ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbags20c11
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AY549888.2| Triticum aestivum putative proteinase inhibitor-r... 408 e-111
2emb|Z48729.1|HVBSI1 H.vulgare Bsi1 gene for putative protease in... 182 6e-43
3gb|L11882.1|WHTWALI5A Triticum aestivum protein of unknown funct... 155 1e-34
4gb|L11881.1|WHTWALI3A Triticum aestivum protein of unknown funct... 58 2e-05
5gb|L28009.1|WHTWALIA Triticum aestivum (wali6) mRNA, complete cds 46 0.086
6gb|CP000138.1| Rhizobium etli CFN 42 plasmid p42f, complete sequ... 42 1.3
7ref|XM_508615.1| PREDICTED: Pan troglodytes similar to NADSYN1 (... 40 5.3
8gb|CP000094.1| Pseudomonas fluorescens PfO-1, complete genome 40 5.3
9gb|AC148310.2| Pan troglodytes BAC clone RP43-31J11 from 7, comp... 40 5.3
10ref|NM_001040330.1| Danio rerio zgc:136662 (zgc:136662), mRNA 40 5.3
11gb|AC117230.3| Mus musculus BAC clone RP23-385F15 from 16, compl... 40 5.3
12ref|NM_001012370.1| Danio rerio exostoses (multiple) 1c (ext1c),... 40 5.3
13gb|BC115216.1| Danio rerio exostoses (multiple) 1c, mRNA (cDNA c... 40 5.3
14ref|XM_680169.1| PREDICTED: Danio rerio similar to EXT1c (LOC572... 40 5.3
15dbj|BA000045.2| Gloeobacter violaceus PCC 7421 DNA, complete genome 40 5.3
16dbj|BA000040.2| Bradyrhizobium japonicum USDA 110 DNA, complete ... 40 5.3
17dbj|BS000238.1| Pan troglodytes chromosome 22 clone:PTB-016O01, ... 40 5.3
18gb|AF042096.3|AF042096 Bradyrhizobium japonicum UbiE (ubiE) gene... 40 5.3
19emb|AL954242.1|PTB109N16 Pan troglodytes chromosome 22 BAC PTB-1... 40 5.3
20gb|AY734457.1| Danio rerio EXT1c mRNA, complete cds 40 5.3
21dbj|AP002387.4| Homo sapiens genomic DNA, chromosome 11 clone:RP... 40 5.3
22gb|AC058786.24| Mus musculus strain C57BL/6J chromosome 4 clone ... 40 5.3
23emb|AL732476.12| Mouse DNA sequence from clone RP23-131A6 on chr... 40 5.3

>gb|AY549888.2| Triticum aestivum putative proteinase inhibitor-related protein
           (wrsi5-1) mRNA, complete cds
          Length = 608

 Score =  408 bits (206), Expect = e-111
 Identities = 295/326 (90%), Gaps = 2/326 (0%)
 Strand = Plus / Minus

                                                                       
Query: 69  acatattgttggccgtatagcacggcccacacacaaacatagcancacgatgactgctca 128
           |||||||||||||||||||||||| |||||| | || |||||   | | |||||||||||
Sbjct: 476 acatattgttggccgtatagcacgacccacagagaagcatag--gcgccatgactgctca 419

                                                                       
Query: 129 tntcatctgagctttattctaggcggcacacctcgtccgagcctgaagccctgaagcgat 188
           | |||||||||||||||| |||||||||| ||||||| ||| |||||||||||||  |||
Sbjct: 418 tctcatctgagctttattttaggcggcacccctcgtctgagactgaagccctgaacggat 359

                                                                       
Query: 189 cagtgctttttgcatgggccaccgcaggtgccgtcgacggtgctcttcatgtcggcgcag 248
           ||||||||||||||||| || ||||||||||| |||||||||||||||||||||||||| 
Sbjct: 358 cagtgctttttgcatggcccgccgcaggtgccatcgacggtgctcttcatgtcggcgcac 299

                                                                       
Query: 249 cggaacgtcttgtgagggctcggggtcaccacgcggcaggcggagcagcccttggggcac 308
           |||||||||||||||||||| || ||||||||||||||||| ||||||||||||||||||
Sbjct: 298 cggaacgtcttgtgagggctgggcgtcaccacgcggcaggccgagcagcccttggggcac 239

                                                                       
Query: 309 tgggggtgggcgtcgncgcatacntcnacccccgagaaggacctgcagttgttgcagcac 368
           ||||||||||||||| |||| || || ||||| |||||||||||||||||||||||||||
Sbjct: 238 tgggggtgggcgtcgtcgcagacgtcgaccccggagaaggacctgcagttgttgcagcac 179

                                     
Query: 369 ttgnggaagaagtnggcgttaacgtg 394
           ||| ||||||||| |||||| |||||
Sbjct: 178 ttggggaagaagtcggcgttcacgtg 153



to top

>emb|Z48729.1|HVBSI1 H.vulgare Bsi1 gene for putative protease inhibitor
          Length = 498

 Score =  182 bits (92), Expect = 6e-43
 Identities = 168/194 (86%), Gaps = 3/194 (1%)
 Strand = Plus / Minus

                                                                       
Query: 183 agcgatcagtgctttttgcatgggccaccgcaggtgccgtcgacggtgctcttcatgtcg 242
           |||||||||| ||| |||||||| || |||||||||||||||||||||   |||||||||
Sbjct: 286 agcgatcagtacttcttgcatggcccgccgcaggtgccgtcgacggtggctttcatgtcg 227

                                                                       
Query: 243 gcgcagcggaacgtcttgtgagggctcggggtcaccacgcggcaggcggagcagcccttg 302
           |||||||||||||||| |   ||| ||| ||||||||||||||| || ||||||||  ||
Sbjct: 226 gcgcagcggaacgtctgg---gggttcgtggtcaccacgcggcacgccgagcagccggtg 170

                                                                       
Query: 303 gggcactgggggtgggcgtcgncgcatacntcnacccccgagaaggacctgcagttgttg 362
           |||||||| || ||||||||| |||| || || ||||| |||||||||||||||||||||
Sbjct: 169 gggcactgcggatgggcgtcgtcgcagacgtcgaccccggagaaggacctgcagttgttg 110

                         
Query: 363 cagcacttgnggaa 376
           |||||| || ||||
Sbjct: 109 cagcacgtggggaa 96



to top

>gb|L11882.1|WHTWALI5A Triticum aestivum protein of unknown function (wali5) mRNA,
           complete cds
          Length = 520

 Score =  155 bits (78), Expect = 1e-34
 Identities = 180/215 (83%), Gaps = 3/215 (1%)
 Strand = Plus / Minus

                                                                       
Query: 180 tgaagcgatcagtgctttttgcatgggccaccgcaggtgccgtcgacggtgctcttcatg 239
           |||| |||||||| ||| ||||| || ||||||||||||||||||||||||   ||||| 
Sbjct: 350 tgaaccgatcagtacttcttgcagggtccaccgcaggtgccgtcgacggtggatttcata 291

                                                                       
Query: 240 tcggcgcagcggaacgtcttgtgagggctcggggtcaccacgcggcaggcggagcagccc 299
           || ||||||||  || | | |   |||||||  | |||||||||||| || |||||||||
Sbjct: 290 tccgcgcagcgccacatttcg---gggctcgtcgacaccacgcggcacgccgagcagccc 234

                                                                       
Query: 300 ttggggcactgggggtgggcgtcgncgcatacntcnacccccgagaaggacctgcagttg 359
           | ||| |||| ||||||||||||| |||| || || ||||||||||||||||||||||||
Sbjct: 233 tggggacacttggggtgggcgtcgtcgcagacgtcgacccccgagaaggacctgcagttg 174

                                              
Query: 360 ttgcagcacttgnggaagaagtnggcgttaacgtg 394
           |||||||||||| |||| || | |||||| |||||
Sbjct: 173 ttgcagcacttggggaaaaaatcggcgttcacgtg 139



 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 44/48 (91%), Gaps = 1/48 (2%)
 Strand = Plus / Minus

                                                           
Query: 11  caacaagcaacaccagtctttttctcgagcgagaaaacacagtgacga 58
           |||||||||||||||  |||||||||||| |||||||||||| |||||
Sbjct: 513 caacaagcaacaccaa-ctttttctcgagagagaaaacacagcgacga 467



to top

>gb|L11881.1|WHTWALI3A Triticum aestivum protein of unknown function (wali3) mRNA,
           complete cds
          Length = 564

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 37/40 (92%)
 Strand = Plus / Minus

                                                   
Query: 337 cccccgagaaggacctgcagttgttgcagcacttgnggaa 376
           ||||||||||| |||||||||||| |||||||||| ||||
Sbjct: 175 cccccgagaagaacctgcagttgtcgcagcacttggggaa 136



to top

>gb|L28009.1|WHTWALIA Triticum aestivum (wali6) mRNA, complete cds
          Length = 585

 Score = 46.1 bits (23), Expect = 0.086
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                          
Query: 337 cccccgagaaggacctgcagttgttgcagca 367
           ||||||||||| |||||||||||| ||||||
Sbjct: 196 cccccgagaagaacctgcagttgtcgcagca 166



to top

>gb|CP000138.1| Rhizobium etli CFN 42 plasmid p42f, complete sequence
          Length = 642517

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 217    tgccgtcgacggtgctcttca 237
              |||||||||||||||||||||
Sbjct: 634922 tgccgtcgacggtgctcttca 634902



to top

>ref|XM_508615.1| PREDICTED: Pan troglodytes similar to NADSYN1 (LOC451394), mRNA
          Length = 791

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 13  acaagcaacaccagtctttt 32
           ||||||||||||||||||||
Sbjct: 633 acaagcaacaccagtctttt 652



to top

>gb|CP000094.1| Pseudomonas fluorescens PfO-1, complete genome
          Length = 6438405

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 352     tgcagttgttgcagcacttg 371
               ||||||||||||||||||||
Sbjct: 2027872 tgcagttgttgcagcacttg 2027891



to top

>gb|AC148310.2| Pan troglodytes BAC clone RP43-31J11 from 7, complete sequence
          Length = 203635

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 13     acaagcaacaccagtctttt 32
              ||||||||||||||||||||
Sbjct: 165082 acaagcaacaccagtctttt 165063



to top

>ref|NM_001040330.1| Danio rerio zgc:136662 (zgc:136662), mRNA
          Length = 2659

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 212  gcaggtgccgtcgacggtgc 231
            ||||||||||||||||||||
Sbjct: 1389 gcaggtgccgtcgacggtgc 1408



to top

>gb|AC117230.3| Mus musculus BAC clone RP23-385F15 from 16, complete sequence
          Length = 184556

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 5     tttattcaacaagcaacacc 24
             ||||||||||||||||||||
Sbjct: 83217 tttattcaacaagcaacacc 83198



to top

>ref|NM_001012370.1| Danio rerio exostoses (multiple) 1c (ext1c), mRNA
          Length = 2214

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 212  gcaggtgccgtcgacggtgc 231
            ||||||||||||||||||||
Sbjct: 1137 gcaggtgccgtcgacggtgc 1156



to top

>gb|BC115216.1| Danio rerio exostoses (multiple) 1c, mRNA (cDNA clone MGC:136662
            IMAGE:8000407), complete cds
          Length = 2659

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 212  gcaggtgccgtcgacggtgc 231
            ||||||||||||||||||||
Sbjct: 1389 gcaggtgccgtcgacggtgc 1408



to top

>ref|XM_680169.1| PREDICTED: Danio rerio similar to EXT1c (LOC572763), partial mRNA
          Length = 240

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 212 gcaggtgccgtcgacggtgc 231
           ||||||||||||||||||||
Sbjct: 117 gcaggtgccgtcgacggtgc 136



to top

>dbj|BA000045.2| Gloeobacter violaceus PCC 7421 DNA, complete genome
          Length = 4659019

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 195     tttttgcatgggccaccgca 214
               ||||||||||||||||||||
Sbjct: 1357636 tttttgcatgggccaccgca 1357655



to top

>dbj|BA000040.2| Bradyrhizobium japonicum USDA 110 DNA, complete genome
          Length = 9105828

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 235    tcatgtcggcgcagcggaac 254
              ||||||||||||||||||||
Sbjct: 807692 tcatgtcggcgcagcggaac 807673



to top

>dbj|BS000238.1| Pan troglodytes chromosome 22 clone:PTB-016O01, map 22, complete
              sequences
          Length = 168017

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 302    ggggcactgggggtgggcgt 321
              ||||||||||||||||||||
Sbjct: 156639 ggggcactgggggtgggcgt 156620



to top

>gb|AF042096.3|AF042096 Bradyrhizobium japonicum UbiE (ubiE) gene, partial cds; AarF (aarF),
            panthotenate metabolism flavoprotein (dfp),
            deoxyuridine-triphosphatase (dut), putative sensor
            protein (bdfA), GalF-like (galF), hypothetical protein
            genes, complete cds; putative helicase 2 gene, partial
            cds; and unknown genes
          Length = 13289

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 235  tcatgtcggcgcagcggaac 254
            ||||||||||||||||||||
Sbjct: 8347 tcatgtcggcgcagcggaac 8366



to top

>emb|AL954242.1|PTB109N16 Pan troglodytes chromosome 22 BAC PTB-109N16, complete sequence
          Length = 190477

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 302   ggggcactgggggtgggcgt 321
             ||||||||||||||||||||
Sbjct: 61465 ggggcactgggggtgggcgt 61446



to top

>gb|AY734457.1| Danio rerio EXT1c mRNA, complete cds
          Length = 2214

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 212  gcaggtgccgtcgacggtgc 231
            ||||||||||||||||||||
Sbjct: 1137 gcaggtgccgtcgacggtgc 1156



to top

>dbj|AP002387.4| Homo sapiens genomic DNA, chromosome 11 clone:RP11-660L16, complete
             sequence
          Length = 170523

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 13    acaagcaacaccagtctttt 32
             ||||||||||||||||||||
Sbjct: 82015 acaagcaacaccagtctttt 82034



to top

>gb|AC058786.24| Mus musculus strain C57BL/6J chromosome 4 clone rp23-117o7, complete
             sequence
          Length = 209737

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 88    gcacggcccacacacaaaca 107
             ||||||||||||||||||||
Sbjct: 97271 gcacggcccacacacaaaca 97290



to top

>emb|AL732476.12| Mouse DNA sequence from clone RP23-131A6 on chromosome 4, complete
            sequence
          Length = 194554

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 88   gcacggcccacacacaaaca 107
            ||||||||||||||||||||
Sbjct: 8245 gcacggcccacacacaaaca 8226


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,355,931
Number of Sequences: 3902068
Number of extensions: 2355931
Number of successful extensions: 50199
Number of sequences better than 10.0: 23
Number of HSP's better than 10.0 without gapping: 23
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 50099
Number of HSP's gapped (non-prelim): 98
length of query: 397
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 375
effective length of database: 17,147,199,772
effective search space: 6430199914500
effective search space used: 6430199914500
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top