || || || ||||| || || || |||||||| | ||||||||| || |  | |||||||
Sbjct: 277 tgaataggtccgtgagaaggtttagtgttcatacgcttacggagaaacctcatgtacttc 218

                   
Query: 591 atcttctg 598
           ||||||||
Sbjct: 217 atcttctg 210



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 45/53 (84%)
 Strand = Plus / Minus

                                                                
Query: 261 tccttcctcttttcctccagctccctgatggtgtcggcgtagttccatccgac 313
           ||||| ||||| | |||||||||| |||||||||||  || |||||| |||||
Sbjct: 547 tcctttctcttgttctccagctccttgatggtgtcgtagtggttccacccgac 495



to top

>emb|BX824368.1|CNS0A5OL Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH43ZE05 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 800

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 105/128 (82%)
 Strand = Plus / Minus

                                                                       
Query: 471 gtcttgtgcggaatcataccgcggatggtgcgccagaggatcttggccggggcgcggaag 530
           |||||||| |||||||||||||| | ||| ||||||| ||||||||  || || ||||||
Sbjct: 331 gtcttgtgtggaatcataccgcgaacggtacgccagaagatcttggagggagcacggaag 272

                                                                       
Query: 531 tggatggggccgtgggatggcttggtgttcatcctcttacggaggaagcggaggtacttc 590
           || || || ||||| || || || |||||||| | ||||||||| || |  | |||||||
Sbjct: 271 tgaataggtccgtgagaaggtttagtgttcatacgcttacggagaaacctcatgtacttc 212

                   
Query: 591 atcttctg 598
           ||||||||
Sbjct: 211 atcttctg 204



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 45/53 (84%)
 Strand = Plus / Minus

                                                                
Query: 261 tccttcctcttttcctccagctccctgatggtgtcggcgtagttccatccgac 313
           ||||| ||||| | |||||||||| |||||||||||  || |||||| |||||
Sbjct: 541 tcctttctcttgttctccagctccttgatggtgtcgtagtggttccacccgac 489



to top

>emb|BX822519.1|CNS0A5UA Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB45ZA10 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 781

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 105/128 (82%)
 Strand = Plus / Minus

                                                                       
Query: 471 gtcttgtgcggaatcataccgcggatggtgcgccagaggatcttggccggggcgcggaag 530
           |||||||| |||||||||||||| | ||| ||||||| ||||||||  || || ||||||
Sbjct: 315 gtcttgtgtggaatcataccgcgaacggtacgccagaagatcttggagggagcacggaag 256

                                                                       
Query: 531 tggatggggccgtgggatggcttggtgttcatcctcttacggaggaagcggaggtacttc 590
           || || || ||||| || || || |||||||| | ||||||||| || |  | |||||||
Sbjct: 255 tgaataggtccgtgagaaggtttagtgttcatacgcttacggagaaacctcatgtacttc 196

                   
Query: 591 atcttctg 598
           ||||||||
Sbjct: 195 atcttctg 188



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 45/53 (84%)
 Strand = Plus / Minus

                                                                
Query: 261 tccttcctcttttcctccagctccctgatggtgtcggcgtagttccatccgac 313
           ||||| ||||| | |||||||||| |||||||||||  || |||||| |||||
Sbjct: 525 tcctttctcttgttctccagctccttgatggtgtcgtagtggttccacccgac 473



to top

>emb|BX822098.1|CNS0A5TD Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB12ZA04 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 660

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 105/128 (82%)
 Strand = Plus / Minus

                                                                       
Query: 471 gtcttgtgcggaatcataccgcggatggtgcgccagaggatcttggccggggcgcggaag 530
           |||||||| |||||||||||||| | ||| ||||||| ||||||||  || || ||||||
Sbjct: 205 gtcttgtgtggaatcataccgcgaacggtacgccagaagatcttggagggagcacggaag 146

                                                                       
Query: 531 tggatggggccgtgggatggcttggtgttcatcctcttacggaggaagcggaggtacttc 590
           || || || ||||| || || || |||||||| | ||||||||| || |  | |||||||
Sbjct: 145 tgaataggtccgtgagaaggtttagtgttcatacgcttacggagaaacctcatgtacttc 86

                   
Query: 591 atcttctg 598
           ||||||||
Sbjct: 85  atcttctg 78



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 45/53 (84%)
 Strand = Plus / Minus

                                                                
Query: 261 tccttcctcttttcctccagctccctgatggtgtcggcgtagttccatccgac 313
           ||||| ||||| | |||||||||| |||||||||||  || |||||| |||||
Sbjct: 415 tcctttctcttgttctccagctccttgatggtgtcgtagtggttccacccgac 363



to top

>gb|AF521144.1| Kandelia candel 60S ribosomal protein mRNA, partial cds
          Length = 236

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 78/93 (83%)
 Strand = Plus / Minus

                                                                       
Query: 506 gaggatcttggccggggcgcggaagtggatggggccgtgggatggcttggtgttcatcct 565
           |||||||||||  || |||||||| |||||||| ||||| || |||||||||||||| | 
Sbjct: 234 gaggatcttggagggagcgcggaaatggatgggtccgtgagaaggcttggtgttcatgcg 175

                                            
Query: 566 cttacggaggaagcggaggtacttcatcttctg 598
            || || ||||| |  |||||||||||||||||
Sbjct: 174 tttgcgaaggaacctcaggtacttcatcttctg 142



to top

>gb|AY498745.1| Capsicum annuum 60S ribosomal protein L13a (RpL13a) mRNA, complete
           cds
          Length = 797

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 95/115 (82%), Gaps = 1/115 (0%)
 Strand = Plus / Minus

                                                                       
Query: 182 cttctcctcggctgccttctcggccttgacgcggagcttcgccagctgctttctcctgtc 241
           |||||||||||| ||||| || ||||| || | ||| || ||||||||||||||||| ||
Sbjct: 644 cttctcctcggcagcctt-tcagccttaaccctgagtttggccagctgctttctcctctc 586

                                                                  
Query: 242 gtacgagaccttggccttctccttcctcttttcctccagctccctgatggtgtcg 296
            || | ||||| |||  ||||||| ||||| ||||| |||||| |||| ||||||
Sbjct: 585 ataagtgacctgggctctctcctttctcttgtcctcgagctccttgatagtgtcg 531



to top

>gb|DQ200397.1| Solanum tuberosum clone 070F10 60S ribosomal protein L13a-like
           protein mRNA, complete cds
          Length = 848

 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 93/114 (81%)
 Strand = Plus / Minus

                                                                       
Query: 182 cttctcctcggctgccttctcggccttgacgcggagcttcgccagctgctttctcctgtc 241
           ||||||||| || |||||||||||||| || | ||| || |||| |||||||||||| ||
Sbjct: 618 cttctcctcagcagccttctcggccttaaccctgagtttggccaactgctttctcctctc 559

                                                                 
Query: 242 gtacgagaccttggccttctccttcctcttttcctccagctccctgatggtgtc 295
           ||| |  |||| |||  ||||||| ||||| | ||| |||||| |||| |||||
Sbjct: 558 gtatgctacctgggctctctcctttctcttgttctcaagctccttgatagtgtc 505



 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 101/125 (80%)
 Strand = Plus / Minus

                                                                       
Query: 474 ttgtgcggaatcataccgcggatggtgcgccagaggatcttggccggggcgcggaagtgg 533
           ||||| |||||||| || |||||||| | |||||||||||| | ||| || |||||||| 
Sbjct: 326 ttgtggggaatcatcccacggatggtcctccagaggatctttgacggagcacggaagtga 267

                                                                       
Query: 534 atggggccgtgggatggcttggtgttcatcctcttacggaggaagcggaggtacttcatc 593
           || || || || || ||||| || ||||||||||| || ||||| |  || |||||||| 
Sbjct: 266 attggtccatgagaaggcttagtattcatcctcttgcgaaggaacctaagatacttcatt 207

                
Query: 594 ttctg 598
           |||||
Sbjct: 206 ttctg 202



to top

>emb|Y09971.1|CPRPL13A C.paradoxa mRNA for ribosomal protein L13a
          Length = 710

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 60/71 (84%)
 Strand = Plus / Minus

                                                                       
Query: 374 gagcgcgtcgggaatgaccatgcgcttggtcctgtcgtacggcggcggcacaccctcgta 433
           |||||| | ||| ||||||||||||||  || |||||||||| |||||||| |||||| |
Sbjct: 385 gagcgcctgggggatgaccatgcgcttcatcttgtcgtacgggggcggcacgccctcgaa 326

                      
Query: 434 cgccttgagcc 444
            ||||| ||||
Sbjct: 325 ggccttcagcc 315



to top

>ref|NM_124253.2| Arabidopsis thaliana structural constituent of ribosome AT5G48760
           mRNA, complete cds
          Length = 834

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 259 tctccttcctcttttcctccagctccctgatggtgtcg 296
           ||||||||||||||  |||||||||| |||||||||||
Sbjct: 538 tctccttcctctttgtctccagctccttgatggtgtcg 501



to top

>ref|XM_509965.1| PREDICTED: Pan troglodytes similar to ribosomal protein L13a; 60S
           ribosomal protein L13a; 23 kD highly basic protein
           (LOC452925), mRNA
          Length = 581

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 29/30 (96%)
 Strand = Plus / Minus

                                         
Query: 251 cttggccttctccttcctcttttcctccag 280
           ||||||||||||||||||||| ||||||||
Sbjct: 416 cttggccttctccttcctcttctcctccag 387



to top

>ref|XM_526928.1| PREDICTED: Pan troglodytes integrin alpha 2 (LOC471550), mRNA
          Length = 3000

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 29/30 (96%)
 Strand = Plus / Minus

                                          
Query: 251  cttggccttctccttcctcttttcctccag 280
            ||||||||||||||||||||| ||||||||
Sbjct: 2883 cttggccttctccttcctcttctcctccag 2854



to top

>ref|XM_514152.1| PREDICTED: Pan troglodytes similar to ribosomal protein L13a; 60S
           ribosomal protein L13a; 23 kD highly basic protein
           (LOC457684), mRNA
          Length = 663

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 29/30 (96%)
 Strand = Plus / Minus

                                         
Query: 251 cttggccttctccttcctcttttcctccag 280
           ||||||||||||||||||||| ||||||||
Sbjct: 495 cttggccttctccttcctcttctcctccag 466



to top

>gb|AC125807.9| Homo sapiens 12 BAC RP11-253E3 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 131995

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 29/30 (96%)
 Strand = Plus / Plus

                                           
Query: 251   cttggccttctccttcctcttttcctccag 280
             ||||||||||||||||||||| ||||||||
Sbjct: 81648 cttggccttctccttcctcttctcctccag 81677



to top

>gb|AY090359.1| Arabidopsis thaliana AT5g48760/K24G6_9 mRNA, complete cds
          Length = 677

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 259 tctccttcctcttttcctccagctccctgatggtgtcg 296
           ||||||||||||||  |||||||||| |||||||||||
Sbjct: 531 tctccttcctctttgtctccagctccttgatggtgtcg 494



to top

>gb|AC020750.4| Homo sapiens chromosome 3 clone RP11-105H19 map 3p, complete sequence
          Length = 156933

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 29/30 (96%)
 Strand = Plus / Minus

                                           
Query: 251   cttggccttctccttcctcttttcctccag 280
             ||||||||||||||||||||| ||||||||
Sbjct: 95042 cttggccttctccttcctcttctcctccag 95013



to top

>gb|AY088191.1| Arabidopsis thaliana clone 4275 mRNA, complete sequence
          Length = 814

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 259 tctccttcctcttttcctccagctccctgatggtgtcg 296
           ||||||||||||||  |||||||||| |||||||||||
Sbjct: 531 tctccttcctctttgtctccagctccttgatggtgtcg 494



to top

>gb|AY122902.1| Arabidopsis thaliana At5g48760/K24G6_9 mRNA, complete cds
          Length = 621

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 259 tctccttcctcttttcctccagctccctgatggtgtcg 296
           ||||||||||||||  |||||||||| |||||||||||
Sbjct: 502 tctccttcctctttgtctccagctccttgatggtgtcg 465



to top

>gb|AC083855.3| Homo sapiens chromosome 3 clone RP11-622I12 map 3p, complete sequence
          Length = 190861

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 29/30 (96%)
 Strand = Plus / Plus

                                            
Query: 251    cttggccttctccttcctcttttcctccag 280
              ||||||||||||||||||||| ||||||||
Sbjct: 188727 cttggccttctccttcctcttctcctccag 188756



to top

>gb|AC003072.1|AC003072 Human BAC clone CTA-963H5 from 22q12.1-qter, complete sequence
          Length = 39401

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 29/30 (96%)
 Strand = Plus / Plus

                                          
Query: 251  cttggccttctccttcctcttttcctccag 280
            ||||||||||||||||||||| ||||||||
Sbjct: 2080 cttggccttctccttcctcttctcctccag 2109



to top

>gb|U18488.1|STU18488 Salmo trutta transplantation antigen mRNA, partial cds
          Length = 621

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                        
Query: 251 cttggccttctccttcctcttttcctcca 279
           ||||||||||||||||||||| |||||||
Sbjct: 455 cttggccttctccttcctcttctcctcca 427



 Score = 44.1 bits (22), Expect = 0.53
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 552 ttggtgttcatcctcttacggaggaa 577
           |||||||||||||||||||| |||||
Sbjct: 154 ttggtgttcatcctcttacgcaggaa 129



to top

>dbj|AB049716.1| Pisum sativum ssa-6 mRNA for putative senescence-associated
           protein, complete cds
          Length = 918

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 49/57 (85%)
 Strand = Plus / Minus

                                                                    
Query: 260 ctccttcctcttttcctccagctccctgatggtgtcggcgtagttccatccgacctc 316
           |||||||||||| | ||||| |||| |||||||||||  ||| |||||||| |||||
Sbjct: 494 ctccttcctcttcttctccaactccttgatggtgtcgtagtaattccatcccacctc 438



to top

>gb|AC140724.4| Mus musculus chromosome 8, clone RP24-291N1, complete sequence
          Length = 159182

 Score = 48.1 bits (24), Expect = 0.034
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                     
Query: 55    taacacagagttaccaaactactt 78
             ||||||||||||||||||||||||
Sbjct: 85840 taacacagagttaccaaactactt 85817



to top

>gb|AC134323.3| Mus musculus BAC clone RP24-512P7 from chromosome 8, complete sequence
          Length = 176667

 Score = 48.1 bits (24), Expect = 0.034
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                      
Query: 55     taacacagagttaccaaactactt 78
              ||||||||||||||||||||||||
Sbjct: 144654 taacacagagttaccaaactactt 144677



to top

>gb|AF109186.1| Homo sapiens FWP004 mRNA, complete cds
          Length = 1247

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 50/59 (84%)
 Strand = Plus / Minus

                                                                      
Query: 519 ggggcgcggaagtggatggggccgtgggatggcttggtgttcatcctcttacggaggaa 577
           ||||| |||||||||  ||||||  |||| || ||||||||||||| ||| ||||||||
Sbjct: 815 ggggcccggaagtggtaggggcctcgggaagggttggtgttcatccgcttgcggaggaa 757



to top

>ref|XM_512821.1| PREDICTED: Pan troglodytes similar to ribosomal protein L13a; 60S
           ribosomal protein L13a; 23 kD highly basic protein
           (LOC456207), mRNA
          Length = 865

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 50/59 (84%)
 Strand = Plus / Minus

                                                                      
Query: 519 ggggcgcggaagtggatggggccgtgggatggcttggtgttcatcctcttacggaggaa 577
           ||||| |||||||||  ||||||  |||| || ||||||||||||| ||| ||||||||
Sbjct: 374 ggggcccggaagtggtaggggcctcgggaagggttggtgttcatccgcttgcggaggaa 316



to top

>ref|XM_511050.1| PREDICTED: Pan troglodytes similar to ribosomal protein L13a; 60S
           ribosomal protein L13a; 23 kD highly basic protein
           (LOC454185), mRNA
          Length = 689

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 50/59 (84%)
 Strand = Plus / Minus

                                                                      
Query: 519 ggggcgcggaagtggatggggccgtgggatggcttggtgttcatcctcttacggaggaa 577
           ||||| |||||||||  ||||||  |||| || ||||||||||||| ||| ||||||||
Sbjct: 250 ggggcccggaagtggtaggggcctcgggaagggttggtgttcatccgcttgcggaggaa 192



to top

>gb|AC156572.3| Mus musculus BAC clone RP23-216C6 from chromosome 13, complete sequence
          Length = 208578

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                     
Query: 256    ccttctccttcctcttttcctcc 278
              |||||||||||||||||||||||
Sbjct: 164552 ccttctccttcctcttttcctcc 164530



to top

>ref|XM_527683.1| PREDICTED: Pan troglodytes similar to ribosomal protein L13a; 60S
           ribosomal protein L13a; 23 kD highly basic protein
           (LOC472308), mRNA
          Length = 612

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 50/59 (84%)
 Strand = Plus / Minus

                                                                      
Query: 519 ggggcgcggaagtggatggggccgtgggatggcttggtgttcatcctcttacggaggaa 577
           ||||| |||||||||  ||||||  |||| || ||||||||||||| ||| ||||||||
Sbjct: 227 ggggcccggaagtggtaggggcctcgggaagggttggtgttcatccgcttgcggaggaa 169



to top

>ref|NM_012423.2| Homo sapiens ribosomal protein L13a (RPL13A), mRNA
          Length = 1142

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 50/59 (84%)
 Strand = Plus / Minus

                                                                      
Query: 519 ggggcgcggaagtggatggggccgtgggatggcttggtgttcatcctcttacggaggaa 577
           ||||| |||||||||  ||||||  |||| || ||||||||||||| ||| ||||||||
Sbjct: 249 ggggcccggaagtggtaggggcctcgggaagggttggtgttcatccgcttgcggaggaa 191



to top

>gb|BC070223.1| Homo sapiens ribosomal protein L13a, mRNA (cDNA clone MGC:88204
           IMAGE:6736442), complete cds
          Length = 1153

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 50/59 (84%)
 Strand = Plus / Minus

                                                                      
Query: 519 ggggcgcggaagtggatggggccgtgggatggcttggtgttcatcctcttacggaggaa 577
           ||||| |||||||||  ||||||  |||| || ||||||||||||| ||| ||||||||
Sbjct: 249 ggggcccggaagtggtaggggcctcgggaagggttggtgttcatccgcttgcggaggaa 191



to top

>gb|BC065236.1| Homo sapiens ribosomal protein L13a, mRNA (cDNA clone MGC:70840
           IMAGE:6161599), complete cds
          Length = 663

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 50/59 (84%)
 Strand = Plus / Minus

                                                                      
Query: 519 ggggcgcggaagtggatggggccgtgggatggcttggtgttcatcctcttacggaggaa 577
           ||||| |||||||||  ||||||  |||| || ||||||||||||| ||| ||||||||
Sbjct: 237 ggggcccggaagtggtaggggcctcgggaagggttggtgttcatccgcttgcggaggaa 179



to top

>gb|BC000514.2| Homo sapiens ribosomal protein L13a, mRNA (cDNA clone MGC:8547
           IMAGE:2822802), complete cds
          Length = 1125

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 50/59 (84%)
 Strand = Plus / Minus

                                                                      
Query: 519 ggggcgcggaagtggatggggccgtgggatggcttggtgttcatcctcttacggaggaa 577
           ||||| |||||||||  ||||||  |||| || ||||||||||||| ||| ||||||||
Sbjct: 232 ggggcccggaagtggtaggggcctcgggaagggttggtgttcatccgcttgcggaggaa 174



to top

>ref|XM_751980.1| Ustilago maydis 521 hypothetical protein (UM00926.1) partial mRNA
          Length = 615

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                          
Query: 468 gcggtcttgtgcggaatcataccgcggatgg 498
           ||||||||||| |||||||| ||||||||||
Sbjct: 287 gcggtcttgtggggaatcatgccgcggatgg 257



to top

>gb|BC013230.1| Homo sapiens ribosomal protein L13a, mRNA (cDNA clone
           IMAGE:3462928)
          Length = 658

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 50/59 (84%)
 Strand = Plus / Minus

                                                                      
Query: 519 ggggcgcggaagtggatggggccgtgggatggcttggtgttcatcctcttacggaggaa 577
           ||||| |||||||||  ||||||  |||| || ||||||||||||| ||| ||||||||
Sbjct: 225 ggggcccggaagtggtaggggcctcgggaagggttggtgttcatccgcttgcggaggaa 167



to top

>gb|BC004900.2| Homo sapiens ribosomal protein L13a, mRNA (cDNA clone
           IMAGE:3545758), partial cds
          Length = 1119

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 50/59 (84%)
 Strand = Plus / Minus

                                                                      
Query: 519 ggggcgcggaagtggatggggccgtgggatggcttggtgttcatcctcttacggaggaa 577
           ||||| |||||||||  ||||||  |||| || ||||||||||||| ||| ||||||||
Sbjct: 223 ggggcccggaagtggtaggggcctcgggaagggttggtgttcatccgcttgcggaggaa 165



to top

>gb|BC071921.1| Homo sapiens cDNA clone IMAGE:6423605, **** WARNING: chimeric clone
           ****
          Length = 1357

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 50/59 (84%)
 Strand = Plus / Minus

                                                                      
Query: 519 ggggcgcggaagtggatggggccgtgggatggcttggtgttcatcctcttacggaggaa 577
           ||||| |||||||||  ||||||  |||| || ||||||||||||| ||| ||||||||
Sbjct: 898 ggggcccggaagtggtaggggcctcgggaagggttggtgttcatccgcttgcggaggaa 840



to top

>gb|BC021568.1| Homo sapiens cDNA clone IMAGE:3343061, **** WARNING: chimeric clone
            ****
          Length = 2530

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 50/59 (84%)
 Strand = Plus / Minus

                                                                       
Query: 519  ggggcgcggaagtggatggggccgtgggatggcttggtgttcatcctcttacggaggaa 577
            ||||| |||||||||  ||||||  |||| || ||||||||||||| ||| ||||||||
Sbjct: 2103 ggggcccggaagtggtaggggcctcgggaagggttggtgttcatccgcttgcggaggaa 2045



to top

>emb|X56932.1|HS23KDHBP H.sapiens mRNA for 23 kD highly basic protein
          Length = 672

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 50/59 (84%)
 Strand = Plus / Minus

                                                                      
Query: 519 ggggcgcggaagtggatggggccgtgggatggcttggtgttcatcctcttacggaggaa 577
           ||||| |||||||||  ||||||  |||| || ||||||||||||| ||| ||||||||
Sbjct: 244 ggggcccggaagtggtaggggcctcgggaagggttggtgttcatccgcttgcggaggaa 186



to top

>emb|AJ388525.1|CFA388525 Canis familiaris mRNA for partial Ribosomal protein L13A (rpL13
           gene)
          Length = 427

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 544 gggatggcttggtgttcatcctcttacggaggaag 578
           ||||||| ||||||||||||| ||| |||||||||
Sbjct: 200 gggatgggttggtgttcatccgcttgcggaggaag 166



to top

>gb|AC068898.8| Homo sapiens chromosome 10 clone RP11-534L6, complete sequence
          Length = 176188

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                         
Query: 254    ggccttctccttcctcttttcctccag 280
              |||||||||||||||||| ||||||||
Sbjct: 137634 ggccttctccttcctcttctcctccag 137660



to top

>emb|CR624659.1| full-length cDNA clone CS0DI065YH07 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1626

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 50/59 (84%)
 Strand = Plus / Minus

                                                                      
Query: 519 ggggcgcggaagtggatggggccgtgggatggcttggtgttcatcctcttacggaggaa 577
           ||||| |||||||||  ||||||  |||| || ||||||||||||| ||| ||||||||
Sbjct: 701 ggggcccggaagtggtaggggcctcgggaagggttggtgttcatccgcttgcggaggaa 643



to top

>emb|CR625138.1| full-length cDNA clone CS0DI071YK05 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1078

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 50/59 (84%)
 Strand = Plus / Minus

                                                                      
Query: 519 ggggcgcggaagtggatggggccgtgggatggcttggtgttcatcctcttacggaggaa 577
           ||||| |||||||||  ||||||  |||| || ||||||||||||| ||| ||||||||
Sbjct: 215 ggggcccggaagtggtaggggcctcgggaagggttggtgttcatccgcttgcggaggaa 157



to top

>emb|CR623949.1| full-length cDNA clone CS0DE014YH06 of Placenta of Homo sapiens
           (human)
          Length = 1036

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 50/59 (84%)
 Strand = Plus / Minus

                                                                      
Query: 519 ggggcgcggaagtggatggggccgtgggatggcttggtgttcatcctcttacggaggaa 577
           ||||| |||||||||  ||||||  |||| || ||||||||||||| ||| ||||||||
Sbjct: 215 ggggcccggaagtggtaggggcctcgggaagggttggtgttcatccgcttgcggaggaa 157



to top

>emb|CR622930.1| full-length cDNA clone CS0DE004YD03 of Placenta of Homo sapiens
           (human)
          Length = 1093

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 50/59 (84%)
 Strand = Plus / Minus

                                                                      
Query: 519 ggggcgcggaagtggatggggccgtgggatggcttggtgttcatcctcttacggaggaa 577
           ||||| |||||||||  ||||||  |||| || ||||||||||||| ||| ||||||||
Sbjct: 215 ggggcccggaagtggtaggggcctcgggaagggttggtgttcatccgcttgcggaggaa 157



to top

>emb|CR622697.1| full-length cDNA clone CS0DL002YH12 of B cells (Ramos cell line)
           Cot 25-normalized of Homo sapiens (human)
          Length = 649

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 50/59 (84%)
 Strand = Plus / Minus

                                                                      
Query: 519 ggggcgcggaagtggatggggccgtgggatggcttggtgttcatcctcttacggaggaa 577
           ||||| |||||||||  ||||||  |||| || ||||||||||||| ||| ||||||||
Sbjct: 238 ggggcccggaagtggtaggggcctcgggaagggttggtgttcatccgcttgcggaggaa 180



to top

>emb|CR622347.1| full-length cDNA clone CS0DI069YJ19 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1084

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 50/59 (84%)
 Strand = Plus / Minus

                                                                      
Query: 519 ggggcgcggaagtggatggggccgtgggatggcttggtgttcatcctcttacggaggaa 577
           ||||| |||||||||  ||||||  |||| || ||||||||||||| ||| ||||||||
Sbjct: 215 ggggcccggaagtggtaggggcctcgggaagggttggtgttcatccgcttgcggaggaa 157



to top

>emb|CR622131.1| full-length cDNA clone CS0DI075YJ21 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1116

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 50/59 (84%)
 Strand = Plus / Minus

                                                                      
Query: 519 ggggcgcggaagtggatggggccgtgggatggcttggtgttcatcctcttacggaggaa 577
           ||||| |||||||||  ||||||  |||| || ||||||||||||| ||| ||||||||
Sbjct: 238 ggggcccggaagtggtaggggcctcgggaagggttggtgttcatccgcttgcggaggaa 180



to top

>emb|CR619845.1| full-length cDNA clone CS0DI058YC16 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1049

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 50/59 (84%)
 Strand = Plus / Minus

                                                                      
Query: 519 ggggcgcggaagtggatggggccgtgggatggcttggtgttcatcctcttacggaggaa 577
           ||||| |||||||||  ||||||  |||| || ||||||||||||| ||| ||||||||
Sbjct: 215 ggggcccggaagtggtaggggcctcgggaagggttggtgttcatccgcttgcggaggaa 157



to top

>emb|CR620187.1| full-length cDNA clone CS0DE001YC16 of Placenta of Homo sapiens
           (human)
          Length = 626

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 50/59 (84%)
 Strand = Plus / Minus

                                                                      
Query: 519 ggggcgcggaagtggatggggccgtgggatggcttggtgttcatcctcttacggaggaa 577
           ||||| |||||||||  ||||||  |||| || ||||||||||||| ||| ||||||||
Sbjct: 215 ggggcccggaagtggtaggggcctcgggaagggttggtgttcatccgcttgcggaggaa 157



to top

>emb|CR618372.1| full-length cDNA clone CS0DD008YF03 of Neuroblastoma Cot
           50-normalized of Homo sapiens (human)
          Length = 1093

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 50/59 (84%)
 Strand = Plus / Minus

                                                                      
Query: 519 ggggcgcggaagtggatggggccgtgggatggcttggtgttcatcctcttacggaggaa 577
           ||||| |||||||||  ||||||  |||| || ||||||||||||| ||| ||||||||
Sbjct: 215 ggggcccggaagtggtaggggcctcgggaagggttggtgttcatccgcttgcggaggaa 157



to top

>emb|CR618336.1| full-length cDNA clone CS0DC008YA18 of Neuroblastoma Cot
           25-normalized of Homo sapiens (human)
          Length = 1084

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 50/59 (84%)
 Strand = Plus / Minus

                                                                      
Query: 519 ggggcgcggaagtggatggggccgtgggatggcttggtgttcatcctcttacggaggaa 577
           ||||| |||||||||  ||||||  |||| || ||||||||||||| ||| ||||||||
Sbjct: 215 ggggcccggaagtggtaggggcctcgggaagggttggtgttcatccgcttgcggaggaa 157



to top

>emb|CR618182.1| full-length cDNA clone CS0DG002YE04 of B cells (Ramos cell line) of
           Homo sapiens (human)
          Length = 1093

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 50/59 (84%)
 Strand = Plus / Minus

                                                                      
Query: 519 ggggcgcggaagtggatggggccgtgggatggcttggtgttcatcctcttacggaggaa 577
           ||||| |||||||||  ||||||  |||| || ||||||||||||| ||| ||||||||
Sbjct: 215 ggggcccggaagtggtaggggcctcgggaagggttggtgttcatccgcttgcggaggaa 157



to top

>emb|CR616905.1| full-length cDNA clone CS0DI065YB06 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1093

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 50/59 (84%)
 Strand = Plus / Minus

                                                                      
Query: 519 ggggcgcggaagtggatggggccgtgggatggcttggtgttcatcctcttacggaggaa 577
           ||||| |||||||||  ||||||  |||| || ||||||||||||| ||| ||||||||
Sbjct: 215 ggggcccggaagtggtaggggcctcgggaagggttggtgttcatccgcttgcggaggaa 157



to top

>emb|CR615101.1| full-length cDNA clone CS0DI074YD18 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1099

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 50/59 (84%)
 Strand = Plus / Minus

                                                                      
Query: 519 ggggcgcggaagtggatggggccgtgggatggcttggtgttcatcctcttacggaggaa 577
           ||||| |||||||||  ||||||  |||| || ||||||||||||| ||| ||||||||
Sbjct: 215 ggggcccggaagtggtaggggcctcgggaagggttggtgttcatccgcttgcggaggaa 157



to top

>emb|CR613935.1| full-length cDNA clone CS0DJ010YF15 of T cells (Jurkat cell line)
           Cot 10-normalized of Homo sapiens (human)
          Length = 1093

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 50/59 (84%)
 Strand = Plus / Minus

                                                                      
Query: 519 ggggcgcggaagtggatggggccgtgggatggcttggtgttcatcctcttacggaggaa 577
           ||||| |||||||||  ||||||  |||| || ||||||||||||| ||| ||||||||
Sbjct: 215 ggggcccggaagtggtaggggcctcgggaagggttggtgttcatccgcttgcggaggaa 157



to top

>emb|CR612270.1| full-length cDNA clone CS0DI068YN06 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1048

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 50/59 (84%)
 Strand = Plus / Minus

                                                                      
Query: 519 ggggcgcggaagtggatggggccgtgggatggcttggtgttcatcctcttacggaggaa 577
           ||||| |||||||||  ||||||  |||| || ||||||||||||| ||| ||||||||
Sbjct: 215 ggggcccggaagtggtaggggcctcgggaagggttggtgttcatccgcttgcggaggaa 157



to top

>emb|CR613016.1| full-length cDNA clone CS0DI065YK06 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 626

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 50/59 (84%)
 Strand = Plus / Minus

                                                                      
Query: 519 ggggcgcggaagtggatggggccgtgggatggcttggtgttcatcctcttacggaggaa 577
           ||||| |||||||||  ||||||  |||| || ||||||||||||| ||| ||||||||
Sbjct: 215 ggggcccggaagtggtaggggcctcgggaagggttggtgttcatccgcttgcggaggaa 157



to top

>gb|AC035139.11| Homo sapiens chromosome 10 clone RP11-563N6, complete sequence
          Length = 210472

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                       
Query: 254  ggccttctccttcctcttttcctccag 280
            |||||||||||||||||| ||||||||
Sbjct: 1517 ggccttctccttcctcttctcctccag 1543



to top

>emb|CR607854.1| full-length cDNA clone CS0DI035YD15 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 649

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 50/59 (84%)
 Strand = Plus / Minus

                                                                      
Query: 519 ggggcgcggaagtggatggggccgtgggatggcttggtgttcatcctcttacggaggaa 577
           ||||| |||||||||  ||||||  |||| || ||||||||||||| ||| ||||||||
Sbjct: 238 ggggcccggaagtggtaggggcctcgggaagggttggtgttcatccgcttgcggaggaa 180



to top

>emb|CR607799.1| full-length cDNA clone CS0DI067YC06 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1093

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 50/59 (84%)
 Strand = Plus / Minus

                                                                      
Query: 519 ggggcgcggaagtggatggggccgtgggatggcttggtgttcatcctcttacggaggaa 577
           ||||| |||||||||  ||||||  |||| || ||||||||||||| ||| ||||||||
Sbjct: 215 ggggcccggaagtggtaggggcctcgggaagggttggtgttcatccgcttgcggaggaa 157



to top

>emb|CR608676.1| full-length cDNA clone CS0CAP006YO09 of Thymus of Homo sapiens
           (human)
          Length = 628

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 50/59 (84%)
 Strand = Plus / Minus

                                                                      
Query: 519 ggggcgcggaagtggatggggccgtgggatggcttggtgttcatcctcttacggaggaa 577
           ||||| |||||||||  ||||||  |||| || ||||||||||||| ||| ||||||||
Sbjct: 215 ggggcccggaagtggtaggggcctcgggaagggttggtgttcatccgcttgcggaggaa 157



to top

>emb|CR607407.1| full-length cDNA clone CS0DI008YJ20 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1088

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 50/59 (84%)
 Strand = Plus / Minus

                                                                      
Query: 519 ggggcgcggaagtggatggggccgtgggatggcttggtgttcatcctcttacggaggaa 577
           ||||| |||||||||  ||||||  |||| || ||||||||||||| ||| ||||||||
Sbjct: 215 ggggcccggaagtggtaggggcctcgggaagggttggtgttcatccgcttgcggaggaa 157



to top

>emb|CR607352.1| full-length cDNA clone CS0DF034YJ13 of Fetal brain of Homo sapiens
           (human)
          Length = 1088

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 50/59 (84%)
 Strand = Plus / Minus

                                                                      
Query: 519 ggggcgcggaagtggatggggccgtgggatggcttggtgttcatcctcttacggaggaa 577
           ||||| |||||||||  ||||||  |||| || ||||||||||||| ||| ||||||||
Sbjct: 215 ggggcccggaagtggtaggggcctcgggaagggttggtgttcatccgcttgcggaggaa 157



to top

>emb|CR606179.1| full-length cDNA clone CS0DM013YA03 of Fetal liver of Homo sapiens
           (human)
          Length = 626

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 50/59 (84%)
 Strand = Plus / Minus

                                                                      
Query: 519 ggggcgcggaagtggatggggccgtgggatggcttggtgttcatcctcttacggaggaa 577
           ||||| |||||||||  ||||||  |||| || ||||||||||||| ||| ||||||||
Sbjct: 215 ggggcccggaagtggtaggggcctcgggaagggttggtgttcatccgcttgcggaggaa 157



to top

>emb|CR603453.1| full-length cDNA clone CS0DB008YK16 of Neuroblastoma Cot
           10-normalized of Homo sapiens (human)
          Length = 1083

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 50/59 (84%)
 Strand = Plus / Minus

                                                                      
Query: 519 ggggcgcggaagtggatggggccgtgggatggcttggtgttcatcctcttacggaggaa 577
           ||||| |||||||||  ||||||  |||| || ||||||||||||| ||| ||||||||
Sbjct: 205 ggggcccggaagtggtaggggcctcgggaagggttggtgttcatccgcttgcggaggaa 147



to top

>emb|CR599383.1| full-length cDNA clone CS0DM006YN06 of Fetal liver of Homo sapiens
           (human)
          Length = 1093

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 50/59 (84%)
 Strand = Plus / Minus

                                                                      
Query: 519 ggggcgcggaagtggatggggccgtgggatggcttggtgttcatcctcttacggaggaa 577
           ||||| |||||||||  ||||||  |||| || ||||||||||||| ||| ||||||||
Sbjct: 215 ggggcccggaagtggtaggggcctcgggaagggttggtgttcatccgcttgcggaggaa 157



to top

>dbj|AK056837.1| Homo sapiens cDNA FLJ32275 fis, clone PROST2000053, moderately
           similar to 60S RIBOSOMAL PROTEIN L13A
          Length = 2315

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 50/59 (84%)
 Strand = Plus / Minus

                                                                      
Query: 519 ggggcgcggaagtggatggggccgtgggatggcttggtgttcatcctcttacggaggaa 577
           ||||| |||||||||  ||||||  |||| || ||||||||||||| ||| ||||||||
Sbjct: 735 ggggcccggaagtggtaggggcctcgggaagggttggtgttcatccgcttgcggaggaa 677



to top

>emb|CR596607.1| full-length cDNA clone CS0DI029YH03 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1091

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 50/59 (84%)
 Strand = Plus / Minus

                                                                      
Query: 519 ggggcgcggaagtggatggggccgtgggatggcttggtgttcatcctcttacggaggaa 577
           ||||| |||||||||  ||||||  |||| || ||||||||||||| ||| ||||||||
Sbjct: 213 ggggcccggaagtggtaggggcctcgggaagggttggtgttcatccgcttgcggaggaa 155



to top

>emb|CR595200.1| full-length cDNA clone CS0DI035YJ24 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 626

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 50/59 (84%)
 Strand = Plus / Minus

                                                                      
Query: 519 ggggcgcggaagtggatggggccgtgggatggcttggtgttcatcctcttacggaggaa 577
           ||||| |||||||||  ||||||  |||| || ||||||||||||| ||| ||||||||
Sbjct: 215 ggggcccggaagtggtaggggcctcgggaagggttggtgttcatccgcttgcggaggaa 157



to top

>gb|AC010619.7| Homo sapiens chromosome 19 clone CTD-3148I10, complete sequence
          Length = 179394

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 50/59 (84%)
 Strand = Plus / Minus

                                                                        
Query: 519   ggggcgcggaagtggatggggccgtgggatggcttggtgttcatcctcttacggaggaa 577
             ||||| |||||||||  ||||||  |||| || ||||||||||||| ||| ||||||||
Sbjct: 77718 ggggcccggaagtggtaggggcctcgggaagggttggtgttcatccgcttgcggaggaa 77660



to top

>emb|CR592554.1| full-length cDNA clone CS0DC029YN07 of Neuroblastoma Cot
           25-normalized of Homo sapiens (human)
          Length = 1093

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 50/59 (84%)
 Strand = Plus / Minus

                                                                      
Query: 519 ggggcgcggaagtggatggggccgtgggatggcttggtgttcatcctcttacggaggaa 577
           ||||| |||||||||  ||||||  |||| || ||||||||||||| ||| ||||||||
Sbjct: 215 ggggcccggaagtggtaggggcctcgggaagggttggtgttcatccgcttgcggaggaa 157



to top

>emb|CR591518.1| full-length cDNA clone CS0DB008YJ02 of Neuroblastoma Cot
           10-normalized of Homo sapiens (human)
          Length = 1069

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 50/59 (84%)
 Strand = Plus / Minus

                                                                      
Query: 519 ggggcgcggaagtggatggggccgtgggatggcttggtgttcatcctcttacggaggaa 577
           ||||| |||||||||  ||||||  |||| || ||||||||||||| ||| ||||||||
Sbjct: 215 ggggcccggaagtggtaggggcctcgggaagggttggtgttcatccgcttgcggaggaa 157



to top

>emb|CR591301.1| full-length cDNA clone CS0DL008YK19 of B cells (Ramos cell line)
           Cot 25-normalized of Homo sapiens (human)
          Length = 1093

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 50/59 (84%)
 Strand = Plus / Minus

                                                                      
Query: 519 ggggcgcggaagtggatggggccgtgggatggcttggtgttcatcctcttacggaggaa 577
           ||||| |||||||||  ||||||  |||| || ||||||||||||| ||| ||||||||
Sbjct: 215 ggggcccggaagtggtaggggcctcgggaagggttggtgttcatccgcttgcggaggaa 157



to top

>gb|AC022533.10| Homo sapiens chromosome 10 clone RP11-230D19, complete sequence
          Length = 174569

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                         
Query: 254    ggccttctccttcctcttttcctccag 280
              |||||||||||||||||| ||||||||
Sbjct: 136041 ggccttctccttcctcttctcctccag 136015



to top

>gb|AC012346.9|AC012346 Homo sapiens chromosome , clone RP11-15N22, complete sequence
          Length = 164470

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                        
Query: 342   tacctgtgcccaggctgcagcctcaga 368
             |||||||||||||||||||| ||||||
Sbjct: 12064 tacctgtgcccaggctgcagtctcaga 12090



to top

>gb|AC025519.10|AC025519 Homo sapiens, clone RP11-484J3, complete sequence
          Length = 171464

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                        
Query: 342   tacctgtgcccaggctgcagcctcaga 368
             |||||||||||||||||||| ||||||
Sbjct: 14412 tacctgtgcccaggctgcagtctcaga 14386



to top

>dbj|AK222747.1| Homo sapiens mRNA for ribosomal protein L13a variant, clone:
           DMC05308
          Length = 630

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 50/59 (84%)
 Strand = Plus / Minus

                                                                      
Query: 519 ggggcgcggaagtggatggggccgtgggatggcttggtgttcatcctcttacggaggaa 577
           ||||| |||||||||  ||||||  |||| || ||||||||||||| ||| ||||||||
Sbjct: 229 ggggcccggaagtggtaggggcctcgggaagggttggtgttcatccgcttgcggaggaa 171



to top

>dbj|AK130605.1| Homo sapiens cDNA FLJ27095 fis, clone SPL04438, highly similar to
           60S ribosomal protein L13A
          Length = 1125

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 50/59 (84%)
 Strand = Plus / Minus

                                                                      
Query: 519 ggggcgcggaagtggatggggccgtgggatggcttggtgttcatcctcttacggaggaa 577
           ||||| |||||||||  ||||||  |||| || ||||||||||||| ||| ||||||||
Sbjct: 250 ggggcccggaagtggtaggggcctcgggaagggttggtgttcatccgcttgcggaggaa 192



to top

>gb|BC062537.1| Homo sapiens ribosomal protein L13a, mRNA (cDNA clone MGC:71249
           IMAGE:4908022), complete cds
          Length = 1122

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 50/59 (84%)
 Strand = Plus / Minus

                                                                      
Query: 519 ggggcgcggaagtggatggggccgtgggatggcttggtgttcatcctcttacggaggaa 577
           ||||| |||||||||  ||||||  |||| || ||||||||||||| ||| ||||||||
Sbjct: 229 ggggcccggaagtggtaggggcctcgggaagggttggtgttcatccgcttgcggaggaa 171



to top

>gb|BC071929.1| Homo sapiens ribosomal protein L13a, mRNA (cDNA clone MGC:88614
           IMAGE:5808487), complete cds
          Length = 1126

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 50/59 (84%)
 Strand = Plus / Minus

                                                                      
Query: 519 ggggcgcggaagtggatggggccgtgggatggcttggtgttcatcctcttacggaggaa 577
           ||||| |||||||||  ||||||  |||| || ||||||||||||| ||| ||||||||
Sbjct: 233 ggggcccggaagtggtaggggcctcgggaagggttggtgttcatccgcttgcggaggaa 175



to top

>gb|AC161811.6| Mus musculus chromosome 5, clone RP23-456E9, complete sequence
          Length = 163565

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 256  ccttctccttcctcttttcctcc 278
            |||||||||||||||||||||||
Sbjct: 6106 ccttctccttcctcttttcctcc 6084



to top

>dbj|AB082924.1| Homo sapiens RPL13a mRNA for ribosomal protein L13a, complete cds
          Length = 974

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 50/59 (84%)
 Strand = Plus / Minus

                                                                      
Query: 519 ggggcgcggaagtggatggggccgtgggatggcttggtgttcatcctcttacggaggaa 577
           ||||| |||||||||  ||||||  |||| || ||||||||||||| ||| ||||||||
Sbjct: 82  ggggcccggaagtggtaggggcctcgggaagggttggtgttcatccgcttgcggaggaa 24



to top

>emb|CT030185.11| Mouse DNA sequence from clone RP23-204L16 on chromosome 13, complete
             sequence
          Length = 116416

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 256   ccttctccttcctcttttcctcc 278
             |||||||||||||||||||||||
Sbjct: 67988 ccttctccttcctcttttcctcc 68010



to top

>gb|BC032107.2| Homo sapiens ribosomal protein L13a, mRNA (cDNA clone
           IMAGE:4644246)
          Length = 1139

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 50/59 (84%)
 Strand = Plus / Minus

                                                                      
Query: 519 ggggcgcggaagtggatggggccgtgggatggcttggtgttcatcctcttacggaggaa 577
           ||||| |||||||||  ||||||  |||| || ||||||||||||| ||| ||||||||
Sbjct: 238 ggggcccggaagtggtaggggcctcgggaagggttggtgttcatccgcttgcggaggaa 180



to top

>gb|AC138365.16| Mus musculus chromosome 5, clone RP23-262B5, complete sequence
          Length = 172631

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 256    ccttctccttcctcttttcctcc 278
              |||||||||||||||||||||||
Sbjct: 122336 ccttctccttcctcttttcctcc 122358



to top

>gb|BC001836.2| Homo sapiens ribosomal protein L13a, mRNA (cDNA clone MGC:4241
           IMAGE:2961667), complete cds
          Length = 694

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 50/59 (84%)
 Strand = Plus / Minus

                                                                      
Query: 519 ggggcgcggaagtggatggggccgtgggatggcttggtgttcatcctcttacggaggaa 577
           ||||| |||||||||  ||||||  |||| || ||||||||||||| ||| ||||||||
Sbjct: 230 ggggcccggaagtggtaggggcctcgggaagggttggtgttcatccgcttgcggaggaa 172



to top

>gb|BC001675.2| Homo sapiens ribosomal protein L13a, mRNA (cDNA clone MGC:2546
           IMAGE:2961667), complete cds
          Length = 694

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 50/59 (84%)
 Strand = Plus / Minus

                                                                      
Query: 519 ggggcgcggaagtggatggggccgtgggatggcttggtgttcatcctcttacggaggaa 577
           ||||| |||||||||  ||||||  |||| || ||||||||||||| ||| ||||||||
Sbjct: 230 ggggcccggaagtggtaggggcctcgggaagggttggtgttcatccgcttgcggaggaa 172



to top

>dbj|AB028893.1| Homo sapiens RPL13A, U32, U33, U34, U35, RPS11, U35 genes for
            ribosomal protein L13a and S11, U32, U33, U34, U35, and
            U35 snoRNA, complete cds and sequence
          Length = 13208

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 50/59 (84%)
 Strand = Plus / Minus

                                                                       
Query: 519  ggggcgcggaagtggatggggccgtgggatggcttggtgttcatcctcttacggaggaa 577
            ||||| |||||||||  ||||||  |||| || ||||||||||||| ||| ||||||||
Sbjct: 3727 ggggcccggaagtggtaggggcctcgggaagggttggtgttcatccgcttgcggaggaa 3669



to top

>ref|XM_520729.1| PREDICTED: Pan troglodytes similar to ribosomal protein L13a; 60S
           ribosomal protein L13a; 23 kD highly basic protein
           (LOC465277), mRNA
          Length = 662

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 251 cttggccttctccttcctcttttcctccag 280
           |||||| |||||||||||||| ||||||||
Sbjct: 514 cttggctttctccttcctcttctcctccag 485



to top

>ref|XM_508935.1| PREDICTED: Pan troglodytes similar to ribosomal protein L13a; 60S
           ribosomal protein L13a; 23 kD highly basic protein
           (LOC451757), mRNA
          Length = 690

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 251 cttggccttctccttcctcttttcctccag 280
           ||||||||||||||| ||||| ||||||||
Sbjct: 423 cttggccttctcctttctcttctcctccag 394



to top

>gb|DQ216006.1| Taeniopygia guttata clone 0061P0024G09 ribosomal protein L13A-like
           mRNA, complete sequence
          Length = 786

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 251 cttggccttctccttcctcttttcctccag 280
           ||||||||||||||||| ||| ||||||||
Sbjct: 499 cttggccttctccttccgcttctcctccag 470



to top

>gb|DQ216003.1| Taeniopygia guttata clone 0058P0045E08 ribosomal protein L13A-like
           mRNA, complete sequence
          Length = 801

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 251 cttggccttctccttcctcttttcctccag 280
           ||||||||||||||||| ||| ||||||||
Sbjct: 528 cttggccttctccttccgcttctcctccag 499



to top

>gb|DQ216001.1| Taeniopygia guttata clone 0058P0049C02 ribosomal protein L13A-like
           mRNA, complete sequence
          Length = 801

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 251 cttggccttctccttcctcttttcctccag 280
           ||||||||||||||||| ||| ||||||||
Sbjct: 528 cttggccttctccttccgcttctcctccag 499



to top

>ref|XM_526130.1| PREDICTED: Pan troglodytes similar to APG7 autophagy 7-like;
           ubiquitin activating enzyme E1-like protein (LOC470747),
           mRNA
          Length = 2091

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                         
Query: 251 cttggccttctccttcctcttttcctccag 280
           |||||||||||| |||||||| ||||||||
Sbjct: 169 cttggccttctcattcctcttctcctccag 198



to top

>gb|AC167134.5| Mus musculus chromosome 1, clone RP23-59E7, complete sequence
          Length = 140039

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 256   ccttctccttcctcttttcctc 277
             ||||||||||||||||||||||
Sbjct: 36545 ccttctccttcctcttttcctc 36566



to top

>ref|XM_533620.2| PREDICTED: Canis familiaris Ribosomal protein L13a (RPL13A), mRNA
          Length = 525

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 251 cttggccttctccttcctcttttcctccag 280
           ||||||||||| ||||||||| ||||||||
Sbjct: 372 cttggccttcttcttcctcttctcctccag 343



to top

>gb|AC012395.5|ATAC012395 Arabidopsis thaliana chromosome III BAC T1B9 genomic sequence, complete
             sequence
          Length = 99128

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 79/98 (80%)
 Strand = Plus / Plus

                                                                         
Query: 501   cgccagaggatcttggccggggcgcggaagtggatggggccgtgggatggcttggtgttc 560
             ||||||| ||||||||  || || |||||||| || || ||||| || || || ||||||
Sbjct: 82432 cgccagaagatcttggagggagcacggaagtgaataggtccgtgagaaggtttagtgttc 82491

                                                   
Query: 561   atcctcttacggaggaagcggaggtacttcatcttctg 598
             || | ||||||||| || |  | |||||||||||||||
Sbjct: 82492 atacgcttacggagaaacctcatgtacttcatcttctg 82529



to top

>emb|CR721854.2|CNS0GJXG Tetraodon nigroviridis full-length cDNA
          Length = 298

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 552 ttggtgttcatcctcttacggaggaa 577
           |||||||||||||||||||| |||||
Sbjct: 40  ttggtgttcatcctcttacgcaggaa 15



to top

>emb|CR734531.2|CNS0GTJM Tetraodon nigroviridis full-length cDNA
          Length = 298

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 552 ttggtgttcatcctcttacggaggaa 577
           |||||||||||||||||||| |||||
Sbjct: 40  ttggtgttcatcctcttacgcaggaa 15



to top

>emb|CR734420.2|CNS0GTGJ Tetraodon nigroviridis full-length cDNA
          Length = 298

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 552 ttggtgttcatcctcttacggaggaa 577
           |||||||||||||||||||| |||||
Sbjct: 40  ttggtgttcatcctcttacgcaggaa 15



to top

>emb|CR733634.2|CNS0GSUP Tetraodon nigroviridis full-length cDNA
          Length = 298

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 552 ttggtgttcatcctcttacggaggaa 577
           |||||||||||||||||||| |||||
Sbjct: 40  ttggtgttcatcctcttacgcaggaa 15



to top

>emb|CR733589.2|CNS0GSTG Tetraodon nigroviridis full-length cDNA
          Length = 298

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 552 ttggtgttcatcctcttacggaggaa 577
           |||||||||||||||||||| |||||
Sbjct: 40  ttggtgttcatcctcttacgcaggaa 15



to top

>emb|CR733845.2|CNS0GT0K Tetraodon nigroviridis full-length cDNA
          Length = 298

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 552 ttggtgttcatcctcttacggaggaa 577
           |||||||||||||||||||| |||||
Sbjct: 40  ttggtgttcatcctcttacgcaggaa 15



to top

>emb|CR731687.2|CNS0GRIK Tetraodon nigroviridis full-length cDNA
          Length = 298

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 552 ttggtgttcatcctcttacggaggaa 577
           |||||||||||||||||||| |||||
Sbjct: 40  ttggtgttcatcctcttacgcaggaa 15



to top

>gb|BC043976.1| Xenopus laevis ribosomal protein L13a, mRNA (cDNA clone MGC:54018
           IMAGE:5571546), complete cds
          Length = 819

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 251 cttggccttctccttcctcttttcctccag 280
           ||||||||||||||| ||||| ||||||||
Sbjct: 584 cttggccttctcctttctcttctcctccag 555



to top

>emb|CR720193.2|CNS0GINB Tetraodon nigroviridis full-length cDNA
          Length = 298

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 552 ttggtgttcatcctcttacggaggaa 577
           |||||||||||||||||||| |||||
Sbjct: 40  ttggtgttcatcctcttacgcaggaa 15



to top

>emb|CR720089.2|CNS0GIKF Tetraodon nigroviridis full-length cDNA
          Length = 298

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 552 ttggtgttcatcctcttacggaggaa 577
           |||||||||||||||||||| |||||
Sbjct: 40  ttggtgttcatcctcttacgcaggaa 15



to top

>emb|CR723864.2|CNS0GLHA Tetraodon nigroviridis full-length cDNA
          Length = 298

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 552 ttggtgttcatcctcttacggaggaa 577
           |||||||||||||||||||| |||||
Sbjct: 40  ttggtgttcatcctcttacgcaggaa 15



to top

>emb|CR723621.2|CNS0GLAJ Tetraodon nigroviridis full-length cDNA
          Length = 917

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 552 ttggtgttcatcctcttacggaggaa 577
           |||||||||||||||||||| |||||
Sbjct: 40  ttggtgttcatcctcttacgcaggaa 15



to top

>emb|CR723218.2|CNS0GKZC Tetraodon nigroviridis full-length cDNA
          Length = 298

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 552 ttggtgttcatcctcttacggaggaa 577
           |||||||||||||||||||| |||||
Sbjct: 40  ttggtgttcatcctcttacgcaggaa 15



to top

>emb|CR722644.2|CNS0GKJE Tetraodon nigroviridis full-length cDNA
          Length = 298

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 552 ttggtgttcatcctcttacggaggaa 577
           |||||||||||||||||||| |||||
Sbjct: 40  ttggtgttcatcctcttacgcaggaa 15



to top

>emb|CR722480.2|CNS0GKEU Tetraodon nigroviridis full-length cDNA
          Length = 715

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 552 ttggtgttcatcctcttacggaggaa 577
           |||||||||||||||||||| |||||
Sbjct: 40  ttggtgttcatcctcttacgcaggaa 15



to top

>emb|CR721533.2|CNS0GJOJ Tetraodon nigroviridis full-length cDNA
          Length = 298

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 552 ttggtgttcatcctcttacggaggaa 577
           |||||||||||||||||||| |||||
Sbjct: 40  ttggtgttcatcctcttacgcaggaa 15



to top

>emb|CR721501.2|CNS0GJNN Tetraodon nigroviridis full-length cDNA
          Length = 299

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 552 ttggtgttcatcctcttacggaggaa 577
           |||||||||||||||||||| |||||
Sbjct: 40  ttggtgttcatcctcttacgcaggaa 15



to top

>emb|CR721288.2|CNS0GJHQ Tetraodon nigroviridis full-length cDNA
          Length = 298

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 552 ttggtgttcatcctcttacggaggaa 577
           |||||||||||||||||||| |||||
Sbjct: 40  ttggtgttcatcctcttacgcaggaa 15



to top

>emb|CR720827.2|CNS0GJ4X Tetraodon nigroviridis full-length cDNA
          Length = 298

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 552 ttggtgttcatcctcttacggaggaa 577
           |||||||||||||||||||| |||||
Sbjct: 40  ttggtgttcatcctcttacgcaggaa 15



to top

>emb|CR720439.2|CNS0GIU5 Tetraodon nigroviridis full-length cDNA
          Length = 298

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 552 ttggtgttcatcctcttacggaggaa 577
           |||||||||||||||||||| |||||
Sbjct: 40  ttggtgttcatcctcttacgcaggaa 15



to top

>emb|CR719991.2|CNS0GIHP Tetraodon nigroviridis full-length cDNA
          Length = 298

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 552 ttggtgttcatcctcttacggaggaa 577
           |||||||||||||||||||| |||||
Sbjct: 40  ttggtgttcatcctcttacgcaggaa 15



to top

>emb|CR719238.2|CNS0GHWS Tetraodon nigroviridis full-length cDNA
          Length = 719

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 552 ttggtgttcatcctcttacggaggaa 577
           |||||||||||||||||||| |||||
Sbjct: 40  ttggtgttcatcctcttacgcaggaa 15



to top

>emb|CR718042.2|CNS0GGZK Tetraodon nigroviridis full-length cDNA
          Length = 298

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 552 ttggtgttcatcctcttacggaggaa 577
           |||||||||||||||||||| |||||
Sbjct: 40  ttggtgttcatcctcttacgcaggaa 15



to top

>emb|CR717997.2|CNS0GGYB Tetraodon nigroviridis full-length cDNA
          Length = 890

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 552 ttggtgttcatcctcttacggaggaa 577
           |||||||||||||||||||| |||||
Sbjct: 40  ttggtgttcatcctcttacgcaggaa 15



to top

>emb|CR717797.2|CNS0GGSR Tetraodon nigroviridis full-length cDNA
          Length = 232

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 552 ttggtgttcatcctcttacggaggaa 577
           |||||||||||||||||||| |||||
Sbjct: 40  ttggtgttcatcctcttacgcaggaa 15



to top

>emb|CR716489.2|CNS0GFSI Tetraodon nigroviridis full-length cDNA
          Length = 292

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 552 ttggtgttcatcctcttacggaggaa 577
           |||||||||||||||||||| |||||
Sbjct: 34  ttggtgttcatcctcttacgcaggaa 9



to top

>emb|CR715865.2|CNS0GFB9 Tetraodon nigroviridis full-length cDNA
          Length = 232

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 552 ttggtgttcatcctcttacggaggaa 577
           |||||||||||||||||||| |||||
Sbjct: 40  ttggtgttcatcctcttacgcaggaa 15



to top

>emb|CR715675.2|CNS0GF5Z Tetraodon nigroviridis full-length cDNA
          Length = 298

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 552 ttggtgttcatcctcttacggaggaa 577
           |||||||||||||||||||| |||||
Sbjct: 40  ttggtgttcatcctcttacgcaggaa 15



to top

>emb|CR715331.2|CNS0GEWF Tetraodon nigroviridis full-length cDNA
          Length = 298

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 552 ttggtgttcatcctcttacggaggaa 577
           |||||||||||||||||||| |||||
Sbjct: 40  ttggtgttcatcctcttacgcaggaa 15



to top

>emb|CR715244.2|CNS0GEU0 Tetraodon nigroviridis full-length cDNA
          Length = 298

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 552 ttggtgttcatcctcttacggaggaa 577
           |||||||||||||||||||| |||||
Sbjct: 40  ttggtgttcatcctcttacgcaggaa 15



to top

>emb|CR715237.2|CNS0GETT Tetraodon nigroviridis full-length cDNA
          Length = 298

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 552 ttggtgttcatcctcttacggaggaa 577
           |||||||||||||||||||| |||||
Sbjct: 40  ttggtgttcatcctcttacgcaggaa 15



to top

>emb|CR712946.2|CNS0GD26 Tetraodon nigroviridis full-length cDNA
          Length = 892

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 552 ttggtgttcatcctcttacggaggaa 577
           |||||||||||||||||||| |||||
Sbjct: 40  ttggtgttcatcctcttacgcaggaa 15



to top

>emb|CR711952.2|CNS0GCAK Tetraodon nigroviridis full-length cDNA
          Length = 298

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 552 ttggtgttcatcctcttacggaggaa 577
           |||||||||||||||||||| |||||
Sbjct: 40  ttggtgttcatcctcttacgcaggaa 15



to top

>emb|CR711062.2|CNS0GBLU Tetraodon nigroviridis full-length cDNA
          Length = 298

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 552 ttggtgttcatcctcttacggaggaa 577
           |||||||||||||||||||| |||||
Sbjct: 40  ttggtgttcatcctcttacgcaggaa 15



to top

>emb|CR710952.2|CNS0GBIS Tetraodon nigroviridis full-length cDNA
          Length = 298

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 552 ttggtgttcatcctcttacggaggaa 577
           |||||||||||||||||||| |||||
Sbjct: 40  ttggtgttcatcctcttacgcaggaa 15



to top

>emb|CR708821.2|CNS0G9VL Tetraodon nigroviridis full-length cDNA
          Length = 298

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 552 ttggtgttcatcctcttacggaggaa 577
           |||||||||||||||||||| |||||
Sbjct: 40  ttggtgttcatcctcttacgcaggaa 15



to top

>emb|CR708798.2|CNS0G9UY Tetraodon nigroviridis full-length cDNA
          Length = 298

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 552 ttggtgttcatcctcttacggaggaa 577
           |||||||||||||||||||| |||||
Sbjct: 40  ttggtgttcatcctcttacgcaggaa 15



to top

>emb|CR707968.2|CNS0G97W Tetraodon nigroviridis full-length cDNA
          Length = 298

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 552 ttggtgttcatcctcttacggaggaa 577
           |||||||||||||||||||| |||||
Sbjct: 40  ttggtgttcatcctcttacgcaggaa 15



to top

>emb|CR707793.2|CNS0G931 Tetraodon nigroviridis full-length cDNA
          Length = 298

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 552 ttggtgttcatcctcttacggaggaa 577
           |||||||||||||||||||| |||||
Sbjct: 40  ttggtgttcatcctcttacgcaggaa 15



to top

>emb|CR706714.2|CNS0G892 Tetraodon nigroviridis full-length cDNA
          Length = 894

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 552 ttggtgttcatcctcttacggaggaa 577
           |||||||||||||||||||| |||||
Sbjct: 40  ttggtgttcatcctcttacgcaggaa 15



to top

>emb|CR706088.2|CNS0G7RO Tetraodon nigroviridis full-length cDNA
          Length = 298

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 552 ttggtgttcatcctcttacggaggaa 577
           |||||||||||||||||||| |||||
Sbjct: 40  ttggtgttcatcctcttacgcaggaa 15



to top

>emb|CR705737.2|CNS0G7HX Tetraodon nigroviridis full-length cDNA
          Length = 298

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 552 ttggtgttcatcctcttacggaggaa 577
           |||||||||||||||||||| |||||
Sbjct: 40  ttggtgttcatcctcttacgcaggaa 15



to top

>emb|CR704066.2|CNS0G67I Tetraodon nigroviridis full-length cDNA
          Length = 298

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 552 ttggtgttcatcctcttacggaggaa 577
           |||||||||||||||||||| |||||
Sbjct: 40  ttggtgttcatcctcttacgcaggaa 15



to top

>emb|CR703887.2|CNS0G62J Tetraodon nigroviridis full-length cDNA
          Length = 298

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 552 ttggtgttcatcctcttacggaggaa 577
           |||||||||||||||||||| |||||
Sbjct: 40  ttggtgttcatcctcttacgcaggaa 15



to top

>emb|CR691280.2|CNS0FWCC Tetraodon nigroviridis full-length cDNA
          Length = 298

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 552 ttggtgttcatcctcttacggaggaa 577
           |||||||||||||||||||| |||||
Sbjct: 40  ttggtgttcatcctcttacgcaggaa 15



to top

>emb|CR698886.2|CNS0G27M Tetraodon nigroviridis full-length cDNA
          Length = 298

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 552 ttggtgttcatcctcttacggaggaa 577
           |||||||||||||||||||| |||||
Sbjct: 40  ttggtgttcatcctcttacgcaggaa 15



to top

>emb|CR697448.2|CNS0G13O Tetraodon nigroviridis full-length cDNA
          Length = 715

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 552 ttggtgttcatcctcttacggaggaa 577
           |||||||||||||||||||| |||||
Sbjct: 40  ttggtgttcatcctcttacgcaggaa 15



to top

>emb|CR691171.2|CNS0FW9B Tetraodon nigroviridis full-length cDNA
          Length = 298

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 552 ttggtgttcatcctcttacggaggaa 577
           |||||||||||||||||||| |||||
Sbjct: 40  ttggtgttcatcctcttacgcaggaa 15



to top

>emb|CR685825.2|CNS0FS4T Tetraodon nigroviridis full-length cDNA
          Length = 298

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 552 ttggtgttcatcctcttacggaggaa 577
           |||||||||||||||||||| |||||
Sbjct: 40  ttggtgttcatcctcttacgcaggaa 15



to top

>emb|CR690814.2|CNS0FVZE Tetraodon nigroviridis full-length cDNA
          Length = 903

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 552 ttggtgttcatcctcttacggaggaa 577
           |||||||||||||||||||| |||||
Sbjct: 40  ttggtgttcatcctcttacgcaggaa 15



to top

>emb|CR689971.2|CNS0FVBZ Tetraodon nigroviridis full-length cDNA
          Length = 914

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 552 ttggtgttcatcctcttacggaggaa 577
           |||||||||||||||||||| |||||
Sbjct: 40  ttggtgttcatcctcttacgcaggaa 15



to top

>emb|CR689406.2|CNS0FUWA Tetraodon nigroviridis full-length cDNA
          Length = 884

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 552 ttggtgttcatcctcttacggaggaa 577
           |||||||||||||||||||| |||||
Sbjct: 40  ttggtgttcatcctcttacgcaggaa 15



to top

>emb|CR687735.2|CNS0FTLV Tetraodon nigroviridis full-length cDNA
          Length = 298

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 552 ttggtgttcatcctcttacggaggaa 577
           |||||||||||||||||||| |||||
Sbjct: 40  ttggtgttcatcctcttacgcaggaa 15



to top

>emb|CR686749.2|CNS0FSUH Tetraodon nigroviridis full-length cDNA
          Length = 298

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 552 ttggtgttcatcctcttacggaggaa 577
           |||||||||||||||||||| |||||
Sbjct: 40  ttggtgttcatcctcttacgcaggaa 15



to top

>emb|CR685068.2|CNS0FRJS Tetraodon nigroviridis full-length cDNA
          Length = 298

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 552 ttggtgttcatcctcttacggaggaa 577
           |||||||||||||||||||| |||||
Sbjct: 40  ttggtgttcatcctcttacgcaggaa 15



to top

>emb|CR684046.2|CNS0FQRE Tetraodon nigroviridis full-length cDNA
          Length = 298

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 552 ttggtgttcatcctcttacggaggaa 577
           |||||||||||||||||||| |||||
Sbjct: 40  ttggtgttcatcctcttacgcaggaa 15



to top

>emb|CR682457.2|CNS0FPJ9 Tetraodon nigroviridis full-length cDNA
          Length = 298

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 552 ttggtgttcatcctcttacggaggaa 577
           |||||||||||||||||||| |||||
Sbjct: 40  ttggtgttcatcctcttacgcaggaa 15



to top

>emb|CR679961.2|CNS0FNLX Tetraodon nigroviridis full-length cDNA
          Length = 298

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 552 ttggtgttcatcctcttacggaggaa 577
           |||||||||||||||||||| |||||
Sbjct: 40  ttggtgttcatcctcttacgcaggaa 15



to top

>emb|CR679201.2|CNS0FN0T Tetraodon nigroviridis full-length cDNA
          Length = 727

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 552 ttggtgttcatcctcttacggaggaa 577
           |||||||||||||||||||| |||||
Sbjct: 40  ttggtgttcatcctcttacgcaggaa 15



to top

>emb|CR679149.2|CNS0FMZD Tetraodon nigroviridis full-length cDNA
          Length = 298

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 552 ttggtgttcatcctcttacggaggaa 577
           |||||||||||||||||||| |||||
Sbjct: 40  ttggtgttcatcctcttacgcaggaa 15



to top

>emb|CR677571.2|CNS0FLRY Tetraodon nigroviridis full-length cDNA
          Length = 894

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 552 ttggtgttcatcctcttacggaggaa 577
           |||||||||||||||||||| |||||
Sbjct: 40  ttggtgttcatcctcttacgcaggaa 15



to top

>emb|CR677193.2|CNS0FLHH Tetraodon nigroviridis full-length cDNA
          Length = 728

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 552 ttggtgttcatcctcttacggaggaa 577
           |||||||||||||||||||| |||||
Sbjct: 40  ttggtgttcatcctcttacgcaggaa 15



to top

>emb|CR675541.2|CNS0FK7V Tetraodon nigroviridis full-length cDNA
          Length = 298

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 552 ttggtgttcatcctcttacggaggaa 577
           |||||||||||||||||||| |||||
Sbjct: 40  ttggtgttcatcctcttacgcaggaa 15



to top

>emb|CR672882.2|CNS0FI60 Tetraodon nigroviridis full-length cDNA
          Length = 299

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 552 ttggtgttcatcctcttacggaggaa 577
           |||||||||||||||||||| |||||
Sbjct: 40  ttggtgttcatcctcttacgcaggaa 15



to top

>emb|CR672163.2|CNS0FHM1 Tetraodon nigroviridis full-length cDNA
          Length = 727

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 552 ttggtgttcatcctcttacggaggaa 577
           |||||||||||||||||||| |||||
Sbjct: 40  ttggtgttcatcctcttacgcaggaa 15



to top

>emb|CR671303.2|CNS0FGY5 Tetraodon nigroviridis full-length cDNA
          Length = 719

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 552 ttggtgttcatcctcttacggaggaa 577
           |||||||||||||||||||| |||||
Sbjct: 40  ttggtgttcatcctcttacgcaggaa 15



to top

>emb|CR669634.2|CNS0FFNS Tetraodon nigroviridis full-length cDNA
          Length = 728

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 552 ttggtgttcatcctcttacggaggaa 577
           |||||||||||||||||||| |||||
Sbjct: 40  ttggtgttcatcctcttacgcaggaa 15



to top

>emb|CR669188.2|CNS0FFBE Tetraodon nigroviridis full-length cDNA
          Length = 299

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 552 ttggtgttcatcctcttacggaggaa 577
           |||||||||||||||||||| |||||
Sbjct: 40  ttggtgttcatcctcttacgcaggaa 15



to top

>emb|CR668979.2|CNS0FF5L Tetraodon nigroviridis full-length cDNA
          Length = 298

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 552 ttggtgttcatcctcttacggaggaa 577
           |||||||||||||||||||| |||||
Sbjct: 40  ttggtgttcatcctcttacgcaggaa 15



to top

>emb|CR664501.2|CNS0FBP7 Tetraodon nigroviridis full-length cDNA
          Length = 298

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 552 ttggtgttcatcctcttacggaggaa 577
           |||||||||||||||||||| |||||
Sbjct: 40  ttggtgttcatcctcttacgcaggaa 15



to top

>emb|CR662473.2|CNS0FA4V Tetraodon nigroviridis full-length cDNA
          Length = 298

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 552 ttggtgttcatcctcttacggaggaa 577
           |||||||||||||||||||| |||||
Sbjct: 40  ttggtgttcatcctcttacgcaggaa 15



to top

>emb|CR661668.2|CNS0F9II Tetraodon nigroviridis full-length cDNA
          Length = 298

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 552 ttggtgttcatcctcttacggaggaa 577
           |||||||||||||||||||| |||||
Sbjct: 40  ttggtgttcatcctcttacgcaggaa 15



to top

>emb|CR660204.2|CNS0F8DU Tetraodon nigroviridis full-length cDNA
          Length = 298

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 552 ttggtgttcatcctcttacggaggaa 577
           |||||||||||||||||||| |||||
Sbjct: 40  ttggtgttcatcctcttacgcaggaa 15



to top

>emb|CR656627.2|CNS0F5MH Tetraodon nigroviridis full-length cDNA
          Length = 716

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 552 ttggtgttcatcctcttacggaggaa 577
           |||||||||||||||||||| |||||
Sbjct: 40  ttggtgttcatcctcttacgcaggaa 15



to top

>emb|CR654883.2|CNS0F4A1 Tetraodon nigroviridis full-length cDNA
          Length = 727

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 552 ttggtgttcatcctcttacggaggaa 577
           |||||||||||||||||||| |||||
Sbjct: 40  ttggtgttcatcctcttacgcaggaa 15



to top

>emb|CR653693.2|CNS0F3CZ Tetraodon nigroviridis full-length cDNA
          Length = 298

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 552 ttggtgttcatcctcttacggaggaa 577
           |||||||||||||||||||| |||||
Sbjct: 40  ttggtgttcatcctcttacgcaggaa 15



to top

>emb|CR649395.2|CNS0F01L Tetraodon nigroviridis full-length cDNA
          Length = 298

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 552 ttggtgttcatcctcttacggaggaa 577
           |||||||||||||||||||| |||||
Sbjct: 40  ttggtgttcatcctcttacgcaggaa 15



to top

>emb|CR649309.2|CNS0EZZ7 Tetraodon nigroviridis full-length cDNA
          Length = 298

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 552 ttggtgttcatcctcttacggaggaa 577
           |||||||||||||||||||| |||||
Sbjct: 40  ttggtgttcatcctcttacgcaggaa 15



to top

>emb|CR649016.2|CNS0EZR2 Tetraodon nigroviridis full-length cDNA
          Length = 298

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 552 ttggtgttcatcctcttacggaggaa 577
           |||||||||||||||||||| |||||
Sbjct: 40  ttggtgttcatcctcttacgcaggaa 15



to top

>gb|AC166831.3| Mus musculus BAC clone RP23-270P14 from chromosome 16, complete
             sequence
          Length = 230269

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 251   cttggccttctccttcctcttt 272
             ||||||||||||||||||||||
Sbjct: 45570 cttggccttctccttcctcttt 45549



to top

>emb|CR646191.2|CNS0EXKL Tetraodon nigroviridis full-length cDNA
          Length = 298

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 552 ttggtgttcatcctcttacggaggaa 577
           |||||||||||||||||||| |||||
Sbjct: 40  ttggtgttcatcctcttacgcaggaa 15



to top

>emb|CR641493.2|CNS0ETY3 Tetraodon nigroviridis full-length cDNA
          Length = 298

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 552 ttggtgttcatcctcttacggaggaa 577
           |||||||||||||||||||| |||||
Sbjct: 40  ttggtgttcatcctcttacgcaggaa 15



to top

>emb|CR638774.2|CNS0ERUK Tetraodon nigroviridis full-length cDNA
          Length = 298

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 552 ttggtgttcatcctcttacggaggaa 577
           |||||||||||||||||||| |||||
Sbjct: 40  ttggtgttcatcctcttacgcaggaa 15



to top

>emb|CR638669.2|CNS0ERRN Tetraodon nigroviridis full-length cDNA
          Length = 298

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 552 ttggtgttcatcctcttacggaggaa 577
           |||||||||||||||||||| |||||
Sbjct: 40  ttggtgttcatcctcttacgcaggaa 15



to top

>emb|CR638020.2|CNS0ER9M Tetraodon nigroviridis full-length cDNA
          Length = 298

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 552 ttggtgttcatcctcttacggaggaa 577
           |||||||||||||||||||| |||||
Sbjct: 40  ttggtgttcatcctcttacgcaggaa 15



to top

>emb|CR637133.2|CNS0EQKZ Tetraodon nigroviridis full-length cDNA
          Length = 298

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 552 ttggtgttcatcctcttacggaggaa 577
           |||||||||||||||||||| |||||
Sbjct: 40  ttggtgttcatcctcttacgcaggaa 15



to top

>emb|CR635244.2|CNS0EP4I Tetraodon nigroviridis full-length cDNA
          Length = 298

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 552 ttggtgttcatcctcttacggaggaa 577
           |||||||||||||||||||| |||||
Sbjct: 40  ttggtgttcatcctcttacgcaggaa 15



to top

>emb|CR634492.2|CNS0EOJM Tetraodon nigroviridis full-length cDNA
          Length = 298

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 552 ttggtgttcatcctcttacggaggaa 577
           |||||||||||||||||||| |||||
Sbjct: 40  ttggtgttcatcctcttacgcaggaa 15



to top

>emb|CR632869.2|CNS0ENAJ Tetraodon nigroviridis full-length cDNA
          Length = 298

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 552 ttggtgttcatcctcttacggaggaa 577
           |||||||||||||||||||| |||||
Sbjct: 40  ttggtgttcatcctcttacgcaggaa 15



to top

>emb|CR633646.2|CNS0ENW4 Tetraodon nigroviridis full-length cDNA
          Length = 298

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 552 ttggtgttcatcctcttacggaggaa 577
           |||||||||||||||||||| |||||
Sbjct: 40  ttggtgttcatcctcttacgcaggaa 15



to top

>emb|CR633029.2|CNS0ENEZ Tetraodon nigroviridis full-length cDNA
          Length = 298

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 552 ttggtgttcatcctcttacggaggaa 577
           |||||||||||||||||||| |||||
Sbjct: 40  ttggtgttcatcctcttacgcaggaa 15



to top

>emb|CR632663.2|CNS0EN4T Tetraodon nigroviridis full-length cDNA
          Length = 298

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 552 ttggtgttcatcctcttacggaggaa 577
           |||||||||||||||||||| |||||
Sbjct: 40  ttggtgttcatcctcttacgcaggaa 15



to top

>emb|CR632233.2|CNS0EMSV Tetraodon nigroviridis full-length cDNA
          Length = 298

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 552 ttggtgttcatcctcttacggaggaa 577
           |||||||||||||||||||| |||||
Sbjct: 40  ttggtgttcatcctcttacgcaggaa 15



to top

>emb|CR632230.2|CNS0EMSS Tetraodon nigroviridis full-length cDNA
          Length = 298

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 552 ttggtgttcatcctcttacggaggaa 577
           |||||||||||||||||||| |||||
Sbjct: 40  ttggtgttcatcctcttacgcaggaa 15



to top

>emb|AL391822.12| Human DNA sequence from clone RP11-494K3 on chromosome 1 Contains the
             3' end of the gene for neurofascin (NFASC) and a ribosomal
             protein L13a (RPL13A) pseudogene, complete sequence
          Length = 115292

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                           
Query: 251   cttggccttctccttcctcttttcctccag 280
             ||||||||| ||| ||||||||||||||||
Sbjct: 35865 cttggccttttccctcctcttttcctccag 35836



to top

>emb|AJ843089.1| Platichthys flesus mRNA for 60S ribosomal protein L13A (rpl13A
           gene)
          Length = 686

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 251 cttggccttctccttcctcttttcctccag 280
           ||||||||||||||| ||||| ||||||||
Sbjct: 522 cttggccttctcctttctcttctcctccag 493



to top

>gb|BC067891.1| Homo sapiens cDNA clone MGC:87657 IMAGE:5271409, complete cds
          Length = 1488

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 251 cttggccttctccttcctcttttcctccag 280
           |||||| |||||||||||||| ||||||||
Sbjct: 431 cttggctttctccttcctcttctcctccag 402



to top

>gb|AC092768.6| Homo sapiens chromosome 11, clone RP11-1149L18, complete sequence
          Length = 146364

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                          
Query: 251  cttggccttctccttcctcttttcctccag 280
            |||||| |||||||||||||| ||||||||
Sbjct: 2917 cttggctttctccttcctcttctcctccag 2946



to top

>gb|BC103039.1| Bos taurus cDNA clone MGC:128198 IMAGE:7984430, complete cds
          Length = 679

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 251 cttggccttctccttcctcttttcctccag 280
           ||||||||||||||| ||||| ||||||||
Sbjct: 518 cttggccttctcctttctcttctcctccag 489



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 47/56 (83%)
 Strand = Plus / Minus

                                                                   
Query: 519 ggggcgcggaagtggatggggccgtgggatggcttggtgttcatcctcttacggag 574
           ||||| |||||||||  ||||||  |||| || ||||||||||||| ||| |||||
Sbjct: 250 ggggctcggaagtggtaggggccacgggaggggttggtgttcatccgcttgcggag 195



to top

>gb|AC084878.12| Homo sapiens 12q BAC RP11-101K23 (Roswell Park Cancer Institute Human
             BAC Library) complete sequence
          Length = 135060

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                           
Query: 251   cttggccttctccttcctcttttcctccag 280
             |||| |||||||||||||||| ||||||||
Sbjct: 77781 cttgaccttctccttcctcttctcctccag 77810



to top

>gb|AC098935.2| Homo sapiens chromosome 1 clone RP11-564A8, complete sequence
          Length = 192565

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                           
Query: 251   cttggccttctccttcctcttttcctccag 280
             ||||||||||||||||| ||| ||||||||
Sbjct: 60141 cttggccttctccttccacttctcctccag 60112



to top

>gb|AC074250.6| Homo sapiens BAC clone RP11-622A1 from 4, complete sequence
          Length = 199331

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                           
Query: 251   cttggccttctccttcctcttttcctccag 280
             ||||| ||||||||| ||||||||||||||
Sbjct: 37403 cttggtcttctcctttctcttttcctccag 37374



to top

>ref|XM_936627.1| PREDICTED: Homo sapiens similar to ribosomal protein L13a
           (LOC647572), mRNA
          Length = 1466

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 251 cttggccttctccttcctcttttcctccag 280
           |||||| |||||||||||||| ||||||||
Sbjct: 430 cttggctttctccttcctcttctcctccag 401



to top

>ref|XM_928691.1| PREDICTED: Homo sapiens similar to ribosomal protein L13a
           (LOC645683), mRNA
          Length = 1466

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 251 cttggccttctccttcctcttttcctccag 280
           |||||| |||||||||||||| ||||||||
Sbjct: 430 cttggctttctccttcctcttctcctccag 401



to top

>gb|BC105558.1| Bos taurus cDNA clone IMAGE:8120112, with apparent retained intron
          Length = 2007

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                          
Query: 251  cttggccttctccttcctcttttcctccag 280
            ||||||||||||||| ||||| ||||||||
Sbjct: 1303 cttggccttctcctttctcttctcctccag 1274



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 47/56 (83%)
 Strand = Plus / Minus

                                                                    
Query: 519  ggggcgcggaagtggatggggccgtgggatggcttggtgttcatcctcttacggag 574
            ||||| |||||||||  ||||||  |||| || ||||||||||||| ||| |||||
Sbjct: 1035 ggggctcggaagtggtaggggccacgggaggggttggtgttcatccgcttgcggag 980



to top

>gb|AC129776.3| Mus musculus BAC clone RP23-197A15 from chromosome 16, complete
            sequence
          Length = 219345

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 251  cttggccttctccttcctcttt 272
            ||||||||||||||||||||||
Sbjct: 1434 cttggccttctccttcctcttt 1413



to top

>ref|NG_002538.1| Homo sapiens ribosomal protein L13a pseudogene 2 (RPL13AP2) on
           chromosome 14
          Length = 773

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 251 cttggccttctccttcctcttttcct 276
           ||||||||||||||||||||| ||||
Sbjct: 530 cttggccttctccttcctcttctcct 505



to top

>gb|AC018523.9|AC018523 Homo sapiens chromosome , clone RP11-140L24, complete sequence
          Length = 166507

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                            
Query: 251    cttggccttctccttcctcttttcctccag 280
              |||||| |||||||||||||| ||||||||
Sbjct: 162299 cttggctttctccttcctcttctcctccag 162328



to top

>gb|AC107675.13| Mus musculus chromosome 1, clone RP24-471N7, complete sequence
          Length = 127374

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 256   ccttctccttcctcttttcctc 277
             ||||||||||||||||||||||
Sbjct: 43714 ccttctccttcctcttttcctc 43693



to top

>emb|AL157792.3|CNS01RG7 Human chromosome 14 DNA sequence BAC R-388M7 of library RPCI-11 from
              chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 194760

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                        
Query: 251    cttggccttctccttcctcttttcct 276
              ||||||||||||||||||||| ||||
Sbjct: 115340 cttggccttctccttcctcttctcct 115365



to top

>emb|AL355773.4|CNS05TCO Human chromosome 14 DNA sequence BAC R-813I20 of library RPCI-11 from
              chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 216647

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                            
Query: 251    cttggccttctccttcctcttttcctccag 280
              |||||| |||||||||||||| ||||||||
Sbjct: 124955 cttggctttctccttcctcttctcctccag 124984



to top

>emb|X56933.1|BTAPAS B.taurus mRNA, alternative polyadenylation signals
          Length = 1101

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 251 cttggccttctccttcctcttttcctccag 280
           ||||||||||||||| ||||| ||||||||
Sbjct: 493 cttggccttctcctttctcttctcctccag 464



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 47/56 (83%)
 Strand = Plus / Minus

                                                                   
Query: 519 ggggcgcggaagtggatggggccgtgggatggcttggtgttcatcctcttacggag 574
           ||||| |||||||||  ||||||  |||| || ||||||||||||| ||| |||||
Sbjct: 225 ggggctcggaagtggtaggggccacgggaggggttggtgttcatccgcttgcggag 170



to top

>gb|AY650304.1| Macaca fascicularis ribosomal protein L13A mRNA, partial cds
          Length = 462

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 251 cttggccttctccttcctcttttcctcca 279
           |||||| |||||||||||||| |||||||
Sbjct: 366 cttggctttctccttcctcttctcctcca 338



to top

>ref|NM_113395.2| Arabidopsis thaliana structural constituent of ribosome AT3G24830
           mRNA, complete cds
          Length = 882

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 48/57 (84%)
 Strand = Plus / Minus

                                                                    
Query: 338 gcagtacctgtgcccaggctgcagcctcagaaccttgagcgcgtcgggaatgaccat 394
           ||||||| |||| |||| ||| |||||||  |||||||| || || |||||||||||
Sbjct: 473 gcagtacttgtgaccagcctgaagcctcaacaccttgagagcatcaggaatgaccat 417



to top

>ref|NM_001016486.2| Xenopus tropicalis hypothetical protein LOC549240 (LOC549240), mRNA
          Length = 771

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 251 cttggccttctccttcctcttttcctcca 279
           ||||||||||||||| ||||| |||||||
Sbjct: 584 cttggccttctcctttctcttctcctcca 556



to top

>ref|XM_418218.1| PREDICTED: Gallus gallus similar to chromosome 19 open reading
           frame 21 (LOC420097), mRNA
          Length = 2960

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 260 ctccttcctcttttcctccagctcc 284
           |||||||||||| ||||||||||||
Sbjct: 582 ctccttcctcttgtcctccagctcc 558



to top

>gb|AC006043.1| Homo sapiens BAC clone RP11-538D15 from 7, complete sequence
          Length = 189036

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 251    cttggccttctccttcctctt 271
              |||||||||||||||||||||
Sbjct: 115153 cttggccttctccttcctctt 115133



to top

>emb|BX000688.11| Human DNA sequence from clone DAQB-36F16 on chromosome 6 Contains the
             GPR53P pseudogene for G protein-coupled receptor 53, the
             OR2I1P pseudogene for olfactory receptor, family 2,
             subfamily I, member 1, the UBD gene for ubiquitin D, the
             OR2H5P pseudogene for olfactory receptor, family 2,
             subfamily H, member 5, the RPL13AP pseudogene for
             ribosomal protein L13a, the OR2H2 gene for olfactory
             receptor, family 2, subfamily H, member 2, the GABBR1 gene
             for gamma-aminobutyric acid (GABA) B receptor, 1, and 3
             CpG islands, complete sequence
          Length = 102684

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 251   cttggccttctccttcctctt 271
             |||||||||||||||||||||
Sbjct: 50599 cttggccttctccttcctctt 50579



to top

>emb|AL662826.11| Human DNA sequence from clone XXbac-101I20 on chromosome 6 contains a
             MAS1 oncogene pseudogene, a olfactory receptor, family 2,
             subfamily I, member 1 pseudogene (OR2I1P, HS6M1-14P), the
             UBD gene for ubiquitin D (FAT10), a olfactory receptor,
             family 2, subfamily H, member 5 pseudogene (OR2H5P,
             HS6M1-13P), a 60S ribosomal protein L13A (RPL13A)
             pseudogene, the OR2H2 gene for olfactory receptor, family
             2, subfamily H, member 2 (HS6M1-12), the GABBR1 gene for
             gamma-aminobutryic acid (GABA) B receptor, 1 (GPRC3A,
             GABABR1), the 5' end of the MOG gene for myelin
             oligodendrocyte protein and three CpG islands, complete
             sequence
          Length = 145431

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 251   cttggccttctccttcctctt 271
             |||||||||||||||||||||
Sbjct: 57020 cttggccttctccttcctctt 57000



to top

>emb|AL645936.5| Human DNA sequence from clone XXbac-126D10 on chromosome 6 contains the
             OR2H2 gene for olfactory receptor, family 2, subfamily H,
             member 2, the OR2I1P and OR2H5P pseudogenes for olfactory
             receptor, family 2, subfamily I, member 1 and subfamily H,
             member 5, the UBD gene for ubiquitin D, a 60S ribosomal
             protein L13A (RPL13A) pseudogene, the GABBR1 gene for
             gamma-aminobutyric acid (GABA) B receptor, 1, a SMT3
             suppressor of mif two 3 homolog 1 (SMT3H1) pseudogene, the
             MOG gene for myelin oligodendrocyte glycoprotein, the gene
             for a novel KRAB box-containing C2H2 type zinc finger
             protein and four CpG islands, complete sequence
          Length = 155874

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 251   cttggccttctccttcctctt 271
             |||||||||||||||||||||
Sbjct: 33892 cttggccttctccttcctctt 33872



to top

>emb|AL109827.8|HSJ309K20 Human DNA sequence from clone RP1-309K20 on chromosome 20 Contains the
             5' end of the FER1L4 gene for fer-1-like 4 (C. elegans),
             the C20orf124 gene for chromosome 20 open reading frame
             124, the SPAG4 gene for sperm associated antigen 4, the
             CPNE1 gene for copine I, the RBM12 gene for RNA binding
             motif protein 12, the 3' end of the NIFS gene for nitrogen
             fixation 1 (S. cerevisiae) and four CpG islands, complete
             sequence
          Length = 98599

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 256   ccttctccttcctcttttcct 276
             |||||||||||||||||||||
Sbjct: 86556 ccttctccttcctcttttcct 86576


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 5,729,007
Number of Sequences: 3902068
Number of extensions: 5729007
Number of successful extensions: 144675
Number of sequences better than 10.0: 369
Number of HSP's better than 10.0 without gapping: 368
Number of HSP's successfully gapped in prelim test: 1
Number of HSP's that attempted gapping in prelim test: 143664
Number of HSP's gapped (non-prelim): 999
length of query: 605
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 582
effective length of database: 17,143,297,704
effective search space: 9977399263728
effective search space used: 9977399263728
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top