ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | rbags20b22 |
|---|---|
| Clone Library Name | barley_pub |
>dbj|D38091.1|WHTPH2AE Triticum aestivum mRNA for protein H2A, complete cds, clone wcH2A-10 Length = 691 Score = 696 bits (351), Expect = 0.0 Identities = 419/441 (95%), Gaps = 3/441 (0%) Strand = Plus / Minus Query: 212 gatacagccgagcacccacgaccaccgagaaggagccgtcatctagctatcgtcatcggc 271 ||||||||||||||||||||||||||||| ||||| |||||||||||||||||| ||||| Sbjct: 531 gatacagccgagcacccacgaccaccgaggaggagtcgtcatctagctatcgtcgtcggc 472 Query: 272 agccgcggccttggcgctgcctccggccttcttggggagcagaaggttgtggatgttggg 331 |||| |||||||| ||||| |||||||||||||||||||| ||||||||||||||||| Sbjct: 471 agccacggccttg---ctgccaccggccttcttggggagcaggaggttgtggatgttggg 415 Query: 332 catgacaccgccgctggcgattgtgaccataccgagcaggcgggagagctcctcgtcgtt 391 ||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||| Sbjct: 414 catgacaccaccgctggcgattgtgaccatgccgagcaggcgggagagctcctcgtcgtt 355 Query: 392 gcggacggcaagctggatatgtcgcggcacgatgcgggtcttcttgttgtccctcgcggc 451 ||||||||| |||||||| || ||||||||||||||||||||||||||||||||||| || Sbjct: 354 gcggacggcgagctggatgtggcgcggcacgatgcgggtcttcttgttgtccctcgccgc 295 Query: 452 gttcccggccaactccaggacctcagcggcgagatactccagcacggcggcgaggtagac 511 |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| Sbjct: 294 gttcccggccaactccagaacctcagcggcgagatactccagcacggcggcgaggtagac 235 Query: 512 gggagcgccggcgccaaccctctcggcgtacttgccggccttgaggaaccgcgcgatcct 571 ||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||| Sbjct: 234 gggggcgccggcgccgaccctctcggcgtacttgccggccttgaggaaccgcgcgatcct 175 Query: 572 gccgacgggaaactggagcccggccttggagctcctggagatagccttcttggcggcgcc 631 ||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||| Sbjct: 174 gccgacggggaactggagcccggccttggagctcctggagatggccttcttggcggcgcc 115 Query: 632 ggagccgatagccttgcccct 652 |||||||| ||||||||||| Sbjct: 114 cgagccgatcgccttgcccct 94 Score = 125 bits (63), Expect = 2e-25 Identities = 132/152 (86%), Gaps = 11/152 (7%) Strand = Plus / Minus Query: 26 caacgaattacagaggatgtaaccattgtccacacctagtttagcaccggtacaagcaca 85 |||||||||||| |||||| ||||||||||||| ||||||||||||||||||||||||| Sbjct: 683 caacgaattacaaaggatgcaaccattgtccacggctagtttagcaccggtacaagcaca 624 Query: 86 cagattcattcagaaactaata--cgtactac--tcct---agtaaaacgcaacacctag 138 ||| ||||||||||||||| ||||||| |||| ||||||||||||||||||| Sbjct: 623 cag----attcagaaactaatagcagtactaccatcctagaagtaaaacgcaacacctag 568 Query: 139 gcaacacttgactgcagacgctactacacaga 170 |||||| || |||| | ||||||||||||||| Sbjct: 567 gcaacatttaactgaacacgctactacacaga 536
>dbj|D38089.1|WHTPH2AC Triticum aestivum mRNA for protein H2A, complete cds, clone wcH2A-4 Length = 725 Score = 688 bits (347), Expect = 0.0 Identities = 418/441 (94%), Gaps = 3/441 (0%) Strand = Plus / Minus Query: 212 gatacagccgagcacccacgaccaccgagaaggagccgtcatctagctatcgtcatcggc 271 ||||||||||||||||||||||| | ||| ||||| |||||||||||||||||| ||||| Sbjct: 529 gatacagccgagcacccacgacctcagaggaggagtcgtcatctagctatcgtcgtcggc 470 Query: 272 agccgcggccttggcgctgcctccggccttcttggggagcagaaggttgtggatgttggg 331 |||| |||||||| |||||||||||||||||||||||||||||||||||||||||||| Sbjct: 469 agccacggccttg---ctgcctccggccttcttggggagcagaaggttgtggatgttggg 413 Query: 332 catgacaccgccgctggcgattgtgaccataccgagcaggcgggagagctcctcgtcgtt 391 |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| Sbjct: 412 catgacaccgccgctggcgattgtgaccatgccgagcaggcgggagagctcctcgtcgtt 353 Query: 392 gcggacggcaagctggatatgtcgcggcacgatgcgggtcttcttgttgtccctcgcggc 451 ||||||||| |||||||| || ||||||||||||||||||||||||||||||||||| || Sbjct: 352 gcggacggcgagctggatgtggcgcggcacgatgcgggtcttcttgttgtccctcgccgc 293 Query: 452 gttcccggccaactccaggacctcagcggcgagatactccagcacggcggcgaggtagac 511 |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| Sbjct: 292 gttcccggccaactccagaacctcagcggcgagatactccagcacggcggcgaggtagac 233 Query: 512 gggagcgccggcgccaaccctctcggcgtacttgccggccttgaggaaccgcgcgatcct 571 ||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||| Sbjct: 232 gggggcgccggcgccgaccctctcggcgtacttgccggccttgaggaaccgcgcgatcct 173 Query: 572 gccgacgggaaactggagcccggccttggagctcctggagatagccttcttggcggcgcc 631 ||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||| Sbjct: 172 gccgacggggaactggagcccggccttggagctcctggagatggccttcttggcggcgcc 113 Query: 632 ggagccgatagccttgcccct 652 || || || ||||||||||| Sbjct: 112 cgaaccaatcgccttgcccct 92 Score = 143 bits (72), Expect = 8e-31 Identities = 78/80 (97%) Strand = Plus / Minus Query: 14 tatagaacgtagcaacgaattacagaggatgtaaccattgtccacacctagtttagcacc 73 |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| | Sbjct: 696 tatagaacatagcaacgaattacagaggatgtaaccattgtccacacctagtttagcatc 637 Query: 74 ggtacaagcacacagattca 93 |||||||||||||||||||| Sbjct: 636 ggtacaagcacacagattca 617 Score = 79.8 bits (40), Expect = 1e-11 Identities = 49/52 (94%) Strand = Plus / Minus Query: 119 tagtaaaacgcaacacctaggcaacacttgactgcagacgctactacacaga 170 ||||||||||||||||||||||||||||| |||| | ||||||||||||||| Sbjct: 585 tagtaaaacgcaacacctaggcaacacttaactgaacacgctactacacaga 534
>ref|XM_478633.1| Oryza sativa (japonica cultivar-group), mRNA Length = 830 Score = 456 bits (230), Expect = e-125 Identities = 338/374 (90%) Strand = Plus / Minus Query: 273 gccgcggccttggcgctgcctccggccttcttggggagcagaaggttgtggatgttgggc 332 ||||| |||||||||||||| ||||||||||||||||| || |||||||||||||||||| Sbjct: 544 gccgccgccttggcgctgccgccggccttcttggggaggagcaggttgtggatgttgggc 485 Query: 333 atgacaccgccgctggcgattgtgaccataccgagcaggcgggagagctcctcgtcgttg 392 ||||| || |||||||||||||||||| | |||||||||||||| ||||||||||||||| Sbjct: 484 atgacgcctccgctggcgattgtgaccgtgccgagcaggcgggatagctcctcgtcgttg 425 Query: 393 cggacggcaagctggatatgtcgcggcacgatgcgggtcttcttgttgtccctcgcggcg 452 |||||||| |||||||| || || ||||| |||||||||||||||||||||||||| ||| Sbjct: 424 cggacggcgagctggatgtggcggggcactatgcgggtcttcttgttgtccctcgccgcg 365 Query: 453 ttcccggccaactccaggacctcagcggcgagatactccagcacggcggcgaggtagacg 512 |||||||| | ||| || |||||||||||||| ||||| || ||||||||||||||||| Sbjct: 364 ttcccggcgagctcaagaacctcagcggcgaggtactcgaggacggcggcgaggtagacc 305 Query: 513 ggagcgccggcgccaaccctctcggcgtacttgccggccttgaggaaccgcgcgatcctg 572 || ||||||||||| |||||||||||||||||||||||||| | |||||| ||||||||| Sbjct: 304 ggggcgccggcgccgaccctctcggcgtacttgccggccttcaagaaccgggcgatcctg 245 Query: 573 ccgacgggaaactggagcccggccttggagctcctggagatagccttcttggcggcgccg 632 || ||||| ||||||||||||||||||||||||| || || ||||||||||||||||| Sbjct: 244 cccacggggaactggagcccggccttggagctccgcgacatggccttcttggcggcgccc 185 Query: 633 gagccgatagcctt 646 |||||||| ||||| Sbjct: 184 gagccgatcgcctt 171
>dbj|AK059228.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-024-D11, full insert sequence Length = 830 Score = 456 bits (230), Expect = e-125 Identities = 338/374 (90%) Strand = Plus / Minus Query: 273 gccgcggccttggcgctgcctccggccttcttggggagcagaaggttgtggatgttgggc 332 ||||| |||||||||||||| ||||||||||||||||| || |||||||||||||||||| Sbjct: 544 gccgccgccttggcgctgccgccggccttcttggggaggagcaggttgtggatgttgggc 485 Query: 333 atgacaccgccgctggcgattgtgaccataccgagcaggcgggagagctcctcgtcgttg 392 ||||| || |||||||||||||||||| | |||||||||||||| ||||||||||||||| Sbjct: 484 atgacgcctccgctggcgattgtgaccgtgccgagcaggcgggatagctcctcgtcgttg 425 Query: 393 cggacggcaagctggatatgtcgcggcacgatgcgggtcttcttgttgtccctcgcggcg 452 |||||||| |||||||| || || ||||| |||||||||||||||||||||||||| ||| Sbjct: 424 cggacggcgagctggatgtggcggggcactatgcgggtcttcttgttgtccctcgccgcg 365 Query: 453 ttcccggccaactccaggacctcagcggcgagatactccagcacggcggcgaggtagacg 512 |||||||| | ||| || |||||||||||||| ||||| || ||||||||||||||||| Sbjct: 364 ttcccggcgagctcaagaacctcagcggcgaggtactcgaggacggcggcgaggtagacc 305 Query: 513 ggagcgccggcgccaaccctctcggcgtacttgccggccttgaggaaccgcgcgatcctg 572 || ||||||||||| |||||||||||||||||||||||||| | |||||| ||||||||| Sbjct: 304 ggggcgccggcgccgaccctctcggcgtacttgccggccttcaagaaccgggcgatcctg 245 Query: 573 ccgacgggaaactggagcccggccttggagctcctggagatagccttcttggcggcgccg 632 || ||||| ||||||||||||||||||||||||| || || ||||||||||||||||| Sbjct: 244 cccacggggaactggagcccggccttggagctccgcgacatggccttcttggcggcgccc 185 Query: 633 gagccgatagcctt 646 |||||||| ||||| Sbjct: 184 gagccgatcgcctt 171
>ref|XM_482492.1| Oryza sativa (japonica cultivar-group), mRNA Length = 405 Score = 389 bits (196), Expect = e-105 Identities = 343/392 (87%) Strand = Plus / Minus Query: 261 tcgtcatcggcagccgcggccttggcgctgcctccggccttcttggggagcagaaggttg 320 ||||| ||||| || ||||||||||||||| ||||||||||||||||| || |||||| Sbjct: 401 tcgtcgtcggcggcggcggccttggcgctggagccggccttcttggggaggagcaggttg 342 Query: 321 tggatgttgggcatgacaccgccgctggcgattgtgaccataccgagcaggcgggagagc 380 ||||||||||||||||| |||||| ||||||| ||||| ||||||||||| || ||| Sbjct: 341 tggatgttgggcatgacgccgccgttggcgatggtgacggcgccgagcaggcgcgacagc 282 Query: 381 tcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttcttgttg 440 |||||||||||||| ||||| |||||||| || | ||||||||| || |||||||||||| Sbjct: 281 tcctcgtcgttgcgcacggcgagctggatgtgcctcggcacgatccgcgtcttcttgttg 222 Query: 441 tccctcgcggcgttcccggccaactccaggacctcagcggcgagatactccagcacggcg 500 |||| ||| ||||||||||| | ||| || ||||| |||||||| ||||| || |||||| Sbjct: 221 tcccgcgccgcgttcccggcgagctcaagaacctcggcggcgaggtactcgaggacggcg 162 Query: 501 gcgaggtagacgggagcgccggcgccaaccctctcggcgtacttgccggccttgaggaac 560 |||||||||||||| ||||||||||| || | ||||||||||||||||||||||||||| Sbjct: 161 gcgaggtagacgggggcgccggcgccgacgcgctcggcgtacttgccggccttgaggaag 102 Query: 561 cgcgcgatcctgccgacgggaaactggagcccggccttggagctcctggagatagccttc 620 || ||||||||||||||||| ||||||||||||||||||||||||| || | |||||| Sbjct: 101 cgggcgatcctgccgacggggaactggagcccggccttggagctccgcgacgtggccttc 42 Query: 621 ttggcggcgccggagccgatagccttgcccct 652 |||||||||| |||||||| ||||||||||| Sbjct: 41 ttggcggcgctcgagccgatcgccttgcccct 10
>gb|AY108339.1| Zea mays PCO070432 mRNA sequence Length = 811 Score = 383 bits (193), Expect = e-103 Identities = 333/379 (87%), Gaps = 3/379 (0%) Strand = Plus / Minus Query: 271 cagccgcggccttggcgctgcctccggc---cttcttggggagcagaaggttgtggatgt 327 ||||||| |||||||| ||||| ||| | ||||||||| | ||| ||||| ||||||| Sbjct: 504 cagccgcagccttggcactgccgccgccagacttcttgggcaacagcaggttatggatgt 445 Query: 328 tgggcatgacaccgccgctggcgattgtgaccataccgagcaggcgggagagctcctcgt 387 ||||||||||||| ||||||||||| || ||| | || |||| ||||||||||||||||| Sbjct: 444 tgggcatgacaccaccgctggcgatggtcaccgtgcccagcaagcgggagagctcctcgt 385 Query: 388 cgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttcttgttgtccctcg 447 ||||||||||||| |||||||| || ||||| ||||||||||||||||||||||||| | Sbjct: 384 cgttgcggacggcgagctggatgtggcgcgggacgatgcgggtcttcttgttgtcccgag 325 Query: 448 cggcgttcccggccaactccaggacctcagcggcgagatactccagcacggcggcgaggt 507 | ||||||||||| | ||| || |||||||| || |||||||| |||||||| ||||||| Sbjct: 324 ccgcgttcccggcaagctcgagaacctcagcagcaagatactcgagcacggcagcgaggt 265 Query: 508 agacgggagcgccggcgccaaccctctcggcgtacttgccggccttgaggaaccgcgcga 567 ||||||| ||||||||||| |||||||||||||||||||||||||||||||||| |||| Sbjct: 264 agacgggggcgccggcgccgaccctctcggcgtacttgccggccttgaggaacctggcga 205 Query: 568 tcctgccgacgggaaactggagcccggccttggagctcctggagatagccttcttggcgg 627 |||| || || || ||||||||||||||||||||||||||||| || ||||||||||||| Sbjct: 204 tccttcccactgggaactggagcccggccttggagctcctggacatggccttcttggcgg 145 Query: 628 cgccggagccgatagcctt 646 | || |||||||| ||||| Sbjct: 144 cccctgagccgatcgcctt 126
>dbj|AK071511.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023096P04, full insert sequence Length = 824 Score = 335 bits (169), Expect = 1e-88 Identities = 307/353 (86%) Strand = Plus / Minus Query: 294 ccggccttcttggggagcagaaggttgtggatgttgggcatgacaccgccgctggcgatt 353 ||||||||||||||||| || | | |||||||||||||||||| |||||||||||||| Sbjct: 483 ccggccttcttggggaggaggtgctggtggatgttgggcatgacgccgccgctggcgatg 424 Query: 354 gtgaccataccgagcaggcgggagagctcctcgtcgttgcggacggcaagctggatatgt 413 ||| | |||||||| || |||||||||||||||||| || || |||||||| || Sbjct: 423 gtggcgccgccgagcagcttggtgagctcctcgtcgttgcgcaccgcgagctggatgtgg 364 Query: 414 cgcggcacgatgcgggtcttcttgttgtccctcgcggcgttcccggccaactccaggacc 473 |||||||| |||||||||||||||||||||||||| ||||||||||| | |||||| ||| Sbjct: 363 cgcggcacaatgcgggtcttcttgttgtccctcgccgcgttcccggcgagctccagcacc 304 Query: 474 tcagcggcgagatactccagcacggcggcgaggtagacgggagcgccggcgccaaccctc 533 || |||||||| ||||| || |||||||||||||||||||||||||||||||| || | | Sbjct: 303 tcggcggcgaggtactcgaggacggcggcgaggtagacgggagcgccggcgccgacgcgc 244 Query: 534 tcggcgtacttgccggccttgaggaaccgcgcgatcctgccgacgggaaactggagcccg 593 |||||||||||||||||||||||||||| |||||||| |||||||| ||||| |||||| Sbjct: 243 tcggcgtacttgccggccttgaggaacctggcgatcctcccgacggggaactgcagcccg 184 Query: 594 gccttggagctcctggagatagccttcttggcggcgccggagccgatagcctt 646 |||||||||||||| || | |||||||| ||||| |||| |||||| ||||| Sbjct: 183 gccttggagctcctcgacgtcgccttcttcgcggccccggcgccgatcgcctt 131
>dbj|AK058913.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-009-A01, full insert sequence Length = 733 Score = 335 bits (169), Expect = 1e-88 Identities = 307/353 (86%) Strand = Plus / Minus Query: 294 ccggccttcttggggagcagaaggttgtggatgttgggcatgacaccgccgctggcgatt 353 ||||||||||||||||| || | | |||||||||||||||||| |||||||||||||| Sbjct: 482 ccggccttcttggggaggaggtgctggtggatgttgggcatgacgccgccgctggcgatg 423 Query: 354 gtgaccataccgagcaggcgggagagctcctcgtcgttgcggacggcaagctggatatgt 413 ||| | |||||||| || |||||||||||||||||| || || |||||||| || Sbjct: 422 gtggcgccgccgagcagcttggtgagctcctcgtcgttgcgcaccgcgagctggatgtgg 363 Query: 414 cgcggcacgatgcgggtcttcttgttgtccctcgcggcgttcccggccaactccaggacc 473 |||||||| |||||||||||||||||||||||||| ||||||||||| | |||||| ||| Sbjct: 362 cgcggcacaatgcgggtcttcttgttgtccctcgccgcgttcccggcgagctccagcacc 303 Query: 474 tcagcggcgagatactccagcacggcggcgaggtagacgggagcgccggcgccaaccctc 533 || |||||||| ||||| || |||||||||||||||||||||||||||||||| || | | Sbjct: 302 tcggcggcgaggtactcgaggacggcggcgaggtagacgggagcgccggcgccgacgcgc 243 Query: 534 tcggcgtacttgccggccttgaggaaccgcgcgatcctgccgacgggaaactggagcccg 593 |||||||||||||||||||||||||||| |||||||| |||||||| ||||| |||||| Sbjct: 242 tcggcgtacttgccggccttgaggaacctggcgatcctcccgacggggaactgcagcccg 183 Query: 594 gccttggagctcctggagatagccttcttggcggcgccggagccgatagcctt 646 |||||||||||||| || | |||||||| ||||| |||| |||||| ||||| Sbjct: 182 gccttggagctcctcgacgtcgccttcttcgcggccccggcgccgatcgcctt 130
>gb|AY104637.1| Zea mays PCO070433 mRNA sequence Length = 767 Score = 335 bits (169), Expect = 1e-88 Identities = 327/379 (86%), Gaps = 3/379 (0%) Strand = Plus / Minus Query: 271 cagccgcggccttggcgctgcctccg---gccttcttggggagcagaaggttgtggatgt 327 ||||||| |||||||||||||| ||| |||||||| ||||| || ||||| ||||||| Sbjct: 504 cagccgcagccttggcgctgccgccgccggccttcttcgggagaagcaggttatggatgt 445 Query: 328 tgggcatgacaccgccgctggcgattgtgaccataccgagcaggcgggagagctcctcgt 387 ||||||||||||| ||||| ||||| || ||| | || |||| |||||||||||| |||| Sbjct: 444 tgggcatgacaccaccgctagcgatggtcaccgtgcccagcaagcgggagagctcttcgt 385 Query: 388 cgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttcttgttgtccctcg 447 ||||||||||||| |||||||| || ||||| ||||||||||||||||||||||| | | Sbjct: 384 cgttgcggacggcgagctggatgtggcgcggtacgatgcgggtcttcttgttgtcacgtg 325 Query: 448 cggcgttcccggccaactccaggacctcagcggcgagatactccagcacggcggcgaggt 507 | || || ||||||| ||| || |||||||| || |||||||| |||||||| ||||||| Sbjct: 324 ccgcattgccggccagctcaagaacctcagcagcaagatactcgagcacggcagcgaggt 265 Query: 508 agacgggagcgccggcgccaaccctctcggcgtacttgccggccttgaggaaccgcgcga 567 |||| || ||||||||||| || |||||||| |||||||||||||||||||||| |||| Sbjct: 264 agacaggggcgccggcgccgactctctcggcatacttgccggccttgaggaacctggcga 205 Query: 568 tcctgccgacgggaaactggagcccggccttggagctcctggagatagccttcttggcgg 627 |||| || ||||| |||||||| || ||||||||||||||||| | ||||||||||||| Sbjct: 204 tccttcccacggggaactggaggccagccttggagctcctggacgtggccttcttggcgg 145 Query: 628 cgccggagccgatagcctt 646 |||| |||||||| ||||| Sbjct: 144 cgcctgagccgatcgcctt 126
>ref|XM_478632.1| Oryza sativa (japonica cultivar-group), mRNA Length = 823 Score = 295 bits (149), Expect = 9e-77 Identities = 302/353 (85%) Strand = Plus / Minus Query: 294 ccggccttcttggggagcagaaggttgtggatgttgggcatgacaccgccgctggcgatt 353 ||||||||||||||||| || | | ||||||||||||||| || |||||||||||||| Sbjct: 517 ccggccttcttggggaggaggtgctggtggatgttgggcatcacgccgccgctggcgatg 458 Query: 354 gtgaccataccgagcaggcgggagagctcctcgtcgttgcggacggcaagctggatatgt 413 ||| | |||||||| || | ||||||||||||||| || || |||||||| || Sbjct: 457 gtggcgccgccgagcagcttggtcaactcctcgtcgttgcgcaccgcgagctggatgtgg 398 Query: 414 cgcggcacgatgcgggtcttcttgttgtccctcgcggcgttcccggccaactccaggacc 473 ||||||||||||||||||||||||||||||||||| ||||||||||| | ||| || ||| Sbjct: 397 cgcggcacgatgcgggtcttcttgttgtccctcgccgcgttcccggcgagctcgagcacc 338 Query: 474 tcagcggcgagatactccagcacggcggcgaggtagacgggagcgccggcgccaaccctc 533 ||||||||||| ||||| || |||||||||||||||||||| || |||||||| || | | Sbjct: 337 tcagcggcgaggtactcgaggacggcggcgaggtagacgggggccccggcgccgacgcgc 278 Query: 534 tcggcgtacttgccggccttgaggaaccgcgcgatcctgccgacgggaaactggagcccg 593 ||||||||||| |||||||||||||||| |||||||||||| ||||| ||||| |||||| Sbjct: 277 tcggcgtacttcccggccttgaggaacctcgcgatcctgccaacggggaactgcagcccg 218 Query: 594 gccttggagctcctggagatagccttcttggcggcgccggagccgatagcctt 646 |||||||||||||| || | |||||||| ||||| || | |||||| ||||| Sbjct: 217 gccttggagctcctcgacgtcgccttcttcgcggcccccgcgccgatcgcctt 165
>dbj|AK099888.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013112I10, full insert sequence Length = 823 Score = 295 bits (149), Expect = 9e-77 Identities = 302/353 (85%) Strand = Plus / Minus Query: 294 ccggccttcttggggagcagaaggttgtggatgttgggcatgacaccgccgctggcgatt 353 ||||||||||||||||| || | | ||||||||||||||| || |||||||||||||| Sbjct: 517 ccggccttcttggggaggaggtgctggtggatgttgggcatcacgccgccgctggcgatg 458 Query: 354 gtgaccataccgagcaggcgggagagctcctcgtcgttgcggacggcaagctggatatgt 413 ||| | |||||||| || | ||||||||||||||| || || |||||||| || Sbjct: 457 gtggcgccgccgagcagcttggtcaactcctcgtcgttgcgcaccgcgagctggatgtgg 398 Query: 414 cgcggcacgatgcgggtcttcttgttgtccctcgcggcgttcccggccaactccaggacc 473 ||||||||||||||||||||||||||||||||||| ||||||||||| | ||| || ||| Sbjct: 397 cgcggcacgatgcgggtcttcttgttgtccctcgccgcgttcccggcgagctcgagcacc 338 Query: 474 tcagcggcgagatactccagcacggcggcgaggtagacgggagcgccggcgccaaccctc 533 ||||||||||| ||||| || |||||||||||||||||||| || |||||||| || | | Sbjct: 337 tcagcggcgaggtactcgaggacggcggcgaggtagacgggggccccggcgccgacgcgc 278 Query: 534 tcggcgtacttgccggccttgaggaaccgcgcgatcctgccgacgggaaactggagcccg 593 ||||||||||| |||||||||||||||| |||||||||||| ||||| ||||| |||||| Sbjct: 277 tcggcgtacttcccggccttgaggaacctcgcgatcctgccaacggggaactgcagcccg 218 Query: 594 gccttggagctcctggagatagccttcttggcggcgccggagccgatagcctt 646 |||||||||||||| || | |||||||| ||||| || | |||||| ||||| Sbjct: 217 gccttggagctcctcgacgtcgccttcttcgcggcccccgcgccgatcgcctt 165
>dbj|AK058540.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-017-B06, full insert sequence Length = 1718 Score = 295 bits (149), Expect = 9e-77 Identities = 302/353 (85%) Strand = Plus / Minus Query: 294 ccggccttcttggggagcagaaggttgtggatgttgggcatgacaccgccgctggcgatt 353 ||||||||||||||||| || | | ||||||||||||||| || |||||||||||||| Sbjct: 518 ccggccttcttggggaggaggtgctggtggatgttgggcatcacgccgccgctggcgatg 459 Query: 354 gtgaccataccgagcaggcgggagagctcctcgtcgttgcggacggcaagctggatatgt 413 ||| | |||||||| || | ||||||||||||||| || || |||||||| || Sbjct: 458 gtggcgccgccgagcagcttggtcaactcctcgtcgttgcgcaccgcgagctggatgtgg 399 Query: 414 cgcggcacgatgcgggtcttcttgttgtccctcgcggcgttcccggccaactccaggacc 473 ||||||||||||||||||||||||||||||||||| ||||||||||| | ||| || ||| Sbjct: 398 cgcggcacgatgcgggtcttcttgttgtccctcgccgcgttcccggcgagctcgagcacc 339 Query: 474 tcagcggcgagatactccagcacggcggcgaggtagacgggagcgccggcgccaaccctc 533 ||||||||||| ||||| || |||||||||||||||||||| || |||||||| || | | Sbjct: 338 tcagcggcgaggtactcgaggacggcggcgaggtagacgggggccccggcgccgacgcgc 279 Query: 534 tcggcgtacttgccggccttgaggaaccgcgcgatcctgccgacgggaaactggagcccg 593 ||||||||||| |||||||||||||||| |||||||||||| ||||| ||||| |||||| Sbjct: 278 tcggcgtacttcccggccttgaggaacctcgcgatcctgccaacggggaactgcagcccg 219 Query: 594 gccttggagctcctggagatagccttcttggcggcgccggagccgatagcctt 646 |||||||||||||| || | |||||||| ||||| || | |||||| ||||| Sbjct: 218 gccttggagctcctcgacgtcgccttcttcgcggcccccgcgccgatcgcctt 166
>gb|AY104826.1| Zea mays PCO099353 mRNA sequence Length = 793 Score = 295 bits (149), Expect = 9e-77 Identities = 302/353 (85%) Strand = Plus / Minus Query: 297 gccttcttggggagcagaaggttgtggatgttgggcatgacaccgccgctggcgattgtg 356 |||||||||||||| || | | ||||||||||||||| || |||||||| ||||| ||| Sbjct: 464 gccttcttggggaggaggtgctggtggatgttgggcataacgccgccgctcgcgatggtg 405 Query: 357 accataccgagcaggcgggagagctcctcgtcgttgcggacggcaagctggatatgtcgc 416 | ||| ||||| || ||||||||||||||||| ||||| |||||||| || ||| Sbjct: 404 gcaccaccaagcagcttggtcagctcctcgtcgttgcgcacggcgagctggatgtgacgc 345 Query: 417 ggcacgatgcgggtcttcttgttgtccctcgcggcgttcccggccaactccaggacctca 476 ||||||||||||||||||||||| |||||||| |||||||| || | ||||||||||||| Sbjct: 344 ggcacgatgcgggtcttcttgttatccctcgctgcgttcccagcaagctccaggacctca 285 Query: 477 gcggcgagatactccagcacggcggcgaggtagacgggagcgccggcgccaaccctctcg 536 |||||||| ||||| || || || ||||||||||| || ||||||||||| || | |||| Sbjct: 284 gcggcgaggtactcgaggacagctgcgaggtagacaggggcgccggcgcccacgcgctcg 225 Query: 537 gcgtacttgccggccttgaggaaccgcgcgatcctgccgacgggaaactggagcccggcc 596 |||||||||||||||||||||||||| ||||||||||||||||||||||| ||||| ||| Sbjct: 224 gcgtacttgccggccttgaggaaccgagcgatcctgccgacgggaaactgcagcccagcc 165 Query: 597 ttggagctcctggagatagccttcttggcggcgccggagccgatagccttgcc 649 ||||||||||| || | |||||||| ||||| || | ||| || |||||||| Sbjct: 164 ttggagctccttgacgttgccttcttcgcggcaccagcgccaatcgccttgcc 112
>gb|AY104828.1| Zea mays PCO072413 mRNA sequence Length = 741 Score = 280 bits (141), Expect = 6e-72 Identities = 300/353 (84%) Strand = Plus / Minus Query: 297 gccttcttggggagcagaaggttgtggatgttgggcatgacaccgccgctggcgattgtg 356 |||||||||||||||||| | | |||||||| ||||| ||||| ||||| ||||| ||| Sbjct: 422 gccttcttggggagcagatgctgatggatgttaggcataacacctccgctcgcgatggtg 363 Query: 357 accataccgagcaggcgggagagctcctcgtcgttgcggacggcaagctggatatgtcgc 416 | ||| | ||| || ||||||||||||||||| || ||||||||||| || ||| Sbjct: 362 gcaccacccaacagtttggtcagctcctcgtcgttgcgcacagcaagctggatgtggcgc 303 Query: 417 ggcacgatgcgggtcttcttgttgtccctcgcggcgttcccggccaactccaggacctca 476 ||||| |||||||||||||||||||||||||||||||||||||| | || || |||||| Sbjct: 302 ggcacaatgcgggtcttcttgttgtccctcgcggcgttcccggcaagttcgagaacctca 243 Query: 477 gcggcgagatactccagcacggcggcgaggtagacgggagcgccggcgccaaccctctcg 536 || ||||| ||||| || |||||||||||||| ||||| ||||||||||| || | ||| Sbjct: 242 gccgcgaggtactcgaggacggcggcgaggtacacgggggcgccggcgccgacgcgctcc 183 Query: 537 gcgtacttgccggccttgaggaaccgcgcgatcctgccgacgggaaactggagcccggcc 596 ||||||||||| ||||||||||||| || |||||||||||||| |||||||| |||||| Sbjct: 182 gcgtacttgcccgccttgaggaacctggcaatcctgccgacggggaactggagtccggcc 123 Query: 597 ttggagctcctggagatagccttcttggcggcgccggagccgatagccttgcc 649 ||||||||||| || | |||||||| |||||||| | ||||||||||||||| Sbjct: 122 ttggagctcctcgacgttgccttcttcgcggcgccagcgccgatagccttgcc 70
>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete sequence Length = 29644043 Score = 254 bits (128), Expect = 3e-64 Identities = 173/188 (92%) Strand = Plus / Minus Query: 273 gccgcggccttggcgctgcctccggccttcttggggagcagaaggttgtggatgttgggc 332 ||||| |||||||||||||| ||||||||||||||||| || |||||||||||||||||| Sbjct: 21539692 gccgccgccttggcgctgccgccggccttcttggggaggagcaggttgtggatgttgggc 21539633 Query: 333 atgacaccgccgctggcgattgtgaccataccgagcaggcgggagagctcctcgtcgttg 392 ||||| || |||||||||||||||||| | |||||||||||||| ||||||||||||||| Sbjct: 21539632 atgacgcctccgctggcgattgtgaccgtgccgagcaggcgggatagctcctcgtcgttg 21539573 Query: 393 cggacggcaagctggatatgtcgcggcacgatgcgggtcttcttgttgtccctcgcggcg 452 |||||||| |||||||| || || ||||| |||||||||||||||||||||||||| ||| Sbjct: 21539572 cggacggcgagctggatgtggcggggcactatgcgggtcttcttgttgtccctcgccgcg 21539513 Query: 453 ttcccggc 460 |||||||| Sbjct: 21539512 ttcccggc 21539505 Score = 214 bits (108), Expect = 3e-52 Identities = 159/176 (90%) Strand = Plus / Minus Query: 471 acctcagcggcgagatactccagcacggcggcgaggtagacgggagcgccggcgccaacc 530 |||||||||||||| ||||| || ||||||||||||||||| || ||||||||||| ||| Sbjct: 21539259 acctcagcggcgaggtactcgaggacggcggcgaggtagaccggggcgccggcgccgacc 21539200 Query: 531 ctctcggcgtacttgccggccttgaggaaccgcgcgatcctgccgacgggaaactggagc 590 ||||||||||||||||||||||| | |||||| ||||||||||| ||||| ||||||||| Sbjct: 21539199 ctctcggcgtacttgccggccttcaagaaccgggcgatcctgcccacggggaactggagc 21539140 Query: 591 ccggccttggagctcctggagatagccttcttggcggcgccggagccgatagcctt 646 |||||||||||||||| || || ||||||||||||||||| |||||||| ||||| Sbjct: 21539139 ccggccttggagctccgcgacatggccttcttggcggcgcccgagccgatcgcctt 21539084 Score = 174 bits (88), Expect = 2e-40 Identities = 154/176 (87%) Strand = Plus / Minus Query: 471 acctcagcggcgagatactccagcacggcggcgaggtagacgggagcgccggcgccaacc 530 |||||||||||||| ||||| || |||||||||||||||||||| || |||||||| || Sbjct: 21536579 acctcagcggcgaggtactcgaggacggcggcgaggtagacgggggccccggcgccgacg 21536520 Query: 531 ctctcggcgtacttgccggccttgaggaaccgcgcgatcctgccgacgggaaactggagc 590 | |||||||||||| |||||||||||||||| |||||||||||| ||||| ||||| ||| Sbjct: 21536519 cgctcggcgtacttcccggccttgaggaacctcgcgatcctgccaacggggaactgcagc 21536460 Query: 591 ccggccttggagctcctggagatagccttcttggcggcgccggagccgatagcctt 646 ||||||||||||||||| || | |||||||| ||||| || | |||||| ||||| Sbjct: 21536459 ccggccttggagctcctcgacgtcgccttcttcgcggcccccgcgccgatcgcctt 21536404 Score = 133 bits (67), Expect = 8e-28 Identities = 142/167 (85%) Strand = Plus / Minus Query: 294 ccggccttcttggggagcagaaggttgtggatgttgggcatgacaccgccgctggcgatt 353 ||||||||||||||||| || | | ||||||||||||||| || |||||||||||||| Sbjct: 21537032 ccggccttcttggggaggaggtgctggtggatgttgggcatcacgccgccgctggcgatg 21536973 Query: 354 gtgaccataccgagcaggcgggagagctcctcgtcgttgcggacggcaagctggatatgt 413 ||| | |||||||| || | ||||||||||||||| || || |||||||| || Sbjct: 21536972 gtggcgccgccgagcagcttggtcaactcctcgtcgttgcgcaccgcgagctggatgtgg 21536913 Query: 414 cgcggcacgatgcgggtcttcttgttgtccctcgcggcgttcccggc 460 ||||||||||||||||||||||||||||||||||| ||||||||||| Sbjct: 21536912 cgcggcacgatgcgggtcttcttgttgtccctcgccgcgttcccggc 21536866 Score = 42.1 bits (21), Expect = 2.3 Identities = 24/25 (96%) Strand = Plus / Plus Query: 575 gacgggaaactggagcccggccttg 599 |||||| |||||||||||||||||| Sbjct: 22313912 gacgggcaactggagcccggccttg 22313936
>dbj|AP003838.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OJ1582_D10 Length = 103475 Score = 254 bits (128), Expect = 3e-64 Identities = 173/188 (92%) Strand = Plus / Minus Query: 273 gccgcggccttggcgctgcctccggccttcttggggagcagaaggttgtggatgttgggc 332 ||||| |||||||||||||| ||||||||||||||||| || |||||||||||||||||| Sbjct: 77476 gccgccgccttggcgctgccgccggccttcttggggaggagcaggttgtggatgttgggc 77417 Query: 333 atgacaccgccgctggcgattgtgaccataccgagcaggcgggagagctcctcgtcgttg 392 ||||| || |||||||||||||||||| | |||||||||||||| ||||||||||||||| Sbjct: 77416 atgacgcctccgctggcgattgtgaccgtgccgagcaggcgggatagctcctcgtcgttg 77357 Query: 393 cggacggcaagctggatatgtcgcggcacgatgcgggtcttcttgttgtccctcgcggcg 452 |||||||| |||||||| || || ||||| |||||||||||||||||||||||||| ||| Sbjct: 77356 cggacggcgagctggatgtggcggggcactatgcgggtcttcttgttgtccctcgccgcg 77297 Query: 453 ttcccggc 460 |||||||| Sbjct: 77296 ttcccggc 77289 Score = 214 bits (108), Expect = 3e-52 Identities = 159/176 (90%) Strand = Plus / Minus Query: 471 acctcagcggcgagatactccagcacggcggcgaggtagacgggagcgccggcgccaacc 530 |||||||||||||| ||||| || ||||||||||||||||| || ||||||||||| ||| Sbjct: 77043 acctcagcggcgaggtactcgaggacggcggcgaggtagaccggggcgccggcgccgacc 76984 Query: 531 ctctcggcgtacttgccggccttgaggaaccgcgcgatcctgccgacgggaaactggagc 590 ||||||||||||||||||||||| | |||||| ||||||||||| ||||| ||||||||| Sbjct: 76983 ctctcggcgtacttgccggccttcaagaaccgggcgatcctgcccacggggaactggagc 76924 Query: 591 ccggccttggagctcctggagatagccttcttggcggcgccggagccgatagcctt 646 |||||||||||||||| || || ||||||||||||||||| |||||||| ||||| Sbjct: 76923 ccggccttggagctccgcgacatggccttcttggcggcgcccgagccgatcgcctt 76868 Score = 174 bits (88), Expect = 2e-40 Identities = 154/176 (87%) Strand = Plus / Minus Query: 471 acctcagcggcgagatactccagcacggcggcgaggtagacgggagcgccggcgccaacc 530 |||||||||||||| ||||| || |||||||||||||||||||| || |||||||| || Sbjct: 74363 acctcagcggcgaggtactcgaggacggcggcgaggtagacgggggccccggcgccgacg 74304 Query: 531 ctctcggcgtacttgccggccttgaggaaccgcgcgatcctgccgacgggaaactggagc 590 | |||||||||||| |||||||||||||||| |||||||||||| ||||| ||||| ||| Sbjct: 74303 cgctcggcgtacttcccggccttgaggaacctcgcgatcctgccaacggggaactgcagc 74244 Query: 591 ccggccttggagctcctggagatagccttcttggcggcgccggagccgatagcctt 646 ||||||||||||||||| || | |||||||| ||||| || | |||||| ||||| Sbjct: 74243 ccggccttggagctcctcgacgtcgccttcttcgcggcccccgcgccgatcgcctt 74188 Score = 133 bits (67), Expect = 8e-28 Identities = 142/167 (85%) Strand = Plus / Minus Query: 294 ccggccttcttggggagcagaaggttgtggatgttgggcatgacaccgccgctggcgatt 353 ||||||||||||||||| || | | ||||||||||||||| || |||||||||||||| Sbjct: 74816 ccggccttcttggggaggaggtgctggtggatgttgggcatcacgccgccgctggcgatg 74757 Query: 354 gtgaccataccgagcaggcgggagagctcctcgtcgttgcggacggcaagctggatatgt 413 ||| | |||||||| || | ||||||||||||||| || || |||||||| || Sbjct: 74756 gtggcgccgccgagcagcttggtcaactcctcgtcgttgcgcaccgcgagctggatgtgg 74697 Query: 414 cgcggcacgatgcgggtcttcttgttgtccctcgcggcgttcccggc 460 ||||||||||||||||||||||||||||||||||| ||||||||||| Sbjct: 74696 cgcggcacgatgcgggtcttcttgttgtccctcgccgcgttcccggc 74650
>dbj|AK064299.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-107-A07, full insert sequence Length = 724 Score = 224 bits (113), Expect = 3e-55 Identities = 194/221 (87%) Strand = Plus / Minus Query: 378 agctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttcttg 437 ||||||||||||||||| || || |||||||| || ||||||||||| | | |||||||| Sbjct: 397 agctcctcgtcgttgcgcaccgccagctggatgtgccgcggcacgatcctgttcttcttg 338 Query: 438 ttgtccctcgcggcgttcccggccaactccaggacctcagcggcgagatactccagcacg 497 ||||||||||| ||||||||||||| |||||| ||||| |||||||| ||||| || ||| Sbjct: 337 ttgtccctcgccgcgttcccggccagctccagcacctcggcggcgaggtactcgaggacg 278 Query: 498 gcggcgaggtagacgggagcgccggcgccaaccctctcggcgtacttgccggccttgagg 557 |||| |||||||||||| ||||||||||| || | ||| ||||||||||||||||||||| Sbjct: 277 gcggagaggtagacgggggcgccggcgccgacgcgctccgcgtacttgccggccttgagg 218 Query: 558 aaccgcgcgatcctgccgacgggaaactggagcccggcctt 598 | || ||||| | ||||||||| ||||||||||||||||| Sbjct: 217 tagcgggcgatgcggccgacggggaactggagcccggcctt 177
>dbj|AK121752.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033087P07, full insert sequence Length = 747 Score = 222 bits (112), Expect = 1e-54 Identities = 196/224 (87%) Strand = Plus / Minus Query: 378 agctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttcttg 437 ||||||||||||||||| || || |||||||| || | ||||||||| ||| |||||||| Sbjct: 400 agctcctcgtcgttgcgcaccgccagctggatgtgcctcggcacgatccggttcttcttg 341 Query: 438 ttgtccctcgcggcgttcccggccaactccaggacctcagcggcgagatactccagcacg 497 ||||||||||| |||||||| |||| |||||| ||||| |||||||| ||||| || ||| Sbjct: 340 ttgtccctcgccgcgttccccgccagctccagcacctcggcggcgaggtactcgaggacg 281 Query: 498 gcggcgaggtagacgggagcgccggcgccaaccctctcggcgtacttgccggccttgagg 557 |||| |||||||||||| ||||||||||| || | ||||||||||||||||||||||||| Sbjct: 280 gcggagaggtagacgggggcgccggcgccgacgcgctcggcgtacttgccggccttgagg 221 Query: 558 aaccgcgcgatcctgccgacgggaaactggagcccggccttgga 601 ||| ||||| | ||||||||| |||||||| ||||||||||| Sbjct: 220 tacctggcgatgcggccgacggggaactggaggccggccttgga 177
>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete sequence Length = 28434780 Score = 210 bits (106), Expect = 4e-51 Identities = 163/182 (89%) Strand = Plus / Minus Query: 471 acctcagcggcgagatactccagcacggcggcgaggtagacgggagcgccggcgccaacc 530 ||||| |||||||| ||||| || |||||||||||||||||||| ||||||||||| || Sbjct: 20566250 acctcggcggcgaggtactcgaggacggcggcgaggtagacgggggcgccggcgccgacg 20566191 Query: 531 ctctcggcgtacttgccggccttgaggaaccgcgcgatcctgccgacgggaaactggagc 590 | ||||||||||||||||||||||||||| || ||||||||||||||||| ||||||||| Sbjct: 20566190 cgctcggcgtacttgccggccttgaggaagcgggcgatcctgccgacggggaactggagc 20566131 Query: 591 ccggccttggagctcctggagatagccttcttggcggcgccggagccgatagccttgccc 650 |||||||||||||||| || | |||||||||||||||| |||||||| ||||||||| Sbjct: 20566130 ccggccttggagctccgcgacgtggccttcttggcggcgctcgagccgatcgccttgccc 20566071 Query: 651 ct 652 || Sbjct: 20566070 ct 20566069 Score = 190 bits (96), Expect = 4e-45 Identities = 174/200 (87%) Strand = Plus / Minus Query: 261 tcgtcatcggcagccgcggccttggcgctgcctccggccttcttggggagcagaaggttg 320 ||||| ||||| || ||||||||||||||| ||||||||||||||||| || |||||| Sbjct: 20566557 tcgtcgtcggcggcggcggccttggcgctggagccggccttcttggggaggagcaggttg 20566498 Query: 321 tggatgttgggcatgacaccgccgctggcgattgtgaccataccgagcaggcgggagagc 380 ||||||||||||||||| |||||| ||||||| ||||| ||||||||||| || ||| Sbjct: 20566497 tggatgttgggcatgacgccgccgttggcgatggtgacggcgccgagcaggcgcgacagc 20566438 Query: 381 tcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttcttgttg 440 |||||||||||||| ||||| |||||||| || | ||||||||| || |||||||||||| Sbjct: 20566437 tcctcgtcgttgcgcacggcgagctggatgtgcctcggcacgatccgcgtcttcttgttg 20566378 Query: 441 tccctcgcggcgttcccggc 460 |||| ||| ||||||||||| Sbjct: 20566377 tcccgcgccgcgttcccggc 20566358 Score = 40.1 bits (20), Expect = 8.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 106 tacgtactactcctagtaaa 125 |||||||||||||||||||| Sbjct: 3543090 tacgtactactcctagtaaa 3543109
>dbj|AP005734.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC clone:OSJNBb0032E15 Length = 120419 Score = 210 bits (106), Expect = 4e-51 Identities = 163/182 (89%) Strand = Plus / Minus Query: 471 acctcagcggcgagatactccagcacggcggcgaggtagacgggagcgccggcgccaacc 530 ||||| |||||||| ||||| || |||||||||||||||||||| ||||||||||| || Sbjct: 70211 acctcggcggcgaggtactcgaggacggcggcgaggtagacgggggcgccggcgccgacg 70152 Query: 531 ctctcggcgtacttgccggccttgaggaaccgcgcgatcctgccgacgggaaactggagc 590 | ||||||||||||||||||||||||||| || ||||||||||||||||| ||||||||| Sbjct: 70151 cgctcggcgtacttgccggccttgaggaagcgggcgatcctgccgacggggaactggagc 70092 Query: 591 ccggccttggagctcctggagatagccttcttggcggcgccggagccgatagccttgccc 650 |||||||||||||||| || | |||||||||||||||| |||||||| ||||||||| Sbjct: 70091 ccggccttggagctccgcgacgtggccttcttggcggcgctcgagccgatcgccttgccc 70032 Query: 651 ct 652 || Sbjct: 70031 ct 70030 Score = 190 bits (96), Expect = 4e-45 Identities = 174/200 (87%) Strand = Plus / Minus Query: 261 tcgtcatcggcagccgcggccttggcgctgcctccggccttcttggggagcagaaggttg 320 ||||| ||||| || ||||||||||||||| ||||||||||||||||| || |||||| Sbjct: 70518 tcgtcgtcggcggcggcggccttggcgctggagccggccttcttggggaggagcaggttg 70459 Query: 321 tggatgttgggcatgacaccgccgctggcgattgtgaccataccgagcaggcgggagagc 380 ||||||||||||||||| |||||| ||||||| ||||| ||||||||||| || ||| Sbjct: 70458 tggatgttgggcatgacgccgccgttggcgatggtgacggcgccgagcaggcgcgacagc 70399 Query: 381 tcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttcttgttg 440 |||||||||||||| ||||| |||||||| || | ||||||||| || |||||||||||| Sbjct: 70398 tcctcgtcgttgcgcacggcgagctggatgtgcctcggcacgatccgcgtcttcttgttg 70339 Query: 441 tccctcgcggcgttcccggc 460 |||| ||| ||||||||||| Sbjct: 70338 tcccgcgccgcgttcccggc 70319
>dbj|AP003898.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC clone:OJ1663_D06 Length = 139103 Score = 210 bits (106), Expect = 4e-51 Identities = 163/182 (89%) Strand = Plus / Minus Query: 471 acctcagcggcgagatactccagcacggcggcgaggtagacgggagcgccggcgccaacc 530 ||||| |||||||| ||||| || |||||||||||||||||||| ||||||||||| || Sbjct: 40622 acctcggcggcgaggtactcgaggacggcggcgaggtagacgggggcgccggcgccgacg 40563 Query: 531 ctctcggcgtacttgccggccttgaggaaccgcgcgatcctgccgacgggaaactggagc 590 | ||||||||||||||||||||||||||| || ||||||||||||||||| ||||||||| Sbjct: 40562 cgctcggcgtacttgccggccttgaggaagcgggcgatcctgccgacggggaactggagc 40503 Query: 591 ccggccttggagctcctggagatagccttcttggcggcgccggagccgatagccttgccc 650 |||||||||||||||| || | |||||||||||||||| |||||||| ||||||||| Sbjct: 40502 ccggccttggagctccgcgacgtggccttcttggcggcgctcgagccgatcgccttgccc 40443 Query: 651 ct 652 || Sbjct: 40442 ct 40441 Score = 190 bits (96), Expect = 4e-45 Identities = 174/200 (87%) Strand = Plus / Minus Query: 261 tcgtcatcggcagccgcggccttggcgctgcctccggccttcttggggagcagaaggttg 320 ||||| ||||| || ||||||||||||||| ||||||||||||||||| || |||||| Sbjct: 40929 tcgtcgtcggcggcggcggccttggcgctggagccggccttcttggggaggagcaggttg 40870 Query: 321 tggatgttgggcatgacaccgccgctggcgattgtgaccataccgagcaggcgggagagc 380 ||||||||||||||||| |||||| ||||||| ||||| ||||||||||| || ||| Sbjct: 40869 tggatgttgggcatgacgccgccgttggcgatggtgacggcgccgagcaggcgcgacagc 40810 Query: 381 tcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttcttgttg 440 |||||||||||||| ||||| |||||||| || | ||||||||| || |||||||||||| Sbjct: 40809 tcctcgtcgttgcgcacggcgagctggatgtgcctcggcacgatccgcgtcttcttgttg 40750 Query: 441 tccctcgcggcgttcccggc 460 |||| ||| ||||||||||| Sbjct: 40749 tcccgcgccgcgttcccggc 40730
>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12, complete sequence Length = 27566993 Score = 190 bits (96), Expect = 4e-45 Identities = 156/176 (88%) Strand = Plus / Plus Query: 471 acctcagcggcgagatactccagcacggcggcgaggtagacgggagcgccggcgccaacc 530 ||||| |||||||| ||||| || |||||||||||||||||||||||||||||||| || Sbjct: 14468900 acctcggcggcgaggtactcgaggacggcggcgaggtagacgggagcgccggcgccgacg 14468959 Query: 531 ctctcggcgtacttgccggccttgaggaaccgcgcgatcctgccgacgggaaactggagc 590 | ||||||||||||||||||||||||||||| |||||||| |||||||| ||||| ||| Sbjct: 14468960 cgctcggcgtacttgccggccttgaggaacctggcgatcctcccgacggggaactgcagc 14469019 Query: 591 ccggccttggagctcctggagatagccttcttggcggcgccggagccgatagcctt 646 ||||||||||||||||| || | |||||||| ||||| |||| |||||| ||||| Sbjct: 14469020 ccggccttggagctcctcgacgtcgccttcttcgcggccccggcgccgatcgcctt 14469075 Score = 153 bits (77), Expect = 9e-34 Identities = 155/181 (85%) Strand = Plus / Plus Query: 294 ccggccttcttggggagcagaaggttgtggatgttgggcatgacaccgccgctggcgatt 353 ||||||||||||||||| || | | |||||||||||||||||| |||||||||||||| Sbjct: 14468520 ccggccttcttggggaggaggtgctggtggatgttgggcatgacgccgccgctggcgatg 14468579 Query: 354 gtgaccataccgagcaggcgggagagctcctcgtcgttgcggacggcaagctggatatgt 413 ||| | |||||||| || |||||||||||||||||| || || |||||||| || Sbjct: 14468580 gtggcgccgccgagcagcttggtgagctcctcgtcgttgcgcaccgcgagctggatgtgg 14468639 Query: 414 cgcggcacgatgcgggtcttcttgttgtccctcgcggcgttcccggccaactccaggacc 473 |||||||| |||||||||||||||||||||||||| ||||||||||| | |||||| ||| Sbjct: 14468640 cgcggcacaatgcgggtcttcttgttgtccctcgccgcgttcccggcgagctccagcacc 14468699 Query: 474 t 474 | Sbjct: 14468700 t 14468700 Score = 133 bits (67), Expect = 8e-28 Identities = 115/131 (87%) Strand = Plus / Plus Query: 471 acctcagcggcgagatactccagcacggcggcgaggtagacgggagcgccggcgccaacc 530 ||||| |||||||| ||||| || ||||||| |||||||||||| ||||||||||| || Sbjct: 20924703 acctcggcggcgaggtactcgaggacggcggagaggtagacgggggcgccggcgccgacg 20924762 Query: 531 ctctcggcgtacttgccggccttgaggaaccgcgcgatcctgccgacgggaaactggagc 590 | ||||||||||||||||||||||||| ||| ||||| | ||||||||| |||||||| Sbjct: 20924763 cgctcggcgtacttgccggccttgaggtacctggcgatgcggccgacggggaactggagg 20924822 Query: 591 ccggccttgga 601 ||||||||||| Sbjct: 20924823 ccggccttgga 20924833 Score = 97.6 bits (49), Expect = 4e-17 Identities = 85/97 (87%) Strand = Plus / Plus Query: 378 agctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttcttg 437 ||||||||||||||||| || || |||||||| || | ||||||||| ||| |||||||| Sbjct: 20924512 agctcctcgtcgttgcgcaccgccagctggatgtgcctcggcacgatccggttcttcttg 20924571 Query: 438 ttgtccctcgcggcgttcccggccaactccaggacct 474 ||||||||||| |||||||| |||| |||||| |||| Sbjct: 20924572 ttgtccctcgccgcgttccccgccagctccagcacct 20924608
>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence Length = 27492551 Score = 190 bits (96), Expect = 4e-45 Identities = 156/176 (88%) Strand = Plus / Plus Query: 471 acctcagcggcgagatactccagcacggcggcgaggtagacgggagcgccggcgccaacc 530 ||||| |||||||| ||||| || |||||||||||||||||||||||||||||||| || Sbjct: 14423184 acctcggcggcgaggtactcgaggacggcggcgaggtagacgggagcgccggcgccgacg 14423243 Query: 531 ctctcggcgtacttgccggccttgaggaaccgcgcgatcctgccgacgggaaactggagc 590 | ||||||||||||||||||||||||||||| |||||||| |||||||| ||||| ||| Sbjct: 14423244 cgctcggcgtacttgccggccttgaggaacctggcgatcctcccgacggggaactgcagc 14423303 Query: 591 ccggccttggagctcctggagatagccttcttggcggcgccggagccgatagcctt 646 ||||||||||||||||| || | |||||||| ||||| |||| |||||| ||||| Sbjct: 14423304 ccggccttggagctcctcgacgtcgccttcttcgcggccccggcgccgatcgcctt 14423359 Score = 153 bits (77), Expect = 9e-34 Identities = 155/181 (85%) Strand = Plus / Plus Query: 294 ccggccttcttggggagcagaaggttgtggatgttgggcatgacaccgccgctggcgatt 353 ||||||||||||||||| || | | |||||||||||||||||| |||||||||||||| Sbjct: 14422804 ccggccttcttggggaggaggtgctggtggatgttgggcatgacgccgccgctggcgatg 14422863 Query: 354 gtgaccataccgagcaggcgggagagctcctcgtcgttgcggacggcaagctggatatgt 413 ||| | |||||||| || |||||||||||||||||| || || |||||||| || Sbjct: 14422864 gtggcgccgccgagcagcttggtgagctcctcgtcgttgcgcaccgcgagctggatgtgg 14422923 Query: 414 cgcggcacgatgcgggtcttcttgttgtccctcgcggcgttcccggccaactccaggacc 473 |||||||| |||||||||||||||||||||||||| ||||||||||| | |||||| ||| Sbjct: 14422924 cgcggcacaatgcgggtcttcttgttgtccctcgccgcgttcccggcgagctccagcacc 14422983 Query: 474 t 474 | Sbjct: 14422984 t 14422984 Score = 133 bits (67), Expect = 8e-28 Identities = 115/131 (87%) Strand = Plus / Plus Query: 471 acctcagcggcgagatactccagcacggcggcgaggtagacgggagcgccggcgccaacc 530 ||||| |||||||| ||||| || ||||||| |||||||||||| ||||||||||| || Sbjct: 20850917 acctcggcggcgaggtactcgaggacggcggagaggtagacgggggcgccggcgccgacg 20850976 Query: 531 ctctcggcgtacttgccggccttgaggaaccgcgcgatcctgccgacgggaaactggagc 590 | ||||||||||||||||||||||||| ||| ||||| | ||||||||| |||||||| Sbjct: 20850977 cgctcggcgtacttgccggccttgaggtacctggcgatgcggccgacggggaactggagg 20851036 Query: 591 ccggccttgga 601 ||||||||||| Sbjct: 20851037 ccggccttgga 20851047 Score = 97.6 bits (49), Expect = 4e-17 Identities = 85/97 (87%) Strand = Plus / Plus Query: 378 agctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttcttg 437 ||||||||||||||||| || || |||||||| || | ||||||||| ||| |||||||| Sbjct: 20850726 agctcctcgtcgttgcgcaccgccagctggatgtgcctcggcacgatccggttcttcttg 20850785 Query: 438 ttgtccctcgcggcgttcccggccaactccaggacct 474 ||||||||||| |||||||| |||| |||||| |||| Sbjct: 20850786 ttgtccctcgccgcgttccccgccagctccagcacct 20850822
>emb|AL731753.2|CNS08C82 Oryza sativa chromosome 12, . BAC OJ1112_B07 of library Monsanto from chromosome 12 of cultivar Nipponbare of ssp. japonica of Oryza sativa (rice), complete sequence Length = 118101 Score = 190 bits (96), Expect = 4e-45 Identities = 156/176 (88%) Strand = Plus / Minus Query: 471 acctcagcggcgagatactccagcacggcggcgaggtagacgggagcgccggcgccaacc 530 ||||| |||||||| ||||| || |||||||||||||||||||||||||||||||| || Sbjct: 48392 acctcggcggcgaggtactcgaggacggcggcgaggtagacgggagcgccggcgccgacg 48333 Query: 531 ctctcggcgtacttgccggccttgaggaaccgcgcgatcctgccgacgggaaactggagc 590 | ||||||||||||||||||||||||||||| |||||||| |||||||| ||||| ||| Sbjct: 48332 cgctcggcgtacttgccggccttgaggaacctggcgatcctcccgacggggaactgcagc 48273 Query: 591 ccggccttggagctcctggagatagccttcttggcggcgccggagccgatagcctt 646 ||||||||||||||||| || | |||||||| ||||| |||| |||||| ||||| Sbjct: 48272 ccggccttggagctcctcgacgtcgccttcttcgcggccccggcgccgatcgcctt 48217 Score = 153 bits (77), Expect = 9e-34 Identities = 155/181 (85%) Strand = Plus / Minus Query: 294 ccggccttcttggggagcagaaggttgtggatgttgggcatgacaccgccgctggcgatt 353 ||||||||||||||||| || | | |||||||||||||||||| |||||||||||||| Sbjct: 48772 ccggccttcttggggaggaggtgctggtggatgttgggcatgacgccgccgctggcgatg 48713 Query: 354 gtgaccataccgagcaggcgggagagctcctcgtcgttgcggacggcaagctggatatgt 413 ||| | |||||||| || |||||||||||||||||| || || |||||||| || Sbjct: 48712 gtggcgccgccgagcagcttggtgagctcctcgtcgttgcgcaccgcgagctggatgtgg 48653 Query: 414 cgcggcacgatgcgggtcttcttgttgtccctcgcggcgttcccggccaactccaggacc 473 |||||||| |||||||||||||||||||||||||| ||||||||||| | |||||| ||| Sbjct: 48652 cgcggcacaatgcgggtcttcttgttgtccctcgccgcgttcccggcgagctccagcacc 48593 Query: 474 t 474 | Sbjct: 48592 t 48592
>gb|BT016168.1| Zea mays clone Contig1 mRNA sequence Length = 676 Score = 184 bits (93), Expect = 2e-43 Identities = 192/225 (85%) Strand = Plus / Minus Query: 378 agctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttcttg 437 |||||||||||||| || || || |||||||| || ||||||||||| ||| |||||||| Sbjct: 382 agctcctcgtcgttccgcaccgccagctggatgtggcgcggcacgatacggttcttcttg 323 Query: 438 ttgtccctcgcggcgttcccggccaactccaggacctcagcggcgagatactccagcacg 497 ||||||| || ||||||||||||| |||||| ||||| |||||||||||||| || ||| Sbjct: 322 ttgtcccgagcagcgttcccggccagctccagcacctcggcggcgagatactcgagaacg 263 Query: 498 gcggcgaggtagacgggagcgccggcgccaaccctctcggcgtacttgccggccttgagg 557 |||| |||||| ||||| || |||||||| || | ||| || ||||| |||||||||||| Sbjct: 262 gcggagaggtacacgggggccccggcgccgacgcgctccgcatacttcccggccttgagg 203 Query: 558 aaccgcgcgatcctgccgacgggaaactggagcccggccttggag 602 |||||||||| | |||||||| ||||| ||||| ||||||||| Sbjct: 202 taccgcgcgatgcgaccgacggggaactgaagcccagccttggag 158
>gb|AY105006.1| Zea mays PCO108932 mRNA sequence Length = 841 Score = 184 bits (93), Expect = 2e-43 Identities = 192/225 (85%) Strand = Plus / Minus Query: 378 agctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttcttg 437 |||||||||||||| || || || |||||||| || ||||||||||| ||| |||||||| Sbjct: 370 agctcctcgtcgttccgcaccgccagctggatgtggcgcggcacgatacggttcttcttg 311 Query: 438 ttgtccctcgcggcgttcccggccaactccaggacctcagcggcgagatactccagcacg 497 ||||||| || ||||||||||||| |||||| ||||| |||||||||||||| || ||| Sbjct: 310 ttgtcccgagcagcgttcccggccagctccagcacctcggcggcgagatactcgagaacg 251 Query: 498 gcggcgaggtagacgggagcgccggcgccaaccctctcggcgtacttgccggccttgagg 557 |||| |||||| ||||| || |||||||| || | ||| || ||||| |||||||||||| Sbjct: 250 gcggagaggtacacgggggccccggcgccgacgcgctccgcatacttcccggccttgagg 191 Query: 558 aaccgcgcgatcctgccgacgggaaactggagcccggccttggag 602 |||||||||| | |||||||| ||||| ||||| ||||||||| Sbjct: 190 taccgcgcgatgcgaccgacggggaactgaagcccagccttggag 146
>gb|AY110108.1| Zea mays CL14299_1 mRNA sequence Length = 712 Score = 182 bits (92), Expect = 1e-42 Identities = 188/220 (85%) Strand = Plus / Plus Query: 381 tcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttcttgttg 440 |||||||||||||| ||||| |||||||| || ||||||||||||||| ||||||||||| Sbjct: 354 tcctcgtcgttgcgcacggcgagctggatgtgacgcggcacgatgcggttcttcttgttg 413 Query: 441 tccctcgcggcgttcccggccaactccaggacctcagcggcgagatactccagcacggcg 500 || | ||| ||||| || |||| |||| ||||| || ||||||||||| || |||||| Sbjct: 414 tcgcgcgccgcgttgcccgccagttccaacacctctgccgcgagatactcgaggacggcg 473 Query: 501 gcgaggtagacgggagcgccggcgccaaccctctcggcgtacttgccggccttgaggaac 560 | |||||||||||| || || |||| || | ||||||||||||||||||||||||| | Sbjct: 474 gagaggtagacgggcgcaccaccgccgacgcgctcggcgtacttgccggccttgaggtag 533 Query: 561 cgcgcgatcctgccgacgggaaactggagcccggccttgg 600 |||||||| | ||||||||| ||||| ||||||||||||| Sbjct: 534 cgcgcgatgcggccgacggggaactgcagcccggccttgg 573
>emb|X94693.1|TAH2A254 T.aestivum histone H2A gene Length = 2241 Score = 174 bits (88), Expect = 2e-40 Identities = 154/176 (87%) Strand = Plus / Minus Query: 471 acctcagcggcgagatactccagcacggcggcgaggtagacgggagcgccggcgccaacc 530 |||||||||||||| ||||| || |||||||||||||||||||| |||||||| || || Sbjct: 1293 acctcagcggcgaggtactcaaggacggcggcgaggtagacgggggcgccggctccgacg 1234 Query: 531 ctctcggcgtacttgccggccttgaggaaccgcgcgatcctgccgacgggaaactggagc 590 | ||||||||||||||||||||||||||||| |||||||| || ||||| ||||| ||| Sbjct: 1233 cgctcggcgtacttgccggccttgaggaacctggcgatccttcccacggggaactgcagc 1174 Query: 591 ccggccttggagctcctggagatagccttcttggcggcgccggagccgatagcctt 646 || ||||||||||||| ||| | ||||||||||| ||||||| |||||| ||||| Sbjct: 1173 ccagccttggagctccgggacgtcgccttcttggccgcgccggcgccgattgcctt 1118 Score = 141 bits (71), Expect = 3e-30 Identities = 152/179 (84%) Strand = Plus / Minus Query: 296 ggccttcttggggagcagaaggttgtggatgttgggcatgacaccgccgctggcgattgt 355 ||||||||||||||| || | | ||||||||||||||| ||||||||||||||||| || Sbjct: 1734 ggccttcttggggaggaggtgctggtggatgttgggcatcacaccgccgctggcgatggt 1675 Query: 356 gaccataccgagcaggcgggagagctcctcgtcgttgcggacggcaagctggatatgtcg 415 | | ||||||| || ||||||||||| ||||| ||||| |||||||| || || Sbjct: 1674 ggcgccgccgagcaacttggtcagctcctcgtcattgcgcacggcgagctggatgtggcg 1615 Query: 416 cggcacgatgcgggtcttcttgttgtccctcgcggcgttcccggccaactccaggacct 474 ||||||||| |||||||||||||||||||| |||||||| ||||||| ||||||||||| Sbjct: 1614 cggcacgatacgggtcttcttgttgtccctggcggcgtttccggccagctccaggacct 1556
>gb|L75824.1|WHTHIH2AA Triticum aestivum histone H2A gene, complete cds Length = 2241 Score = 174 bits (88), Expect = 2e-40 Identities = 154/176 (87%) Strand = Plus / Minus Query: 471 acctcagcggcgagatactccagcacggcggcgaggtagacgggagcgccggcgccaacc 530 |||||||||||||| ||||| || |||||||||||||||||||| |||||||| || || Sbjct: 1293 acctcagcggcgaggtactcaaggacggcggcgaggtagacgggggcgccggctccgacg 1234 Query: 531 ctctcggcgtacttgccggccttgaggaaccgcgcgatcctgccgacgggaaactggagc 590 | ||||||||||||||||||||||||||||| |||||||| || ||||| ||||| ||| Sbjct: 1233 cgctcggcgtacttgccggccttgaggaacctggcgatccttcccacggggaactgcagc 1174 Query: 591 ccggccttggagctcctggagatagccttcttggcggcgccggagccgatagcctt 646 || ||||||||||||| ||| | ||||||||||| ||||||| |||||| ||||| Sbjct: 1173 ccagccttggagctccgggacgtcgccttcttggccgcgccggcgccgattgcctt 1118 Score = 141 bits (71), Expect = 3e-30 Identities = 152/179 (84%) Strand = Plus / Minus Query: 296 ggccttcttggggagcagaaggttgtggatgttgggcatgacaccgccgctggcgattgt 355 ||||||||||||||| || | | ||||||||||||||| ||||||||||||||||| || Sbjct: 1734 ggccttcttggggaggaggtgctggtggatgttgggcatcacaccgccgctggcgatggt 1675 Query: 356 gaccataccgagcaggcgggagagctcctcgtcgttgcggacggcaagctggatatgtcg 415 | | ||||||| || ||||||||||| ||||| ||||| |||||||| || || Sbjct: 1674 ggcgccgccgagcaacttggtcagctcctcgtcattgcgcacggcgagctggatgtggcg 1615 Query: 416 cggcacgatgcgggtcttcttgttgtccctcgcggcgttcccggccaactccaggacct 474 ||||||||| |||||||||||||||||||| |||||||| ||||||| ||||||||||| Sbjct: 1614 cggcacgatacgggtcttcttgttgtccctggcggcgtttccggccagctccaggacct 1556
>gb|AY389710.1| Hyacinthus orientalis histone H2A mRNA, partial cds Length = 677 Score = 172 bits (87), Expect = 9e-40 Identities = 249/303 (82%) Strand = Plus / Minus Query: 297 gccttcttggggagcagaaggttgtggatgttgggcatgacaccgccgctggcgattgtg 356 |||||||| ||||||| |||||||||||||||||||| ||||| ||| | ||||| || Sbjct: 453 gccttcttcgggagcaagaggttgtggatgttgggcatcacacctccgtttgcgatggtc 394 Query: 357 accataccgagcaggcgggagagctcctcgtcgttgcggacggcaagctggatatgtcgc 416 ||||| || | || || |||||||| ||||| | || || |||||||| || || Sbjct: 393 accatccccaagagcttcgacagctcctcatcgttcctcaccgcgagctggatgtgacgt 334 Query: 417 ggcacgatgcgggtcttcttgttgtccctcgcggcgttcccggccaactccaggacctca 476 |||||||| | ||||||||||||||| ||||| || ||||| || | ||||| ||||||| Sbjct: 333 ggcacgatcctggtcttcttgttgtctctcgcagcattcccagcaagctccaagacctca 274 Query: 477 gcggcgagatactccagcacggcggcgaggtagacgggagcgccggcgccaaccctctcg 536 |||||||| ||||||| |||||||||||||| || || || |||||||| ||||||||| Sbjct: 273 gcggcgaggtactccaagacggcggcgaggtacaccggggctccggcgccgaccctctcg 214 Query: 537 gcgtacttgccggccttgaggaaccgcgcgatcctgccgacgggaaactggagcccggcc 596 || |||||||| ||||| | |||||| || || | ||||||||| ||||| ||||||||| Sbjct: 213 gcatacttgccagcctttaagaaccgtgctatacggccgacggggaactgtagcccggcc 154 Query: 597 ttg 599 ||| Sbjct: 153 ttg 151
>gb|L41841.1|CREHIH3G Chlamydomonas reinhardtii histone H3, histone H4, histone H2B, and histone H2A genes, complete cds Length = 4358 Score = 149 bits (75), Expect = 1e-32 Identities = 186/223 (83%) Strand = Plus / Minus Query: 378 agctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttcttg 437 ||||||||||||||||||| ||| |||||||| || || |||||||||||| |||||||| Sbjct: 4081 agctcctcgtcgttgcggatggccagctggatgtggcggggcacgatgcggttcttcttg 4022 Query: 438 ttgtccctcgcggcgttcccggccaactccaggacctcagcggcgagatactccagcacg 497 ||||| | |||||||| ||||||| |||||| |||||||||| || ||||||||||| Sbjct: 4021 ttgtcgcgggcggcgttgccggccagctccagcacctcagcggtcaggtactccagcaca 3962 Query: 498 gcggcgaggtagacgggagcgccggcgccaaccctctcggcgtacttgccggccttgagg 557 ||||| ||||| ||||| |||||||| || | | ||||||||||||||| ||| ||| Sbjct: 3961 gcggccaggtacacgggcgcgccggcaccgatgcgctcggcgtacttgcccttcttcagg 3902 Query: 558 aaccgcgcgatcctgccgacgggaaactggagcccggccttgg 600 | ||||| || | ||| ||||| ||||| || |||||||||| Sbjct: 3901 tagcgcgcaatgcggccaacggggaactgcaggccggccttgg 3859
>gb|AF255739.1|AF255739 Bufo bufo gagarizans replication-dependent histone H2A gene, complete cds Length = 2120 Score = 141 bits (71), Expect = 3e-30 Identities = 146/171 (85%) Strand = Plus / Minus Query: 377 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 436 |||||||||||||||||| ||||| ||||| | || || || | ||||||||||||||| Sbjct: 1087 gagctcctcgtcgttgcgcacggccagctgcaggtgacgggggatgatgcgggtcttctt 1028 Query: 437 gttgtccctcgcggcgttcccggccaactccaggacctcagcggcgagatactccagcac 496 |||||| | ||||| || ||||||| |||||||| ||| |||| ||||||||| ||||| Sbjct: 1027 gttgtcgcgggcggcattgccggccagctccaggatctcggcggtgagatactcgagcac 968 Query: 497 ggcggcgaggtagacgggagcgccggcgccaaccctctcggcgtacttgcc 547 ||||| | ||||||||||||||||||||| ||||||| |||||| ||||| Sbjct: 967 agcggccaagtagacgggagcgccggcgcccaccctctgggcgtagttgcc 917
>gb|U16726.1|CRU16726 Chlamydomonas reinhardtii histone H1 (ch1), histone H2A (ch2a-IV), and histone H2B (ch2b-IV) genes, complete cds Length = 4502 Score = 139 bits (70), Expect = 1e-29 Identities = 145/170 (85%) Strand = Plus / Plus Query: 378 agctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttcttg 437 |||||||| |||||||||| ||| |||||||| || || ||||| |||||| |||||||| Sbjct: 3194 agctcctcatcgttgcggatggccagctggatgtggcgaggcacaatgcggttcttcttg 3253 Query: 438 ttgtccctcgcggcgttcccggccaactccaggacctcagcggcgagatactccagcacg 497 ||||| | |||||||| ||||||| |||||| |||||||||| || |||||||||||| Sbjct: 3254 ttgtcgcgggcggcgttgccggccagctccagcacctcagcggtcaggtactccagcacg 3313 Query: 498 gcggcgaggtagacgggagcgccggcgccaaccctctcggcgtacttgcc 547 ||||| ||||| ||||| |||||||| || | | ||||||||||||||| Sbjct: 3314 gcggccaggtacacgggcgcgccggcaccgatgcgctcggcgtacttgcc 3363
>dbj|D38087.1|WHTPH2AA Triticum aestivum mRNA for protein H2A, complete cds, clone wcH2A-2 Length = 717 Score = 137 bits (69), Expect = 5e-29 Identities = 243/301 (80%) Strand = Plus / Minus Query: 299 cttcttggggagcagaaggttgtggatgttgggcatgacaccgccgctggcgattgtgac 358 ||||||||||||||| | | || ||||||||| ||||| |||||| |||||| ||||| Sbjct: 436 cttcttggggagcagcacggagttgatgttggggatgacgccgccgtgggcgatggtgac 377 Query: 359 cataccgagcaggcgggagagctcctcgtcgttgcggacggcaagctggatatgtcgcgg 418 ||||||| | | |||||||| ||||||||||||||| ||| | | || ||||| Sbjct: 376 gccggcgagcagcctgccgagctcctggtcgttgcggacggccagcagcaggtggcgcgg 317 Query: 419 cacgatgcgggtcttcttgttgtccctcgcggcgttcccggccaactccaggacctcagc 478 | |||||| ||||||||||||||| | || ||||| ||||| | |||||||||||| || Sbjct: 316 gatgatgcgcgtcttcttgttgtccttggccgcgttgccggcaagctccaggacctcggc 257 Query: 479 ggcgagatactccagcacggcggcgaggtagacgggagcgccggcgccaaccctctcggc 538 |||||| ||||| || |||||||||||||||||||| ||||||| ||| || | || ||| Sbjct: 256 ggcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgacgcgctgggc 197 Query: 539 gtacttgccggccttgaggaaccgcgcgatcctgccgacgggaaactggagcccggcctt 598 ||| ||| ||||||| | ||| |||| | ||||||||| ||||| ||||||||||| Sbjct: 196 gtagcggcccttcttgaggtagcgcccgatgcggccgacggggaactgcagcccggcctt 137 Query: 599 g 599 | Sbjct: 136 g 136
>gb|BT019315.1| Zea mays clone Contig989.F mRNA sequence Length = 699 Score = 133 bits (67), Expect = 8e-28 Identities = 184/223 (82%) Strand = Plus / Minus Query: 377 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 436 |||||||||||||||||||| || || | | || ||||| | |||||| |||||||| Sbjct: 383 gagctcctcgtcgttgcggatcgccaggagcacgtggcgcgggatgatgcgcgtcttctt 324 Query: 437 gttgtccctcgcggcgttcccggccaactccaggacctcagcggcgagatactccagcac 496 |||||| |||| |||||||| ||||||||||| ||||| |||||||| |||||||| || Sbjct: 323 gttgtctttcgccgcgttccctgccaactccagaacctcggcggcgaggtactccagaac 264 Query: 497 ggcggcgaggtagacgggagcgccggcgccaaccctctcggcgtacttgccggccttgag 556 |||||||||||||||||| ||||| | ||| || | || |||||| ||| |||||| Sbjct: 263 ggcggcgaggtagacgggggcgccagtgcccacgcgctgcgcgtaccggcccttcttgag 204 Query: 557 gaaccgcgcgatcctgccgacgggaaactggagcccggccttg 599 | | ||| |||||| ||||||||| ||||| |||||||||||| Sbjct: 203 gtagcgcccgatccggccgacggggaactgcagcccggccttg 161
>gb|AF377946.3| Oryza sativa (japonica cultivar-group) chromosome 3, BAC clone OSJNBa0031O09, complete sequence Length = 161339 Score = 133 bits (67), Expect = 8e-28 Identities = 115/131 (87%) Strand = Plus / Minus Query: 471 acctcagcggcgagatactccagcacggcggcgaggtagacgggagcgccggcgccaacc 530 ||||| |||||||| ||||| || ||||||| |||||||||||| ||||||||||| || Sbjct: 38208 acctcggcggcgaggtactcgaggacggcggagaggtagacgggggcgccggcgccgacg 38149 Query: 531 ctctcggcgtacttgccggccttgaggaaccgcgcgatcctgccgacgggaaactggagc 590 | ||| ||||||||||||||||||||| | || ||||| | ||||||||| ||||||||| Sbjct: 38148 cgctccgcgtacttgccggccttgaggtagcgggcgatgcggccgacggggaactggagc 38089 Query: 591 ccggccttgga 601 ||||||||||| Sbjct: 38088 ccggccttgga 38078 Score = 105 bits (53), Expect = 2e-19 Identities = 86/97 (88%) Strand = Plus / Minus Query: 378 agctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttcttg 437 ||||||||||||||||| || || |||||||| || ||||||||||| | | |||||||| Sbjct: 38405 agctcctcgtcgttgcgcaccgccagctggatgtgccgcggcacgatcctgttcttcttg 38346 Query: 438 ttgtccctcgcggcgttcccggccaactccaggacct 474 ||||||||||| ||||||||||||| |||||| |||| Sbjct: 38345 ttgtccctcgccgcgttcccggccagctccagcacct 38309
>gb|AC146936.4| Oryza sativa (japonica cultivar-group) chromosome 3 clone B1154F06 map near C10769, complete sequence Length = 194856 Score = 133 bits (67), Expect = 8e-28 Identities = 115/131 (87%) Strand = Plus / Plus Query: 471 acctcagcggcgagatactccagcacggcggcgaggtagacgggagcgccggcgccaacc 530 ||||| |||||||| ||||| || ||||||| |||||||||||| ||||||||||| || Sbjct: 141224 acctcggcggcgaggtactcgaggacggcggagaggtagacgggggcgccggcgccgacg 141283 Query: 531 ctctcggcgtacttgccggccttgaggaaccgcgcgatcctgccgacgggaaactggagc 590 | ||| ||||||||||||||||||||| | || ||||| | ||||||||| ||||||||| Sbjct: 141284 cgctccgcgtacttgccggccttgaggtagcgggcgatgcggccgacggggaactggagc 141343 Query: 591 ccggccttgga 601 ||||||||||| Sbjct: 141344 ccggccttgga 141354 Score = 105 bits (53), Expect = 2e-19 Identities = 86/97 (88%) Strand = Plus / Plus Query: 378 agctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttcttg 437 ||||||||||||||||| || || |||||||| || ||||||||||| | | |||||||| Sbjct: 141027 agctcctcgtcgttgcgcaccgccagctggatgtgccgcggcacgatcctgttcttcttg 141086 Query: 438 ttgtccctcgcggcgttcccggccaactccaggacct 474 ||||||||||| ||||||||||||| |||||| |||| Sbjct: 141087 ttgtccctcgccgcgttcccggccagctccagcacct 141123
>gb|AC147426.2| Oryza sativa chromosome 3 B1377B10 genomic sequence, complete sequence Length = 184366 Score = 133 bits (67), Expect = 8e-28 Identities = 115/131 (87%) Strand = Plus / Minus Query: 471 acctcagcggcgagatactccagcacggcggcgaggtagacgggagcgccggcgccaacc 530 ||||| |||||||| ||||| || ||||||| |||||||||||| ||||||||||| || Sbjct: 181362 acctcggcggcgaggtactcgaggacggcggagaggtagacgggggcgccggcgccgacg 181303 Query: 531 ctctcggcgtacttgccggccttgaggaaccgcgcgatcctgccgacgggaaactggagc 590 | ||| ||||||||||||||||||||| | || ||||| | ||||||||| ||||||||| Sbjct: 181302 cgctccgcgtacttgccggccttgaggtagcgggcgatgcggccgacggggaactggagc 181243 Query: 591 ccggccttgga 601 ||||||||||| Sbjct: 181242 ccggccttgga 181232 Score = 105 bits (53), Expect = 2e-19 Identities = 86/97 (88%) Strand = Plus / Minus Query: 378 agctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttcttg 437 ||||||||||||||||| || || |||||||| || ||||||||||| | | |||||||| Sbjct: 181559 agctcctcgtcgttgcgcaccgccagctggatgtgccgcggcacgatcctgttcttcttg 181500 Query: 438 ttgtccctcgcggcgttcccggccaactccaggacct 474 ||||||||||| ||||||||||||| |||||| |||| Sbjct: 181499 ttgtccctcgccgcgttcccggccagctccagcacct 181463
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 Length = 36102668 Score = 133 bits (67), Expect = 8e-28 Identities = 115/131 (87%) Strand = Plus / Minus Query: 471 acctcagcggcgagatactccagcacggcggcgaggtagacgggagcgccggcgccaacc 530 ||||| |||||||| ||||| || ||||||| |||||||||||| ||||||||||| || Sbjct: 28998067 acctcggcggcgaggtactcgaggacggcggagaggtagacgggggcgccggcgccgacg 28998008 Query: 531 ctctcggcgtacttgccggccttgaggaaccgcgcgatcctgccgacgggaaactggagc 590 | ||| ||||||||||||||||||||| | || ||||| | ||||||||| ||||||||| Sbjct: 28998007 cgctccgcgtacttgccggccttgaggtagcgggcgatgcggccgacggggaactggagc 28997948 Query: 591 ccggccttgga 601 ||||||||||| Sbjct: 28997947 ccggccttgga 28997937 Score = 105 bits (53), Expect = 2e-19 Identities = 86/97 (88%) Strand = Plus / Minus Query: 378 agctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttcttg 437 ||||||||||||||||| || || |||||||| || ||||||||||| | | |||||||| Sbjct: 28998264 agctcctcgtcgttgcgcaccgccagctggatgtgccgcggcacgatcctgttcttcttg 28998205 Query: 438 ttgtccctcgcggcgttcccggccaactccaggacct 474 ||||||||||| ||||||||||||| |||||| |||| Sbjct: 28998204 ttgtccctcgccgcgttcccggccagctccagcacct 28998168 Score = 58.0 bits (29), Expect = 4e-05 Identities = 104/129 (80%) Strand = Plus / Plus Query: 471 acctcagcggcgagatactccagcacggcggcgaggtagacgggagcgccggcgccaacc 530 ||||| || ||||| ||||| || |||||||||||||||||||| ||||||| ||| | Sbjct: 9471496 acctcggcagcgaggtactcgaggacggcggcgaggtagacgggggcgccggtgccgatg 9471555 Query: 531 ctctcggcgtacttgccggccttgaggaaccgcgcgatcctgccgacgggaaactggagc 590 | || |||||| ||| ||||||| | || |||| | ||||||||| ||||||||| Sbjct: 9471556 cgctgggcgtagcggcccttcttgaggtagcggccgatacggccgacggggaactggagc 9471615 Query: 591 ccggccttg 599 ||||||||| Sbjct: 9471616 ccggccttg 9471624 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Plus Query: 430 tcttcttgttgtccctcgcggcgttcccggccaactccaggacct 474 |||||||||||||||| || ||||||||||| | |||||| |||| Sbjct: 9471354 tcttcttgttgtccctggccgcgttcccggcgagctccagcacct 9471398 Score = 42.1 bits (21), Expect = 2.3 Identities = 24/25 (96%) Strand = Plus / Plus Query: 625 cggcgccggagccgatagccttgcc 649 ||||||||| ||||||||||||||| Sbjct: 21805850 cggcgccggcgccgatagccttgcc 21805874 Score = 42.1 bits (21), Expect = 2.3 Identities = 42/49 (85%) Strand = Plus / Minus Query: 551 cttgaggaaccgcgcgatcctgccgacgggaaactggagcccggccttg 599 ||||||| | ||| |||| | ||||||||| || ||||||||||||||| Sbjct: 2464019 cttgaggtagcgcccgatacggccgacggggaattggagcccggccttg 2463971
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete sequence Length = 36192742 Score = 133 bits (67), Expect = 8e-28 Identities = 115/131 (87%) Strand = Plus / Minus Query: 471 acctcagcggcgagatactccagcacggcggcgaggtagacgggagcgccggcgccaacc 530 ||||| |||||||| ||||| || ||||||| |||||||||||| ||||||||||| || Sbjct: 29089489 acctcggcggcgaggtactcgaggacggcggagaggtagacgggggcgccggcgccgacg 29089430 Query: 531 ctctcggcgtacttgccggccttgaggaaccgcgcgatcctgccgacgggaaactggagc 590 | ||| ||||||||||||||||||||| | || ||||| | ||||||||| ||||||||| Sbjct: 29089429 cgctccgcgtacttgccggccttgaggtagcgggcgatgcggccgacggggaactggagc 29089370 Query: 591 ccggccttgga 601 ||||||||||| Sbjct: 29089369 ccggccttgga 29089359 Score = 105 bits (53), Expect = 2e-19 Identities = 86/97 (88%) Strand = Plus / Minus Query: 378 agctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttcttg 437 ||||||||||||||||| || || |||||||| || ||||||||||| | | |||||||| Sbjct: 29089686 agctcctcgtcgttgcgcaccgccagctggatgtgccgcggcacgatcctgttcttcttg 29089627 Query: 438 ttgtccctcgcggcgttcccggccaactccaggacct 474 ||||||||||| ||||||||||||| |||||| |||| Sbjct: 29089626 ttgtccctcgccgcgttcccggccagctccagcacct 29089590 Score = 58.0 bits (29), Expect = 4e-05 Identities = 104/129 (80%) Strand = Plus / Plus Query: 471 acctcagcggcgagatactccagcacggcggcgaggtagacgggagcgccggcgccaacc 530 ||||| || ||||| ||||| || |||||||||||||||||||| ||||||| ||| | Sbjct: 9469617 acctcggcagcgaggtactcgaggacggcggcgaggtagacgggggcgccggtgccgatg 9469676 Query: 531 ctctcggcgtacttgccggccttgaggaaccgcgcgatcctgccgacgggaaactggagc 590 | || |||||| ||| ||||||| | || |||| | ||||||||| ||||||||| Sbjct: 9469677 cgctgggcgtagcggcccttcttgaggtagcggccgatacggccgacggggaactggagc 9469736 Query: 591 ccggccttg 599 ||||||||| Sbjct: 9469737 ccggccttg 9469745 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Plus Query: 430 tcttcttgttgtccctcgcggcgttcccggccaactccaggacct 474 |||||||||||||||| || ||||||||||| | |||||| |||| Sbjct: 9469475 tcttcttgttgtccctggccgcgttcccggcgagctccagcacct 9469519 Score = 42.1 bits (21), Expect = 2.3 Identities = 24/25 (96%) Strand = Plus / Plus Query: 625 cggcgccggagccgatagccttgcc 649 ||||||||| ||||||||||||||| Sbjct: 21798879 cggcgccggcgccgatagccttgcc 21798903 Score = 42.1 bits (21), Expect = 2.3 Identities = 42/49 (85%) Strand = Plus / Minus Query: 551 cttgaggaaccgcgcgatcctgccgacgggaaactggagcccggccttg 599 ||||||| | ||| |||| | ||||||||| || ||||||||||||||| Sbjct: 2464129 cttgaggtagcgcccgatacggccgacggggaattggagcccggccttg 2464081
>gb|AY103585.1| Zea mays PCO123564 mRNA sequence Length = 1953 Score = 133 bits (67), Expect = 8e-28 Identities = 184/223 (82%) Strand = Plus / Minus Query: 377 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 436 |||||||||||||||||||| || || | | || ||||| | |||||| |||||||| Sbjct: 532 gagctcctcgtcgttgcggatcgccaggagcacgtggcgcgggatgatgcgcgtcttctt 473 Query: 437 gttgtccctcgcggcgttcccggccaactccaggacctcagcggcgagatactccagcac 496 |||||| |||| |||||||| ||||||||||| ||||| |||||||| |||||||| || Sbjct: 472 gttgtctttcgccgcgttccctgccaactccagaacctcggcggcgaggtactccaggac 413 Query: 497 ggcggcgaggtagacgggagcgccggcgccaaccctctcggcgtacttgccggccttgag 556 |||||||||||||||||| ||||| | ||| || | || |||||| ||| |||||| Sbjct: 412 ggcggcgaggtagacgggggcgccagtgcccacgcgctgcgcgtaccggcccttcttgag 353 Query: 557 gaaccgcgcgatcctgccgacgggaaactggagcccggccttg 599 | | ||| |||||| ||||||||| ||||| |||||||||||| Sbjct: 352 gtagcgcccgatccggccgacggggaactgcagcccggccttg 310
>emb|AL713943.3|CNS07YPC Oryza sativa chromosome 12, . BAC OSJNBa0030G16 of library OSJNBa from chromosome 12 of cultivar Nipponbare of ssp. japonica of Oryza sativa (rice), complete sequence Length = 182172 Score = 133 bits (67), Expect = 8e-28 Identities = 115/131 (87%) Strand = Plus / Plus Query: 471 acctcagcggcgagatactccagcacggcggcgaggtagacgggagcgccggcgccaacc 530 ||||| |||||||| ||||| || ||||||| |||||||||||| ||||||||||| || Sbjct: 10193 acctcggcggcgaggtactcgaggacggcggagaggtagacgggggcgccggcgccgacg 10252 Query: 531 ctctcggcgtacttgccggccttgaggaaccgcgcgatcctgccgacgggaaactggagc 590 | ||||||||||||||||||||||||| ||| ||||| | ||||||||| |||||||| Sbjct: 10253 cgctcggcgtacttgccggccttgaggtacctggcgatgcggccgacggggaactggagg 10312 Query: 591 ccggccttgga 601 ||||||||||| Sbjct: 10313 ccggccttgga 10323 Score = 97.6 bits (49), Expect = 4e-17 Identities = 85/97 (87%) Strand = Plus / Plus Query: 378 agctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttcttg 437 ||||||||||||||||| || || |||||||| || | ||||||||| ||| |||||||| Sbjct: 10002 agctcctcgtcgttgcgcaccgccagctggatgtgcctcggcacgatccggttcttcttg 10061 Query: 438 ttgtccctcgcggcgttcccggccaactccaggacct 474 ||||||||||| |||||||| |||| |||||| |||| Sbjct: 10062 ttgtccctcgccgcgttccccgccagctccagcacct 10098
>emb|AL731880.3|CNS08C8J Oryza sativa chromosome 12, . BAC OSJNBa0035E02 of library OSJNBa from chromosome 12 of cultivar Nipponbare of ssp. japonica of Oryza sativa (rice), complete sequence Length = 107819 Score = 133 bits (67), Expect = 8e-28 Identities = 115/131 (87%) Strand = Plus / Minus Query: 471 acctcagcggcgagatactccagcacggcggcgaggtagacgggagcgccggcgccaacc 530 ||||| |||||||| ||||| || ||||||| |||||||||||| ||||||||||| || Sbjct: 34292 acctcggcggcgaggtactcgaggacggcggagaggtagacgggggcgccggcgccgacg 34233 Query: 531 ctctcggcgtacttgccggccttgaggaaccgcgcgatcctgccgacgggaaactggagc 590 | ||||||||||||||||||||||||| ||| ||||| | ||||||||| |||||||| Sbjct: 34232 cgctcggcgtacttgccggccttgaggtacctggcgatgcggccgacggggaactggagg 34173 Query: 591 ccggccttgga 601 ||||||||||| Sbjct: 34172 ccggccttgga 34162 Score = 97.6 bits (49), Expect = 4e-17 Identities = 85/97 (87%) Strand = Plus / Minus Query: 378 agctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttcttg 437 ||||||||||||||||| || || |||||||| || | ||||||||| ||| |||||||| Sbjct: 34483 agctcctcgtcgttgcgcaccgccagctggatgtgcctcggcacgatccggttcttcttg 34424 Query: 438 ttgtccctcgcggcgttcccggccaactccaggacct 474 ||||||||||| |||||||| |||| |||||| |||| Sbjct: 34423 ttgtccctcgccgcgttccccgccagctccagcacct 34387
>gb|U70133.1|BBU70133 Bufo bufo gagarizans replication-dependent histone H2A mRNA, complete cds Length = 466 Score = 133 bits (67), Expect = 8e-28 Identities = 145/171 (84%) Strand = Plus / Minus Query: 377 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 436 |||||||||||||||||| ||||| ||||| | || || || | |||||| |||||||| Sbjct: 303 gagctcctcgtcgttgcgcacggccagctgcaggtgacgggggatgatgcgagtcttctt 244 Query: 437 gttgtccctcgcggcgttcccggccaactccaggacctcagcggcgagatactccagcac 496 |||||| | ||||| || ||||||| |||||||| ||| |||| ||||||||| ||||| Sbjct: 243 gttgtcgcgggcggcattgccggccagctccaggatctcggcggtgagatactcgagcac 184 Query: 497 ggcggcgaggtagacgggagcgccggcgccaaccctctcggcgtacttgcc 547 ||||| | ||||||||||||||||||||| ||||||| |||||| ||||| Sbjct: 183 agcggccaagtagacgggagcgccggcgcccaccctctgggcgtagttgcc 133
>dbj|D38090.1|WHTPH2AD Triticum aestivum mRNA for protein H2A, complete cds, clone wcH2A-9 Length = 704 Score = 131 bits (66), Expect = 3e-27 Identities = 183/222 (82%) Strand = Plus / Minus Query: 377 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 436 |||||||| |||||||||||| || ||| | | || ||||| | ||||||||||||||| Sbjct: 335 gagctcctggtcgttgcggacagcgagcagcaggtggcgcgggatgatgcgggtcttctt 276 Query: 437 gttgtccctcgcggcgttcccggccaactccaggacctcagcggcgagatactccagcac 496 ||||||| | || ||||| ||||| | |||||| ||||| |||||||| ||||| || || Sbjct: 275 gttgtccttggccgcgttgccggcaagctccagcacctcggcggcgaggtactcgaggac 216 Query: 497 ggcggcgaggtagacgggagcgccggcgccaaccctctcggcgtacttgccggccttgag 556 |||||||||||||||||| ||||||| ||| || | || |||||| ||| |||||| Sbjct: 215 ggcggcgaggtagacgggggcgccggagccgacgcgctgggcgtagcggcccttcttgag 156 Query: 557 gaaccgcgcgatcctgccgacgggaaactggagcccggcctt 598 | | ||| |||| | ||||||||| ||||||||||||||||| Sbjct: 155 gtagcgcccgatgcggccgacggggaactggagcccggcctt 114
>gb|U16724.1|CRU16724 Chlamydomonas reinhardtii histone H3 (ch3-II), histone H4 (ch4-II), histone H2B (ch2b-II) and histone H2A (ch2a-II) genes, complete cds Length = 3777 Score = 131 bits (66), Expect = 3e-27 Identities = 144/170 (84%) Strand = Plus / Minus Query: 378 agctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttcttg 437 |||||||| |||||||||| ||| |||||||| || || |||||||||||| |||||||| Sbjct: 3500 agctcctcatcgttgcggatggccagctggatgtggcggggcacgatgcggttcttcttg 3441 Query: 438 ttgtccctcgcggcgttcccggccaactccaggacctcagcggcgagatactccagcacg 497 ||||| | |||||||| ||||||| |||||| |||||||||| || ||||| ||||| Sbjct: 3440 ttgtcgcgggcggcgttgccggccagctccagcacctcagcggtcaggtactcgagcaca 3381 Query: 498 gcggcgaggtagacgggagcgccggcgccaaccctctcggcgtacttgcc 547 ||||| ||||| ||||| |||||||| || | | ||||||||||||||| Sbjct: 3380 gcggccaggtacacgggcgcgccggcaccgatgcgctcggcgtacttgcc 3331
>dbj|D38088.1|WHTPH2AB Triticum aestivum mRNA for protein H2A, complete cds, clone wcH2A-3 Length = 1153 Score = 127 bits (64), Expect = 5e-26 Identities = 244/304 (80%) Strand = Plus / Minus Query: 295 cggccttcttggggagcagaaggttgtggatgttgggcatgacaccgccgctggcgattg 354 ||||||||||||||||||| | | || ||||||||| ||||| |||||| |||||| | Sbjct: 438 cggccttcttggggagcagcacggagttgatgttggggatgacgccgccgtgggcgatgg 379 Query: 355 tgaccataccgagcaggcgggagagctcctcgtcgttgcggacggcaagctggatatgtc 414 |||| ||||||| | | ||||||| ||||||||||||||| ||| | | || | Sbjct: 378 tgacgccggcgagcagcctgcccagctcctggtcgttgcggacggccagcagcaggtggc 319 Query: 415 gcggcacgatgcgggtcttcttgttgtccctcgcggcgttcccggccaactccaggacct 474 |||| | |||||| ||||||||||||||| | || ||||| ||||| | ||||||||||| Sbjct: 318 gcgggatgatgcgcgtcttcttgttgtccttggccgcgttgccggcgagctccaggacct 259 Query: 475 cagcggcgagatactccagcacggcggcgaggtagacgggagcgccggcgccaaccctct 534 | |||||||| ||||| || |||||||||||||||||||| ||||||| ||| || || Sbjct: 258 cggcggcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgacggcct 199 Query: 535 cggcgtacttgccggccttgaggaaccgcgcgatcctgccgacgggaaactggagcccgg 594 ||||| ||| ||||||| | ||| |||| | ||||||||| ||||||||||||| Sbjct: 198 gcgcgtagcggcccttcttgaggtagcgcccgatgcggccgacggggaactggagcccgg 139 Query: 595 cctt 598 |||| Sbjct: 138 cctt 135
>gb|BT016569.1| Zea mays clone Contig402 mRNA sequence Length = 719 Score = 125 bits (63), Expect = 2e-25 Identities = 183/223 (82%) Strand = Plus / Minus Query: 377 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 436 |||||||||||||||||||| |||||| | | || ||||| | ||||||||||||||| Sbjct: 414 gagctcctcgtcgttgcggatggcaaggagcacgtggcgcgggatgatgcgggtcttctt 355 Query: 437 gttgtccctcgcggcgttcccggccaactccaggacctcagcggcgagatactccagcac 496 ||||||| | || ||||| ||||||| |||||| ||||| ||||| || ||||| || || Sbjct: 354 gttgtccttggcagcgttgccggccagctccagcacctcggcggccaggtactcgaggac 295 Query: 497 ggcggcgaggtagacgggagcgccggcgccaaccctctcggcgtacttgccggccttgag 556 |||||| ||||||||||| ||||| | ||| || | || |||||| ||| ||| || Sbjct: 294 ggcggccaggtagacgggggcgcccgtgccgacgcgctgcgcgtaccggcccttcttcag 235 Query: 557 gaaccgcgcgatcctgccgacgggaaactggagcccggccttg 599 | ||||| |||| | ||||||||||||||| |||||||||||| Sbjct: 234 gtaccgcccgatgcggccgacgggaaactgcagcccggccttg 192
>gb|AY103710.1| Zea mays PCO123562 mRNA sequence Length = 770 Score = 125 bits (63), Expect = 2e-25 Identities = 183/223 (82%) Strand = Plus / Minus Query: 377 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 436 |||||||||||||||||||| |||||| | | || ||||| | ||||||||||||||| Sbjct: 414 gagctcctcgtcgttgcggatggcaaggagcacgtggcgcgggatgatgcgggtcttctt 355 Query: 437 gttgtccctcgcggcgttcccggccaactccaggacctcagcggcgagatactccagcac 496 ||||||| | || ||||| ||||||| |||||| ||||| ||||| || ||||| || || Sbjct: 354 gttgtccttggcagcgttgccggccagctccagcacctcggcggccaggtactcgaggac 295 Query: 497 ggcggcgaggtagacgggagcgccggcgccaaccctctcggcgtacttgccggccttgag 556 |||||| ||||||||||| ||||| | ||| || | || |||||| ||| ||| || Sbjct: 294 ggcggccaggtagacgggggcgcccgtgccgacgcgctgcgcgtaccggcccttcttcag 235 Query: 557 gaaccgcgcgatcctgccgacgggaaactggagcccggccttg 599 | ||||| |||| | ||||||||||||||| |||||||||||| Sbjct: 234 gtaccgcccgatgcggccgacgggaaactgcagcccggccttg 192
>gb|BT019008.1| Zea mays clone Contig499.F mRNA sequence Length = 674 Score = 123 bits (62), Expect = 8e-25 Identities = 182/222 (81%) Strand = Plus / Minus Query: 377 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 436 |||||||||||||||||||| || ||| | | || ||||| |||||||| |||||||| Sbjct: 371 gagctcctcgtcgttgcggatcgccagcagcacgtggcgcgggacgatgcgcgtcttctt 312 Query: 437 gttgtccctcgcggcgttcccggccaactccaggacctcagcggcgagatactccagcac 496 ||||||| | || ||||| ||||| | ||||||||||||||||||||| |||||||| || Sbjct: 311 gttgtccttggcagcgttgccggcgagctccaggacctcagcggcgaggtactccaggac 252 Query: 497 ggcggcgaggtagacgggagcgccggcgccaaccctctcggcgtacttgccggccttgag 556 ||| |||||||||||||| || ||| ||| || | || ||||| ||| |||||| Sbjct: 251 ggccgcgaggtagacgggggcaccgctgccgacgcgctgcgcgtagcggcccttcttgag 192 Query: 557 gaaccgcgcgatcctgccgacgggaaactggagcccggcctt 598 | | ||| |||| | ||||||||| ||||||||||||||||| Sbjct: 191 gtagcgcccgatgcggccgacggggaactggagcccggcctt 150
>emb|CR709561.2|CNS0GAG5 Tetraodon nigroviridis full-length cDNA Length = 613 Score = 123 bits (62), Expect = 8e-25 Identities = 143/170 (84%) Strand = Plus / Minus Query: 378 agctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttcttg 437 ||||| |||||||| || || || ||||||| ||| || || | |||||||||||||||| Sbjct: 334 agctcttcgtcgttccgcacagccagctggagatggcgagggatgatgcgggtcttcttg 275 Query: 438 ttgtccctcgcggcgttcccggccaactccaggacctcagcggcgagatactccagcacg 497 ||||| || |||||||| |||||||||||||||| ||| |||| ||||||||||| ||| Sbjct: 274 ttgtctcttgcggcgttgccggccaactccaggatctcggcggtcagatactccaggacg 215 Query: 498 gcggcgaggtagacgggagcgccggcgccaaccctctcggcgtacttgcc 547 || || ||||||||||| || |||||||| || | ||| ||||| ||||| Sbjct: 214 gcagccaggtagacgggcgccccggcgccgactcgctccgcgtagttgcc 165
>emb|CR700361.2|CNS0G3CL Tetraodon nigroviridis full-length cDNA Length = 547 Score = 123 bits (62), Expect = 8e-25 Identities = 143/170 (84%) Strand = Plus / Minus Query: 378 agctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttcttg 437 ||||||||||||||||| ||||| ||||| | || ||||| | ||| | |||||||||| Sbjct: 310 agctcctcgtcgttgcgcacggccagctgcaggtgccgcgggatgatcctggtcttcttg 251 Query: 438 ttgtccctcgcggcgttcccggccaactccaggacctcagcggcgagatactccagcacg 497 ||||| | |||||||||||||||| |||||||| |||||||| || |||||||||||| Sbjct: 250 ttgtcgcgggcggcgttcccggccagctccaggatctcagcggtcaggtactccagcacg 191 Query: 498 gcggcgaggtagacgggagcgccggcgccaaccctctcggcgtacttgcc 547 || || |||||||| || ||||||||||| || | || |||||| ||||| Sbjct: 190 gccgccaggtagaccggggcgccggcgccgacacgctgggcgtagttgcc 141
>dbj|AK074018.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033075N03, full insert sequence Length = 797 Score = 117 bits (59), Expect = 5e-23 Identities = 182/223 (81%) Strand = Plus / Minus Query: 377 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 436 |||||||||||||||||||| || ||| | | || | ||| | ||| ||| ||||||| Sbjct: 389 gagctcctcgtcgttgcggatcgccagcagcacgtgcctcgggatgatccggttcttctt 330 Query: 437 gttgtccctcgcggcgttcccggccaactccaggacctcagcggcgagatactccagcac 496 |||||||| ||| ||||||||||| | |||||| ||||| |||||||| ||||| || || Sbjct: 329 gttgtcccgcgccgcgttcccggcgagctccagcacctctgcggcgaggtactcgaggac 270 Query: 497 ggcggcgaggtagacgggagcgccggcgccaaccctctcggcgtacttgccggccttgag 556 |||||||||||||||||| ||||||| ||| || | || |||||| ||| |||||| Sbjct: 269 ggcggcgaggtagacgggggcgccggtgccgacgcgctgggcgtagcggcccttcttgag 210 Query: 557 gaaccgcgcgatcctgccgacgggaaactggagcccggccttg 599 | | || |||| | ||||||||| |||||||||||||||||| Sbjct: 209 gtagcggccgatgcggccgacggggaactggagcccggccttg 167
>gb|M31922.1|VVCH4AB V.carteri histone H2A-IV and H2B-IV genes, complete cds Length = 2132 Score = 117 bits (59), Expect = 5e-23 Identities = 122/143 (85%) Strand = Plus / Plus Query: 378 agctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttcttg 437 ||||||||||||||||||| ||| |||||||| || ||||| ||||||||| |||||||| Sbjct: 550 agctcctcgtcgttgcggatggcgagctggatgtggcgcgggacgatgcggttcttcttg 609 Query: 438 ttgtccctcgcggcgttcccggccaactccaggacctcagcggcgagatactccagcacg 497 ||||| | || ||||| || |||| |||||| |||||||| | || ||||||||||| Sbjct: 610 ttgtcgcgggccgcgttgccagccagctccagaacctcagcagtcaggtactccagcaca 669 Query: 498 gcggcgaggtagacgggagcgcc 520 ||||| ||||||||||| ||||| Sbjct: 670 gcggccaggtagacgggggcgcc 692
>gb|U16725.1|CRU16725 Chlamydomonas reinhardtii histone H3 (ch3-III), histone H4 (ch4-III), histone H2B (ch2b-III) and histone H2A (ch2a-III) genes, complete cds Length = 4582 Score = 115 bits (58), Expect = 2e-22 Identities = 142/170 (83%) Strand = Plus / Minus Query: 378 agctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttcttg 437 |||||||| || ||||||| ||| |||||||| || || |||||||| ||| |||||||| Sbjct: 3379 agctcctcatcattgcggatggccagctggatgtggcggggcacgatacggttcttcttg 3320 Query: 438 ttgtccctcgcggcgttcccggccaactccaggacctcagcggcgagatactccagcacg 497 ||||| | |||||||| ||||||| ||| || |||||||||| || ||||||||||| Sbjct: 3319 ttgtcgcgggcggcgttgccggccagctctagcacctcagcggtcaggtactccagcaca 3260 Query: 498 gcggcgaggtagacgggagcgccggcgccaaccctctcggcgtacttgcc 547 ||||| ||||| ||||| |||||||| || | | ||||||||||||||| Sbjct: 3259 gcggccaggtacacgggcgcgccggcaccgatgcgctcggcgtacttgcc 3210
>gb|AF255740.1|AF255740 Bufo bufo gagarizans histone H1 (H1) and histone H2A variant (H2AInr) genes, complete cds Length = 2396 Score = 113 bits (57), Expect = 7e-22 Identities = 143/171 (83%), Gaps = 3/171 (1%) Strand = Plus / Minus Query: 377 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 436 |||||||||||||||||| ||||| ||||| | || || || | |||||||| |||| Sbjct: 1506 gagctcctcgtcgttgcgcacggccagctgcaggtgacgggggatgatgcggg---tctt 1450 Query: 437 gttgtccctcgcggcgttcccggccaactccaggacctcagcggcgagatactccagcac 496 |||||| | ||||| || ||||||| |||||||| ||| |||| ||||||||| ||||| Sbjct: 1449 gttgtcgcgggcggcattgccggccagctccaggatctcggcggtgagatactcgagcac 1390 Query: 497 ggcggcgaggtagacgggagcgccggcgccaaccctctcggcgtacttgcc 547 ||||| | ||||||||||||||||||||| ||||||| |||||| ||||| Sbjct: 1389 agcggccaagtagacgggagcgccggcgcccaccctctgggcgtagttgcc 1339
>ref|NM_118857.2| Arabidopsis thaliana DNA binding AT4G27230 mRNA, complete cds Length = 666 Score = 111 bits (56), Expect = 3e-21 Identities = 128/152 (84%) Strand = Plus / Minus Query: 399 gcaagctggatatgtcgcggcacgatgcgggtcttcttgttgtccctcgcggcgttcccg 458 |||||||| || ||||| || || || ||||||||||||||||| ||||| |||||||| Sbjct: 357 gcaagctgaatgtgtcgtggaactatacgggtcttcttgttgtctctcgctgcgttccca 298 Query: 459 gccaactccaggacctcagcggcgagatactccagcacggcggcgaggtagacgggagcg 518 || | ||| || |||||||||||||| || || || ||||||||||| ||||| ||||| Sbjct: 297 gcaagctcaagtacctcagcggcgaggtattcaagaacggcggcgagatagaccggagct 238 Query: 519 ccggcgccaaccctctcggcgtacttgccggc 550 ||||| ||||| | |||||||||||| ||||| Sbjct: 237 ccggcaccaacacgctcggcgtacttaccggc 206 Score = 44.1 bits (22), Expect = 0.57 Identities = 34/38 (89%) Strand = Plus / Minus Query: 297 gccttcttggggagcagaaggttgtggatgttgggcat 334 |||||||||||||| || || ||||||||||| ||||| Sbjct: 459 gccttcttggggagaaggagattgtggatgttaggcat 422
>gb|BT017719.1| Zea mays clone EL01N0447A04.c mRNA sequence Length = 772 Score = 111 bits (56), Expect = 3e-21 Identities = 122/144 (84%) Strand = Plus / Minus Query: 377 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 436 |||||||||||||||||||| ||| || ||| || ||||| | ||||||||| ||||| Sbjct: 371 gagctcctcgtcgttgcggatggcgaggaggaggtggcgcgggatgatgcgggttttctt 312 Query: 437 gttgtccctcgcggcgttcccggccaactccaggacctcagcggcgagatactccagcac 496 |||||| | ||| ||||| || |||| ||||||||||||||||||||| ||||| || || Sbjct: 311 gttgtcgcgcgccgcgttgccagccagctccaggacctcagcggcgaggtactcgaggac 252 Query: 497 ggcggcgaggtagacgggagcgcc 520 |||||| ||| | ||||||||||| Sbjct: 251 ggcggccaggaacacgggagcgcc 228
>gb|BT006076.1| Arabidopsis thaliana clone U20287 putative histone H2A (At4g27230) mRNA, complete cds Length = 427 Score = 111 bits (56), Expect = 3e-21 Identities = 128/152 (84%) Strand = Plus / Minus Query: 399 gcaagctggatatgtcgcggcacgatgcgggtcttcttgttgtccctcgcggcgttcccg 458 |||||||| || ||||| || || || ||||||||||||||||| ||||| |||||||| Sbjct: 263 gcaagctgaatgtgtcgtggaactatacgggtcttcttgttgtctctcgctgcgttccca 204 Query: 459 gccaactccaggacctcagcggcgagatactccagcacggcggcgaggtagacgggagcg 518 || | ||| || |||||||||||||| || || || ||||||||||| ||||| ||||| Sbjct: 203 gcaagctcaagtacctcagcggcgaggtattcaagaacggcggcgagatagaccggagct 144 Query: 519 ccggcgccaaccctctcggcgtacttgccggc 550 ||||| ||||| | |||||||||||| ||||| Sbjct: 143 ccggcaccaacacgctcggcgtacttaccggc 112 Score = 44.1 bits (22), Expect = 0.57 Identities = 34/38 (89%) Strand = Plus / Minus Query: 297 gccttcttggggagcagaaggttgtggatgttgggcat 334 |||||||||||||| || || ||||||||||| ||||| Sbjct: 365 gccttcttggggagaaggagattgtggatgttaggcat 328
>gb|BT005779.1| Arabidopsis thaliana clone RAFL14-92-E07 (R20287) putative histone H2A (At4g27230) mRNA, complete cds Length = 677 Score = 111 bits (56), Expect = 3e-21 Identities = 128/152 (84%) Strand = Plus / Minus Query: 399 gcaagctggatatgtcgcggcacgatgcgggtcttcttgttgtccctcgcggcgttcccg 458 |||||||| || ||||| || || || ||||||||||||||||| ||||| |||||||| Sbjct: 353 gcaagctgaatgtgtcgtggaactatacgggtcttcttgttgtctctcgctgcgttccca 294 Query: 459 gccaactccaggacctcagcggcgagatactccagcacggcggcgaggtagacgggagcg 518 || | ||| || |||||||||||||| || || || ||||||||||| ||||| ||||| Sbjct: 293 gcaagctcaagtacctcagcggcgaggtattcaagaacggcggcgagatagaccggagct 234 Query: 519 ccggcgccaaccctctcggcgtacttgccggc 550 ||||| ||||| | |||||||||||| ||||| Sbjct: 233 ccggcaccaacacgctcggcgtacttaccggc 202 Score = 44.1 bits (22), Expect = 0.57 Identities = 34/38 (89%) Strand = Plus / Minus Query: 297 gccttcttggggagcagaaggttgtggatgttgggcat 334 |||||||||||||| || || ||||||||||| ||||| Sbjct: 455 gccttcttggggagaaggagattgtggatgttaggcat 418
>gb|AY088714.1| Arabidopsis thaliana clone 927 mRNA, complete sequence Length = 660 Score = 111 bits (56), Expect = 3e-21 Identities = 128/152 (84%) Strand = Plus / Minus Query: 399 gcaagctggatatgtcgcggcacgatgcgggtcttcttgttgtccctcgcggcgttcccg 458 |||||||| || ||||| || || || ||||||||||||||||| ||||| |||||||| Sbjct: 358 gcaagctgaatgtgtcgtggaactatacgggtcttcttgttgtctctcgctgcgttccca 299 Query: 459 gccaactccaggacctcagcggcgagatactccagcacggcggcgaggtagacgggagcg 518 || | ||| || |||||||||||||| || || || ||||||||||| ||||| ||||| Sbjct: 298 gcaagctcaagtacctcagcggcgaggtattcaagaacggcggcgagatagaccggagct 239 Query: 519 ccggcgccaaccctctcggcgtacttgccggc 550 ||||| ||||| | |||||||||||| ||||| Sbjct: 238 ccggcaccaacacgctcggcgtacttaccggc 207 Score = 44.1 bits (22), Expect = 0.57 Identities = 34/38 (89%) Strand = Plus / Minus Query: 297 gccttcttggggagcagaaggttgtggatgttgggcat 334 |||||||||||||| || || ||||||||||| ||||| Sbjct: 460 gccttcttggggagaaggagattgtggatgttaggcat 423
>ref|XM_577577.1| PREDICTED: Rattus norvegicus similar to Histone H2A.1 (LOC502129), mRNA Length = 393 Score = 109 bits (55), Expect = 1e-20 Identities = 130/155 (83%) Strand = Plus / Minus Query: 377 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 436 |||||||||||||||||||| ||| ||||| | || ||||| | |||||| |||||||| Sbjct: 282 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 223 Query: 437 gttgtccctcgcggcgttcccggccaactccaggacctcagcggcgagatactccagcac 496 |||||||||||| ||||| || |||| |||||||| ||| || | || ||||||||||| Sbjct: 222 gttgtccctcgctgcgttgcccgccagctccaggatctcggccgtcaggtactccagcac 163 Query: 497 ggcggcgaggtagacgggagcgccggcgccaaccc 531 ||| || ||||| || || ||||||||||| |||| Sbjct: 162 ggccgccaggtacaccggggcgccggcgcccaccc 128
>ref|XM_225386.2| PREDICTED: Rattus norvegicus histone 1, H2an (predicted) (Hist1h2an_predicted), mRNA Length = 546 Score = 109 bits (55), Expect = 1e-20 Identities = 130/155 (83%) Strand = Plus / Minus Query: 377 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 436 |||||||||||||||||||| ||| ||||| | || ||||| | |||||| |||||||| Sbjct: 282 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 223 Query: 437 gttgtccctcgcggcgttcccggccaactccaggacctcagcggcgagatactccagcac 496 |||||||||||| ||||| || |||| |||||||| ||| || | || ||||||||||| Sbjct: 222 gttgtccctcgctgcgttgcccgccagctccaggatctcggccgtcaggtactccagcac 163 Query: 497 ggcggcgaggtagacgggagcgccggcgccaaccc 531 ||| || ||||| || || ||||||||||| |||| Sbjct: 162 ggccgccaggtacaccggggcgccggcgcccaccc 128
>ref|XM_225372.2| PREDICTED: Rattus norvegicus similar to Histone H2A.1 (LOC306962), mRNA Length = 437 Score = 109 bits (55), Expect = 1e-20 Identities = 142/171 (83%) Strand = Plus / Minus Query: 377 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 436 |||||||||||||||||||| ||| ||||| | || ||||| | |||||| |||||||| Sbjct: 296 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 237 Query: 437 gttgtccctcgcggcgttcccggccaactccaggacctcagcggcgagatactccagcac 496 |||||||||||| ||||| || |||| |||||||| ||| || | || ||||||||||| Sbjct: 236 gttgtccctcgccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcac 177 Query: 497 ggcggcgaggtagacgggagcgccggcgccaaccctctcggcgtacttgcc 547 ||| || || || || || ||||||||||| |||| ||||| ||| ||||| Sbjct: 176 ggccgccagatacactggggcgccggcgcccacccgctcggagtagttgcc 126
>gb|BT016301.1| Zea mays clone Contig134 mRNA sequence Length = 846 Score = 107 bits (54), Expect = 5e-20 Identities = 123/146 (84%) Strand = Plus / Minus Query: 377 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 436 |||||||||||||||||||| || ||| | | || ||||| | ||| ||| ||||||| Sbjct: 319 gagctcctcgtcgttgcggatcgccagcagtacgtgccgcgggatgatccggttcttctt 260 Query: 437 gttgtccctcgcggcgttcccggccaactccaggacctcagcggcgagatactccagcac 496 |||||||| ||| |||||||| |||||||| |||| ||| |||||||| ||||| || || Sbjct: 259 gttgtcccgcgctgcgttccccgccaactcgaggagctcggcggcgaggtactcgaggac 200 Query: 497 ggcggcgaggtagacgggagcgccgg 522 ||| |||||||||||||| ||||||| Sbjct: 199 ggcagcgaggtagacgggggcgccgg 174
>ref|XM_569065.1| Cryptococcus neoformans var. neoformans JEC21 histone H2A-1 (CNB00550) partial mRNA Length = 544 Score = 107 bits (54), Expect = 5e-20 Identities = 123/146 (84%) Strand = Plus / Minus Query: 377 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 436 |||||| |||||||| |||||||||||||| | ||||| || ||||| |||| |||||| Sbjct: 342 gagctcttcgtcgtttcggacggcaagctgaaggtgtcgggggacgatacgggacttctt 283 Query: 437 gttgtccctcgcggcgttcccggccaactccaggacctcagcggcgagatactccagcac 496 |||||| | || ||||| ||||||||||| |||| |||||||| || ||||| || || Sbjct: 282 gttgtctcgggcagcgttaccggccaactcgaggatttcagcggcaaggtactcaaggac 223 Query: 497 ggcggcgaggtagacgggagcgccgg 522 ||| ||||||||||||||||| |||| Sbjct: 222 ggcagcgaggtagacgggagcaccgg 197
>emb|CR705345.2|CNS0G771 Tetraodon nigroviridis full-length cDNA Length = 1250 Score = 107 bits (54), Expect = 5e-20 Identities = 141/170 (82%) Strand = Plus / Minus Query: 378 agctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttcttg 437 ||||| |||||||| || || || ||||||| ||| || || | |||||||||| |||| Sbjct: 335 agctcttcgtcgttccgcacagccagctggagatggcgagggataatgcgggtctccttg 276 Query: 438 ttgtccctcgcggcgttcccggccaactccaggacctcagcggcgagatactccagcacg 497 ||||| || |||||||| |||||||||||||||| ||| |||| ||||||||||| ||| Sbjct: 275 ttgtctcttgcggcgttgccggccaactccaggatctcggcggtcagatactccaggacg 216 Query: 498 gcggcgaggtagacgggagcgccggcgccaaccctctcggcgtacttgcc 547 || || ||||||||||| || |||||||| || | ||| ||||| ||||| Sbjct: 215 gcagccaggtagacgggcgccccggcgccgactcgctccgcgtagttgcc 166
>ref|XM_683706.1| PREDICTED: Danio rerio similar to histone H2A (LOC560309), mRNA Length = 387 Score = 107 bits (54), Expect = 5e-20 Identities = 126/150 (84%) Strand = Plus / Minus Query: 380 ctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttcttgtt 439 ||||||||||||||| || || ||||| | || || || | |||||||||||||||||| Sbjct: 279 ctcctcgtcgttgcgcaccgccagctgcaggtgacgggggatgatgcgggtcttcttgtt 220 Query: 440 gtccctcgcggcgttcccggccaactccaggacctcagcggcgagatactccagcacggc 499 ||||| |||||||| |||||||||||||||| ||||||| |||||||| ||||| || Sbjct: 219 gtcccgagcggcgtttccggccaactccaggatttcagcggtcagatactcgagcacagc 160 Query: 500 ggcgaggtagacgggagcgccggcgccaac 529 ||| | |||||| ||||| ||||| ||||| Sbjct: 159 ggccaagtagactggagcaccggcaccaac 130
>gb|AY104486.1| Zea mays PCO109435 mRNA sequence Length = 992 Score = 107 bits (54), Expect = 5e-20 Identities = 123/146 (84%) Strand = Plus / Minus Query: 377 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 436 ||||||||| |||||||||| || ||| | | |||||||| | ||| ||| ||||||| Sbjct: 390 gagctcctcatcgttgcggatcgccagcagtacgtgtcgcgggatgatccggttcttctt 331 Query: 437 gttgtccctcgcggcgttcccggccaactccaggacctcagcggcgagatactccagcac 496 |||||||| ||| |||||||| |||||||| |||| ||| |||||||| ||||| || || Sbjct: 330 gttgtcccgcgctgcgttccccgccaactcgaggagctcggcggcgaggtactcgaggac 271 Query: 497 ggcggcgaggtagacgggagcgccgg 522 ||| |||||||||||||| ||||||| Sbjct: 270 ggcagcgaggtagacgggggcgccgg 245
>emb|CR354435.20| Zebrafish DNA sequence from clone CH211-113A14 in linkage group 25, complete sequence Length = 167326 Score = 107 bits (54), Expect = 5e-20 Identities = 126/150 (84%) Strand = Plus / Plus Query: 380 ctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttcttgtt 439 ||||||||||||||| || || ||||| | || || || | |||||||||||||||||| Sbjct: 92055 ctcctcgtcgttgcgcaccgccagctgcaggtgacgggggatgatgcgggtcttcttgtt 92114 Query: 440 gtccctcgcggcgttcccggccaactccaggacctcagcggcgagatactccagcacggc 499 ||||| |||||||| |||||||||||||||| ||||||| |||||||| ||||| || Sbjct: 92115 gtcccgagcggcgtttccggccaactccaggatttcagcggtcagatactcgagcacagc 92174 Query: 500 ggcgaggtagacgggagcgccggcgccaac 529 ||| | |||||| ||||| ||||| ||||| Sbjct: 92175 ggccaagtagactggagcaccggcaccaac 92204 Score = 103 bits (52), Expect = 7e-19 Identities = 127/152 (83%) Strand = Plus / Plus Query: 378 agctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttcttg 437 ||||||||||||||||| || || ||||| | || || || | ||| |||||||||||| Sbjct: 117640 agctcctcgtcgttgcgcaccgccagctgcaggtgacgggggatgatacgggtcttcttg 117699 Query: 438 ttgtccctcgcggcgttcccggccaactccaggacctcagcggcgagatactccagcacg 497 ||||||| |||||||| || ||||||||||||| |||||||| |||||||| ||||| Sbjct: 117700 ttgtcccgagcggcgtttccagccaactccaggatctcagcggtcagatactcgagcaca 117759 Query: 498 gcggcgaggtagacgggagcgccggcgccaac 529 ||||| | |||||| ||||| ||||| ||||| Sbjct: 117760 gcggccaagtagactggagcaccggcaccaac 117791 Score = 103 bits (52), Expect = 7e-19 Identities = 127/152 (83%) Strand = Plus / Plus Query: 378 agctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttcttg 437 ||||||||||||||||| || || ||||| | || || || | ||| |||||||||||| Sbjct: 106584 agctcctcgtcgttgcgcaccgccagctgcaggtgacgggggatgatacgggtcttcttg 106643 Query: 438 ttgtccctcgcggcgttcccggccaactccaggacctcagcggcgagatactccagcacg 497 ||||||| |||||||| || ||||||||||||| |||||||| |||||||| ||||| Sbjct: 106644 ttgtcccgagcggcgtttccagccaactccaggatctcagcggtcagatactcgagcaca 106703 Query: 498 gcggcgaggtagacgggagcgccggcgccaac 529 ||||| | |||||| ||||| ||||| ||||| Sbjct: 106704 gcggccaagtagactggagcaccggcaccaac 106735 Score = 99.6 bits (50), Expect = 1e-17 Identities = 122/146 (83%) Strand = Plus / Plus Query: 378 agctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttcttg 437 ||||||||||||||||| || || ||||| | || || || | |||||||||||||||| Sbjct: 100409 agctcctcgtcgttgcgcaccgccagctgcaggtgacgggggatgatgcgggtcttcttg 100468 Query: 438 ttgtccctcgcggcgttcccggccaactccaggacctcagcggcgagatactccagcacg 497 ||||||| |||||||| || ||||||||||||| |||||| | |||||||| ||||| Sbjct: 100469 ttgtcccgagcggcgtttccagccaactccaggatctcagcagttagatactcgagcaca 100528 Query: 498 gcggcgaggtagacgggagcgccggc 523 ||||| ||||| || ||||| ||||| Sbjct: 100529 gcggccaggtacactggagcaccggc 100554 Score = 95.6 bits (48), Expect = 2e-16 Identities = 120/144 (83%) Strand = Plus / Plus Query: 380 ctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttcttgtt 439 ||||||||||||||| || || ||||| | || || || | ||| |||||||||||||| Sbjct: 87619 ctcctcgtcgttgcgcaccgccagctgcaggtgacgggggatgatacgggtcttcttgtt 87678 Query: 440 gtccctcgcggcgttcccggccaactccaggacctcagcggcgagatactccagcacggc 499 ||||| |||||||| |||||||||||||||| |||||||| |||||||| ||||| || Sbjct: 87679 gtcccgagcggcgtttccggccaactccaggatctcagcggtcagatactcgagcacagc 87738 Query: 500 ggcgaggtagacgggagcgccggc 523 ||| | ||| || ||||| ||||| Sbjct: 87739 ggccaagtacaccggagcaccggc 87762 Score = 91.7 bits (46), Expect = 3e-15 Identities = 85/98 (86%) Strand = Plus / Minus Query: 426 cgggtcttcttgttgtccctcgcggcgttcccggccaactccaggacctcagcggcgaga 485 ||||||||||||||||||| |||||||| |||||||||||||||| |||||||| ||| Sbjct: 61962 cgggtcttcttgttgtcccgagcggcgtttccggccaactccaggatctcagcggtcaga 61903 Query: 486 tactccagcacggcggcgaggtagacgggagcgccggc 523 ||||| ||||| ||||| | ||| || ||||| ||||| Sbjct: 61902 tactcgagcacagcggccaagtacaccggagcaccggc 61865 Score = 89.7 bits (45), Expect = 1e-14 Identities = 69/77 (89%) Strand = Plus / Plus Query: 426 cgggtcttcttgttgtccctcgcggcgttcccggccaactccaggacctcagcggcgaga 485 ||||||||||||||||||| |||||||| |||||||||||||||| |||||||| ||| Sbjct: 80588 cgggtcttcttgttgtcccgagcggcgtttccggccaactccaggatctcagcggtcaga 80647 Query: 486 tactccagcacggcggc 502 ||||| ||||| ||||| Sbjct: 80648 tactcgagcacagcggc 80664
>ref|NM_193707.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 480 Score = 105 bits (53), Expect = 2e-19 Identities = 83/93 (89%) Strand = Plus / Minus Query: 430 tcttcttgttgtccctcgcggcgttcccggccaactccaggacctcagcggcgagatact 489 |||||||||||||||| || ||||||||||| | |||||| ||||| |||||||| |||| Sbjct: 268 tcttcttgttgtccctggccgcgttcccggcgagctccagcacctcggcggcgaggtact 209 Query: 490 ccagcacggcggcgaggtagacgggagcgccgg 522 | || |||||||||||||||||||| ||||||| Sbjct: 208 cgaggacggcggcgaggtagacgggggcgccgg 176 Score = 48.1 bits (24), Expect = 0.037 Identities = 27/28 (96%) Strand = Plus / Minus Query: 572 gccgacgggaaactggagcccggccttg 599 ||||||||| |||||||||||||||||| Sbjct: 126 gccgacggggaactggagcccggccttg 99
>ref|XM_683282.1| PREDICTED: Danio rerio similar to histone H2A (LOC559892), mRNA Length = 696 Score = 103 bits (52), Expect = 7e-19 Identities = 127/152 (83%) Strand = Plus / Minus Query: 378 agctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttcttg 437 ||||||||||||||||| || || ||||| | || || || | ||| |||||||||||| Sbjct: 281 agctcctcgtcgttgcgcaccgccagctgcaggtgacgggggatgatacgggtcttcttg 222 Query: 438 ttgtccctcgcggcgttcccggccaactccaggacctcagcggcgagatactccagcacg 497 ||||||| |||||||| || ||||||||||||| |||||||| |||||||| ||||| Sbjct: 221 ttgtcccgagcggcgtttccagccaactccaggatctcagcggtcagatactcgagcaca 162 Query: 498 gcggcgaggtagacgggagcgccggcgccaac 529 ||||| | |||||| ||||| ||||| ||||| Sbjct: 161 gcggccaagtagactggagcaccggcaccaac 130
>ref|XM_683060.1| PREDICTED: Danio rerio similar to replication-dependent histone H2A (LOC559697), mRNA Length = 423 Score = 103 bits (52), Expect = 7e-19 Identities = 127/152 (83%) Strand = Plus / Minus Query: 378 agctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttcttg 437 ||||||||||||||||| || || ||||| | || || || | ||| |||||||||||| Sbjct: 281 agctcctcgtcgttgcgcaccgccagctgcaggtgacgggggatgatacgggtcttcttg 222 Query: 438 ttgtccctcgcggcgttcccggccaactccaggacctcagcggcgagatactccagcacg 497 ||||||| |||||||| || ||||||||||||| |||||||| |||||||| ||||| Sbjct: 221 ttgtcccgagcggcgtttccagccaactccaggatctcagcggtcagatactcgagcaca 162 Query: 498 gcggcgaggtagacgggagcgccggcgccaac 529 ||||| | |||||| ||||| ||||| ||||| Sbjct: 161 gcggccaagtagactggagcaccggcaccaac 130
>gb|M31921.1|VVCH2AB V.carteri histone H2A-III and H2B-III genes, complete cds Length = 1442 Score = 103 bits (52), Expect = 7e-19 Identities = 118/140 (84%) Strand = Plus / Plus Query: 378 agctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttcttg 437 ||||||||||| ||||||| ||| | ||||||||| || || ||||||||| |||||||| Sbjct: 267 agctcctcgtcattgcggatggccaactggatatggcgtgggacgatgcggttcttcttg 326 Query: 438 ttgtccctcgcggcgttcccggccaactccaggacctcagcggcgagatactccagcacg 497 ||||| | || ||||| ||||||| |||||| |||||||||| ||| |||||||| || Sbjct: 327 ttgtcgcgagcagcgtttccggccagctccagaacctcagcggtgaggtactccaggaca 386 Query: 498 gcggcgaggtagacgggagc 517 || || ||||| |||||||| Sbjct: 387 gcagccaggtacacgggagc 406
>gb|BC068823.1| Xenopus laevis cDNA clone IMAGE:6635737, partial cds Length = 763 Score = 101 bits (51), Expect = 3e-18 Identities = 141/171 (82%) Strand = Plus / Plus Query: 377 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 436 |||||||||||||||||| ||||| ||||| | || | || | |||||| |||||||| Sbjct: 367 gagctcctcgtcgttgcgcacggcgagctgcaggtgcctggggatgatgcgagtcttctt 426 Query: 437 gttgtccctcgcggcgttcccggccaactccaggacctcagcggcgagatactccagcac 496 ||| |||| || ||||| |||||||||||||||| ||| |||| |||||||| ||||| Sbjct: 427 gttatcccgggcagcgttgccggccaactccaggatctcggcggtcagatactcgagcac 486 Query: 497 ggcggcgaggtagacgggagcgccggcgccaaccctctcggcgtacttgcc 547 ||||| |||||||| ||||| ||||| || |||| |||||| || ||||| Sbjct: 487 cgcggccaggtagactggagctccggctcccacccgctcggcataattgcc 537
>ref|XM_475374.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 492 Score = 99.6 bits (50), Expect = 1e-17 Identities = 122/146 (83%) Strand = Plus / Minus Query: 377 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 436 |||||||||||||||||||| || ||| | | || ||||| | ||| ||| ||||||| Sbjct: 315 gagctcctcgtcgttgcggatcgccagcagcacgtgccgcgggatgatccggttcttctt 256 Query: 437 gttgtccctcgcggcgttcccggccaactccaggacctcagcggcgagatactccagcac 496 |||||||| ||| |||||||| || | ||| || ||||| |||||||| ||||| || || Sbjct: 255 gttgtcccgcgccgcgttccccgcaagctcgagcacctcggcggcgaggtactcgaggac 196 Query: 497 ggcggcgaggtagacgggagcgccgg 522 |||||||||||||||||| ||||||| Sbjct: 195 ggcggcgaggtagacgggggcgccgg 170 Score = 48.1 bits (24), Expect = 0.037 Identities = 27/28 (96%) Strand = Plus / Minus Query: 572 gccgacgggaaactggagcccggccttg 599 ||||||||| |||||||||||||||||| Sbjct: 120 gccgacggggaactggagcccggccttg 93
>gb|BC077427.1| Xenopus laevis MGC82198 protein, mRNA (cDNA clone MGC:82198 IMAGE:3402168), complete cds Length = 1591 Score = 99.6 bits (50), Expect = 1e-17 Identities = 107/126 (84%) Strand = Plus / Minus Query: 422 gatgcgggtcttcttgttgtccctcgcggcgttcccggccaactccaggacctcagcggc 481 |||||||||||||||||| |||| || ||||| |||||||||||||||| |||||||| Sbjct: 245 gatgcgggtcttcttgttatcccgggcagcgttgccggccaactccaggatctcagcggt 186 Query: 482 gagatactccagcacggcggcgaggtagacgggagcgccggcgccaaccctctcggcgta 541 || ||||| ||||| |||||||| ||||| ||||| ||||| || |||| |||||| || Sbjct: 185 caggtactcgagcactgcggcgagatagaccggagctccggctcccacccgctcggcata 126 Query: 542 cttgcc 547 ||||| Sbjct: 125 attgcc 120
>gb|BC098891.1| Danio rerio zgc:114037, mRNA (cDNA clone MGC:114037 IMAGE:7276112), complete cds Length = 530 Score = 99.6 bits (50), Expect = 1e-17 Identities = 122/146 (83%) Strand = Plus / Minus Query: 378 agctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttcttg 437 ||||||||||||||||| || || ||||| | || || || | |||||||||||||||| Sbjct: 323 agctcctcgtcgttgcgcaccgccagctgcaggtgacgggggatgatgcgggtcttcttg 264 Query: 438 ttgtccctcgcggcgttcccggccaactccaggacctcagcggcgagatactccagcacg 497 ||||||| |||||||| || ||||||||||||| |||||| | |||||||| ||||| Sbjct: 263 ttgtcccgagcggcgtttccagccaactccaggatctcagcagttagatactcgagcaca 204 Query: 498 gcggcgaggtagacgggagcgccggc 523 ||||| ||||| || ||||| ||||| Sbjct: 203 gcggccaggtacactggagcaccggc 178
>emb|CT025304.2| Xenopus tropicalis finished cDNA, clone TNeu074k04 Length = 550 Score = 99.6 bits (50), Expect = 1e-17 Identities = 86/98 (87%) Strand = Plus / Minus Query: 426 cgggtcttcttgttgtccctcgcggcgttcccggccaactccaggacctcagcggcgaga 485 |||||||||||||| |||| || |||||||||||||||||||||| |||||||| ||| Sbjct: 247 cgggtcttcttgttatcccgggcagcgttcccggccaactccaggatctcagcggtcaga 188 Query: 486 tactccagcacggcggcgaggtagacgggagcgccggc 523 ||||||||||| ||||| || ||||| ||||| ||||| Sbjct: 187 tactccagcactgcggcaagatagactggagctccggc 150
>ref|NM_001031826.1| Danio rerio zgc:114037 (zgc:114037), mRNA Length = 530 Score = 99.6 bits (50), Expect = 1e-17 Identities = 122/146 (83%) Strand = Plus / Minus Query: 378 agctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttcttg 437 ||||||||||||||||| || || ||||| | || || || | |||||||||||||||| Sbjct: 323 agctcctcgtcgttgcgcaccgccagctgcaggtgacgggggatgatgcgggtcttcttg 264 Query: 438 ttgtccctcgcggcgttcccggccaactccaggacctcagcggcgagatactccagcacg 497 ||||||| |||||||| || ||||||||||||| |||||| | |||||||| ||||| Sbjct: 263 ttgtcccgagcggcgtttccagccaactccaggatctcagcagttagatactcgagcaca 204 Query: 498 gcggcgaggtagacgggagcgccggc 523 ||||| ||||| || ||||| ||||| Sbjct: 203 gcggccaggtacactggagcaccggc 178
>ref|XM_683419.1| PREDICTED: Danio rerio similar to replication-dependent histone H2A (LOC560025), mRNA Length = 501 Score = 99.6 bits (50), Expect = 1e-17 Identities = 122/146 (83%) Strand = Plus / Minus Query: 378 agctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttcttg 437 ||||||||||||||||| || || ||||| | || || || | |||||||||||||||| Sbjct: 365 agctcctcgtcgttgcgcaccgccagctgcaggtgacgggggatgatgcgggtcttcttg 306 Query: 438 ttgtccctcgcggcgttcccggccaactccaggacctcagcggcgagatactccagcacg 497 ||||||| |||||||| || ||||||||||||| |||||| | |||||||| ||||| Sbjct: 305 ttgtcccgagcggcgtttccagccaactccaggatctcagcagttagatactcgagcaca 246 Query: 498 gcggcgaggtagacgggagcgccggc 523 ||||| ||||| || ||||| ||||| Sbjct: 245 gcggccaggtacactggagcaccggc 220
>ref|XM_694138.1| PREDICTED: Danio rerio similar to histone H2A (LOC570634), mRNA Length = 387 Score = 99.6 bits (50), Expect = 1e-17 Identities = 122/146 (83%) Strand = Plus / Minus Query: 378 agctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttcttg 437 |||||||||||||| || || || ||||| | || || || | |||||||||||||||| Sbjct: 281 agctcctcgtcgttacgcaccgccagctgcaggtgacgggggatgatgcgggtcttcttg 222 Query: 438 ttgtccctcgcggcgttcccggccaactccaggacctcagcggcgagatactccagcacg 497 ||||||| |||||||| ||||||||||| |||| |||||||| |||||||| ||||| Sbjct: 221 ttgtcccgagcggcgtttccggccaactctaggatctcagcggtcagatactcgagcaca 162 Query: 498 gcggcgaggtagacgggagcgccggc 523 ||||| ||||| || ||||| ||||| Sbjct: 161 gcggccaggtacaccggagcaccggc 136
>dbj|AK121750.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033087I02, full insert sequence Length = 754 Score = 99.6 bits (50), Expect = 1e-17 Identities = 140/170 (82%) Strand = Plus / Minus Query: 430 tcttcttgttgtccctcgcggcgttcccggccaactccaggacctcagcggcgagatact 489 |||||||||||||||| || ||||||||||| | |||||| ||||| || ||||| |||| Sbjct: 358 tcttcttgttgtccctggccgcgttcccggcgagctccagcacctcggcagcgaggtact 299 Query: 490 ccagcacggcggcgaggtagacgggagcgccggcgccaaccctctcggcgtacttgccgg 549 | || |||||||||||||||||||| ||||||| ||| | | || |||||| ||| Sbjct: 298 cgaggacggcggcgaggtagacgggggcgccggtgccgatgcgctgggcgtagcggccct 239 Query: 550 ccttgaggaaccgcgcgatcctgccgacgggaaactggagcccggccttg 599 ||||||| | || |||| | ||||||||| |||||||||||||||||| Sbjct: 238 tcttgaggtagcggccgatacggccgacggggaactggagcccggccttg 189
>dbj|AK099763.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013094K03, full insert sequence Length = 912 Score = 99.6 bits (50), Expect = 1e-17 Identities = 122/146 (83%) Strand = Plus / Minus Query: 377 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 436 |||||||||||||||||||| || ||| | | || ||||| | ||| ||| ||||||| Sbjct: 385 gagctcctcgtcgttgcggatcgccagcagcacgtgccgcgggatgatccggttcttctt 326 Query: 437 gttgtccctcgcggcgttcccggccaactccaggacctcagcggcgagatactccagcac 496 |||||||| ||| |||||||| || | ||| || ||||| |||||||| ||||| || || Sbjct: 325 gttgtcccgcgccgcgttccccgcaagctcgagcacctcggcggcgaggtactcgaggac 266 Query: 497 ggcggcgaggtagacgggagcgccgg 522 |||||||||||||||||| ||||||| Sbjct: 265 ggcggcgaggtagacgggggcgccgg 240 Score = 48.1 bits (24), Expect = 0.037 Identities = 27/28 (96%) Strand = Plus / Minus Query: 572 gccgacgggaaactggagcccggccttg 599 ||||||||| |||||||||||||||||| Sbjct: 190 gccgacggggaactggagcccggccttg 163
>dbj|AK067406.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013099N23, full insert sequence Length = 1097 Score = 99.6 bits (50), Expect = 1e-17 Identities = 122/146 (83%) Strand = Plus / Minus Query: 377 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 436 |||||||||||||||||||| || ||| | | || ||||| | ||| ||| ||||||| Sbjct: 386 gagctcctcgtcgttgcggatcgccagcagcacgtgccgcgggatgatccggttcttctt 327 Query: 437 gttgtccctcgcggcgttcccggccaactccaggacctcagcggcgagatactccagcac 496 |||||||| ||| |||||||| || | ||| || ||||| |||||||| ||||| || || Sbjct: 326 gttgtcccgcgccgcgttccccgcaagctcgagcacctcggcggcgaggtactcgaggac 267 Query: 497 ggcggcgaggtagacgggagcgccgg 522 |||||||||||||||||| ||||||| Sbjct: 266 ggcggcgaggtagacgggggcgccgg 241 Score = 48.1 bits (24), Expect = 0.037 Identities = 27/28 (96%) Strand = Plus / Minus Query: 572 gccgacgggaaactggagcccggccttg 599 ||||||||| |||||||||||||||||| Sbjct: 191 gccgacggggaactggagcccggccttg 164
>gb|AY389588.1| Hyacinthus orientalis histone H2A mRNA, complete cds Length = 643 Score = 97.6 bits (49), Expect = 4e-17 Identities = 82/93 (88%) Strand = Plus / Minus Query: 430 tcttcttgttgtccctcgcggcgttcccggccaactccaggacctcagcggcgagatact 489 ||||||| ||||||||||| ||||| ||||||||||||| |||||||| ||||| |||| Sbjct: 283 tcttcttattgtccctcgccgcgtttccggccaactccaatacctcagcagcgaggtact 224 Query: 490 ccagcacggcggcgaggtagacgggagcgccgg 522 ||| ||||||||||||||||| ||||| |||| Sbjct: 223 ccaagacggcggcgaggtagaccggagctccgg 191 Score = 40.1 bits (20), Expect = 8.9 Identities = 23/24 (95%) Strand = Plus / Minus Query: 576 acgggaaactggagcccggccttg 599 ||||| |||||||||||||||||| Sbjct: 137 acggggaactggagcccggccttg 114
>ref|XM_682538.1| PREDICTED: Danio rerio similar to replication-dependent histone H2A (LOC559220), mRNA Length = 444 Score = 97.6 bits (49), Expect = 4e-17 Identities = 106/125 (84%) Strand = Plus / Minus Query: 378 agctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttcttg 437 ||||||||||||||||| || || ||||| | || || || | ||| |||||||||||| Sbjct: 281 agctcctcgtcgttgcgcaccgccagctgcaggtgacgggggatgatacgggtcttcttg 222 Query: 438 ttgtccctcgcggcgttcccggccaactccaggacctcagcggcgagatactccagcacg 497 ||||||| |||||||| || ||||||||||||| |||||||| |||||||| |||||| Sbjct: 221 ttgtcccgagcggcgtttccagccaactccaggatctcagcggtcagatactcgagcacg 162 Query: 498 gcggc 502 ||||| Sbjct: 161 gcggc 157
>emb|BX088700.1|CNS09S4S DNA centromeric region sequence from BAC DP26B06, DP34F04, DP16D11, DP09G08, DP35C12 of chromosome 5 of Podospora anserina Length = 322194 Score = 95.6 bits (48), Expect = 2e-16 Identities = 120/144 (83%) Strand = Plus / Plus Query: 380 ctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttcttgtt 439 |||||| |||||||||| ||| ||||||| ||| || || | ||| |||||||||||||| Sbjct: 19993 ctcctcatcgttgcggatggcgagctggagatgacgggggatgatacgggtcttcttgtt 20052 Query: 440 gtccctcgcggcgttcccggccaactccaggacctcagcggcgagatactccagcacggc 499 ||| | |||||||| || |||||||| |||| || || ||||| ||||| || || || Sbjct: 20053 gtcacgagcggcgttgccagccaactcgaggatttcggcagcgaggtactcaagaacagc 20112 Query: 500 ggcgaggtagacgggagcgccggc 523 |||||||||||||||||| ||||| Sbjct: 20113 ggcgaggtagacgggagcaccggc 20136
>ref|XM_683938.1| PREDICTED: Danio rerio similar to histone H2A (LOC560527), mRNA Length = 387 Score = 95.6 bits (48), Expect = 2e-16 Identities = 120/144 (83%) Strand = Plus / Minus Query: 380 ctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttcttgtt 439 ||||||||||||||| || || ||||| | || || || | ||| |||||||||||||| Sbjct: 279 ctcctcgtcgttgcgcaccgccagctgcaggtgacgggggatgatacgggtcttcttgtt 220 Query: 440 gtccctcgcggcgttcccggccaactccaggacctcagcggcgagatactccagcacggc 499 ||||| |||||||| |||||||||||||||| |||||||| |||||||| ||||| || Sbjct: 219 gtcccgagcggcgtttccggccaactccaggatctcagcggtcagatactcgagcacagc 160 Query: 500 ggcgaggtagacgggagcgccggc 523 ||| | ||| || ||||| ||||| Sbjct: 159 ggccaagtacaccggagcaccggc 136
>emb|AL590462.1|CNS07EGJ DNA centromeric region sequence BAC 34F04 of chromosome 5 of Podospora anserina Length = 103568 Score = 95.6 bits (48), Expect = 2e-16 Identities = 120/144 (83%) Strand = Plus / Minus Query: 380 ctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttcttgtt 439 |||||| |||||||||| ||| ||||||| ||| || || | ||| |||||||||||||| Sbjct: 85118 ctcctcatcgttgcggatggcgagctggagatgacgggggatgatacgggtcttcttgtt 85059 Query: 440 gtccctcgcggcgttcccggccaactccaggacctcagcggcgagatactccagcacggc 499 ||| | |||||||| || |||||||| |||| || || ||||| ||||| || || || Sbjct: 85058 gtcacgagcggcgttgccagccaactcgaggatttcggcagcgaggtactcaagaacagc 84999 Query: 500 ggcgaggtagacgggagcgccggc 523 |||||||||||||||||| ||||| Sbjct: 84998 ggcgaggtagacgggagcaccggc 84975
>gb|BC106331.1| Xenopus laevis cDNA clone MGC:130860 IMAGE:7205580, complete cds Length = 799 Score = 93.7 bits (47), Expect = 7e-16 Identities = 182/227 (80%) Strand = Plus / Minus Query: 321 tggatgttgggcatgacaccgccgctggcgattgtgaccataccgagcaggcgggagagc 380 ||||||||||||| ||||||||| |||||| |||||| |||||||| | |||| Sbjct: 350 tggatgttgggcaggacaccgccctgggcgatggtgacccctccgagcagtttgttgagc 291 Query: 381 tcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttcttgttg 440 |||||||||||||| ||||| ||||| | || | || | ||| || ||||||||||| Sbjct: 290 tcctcgtcgttgcgcacggcgagctgcaggtgcctggggatgatccgagtcttcttgtta 231 Query: 441 tccctcgcggcgttcccggccaactccaggacctcagcggcgagatactccagcacggcg 500 |||| || ||||| ||||||||||| |||| ||| |||| |||||||| ||||| ||| Sbjct: 230 tcccgggcagcgttgccggccaactcgaggatctcggcggtcagatactcgagcaccgcg 171 Query: 501 gcgaggtagacgggagcgccggcgccaaccctctcggcgtacttgcc 547 || |||||||| ||||| ||||| || |||| |||||| || ||||| Sbjct: 170 gcaaggtagactggagctccggctcccacccgctcggcataattgcc 124
>ref|XM_540292.2| PREDICTED: Canis familiaris similar to histone 2, H2ac (LOC483174), mRNA Length = 485 Score = 93.7 bits (47), Expect = 7e-16 Identities = 182/227 (80%) Strand = Plus / Minus Query: 321 tggatgttgggcatgacaccgccgctggcgattgtgaccataccgagcaggcgggagagc 380 ||||||||||||| ||| ||||| |||||| |||||| | || ||||| | |||| Sbjct: 395 tggatgttgggcaggacgccgccctgggcgatggtgaccttgcccagcagcttgttgagc 336 Query: 381 tcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttcttgttg 440 |||||||||||||||| ||| ||||| | || || || | ||| || |||||||||||| Sbjct: 335 tcctcgtcgttgcggatggccagctgcaggtggcgggggatgatacgcgtcttcttgttg 276 Query: 441 tccctcgcggcgttcccggccaactccaggacctcagcggcgagatactccagcacggcg 500 || | || ||||| || |||| |||||||| ||| || | || |||||||||||||| Sbjct: 275 tcgcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcacggcc 216 Query: 501 gcgaggtagacgggagcgccggcgccaaccctctcggcgtacttgcc 547 || | |||||||||||||||||| || |||| ||||||||| ||||| Sbjct: 215 gccatgtagacgggagcgccggcccccacccgctcggcgtagttgcc 169
>ref|XM_845715.1| PREDICTED: Canis familiaris similar to Histone H2A.o (H2A/o) (H2A.2) (H2a-615) (LOC608631), mRNA Length = 534 Score = 93.7 bits (47), Expect = 7e-16 Identities = 182/227 (80%) Strand = Plus / Minus Query: 321 tggatgttgggcatgacaccgccgctggcgattgtgaccataccgagcaggcgggagagc 380 ||||||||||||| ||| ||||| |||||| |||||| | || ||||| | |||| Sbjct: 373 tggatgttgggcaggacgccgccctgggcgatggtgaccttgcccagcagcttgttgagc 314 Query: 381 tcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttcttgttg 440 |||||||||||||||| ||| ||||| | || || || | ||| || |||||||||||| Sbjct: 313 tcctcgtcgttgcggatggccagctgcaggtggcgggggatgatacgcgtcttcttgttg 254 Query: 441 tccctcgcggcgttcccggccaactccaggacctcagcggcgagatactccagcacggcg 500 || | || ||||| || |||| |||||||| ||| || | || |||||||||||||| Sbjct: 253 tcgcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcacggcc 194 Query: 501 gcgaggtagacgggagcgccggcgccaaccctctcggcgtacttgcc 547 || | |||||||||||||||||| || |||| ||||||||| ||||| Sbjct: 193 gccatgtagacgggagcgccggcccccacccgctcggcgtagttgcc 147
>ref|XM_540286.2| PREDICTED: Canis familiaris similar to Histone H2A.o (H2A/o) (H2A.2) (H2a-615) (LOC483168), mRNA Length = 534 Score = 93.7 bits (47), Expect = 7e-16 Identities = 182/227 (80%) Strand = Plus / Minus Query: 321 tggatgttgggcatgacaccgccgctggcgattgtgaccataccgagcaggcgggagagc 380 ||||||||||||| ||| ||||| |||||| |||||| | || ||||| | |||| Sbjct: 373 tggatgttgggcaggacgccgccctgggcgatggtgaccttgcccagcagcttgttgagc 314 Query: 381 tcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttcttgttg 440 |||||||||||||||| ||| ||||| | || || || | ||| || |||||||||||| Sbjct: 313 tcctcgtcgttgcggatggccagctgcaggtggcgggggatgatacgcgtcttcttgttg 254 Query: 441 tccctcgcggcgttcccggccaactccaggacctcagcggcgagatactccagcacggcg 500 || | || ||||| || |||| |||||||| ||| || | || |||||||||||||| Sbjct: 253 tcgcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcacggcc 194 Query: 501 gcgaggtagacgggagcgccggcgccaaccctctcggcgtacttgcc 547 || | |||||||||||||||||| || |||| ||||||||| ||||| Sbjct: 193 gccatgtagacgggagcgccggcccccacccgctcggcgtagttgcc 147
>emb|X03018.1|XLHISH3A Xenopus laevis histone gene cluster XlH3-A with genes H1A, H2B, H3 and H4 Length = 8592 Score = 93.7 bits (47), Expect = 7e-16 Identities = 182/227 (80%) Strand = Plus / Minus Query: 321 tggatgttgggcatgacaccgccgctggcgattgtgaccataccgagcaggcgggagagc 380 ||||||||||||| ||||||||| |||||| |||||| |||||||| | |||| Sbjct: 4709 tggatgttgggcaggacaccgccctgggcgatggtgacccctccgagcagtttgttgagc 4650 Query: 381 tcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttcttgttg 440 |||||||||||||| ||||| ||||| | || | || | ||| || ||||||||||| Sbjct: 4649 tcctcgtcgttgcgcacggcgagctgcaggtgcctggggatgatccgagtcttcttgtta 4590 Query: 441 tccctcgcggcgttcccggccaactccaggacctcagcggcgagatactccagcacggcg 500 |||| || ||||| ||||||||||| |||| ||| |||| |||||||| ||||| ||| Sbjct: 4589 tcccgggcagcgttgccggccaactcgaggatctcggcggtcagatactcgagcaccgcg 4530 Query: 501 gcgaggtagacgggagcgccggcgccaaccctctcggcgtacttgcc 547 || |||||||| ||||| ||||| || |||| |||||| || ||||| Sbjct: 4529 gcaaggtagactggagctccggctcccacccgctcggcataattgcc 4483
>gb|M21287.1|XELHX1H3 X.laevis histone H1B, H2A, H2B, and H4 genes, complete cds, and histone H3 gene, 3' end, gene cluster X1h3 Length = 8608 Score = 93.7 bits (47), Expect = 7e-16 Identities = 182/227 (80%) Strand = Plus / Minus Query: 321 tggatgttgggcatgacaccgccgctggcgattgtgaccataccgagcaggcgggagagc 380 ||||||||||||| ||||||||| |||||| |||||| |||||||| | |||| Sbjct: 4726 tggatgttgggcaggacaccgccctgggcgatggtgacccctccgagcagtttgttgagc 4667 Query: 381 tcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttcttgttg 440 |||||||||||||| ||||| ||||| | || | || | ||| || ||||||||||| Sbjct: 4666 tcctcgtcgttgcgcacggcgagctgcaggtgcctggggatgatccgagtcttcttgtta 4607 Query: 441 tccctcgcggcgttcccggccaactccaggacctcagcggcgagatactccagcacggcg 500 |||| || ||||| ||||||||||| |||| ||| |||| |||||||| ||||| ||| Sbjct: 4606 tcccgggcagcgttgccggccaactcgaggatctcggcggtcagatactcgagcaccgcg 4547 Query: 501 gcgaggtagacgggagcgccggcgccaaccctctcggcgtacttgcc 547 || |||||||| ||||| ||||| || |||| |||||| || ||||| Sbjct: 4546 gcaaggtagactggagctccggctcccacccgctcggcataattgcc 4500
>ref|XM_527273.1| PREDICTED: Pan troglodytes similar to Histone H2A.1 (LOC471895), mRNA Length = 387 Score = 91.7 bits (46), Expect = 3e-15 Identities = 133/162 (82%) Strand = Plus / Minus Query: 377 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 436 |||||||||||||||||||| ||| || |||| || ||||| | ||| ||||||||||| Sbjct: 282 gagctcctcgtcgttgcggatggccagttggaggtgacgcgggatgatacgggtcttctt 223 Query: 437 gttgtccctcgcggcgttcccggccaactccaggacctcagcggcgagatactccagcac 496 |||||| | || || || || |||| |||||||| |||||||| || ||||||||||| Sbjct: 222 gttgtcgcgggccgcattgccagccagctccaggatctcagcggtcaggtactccagcac 163 Query: 497 ggcggcgaggtagacgggagcgccggcgccaaccctctcggc 538 || || ||||| || || |||||||| ||||||| |||||| Sbjct: 162 cgcagccaggtacactggcgcgccggctccaacccgctcggc 121
>ref|NM_178185.1| Mus musculus histone 1, H2ao (Hist1h2ao), mRNA Length = 393 Score = 91.7 bits (46), Expect = 3e-15 Identities = 124/150 (82%) Strand = Plus / Minus Query: 377 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 436 |||||||||||||||||||| ||| ||||| | || ||||| | |||||| |||||||| Sbjct: 282 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 223 Query: 437 gttgtccctcgcggcgttcccggccaactccaggacctcagcggcgagatactccagcac 496 |||||| | || ||||| || |||| |||||||| ||| || | || ||||||||||| Sbjct: 222 gttgtcgcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcac 163 Query: 497 ggcggcgaggtagacgggagcgccggcgcc 526 ||| || |||||||| || ||||||||||| Sbjct: 162 ggccgccaggtagaccggggcgccggcgcc 133
>ref|NM_080596.1| Homo sapiens histone 1, H2ah (HIST1H2AH), mRNA Length = 439 Score = 91.7 bits (46), Expect = 3e-15 Identities = 133/162 (82%) Strand = Plus / Minus Query: 377 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 436 |||||||||||||||||||| ||| || |||| || ||||| | ||| ||||||||||| Sbjct: 282 gagctcctcgtcgttgcggatggccagttggaggtgacgcgggatgatacgggtcttctt 223 Query: 437 gttgtccctcgcggcgttcccggccaactccaggacctcagcggcgagatactccagcac 496 |||||| | || || || || |||| |||||||| |||||||| || ||||||||||| Sbjct: 222 gttgtcgcgggccgcattgccagccagctccaggatctcagcggtcaggtactccagcac 163 Query: 497 ggcggcgaggtagacgggagcgccggcgccaaccctctcggc 538 || || ||||| || || |||||||| ||||||| |||||| Sbjct: 162 cgcagccaggtacactggcgcgccggctccaacccgctcggc 121
>ref|XM_978341.1| PREDICTED: Mus musculus similar to histone 2a, transcript variant 2 (LOC665433), mRNA Length = 465 Score = 91.7 bits (46), Expect = 3e-15 Identities = 124/150 (82%) Strand = Plus / Minus Query: 377 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 436 |||||||||||||||||||| ||| ||||| | || ||||| | |||||| |||||||| Sbjct: 314 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 255 Query: 437 gttgtccctcgcggcgttcccggccaactccaggacctcagcggcgagatactccagcac 496 |||||| | || ||||| || |||| |||||||| ||| || | || ||||||||||| Sbjct: 254 gttgtcgcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcac 195 Query: 497 ggcggcgaggtagacgggagcgccggcgcc 526 ||| || |||||||| || ||||||||||| Sbjct: 194 ggccgccaggtagaccggggcgccggcgcc 165
>ref|XM_978296.1| PREDICTED: Mus musculus similar to histone 2a, transcript variant 1 (LOC665433), mRNA Length = 467 Score = 91.7 bits (46), Expect = 3e-15 Identities = 124/150 (82%) Strand = Plus / Minus Query: 377 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 436 |||||||||||||||||||| ||| ||||| | || ||||| | |||||| |||||||| Sbjct: 316 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 257 Query: 437 gttgtccctcgcggcgttcccggccaactccaggacctcagcggcgagatactccagcac 496 |||||| | || ||||| || |||| |||||||| ||| || | || ||||||||||| Sbjct: 256 gttgtcgcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcac 197 Query: 497 ggcggcgaggtagacgggagcgccggcgcc 526 ||| || |||||||| || ||||||||||| Sbjct: 196 ggccgccaggtagaccggggcgccggcgcc 167
>ref|XM_391803.1| Gibberella zeae PH-1 H2A_NEUCR Histone H2A (FG11627.1) partial mRNA Length = 405 Score = 91.7 bits (46), Expect = 3e-15 Identities = 121/146 (82%) Strand = Plus / Minus Query: 378 agctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttcttg 437 |||||||| ||||| |||| ||||||||| | ||| || || | ||| |||||||||||| Sbjct: 287 agctcctcatcgtttcggatggcaagctgaagatgacgggggatgatacgggtcttcttg 228 Query: 438 ttgtccctcgcggcgttcccggccaactccaggacctcagcggcgagatactccagcacg 497 ||||| | || ||||| || |||||||| |||| ||||| ||||| ||||| || ||| Sbjct: 227 ttgtcgcgagcagcgttaccagccaactcgaggatttcagcagcgaggtactcgaggacg 168 Query: 498 gcggcgaggtagacgggagcgccggc 523 || ||||||||||||||||| ||||| Sbjct: 167 gcagcgaggtagacgggagcaccggc 142
>emb|AL021807.2|HS86C11 Human DNA sequence from clone RP1-86C11 on chromosome 6p21.31-22.1 Contains a vomeronasal olfactory 1 receptor chromosome 6-2 (VN1R6-2P) pseudogene, histone genes H2BFN and H2AFA, the gene for a novel protein identical to H2B histone family member A (H2BFA), the gene for a novel protein identical to H2A histone family member I (H2AFI), a novel histone gene similar to H4F2 and three CpG islands, complete sequence Length = 89016 Score = 91.7 bits (46), Expect = 3e-15 Identities = 133/162 (82%) Strand = Plus / Minus Query: 377 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 436 |||||||||||||||||||| ||| || |||| || ||||| | ||| ||||||||||| Sbjct: 70715 gagctcctcgtcgttgcggatggccagttggaggtgacgcgggatgatacgggtcttctt 70656 Query: 437 gttgtccctcgcggcgttcccggccaactccaggacctcagcggcgagatactccagcac 496 |||||| | || || || || |||| |||||||| |||||||| || ||||||||||| Sbjct: 70655 gttgtcgcgggccgcattgccagccagctccaggatctcagcggtcaggtactccagcac 70596 Query: 497 ggcggcgaggtagacgggagcgccggcgccaaccctctcggc 538 || || ||||| || || |||||||| ||||||| |||||| Sbjct: 70595 cgcagccaggtacactggcgcgccggctccaacccgctcggc 70554 Score = 85.7 bits (43), Expect = 2e-13 Identities = 139/171 (81%) Strand = Plus / Minus Query: 377 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 436 |||||||||||||||||||| ||| || |||| ||| ||||| | ||||||||||||||| Sbjct: 56658 gagctcctcgtcgttgcggatggccagttggagatgacgcgggatgatgcgggtcttctt 56599 Query: 437 gttgtccctcgcggcgttcccggccaactccaggacctcagcggcgagatactccagcac 496 |||||| | || ||||| || |||| ||||||| ||| |||| || ||||||||||| Sbjct: 56598 gttgtcgcgggccgcgttgcccgccagttccaggatctcggcggtcaggtactccagcac 56539 Query: 497 ggcggcgaggtagacgggagcgccggcgccaaccctctcggcgtacttgcc 547 || || || || || || |||||||| || |||| |||||| || ||||| Sbjct: 56538 cgctgccagatacaccggcgcgccggccccgacccgctcggcatagttgcc 56488
>emb|AL592149.8| Mouse DNA sequence from clone RP23-283N14 on chromosome 13 Contains a novel gene, the genes for three H1, four H2a, five H2b, four H3 and four H4 histone family members, the 3' end of a variant of the Hfe gene for hemochromatosis protein (Mr2) and ten CpG islands, complete sequence Length = 184730 Score = 91.7 bits (46), Expect = 3e-15 Identities = 124/150 (82%) Strand = Plus / Plus Query: 377 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 436 |||||||||||||||||||| ||| ||||| | || ||||| | |||||| |||||||| Sbjct: 164051 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 164110 Query: 437 gttgtccctcgcggcgttcccggccaactccaggacctcagcggcgagatactccagcac 496 |||||| | || ||||| || |||| |||||||| ||| || | || ||||||||||| Sbjct: 164111 gttgtcgcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcac 164170 Query: 497 ggcggcgaggtagacgggagcgccggcgcc 526 ||| || |||||||| || ||||||||||| Sbjct: 164171 ggccgccaggtagaccggggcgccggcgcc 164200 Score = 83.8 bits (42), Expect = 7e-13 Identities = 123/150 (82%) Strand = Plus / Minus Query: 377 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 436 |||||||||||||||||||| ||| ||||| | || ||||| | |||||| |||||||| Sbjct: 55358 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 55299 Query: 437 gttgtccctcgcggcgttcccggccaactccaggacctcagcggcgagatactccagcac 496 |||||| | || ||||| || |||| |||||||| ||| || | || ||||||||||| Sbjct: 55298 gttgtcgcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcac 55239 Query: 497 ggcggcgaggtagacgggagcgccggcgcc 526 ||| || ||||| || || ||||||||||| Sbjct: 55238 ggccgccaggtacaccggggcgccggcgcc 55209 Score = 83.8 bits (42), Expect = 7e-13 Identities = 123/150 (82%) Strand = Plus / Plus Query: 377 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 436 |||||||||||||||||||| ||| ||||| | || ||||| | |||||| |||||||| Sbjct: 51433 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 51492 Query: 437 gttgtccctcgcggcgttcccggccaactccaggacctcagcggcgagatactccagcac 496 |||||| | || ||||| || |||| |||||||| ||| || | || ||||||||||| Sbjct: 51493 gttgtcgcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcac 51552 Query: 497 ggcggcgaggtagacgggagcgccggcgcc 526 ||| || ||||| || || ||||||||||| Sbjct: 51553 ggccgccaggtacaccggggcgccggcgcc 51582 Score = 83.8 bits (42), Expect = 7e-13 Identities = 123/150 (82%) Strand = Plus / Minus Query: 377 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 436 |||||||||||||||||||| ||| ||||| | || ||||| | |||||| |||||||| Sbjct: 14794 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 14735 Query: 437 gttgtccctcgcggcgttcccggccaactccaggacctcagcggcgagatactccagcac 496 |||||| | || ||||| || |||| |||||||| ||| || | || ||||||||||| Sbjct: 14734 gttgtcgcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcac 14675 Query: 497 ggcggcgaggtagacgggagcgccggcgcc 526 ||| || ||||| || || ||||||||||| Sbjct: 14674 ggccgccaggtacaccggggcgccggcgcc 14645
>ref|NM_178189.2| Mus musculus histone 1, H2ac (Hist1h2ac), mRNA Length = 2493 Score = 91.7 bits (46), Expect = 3e-15 Identities = 124/150 (82%) Strand = Plus / Minus Query: 377 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 436 |||||||||||||||||||| ||| ||||| | || ||||| | |||||| |||||||| Sbjct: 326 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 267 Query: 437 gttgtccctcgcggcgttcccggccaactccaggacctcagcggcgagatactccagcac 496 |||||| | || ||||| || |||| |||||||| ||| || | || ||||||||||| Sbjct: 266 gttgtcgcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcac 207 Query: 497 ggcggcgaggtagacgggagcgccggcgcc 526 ||| || |||||||| || ||||||||||| Sbjct: 206 ggccgccaggtagaccggggcgccggcgcc 177
>emb|AL589879.21| Mouse DNA sequence from clone RP23-38E20 on chromosome 13 Contains the genes for H2b histone family member A, two H2a, two H4 and an H2b histone family member, a serine/threonine protein kinase pseudogene, a novel pseudogene, a novel gene (4930500C15Rik), the gene for a novel KRAB box and C2H2 Zinc Finger containing protein, a ribosomal protein L21 (RPL21) pseudogene, a TU mitochondrial translation elongation factor (tufa) pseudogene, the 5' end of the gene for a novel protein similar to nuclear envelope pore membrane protein POM121 and four CpG islands, complete sequence Length = 182817 Score = 91.7 bits (46), Expect = 3e-15 Identities = 124/150 (82%) Strand = Plus / Plus Query: 377 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 436 |||||||||||||||||||| ||| ||||| | || ||||| | |||||| |||||||| Sbjct: 33361 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 33420 Query: 437 gttgtccctcgcggcgttcccggccaactccaggacctcagcggcgagatactccagcac 496 |||||| | || ||||| || |||| |||||||| ||| || | || ||||||||||| Sbjct: 33421 gttgtcgcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcac 33480 Query: 497 ggcggcgaggtagacgggagcgccggcgcc 526 ||| || |||||||| || ||||||||||| Sbjct: 33481 ggccgccaggtagaccggggcgccggcgcc 33510 Score = 91.7 bits (46), Expect = 3e-15 Identities = 124/150 (82%) Strand = Plus / Minus Query: 377 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 436 |||||||||||||||||||| ||| ||||| | || ||||| | |||||| |||||||| Sbjct: 10915 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 10856 Query: 437 gttgtccctcgcggcgttcccggccaactccaggacctcagcggcgagatactccagcac 496 |||||| | || ||||| || |||| |||||||| ||| || | || ||||||||||| Sbjct: 10855 gttgtcgcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcac 10796 Query: 497 ggcggcgaggtagacgggagcgccggcgcc 526 ||| || |||||||| || ||||||||||| Sbjct: 10795 ggccgccaggtagaccggggcgccggcgcc 10766
>emb|AL590614.8| Mouse DNA sequence from clone RP23-9O16 on chromosome 13 Contains the 3' end of the gene for a novel protein similar to nuclear envelope pore membrane protein POM121, the Prss16 gene for thymus serine protease16, three novel genes, the genes for two H2a, two H2b and one H4 histone family members, a ribosomal protein L37A (Rpl37a) pseudogene, a novel pseudogene, three genes for novel vomeronasal 1 receptor H (V1rh) family members, the gene for a novel vomeronasal 1 receptor I (V1ri) family member, six V1ri pseudogenes, a V1rh pseudogene and six CpG islands, complete sequence Length = 210845 Score = 91.7 bits (46), Expect = 3e-15 Identities = 124/150 (82%) Strand = Plus / Plus Query: 377 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 436 |||||||||||||||||||| ||| ||||| | || ||||| | |||||| |||||||| Sbjct: 60002 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 60061 Query: 437 gttgtccctcgcggcgttcccggccaactccaggacctcagcggcgagatactccagcac 496 |||||| | || ||||| || |||| |||||||| ||| || | || ||||||||||| Sbjct: 60062 gttgtcgcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcac 60121 Query: 497 ggcggcgaggtagacgggagcgccggcgcc 526 ||| || |||||||| || ||||||||||| Sbjct: 60122 ggccgccaggtagaccggggcgccggcgcc 60151 Score = 83.8 bits (42), Expect = 7e-13 Identities = 123/150 (82%) Strand = Plus / Plus Query: 377 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 436 |||||||||||||||||||| ||| ||||| | || ||||| | |||||| |||||||| Sbjct: 52627 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 52686 Query: 437 gttgtccctcgcggcgttcccggccaactccaggacctcagcggcgagatactccagcac 496 |||||| | || ||||| || |||| |||||||| ||| || | || ||||||||||| Sbjct: 52687 gttgtcgcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcac 52746 Query: 497 ggcggcgaggtagacgggagcgccggcgcc 526 ||| || ||||| || || ||||||||||| Sbjct: 52747 ggccgccaggtacaccggggcgccggcgcc 52776
>gb|BC065803.1| Mus musculus histone 1, H2ag, mRNA (cDNA clone MGC:73771 IMAGE:1263745), complete cds Length = 527 Score = 91.7 bits (46), Expect = 3e-15 Identities = 124/150 (82%) Strand = Plus / Minus Query: 377 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 436 |||||||||||||||||||| ||| ||||| | || ||||| | |||||| |||||||| Sbjct: 304 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 245 Query: 437 gttgtccctcgcggcgttcccggccaactccaggacctcagcggcgagatactccagcac 496 |||||| | || ||||| || |||| |||||||| ||| || | || ||||||||||| Sbjct: 244 gttgtcgcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcac 185 Query: 497 ggcggcgaggtagacgggagcgccggcgcc 526 ||| || |||||||| || ||||||||||| Sbjct: 184 ggccgccaggtagaccggggcgccggcgcc 155
>dbj|AK145443.1| Mus musculus 5 days embryo whole body cDNA, RIKEN full-length enriched library, clone:I0C0045N09 product:histone 1, H2ad, full insert sequence Length = 446 Score = 91.7 bits (46), Expect = 3e-15 Identities = 124/150 (82%) Strand = Plus / Minus Query: 377 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 436 |||||||||||||||||||| ||| ||||| | || ||||| | |||||| |||||||| Sbjct: 315 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 256 Query: 437 gttgtccctcgcggcgttcccggccaactccaggacctcagcggcgagatactccagcac 496 |||||| | || ||||| || |||| |||||||| ||| || | || ||||||||||| Sbjct: 255 gttgtcgcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcac 196 Query: 497 ggcggcgaggtagacgggagcgccggcgcc 526 ||| || |||||||| || ||||||||||| Sbjct: 195 ggccgccaggtagaccggggcgccggcgcc 166
>dbj|AK146846.1| Mus musculus 17 days embryo heart cDNA, RIKEN full-length enriched library, clone:I920064A15 product:histone 1, H2ad, full insert sequence Length = 445 Score = 91.7 bits (46), Expect = 3e-15 Identities = 124/150 (82%) Strand = Plus / Minus Query: 377 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 436 |||||||||||||||||||| ||| ||||| | || ||||| | |||||| |||||||| Sbjct: 313 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 254 Query: 437 gttgtccctcgcggcgttcccggccaactccaggacctcagcggcgagatactccagcac 496 |||||| | || ||||| || |||| |||||||| ||| || | || ||||||||||| Sbjct: 253 gttgtcgcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcac 194 Query: 497 ggcggcgaggtagacgggagcgccggcgcc 526 ||| || |||||||| || ||||||||||| Sbjct: 193 ggccgccaggtagaccggggcgccggcgcc 164
>ref|XM_684593.1| PREDICTED: Danio rerio similar to histone H2A (LOC561187), mRNA Length = 387 Score = 91.7 bits (46), Expect = 3e-15 Identities = 85/98 (86%) Strand = Plus / Minus Query: 426 cgggtcttcttgttgtccctcgcggcgttcccggccaactccaggacctcagcggcgaga 485 ||||||||||||||||||| |||||||| |||||||||||||||| |||||||| ||| Sbjct: 233 cgggtcttcttgttgtcccgagcggcgtttccggccaactccaggatctcagcggtcaga 174 Query: 486 tactccagcacggcggcgaggtagacgggagcgccggc 523 ||||| ||||| ||||| | ||| || ||||| ||||| Sbjct: 173 tactcgagcacagcggccaagtacaccggagcaccggc 136
>gb|BC062251.1| Mus musculus cDNA clone MGC:73635 IMAGE:1224905, complete cds Length = 444 Score = 91.7 bits (46), Expect = 3e-15 Identities = 124/150 (82%) Strand = Plus / Minus Query: 377 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 436 |||||||||||||||||||| ||| ||||| | || ||||| | |||||| |||||||| Sbjct: 294 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 235 Query: 437 gttgtccctcgcggcgttcccggccaactccaggacctcagcggcgagatactccagcac 496 |||||| | || ||||| || |||| |||||||| ||| || | || ||||||||||| Sbjct: 234 gttgtcgcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcac 175 Query: 497 ggcggcgaggtagacgggagcgccggcgcc 526 ||| || |||||||| || ||||||||||| Sbjct: 174 ggccgccaggtagaccggggcgccggcgcc 145
>ref|NM_178186.2| Mus musculus histone 1, H2ag (Hist1h2ag), mRNA Length = 527 Score = 91.7 bits (46), Expect = 3e-15 Identities = 124/150 (82%) Strand = Plus / Minus Query: 377 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 436 |||||||||||||||||||| ||| ||||| | || ||||| | |||||| |||||||| Sbjct: 304 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 245 Query: 437 gttgtccctcgcggcgttcccggccaactccaggacctcagcggcgagatactccagcac 496 |||||| | || ||||| || |||| |||||||| ||| || | || ||||||||||| Sbjct: 244 gttgtcgcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcac 185 Query: 497 ggcggcgaggtagacgggagcgccggcgcc 526 ||| || |||||||| || ||||||||||| Sbjct: 184 ggccgccaggtagaccggggcgccggcgcc 155
>dbj|AK033518.1| Mus musculus adult male colon cDNA, RIKEN full-length enriched library, clone:9030420B16 product:histone 1, H2ac, full insert sequence Length = 2493 Score = 91.7 bits (46), Expect = 3e-15 Identities = 124/150 (82%) Strand = Plus / Minus Query: 377 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 436 |||||||||||||||||||| ||| ||||| | || ||||| | |||||| |||||||| Sbjct: 326 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 267 Query: 437 gttgtccctcgcggcgttcccggccaactccaggacctcagcggcgagatactccagcac 496 |||||| | || ||||| || |||| |||||||| ||| || | || ||||||||||| Sbjct: 266 gttgtcgcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcac 207 Query: 497 ggcggcgaggtagacgggagcgccggcgcc 526 ||| || |||||||| || ||||||||||| Sbjct: 206 ggccgccaggtagaccggggcgccggcgcc 177
>gb|BC093851.1| Homo sapiens histone 1, H2ai, mRNA (cDNA clone MGC:120886 IMAGE:7939696), complete cds Length = 457 Score = 91.7 bits (46), Expect = 3e-15 Identities = 133/162 (82%) Strand = Plus / Minus Query: 377 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 436 |||||||||||||||||||| ||| || |||| || ||||| | ||| ||||||||||| Sbjct: 329 gagctcctcgtcgttgcggatggccagttggaggtgacgcgggatgatacgggtcttctt 270 Query: 437 gttgtccctcgcggcgttcccggccaactccaggacctcagcggcgagatactccagcac 496 |||||| | || || || || |||| |||||||| |||||||| || ||||||||||| Sbjct: 269 gttgtcgcgggccgcattgccagccagctccaggatctcagcggtcaggtactccagcac 210 Query: 497 ggcggcgaggtagacgggagcgccggcgccaaccctctcggc 538 || || ||||| || || |||||||| ||||||| |||||| Sbjct: 209 cgcagccaggtacactggcgcgccggctccaacccgctcggc 168
>gb|BC093849.1| Homo sapiens histone 1, H2ai, mRNA (cDNA clone MGC:120884 IMAGE:7939694), complete cds Length = 457 Score = 91.7 bits (46), Expect = 3e-15 Identities = 133/162 (82%) Strand = Plus / Minus Query: 377 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 436 |||||||||||||||||||| ||| || |||| || ||||| | ||| ||||||||||| Sbjct: 329 gagctcctcgtcgttgcggatggccagttggaggtgacgcgggatgatacgggtcttctt 270 Query: 437 gttgtccctcgcggcgttcccggccaactccaggacctcagcggcgagatactccagcac 496 |||||| | || || || || |||| |||||||| |||||||| || ||||||||||| Sbjct: 269 gttgtcgcgggccgcattgccagccagctccaggatctcagcggtcaggtactccagcac 210 Query: 497 ggcggcgaggtagacgggagcgccggcgccaaccctctcggc 538 || || ||||| || || |||||||| ||||||| |||||| Sbjct: 209 cgcagccaggtacactggcgcgccggctccaacccgctcggc 168
>ref|XM_577573.1| PREDICTED: Rattus norvegicus similar to Histone H2A.l (H2A/l) (LOC502125), mRNA Length = 393 Score = 91.7 bits (46), Expect = 3e-15 Identities = 106/126 (84%) Strand = Plus / Minus Query: 422 gatgcgggtcttcttgttgtccctcgcggcgttcccggccaactccaggacctcagcggc 481 |||||| |||||||||||||||||||| ||||| || |||| |||||||| ||| || | Sbjct: 237 gatgcgtgtcttcttgttgtccctcgccgcgttgcccgccagctccaggatctcggccgt 178 Query: 482 gagatactccagcacggcggcgaggtagacgggagcgccggcgccaaccctctcggcgta 541 || ||||||||||| || || ||||| || || ||||||||||| |||||||| ||||| Sbjct: 177 caggtactccagcacagccgccaggtacaccggggcgccggcgcccaccctctccgcgta 118 Query: 542 cttgcc 547 ||||| Sbjct: 117 gttgcc 112
>gb|AY131988.1| Homo sapiens histone H2A (HIST1H2AH) gene, complete cds Length = 1155 Score = 91.7 bits (46), Expect = 3e-15 Identities = 133/162 (82%) Strand = Plus / Minus Query: 377 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 436 |||||||||||||||||||| ||| || |||| || ||||| | ||| ||||||||||| Sbjct: 668 gagctcctcgtcgttgcggatggccagttggaggtgacgcgggatgatacgggtcttctt 609 Query: 437 gttgtccctcgcggcgttcccggccaactccaggacctcagcggcgagatactccagcac 496 |||||| | || || || || |||| |||||||| |||||||| || ||||||||||| Sbjct: 608 gttgtcgcgggccgcattgccagccagctccaggatctcagcggtcaggtactccagcac 549 Query: 497 ggcggcgaggtagacgggagcgccggcgccaaccctctcggc 538 || || ||||| || || |||||||| ||||||| |||||| Sbjct: 548 cgcagccaggtacactggcgcgccggctccaacccgctcggc 507
>gb|AY158919.1| Mus musculus histone protein Hist1h2ac gene, complete cds Length = 1390 Score = 91.7 bits (46), Expect = 3e-15 Identities = 124/150 (82%) Strand = Plus / Minus Query: 377 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 436 |||||||||||||||||||| ||| ||||| | || ||||| | |||||| |||||||| Sbjct: 782 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 723 Query: 437 gttgtccctcgcggcgttcccggccaactccaggacctcagcggcgagatactccagcac 496 |||||| | || ||||| || |||| |||||||| ||| || | || ||||||||||| Sbjct: 722 gttgtcgcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcac 663 Query: 497 ggcggcgaggtagacgggagcgccggcgcc 526 ||| || |||||||| || ||||||||||| Sbjct: 662 ggccgccaggtagaccggggcgccggcgcc 633
>gb|AY158915.1| Mus musculus histone protein Hist1h2ag gene, complete cds Length = 1392 Score = 91.7 bits (46), Expect = 3e-15 Identities = 124/150 (82%) Strand = Plus / Minus Query: 377 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 436 |||||||||||||||||||| ||| ||||| | || ||||| | |||||| |||||||| Sbjct: 781 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 722 Query: 437 gttgtccctcgcggcgttcccggccaactccaggacctcagcggcgagatactccagcac 496 |||||| | || ||||| || |||| |||||||| ||| || | || ||||||||||| Sbjct: 721 gttgtcgcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcac 662 Query: 497 ggcggcgaggtagacgggagcgccggcgcc 526 ||| || |||||||| || ||||||||||| Sbjct: 661 ggccgccaggtagaccggggcgccggcgcc 632
>gb|AY158913.1| Mus musculus histone protein Hist1h2ao gene, complete cds Length = 1390 Score = 91.7 bits (46), Expect = 3e-15 Identities = 124/150 (82%) Strand = Plus / Minus Query: 377 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 436 |||||||||||||||||||| ||| ||||| | || ||||| | |||||| |||||||| Sbjct: 782 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 723 Query: 437 gttgtccctcgcggcgttcccggccaactccaggacctcagcggcgagatactccagcac 496 |||||| | || ||||| || |||| |||||||| ||| || | || ||||||||||| Sbjct: 722 gttgtcgcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcac 663 Query: 497 ggcggcgaggtagacgggagcgccggcgcc 526 ||| || |||||||| || ||||||||||| Sbjct: 662 ggccgccaggtagaccggggcgccggcgcc 633
>ref|NG_000827.2| Homo sapiens genomic histone family microcluster (HFM@) on chromosome 6 Length = 20621 Score = 91.7 bits (46), Expect = 3e-15 Identities = 133/162 (82%) Strand = Plus / Minus Query: 377 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 436 |||||||||||||||||||| ||| || |||| || ||||| | ||| ||||||||||| Sbjct: 19916 gagctcctcgtcgttgcggatggccagttggaggtgacgcgggatgatacgggtcttctt 19857 Query: 437 gttgtccctcgcggcgttcccggccaactccaggacctcagcggcgagatactccagcac 496 |||||| | || || || || |||| |||||||| |||||||| || ||||||||||| Sbjct: 19856 gttgtcgcgggccgcattgccagccagctccaggatctcagcggtcaggtactccagcac 19797 Query: 497 ggcggcgaggtagacgggagcgccggcgccaaccctctcggc 538 || || ||||| || || |||||||| ||||||| |||||| Sbjct: 19796 cgcagccaggtacactggcgcgccggctccaacccgctcggc 19755 Score = 85.7 bits (43), Expect = 2e-13 Identities = 139/171 (81%) Strand = Plus / Minus Query: 377 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 436 |||||||||||||||||||| ||| || |||| ||| ||||| | ||||||||||||||| Sbjct: 5859 gagctcctcgtcgttgcggatggccagttggagatgacgcgggatgatgcgggtcttctt 5800 Query: 437 gttgtccctcgcggcgttcccggccaactccaggacctcagcggcgagatactccagcac 496 |||||| | || ||||| || |||| ||||||| ||| |||| || ||||||||||| Sbjct: 5799 gttgtcgcgggccgcgttgcccgccagttccaggatctcggcggtcaggtactccagcac 5740 Query: 497 ggcggcgaggtagacgggagcgccggcgccaaccctctcggcgtacttgcc 547 || || || || || || |||||||| || |||| |||||| || ||||| Sbjct: 5739 cgctgccagatacaccggcgcgccggccccgacccgctcggcatagttgcc 5689
>ref|XM_522264.1| PREDICTED: Pan troglodytes similar to Histone H2A.x (H2a/x) (LOC466864), mRNA Length = 432 Score = 89.7 bits (45), Expect = 1e-14 Identities = 135/165 (81%) Strand = Plus / Minus Query: 377 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 436 |||||||||||||||||||| ||| ||||| | || || || | ||| || |||||||| Sbjct: 282 gagctcctcgtcgttgcggatggccagctgcaggtggcgggggatgattcgcgtcttctt 223 Query: 437 gttgtccctcgcggcgttcccggccaactccaggacctcagcggcgagatactccagcac 496 |||||| | || || || || |||| |||||||| |||||||| ||| ||||||||||| Sbjct: 222 gttgtcgcgggccgcattgcccgccagctccaggatctcagcggtgaggtactccagcac 163 Query: 497 ggcggcgaggtagacgggagcgccggcgccaaccctctcggcgta 541 || || ||||| || || |||||||||||||| | ||||||||| Sbjct: 162 tgccgccaggtacactggcgcgccggcgccaacgcgctcggcgta 118
>gb|BC046078.1| Danio rerio H2A histone family, member X, mRNA (cDNA clone MGC:56329 IMAGE:5603679), complete cds Length = 643 Score = 89.7 bits (45), Expect = 1e-14 Identities = 123/149 (82%) Strand = Plus / Minus Query: 378 agctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttcttg 437 |||||||||||||| |||||||| | ||||| ||| || || | ||| || ||||||||| Sbjct: 324 agctcctcgtcgttacggacggccaactggagatggcgggggatgatacgagtcttcttg 265 Query: 438 ttgtccctcgcggcgttcccggccaactccaggacctcagcggcgagatactccagcacg 497 ||||| || |||||||| || |||||||| |||| |||||| | || ||||| |||||| Sbjct: 264 ttgtctcttgcggcgtttcccgccaactcgaggatctcagcagtcaggtactcgagcacg 205 Query: 498 gcggcgaggtagacgggagcgccggcgcc 526 ||||| || || ||||| || |||||||| Sbjct: 204 gcggccagatacacgggggcaccggcgcc 176
>gb|BC004915.2| Homo sapiens H2A histone family, member X, mRNA (cDNA clone MGC:4759 IMAGE:3537648), complete cds Length = 1580 Score = 89.7 bits (45), Expect = 1e-14 Identities = 135/165 (81%) Strand = Plus / Minus Query: 377 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 436 |||||||||||||||||||| ||| ||||| | || || || | ||| || |||||||| Sbjct: 325 gagctcctcgtcgttgcggatggccagctgcaggtggcgggggatgattcgcgtcttctt 266 Query: 437 gttgtccctcgcggcgttcccggccaactccaggacctcagcggcgagatactccagcac 496 |||||| | || || || || |||| |||||||| |||||||| ||| ||||||||||| Sbjct: 265 gttgtcgcgggccgcattgcccgccagctccaggatctcagcggtgaggtactccagcac 206 Query: 497 ggcggcgaggtagacgggagcgccggcgccaaccctctcggcgta 541 || || ||||| || || |||||||||||||| | ||||||||| Sbjct: 205 tgccgccaggtacactggcgcgccggcgccaacgcgctcggcgta 161
>ref|XM_868674.1| PREDICTED: Bos taurus similar to Histone H2A.1 (LOC616611), mRNA Length = 393 Score = 89.7 bits (45), Expect = 1e-14 Identities = 135/165 (81%) Strand = Plus / Minus Query: 377 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 436 |||||||||||||||||||| ||| ||||| | || ||||| | || ||||||||||| Sbjct: 282 gagctcctcgtcgttgcggatggccagctgcaggtgacgcgggataatacgggtcttctt 223 Query: 437 gttgtccctcgcggcgttcccggccaactccaggacctcagcggcgagatactccagcac 496 |||||||| || ||||| || |||| |||||||| ||| || | |||||||||||||| Sbjct: 222 gttgtcccgggccgcgttgcccgccagctccaggatctcggccgtcagatactccagcac 163 Query: 497 ggcggcgaggtagacgggagcgccggcgccaaccctctcggcgta 541 || || ||||| || || |||||||| || |||| ||||||||| Sbjct: 162 cgccgccaggtacactggcgcgccggccccgacccgctcggcgta 118
>ref|NM_201073.1| Danio rerio H2A histone family, member X (h2afx), mRNA Length = 643 Score = 89.7 bits (45), Expect = 1e-14 Identities = 123/149 (82%) Strand = Plus / Minus Query: 378 agctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttcttg 437 |||||||||||||| |||||||| | ||||| ||| || || | ||| || ||||||||| Sbjct: 324 agctcctcgtcgttacggacggccaactggagatggcgggggatgatacgagtcttcttg 265 Query: 438 ttgtccctcgcggcgttcccggccaactccaggacctcagcggcgagatactccagcacg 497 ||||| || |||||||| || |||||||| |||| |||||| | || ||||| |||||| Sbjct: 264 ttgtctcttgcggcgtttcccgccaactcgaggatctcagcagtcaggtactcgagcacg 205 Query: 498 gcggcgaggtagacgggagcgccggcgcc 526 ||||| || || ||||| || |||||||| Sbjct: 204 gcggccagatacacgggggcaccggcgcc 176
>ref|NM_002105.2| Homo sapiens H2A histone family, member X (H2AFX), mRNA Length = 1651 Score = 89.7 bits (45), Expect = 1e-14 Identities = 135/165 (81%) Strand = Plus / Minus Query: 377 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 436 |||||||||||||||||||| ||| ||||| | || || || | ||| || |||||||| Sbjct: 355 gagctcctcgtcgttgcggatggccagctgcaggtggcgggggatgattcgcgtcttctt 296 Query: 437 gttgtccctcgcggcgttcccggccaactccaggacctcagcggcgagatactccagcac 496 |||||| | || || || || |||| |||||||| |||||||| ||| ||||||||||| Sbjct: 295 gttgtcgcgggccgcattgcccgccagctccaggatctcagcggtgaggtactccagcac 236 Query: 497 ggcggcgaggtagacgggagcgccggcgccaaccctctcggcgta 541 || || ||||| || || |||||||||||||| | ||||||||| Sbjct: 235 tgccgccaggtacactggcgcgccggcgccaacgcgctcggcgta 191
>emb|X14850.1|HSH2AX Human H2A.X mRNA encoding histone H2A.X Length = 1585 Score = 89.7 bits (45), Expect = 1e-14 Identities = 135/165 (81%) Strand = Plus / Minus Query: 377 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 436 |||||||||||||||||||| ||| ||||| | || || || | ||| || |||||||| Sbjct: 355 gagctcctcgtcgttgcggatggccagctgcaggtggcgggggatgattcgcgtcttctt 296 Query: 437 gttgtccctcgcggcgttcccggccaactccaggacctcagcggcgagatactccagcac 496 |||||| | || || || || |||| |||||||| |||||||| ||| ||||||||||| Sbjct: 295 gttgtcgcgggccgcattgcccgccagctccaggatctcagcggtgaggtactccagcac 236 Query: 497 ggcggcgaggtagacgggagcgccggcgccaaccctctcggcgta 541 || || ||||| || || |||||||||||||| | ||||||||| Sbjct: 235 tgccgccaggtacactggcgcgccggcgccaacgcgctcggcgta 191
>gb|BC013416.2| Homo sapiens H2A histone family, member X, mRNA (cDNA clone MGC:4703 IMAGE:3534359), complete cds Length = 1616 Score = 89.7 bits (45), Expect = 1e-14 Identities = 135/165 (81%) Strand = Plus / Minus Query: 377 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 436 |||||||||||||||||||| ||| ||||| | || || || | ||| || |||||||| Sbjct: 320 gagctcctcgtcgttgcggatggccagctgcaggtggcgggggatgattcgcgtcttctt 261 Query: 437 gttgtccctcgcggcgttcccggccaactccaggacctcagcggcgagatactccagcac 496 |||||| | || || || || |||| |||||||| |||||||| ||| ||||||||||| Sbjct: 260 gttgtcgcgggccgcattgcccgccagctccaggatctcagcggtgaggtactccagcac 201 Query: 497 ggcggcgaggtagacgggagcgccggcgccaaccctctcggcgta 541 || || ||||| || || |||||||||||||| | ||||||||| Sbjct: 200 tgccgccaggtacactggcgcgccggcgccaacgcgctcggcgta 156
>emb|CR605072.1| full-length cDNA clone CS0DD007YB20 of Neuroblastoma Cot 50-normalized of Homo sapiens (human) Length = 1373 Score = 89.7 bits (45), Expect = 1e-14 Identities = 135/165 (81%) Strand = Plus / Minus Query: 377 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 436 |||||||||||||||||||| ||| ||||| | || || || | ||| || |||||||| Sbjct: 337 gagctcctcgtcgttgcggatggccagctgcaggtggcgggggatgattcgcgtcttctt 278 Query: 437 gttgtccctcgcggcgttcccggccaactccaggacctcagcggcgagatactccagcac 496 |||||| | || || || || |||| |||||||| |||||||| ||| ||||||||||| Sbjct: 277 gttgtcgcgggccgcattgcccgccagctccaggatctcagcggtgaggtactccagcac 218 Query: 497 ggcggcgaggtagacgggagcgccggcgccaaccctctcggcgta 541 || || ||||| || || |||||||||||||| | ||||||||| Sbjct: 217 tgccgccaggtacactggcgcgccggcgccaacgcgctcggcgta 173
>ref|XM_684224.1| PREDICTED: Danio rerio similar to replication-dependent histone H2A (LOC560822), mRNA Length = 441 Score = 89.7 bits (45), Expect = 1e-14 Identities = 69/77 (89%) Strand = Plus / Minus Query: 426 cgggtcttcttgttgtccctcgcggcgttcccggccaactccaggacctcagcggcgaga 485 ||||||||||||||||||| |||||||| |||||||||||||||| |||||||| ||| Sbjct: 233 cgggtcttcttgttgtcccgagcggcgtttccggccaactccaggatctcagcggtcaga 174 Query: 486 tactccagcacggcggc 502 ||||| ||||| ||||| Sbjct: 173 tactcgagcacagcggc 157
>emb|BX510347.9| Zebrafish DNA sequence from clone DKEY-5E14 in linkage group 5, complete sequence Length = 13288 Score = 89.7 bits (45), Expect = 1e-14 Identities = 123/149 (82%) Strand = Plus / Minus Query: 378 agctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttcttg 437 |||||||||||||| |||||||| | ||||| ||| || || | ||| || ||||||||| Sbjct: 6678 agctcctcgtcgttacggacggccaactggagatggcgagggatgatacgagtcttcttg 6619 Query: 438 ttgtccctcgcggcgttcccggccaactccaggacctcagcggcgagatactccagcacg 497 ||||| || |||||||| || |||||||| || | |||||| | |||||||| |||||| Sbjct: 6618 ttgtctcttgcggcgtttcccgccaactcgagaatctcagcagtcagatactcgagcacg 6559 Query: 498 gcggcgaggtagacgggagcgccggcgcc 526 ||||| || || ||||| || |||||||| Sbjct: 6558 gcggccagatacacgggggcaccggcgcc 6530
>emb|CR450244.2| Zebrafish DNA sequence from clone CH211-196O21 in linkage group 4, complete sequence Length = 21058 Score = 89.7 bits (45), Expect = 1e-14 Identities = 123/149 (82%) Strand = Plus / Minus Query: 378 agctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttcttg 437 |||||||||||||| |||||||| | ||||| ||| || || | ||| || ||||||||| Sbjct: 14448 agctcctcgtcgttacggacggccaactggagatggcgagggatgatacgagtcttcttg 14389 Query: 438 ttgtccctcgcggcgttcccggccaactccaggacctcagcggcgagatactccagcacg 497 ||||| || |||||||| || |||||||| || | |||||| | |||||||| |||||| Sbjct: 14388 ttgtctcttgcggcgtttcccgccaactcgagaatctcagcagtcagatactcgagcacg 14329 Query: 498 gcggcgaggtagacgggagcgccggcgcc 526 ||||| || || ||||| || |||||||| Sbjct: 14328 gcggccagatacacgggggcaccggcgcc 14300
>gb|AY760064.1| Muntiacus muntjak vaginalis H2A histone family member X (H2AX) mRNA, partial cds Length = 300 Score = 89.7 bits (45), Expect = 1e-14 Identities = 135/165 (81%) Strand = Plus / Minus Query: 377 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 436 |||||||||||||||||||| ||| ||||| | || || || | || || |||||||| Sbjct: 243 gagctcctcgtcgttgcggatggccagctgcaggtggcgggggattatccgcgtcttctt 184 Query: 437 gttgtccctcgcggcgttcccggccaactccaggacctcagcggcgagatactccagcac 496 |||||| | || ||||| || |||| |||||||| |||||||| ||| ||||| || || Sbjct: 183 gttgtcgcgggccgcgttgcccgccagctccaggatctcagcggtgaggtactcgagtac 124 Query: 497 ggcggcgaggtagacgggagcgccggcgccaaccctctcggcgta 541 || || |||||||| || ||||||||||| |||||||||||||| Sbjct: 123 cgccgccaggtagaccggcgcgccggcgcccaccctctcggcgta 79
>emb|BX294169.10| Zebrafish DNA sequence from clone DKEY-151N15 in linkage group 5, complete sequence Length = 73230 Score = 89.7 bits (45), Expect = 1e-14 Identities = 123/149 (82%) Strand = Plus / Minus Query: 378 agctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttcttg 437 |||||||||||||| |||||||| | ||||| ||| || || | ||| || ||||||||| Sbjct: 6581 agctcctcgtcgttacggacggccaactggagatggcgagggatgatacgagtcttcttg 6522 Query: 438 ttgtccctcgcggcgttcccggccaactccaggacctcagcggcgagatactccagcacg 497 ||||| || |||||||| || |||||||| |||| |||||| | || ||||| |||||| Sbjct: 6521 ttgtctcttgcggcgtttcccgccaactcgaggatctcagcagtcaggtactcgagcacg 6462 Query: 498 gcggcgaggtagacgggagcgccggcgcc 526 ||||| || || ||||| || |||||||| Sbjct: 6461 gcggccagatacacgggggcaccggcgcc 6433
>gb|DQ015918.1| Homo sapiens H2A histone family, member X (H2AFX) gene, complete cds Length = 5462 Score = 89.7 bits (45), Expect = 1e-14 Identities = 135/165 (81%) Strand = Plus / Minus Query: 377 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 436 |||||||||||||||||||| ||| ||||| | || || || | ||| || |||||||| Sbjct: 2353 gagctcctcgtcgttgcggatggccagctgcaggtggcgggggatgattcgcgtcttctt 2294 Query: 437 gttgtccctcgcggcgttcccggccaactccaggacctcagcggcgagatactccagcac 496 |||||| | || || || || |||| |||||||| |||||||| ||| ||||||||||| Sbjct: 2293 gttgtcgcgggccgcattgcccgccagctccaggatctcagcggtgaggtactccagcac 2234 Query: 497 ggcggcgaggtagacgggagcgccggcgccaaccctctcggcgta 541 || || ||||| || || |||||||||||||| | ||||||||| Sbjct: 2233 tgccgccaggtacactggcgcgccggcgccaacgcgctcggcgta 2189
>gb|BC011694.2| Homo sapiens H2A histone family, member X, mRNA (cDNA clone MGC:19656 IMAGE:3139343), complete cds Length = 1589 Score = 89.7 bits (45), Expect = 1e-14 Identities = 135/165 (81%) Strand = Plus / Minus Query: 377 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 436 |||||||||||||||||||| ||| ||||| | || || || | ||| || |||||||| Sbjct: 335 gagctcctcgtcgttgcggatggccagctgcaggtggcgggggatgattcgcgtcttctt 276 Query: 437 gttgtccctcgcggcgttcccggccaactccaggacctcagcggcgagatactccagcac 496 |||||| | || || || || |||| |||||||| |||||||| ||| ||||||||||| Sbjct: 275 gttgtcgcgggccgcattgcccgccagctccaggatctcagcggtgaggtactccagcac 216 Query: 497 ggcggcgaggtagacgggagcgccggcgccaaccctctcggcgta 541 || || ||||| || || |||||||||||||| | ||||||||| Sbjct: 215 tgccgccaggtacactggcgcgccggcgccaacgcgctcggcgta 171
>dbj|AP003391.1| Homo sapiens genomic DNA, chromosome 11q clone:CTD-2589C9, complete sequences Length = 46239 Score = 89.7 bits (45), Expect = 1e-14 Identities = 135/165 (81%) Strand = Plus / Plus Query: 377 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 436 |||||||||||||||||||| ||| ||||| | || || || | ||| || |||||||| Sbjct: 9885 gagctcctcgtcgttgcggatggccagctgcaggtggcgggggatgattcgcgtcttctt 9944 Query: 437 gttgtccctcgcggcgttcccggccaactccaggacctcagcggcgagatactccagcac 496 |||||| | || || || || |||| |||||||| |||||||| ||| ||||||||||| Sbjct: 9945 gttgtcgcgggccgcattgcccgccagctccaggatctcagcggtgaggtactccagcac 10004 Query: 497 ggcggcgaggtagacgggagcgccggcgccaaccctctcggcgta 541 || || ||||| || || |||||||||||||| | ||||||||| Sbjct: 10005 tgccgccaggtacactggcgcgccggcgccaacgcgctcggcgta 10049
>emb|AJ494853.1|ODI494853 Oikopleura dioica mRNA for histone H2A.1a (H2A.1a gene) Length = 509 Score = 87.7 bits (44), Expect = 4e-14 Identities = 134/164 (81%) Strand = Plus / Minus Query: 384 tcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttcttgttgtcc 443 |||||||| |||| ||| ||||||| |||||| || | ||| ||||||||||||||||| Sbjct: 277 tcgtcgtttcggatggcgagctggagatgtcgagggatgattcgggtcttcttgttgtct 218 Query: 444 ctcgcggcgttcccggccaactccaggacctcagcggcgagatactccagcacggcggcg 503 | |||||||| ||||||||||| || || ||||||| | || || || ||||||||| Sbjct: 217 cgggcggcgtttccggccaactcgagaacttcagcggacaagtattcgaggacggcggcg 158 Query: 504 aggtagacgggagcgccggcgccaaccctctcggcgtacttgcc 547 |||||||| || ||||| || || || | ||||||||| ||||| Sbjct: 157 aggtagactggtgcgccagctccgactcgctcggcgtagttgcc 114
>ref|XM_687127.1| PREDICTED: Danio rerio similar to replication-dependent histone H2A (LOC563765), partial mRNA Length = 417 Score = 87.7 bits (44), Expect = 4e-14 Identities = 119/144 (82%) Strand = Plus / Minus Query: 380 ctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttcttgtt 439 ||||||||||||||| || || ||||| | || || || | ||| |||||||||||||| Sbjct: 279 ctcctcgtcgttgcgcaccgccagctgcaggtgacgggggatgatacgggtcttcttgtt 220 Query: 440 gtccctcgcggcgttcccggccaactccaggacctcagcggcgagatactccagcacggc 499 ||||| |||||||| || ||||||||||||| |||||||| |||||||| ||||| || Sbjct: 219 gtcccgagcggcgtttccagccaactccaggatctcagcggtcagatactcgagcacagc 160 Query: 500 ggcgaggtagacgggagcgccggc 523 ||| | ||| || ||||| ||||| Sbjct: 159 ggccaagtacactggagcaccggc 136
>ref|XM_687955.1| PREDICTED: Danio rerio similar to histone H2A (LOC564621), mRNA Length = 387 Score = 87.7 bits (44), Expect = 4e-14 Identities = 125/152 (82%) Strand = Plus / Minus Query: 378 agctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttcttg 437 ||||||||||||||||| || || ||||| | || || || | ||| |||||||||||| Sbjct: 281 agctcctcgtcgttgcgcaccgccagctgcaggtgacgggggatgatacgggtcttcttg 222 Query: 438 ttgtccctcgcggcgttcccggccaactccaggacctcagcggcgagatactccagcacg 497 ||||||| ||||| || || ||||||||||||| |||||||| |||||||| ||||| Sbjct: 221 ttgtcccgagcggcatttccagccaactccaggatctcagcggtcagatactcgagcact 162 Query: 498 gcggcgaggtagacgggagcgccggcgccaac 529 ||||| | ||| || ||||| ||||| ||||| Sbjct: 161 gcggctaagtacactggagcaccggcaccaac 130
>ref|XM_686987.1| PREDICTED: Danio rerio similar to replication-dependent histone H2A (LOC563625), mRNA Length = 432 Score = 87.7 bits (44), Expect = 4e-14 Identities = 89/104 (85%) Strand = Plus / Minus Query: 426 cgggtcttcttgttgtccctcgcggcgttcccggccaactccaggacctcagcggcgaga 485 ||||||||||||||||||| |||||||| || |||||||| |||| |||||||| ||| Sbjct: 233 cgggtcttcttgttgtcccgagcggcgtttccagccaactcaaggatctcagcggtcaga 174 Query: 486 tactccagcacggcggcgaggtagacgggagcgccggcgccaac 529 ||||| ||||| ||||| | |||||| ||||| ||||| ||||| Sbjct: 173 tactcgagcacagcggccaagtagactggagcaccggcaccaac 130
>gb|U08225.1|ZMU08225 Zea mays W-22 histone H2A mRNA, complete cds Length = 714 Score = 87.7 bits (44), Expect = 4e-14 Identities = 86/100 (86%) Strand = Plus / Minus Query: 423 atgcgggtcttcttgttgtccctcgcggcgttcccggccaactccaggacctcagcggcg 482 ||||| ||||||||||||||||| || || || ||||| | |||||| |||||||||||| Sbjct: 343 atgcgagtcttcttgttgtccctggcagcattaccggcgagctccagaacctcagcggcg 284 Query: 483 agatactccagcacggcggcgaggtagacgggagcgccgg 522 || || || || || ||||||||||||||||| ||||||| Sbjct: 283 aggtattcgaggacagcggcgaggtagacgggggcgccgg 244
>gb|BC017379.1| Homo sapiens histone 1, H2ac, mRNA (cDNA clone MGC:1730 IMAGE:2988620), complete cds Length = 1656 Score = 85.7 bits (43), Expect = 2e-13 Identities = 139/171 (81%) Strand = Plus / Minus Query: 377 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 436 |||||||||||||||||||| ||| ||||| | || ||||| | |||||| |||||||| Sbjct: 334 gagctcctcgtcgttgcggatggccagctgcaagtggcgcgggatgatgcgagtcttctt 275 Query: 437 gttgtccctcgcggcgttcccggccaactccaggacctcagcggcgagatactccagcac 496 |||||| | || ||||| ||||||| |||||||| ||| |||| |||||||| | ||| Sbjct: 274 gttgtcgcgagccgcgttgccggccagctccaggatctcggcggtcagatactctaacac 215 Query: 497 ggcggcgaggtagacgggagcgccggcgccaaccctctcggcgtacttgcc 547 || || ||||| || || ||||| || ||||||| ||| ||||| ||||| Sbjct: 214 cgccgccaggtacaccggcgcgcctgccccaacccgctctgcgtagttgcc 164
>ref|XM_425469.1| PREDICTED: Gallus gallus similar to histone 2, H2ac (LOC427895), mRNA Length = 390 Score = 85.7 bits (43), Expect = 2e-13 Identities = 139/171 (81%) Strand = Plus / Minus Query: 377 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 436 |||||||||||||||||||| ||| ||||| | || || || | |||||| |||||||| Sbjct: 282 gagctcctcgtcgttgcggatggccagctgcaggtggcgggggatgatgcgcgtcttctt 223 Query: 437 gttgtccctcgcggcgttcccggccaactccaggacctcagcggcgagatactccagcac 496 |||||| | || ||||| || |||| |||||||| ||| || | || ||||||||||| Sbjct: 222 gttgtcgcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcac 163 Query: 497 ggcggcgaggtagacgggagcgccggcgccaaccctctcggcgtacttgcc 547 ||| || ||||| || || ||||||||||| |||| ||| ||||| ||||| Sbjct: 162 ggccgccaggtacaccggggcgccggcgcccacccgctccgcgtagttgcc 112
>ref|XM_425467.1| PREDICTED: Gallus gallus similar to histone 2, H2ac (LOC427893), mRNA Length = 390 Score = 85.7 bits (43), Expect = 2e-13 Identities = 139/171 (81%) Strand = Plus / Minus Query: 377 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 436 |||||||||||||||||||| ||| ||||| | || || || | |||||| |||||||| Sbjct: 282 gagctcctcgtcgttgcggatggccagctgcaggtggcgggggatgatgcgcgtcttctt 223 Query: 437 gttgtccctcgcggcgttcccggccaactccaggacctcagcggcgagatactccagcac 496 |||||| | || ||||| || |||| |||||||| ||| || | || ||||||||||| Sbjct: 222 gttgtcgcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcac 163 Query: 497 ggcggcgaggtagacgggagcgccggcgccaaccctctcggcgtacttgcc 547 ||| || ||||| || || ||||||||||| |||| ||| ||||| ||||| Sbjct: 162 ggccgccaggtacaccggggcgccggcgcccacccgctccgcgtagttgcc 112
>ref|XM_425465.1| PREDICTED: Gallus gallus similar to histone 2, H2ac (LOC427891), mRNA Length = 390 Score = 85.7 bits (43), Expect = 2e-13 Identities = 139/171 (81%) Strand = Plus / Minus Query: 377 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 436 |||||||||||||||||||| ||| ||||| | || || || | |||||| |||||||| Sbjct: 282 gagctcctcgtcgttgcggatggccagctgcaggtggcgggggatgatgcgcgtcttctt 223 Query: 437 gttgtccctcgcggcgttcccggccaactccaggacctcagcggcgagatactccagcac 496 |||||| | || ||||| || |||| |||||||| ||| || | || ||||||||||| Sbjct: 222 gttgtcgcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcac 163 Query: 497 ggcggcgaggtagacgggagcgccggcgccaaccctctcggcgtacttgcc 547 ||| || ||||| || || ||||||||||| |||| ||| ||||| ||||| Sbjct: 162 ggccgccaggtacaccggggcgccggcgcccacccgctccgcgtagttgcc 112
>ref|XM_425459.1| PREDICTED: Gallus gallus similar to histone 2, H2ac (LOC427885), mRNA Length = 918 Score = 85.7 bits (43), Expect = 2e-13 Identities = 139/171 (81%) Strand = Plus / Minus Query: 377 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 436 |||||||||||||||||||| ||| ||||| | || || || | |||||| |||||||| Sbjct: 282 gagctcctcgtcgttgcggatggccagctgcaggtggcgggggatgatgcgcgtcttctt 223 Query: 437 gttgtccctcgcggcgttcccggccaactccaggacctcagcggcgagatactccagcac 496 |||||| | || ||||| || |||| |||||||| ||| || | || ||||||||||| Sbjct: 222 gttgtcgcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcac 163 Query: 497 ggcggcgaggtagacgggagcgccggcgccaaccctctcggcgtacttgcc 547 ||| || ||||| || || ||||||||||| |||| ||| ||||| ||||| Sbjct: 162 ggccgccaggtacaccggggcgccggcgcccacccgctccgcgtagttgcc 112
>ref|XM_425455.1| PREDICTED: Gallus gallus similar to histone 2, H2ac (LOC427881), mRNA Length = 534 Score = 85.7 bits (43), Expect = 2e-13 Identities = 139/171 (81%) Strand = Plus / Minus Query: 377 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 436 |||||||||||||||||||| ||| ||||| | || || || | |||||| |||||||| Sbjct: 426 gagctcctcgtcgttgcggatggccagctgcaggtggcgggggatgatgcgcgtcttctt 367 Query: 437 gttgtccctcgcggcgttcccggccaactccaggacctcagcggcgagatactccagcac 496 |||||| | || ||||| || |||| |||||||| ||| || | || ||||||||||| Sbjct: 366 gttgtcgcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcac 307 Query: 497 ggcggcgaggtagacgggagcgccggcgccaaccctctcggcgtacttgcc 547 ||| || ||||| || || ||||||||||| |||| ||| ||||| ||||| Sbjct: 306 ggccgccaggtacaccggggcgccggcgcccacccgctccgcgtagttgcc 256
>ref|XM_416195.1| PREDICTED: Gallus gallus similar to histone 2, H2ac (LOC417955), mRNA Length = 1220 Score = 85.7 bits (43), Expect = 2e-13 Identities = 139/171 (81%) Strand = Plus / Minus Query: 377 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 436 |||||||||||||||||||| ||| ||||| | || || || | |||||| |||||||| Sbjct: 1112 gagctcctcgtcgttgcggatggccagctgcaggtggcgggggatgatgcgcgtcttctt 1053 Query: 437 gttgtccctcgcggcgttcccggccaactccaggacctcagcggcgagatactccagcac 496 |||||| | || ||||| || |||| |||||||| ||| || | || ||||||||||| Sbjct: 1052 gttgtcgcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcac 993 Query: 497 ggcggcgaggtagacgggagcgccggcgccaaccctctcggcgtacttgcc 547 ||| || ||||| || || ||||||||||| |||| ||| ||||| ||||| Sbjct: 992 ggccgccaggtacaccggggcgccggcgcccacccgctccgcgtagttgcc 942
>ref|XM_416193.1| PREDICTED: Gallus gallus similar to histone protein Hist2h3c1 (LOC417953), mRNA Length = 2271 Score = 85.7 bits (43), Expect = 2e-13 Identities = 139/171 (81%) Strand = Plus / Plus Query: 377 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 436 |||||||||||||||||||| ||| ||||| | || || || | |||||| |||||||| Sbjct: 1249 gagctcctcgtcgttgcggatggccagctgcaggtggcgggggatgatgcgcgtcttctt 1308 Query: 437 gttgtccctcgcggcgttcccggccaactccaggacctcagcggcgagatactccagcac 496 |||||| | || ||||| || |||| |||||||| ||| || | || ||||||||||| Sbjct: 1309 gttgtcgcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcac 1368 Query: 497 ggcggcgaggtagacgggagcgccggcgccaaccctctcggcgtacttgcc 547 ||| || ||||| || || ||||||||||| |||| ||| ||||| ||||| Sbjct: 1369 ggccgccaggtacaccggggcgccggcgcccacccgctccgcgtagttgcc 1419
>ref|XM_416192.1| PREDICTED: Gallus gallus similar to germinal histone H4 gene (LOC417952), mRNA Length = 1374 Score = 85.7 bits (43), Expect = 2e-13 Identities = 139/171 (81%) Strand = Plus / Plus Query: 377 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 436 |||||||||||||||||||| ||| ||||| | || || || | |||||| |||||||| Sbjct: 808 gagctcctcgtcgttgcggatggccagctgcaggtggcgggggatgatgcgcgtcttctt 867 Query: 437 gttgtccctcgcggcgttcccggccaactccaggacctcagcggcgagatactccagcac 496 |||||| | || ||||| || |||| |||||||| ||| || | || ||||||||||| Sbjct: 868 gttgtcgcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcac 927 Query: 497 ggcggcgaggtagacgggagcgccggcgccaaccctctcggcgtacttgcc 547 ||| || ||||| || || ||||||||||| |||| ||| ||||| ||||| Sbjct: 928 ggccgccaggtacaccggggcgccggcgcccacccgctccgcgtagttgcc 978
>gb|BC016677.1| Homo sapiens histone 1, H2ag, mRNA (cDNA clone MGC:17204 IMAGE:4342191), complete cds Length = 2256 Score = 85.7 bits (43), Expect = 2e-13 Identities = 139/171 (81%) Strand = Plus / Minus Query: 377 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 436 |||||||||||||||||||| ||| || |||| ||| ||||| | ||||||||||||||| Sbjct: 301 gagctcctcgtcgttgcggatggccagttggagatgacgcgggatgatgcgggtcttctt 242 Query: 437 gttgtccctcgcggcgttcccggccaactccaggacctcagcggcgagatactccagcac 496 |||||| | || ||||| || |||| ||||||| ||| |||| || ||||||||||| Sbjct: 241 gttgtcgcgggccgcgttgcccgccagttccaggatctcggcggtcaggtactccagcac 182 Query: 497 ggcggcgaggtagacgggagcgccggcgccaaccctctcggcgtacttgcc 547 || || || || || || |||||||| || |||| |||||| || ||||| Sbjct: 181 cgctgccagatacaccggcgcgccggccccgacccgctcggcatagttgcc 131
>gb|BC067782.1| Homo sapiens histone 1, H2ag, mRNA (cDNA clone IMAGE:5314244), partial cds Length = 2270 Score = 85.7 bits (43), Expect = 2e-13 Identities = 139/171 (81%) Strand = Plus / Minus Query: 377 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 436 |||||||||||||||||||| ||| || |||| ||| ||||| | ||||||||||||||| Sbjct: 312 gagctcctcgtcgttgcggatggccagttggagatgacgcgggatgatgcgggtcttctt 253 Query: 437 gttgtccctcgcggcgttcccggccaactccaggacctcagcggcgagatactccagcac 496 |||||| | || ||||| || |||| ||||||| ||| |||| || ||||||||||| Sbjct: 252 gttgtcgcgggccgcgttgcccgccagttccaggatctcggcggtcaggtactccagcac 193 Query: 497 ggcggcgaggtagacgggagcgccggcgccaaccctctcggcgtacttgcc 547 || || || || || || |||||||| || |||| |||||| || ||||| Sbjct: 192 cgctgccagatacaccggcgcgccggccccgacccgctcggcatagttgcc 142
>ref|NM_177688.2| Mus musculus H2A histone family, member J (H2afj), mRNA Length = 1754 Score = 85.7 bits (43), Expect = 2e-13 Identities = 139/171 (81%) Strand = Plus / Minus Query: 377 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 436 |||||||||||||||||||| ||| ||||| | || || || | |||||| |||||||| Sbjct: 299 gagctcctcgtcgttgcggatggccagctgcaggtgacgagggatgatgcgcgtcttctt 240 Query: 437 gttgtccctcgcggcgttcccggccaactccaggacctcagcggcgagatactccagcac 496 |||||||||||| ||||| || |||| |||||||| ||| || | || ||||||||||| Sbjct: 239 gttgtccctcgccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcac 180 Query: 497 ggcggcgaggtagacgggagcgccggcgccaaccctctcggcgtacttgcc 547 || || ||||| ||||| || || ||||| || | ||| ||||| ||||| Sbjct: 179 cgccgccaggtacacgggcgctcccgcgcccacgcgctccgcgtagttgcc 129
>ref|NM_021064.3| Homo sapiens histone 1, H2ag (HIST1H2AG), mRNA Length = 2267 Score = 85.7 bits (43), Expect = 2e-13 Identities = 139/171 (81%) Strand = Plus / Minus Query: 377 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 436 |||||||||||||||||||| ||| || |||| ||| ||||| | ||||||||||||||| Sbjct: 312 gagctcctcgtcgttgcggatggccagttggagatgacgcgggatgatgcgggtcttctt 253 Query: 437 gttgtccctcgcggcgttcccggccaactccaggacctcagcggcgagatactccagcac 496 |||||| | || ||||| || |||| ||||||| ||| |||| || ||||||||||| Sbjct: 252 gttgtcgcgggccgcgttgcccgccagttccaggatctcggcggtcaggtactccagcac 193 Query: 497 ggcggcgaggtagacgggagcgccggcgccaaccctctcggcgtacttgcc 547 || || || || || || |||||||| || |||| |||||| || ||||| Sbjct: 192 cgctgccagatacaccggcgcgccggccccgacccgctcggcatagttgcc 142
>gb|AC122804.4| Mus musculus BAC clone RP23-296J10 from 6, complete sequence Length = 205659 Score = 85.7 bits (43), Expect = 2e-13 Identities = 139/171 (81%) Strand = Plus / Plus Query: 377 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 436 |||||||||||||||||||| ||| ||||| | || || || | |||||| |||||||| Sbjct: 108662 gagctcctcgtcgttgcggatggccagctgcaggtgacgagggatgatgcgcgtcttctt 108721 Query: 437 gttgtccctcgcggcgttcccggccaactccaggacctcagcggcgagatactccagcac 496 |||||||||||| ||||| || |||| |||||||| ||| || | || ||||||||||| Sbjct: 108722 gttgtccctcgccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcac 108781 Query: 497 ggcggcgaggtagacgggagcgccggcgccaaccctctcggcgtacttgcc 547 || || ||||| ||||| || || ||||| || | ||| ||||| ||||| Sbjct: 108782 cgccgccaggtacacgggcgctcccgcgcccacgcgctccgcgtagttgcc 108832
>emb|CR673199.2|CNS0FIET Tetraodon nigroviridis full-length cDNA Length = 775 Score = 85.7 bits (43), Expect = 2e-13 Identities = 122/147 (82%), Gaps = 1/147 (0%) Strand = Plus / Minus Query: 377 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 436 |||||||||||||||||| || || ||||| | || || || | ||||||||| ||||| Sbjct: 320 gagctcctcgtcgttgcgcaccgccagctgcaggtggcgggggatgatgcgggt-ttctt 262 Query: 437 gttgtccctcgcggcgttcccggccaactccaggacctcagcggcgagatactccagcac 496 |||||| | || ||||| ||||||| |||||||| ||| |||| || ||||||||||| Sbjct: 261 gttgtcgcgggcagcgttgccggccagctccaggatctcggcggtcaggtactccagcac 202 Query: 497 ggcggcgaggtagacgggagcgccggc 523 |||||| |||||||| ||||| ||||| Sbjct: 201 ggcggccaggtagaccggagcaccggc 175 Score = 42.1 bits (21), Expect = 2.3 Identities = 24/25 (96%) Strand = Plus / Minus Query: 572 gccgacgggaaactggagcccggcc 596 ||||||||| ||||||||||||||| Sbjct: 126 gccgacggggaactggagcccggcc 102
>ref|XM_962318.1| PREDICTED: Tribolium castaneum similar to H2A histone family, member X (LOC655756), mRNA Length = 545 Score = 85.7 bits (43), Expect = 2e-13 Identities = 82/95 (86%) Strand = Plus / Minus Query: 429 gtcttcttgttgtccctcgcggcgttcccggccaactccaggacctcagcggcgagatac 488 ||||||||||||||||| || ||||| |||||||||||||| |||||||| || || ||| Sbjct: 283 gtcttcttgttgtccctagcagcgtttccggccaactccagcacctcagcagccaggtac 224 Query: 489 tccagcacggcggcgaggtagacgggagcgccggc 523 |||| |||||||| ||||| ||||| || ||||| Sbjct: 223 tccataacggcggccaggtacacgggggctccggc 189
>emb|X07763.1|GGH2AB8 Chicken DNA for pCH3.5E histone H2A/H2B sequence Length = 1017 Score = 85.7 bits (43), Expect = 2e-13 Identities = 139/171 (81%) Strand = Plus / Plus Query: 377 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 436 |||||||||||||||||||| ||| ||||| | || || || | |||||| |||||||| Sbjct: 25 gagctcctcgtcgttgcggatggccagctgcaggtggcgggggatgatgcgcgtcttctt 84 Query: 437 gttgtccctcgcggcgttcccggccaactccaggacctcagcggcgagatactccagcac 496 |||||| | || ||||| || |||| |||||||| ||| || | || ||||||||||| Sbjct: 85 gttgtcgcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcac 144 Query: 497 ggcggcgaggtagacgggagcgccggcgccaaccctctcggcgtacttgcc 547 ||| || ||||| || || ||||||||||| |||| ||| ||||| ||||| Sbjct: 145 ggccgccaggtacaccggggcgccggcgcccacccgctccgcgtagttgcc 195
>emb|X02218.1|GGHIS1 Chicken duplicated genes for histone H2A, H4 and a histone H3 gene Length = 8384 Score = 85.7 bits (43), Expect = 2e-13 Identities = 139/171 (81%) Strand = Plus / Minus Query: 377 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 436 |||||||||||||||||||| ||| ||||| | || || || | |||||| |||||||| Sbjct: 5213 gagctcctcgtcgttgcggatggccagctgcaggtggcgggggatgatgcgcgtcttctt 5154 Query: 437 gttgtccctcgcggcgttcccggccaactccaggacctcagcggcgagatactccagcac 496 |||||| | || ||||| || |||| |||||||| ||| || | || ||||||||||| Sbjct: 5153 gttgtcgcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcac 5094 Query: 497 ggcggcgaggtagacgggagcgccggcgccaaccctctcggcgtacttgcc 547 ||| || ||||| || || ||||||||||| |||| ||| ||||| ||||| Sbjct: 5093 ggccgccaggtacaccggggcgccggcgcccacccgctccgcgtagttgcc 5043 Score = 85.7 bits (43), Expect = 2e-13 Identities = 139/171 (81%) Strand = Plus / Plus Query: 377 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 436 |||||||||||||||||||| ||| ||||| | || || || | |||||| |||||||| Sbjct: 2231 gagctcctcgtcgttgcggatggccagctgcaggtggcgggggatgatgcgcgtcttctt 2290 Query: 437 gttgtccctcgcggcgttcccggccaactccaggacctcagcggcgagatactccagcac 496 |||||| | || ||||| || |||| |||||||| ||| || | || ||||||||||| Sbjct: 2291 gttgtcgcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcac 2350 Query: 497 ggcggcgaggtagacgggagcgccggcgccaaccctctcggcgtacttgcc 547 ||| || ||||| || || ||||||||||| |||| ||| ||||| ||||| Sbjct: 2351 ggccgccaggtacaccggggcgccggcgcccacccgctccgcgtagttgcc 2401
>dbj|AK053755.1| Mus musculus 0 day neonate eyeball cDNA, RIKEN full-length enriched library, clone:E130307C13 product:HISTONE H2A homolog [Gallus gallus], full insert sequence Length = 1754 Score = 85.7 bits (43), Expect = 2e-13 Identities = 139/171 (81%) Strand = Plus / Minus Query: 377 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 436 |||||||||||||||||||| ||| ||||| | || || || | |||||| |||||||| Sbjct: 299 gagctcctcgtcgttgcggatggccagctgcaggtgacgagggatgatgcgcgtcttctt 240 Query: 437 gttgtccctcgcggcgttcccggccaactccaggacctcagcggcgagatactccagcac 496 |||||||||||| ||||| || |||| |||||||| ||| || | || ||||||||||| Sbjct: 239 gttgtccctcgccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcac 180 Query: 497 ggcggcgaggtagacgggagcgccggcgccaaccctctcggcgtacttgcc 547 || || ||||| ||||| || || ||||| || | ||| ||||| ||||| Sbjct: 179 cgccgccaggtacacgggcgctcccgcgcccacgcgctccgcgtagttgcc 129
>ref|XM_344599.2| PREDICTED: Rattus norvegicus histone 1, H2ao (predicted) (Hist1h2ao_predicted), mRNA Length = 483 Score = 85.7 bits (43), Expect = 2e-13 Identities = 139/171 (81%) Strand = Plus / Minus Query: 377 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 436 |||||||||||||||||||| ||| ||||| | || ||||| | |||||| ||||| || Sbjct: 282 gagctcctcgtcgttgcggatggccagctgcaggtgacgcggaatgatgcgtgtcttttt 223 Query: 437 gttgtccctcgcggcgttcccggccaactccaggacctcagcggcgagatactccagcac 496 |||||||||||| ||||| || || | ||||| || ||| || | || ||||||||||| Sbjct: 222 gttgtccctcgccgcgttgcctgcgagctccaagatctcggccgtcaggtactccagcac 163 Query: 497 ggcggcgaggtagacgggagcgccggcgccaaccctctcggcgtacttgcc 547 ||| || ||||| || || |||||||| || |||| ||| ||||| ||||| Sbjct: 162 ggccgccaggtacaccggggcgccggctcccacccgctccgcgtagttgcc 112
>gb|AY131987.1| Homo sapiens histone H2A (HIST1H2AG) gene, complete cds Length = 1173 Score = 85.7 bits (43), Expect = 2e-13 Identities = 139/171 (81%) Strand = Plus / Minus Query: 377 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 436 |||||||||||||||||||| ||| || |||| ||| ||||| | ||||||||||||||| Sbjct: 674 gagctcctcgtcgttgcggatggccagttggagatgacgcgggatgatgcgggtcttctt 615 Query: 437 gttgtccctcgcggcgttcccggccaactccaggacctcagcggcgagatactccagcac 496 |||||| | || ||||| || |||| ||||||| ||| |||| || ||||||||||| Sbjct: 614 gttgtcgcgggccgcgttgcccgccagttccaggatctcggcggtcaggtactccagcac 555 Query: 497 ggcggcgaggtagacgggagcgccggcgccaaccctctcggcgtacttgcc 547 || || || || || || |||||||| || |||| |||||| || ||||| Sbjct: 554 cgctgccagatacaccggcgcgccggccccgacccgctcggcatagttgcc 504
>gb|BC096705.1| Homo sapiens histone 2, H2aa, mRNA (cDNA clone MGC:120083 IMAGE:40021705), complete cds Length = 480 Score = 85.7 bits (43), Expect = 2e-13 Identities = 118/143 (82%) Strand = Plus / Minus Query: 381 tcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttcttgttg 440 |||||||||||||||| ||| ||||||| || || || | |||||| |||||||||||| Sbjct: 278 tcctcgtcgttgcggatggccagctggaggtgacgagggatgatgcgcgtcttcttgttg 219 Query: 441 tccctcgcggcgttcccggccaactccaggacctcagcggcgagatactccagcacggcg 500 |||| || ||||| || |||| |||||||| |||||||| |||||||| || || || Sbjct: 218 tcccgagccgcgttgcccgccagctccaggatctcagcggtcagatactcgaggaccgca 159 Query: 501 gcgaggtagacgggagcgccggc 523 || | ||||||||| |||||||| Sbjct: 158 gccatgtagacgggcgcgccggc 136
>gb|BC099606.1| Mus musculus H2A histone family, member J, mRNA (cDNA clone MGC:118637 IMAGE:1383389), complete cds Length = 587 Score = 85.7 bits (43), Expect = 2e-13 Identities = 139/171 (81%) Strand = Plus / Minus Query: 377 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 436 |||||||||||||||||||| ||| ||||| | || || || | |||||| |||||||| Sbjct: 356 gagctcctcgtcgttgcggatggccagctgcaggtgacgagggatgatgcgcgtcttctt 297 Query: 437 gttgtccctcgcggcgttcccggccaactccaggacctcagcggcgagatactccagcac 496 |||||||||||| ||||| || |||| |||||||| ||| || | || ||||||||||| Sbjct: 296 gttgtccctcgccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcac 237 Query: 497 ggcggcgaggtagacgggagcgccggcgccaaccctctcggcgtacttgcc 547 || || ||||| ||||| || || ||||| || | ||| ||||| ||||| Sbjct: 236 cgccgccaggtacacgggcgctcccgcgcccacgcgctccgcgtagttgcc 186
>dbj|D11055.1|CHKH2A4H Gallus gallus gene for H2A histone, complete cds Length = 1028 Score = 85.7 bits (43), Expect = 2e-13 Identities = 139/171 (81%) Strand = Plus / Minus Query: 377 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 436 |||||||||||||||||||| ||| ||||| | || || || | |||||| |||||||| Sbjct: 613 gagctcctcgtcgttgcggatggccagctgcaggtggcgggggatgatgcgcgtcttctt 554 Query: 437 gttgtccctcgcggcgttcccggccaactccaggacctcagcggcgagatactccagcac 496 |||||| | || ||||| || |||| |||||||| ||| || | || ||||||||||| Sbjct: 553 gttgtcgcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcac 494 Query: 497 ggcggcgaggtagacgggagcgccggcgccaaccctctcggcgtacttgcc 547 ||| || ||||| || || ||||||||||| |||| ||| ||||| ||||| Sbjct: 493 ggccgccaggtacaccggggcgccggcgcccacccgctccgcgtagttgcc 443
>gb|U38933.1|GGU38933 Gallus gallus histone H2A (H2A-VIII) gene, complete cds Length = 740 Score = 85.7 bits (43), Expect = 2e-13 Identities = 139/171 (81%) Strand = Plus / Minus Query: 377 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 436 |||||||||||||||||||| ||| ||||| | || || || | |||||| |||||||| Sbjct: 460 gagctcctcgtcgttgcggatggccagctgcaggtggcgggggatgatgcgcgtcttctt 401 Query: 437 gttgtccctcgcggcgttcccggccaactccaggacctcagcggcgagatactccagcac 496 |||||| | || ||||| || |||| |||||||| ||| || | || ||||||||||| Sbjct: 400 gttgtcgcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcac 341 Query: 497 ggcggcgaggtagacgggagcgccggcgccaaccctctcggcgtacttgcc 547 ||| || ||||| || || ||||||||||| |||| ||| ||||| ||||| Sbjct: 340 ggccgccaggtacaccggggcgccggcgcccacccgctccgcgtagttgcc 290
>gb|U38932.1|GGU38932 Gallus gallus histone H2A (H2A-VII) gene, complete cds Length = 827 Score = 85.7 bits (43), Expect = 2e-13 Identities = 139/171 (81%) Strand = Plus / Minus Query: 377 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 436 |||||||||||||||||||| ||| ||||| | || || || | |||||| |||||||| Sbjct: 443 gagctcctcgtcgttgcggatggccagctgcaggtggcgggggatgatgcgcgtcttctt 384 Query: 437 gttgtccctcgcggcgttcccggccaactccaggacctcagcggcgagatactccagcac 496 |||||| | || ||||| || |||| |||||||| ||| || | || ||||||||||| Sbjct: 383 gttgtcgcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcac 324 Query: 497 ggcggcgaggtagacgggagcgccggcgccaaccctctcggcgtacttgcc 547 ||| || ||||| || || ||||||||||| |||| ||| ||||| ||||| Sbjct: 323 ggccgccaggtacaccggggcgccggcgcccacccgctccgcgtagttgcc 273
>gb|U38931.1|GGU38931 Gallus gallus histone H2A (H2A-VI) gene, complete cds Length = 743 Score = 85.7 bits (43), Expect = 2e-13 Identities = 139/171 (81%) Strand = Plus / Minus Query: 377 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 436 |||||||||||||||||||| ||| ||||| | || || || | |||||| |||||||| Sbjct: 305 gagctcctcgtcgttgcggatggccagctgcaggtggcgggggatgatgcgcgtcttctt 246 Query: 437 gttgtccctcgcggcgttcccggccaactccaggacctcagcggcgagatactccagcac 496 |||||| | || ||||| || |||| |||||||| ||| || | || ||||||||||| Sbjct: 245 gttgtcgcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcac 186 Query: 497 ggcggcgaggtagacgggagcgccggcgccaaccctctcggcgtacttgcc 547 ||| || ||||| || || ||||||||||| |||| ||| ||||| ||||| Sbjct: 185 ggccgccaggtacaccggggcgccggcgcccacccgctccgcgtagttgcc 135
>gb|L19778.1|HUMH2A1B Homo sapiens histone H2A.1b mRNA, complete cds Length = 2250 Score = 85.7 bits (43), Expect = 2e-13 Identities = 139/171 (81%) Strand = Plus / Minus Query: 377 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 436 |||||||||||||||||||| ||| || |||| ||| ||||| | ||||||||||||||| Sbjct: 312 gagctcctcgtcgttgcggatggccagttggagatgacgcgggatgatgcgggtcttctt 253 Query: 437 gttgtccctcgcggcgttcccggccaactccaggacctcagcggcgagatactccagcac 496 |||||| | || ||||| || |||| ||||||| ||| |||| || ||||||||||| Sbjct: 252 gttgtcgcgggccgcgttgcccgccagttccaggatctcggcggtcaggtactccagcac 193 Query: 497 ggcggcgaggtagacgggagcgccggcgccaaccctctcggcgtacttgcc 547 || || || || || || |||||||| || |||| |||||| || ||||| Sbjct: 192 cgctgccagatacaccggcgcgccggccccgacccgctcggcatagttgcc 142
>gb|AF013803.1| Pinus taeda H2A homolog (lp15) gene, complete cds Length = 781 Score = 85.7 bits (43), Expect = 2e-13 Identities = 139/171 (81%) Strand = Plus / Minus Query: 429 gtcttcttgttgtccctcgcggcgttcccggccaactccaggacctcagcggcgagatac 488 |||||||||||||||| || ||||| || |||| ||||| ||||| || || || || Sbjct: 308 gtcttcttgttgtcccgggcagcgttacctgccagttccagcacctcggctgccaggtat 249 Query: 489 tccagcacggcggcgaggtagacgggagcgccggcgccaaccctctcggcgtacttgccg 548 || || ||||| |||||||| || || ||||| | || |||| ||||| ||||||||| Sbjct: 248 tcaagaacggccgcgaggtaaacaggtgcgcctcctcccacccgttcggcatacttgccg 189 Query: 549 gccttgaggaaccgcgcgatcctgccgacgggaaactggagcccggccttg 599 |||||||||||||| ||||| ||||| || || |||||||| ||||||||| Sbjct: 188 gccttgaggaaccgggcgattctgcccacagggaactggaggccggccttg 138
>ref|XM_525084.1| PREDICTED: Pan troglodytes similar to Histone H2A.1 (LOC469700), mRNA Length = 393 Score = 83.8 bits (42), Expect = 7e-13 Identities = 123/150 (82%) Strand = Plus / Minus Query: 377 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 436 |||||||||||||||||||| ||| ||||| | || ||||| | |||||| |||||||| Sbjct: 282 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 223 Query: 437 gttgtccctcgcggcgttcccggccaactccaggacctcagcggcgagatactccagcac 496 |||||| | ||| ||||| ||||| | |||||||| ||| || | || ||||| ||||| Sbjct: 222 gttgtcgcgcgccgcgttgccggcaagctccaggatctcggcagtcaggtactcgagcac 163 Query: 497 ggcggcgaggtagacgggagcgccggcgcc 526 ||||| || ||||| || ||||||||||| Sbjct: 162 cgcggccagatagaccggggcgccggcgcc 133
>gb|AY812081.1| Schistosoma japonicum SJCHGC05779 protein mRNA, partial cds Length = 1040 Score = 83.8 bits (42), Expect = 7e-13 Identities = 138/170 (81%) Strand = Plus / Minus Query: 378 agctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttcttg 437 |||||||||||||| ||||| || ||||| | || || || | ||| || ||||||||| Sbjct: 231 agctcctcgtcgttacggactgccagctgcaggtgacgggggatgatacgagtcttcttg 172 Query: 438 ttgtccctcgcggcgttcccggccaactccaggacctcagcggcgagatactccagcacg 497 ||||| | || ||||| |||||||||||||||| |||||| | || ||||| ||||| Sbjct: 171 ttgtcacgggcagcgtttccggccaactccaggatctcagcagtcaggtactcgagcact 112 Query: 498 gcggcgaggtagacgggagcgccggcgccaaccctctcggcgtacttgcc 547 ||||| |||||||| || ||||| ||||| || | ||||||||| ||||| Sbjct: 111 gcggccaggtagactggtgcgccagcgcccacacgctcggcgtagttgcc 62
>gb|AC034285.6| Mus musculus chromosome 13, clone RP23-220G21, complete sequence Length = 209720 Score = 83.8 bits (42), Expect = 7e-13 Identities = 123/150 (82%) Strand = Plus / Plus Query: 377 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 436 |||||||||||||||||||| ||| ||||| | || ||||| | |||||| |||||||| Sbjct: 101186 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 101245 Query: 437 gttgtccctcgcggcgttcccggccaactccaggacctcagcggcgagatactccagcac 496 |||||| | || ||||| || |||| |||||||| ||| || | || ||||||||||| Sbjct: 101246 gttgtcgcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcac 101305 Query: 497 ggcggcgaggtagacgggagcgccggcgcc 526 ||| || ||||| || || ||||||||||| Sbjct: 101306 ggccgccaggtacaccggggcgccggcgcc 101335 Score = 83.8 bits (42), Expect = 7e-13 Identities = 123/150 (82%) Strand = Plus / Minus Query: 377 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 436 |||||||||||||||||||| ||| ||||| | || ||||| | |||||| |||||||| Sbjct: 64551 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 64492 Query: 437 gttgtccctcgcggcgttcccggccaactccaggacctcagcggcgagatactccagcac 496 |||||| | || ||||| || |||| |||||||| ||| || | || ||||||||||| Sbjct: 64491 gttgtcgcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcac 64432 Query: 497 ggcggcgaggtagacgggagcgccggcgcc 526 ||| || ||||| || || ||||||||||| Sbjct: 64431 ggccgccaggtacaccggggcgccggcgcc 64402 Score = 83.8 bits (42), Expect = 7e-13 Identities = 123/150 (82%) Strand = Plus / Plus Query: 377 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 436 |||||||||||||||||||| ||| ||||| | || ||||| | |||||| |||||||| Sbjct: 60626 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 60685 Query: 437 gttgtccctcgcggcgttcccggccaactccaggacctcagcggcgagatactccagcac 496 |||||| | || ||||| || |||| |||||||| ||| || | || ||||||||||| Sbjct: 60686 gttgtcgcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcac 60745 Query: 497 ggcggcgaggtagacgggagcgccggcgcc 526 ||| || ||||| || || ||||||||||| Sbjct: 60746 ggccgccaggtacaccggggcgccggcgcc 60775
>ref|NG_002734.1| Mus musculus histone 1, H2aj (Hist1h2aj) pseudogene on chromosome 13 Length = 1357 Score = 83.8 bits (42), Expect = 7e-13 Identities = 123/150 (82%) Strand = Plus / Minus Query: 377 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 436 |||||||||||||||||||| ||| ||||| | || ||||| | |||||| |||||||| Sbjct: 764 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 705 Query: 437 gttgtccctcgcggcgttcccggccaactccaggacctcagcggcgagatactccagcac 496 |||||| | || ||||| || |||| |||||||| ||| || | || ||||||||||| Sbjct: 704 gttgtcgcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcac 645 Query: 497 ggcggcgaggtagacgggagcgccggcgcc 526 ||| || ||||| || || ||||||||||| Sbjct: 644 ggccgccaggtacaccggggcgccggcgcc 615
>ref|XM_906486.2| PREDICTED: Mus musculus similar to H2A histone family, member J (LOC632401), mRNA Length = 1833 Score = 83.8 bits (42), Expect = 7e-13 Identities = 114/138 (82%) Strand = Plus / Minus Query: 377 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 436 |||||||||||||||||||| ||| ||||| | || || || | |||||| |||||||| Sbjct: 378 gagctcctcgtcgttgcggatggccagctgcaggtggcgagggatgatgcgcgtcttctt 319 Query: 437 gttgtccctcgcggcgttcccggccaactccaggacctcagcggcgagatactccagcac 496 |||||||||||| ||||| || |||| |||||||| ||| || | || ||||||||||| Sbjct: 318 gttgtccctcgccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcac 259 Query: 497 ggcggcgaggtagacggg 514 || || ||||| ||||| Sbjct: 258 cgccgccaggtacacggg 241
>ref|XM_543796.2| PREDICTED: Canis familiaris similar to H2A histone family, member J isoform 2 (LOC486669), mRNA Length = 598 Score = 83.8 bits (42), Expect = 7e-13 Identities = 123/150 (82%) Strand = Plus / Minus Query: 377 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 436 |||||||||||||||||||| ||| || || | || ||||| | ||| | ||||||||| Sbjct: 360 gagctcctcgtcgttgcggatggcgagttgcaggtggcgcgggatgatcctggtcttctt 301 Query: 437 gttgtccctcgcggcgttcccggccaactccaggacctcagcggcgagatactccagcac 496 |||||| | ||||| || |||||||||||||||| |||||| | || ||||||||||| Sbjct: 300 gttgtcacgagcggcattgccggccaactccaggatctcagccgtcaggtactccagcac 241 Query: 497 ggcggcgaggtagacgggagcgccggcgcc 526 || || ||||| ||||| || |||||||| Sbjct: 240 cgccgccaggtacacgggcgccccggcgcc 211
>gb|AY223124.1| Schistosoma japonicum clone ZZD1425 mRNA sequence Length = 654 Score = 83.8 bits (42), Expect = 7e-13 Identities = 138/170 (81%) Strand = Plus / Minus Query: 378 agctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttcttg 437 |||||||||||||| ||||| || ||||| | || || || | ||| || ||||||||| Sbjct: 293 agctcctcgtcgttacggactgccagctgcaggtgacgggggatgatacgagtcttcttg 234 Query: 438 ttgtccctcgcggcgttcccggccaactccaggacctcagcggcgagatactccagcacg 497 ||||| | || ||||| |||||||||||||||| |||||| | || ||||| ||||| Sbjct: 233 ttgtcacgggcagcgtttccggccaactccaggatctcagcagtcaggtactcgagcact 174 Query: 498 gcggcgaggtagacgggagcgccggcgccaaccctctcggcgtacttgcc 547 ||||| |||||||| || ||||| ||||| || | ||||||||| ||||| Sbjct: 173 gcggccaggtagactggtgcgccagcgcccacacgctcggcgtagttgcc 124
>gb|BC058544.1| Mus musculus cDNA clone IMAGE:5711765, with apparent retained intron Length = 497 Score = 83.8 bits (42), Expect = 7e-13 Identities = 123/150 (82%) Strand = Plus / Minus Query: 377 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 436 |||||||||||||||||||| ||| ||||| | || ||||| | |||||| |||||||| Sbjct: 313 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 254 Query: 437 gttgtccctcgcggcgttcccggccaactccaggacctcagcggcgagatactccagcac 496 |||||| | || ||||| || |||| |||||||| ||| || | || ||||||||||| Sbjct: 253 gttgtcgcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcac 194 Query: 497 ggcggcgaggtagacgggagcgccggcgcc 526 ||| || ||||| || || ||||||||||| Sbjct: 193 ggccgccaggtacaccggggcgccggcgcc 164
>emb|X05863.1|MMHIS2BB Mouse H2B and H2A-pseudo histone genes (291B) Length = 1826 Score = 83.8 bits (42), Expect = 7e-13 Identities = 123/150 (82%) Strand = Plus / Minus Query: 377 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 436 |||||||||||||||||||| ||| ||||| | || ||||| | |||||| |||||||| Sbjct: 1230 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 1171 Query: 437 gttgtccctcgcggcgttcccggccaactccaggacctcagcggcgagatactccagcac 496 |||||| | || ||||| || |||| |||||||| ||| || | || ||||||||||| Sbjct: 1170 gttgtcgcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcac 1111 Query: 497 ggcggcgaggtagacgggagcgccggcgcc 526 ||| || ||||| || || ||||||||||| Sbjct: 1110 ggccgccaggtacaccggggcgccggcgcc 1081
>emb|X05862.1|MMHIS2BA Mouse H2B and H2A histone genes (291A) Length = 1797 Score = 83.8 bits (42), Expect = 7e-13 Identities = 123/150 (82%) Strand = Plus / Minus Query: 377 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 436 |||||||||||||||||||| ||| ||||| | || ||||| | |||||| |||||||| Sbjct: 1231 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 1172 Query: 437 gttgtccctcgcggcgttcccggccaactccaggacctcagcggcgagatactccagcac 496 |||||| | || ||||| || |||| |||||||| ||| || | || ||||||||||| Sbjct: 1171 gttgtcgcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcac 1112 Query: 497 ggcggcgaggtagacgggagcgccggcgcc 526 ||| || ||||| || || ||||||||||| Sbjct: 1111 ggccgccaggtacaccggggcgccggcgcc 1082
>gb|BC099406.1| Mus musculus histone 1, H2ac, mRNA (cDNA clone MGC:117571 IMAGE:30789778), complete cds Length = 1075 Score = 83.8 bits (42), Expect = 7e-13 Identities = 123/150 (82%) Strand = Plus / Minus Query: 377 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 436 |||||||||||||||||||| ||| ||||| | || ||||| | |||||| |||||||| Sbjct: 292 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 233 Query: 437 gttgtccctcgcggcgttcccggccaactccaggacctcagcggcgagatactccagcac 496 |||||| | || ||||| || |||| |||||||| ||| || | || ||||||||||| Sbjct: 232 gttgtcgcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcac 173 Query: 497 ggcggcgaggtagacgggagcgccggcgcc 526 ||| || ||||| || || ||||||||||| Sbjct: 172 ggccgccaggtacaccggggcgccggcgcc 143
>emb|AL589651.8| Mouse DNA sequence from clone RP23-138F20 on chromosome 13 Contains five genes for olfactory receptors, a novel gene, the H1f5 gene for H1 histone family member 5, three genes and one pseudogene for H2a histone family members, four genes for H2b, two genes for H4, and two genes for H3 histone family members and seven CpG islands, complete sequence Length = 222823 Score = 83.8 bits (42), Expect = 7e-13 Identities = 123/150 (82%) Strand = Plus / Plus Query: 377 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 436 |||||||||||||||||||| ||| ||||| | || ||||| | |||||| |||||||| Sbjct: 207927 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 207986 Query: 437 gttgtccctcgcggcgttcccggccaactccaggacctcagcggcgagatactccagcac 496 |||||| | || ||||| || |||| |||||||| ||| || | || ||||||||||| Sbjct: 207987 gttgtcgcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcac 208046 Query: 497 ggcggcgaggtagacgggagcgccggcgcc 526 ||| || ||||| || || ||||||||||| Sbjct: 208047 ggccgccaggtacaccggggcgccggcgcc 208076 Score = 83.8 bits (42), Expect = 7e-13 Identities = 123/150 (82%) Strand = Plus / Plus Query: 377 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 436 |||||||||||||||||||| ||| ||||| | || ||||| | |||||| |||||||| Sbjct: 142528 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 142587 Query: 437 gttgtccctcgcggcgttcccggccaactccaggacctcagcggcgagatactccagcac 496 |||||| | || ||||| || |||| |||||||| ||| || | || ||||||||||| Sbjct: 142588 gttgtcgcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcac 142647 Query: 497 ggcggcgaggtagacgggagcgccggcgcc 526 ||| || ||||| || || ||||||||||| Sbjct: 142648 ggccgccaggtacaccggggcgccggcgcc 142677 Score = 83.8 bits (42), Expect = 7e-13 Identities = 123/150 (82%) Strand = Plus / Minus Query: 377 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 436 |||||||||||||||||||| ||| ||||| | || ||||| | |||||| |||||||| Sbjct: 137693 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 137634 Query: 437 gttgtccctcgcggcgttcccggccaactccaggacctcagcggcgagatactccagcac 496 |||||| | || ||||| || |||| |||||||| ||| || | || ||||||||||| Sbjct: 137633 gttgtcgcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcac 137574 Query: 497 ggcggcgaggtagacgggagcgccggcgcc 526 ||| || ||||| || || ||||||||||| Sbjct: 137573 ggccgccaggtacaccggggcgccggcgcc 137544 Score = 67.9 bits (34), Expect = 4e-08 Identities = 121/150 (80%) Strand = Plus / Plus Query: 377 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 436 |||||||||||||||||||| ||| ||||| | || ||||| | ||||| |||||||| Sbjct: 174536 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggataatgcgcgtcttctt 174595 Query: 437 gttgtccctcgcggcgttcccggccaactccaggacctcagcggcgagatactccagcac 496 |||||| | || ||||| || |||| |||||||| ||| || | || ||||| ||||| Sbjct: 174596 gttgtcgcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactctagcac 174655 Query: 497 ggcggcgaggtagacgggagcgccggcgcc 526 ||| || ||||| || || ||||||||||| Sbjct: 174656 ggctgccaggtacaccggggcgccggcgcc 174685
>emb|AL590388.4| Mouse DNA sequence from clone RP23-480B19 on chromosome 13 Contains the Slc17a1 gene for solute carrier family 17 (vesicular glutamate transporter) member 1, two genes for novel solute carrier family 17 (Slc17) members, two novel genes, the gene for a novel C3HC4 type zinc finger (ring finger) protein, the gene for an H2a, an H2b, two genes for H3 and two genes for H4 histone family members, a H2a histone family pseudogene, the H1f1 and H1f2 genes for H1 histone family members 1 and 2, the H3f2 gene for H3 histone family, member 2 (H3.2), a novel pseudogene, the Hfe gene for hemochromatosis protein (Mr2) and two CpG islands, complete sequence Length = 186062 Score = 83.8 bits (42), Expect = 7e-13 Identities = 123/150 (82%) Strand = Plus / Plus Query: 377 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 436 |||||||||||||||||||| ||| ||||| | || ||||| | |||||| |||||||| Sbjct: 136964 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 137023 Query: 437 gttgtccctcgcggcgttcccggccaactccaggacctcagcggcgagatactccagcac 496 |||||| | || ||||| || |||| |||||||| ||| || | || ||||||||||| Sbjct: 137024 gttgtcgcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcac 137083 Query: 497 ggcggcgaggtagacgggagcgccggcgcc 526 ||| || ||||| || || ||||||||||| Sbjct: 137084 ggccgccaggtacaccggggcgccggcgcc 137113 Score = 60.0 bits (30), Expect = 1e-05 Identities = 57/66 (86%) Strand = Plus / Minus Query: 377 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 436 |||||||||||||||||||| ||| ||||| | || ||||| | |||||| |||||||| Sbjct: 142102 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 142043 Query: 437 gttgtc 442 |||||| Sbjct: 142042 gttgtc 142037
>emb|AJ494848.1|ODI494848 Oikopleura dioica H3.1 gene, H4.1 gene, H1.1 gene, and H2A.1 gene Length = 5705 Score = 83.8 bits (42), Expect = 7e-13 Identities = 102/122 (83%) Strand = Plus / Plus Query: 402 agctggatatgtcgcggcacgatgcgggtcttcttgttgtccctcgcggcgttcccggcc 461 ||||||| |||||| || | ||| |||||||| |||||||| | |||||||| || ||| Sbjct: 3251 agctggagatgtcgtgggatgattcgggtctttttgttgtctcgggcggcgtttccagcc 3310 Query: 462 aactccaggacctcagcggcgagatactccagcacggcggcgaggtagacgggagcgccg 521 || || ||||| ||||||| |||||| || || |||||||||||||||||||| || ||| Sbjct: 3311 aattcaaggacttcagcggagagatattcgagtacggcggcgaggtagacgggggcaccg 3370 Query: 522 gc 523 || Sbjct: 3371 gc 3372
>gb|BC076498.1| Mus musculus histone 1, H2ae, mRNA (cDNA clone MGC:90847 IMAGE:5713252), complete cds Length = 492 Score = 83.8 bits (42), Expect = 7e-13 Identities = 123/150 (82%) Strand = Plus / Minus Query: 377 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 436 |||||||||||||||||||| ||| ||||| | || ||||| | |||||| |||||||| Sbjct: 312 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 253 Query: 437 gttgtccctcgcggcgttcccggccaactccaggacctcagcggcgagatactccagcac 496 |||||| | || ||||| || |||| |||||||| ||| || | || ||||||||||| Sbjct: 252 gttgtcgcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcac 193 Query: 497 ggcggcgaggtagacgggagcgccggcgcc 526 ||| || ||||| || || ||||||||||| Sbjct: 192 ggccgccaggtacaccggggcgccggcgcc 163
>dbj|AK146117.1| Mus musculus TIB-55 BB88 cDNA, RIKEN full-length enriched library, clone:I730004H15 product:histone 1, H2ai, full insert sequence Length = 1396 Score = 83.8 bits (42), Expect = 7e-13 Identities = 123/150 (82%) Strand = Plus / Minus Query: 377 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 436 |||||||||||||||||||| ||| ||||| | || ||||| | |||||| |||||||| Sbjct: 294 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 235 Query: 437 gttgtccctcgcggcgttcccggccaactccaggacctcagcggcgagatactccagcac 496 |||||| | || ||||| || |||| |||||||| ||| || | || ||||||||||| Sbjct: 234 gttgtcgcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcac 175 Query: 497 ggcggcgaggtagacgggagcgccggcgcc 526 ||| || ||||| || || ||||||||||| Sbjct: 174 ggccgccaggtacaccggggcgccggcgcc 145
>ref|XM_694133.1| PREDICTED: Danio rerio similar to replication-dependent histone H2A (LOC570629), mRNA Length = 420 Score = 83.8 bits (42), Expect = 7e-13 Identities = 120/146 (82%) Strand = Plus / Minus Query: 378 agctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttcttg 437 ||||||||||||||||| || || ||||| | || || || | ||| ||||| |||||| Sbjct: 281 agctcctcgtcgttgcgcaccgccagctgcaggtgacgggggatgatacgggttttcttg 222 Query: 438 ttgtccctcgcggcgttcccggccaactccaggacctcagcggcgagatactccagcacg 497 ||||||| |||||||| || ||||||||||||| |||||||| |||||||| ||||| Sbjct: 221 ttgtcccgagcggcgtttccagccaactccaggatctcagcggtcagatactcgagcaca 162 Query: 498 gcggcgaggtagacgggagcgccggc 523 ||||| | ||| || ||||| ||||| Sbjct: 161 gcggccaagtacactggagcaccggc 136
>ref|NM_175660.2| Mus musculus histone 1, H2ab (Hist1h2ab), mRNA Length = 506 Score = 83.8 bits (42), Expect = 7e-13 Identities = 123/150 (82%) Strand = Plus / Minus Query: 377 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 436 |||||||||||||||||||| ||| ||||| | || ||||| | |||||| |||||||| Sbjct: 327 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 268 Query: 437 gttgtccctcgcggcgttcccggccaactccaggacctcagcggcgagatactccagcac 496 |||||| | || ||||| || |||| |||||||| ||| || | || ||||||||||| Sbjct: 267 gttgtcgcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcac 208 Query: 497 ggcggcgaggtagacgggagcgccggcgcc 526 ||| || ||||| || || ||||||||||| Sbjct: 207 ggccgccaggtacaccggggcgccggcgcc 178
>gb|BC090402.1| Mus musculus cDNA clone MGC:103288 IMAGE:5150365, complete cds Length = 447 Score = 83.8 bits (42), Expect = 7e-13 Identities = 123/150 (82%) Strand = Plus / Minus Query: 377 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 436 |||||||||||||||||||| ||| ||||| | || ||||| | |||||| |||||||| Sbjct: 294 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 235 Query: 437 gttgtccctcgcggcgttcccggccaactccaggacctcagcggcgagatactccagcac 496 |||||| | || ||||| || |||| |||||||| ||| || | || ||||||||||| Sbjct: 234 gttgtcgcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcac 175 Query: 497 ggcggcgaggtagacgggagcgccggcgcc 526 ||| || ||||| || || ||||||||||| Sbjct: 174 ggccgccaggtacaccggggcgccggcgcc 145
>gb|BC069947.1| Mus musculus cDNA clone IMAGE:6494016 Length = 2110 Score = 83.8 bits (42), Expect = 7e-13 Identities = 123/150 (82%) Strand = Plus / Minus Query: 377 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 436 |||||||||||||||||||| ||| ||||| | || ||||| | |||||| |||||||| Sbjct: 552 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 493 Query: 437 gttgtccctcgcggcgttcccggccaactccaggacctcagcggcgagatactccagcac 496 |||||| | || ||||| || |||| |||||||| ||| || | || ||||||||||| Sbjct: 492 gttgtcgcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcac 433 Query: 497 ggcggcgaggtagacgggagcgccggcgcc 526 ||| || ||||| || || ||||||||||| Sbjct: 432 ggccgccaggtacaccggggcgccggcgcc 403
>gb|BC055904.1| Mus musculus cDNA clone IMAGE:4913108 Length = 2221 Score = 83.8 bits (42), Expect = 7e-13 Identities = 123/150 (82%) Strand = Plus / Minus Query: 377 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 436 |||||||||||||||||||| ||| ||||| | || ||||| | |||||| |||||||| Sbjct: 550 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 491 Query: 437 gttgtccctcgcggcgttcccggccaactccaggacctcagcggcgagatactccagcac 496 |||||| | || ||||| || |||| |||||||| ||| || | || ||||||||||| Sbjct: 490 gttgtcgcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcac 431 Query: 497 ggcggcgaggtagacgggagcgccggcgcc 526 ||| || ||||| || || ||||||||||| Sbjct: 430 ggccgccaggtacaccggggcgccggcgcc 401
>ref|NM_178187.2| Mus musculus histone 1, H2ae (Hist1h2ae), mRNA Length = 705 Score = 83.8 bits (42), Expect = 7e-13 Identities = 123/150 (82%) Strand = Plus / Minus Query: 377 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 436 |||||||||||||||||||| ||| ||||| | || ||||| | |||||| |||||||| Sbjct: 395 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 336 Query: 437 gttgtccctcgcggcgttcccggccaactccaggacctcagcggcgagatactccagcac 496 |||||| | || ||||| || |||| |||||||| ||| || | || ||||||||||| Sbjct: 335 gttgtcgcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcac 276 Query: 497 ggcggcgaggtagacgggagcgccggcgcc 526 ||| || ||||| || || ||||||||||| Sbjct: 275 ggccgccaggtacaccggggcgccggcgcc 246
>ref|NM_178188.3| Mus musculus histone 1, H2ad (Hist1h2ad), mRNA Length = 393 Score = 83.8 bits (42), Expect = 7e-13 Identities = 123/150 (82%) Strand = Plus / Minus Query: 377 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 436 |||||||||||||||||||| ||| ||||| | || ||||| | |||||| |||||||| Sbjct: 282 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 223 Query: 437 gttgtccctcgcggcgttcccggccaactccaggacctcagcggcgagatactccagcac 496 |||||| | || ||||| || |||| |||||||| ||| || | || ||||||||||| Sbjct: 222 gttgtcgcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcac 163 Query: 497 ggcggcgaggtagacgggagcgccggcgcc 526 ||| || ||||| || || ||||||||||| Sbjct: 162 ggccgccaggtacaccggggcgccggcgcc 133
>gb|U62669.1|MMU62669 Mus musculus histone H3.2-F (H3-F), histone H2a.1-F (H2a-F), histone H2b-F (H2b-F) genes, complete cds Length = 2822 Score = 83.8 bits (42), Expect = 7e-13 Identities = 123/150 (82%) Strand = Plus / Plus Query: 377 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 436 |||||||||||||||||||| ||| ||||| | || ||||| | |||||| |||||||| Sbjct: 1547 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 1606 Query: 437 gttgtccctcgcggcgttcccggccaactccaggacctcagcggcgagatactccagcac 496 |||||| | || ||||| || |||| |||||||| ||| || | || ||||||||||| Sbjct: 1607 gttgtcgcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcac 1666 Query: 497 ggcggcgaggtagacgggagcgccggcgcc 526 ||| || ||||| || || ||||||||||| Sbjct: 1667 ggccgccaggtacaccggggcgccggcgcc 1696
>dbj|AK028026.1| Mus musculus 18-day embryo whole body cDNA, RIKEN full-length enriched library, clone:1190022L06 product:HISTONE H2A homolog [Homo sapiens], full insert sequence Length = 705 Score = 83.8 bits (42), Expect = 7e-13 Identities = 123/150 (82%) Strand = Plus / Minus Query: 377 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 436 |||||||||||||||||||| ||| ||||| | || ||||| | |||||| |||||||| Sbjct: 395 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 336 Query: 437 gttgtccctcgcggcgttcccggccaactccaggacctcagcggcgagatactccagcac 496 |||||| | || ||||| || |||| |||||||| ||| || | || ||||||||||| Sbjct: 335 gttgtcgcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcac 276 Query: 497 ggcggcgaggtagacgggagcgccggcgcc 526 ||| || ||||| || || ||||||||||| Sbjct: 275 ggccgccaggtacaccggggcgccggcgcc 246
>gb|BC093343.1| Danio rerio MID1 interacting protein 1, mRNA (cDNA clone MGC:112497 IMAGE:7411962), complete cds Length = 1726 Score = 83.8 bits (42), Expect = 7e-13 Identities = 84/98 (85%) Strand = Plus / Minus Query: 426 cgggtcttcttgttgtccctcgcggcgttcccggccaactccaggacctcagcggcgaga 485 ||||||||||||||||||| |||||||| || || |||||||||| |||||||| ||| Sbjct: 271 cgggtcttcttgttgtcccgagcggcgtttccagctaactccaggatctcagcggtcaga 212 Query: 486 tactccagcacggcggcgaggtagacgggagcgccggc 523 ||||| ||||||||||| | ||| || ||||| ||||| Sbjct: 211 tactcgagcacggcggccaagtacactggagcaccggc 174
>ref|NM_178184.1| Mus musculus histone 1, H2an (Hist1h2an), mRNA Length = 393 Score = 83.8 bits (42), Expect = 7e-13 Identities = 123/150 (82%) Strand = Plus / Minus Query: 377 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 436 |||||||||||||||||||| ||| ||||| | || ||||| | |||||| |||||||| Sbjct: 282 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 223 Query: 437 gttgtccctcgcggcgttcccggccaactccaggacctcagcggcgagatactccagcac 496 |||||| | || ||||| || |||| |||||||| ||| || | || ||||||||||| Sbjct: 222 gttgtcgcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcac 163 Query: 497 ggcggcgaggtagacgggagcgccggcgcc 526 ||| || ||||| || || ||||||||||| Sbjct: 162 ggccgccaggtacaccggggcgccggcgcc 133
>ref|NM_178182.1| Mus musculus histone 1, H2ai (Hist1h2ai), mRNA Length = 393 Score = 83.8 bits (42), Expect = 7e-13 Identities = 123/150 (82%) Strand = Plus / Minus Query: 377 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 436 |||||||||||||||||||| ||| ||||| | || ||||| | |||||| |||||||| Sbjct: 282 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 223 Query: 437 gttgtccctcgcggcgttcccggccaactccaggacctcagcggcgagatactccagcac 496 |||||| | || ||||| || |||| |||||||| ||| || | || ||||||||||| Sbjct: 222 gttgtcgcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcac 163 Query: 497 ggcggcgaggtagacgggagcgccggcgcc 526 ||| || ||||| || || ||||||||||| Sbjct: 162 ggccgccaggtacaccggggcgccggcgcc 133
>gb|AY158920.1| Mus musculus histone protein Hist1h2ab gene, complete cds Length = 1390 Score = 83.8 bits (42), Expect = 7e-13 Identities = 123/150 (82%) Strand = Plus / Minus Query: 377 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 436 |||||||||||||||||||| ||| ||||| | || ||||| | |||||| |||||||| Sbjct: 782 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 723 Query: 437 gttgtccctcgcggcgttcccggccaactccaggacctcagcggcgagatactccagcac 496 |||||| | || ||||| || |||| |||||||| ||| || | || ||||||||||| Sbjct: 722 gttgtcgcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcac 663 Query: 497 ggcggcgaggtagacgggagcgccggcgcc 526 ||| || ||||| || || ||||||||||| Sbjct: 662 ggccgccaggtacaccggggcgccggcgcc 633
>gb|AY158918.1| Mus musculus histone protein Hist1h2ad gene, complete cds Length = 1390 Score = 83.8 bits (42), Expect = 7e-13 Identities = 123/150 (82%) Strand = Plus / Minus Query: 377 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 436 |||||||||||||||||||| ||| ||||| | || ||||| | |||||| |||||||| Sbjct: 782 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 723 Query: 437 gttgtccctcgcggcgttcccggccaactccaggacctcagcggcgagatactccagcac 496 |||||| | || ||||| || |||| |||||||| ||| || | || ||||||||||| Sbjct: 722 gttgtcgcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcac 663 Query: 497 ggcggcgaggtagacgggagcgccggcgcc 526 ||| || ||||| || || ||||||||||| Sbjct: 662 ggccgccaggtacaccggggcgccggcgcc 633
>gb|AY158917.1| Mus musculus histone protein Hist1h2ae gene, complete cds Length = 1390 Score = 83.8 bits (42), Expect = 7e-13 Identities = 123/150 (82%) Strand = Plus / Minus Query: 377 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 436 |||||||||||||||||||| ||| ||||| | || ||||| | |||||| |||||||| Sbjct: 782 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 723 Query: 437 gttgtccctcgcggcgttcccggccaactccaggacctcagcggcgagatactccagcac 496 |||||| | || ||||| || |||| |||||||| ||| || | || ||||||||||| Sbjct: 722 gttgtcgcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcac 663 Query: 497 ggcggcgaggtagacgggagcgccggcgcc 526 ||| || ||||| || || ||||||||||| Sbjct: 662 ggccgccaggtacaccggggcgccggcgcc 633
>gb|AY158916.1| Mus musculus histone protein Hist1h2af gene, complete cds Length = 1390 Score = 83.8 bits (42), Expect = 7e-13 Identities = 123/150 (82%) Strand = Plus / Minus Query: 377 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 436 |||||||||||||||||||| ||| ||||| | || ||||| | |||||| |||||||| Sbjct: 806 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 747 Query: 437 gttgtccctcgcggcgttcccggccaactccaggacctcagcggcgagatactccagcac 496 |||||| | || ||||| || |||| |||||||| ||| || | || ||||||||||| Sbjct: 746 gttgtcgcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcac 687 Query: 497 ggcggcgaggtagacgggagcgccggcgcc 526 ||| || ||||| || || ||||||||||| Sbjct: 686 ggccgccaggtacaccggggcgccggcgcc 657
>gb|AY158914.1| Mus musculus histone protein Hist1h2ah gene, complete cds Length = 1381 Score = 83.8 bits (42), Expect = 7e-13 Identities = 123/150 (82%) Strand = Plus / Minus Query: 377 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 436 |||||||||||||||||||| ||| ||||| | || ||||| | |||||| |||||||| Sbjct: 779 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 720 Query: 437 gttgtccctcgcggcgttcccggccaactccaggacctcagcggcgagatactccagcac 496 |||||| | || ||||| || |||| |||||||| ||| || | || ||||||||||| Sbjct: 719 gttgtcgcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcac 660 Query: 497 ggcggcgaggtagacgggagcgccggcgcc 526 ||| || ||||| || || ||||||||||| Sbjct: 659 ggccgccaggtacaccggggcgccggcgcc 630
>gb|AY158912.1| Mus musculus histone protein Hist1h2an gene, complete cds Length = 1390 Score = 83.8 bits (42), Expect = 7e-13 Identities = 123/150 (82%) Strand = Plus / Minus Query: 377 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 436 |||||||||||||||||||| ||| ||||| | || ||||| | |||||| |||||||| Sbjct: 782 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 723 Query: 437 gttgtccctcgcggcgttcccggccaactccaggacctcagcggcgagatactccagcac 496 |||||| | || ||||| || |||| |||||||| ||| || | || ||||||||||| Sbjct: 722 gttgtcgcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcac 663 Query: 497 ggcggcgaggtagacgggagcgccggcgcc 526 ||| || ||||| || || ||||||||||| Sbjct: 662 ggccgccaggtacaccggggcgccggcgcc 633
>gb|AY158910.1| Mus musculus histone protein Hist1h2aj pseudogene, partial sequence Length = 1357 Score = 83.8 bits (42), Expect = 7e-13 Identities = 123/150 (82%) Strand = Plus / Minus Query: 377 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 436 |||||||||||||||||||| ||| ||||| | || ||||| | |||||| |||||||| Sbjct: 764 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 705 Query: 437 gttgtccctcgcggcgttcccggccaactccaggacctcagcggcgagatactccagcac 496 |||||| | || ||||| || |||| |||||||| ||| || | || ||||||||||| Sbjct: 704 gttgtcgcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcac 645 Query: 497 ggcggcgaggtagacgggagcgccggcgcc 526 ||| || ||||| || || ||||||||||| Sbjct: 644 ggccgccaggtacaccggggcgccggcgcc 615
>gb|AY158909.1| Mus musculus histone protein Hist1h2ai gene, complete cds Length = 1387 Score = 83.8 bits (42), Expect = 7e-13 Identities = 123/150 (82%) Strand = Plus / Minus Query: 377 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 436 |||||||||||||||||||| ||| ||||| | || ||||| | |||||| |||||||| Sbjct: 779 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 720 Query: 437 gttgtccctcgcggcgttcccggccaactccaggacctcagcggcgagatactccagcac 496 |||||| | || ||||| || |||| |||||||| ||| || | || ||||||||||| Sbjct: 719 gttgtcgcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcac 660 Query: 497 ggcggcgaggtagacgggagcgccggcgcc 526 ||| || ||||| || || ||||||||||| Sbjct: 659 ggccgccaggtacaccggggcgccggcgcc 630
>ref|NM_175661.1| Mus musculus histone 1, H2af (Hist1h2af), mRNA Length = 393 Score = 83.8 bits (42), Expect = 7e-13 Identities = 123/150 (82%) Strand = Plus / Minus Query: 377 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 436 |||||||||||||||||||| ||| ||||| | || ||||| | |||||| |||||||| Sbjct: 282 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 223 Query: 437 gttgtccctcgcggcgttcccggccaactccaggacctcagcggcgagatactccagcac 496 |||||| | || ||||| || |||| |||||||| ||| || | || ||||||||||| Sbjct: 222 gttgtcgcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcac 163 Query: 497 ggcggcgaggtagacgggagcgccggcgcc 526 ||| || ||||| || || ||||||||||| Sbjct: 162 ggccgccaggtacaccggggcgccggcgcc 133
>ref|NM_175659.1| Mus musculus histone 1, H2ah (Hist1h2ah), mRNA Length = 387 Score = 83.8 bits (42), Expect = 7e-13 Identities = 123/150 (82%) Strand = Plus / Minus Query: 377 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 436 |||||||||||||||||||| ||| ||||| | || ||||| | |||||| |||||||| Sbjct: 282 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 223 Query: 437 gttgtccctcgcggcgttcccggccaactccaggacctcagcggcgagatactccagcac 496 |||||| | || ||||| || |||| |||||||| ||| || | || ||||||||||| Sbjct: 222 gttgtcgcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcac 163 Query: 497 ggcggcgaggtagacgggagcgccggcgcc 526 ||| || ||||| || || ||||||||||| Sbjct: 162 ggccgccaggtacaccggggcgccggcgcc 133
>gb|BC024397.1| Mus musculus H2A histone family, member J, mRNA (cDNA clone MGC:36202 IMAGE:5055276), complete cds Length = 550 Score = 83.8 bits (42), Expect = 7e-13 Identities = 114/138 (82%) Strand = Plus / Minus Query: 377 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 436 |||||||||||||||||||| ||| ||||| | || || || | |||||| |||||||| Sbjct: 334 gagctcctcgtcgttgcggatggccagctgcaggtggcgagggatgatgcgcgtcttctt 275 Query: 437 gttgtccctcgcggcgttcccggccaactccaggacctcagcggcgagatactccagcac 496 |||||||||||| ||||| || |||| |||||||| ||| || | || ||||||||||| Sbjct: 274 gttgtccctcgccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcac 215 Query: 497 ggcggcgaggtagacggg 514 || || ||||| ||||| Sbjct: 214 cgccgccaggtacacggg 197
>gb|J00980.1|XELHIS2AL xenopus laevis h2a histone gene & flanks Length = 748 Score = 83.8 bits (42), Expect = 7e-13 Identities = 105/126 (83%) Strand = Plus / Minus Query: 422 gatgcgggtcttcttgttgtccctcgcggcgttcccggccaactccaggacctcagcggc 481 |||||||||||| ||||| |||| || ||||| ||||||||||||| || |||||||| Sbjct: 392 gatgcgggtctttttgttatcccgagcagcgttgccggccaactccaagatctcagcggt 333 Query: 482 gagatactccagcacggcggcgaggtagacgggagcgccggcgccaaccctctcggcgta 541 |||||||| ||||| ||||| || ||||| ||||| ||||| || |||| |||||| || Sbjct: 332 cagatactcgagcactgcggccagatagaccggagctccggctcccacccgctcggcata 273 Query: 542 cttgcc 547 ||||| Sbjct: 272 attgcc 267
>gb|M37736.1|MUSHIS2AR Mouse replication-dependent histone H2A.1 gene Length = 668 Score = 83.8 bits (42), Expect = 7e-13 Identities = 123/150 (82%) Strand = Plus / Minus Query: 377 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 436 |||||||||||||||||||| ||| ||||| | || ||||| | |||||| |||||||| Sbjct: 405 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 346 Query: 437 gttgtccctcgcggcgttcccggccaactccaggacctcagcggcgagatactccagcac 496 |||||| | || ||||| || |||| |||||||| ||| || | || ||||||||||| Sbjct: 345 gttgtcgcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcac 286 Query: 497 ggcggcgaggtagacgggagcgccggcgcc 526 ||| || ||||| || || ||||||||||| Sbjct: 285 ggccgccaggtacaccggggcgccggcgcc 256
>gb|AY389592.1| Hyacinthus orientalis histone H2A mRNA, complete cds Length = 635 Score = 81.8 bits (41), Expect = 3e-12 Identities = 80/93 (86%) Strand = Plus / Minus Query: 430 tcttcttgttgtccctcgcggcgttcccggccaactccaggacctcagcggcgagatact 489 ||||||||||||| ||||| ||||| ||||||||||||| ||||| ||||| || |||| Sbjct: 268 tcttcttgttgtctctcgccgcgtttccggccaactccaatacctctgcggctaggtact 209 Query: 490 ccagcacggcggcgaggtagacgggagcgccgg 522 | || |||||||| |||||||| ||||| |||| Sbjct: 208 cgaggacggcggcaaggtagaccggagctccgg 176
>ref|XM_610233.2| PREDICTED: Bos taurus similar to Histone H2AFX (Histone H2A.X) (H2a/x) (LOC531733), mRNA Length = 1724 Score = 81.8 bits (41), Expect = 3e-12 Identities = 134/165 (81%) Strand = Plus / Minus Query: 377 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 436 |||||||||||||||||||| ||| ||||| | || || || | || || |||||||| Sbjct: 771 gagctcctcgtcgttgcggatggccagctgcaggtggcgggggattatccgcgtcttctt 712 Query: 437 gttgtccctcgcggcgttcccggccaactccaggacctcagcggcgagatactccagcac 496 |||||| | || || || || |||| |||||||| |||||||| ||| ||||| || || Sbjct: 711 gttgtcgcgggccgcattgcccgccagctccaggatctcagcggtgaggtactcgagtac 652 Query: 497 ggcggcgaggtagacgggagcgccggcgccaaccctctcggcgta 541 || || |||||||| || ||||||||||| |||||||||||||| Sbjct: 651 cgccgccaggtagaccggcgcgccggcgcccaccctctcggcgta 607
>ref|XM_865976.1| PREDICTED: Bos taurus similar to Histone H2A.g (H2A/g) (H2A.3) (LOC614970), mRNA Length = 447 Score = 81.8 bits (41), Expect = 3e-12 Identities = 131/161 (81%) Strand = Plus / Minus Query: 377 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 436 |||||||||||||||||||| ||| ||||| | ||| ||||| | ||||||||||||||| Sbjct: 282 gagctcctcgtcgttgcggatggccagctgcagatgacgcgggatgatgcgggtcttctt 223 Query: 437 gttgtccctcgcggcgttcccggccaactccaggacctcagcggcgagatactccagcac 496 |||||||| || ||||| || |||| ||| | || ||| || | || ||||||||||| Sbjct: 222 gttgtcccgggctgcgttgcccgccagctctaagatctcggctgtcaggtactccagcac 163 Query: 497 ggcggcgaggtagacgggagcgccggcgccaaccctctcgg 537 || || ||||| || || || ||||| ||||||| ||||| Sbjct: 162 cgccgccaggtacaccggggccccggccccaacccgctcgg 122
>emb|Z73102.1|CEB0035 Caenorhabditis elegans Cosmid B0035, complete sequence Length = 39483 Score = 81.8 bits (41), Expect = 3e-12 Identities = 125/153 (81%) Strand = Plus / Plus Query: 377 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 436 ||||||||||||||||||||| || || || | ||||| || |||| ||||||||||| Sbjct: 29866 gagctcctcgtcgttgcggacagcgagttgaagatgtcttggggcgatacgggtcttctt 29925 Query: 437 gttgtccctcgcggcgttcccggccaactccaggacctcagcggcgagatactccagcac 496 |||||| | || ||||| ||||||||||| || |||||||| |||||||| || || || Sbjct: 29926 gttgtcacgggcagcgttaccggccaactcgagaacctcagcagcgagatattcaagaac 29985 Query: 497 ggcggcgaggtagacgggagcgccggcgccaac 529 ||||| | |||||| || || ||||| ||||| Sbjct: 29986 agcggccaagtagactggggctccggctccaac 30018
>emb|Z82271.1|CEF54E12 Caenorhabditis elegans Cosmid F54E12, complete sequence Length = 13877 Score = 81.8 bits (41), Expect = 3e-12 Identities = 125/153 (81%) Strand = Plus / Minus Query: 377 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 436 ||||||||||||||||||||| || || || | ||||| || |||| ||||||||||| Sbjct: 7038 gagctcctcgtcgttgcggacagcgagttgaagatgtcttggggcgatacgggtcttctt 6979 Query: 437 gttgtccctcgcggcgttcccggccaactccaggacctcagcggcgagatactccagcac 496 |||||| | || ||||| ||||||||||| || |||||||| |||||||| || || || Sbjct: 6978 gttgtcacgggcagcgttaccggccaactcgagaacctcagcagcgagatattcaagaac 6919 Query: 497 ggcggcgaggtagacgggagcgccggcgccaac 529 ||||| | |||||| || || ||||| ||||| Sbjct: 6918 agcggccaagtagactggggctccggctccaac 6886
>ref|XM_848163.1| PREDICTED: Canis familiaris similar to Histone H2A.x (H2a/x) (LOC489372), mRNA Length = 841 Score = 81.8 bits (41), Expect = 3e-12 Identities = 134/165 (81%) Strand = Plus / Minus Query: 377 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 436 |||||||||||||||||||| ||| ||||| | || || || | |||||| |||||||| Sbjct: 579 gagctcctcgtcgttgcggatggccagctgcaggtggcgggggatgatgcgcgtcttctt 520 Query: 437 gttgtccctcgcggcgttcccggccaactccaggacctcagcggcgagatactccagcac 496 |||||| | || ||||| || |||| |||||||| ||| || | || ||||| ||||| Sbjct: 519 gttgtcgcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactcgagcac 460 Query: 497 ggcggcgaggtagacgggagcgccggcgccaaccctctcggcgta 541 ||| || ||||| || || ||||||||||| |||| ||||||||| Sbjct: 459 ggccgccaggtacaccggcgcgccggcgcccacccgctcggcgta 415
>emb|CR457079.1| Homo sapiens full open reading frame cDNA clone RZPDo834A117D for gene H2AFX, H2A histone family, member X; complete cds, incl. stopcodon Length = 432 Score = 81.8 bits (41), Expect = 3e-12 Identities = 134/165 (81%) Strand = Plus / Minus Query: 377 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 436 |||||||||||||||||||| ||| ||||| | || || || | ||| | |||||||| Sbjct: 282 gagctcctcgtcgttgcggatggccagctgcaggtggcgggggatgattagcgtcttctt 223 Query: 437 gttgtccctcgcggcgttcccggccaactccaggacctcagcggcgagatactccagcac 496 |||||| | || || || || |||| |||||||| |||||||| ||| ||||||||||| Sbjct: 222 gttgtcgcgggccgcattgcccgccagctccaggatctcagcggtgaggtactccagcac 163 Query: 497 ggcggcgaggtagacgggagcgccggcgccaaccctctcggcgta 541 || || ||||| || || |||||||||||||| | ||||||||| Sbjct: 162 tgccgccaggtacactggcgcgccggcgccaacgcgctcggcgta 118
>ref|NM_069749.1| Caenorhabditis elegans HIStone family member (his-65) (his-65) mRNA, complete cds Length = 384 Score = 81.8 bits (41), Expect = 3e-12 Identities = 125/153 (81%) Strand = Plus / Minus Query: 377 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 436 ||||||||||||||||||||| || || || | ||||| || |||| ||||||||||| Sbjct: 285 gagctcctcgtcgttgcggacagcgagttgaagatgtcttggggcgatacgggtcttctt 226 Query: 437 gttgtccctcgcggcgttcccggccaactccaggacctcagcggcgagatactccagcac 496 |||||| | || ||||| ||||||||||| || |||||||| |||||||| || || || Sbjct: 225 gttgtcacgggcagcgttaccggccaactcgagaacctcagcagcgagatattcaagaac 166 Query: 497 ggcggcgaggtagacgggagcgccggcgccaac 529 ||||| | |||||| || || ||||| ||||| Sbjct: 165 agcggccaagtagactggggctccggctccaac 133
>ref|NM_069740.1| Caenorhabditis elegans HIStone family member (his-57) (his-57) mRNA, complete cds Length = 384 Score = 81.8 bits (41), Expect = 3e-12 Identities = 125/153 (81%) Strand = Plus / Minus Query: 377 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 436 ||||||||||||||||||||| || || || | ||||| || |||| ||||||||||| Sbjct: 285 gagctcctcgtcgttgcggacagcgagttgaagatgtcttggggcgatacgggtcttctt 226 Query: 437 gttgtccctcgcggcgttcccggccaactccaggacctcagcggcgagatactccagcac 496 |||||| | || ||||| ||||||||||| || |||||||| |||||||| || || || Sbjct: 225 gttgtcacgggcagcgttaccggccaactcgagaacctcagcagcgagatattcaagaac 166 Query: 497 ggcggcgaggtagacgggagcgccggcgccaac 529 ||||| | |||||| || || ||||| ||||| Sbjct: 165 agcggccaagtagactggggctccggctccaac 133
>ref|NM_069730.1| Caenorhabditis elegans HIStone family member (his-47) (his-47) mRNA, complete cds Length = 384 Score = 81.8 bits (41), Expect = 3e-12 Identities = 125/153 (81%) Strand = Plus / Minus Query: 377 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 436 ||||||||||||||||||||| || || || | ||||| || |||| ||||||||||| Sbjct: 285 gagctcctcgtcgttgcggacagcgagttgaagatgtcttggggcgatacgggtcttctt 226 Query: 437 gttgtccctcgcggcgttcccggccaactccaggacctcagcggcgagatactccagcac 496 |||||| | || ||||| ||||||||||| || |||||||| |||||||| || || || Sbjct: 225 gttgtcacgggcagcgttaccggccaactcgagaacctcagcagcgagatattcaagaac 166 Query: 497 ggcggcgaggtagacgggagcgccggcgccaac 529 ||||| | |||||| || || ||||| ||||| Sbjct: 165 agcggccaagtagactggggctccggctccaac 133
>emb|Z92789.1|CEH02I12 Caenorhabditis elegans Fosmid H02I12, complete sequence Length = 34087 Score = 81.8 bits (41), Expect = 3e-12 Identities = 125/153 (81%) Strand = Plus / Minus Query: 377 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 436 ||||||||||||||||||||| || || || | ||||| || |||| ||||||||||| Sbjct: 30075 gagctcctcgtcgttgcggacagcgagttgaagatgtcttggggcgatacgggtcttctt 30016 Query: 437 gttgtccctcgcggcgttcccggccaactccaggacctcagcggcgagatactccagcac 496 |||||| | || ||||| ||||||||||| || |||||||| |||||||| || || || Sbjct: 30015 gttgtcacgggcagcgttaccggccaactcgagaacctcagcagcgagatattcaagaac 29956 Query: 497 ggcggcgaggtagacgggagcgccggcgccaac 529 ||||| | |||||| || || ||||| ||||| Sbjct: 29955 agcggccaagtagactggggctccggctccaac 29923
>ref|XM_865148.1| PREDICTED: Bos taurus similar to Histone H2A.1 (LOC613926), mRNA Length = 393 Score = 79.8 bits (40), Expect = 1e-11 Identities = 105/124 (84%), Gaps = 2/124 (1%) Strand = Plus / Minus Query: 377 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 436 |||||||||||||||||||| ||| ||||| | || ||||| | ||||||||||||||| Sbjct: 282 gagctcctcgtcgttgcggatggccagctgcaagtgacgcgggatgatgcgggtcttctt 223 Query: 437 gttgtccctcgcggcgttcccggccaactccaggacctcag-cggcgagatactccagca 495 |||||||| || ||||| || |||| |||||||| ||| | |||| || |||||||||| Sbjct: 222 gttgtcccgggccgcgttgcccgccagctccaggatctcggccggcaag-tactccagca 164 Query: 496 cggc 499 |||| Sbjct: 163 cggc 160
>gb|BC050952.1| Danio rerio, clone IMAGE:5612116, mRNA Length = 1377 Score = 79.8 bits (40), Expect = 1e-11 Identities = 67/76 (88%) Strand = Plus / Minus Query: 427 gggtcttcttgttgtccctcgcggcgttcccggccaactccaggacctcagcggcgagat 486 |||||||||||||||||| |||||||| || ||||||||||||| |||||||| |||| Sbjct: 267 gggtcttcttgttgtcccgagcggcgtttccagccaactccaggatctcagcggtcagat 208 Query: 487 actccagcacggcggc 502 |||| ||||| ||||| Sbjct: 207 actcgagcacagcggc 192
>gb|BC060324.1| Homo sapiens histone 2, H2ac, mRNA (cDNA clone MGC:74460 IMAGE:3892650), complete cds Length = 446 Score = 77.8 bits (39), Expect = 4e-11 Identities = 135/167 (80%) Strand = Plus / Minus Query: 381 tcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttcttgttg 440 |||||||||||||||| ||| ||||||| || || || | |||||| |||||||||||| Sbjct: 313 tcctcgtcgttgcggatggccagctggaggtgacgagggatgatgcgcgtcttcttgttg 254 Query: 441 tccctcgcggcgttcccggccaactccaggacctcagcggcgagatactccagcacggcg 500 |||| || ||||| || |||| |||||||| ||| |||| || ||||| || || || Sbjct: 253 tcccgagccgcgttgcccgccagctccaggatctcggcggtcaggtactcgaggaccgcc 194 Query: 501 gcgaggtagacgggagcgccggcgccaaccctctcggcgtacttgcc 547 || | ||||||||| |||||||| || |||| ||| ||||| ||||| Sbjct: 193 gccatgtagacgggcgcgccggcccccacccgctccgcgtagttgcc 147
>gb|DQ214188.1| Taeniopygia guttata clone 0058P0024E05 histone 1 H2ai-like mRNA, complete sequence Length = 786 Score = 77.8 bits (39), Expect = 4e-11 Identities = 138/171 (80%) Strand = Plus / Minus Query: 377 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 436 |||||||||||||||||||| ||| ||||| | || || || | |||||| |||||||| Sbjct: 365 gagctcctcgtcgttgcggatggcgagctgcaggtggcgggggatgatgcgcgtcttctt 306 Query: 437 gttgtccctcgcggcgttcccggccaactccaggacctcagcggcgagatactccagcac 496 |||||| | || ||||| || |||| |||||||| ||| || | || ||||||||||| Sbjct: 305 gttgtcgcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcac 246 Query: 497 ggcggcgaggtagacgggagcgccggcgccaaccctctcggcgtacttgcc 547 ||| || ||||| || || ||||||||||| || | ||| ||||| ||||| Sbjct: 245 ggccgccaggtacaccggcgcgccggcgcccacgcgctccgcgtagttgcc 195
>gb|DQ214187.1| Taeniopygia guttata clone 0058P0044E04 histone 1 H2ai-like mRNA, complete sequence Length = 786 Score = 77.8 bits (39), Expect = 4e-11 Identities = 138/171 (80%) Strand = Plus / Minus Query: 377 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 436 |||||||||||||||||||| ||| ||||| | || || || | |||||| |||||||| Sbjct: 365 gagctcctcgtcgttgcggatggcgagctgcaggtggcgggggatgatgcgcgtcttctt 306 Query: 437 gttgtccctcgcggcgttcccggccaactccaggacctcagcggcgagatactccagcac 496 |||||| | || ||||| || |||| |||||||| ||| || | || ||||||||||| Sbjct: 305 gttgtcgcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcac 246 Query: 497 ggcggcgaggtagacgggagcgccggcgccaaccctctcggcgtacttgcc 547 ||| || ||||| || || ||||||||||| || | ||| ||||| ||||| Sbjct: 245 ggccgccaggtacaccggcgcgccggcgcccacgcgctccgcgtagttgcc 195
>ref|XM_527283.1| PREDICTED: Pan troglodytes similar to Hist2h2aa1 protein (LOC471905), mRNA Length = 555 Score = 77.8 bits (39), Expect = 4e-11 Identities = 120/147 (81%) Strand = Plus / Minus Query: 377 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 436 |||||||||||||||||||| ||| ||||| | || ||||| | |||||||||||||| Sbjct: 444 gagctcctcgtcgttgcggatggccagctgcaagtggcgcgggataatgcgggtcttctt 385 Query: 437 gttgtccctcgcggcgttcccggccaactccaggacctcagcggcgagatactccagcac 496 |||||| | |||||||| || |||| |||||||| ||| || | || ||||||||||| Sbjct: 384 gttgtcgcgggcggcgttgcccgccagctccaggatctcggcagtcaggtactccagcac 325 Query: 497 ggcggcgaggtagacgggagcgccggc 523 || || ||||| || || |||||||| Sbjct: 324 tgccgccaggtaaaccggcgcgccggc 298
>ref|XM_518300.1| PREDICTED: Pan troglodytes similar to Histone H2A.1 (LOC462507), mRNA Length = 846 Score = 77.8 bits (39), Expect = 4e-11 Identities = 138/171 (80%) Strand = Plus / Minus Query: 377 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 436 |||||||||||||||||||| ||| ||||| | || ||||| | ||||||||||||||| Sbjct: 228 gagctcctcgtcgttgcggatggccagctgcaagtggcgcgggatgatgcgggtcttctt 169 Query: 437 gttgtccctcgcggcgttcccggccaactccaggacctcagcggcgagatactccagcac 496 |||||| | || ||||| || |||| ||||||| ||| |||| || ||||||||||| Sbjct: 168 gttgtcgcgggccgcgttgccagccagttccaggatctcggcggttaggtactccagcac 109 Query: 497 ggcggcgaggtagacgggagcgccggcgccaaccctctcggcgtacttgcc 547 || || ||||| || || || ||||| || |||| ||| ||||| ||||| Sbjct: 108 cgccgccaggtacaccggcgctccggcaccgacccgctcagcgtagttgcc 58
>ref|XM_518286.1| PREDICTED: Pan troglodytes similar to Histone H2A.l (H2A/l) (LOC462490), mRNA Length = 565 Score = 77.8 bits (39), Expect = 4e-11 Identities = 138/171 (80%) Strand = Plus / Minus Query: 377 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 436 |||||||||||||||||||| ||| ||||| | || ||||| | |||||| |||||||| Sbjct: 324 gagctcctcgtcgttgcggatggccagctgcaagtggcgcgggatgatgcgagtcttctt 265 Query: 437 gttgtccctcgcggcgttcccggccaactccaggacctcagcggcgagatactccagcac 496 |||||| | || ||||| ||||||| |||||||| ||| |||| || ||||| | ||| Sbjct: 264 gttgtcgcgagccgcgttgccggccagctccaggatctcggcggtcaggtactctaacac 205 Query: 497 ggcggcgaggtagacgggagcgccggcgccaaccctctcggcgtacttgcc 547 || || ||||| || || ||||| || ||||||| ||| ||||| ||||| Sbjct: 204 cgccgccaggtacaccggcgcgcctgccccaacccgctctgcgtagttgcc 154
>ref|XM_513764.1| PREDICTED: Pan troglodytes LOC457261 (LOC457261), mRNA Length = 789 Score = 77.8 bits (39), Expect = 4e-11 Identities = 117/143 (81%) Strand = Plus / Minus Query: 381 tcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttcttgttg 440 |||||||||||||||| ||| ||||||| || || || | |||||| |||||||||||| Sbjct: 683 tcctcgtcgttgcggatggccagctggaggtgacgagggatgatgcgcgtcttcttgttg 624 Query: 441 tccctcgcggcgttcccggccaactccaggacctcagcggcgagatactccagcacggcg 500 |||| || ||||| || |||| |||||||| ||| |||| |||||||| || || || Sbjct: 623 tcccgagccgcgttgcccgccagctccaggatctcggcggtcagatactcgaggaccgca 564 Query: 501 gcgaggtagacgggagcgccggc 523 || | ||||||||| |||||||| Sbjct: 563 gccatgtagacgggcgcgccggc 541
>ref|NM_003517.2| Homo sapiens histone 2, H2ac (HIST2H2AC), mRNA Length = 437 Score = 77.8 bits (39), Expect = 4e-11 Identities = 135/167 (80%) Strand = Plus / Minus Query: 381 tcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttcttgttg 440 |||||||||||||||| ||| ||||||| || || || | |||||| |||||||||||| Sbjct: 278 tcctcgtcgttgcggatggccagctggaggtgacgagggatgatgcgcgtcttcttgttg 219 Query: 441 tccctcgcggcgttcccggccaactccaggacctcagcggcgagatactccagcacggcg 500 |||| || ||||| || |||| |||||||| ||| |||| || ||||| || || || Sbjct: 218 tcccgagccgcgttgcccgccagctccaggatctcggcggtcaggtactcgaggaccgcc 159 Query: 501 gcgaggtagacgggagcgccggcgccaaccctctcggcgtacttgcc 547 || | ||||||||| |||||||| || |||| ||| ||||| ||||| Sbjct: 158 gccatgtagacgggcgcgccggcccccacccgctccgcgtagttgcc 112
>gb|AY648852.1| Homo sapiens histone H2A/r gene, complete cds Length = 1119 Score = 77.8 bits (39), Expect = 4e-11 Identities = 135/167 (80%) Strand = Plus / Minus Query: 381 tcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttcttgttg 440 |||||||||||||||| ||| ||||||| || || || | |||||| |||||||||||| Sbjct: 651 tcctcgtcgttgcggatggccagctggaggtgacgagggatgatgcgcgtcttcttgttg 592 Query: 441 tccctcgcggcgttcccggccaactccaggacctcagcggcgagatactccagcacggcg 500 |||| || ||||| || |||| |||||||| ||| |||| || ||||| || || || Sbjct: 591 tcccgagccgcgttgcccgccagctccaggatctcggcggtcaggtactcgaggaccgcc 532 Query: 501 gcgaggtagacgggagcgccggcgccaaccctctcggcgtacttgcc 547 || | ||||||||| |||||||| || |||| ||| ||||| ||||| Sbjct: 531 gccatgtagacgggcgcgccggcccccacccgctccgcgtagttgcc 485
>gb|BC019308.1| Homo sapiens histone 2, H2aa, mRNA (cDNA clone MGC:4205 IMAGE:2823572), complete cds Length = 567 Score = 77.8 bits (39), Expect = 4e-11 Identities = 117/143 (81%) Strand = Plus / Minus Query: 381 tcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttcttgttg 440 |||||||||||||||| ||| ||||||| || || || | |||||| |||||||||||| Sbjct: 316 tcctcgtcgttgcggatggccagctggaggtgacgagggatgatgcgcgtcttcttgttg 257 Query: 441 tccctcgcggcgttcccggccaactccaggacctcagcggcgagatactccagcacggcg 500 |||| || ||||| || |||| |||||||| ||| |||| |||||||| || || || Sbjct: 256 tcccgagccgcgttgcccgccagctccaggatctcggcggtcagatactcgaggaccgca 197 Query: 501 gcgaggtagacgggagcgccggc 523 || | ||||||||| |||||||| Sbjct: 196 gccatgtagacgggcgcgccggc 174
>gb|BC001629.1| Homo sapiens histone 2, H2aa, mRNA (cDNA clone MGC:2238 IMAGE:3536984), complete cds Length = 567 Score = 77.8 bits (39), Expect = 4e-11 Identities = 117/143 (81%) Strand = Plus / Minus Query: 381 tcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttcttgttg 440 |||||||||||||||| ||| ||||||| || || || | |||||| |||||||||||| Sbjct: 316 tcctcgtcgttgcggatggccagctggaggtgacgagggatgatgcgcgtcttcttgttg 257 Query: 441 tccctcgcggcgttcccggccaactccaggacctcagcggcgagatactccagcacggcg 500 |||| || ||||| || |||| |||||||| ||| |||| |||||||| || || || Sbjct: 256 tcccgagccgcgttgcccgccagctccaggatctcggcggtcagatactcgaggaccgca 197 Query: 501 gcgaggtagacgggagcgccggc 523 || | ||||||||| |||||||| Sbjct: 196 gccatgtagacgggcgcgccggc 174
>gb|BC069306.1| Homo sapiens histone 1, H2al, mRNA (cDNA clone MGC:97481 IMAGE:7262757), complete cds Length = 469 Score = 77.8 bits (39), Expect = 4e-11 Identities = 120/147 (81%) Strand = Plus / Minus Query: 377 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 436 |||||||||||||||||||| ||| ||||| | || ||||| | |||||||||||||| Sbjct: 308 gagctcctcgtcgttgcggatggccagctgcaagtggcgcgggataatgcgggtcttctt 249 Query: 437 gttgtccctcgcggcgttcccggccaactccaggacctcagcggcgagatactccagcac 496 |||||| | |||||||| || |||| |||||||| ||| || | || ||||||||||| Sbjct: 248 gttgtcgcgggcggcgttgcccgccagctccaggatctcggcagtcaggtactccagcac 189 Query: 497 ggcggcgaggtagacgggagcgccggc 523 || || ||||| || || |||||||| Sbjct: 188 cgccgccaggtacaccggcgcgccggc 162
>gb|BC031333.1| Homo sapiens histone 1, H3d, mRNA (cDNA clone MGC:45668 IMAGE:3608479), complete cds Length = 890 Score = 77.8 bits (39), Expect = 4e-11 Identities = 87/103 (84%) Strand = Plus / Minus Query: 378 agctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttcttg 437 ||||||||||||||||||| ||| ||||| | ||||| || | |||||||||||||||| Sbjct: 250 agctcctcgtcgttgcggatggccagctgcaagtgtcgggggatgatgcgggtcttcttg 191 Query: 438 ttgtccctcgcggcgttcccggccaactccaggacctcagcgg 480 ||||| | |||||||| || |||| |||||||| ||| |||| Sbjct: 190 ttgtcgcgggcggcgttgcccgccagctccaggatctcggcgg 148
>ref|NG_001335.1| Homo sapiens genomic large histone family cluster (HFL@) on chromosome 6 Length = 269712 Score = 77.8 bits (39), Expect = 4e-11 Identities = 87/103 (84%) Strand = Plus / Plus Query: 378 agctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttcttg 437 ||||||||||||||||||| ||| ||||| | ||||| || | |||||||||||||||| Sbjct: 182963 agctcctcgtcgttgcggatggccagctgcaggtgtcgggggatgatgcgggtcttcttg 183022 Query: 438 ttgtccctcgcggcgttcccggccaactccaggacctcagcgg 480 ||||| | |||||||| || |||| |||||||| ||| |||| Sbjct: 183023 ttgtcgcgggcggcgttgcccgccagctccaggatctcggcgg 183065 Score = 77.8 bits (39), Expect = 4e-11 Identities = 138/171 (80%) Strand = Plus / Minus Query: 377 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 436 |||||||||||||||||||| ||| ||||| | || ||||| | |||||| |||||||| Sbjct: 108456 gagctcctcgtcgttgcggatggccagctgcaagtggcgcgggatgatgcgagtcttctt 108397 Query: 437 gttgtccctcgcggcgttcccggccaactccaggacctcagcggcgagatactccagcac 496 |||||| | || ||||| ||||||| |||||||| ||| |||| || ||||| | ||| Sbjct: 108396 gttgtcgcgagccgcgttgccggccagctccaggatctcggcggtcaggtactctaacac 108337 Query: 497 ggcggcgaggtagacgggagcgccggcgccaaccctctcggcgtacttgcc 547 || || ||||| || || ||||| || ||||||| ||| ||||| ||||| Sbjct: 108336 cgccgccaggtacaccggcgcgcctgccccaacccgctctgcgtagttgcc 108286 Score = 58.0 bits (29), Expect = 4e-05 Identities = 56/65 (86%) Strand = Plus / Minus Query: 378 agctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttcttg 437 ||||||||||||||||||| ||| ||||| | || ||||| | ||||||||||||||| Sbjct: 201255 agctcctcgtcgttgcggatggctagctgcaggtggcgcgggatgatgcgggtcttctta 201196 Query: 438 ttgtc 442 ||||| Sbjct: 201195 ttgtc 201191 Score = 42.1 bits (21), Expect = 2.3 Identities = 54/65 (83%) Strand = Plus / Plus Query: 378 agctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttcttg 437 ||||||||||| ||||||| ||| | || | || ||||| | |||||||||||||||| Sbjct: 17230 agctcctcgtcattgcggatggccaattgcaggtggcgcgggatgatgcgggtcttcttg 17289 Query: 438 ttgtc 442 ||||| Sbjct: 17290 ttgtc 17294
>ref|NM_003530.3| Homo sapiens histone 1, H3d (HIST1H3D), mRNA Length = 864 Score = 77.8 bits (39), Expect = 4e-11 Identities = 87/103 (84%) Strand = Plus / Minus Query: 378 agctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttcttg 437 ||||||||||||||||||| ||| ||||| | ||||| || | |||||||||||||||| Sbjct: 274 agctcctcgtcgttgcggatggccagctgcaggtgtcgggggatgatgcgggtcttcttg 215 Query: 438 ttgtccctcgcggcgttcccggccaactccaggacctcagcgg 480 ||||| | |||||||| || |||| |||||||| ||| |||| Sbjct: 214 ttgtcgcgggcggcgttgcccgccagctccaggatctcggcgg 172
>ref|NG_000009.2| Homo sapiens small histone family cluster (HFS@) on chromosome 6 Length = 91567 Score = 77.8 bits (39), Expect = 4e-11 Identities = 120/147 (81%) Strand = Plus / Plus Query: 377 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 436 |||||||||||||||||||| ||| ||||| | || ||||| | |||||||||||||| Sbjct: 28816 gagctcctcgtcgttgcggatggccagctgcaagtggcgcgggataatgcgggtcttctt 28875 Query: 437 gttgtccctcgcggcgttcccggccaactccaggacctcagcggcgagatactccagcac 496 |||||| | |||||||| || |||| |||||||| ||| || | || ||||||||||| Sbjct: 28876 gttgtcgcgggcggcgttgcccgccagctccaggatctcggcagtcaggtactccagcac 28935 Query: 497 ggcggcgaggtagacgggagcgccggc 523 || || ||||| || || |||||||| Sbjct: 28936 cgccgccaggtacaccggcgcgccggc 28962 Score = 77.8 bits (39), Expect = 4e-11 Identities = 138/171 (80%) Strand = Plus / Minus Query: 377 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 436 |||||||||||||||||||| ||| ||||| | || ||||| | |||||||||||| || Sbjct: 1584 gagctcctcgtcgttgcggatggccagctgcaagtggcgcgggatgatgcgggtcttttt 1525 Query: 437 gttgtccctcgcggcgttcccggccaactccaggacctcagcggcgagatactccagcac 496 |||||| | || ||||| || |||| |||||||| ||| || | || ||||||||||| Sbjct: 1524 gttgtcgcgggctgcgttgcccgccagctccaggatctcggcagttaggtactccagcac 1465 Query: 497 ggcggcgaggtagacgggagcgccggcgccaaccctctcggcgtacttgcc 547 || || ||||| || || |||||||| || |||| ||| ||||| ||||| Sbjct: 1464 cgccgccaggtaaaccggcgcgccggccccgacccgctcagcgtagttgcc 1414 Score = 71.9 bits (36), Expect = 3e-09 Identities = 99/120 (82%) Strand = Plus / Plus Query: 377 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 436 ||||||||| |||||||||| ||| ||||||| || ||||| | |||||| |||||||| Sbjct: 85961 gagctcctcatcgttgcggatggccagctggaggtgacgcgggatgatgcgagtcttctt 86020 Query: 437 gttgtccctcgcggcgttcccggccaactccaggacctcagcggcgagatactccagcac 496 |||||| | || ||||| || |||| |||||||| ||| |||| || ||||||||||| Sbjct: 86021 gttgtcgcgggccgcgttgccagccagctccaggatctcggcggtcaggtactccagcac 86080 Score = 71.9 bits (36), Expect = 3e-09 Identities = 99/120 (82%) Strand = Plus / Minus Query: 377 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 436 ||||||||| |||||||||| ||| ||||||| || ||||| | |||||| |||||||| Sbjct: 79993 gagctcctcatcgttgcggatggccagctggaggtgacgcgggatgatgcgagtcttctt 79934 Query: 437 gttgtccctcgcggcgttcccggccaactccaggacctcagcggcgagatactccagcac 496 |||||| | || ||||| || |||| |||||||| ||| |||| || ||||||||||| Sbjct: 79933 gttgtcgcgggccgcgttgccagccagctccaggatctcggcggtcaggtactccagcac 79874 Score = 69.9 bits (35), Expect = 1e-08 Identities = 137/171 (80%) Strand = Plus / Minus Query: 377 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 436 |||||||||||||||||||| ||| ||||| | || ||||| | ||||||||||||||| Sbjct: 56394 gagctcctcgtcgttgcggatggccagctgcaagtggcgcgggatgatgcgggtcttctt 56335 Query: 437 gttgtccctcgcggcgttcccggccaactccaggacctcagcggcgagatactccagcac 496 |||||| | || ||||| || |||| ||||||| ||| |||| || ||||||| ||| Sbjct: 56334 gttgtcgcgggccgcgttgccagccagttccaggatctcggcggttaggtactccaacac 56275 Query: 497 ggcggcgaggtagacgggagcgccggcgccaaccctctcggcgtacttgcc 547 || || ||||| || || || ||||| || |||| ||| ||||| ||||| Sbjct: 56274 cgccgccaggtacaccggcgctccggcaccgacccgctcagcgtagttgcc 56224
>ref|NM_021065.2| Homo sapiens histone 1, H2ad (HIST1H2AD), mRNA Length = 460 Score = 77.8 bits (39), Expect = 4e-11 Identities = 87/103 (84%) Strand = Plus / Minus Query: 378 agctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttcttg 437 ||||||||||||||||||| ||| ||||| | ||||| || | |||||||||||||||| Sbjct: 281 agctcctcgtcgttgcggatggccagctgcaggtgtcgggggatgatgcgggtcttcttg 222 Query: 438 ttgtccctcgcggcgttcccggccaactccaggacctcagcgg 480 ||||| | |||||||| || |||| |||||||| ||| |||| Sbjct: 221 ttgtcgcgggcggcgttgcccgccagctccaggatctcggcgg 179
>ref|NM_003516.2| Homo sapiens histone 2, H2aa (HIST2H2AA), mRNA Length = 534 Score = 77.8 bits (39), Expect = 4e-11 Identities = 117/143 (81%) Strand = Plus / Minus Query: 381 tcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttcttgttg 440 |||||||||||||||| ||| ||||||| || || || | |||||| |||||||||||| Sbjct: 331 tcctcgtcgttgcggatggccagctggaggtgacgagggatgatgcgcgtcttcttgttg 272 Query: 441 tccctcgcggcgttcccggccaactccaggacctcagcggcgagatactccagcacggcg 500 |||| || ||||| || |||| |||||||| ||| |||| |||||||| || || || Sbjct: 271 tcccgagccgcgttgcccgccagctccaggatctcggcggtcagatactcgaggaccgca 212 Query: 501 gcgaggtagacgggagcgccggc 523 || | ||||||||| |||||||| Sbjct: 211 gccatgtagacgggcgcgccggc 189
>ref|NM_003514.2| Homo sapiens histone 1, H2am (HIST1H2AM), mRNA Length = 487 Score = 77.8 bits (39), Expect = 4e-11 Identities = 138/171 (80%) Strand = Plus / Minus Query: 377 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 436 |||||||||||||||||||| ||| ||||| | || ||||| | |||||||||||| || Sbjct: 318 gagctcctcgtcgttgcggatggccagctgcaagtggcgcgggatgatgcgggtcttttt 259 Query: 437 gttgtccctcgcggcgttcccggccaactccaggacctcagcggcgagatactccagcac 496 |||||| | || ||||| || |||| |||||||| ||| || | || ||||||||||| Sbjct: 258 gttgtcgcgggctgcgttgcccgccagctccaggatctcggcagttaggtactccagcac 199 Query: 497 ggcggcgaggtagacgggagcgccggcgccaaccctctcggcgtacttgcc 547 || || ||||| || || |||||||| || |||| ||| ||||| ||||| Sbjct: 198 cgccgccaggtaaaccggcgcgccggccccgacccgctcagcgtagttgcc 148
>ref|NM_003512.3| Homo sapiens histone 1, H2ac (HIST1H2AC), mRNA Length = 546 Score = 77.8 bits (39), Expect = 4e-11 Identities = 138/171 (80%) Strand = Plus / Minus Query: 377 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 436 |||||||||||||||||||| ||| ||||| | || ||||| | |||||| |||||||| Sbjct: 370 gagctcctcgtcgttgcggatggccagctgcaagtggcgcgggatgatgcgagtcttctt 311 Query: 437 gttgtccctcgcggcgttcccggccaactccaggacctcagcggcgagatactccagcac 496 |||||| | || ||||| ||||||| |||||||| ||| |||| || ||||| | ||| Sbjct: 310 gttgtcgcgagccgcgttgccggccagctccaggatctcggcggtcaggtactctaacac 251 Query: 497 ggcggcgaggtagacgggagcgccggcgccaaccctctcggcgtacttgcc 547 || || ||||| || || ||||| || ||||||| ||| ||||| ||||| Sbjct: 250 cgccgccaggtacaccggcgcgcctgccccaacccgctctgcgtagttgcc 200
>ref|NM_003511.2| Homo sapiens histone 1, H2al (HIST1H2AL), mRNA Length = 470 Score = 77.8 bits (39), Expect = 4e-11 Identities = 120/147 (81%) Strand = Plus / Minus Query: 377 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 436 |||||||||||||||||||| ||| ||||| | || ||||| | |||||||||||||| Sbjct: 308 gagctcctcgtcgttgcggatggccagctgcaagtggcgcgggataatgcgggtcttctt 249 Query: 437 gttgtccctcgcggcgttcccggccaactccaggacctcagcggcgagatactccagcac 496 |||||| | |||||||| || |||| |||||||| ||| || | || ||||||||||| Sbjct: 248 gttgtcgcgggcggcgttgcccgccagctccaggatctcggcagtcaggtactccagcac 189 Query: 497 ggcggcgaggtagacgggagcgccggc 523 || || ||||| || || |||||||| Sbjct: 188 cgccgccaggtacaccggcgcgccggc 162
>ref|XM_545430.1| PREDICTED: Canis familiaris similar to Histone H2A.l (H2A/l) (LOC488308), mRNA Length = 456 Score = 77.8 bits (39), Expect = 4e-11 Identities = 138/171 (80%) Strand = Plus / Minus Query: 377 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 436 |||||||||||||||||||| ||| ||||| | || ||||| | |||||| |||||||| Sbjct: 345 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 286 Query: 437 gttgtccctcgcggcgttcccggccaactccaggacctcagcggcgagatactccagcac 496 |||||| | || ||||| || |||| |||||||| ||| || | || ||||||||||| Sbjct: 285 gttgtcgcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcac 226 Query: 497 ggcggcgaggtagacgggagcgccggcgccaaccctctcggcgtacttgcc 547 ||| || ||||| || || ||||| || || |||| ||| ||||| ||||| Sbjct: 225 ggccgccaggtacaccggcgcgcccgccccgacccgctccgcgtagttgcc 175
>ref|XM_545426.2| PREDICTED: Canis familiaris similar to Histone H2A.l (H2A/l) (LOC488304), mRNA Length = 588 Score = 77.8 bits (39), Expect = 4e-11 Identities = 138/171 (80%) Strand = Plus / Minus Query: 377 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 436 |||||||||||||||||||| ||| ||||| | || ||||| | |||||| |||||||| Sbjct: 429 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 370 Query: 437 gttgtccctcgcggcgttcccggccaactccaggacctcagcggcgagatactccagcac 496 |||||| | || ||||| || |||| |||||||| ||| || | || ||||||||||| Sbjct: 369 gttgtcgcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcac 310 Query: 497 ggcggcgaggtagacgggagcgccggcgccaaccctctcggcgtacttgcc 547 ||| || ||||| || || ||||| || || |||| ||| ||||| ||||| Sbjct: 309 ggccgccaggtacaccggcgcgcccgccccgacccgctccgcgtagttgcc 259 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 3,870,860 Number of Sequences: 3902068 Number of extensions: 3870860 Number of successful extensions: 81389 Number of sequences better than 10.0: 873 Number of HSP's better than 10.0 without gapping: 873 Number of HSP's successfully gapped in prelim test: 10 Number of HSP's that attempted gapping in prelim test: 77833 Number of HSP's gapped (non-prelim): 3306 length of query: 654 length of database: 17,233,045,268 effective HSP length: 23 effective length of query: 631 effective length of database: 17,143,297,704 effective search space: 10817420851224 effective search space used: 10817420851224 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)
