ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbags19m15
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AC108762.2| Oryza sativa (japonica cultivar-group) chromosome... 408 e-111
2dbj|AK069787.1| Oryza sativa (japonica cultivar-group) cDNA clon... 400 e-108
3gb|AY109275.1| Zea mays PCO093820 mRNA sequence 337 3e-89
4gb|AC148396.3| Medicago truncatula chromosome 2 BAC clone mth2-1... 88 4e-14
5ref|XM_855139.1| PREDICTED: Canis familiaris similar to heat sho... 78 4e-11
6ref|XM_532082.2| PREDICTED: Canis familiaris similar to heat sho... 78 4e-11
7gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 76 2e-10
8dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 76 2e-10
9gb|AC134237.2| Oryza sativa (japonica cultivar-group) chromosome... 76 2e-10
10gb|AC121490.2| Oryza sativa (japonica cultivar-group) chromosome... 76 2e-10
11dbj|AK103835.1| Oryza sativa (japonica cultivar-group) cDNA clon... 76 2e-10
12ref|XM_468043.1| Oryza sativa (japonica cultivar-group), mRNA 72 3e-09
13emb|AJ719486.1| Gallus gallus mRNA for hypothetical protein, clo... 72 3e-09
14ref|NM_001006147.1| Gallus gallus heat shock 70kDa protein 9B (m... 72 3e-09
15dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 72 3e-09
16dbj|AP004853.3| Oryza sativa (japonica cultivar-group) genomic D... 72 3e-09
17dbj|AP004068.3| Oryza sativa (japonica cultivar-group) genomic D... 72 3e-09
18dbj|AK065228.1| Oryza sativa (japonica cultivar-group) cDNA clon... 72 3e-09
19dbj|AK060740.1| Oryza sativa (japonica cultivar-group) cDNA clon... 72 3e-09
20emb|BX897700.1| Bartonella quintana str. Toulouse, complete genome 70 1e-08
21emb|BX897699.1| Bartonella henselae strain Houston-1, complete g... 70 1e-08
22gb|AF142571.1|AF142571 Saguinus oedipus intracellular vitamin D ... 70 1e-08
23ref|XM_508830.1| PREDICTED: Pan troglodytes heat shock 70kDa pro... 68 4e-08
24gb|BC016660.1| Homo sapiens heat shock 70kDa protein 8, transcri... 68 4e-08
25gb|BC016179.1| Homo sapiens heat shock 70kDa protein 8, transcri... 68 4e-08
26gb|BC019816.2| Homo sapiens heat shock 70kDa protein 8, transcri... 68 4e-08
27gb|BC007276.1| Homo sapiens heat shock 70kDa protein 8, mRNA (cD... 68 4e-08
28ref|NM_006597.3| Homo sapiens heat shock 70kDa protein 8 (HSPA8)... 68 4e-08
29gb|BC008907.2| Homo sapiens heat shock 70kDa protein 8, mRNA (cD... 68 4e-08
30gb|BC002423.1| Homo sapiens ribosomal protein L8, mRNA (cDNA clo... 68 4e-08
31gb|BC041201.1| Xenopus laevis Heat shock cognate protein 70, mRN... 68 4e-08
32gb|AC009945.2| Homo sapiens BAC clone CTD-2060L22 from 7, comple... 68 4e-08
33gb|BC002644.2| Homo sapiens hypothetical protein MGC4859 similar... 68 4e-08
34gb|BC112920.1| Homo sapiens cDNA clone IMAGE:7484542, **** WARNI... 68 4e-08
35emb|Y00371.1|HSHSC70 Human hsc70 gene for 71 kd heat shock cogna... 68 4e-08
36emb|CR925990.1| Pongo pygmaeus mRNA; cDNA DKFZp459M2220 (from cl... 68 4e-08
37emb|CR861166.1| Pongo pygmaeus mRNA; cDNA DKFZp459P2416 (from cl... 68 4e-08
38emb|CR860584.1| Pongo pygmaeus mRNA; cDNA DKFZp459L1519 (from cl... 68 4e-08
39emb|CR859135.1| Pongo pygmaeus mRNA; cDNA DKFZp459D1928 (from cl... 68 4e-08
40emb|CR623327.1| full-length cDNA clone CL0BB012ZA08 of Neuroblas... 68 4e-08
41emb|CR618855.1| full-length cDNA clone CS0DA004YH14 of Neuroblas... 68 4e-08
42dbj|AK096100.1| Homo sapiens cDNA FLJ38781 fis, clone LIVER20002... 68 4e-08
43emb|CR619085.1| full-length cDNA clone CS0DF008YL15 of Fetal bra... 68 4e-08
44emb|CR618452.1| full-length cDNA clone CS0DA004YF21 of Neuroblas... 68 4e-08
45emb|CR617847.1| full-length cDNA clone CS0DN003YP05 of Adult bra... 68 4e-08
46emb|CR614382.1| full-length cDNA clone CS0CAP006YL11 of Thymus o... 68 4e-08
47emb|CR609237.1| full-length cDNA clone CL0BA012ZA08 of Placenta ... 68 4e-08
48emb|CR605894.1| full-length cDNA clone CS0DA003YN07 of Neuroblas... 68 4e-08
49emb|CR599778.1| full-length cDNA clone CS0DE006YC12 of Placenta ... 68 4e-08
50emb|CR598455.1| full-length cDNA clone CS0DA003YC01 of Neuroblas... 68 4e-08
51emb|CR598352.1| full-length cDNA clone CS0DF006YL22 of Fetal bra... 68 4e-08
52ref|NG_005513.1| Homo sapiens heat shock 70kDa protein 8 pseudog... 68 4e-08
53emb|CR597390.1| full-length cDNA clone CS0DF009YO17 of Fetal bra... 68 4e-08
54dbj|AB073886.1| Homo sapiens primary neuroblastoma cDNA, clone:N... 68 4e-08
55ref|XM_936755.1| PREDICTED: Homo sapiens similar to Chain , Heat... 68 4e-08
56ref|XM_935683.1| PREDICTED: Homo sapiens similar to Chain , Heat... 68 4e-08
57ref|XM_376576.3| PREDICTED: Homo sapiens similar to Chain , Heat... 68 4e-08
58gb|BC015699.1|BC015699 Homo sapiens, clone IMAGE:3906958, mRNA, ... 68 4e-08
59gb|AF352832.1|AF352832 Homo sapiens constitutive heat shock prot... 68 4e-08
60dbj|AK222785.1| Homo sapiens mRNA for heat shock 70kDa protein 8... 68 4e-08
61dbj|AB072749.1| Macaca fascicularis testis cDNA clone:QtsA-16150... 68 4e-08
62emb|Z49896.1|XLHS7CU14 X.laevis DNA for intronic U14 small nucle... 68 4e-08
63dbj|AK129885.1| Homo sapiens cDNA FLJ26375 fis, clone HRT06292, ... 68 4e-08
64gb|AY104983.1| Zea mays PCO092463 mRNA sequence 68 4e-08
65dbj|AP000926.6| Homo sapiens genomic DNA, chromosome 11 clone:RP... 68 4e-08
66gb|U30885.1|U30885 Xenopus laevis heat shock cognate 70.I (hsc70... 68 4e-08
67gb|U55070.1|XLU55070 Xenopus laevis heat shock cognate 70.II pro... 68 4e-08
68gb|U55176.1|XLU55176 Xenopus laevis heat shock cognate 70.II mRN... 68 4e-08
69emb|X73685.1|CAHSP C.aethiops hsp70 mRNA 68 4e-08
70emb|X66874.1|PV70HSP P.vulgaris mRNA for 70 kD heat shock protein 66 2e-07
71gb|AY120919.1| Cryptosporidium sp. 1453 70 kDa heat shock protei... 66 2e-07
72dbj|AB102771.1| Cryptosporidium sp. MNJ-1 HSP70 gene for heat sh... 66 2e-07
73gb|AF502479.1| Mitsukurina owstoni isolate Miow3 Hsp70 protein (... 64 6e-07
74ref|XM_575798.1| PREDICTED: Rattus norvegicus similar to heat sh... 64 6e-07
75ref|XM_529112.1| PREDICTED: Pan troglodytes similar to heat shoc... 62 3e-06
76ref|XR_002535.1| PREDICTED: Mus musculus similar to heat shock p... 62 3e-06
77gb|AC126431.3| Mus musculus BAC clone RP24-407P8 from chromosome... 62 3e-06
78gb|AC129187.4| Mus musculus BAC clone RP23-427D4 from chromosome... 62 3e-06
79emb|AL390728.37| Human DNA sequence from clone RP11-488L18 on ch... 62 3e-06
80gb|BC098914.1| Rattus norvegicus heat shock protein 8, mRNA (cDN... 62 3e-06
81emb|AJ318883.1|OED318883 Ostrea edulis partial hsp70 gene for he... 62 3e-06
82gb|BC061547.1| Rattus norvegicus heat shock protein 8, mRNA (cDN... 62 3e-06
83gb|DQ399046.1| Ictalurus punctatus clone SQE05 heat shock cognat... 62 3e-06
84ref|NG_004796.1| Rattus norvegicus heat shock cognate protein 70... 62 3e-06
85ref|NG_004795.1| Rattus norvegicus heat shock cognate protein 70... 62 3e-06
86gb|AC092404.2| Mus musculus strain C57BL6/J chromosome 5 clone R... 62 3e-06
87gb|AF144646.1|AF144646 Crassostrea gigas heat shock protein 70 (... 62 3e-06
88gb|AY195744.1| Carassius auratus gibelio heat shock cognate 70 k... 62 3e-06
89ref|XM_341392.2| PREDICTED: Rattus norvegicus BM259 protein (Bm2... 62 3e-06
90dbj|AB092840.1| Carassius auratus HSC70 mRNA for heat shock cogn... 62 3e-06
91dbj|AB122064.1| Crassostrea gigas HSC71 mRNA for 71kDa heat shoc... 62 3e-06
92gb|AC004822.1|AC004822 Homo sapiens PAC clone RP1-170D19 from Xq... 62 3e-06
93emb|Y00054.1|RNHSC73 Rat gene for hsc73 , the major hsp70-like p... 62 3e-06
94emb|X70065.1|RNHSP72PS R.norvegicus Hsc70-ps1 gene 62 3e-06
95gb|U40994.1|PCU40994 Pneumocystis carinii f. sp. rattus BiP prec... 62 3e-06
96ref|NM_024351.2| Rattus norvegicus heat shock protein 8 (Hspa8),... 62 3e-06
97gb|M11942.1|RATHSPA Rat 70 kd heat-shock-like protein mRNA, comp... 62 3e-06
98gb|AC134426.20| Mus musculus chromosome 1, clone RP24-342A12, co... 60 1e-05
99gb|BC067910.2| Xenopus tropicalis hypothetical protein MGC69535,... 60 1e-05
100gb|BC046262.1| Xenopus laevis similar to Heat shock cognate prot... 60 1e-05
101gb|BC045259.1| Xenopus laevis similar to heat shock protein, 74 ... 60 1e-05
102gb|AC102133.27| Mus musculus chromosome 1, clone RP23-241J21, co... 60 1e-05
103emb|AJ318882.1|CGI318882 Crassostrea gigas partial hsp70 gene fo... 60 1e-05
104emb|AJ305315.1|CGI305315 Crassostrea gigas hsc70 gene, exons 1-6 60 1e-05
105ref|NM_001001229.2| Xenopus tropicalis hypothetical protein MGC6... 60 1e-05
106gb|AC149875.2| Xenopus tropicalis clone CH216-151P11, complete s... 60 1e-05
107emb|CR760959.2| Xenopus tropicalis finished cDNA, clone TEgg043g04 60 1e-05
108gb|AF106835.1|AF106835 Methylovorus sp. strain SS1 putative GrpE... 60 1e-05
109gb|U22460.1|IPU22460 Ictalurus punctatus heat shock protein 70 (... 60 1e-05
110ref|XM_592191.2| PREDICTED: Bos taurus similar to heat shock 70k... 58 4e-05
111emb|Z83108.1|CEF44E5 Caenorhabditis elegans Cosmid F44E5, comple... 58 4e-05
112ref|NM_064109.2| Caenorhabditis elegans F44E5.5 (F44E5.5) mRNA, ... 58 4e-05
113ref|NM_064108.2| Caenorhabditis elegans F44E5.4 (F44E5.4) mRNA, ... 58 4e-05
114gb|AY120920.1| Cryptosporidium canis 70 kDa heat shock protein g... 58 4e-05
115gb|AF221529.1|AF221529 Cryptosporidium parvum isolate 244 heat s... 58 4e-05
116gb|AY422994.1| Danio rerio heat shock 70kDa protein 8 (HSPA8) mR... 56 2e-04
117ref|XM_527345.1| PREDICTED: Pan troglodytes similar to heat shoc... 56 2e-04
118gb|AF134726.1| Homo sapiens BAC clone 215O12 NG35, NG36, G9A, NG... 56 2e-04
119gb|BC034483.1| Homo sapiens heat shock 70kDa protein 1-like, mRN... 56 2e-04
120gb|AY286123.1| Cyanidioschyzon merolae DBV201 chloroplast, compl... 56 2e-04
121gb|BC045130.1| Xenopus laevis heat shock protein, 74 kDa, A, mRN... 56 2e-04
122ref|NM_005527.2| Homo sapiens heat shock 70kDa protein 1-like (H... 56 2e-04
123emb|AL929592.8| Human DNA sequence from clone DAQB-147D11 on chr... 56 2e-04
124emb|AL671762.10| Human DNA sequence from clone XXbac-254B15 on c... 56 2e-04
125emb|AL662834.8| Human DNA sequence from clone XXbac-40G17 on chr... 56 2e-04
126emb|Y11413.1|DRHSC70 D.rerio hsc70 mRNA 56 2e-04
127gb|AF502513.1| Isurus oxyrinchus isolate Isox10 Hsp70 pseudogene... 56 2e-04
128gb|AF502488.1| Pseudocarcharias kamoharai isolate Pska5 Hsp70 pr... 56 2e-04
129gb|AF502487.1| Pseudocarcharias kamoharai isolate Pska4 Hsp70 pr... 56 2e-04
130gb|AF502486.1| Pseudocarcharias kamoharai isolate Pska3 Hsp70 pr... 56 2e-04
131gb|AF502485.1| Pseudocarcharias kamoharai isolate Pska2 Hsp70 pr... 56 2e-04
132gb|AF502484.1| Pseudocarcharias kamoharai isolate Pska1 Hsp70 pr... 56 2e-04
133gb|AF502483.1| Odontaspis ferox isolate Odfe6 Hsp70 protein (Hsp... 56 2e-04
134gb|AF502482.1| Odontaspis ferox isolate Odfe5 Hsp70 protein (Hsp... 56 2e-04
135gb|AF502478.1| Mitsukurina owstoni isolate Miow2 Hsp70 protein (... 56 2e-04
136gb|AF502476.1| Megachasma pelagios isolate Mepe7 Hsp70 protein (... 56 2e-04
137gb|AF502475.1| Megachasma pelagios isolate Mepe6 Hsp70 protein (... 56 2e-04
138gb|AF502474.1| Megachasma pelagios isolate Mepe5 Hsp70 protein (... 56 2e-04
139gb|AF502473.1| Megachasma pelagios isolate Mepe4 Hsp70 protein (... 56 2e-04
140gb|AF502470.1| Megachasma pelagios isolate Mepe1 Hsp70 protein (... 56 2e-04
141gb|AF502461.1| Alopias vulpinus isolate Alvu5 Hsp70 protein (Hsp... 56 2e-04
142gb|AF502455.1| Alopias superciliosus isolate Alsu5 Hsp70 protein... 56 2e-04
143gb|AF502454.1| Alopias superciliosus isolate Alsu4 Hsp70 protein... 56 2e-04
144gb|AF502453.1| Alopias superciliosus isolate Alsu3 Hsp70 protein... 56 2e-04
145gb|AF502450.1| Alopias pelagicus isolate Alpe6 Hsp70 protein (Hs... 56 2e-04
146gb|AF502449.1| Alopias pelagicus isolate Alpe5 Hsp70 protein (Hs... 56 2e-04
147gb|AF502448.1| Alopias pelagicus isolate Alpe4 Hsp70 protein (Hs... 56 2e-04
148gb|AF502447.1| Alopias pelagicus isolate Alpe3 Hsp70 protein (Hs... 56 2e-04
149gb|AF502446.1| Alopias pelagicus isolate Alpe2 Hsp70 protein (Hs... 56 2e-04
150gb|AF502443.1| Odontaspis ferox isolate Odfe2 Hsp70 protein (Hsp... 56 2e-04
151gb|AF502442.1| Odontaspis ferox isolate Odfe1 Hsp70 protein (Hsp... 56 2e-04
152emb|CR759915.6| Human DNA sequence from clone DAAP-21F2 on chrom... 56 2e-04
153emb|CR388202.9| Human DNA sequence from clone DADB-333F21 on chr... 56 2e-04
154gb|DQ383515.2| Homo sapiens heat shock 70kDa protein 1-like (HSP... 56 2e-04
155ref|XM_687844.1| PREDICTED: Danio rerio similar to Heat shock pr... 56 2e-04
156dbj|AB168812.1| Macaca fascicularis testis cDNA, clone: QtsA-150... 56 2e-04
157dbj|AB168570.1| Macaca fascicularis testis cDNA clone: QtsA-1308... 56 2e-04
158gb|AF217511.1|AF217511 Homo sapiens uncharacterized bone marrow ... 56 2e-04
159gb|AC148662.1| Macaca mulatta Major Histocompatibility Complex B... 56 2e-04
160emb|BX276087.14| Zebrafish DNA sequence from clone CH211-270M20 ... 56 2e-04
161dbj|AK223386.1| Homo sapiens mRNA for heat shock 70kDa protein 1... 56 2e-04
162gb|BC063228.1| Danio rerio heat shock protein 8, mRNA (cDNA clon... 56 2e-04
163gb|BC045841.1| Danio rerio heat shock protein 8, mRNA (cDNA clon... 56 2e-04
164ref|NM_131401.1| Danio rerio heat shock protein 8 (hspa8), mRNA 56 2e-04
165dbj|BA000025.2| Homo sapiens genomic DNA, chromosome 6p21.3, HLA... 56 2e-04
166gb|AY892966.1| Synthetic construct Homo sapiens clone FLH141345.... 56 2e-04
167gb|AY890508.1| Synthetic construct Homo sapiens clone FLH141349.... 56 2e-04
168gb|L77146.1|ZEFHSC7R Danio rerio heat shock cognate (hsc70) mRNA... 56 2e-04
169emb|BX120005.6| Zebrafish DNA sequence from clone RP71-56I13 in ... 56 2e-04
170dbj|AB002583.1| Cyanidioschyzon merolae chloroplast DNA, complet... 56 2e-04
171gb|BC066491.1| Danio rerio heat shock protein 8, mRNA (cDNA clon... 56 2e-04
172emb|AL132713.11|HSDJ71I17 Human DNA sequence from clone RP1-71I1... 56 2e-04
173gb|M59829.1|HUMMHHSPHO Human MHC class III HSP70-HOM gene (HLA),... 56 2e-04
174dbj|D85730.1| Homo sapiens HSPA1L mRNA for Heat shock protein 70... 56 2e-04
175gb|BC106169.1| Mus musculus heat shock protein 8, mRNA (cDNA clo... 54 6e-04
176gb|BC106193.1| Mus musculus heat shock protein 8, mRNA (cDNA clo... 54 6e-04
177gb|BC085486.1| Mus musculus heat shock protein 8, mRNA (cDNA clo... 54 6e-04
178gb|AY466445.1| Macrobrachium rosenbergii heat shock protein 70 m... 54 6e-04
179ref|NM_031165.3| Mus musculus heat shock protein 8 (Hspa8), mRNA 54 6e-04
180ref|XM_986932.1| PREDICTED: Mus musculus similar to heat shock p... 54 6e-04
181ref|XM_989582.1| PREDICTED: Mus musculus similar to heat shock p... 54 6e-04
182ref|XR_001853.1| PREDICTED: Mus musculus similar to heat shock p... 54 6e-04
183ref|XR_003182.1| PREDICTED: Mus musculus similar to heat shock p... 54 6e-04
184emb|AJ783715.1| Mytilus galloprovincialis partial hsc70 gene for... 54 6e-04
185emb|AJ783714.1| Mytilus galloprovincialis hsc71 gene for heat sh... 54 6e-04
186gb|AC109329.8| Homo sapiens chromosome 8, clone CTD-3107M8, comp... 54 6e-04
187gb|AC111044.9| Mus musculus chromosome 10, clone RP23-299H4, com... 54 6e-04
188gb|AY219845.1| Cyprinus carpio constitutive heat shock protein H... 54 6e-04
189gb|AY219844.1| Cyprinus carpio constitutive heat shock protein H... 54 6e-04
190gb|AY226078.1| Monosiga brevicollis type Mb_C 70-kDa heat-shock ... 54 6e-04
191gb|AY120893.1| Cyprinus carpio muscle-specific heat shock protei... 54 6e-04
192emb|Z49764.2|PM5LBIPRT Pseudotsuga menziesii mRNA for luminal bi... 54 6e-04
193emb|Y15109.1|SRY15109 Sycon raphanus mRNA for heat shock protein 70 54 6e-04
194emb|AJ305316.1|OED305316 Ostrea edulis hsc70 gene, exons 1-6 54 6e-04
195gb|AC125311.3| Mus musculus BAC clone RP24-325G24 from chromosom... 54 6e-04
196gb|AC158355.2| Mus musculus BAC clone RP24-374N16 from chromosom... 54 6e-04
197dbj|AK098074.1| Mus musculus cDNA fis, clone TRACH2001651,highly... 54 6e-04
198dbj|AK145416.1| Mus musculus morula whole body morula cDNA, RIKE... 54 6e-04
199dbj|AK151065.1| Mus musculus bone marrow macrophage cDNA, RIKEN ... 54 6e-04
200dbj|AK151041.1| Mus musculus bone marrow macrophage cDNA, RIKEN ... 54 6e-04
201dbj|AK150958.1| Mus musculus bone marrow macrophage cDNA, RIKEN ... 54 6e-04
202dbj|AK149954.1| Mus musculus bone marrow macrophage cDNA, RIKEN ... 54 6e-04
203dbj|AK135281.1| Mus musculus 12 days embryo male wolffian duct i... 54 6e-04
204dbj|AK151997.1| Mus musculus bone marrow macrophage cDNA, RIKEN ... 54 6e-04
205dbj|AK151948.1| Mus musculus bone marrow macrophage cDNA, RIKEN ... 54 6e-04
206dbj|AK153032.1| Mus musculus bone marrow macrophage cDNA, RIKEN ... 54 6e-04
207dbj|AK151892.1| Mus musculus bone marrow macrophage cDNA, RIKEN ... 54 6e-04
208dbj|AK151865.1| Mus musculus bone marrow macrophage cDNA, RIKEN ... 54 6e-04
209dbj|AK151808.1| Mus musculus bone marrow macrophage cDNA, RIKEN ... 54 6e-04
210dbj|AK151775.1| Mus musculus bone marrow macrophage cDNA, RIKEN ... 54 6e-04
211dbj|AK151741.1| Mus musculus bone marrow macrophage cDNA, RIKEN ... 54 6e-04
212dbj|AK150846.1| Mus musculus bone marrow macrophage cDNA, RIKEN ... 54 6e-04
213dbj|AK146985.1| Mus musculus 17 days embryo kidney cDNA, RIKEN f... 54 6e-04
214dbj|AK146708.1| Mus musculus 16 days embryo heart cDNA, RIKEN fu... 54 6e-04
215dbj|AK153834.1| Mus musculus 2 days neonate thymus thymic cells ... 54 6e-04
216dbj|AK152803.1| Mus musculus bone marrow macrophage cDNA, RIKEN ... 54 6e-04
217dbj|AK152768.1| Mus musculus bone marrow macrophage cDNA, RIKEN ... 54 6e-04
218dbj|AK152703.1| Mus musculus bone marrow macrophage cDNA, RIKEN ... 54 6e-04
219gb|AC090820.6| Homo sapiens chromosome 8, clone CTD-2345M20, com... 54 6e-04
220dbj|AK151537.1| Mus musculus bone marrow macrophage cDNA, RIKEN ... 54 6e-04
221dbj|AK151516.1| Mus musculus bone marrow macrophage cDNA, RIKEN ... 54 6e-04
222dbj|AK150701.1| Mus musculus bone marrow macrophage cDNA, RIKEN ... 54 6e-04
223dbj|AK147864.1| Mus musculus melanocyte cDNA, RIKEN full-length ... 54 6e-04
224dbj|AK146547.1| Mus musculus 17 days embryo kidney cDNA, RIKEN f... 54 6e-04
225dbj|AK152697.1| Mus musculus bone marrow macrophage cDNA, RIKEN ... 54 6e-04
226dbj|AK152598.1| Mus musculus bone marrow macrophage cDNA, RIKEN ... 54 6e-04
227dbj|AK152315.1| Mus musculus bone marrow macrophage cDNA, RIKEN ... 54 6e-04
228dbj|AK151435.1| Mus musculus bone marrow macrophage cDNA, RIKEN ... 54 6e-04
229dbj|AK150498.1| Mus musculus bone marrow macrophage cDNA, RIKEN ... 54 6e-04
230dbj|AK150474.1| Mus musculus bone marrow macrophage cDNA, RIKEN ... 54 6e-04
231dbj|AK157831.1| Mus musculus cDNA, RIKEN full-length enriched li... 54 6e-04
232dbj|AK166808.1| Mus musculus blastocyst blastocyst cDNA, RIKEN f... 54 6e-04
233dbj|AK166776.1| Mus musculus blastocyst blastocyst cDNA, RIKEN f... 54 6e-04
234dbj|AK166767.1| Mus musculus blastocyst blastocyst cDNA, RIKEN f... 54 6e-04
235dbj|AK166721.1| Mus musculus blastocyst blastocyst cDNA, RIKEN f... 54 6e-04
236dbj|AK166643.1| Mus musculus morula whole body morula cDNA, RIKE... 54 6e-04
237dbj|AK151287.1| Mus musculus bone marrow macrophage cDNA, RIKEN ... 54 6e-04
238dbj|AK151127.1| Mus musculus bone marrow macrophage cDNA, RIKEN ... 54 6e-04
239dbj|AK168934.1| Mus musculus 17 days pregnant adult female amnio... 54 6e-04
240dbj|AK168887.1| Mus musculus 16 days embryo kidney cDNA, RIKEN f... 54 6e-04
241dbj|AK168776.1| Mus musculus 17 days embryo stomach cDNA, RIKEN ... 54 6e-04
242dbj|AK168750.1| Mus musculus 17 days embryo kidney cDNA, RIKEN f... 54 6e-04
243dbj|AK168711.1| Mus musculus 16 days embryo kidney cDNA, RIKEN f... 54 6e-04
244dbj|AK168654.1| Mus musculus 13 days embryo liver cDNA, RIKEN fu... 54 6e-04
245dbj|AK168625.1| Mus musculus 13 days embryo liver cDNA, RIKEN fu... 54 6e-04
246dbj|AK166545.1| Mus musculus morula whole body morula cDNA, RIKE... 54 6e-04
247dbj|AK168577.1| Mus musculus 16 days embryo heart cDNA, RIKEN fu... 54 6e-04
248dbj|AK168542.1| Mus musculus 16 days embryo kidney cDNA, RIKEN f... 54 6e-04
249dbj|AK168519.1| Mus musculus 17 days pregnant adult female amnio... 54 6e-04
250dbj|AK168511.1| Mus musculus 17 days embryo stomach cDNA, RIKEN ... 54 6e-04
251dbj|AK168492.1| Mus musculus 16 days embryo heart cDNA, RIKEN fu... 54 6e-04
252dbj|AK168435.1| Mus musculus 13 days embryo liver cDNA, RIKEN fu... 54 6e-04
253dbj|AK167414.1| Mus musculus 14 days embryo liver cDNA, RIKEN fu... 54 6e-04
254dbj|AK167254.1| Mus musculus blastocyst blastocyst cDNA, RIKEN f... 54 6e-04
255dbj|AK167229.1| Mus musculus blastocyst blastocyst cDNA, RIKEN f... 54 6e-04
256dbj|AK164000.1| Mus musculus ES cells cDNA, RIKEN full-length en... 54 6e-04
257dbj|AK163987.1| Mus musculus ES cells cDNA, RIKEN full-length en... 54 6e-04
258dbj|AK159479.1| Mus musculus osteoclast-like cell cDNA, RIKEN fu... 54 6e-04
259dbj|AK169594.1| Mus musculus 2 days neonate thymus thymic cells ... 54 6e-04
260dbj|AK167218.1| Mus musculus blastocyst blastocyst cDNA, RIKEN f... 54 6e-04
261dbj|AK167043.1| Mus musculus blastocyst blastocyst cDNA, RIKEN f... 54 6e-04
262dbj|AK167163.1| Mus musculus blastocyst blastocyst cDNA, RIKEN f... 54 6e-04
263dbj|AK167134.1| Mus musculus blastocyst blastocyst cDNA, RIKEN f... 54 6e-04
264dbj|AK167122.1| Mus musculus blastocyst blastocyst cDNA, RIKEN f... 54 6e-04
265dbj|AK167121.1| Mus musculus blastocyst blastocyst cDNA, RIKEN f... 54 6e-04
266dbj|AK162775.1| Mus musculus 16 days neonate thymus cDNA, RIKEN ... 54 6e-04
267gb|L19533.1|CRUU14HS Cricetulus griseus heat resistant protein gene 54 6e-04
268dbj|AK169293.1| Mus musculus 13 days embryo liver cDNA, RIKEN fu... 54 6e-04
269dbj|AK169329.1| Mus musculus 17 days pregnant adult female amnio... 54 6e-04
270dbj|AK169236.1| Mus musculus 16 days embryo kidney cDNA, RIKEN f... 54 6e-04
271dbj|AK167910.1| Mus musculus CRL-1722 L5178Y-R cDNA, RIKEN full-... 54 6e-04
272dbj|AK167845.1| Mus musculus CRL-1722 L5178Y-R cDNA, RIKEN full-... 54 6e-04
273dbj|AK166913.1| Mus musculus blastocyst blastocyst cDNA, RIKEN f... 54 6e-04
274dbj|AK166910.1| Mus musculus blastocyst blastocyst cDNA, RIKEN f... 54 6e-04
275dbj|AK166908.1| Mus musculus blastocyst blastocyst cDNA, RIKEN f... 54 6e-04
276dbj|AK166933.1| Mus musculus blastocyst blastocyst cDNA, RIKEN f... 54 6e-04
277dbj|AK166873.1| Mus musculus blastocyst blastocyst cDNA, RIKEN f... 54 6e-04
278dbj|AK166861.1| Mus musculus blastocyst blastocyst cDNA, RIKEN f... 54 6e-04
279dbj|AK166846.1| Mus musculus blastocyst blastocyst cDNA, RIKEN f... 54 6e-04
280dbj|AK166830.1| Mus musculus blastocyst blastocyst cDNA, RIKEN f... 54 6e-04
281dbj|AK169179.1| Mus musculus 16 days embryo kidney cDNA, RIKEN f... 54 6e-04
282dbj|AK169093.1| Mus musculus 16 days embryo kidney cDNA, RIKEN f... 54 6e-04
283dbj|AK145579.1| Mus musculus blastocyst blastocyst cDNA, RIKEN f... 54 6e-04
284dbj|AK081701.1| Mus musculus 16 days embryo head cDNA, RIKEN ful... 54 6e-04
285dbj|AK035286.1| Mus musculus adult male urinary bladder cDNA, RI... 54 6e-04
286gb|BC105182.1| Bos taurus heat shock 70 kDa protein 8, mRNA (cDN... 54 6e-04
287dbj|AK075935.1| Mus musculus ES cells cDNA, RIKEN full-length en... 54 6e-04
288dbj|AK004608.1| Mus musculus adult male lung cDNA, RIKEN full-le... 54 6e-04
289emb|AL116840.1|CNS01DHS Botrytis cinerea strain T4 cDNA library 54 6e-04
290emb|AL114947.1|CNS01C17 Botrytis cinerea strain T4 cDNA library 54 6e-04
291emb|AL114140.1|CNS01BES Botrytis cinerea strain T4 cDNA library 54 6e-04
292emb|AL113014.1|CNS01AJI Botrytis cinerea strain T4 cDNA library 54 6e-04
293emb|AL112298.1|CNS019ZM Botrytis cinerea strain T4 cDNA library 54 6e-04
294gb|BC094900.1| Mus musculus heat shock protein 8, mRNA (cDNA clo... 54 6e-04
295gb|AY120917.1| Cryptosporidium sp. 1170 70 kDa heat shock protei... 54 6e-04
296dbj|AK217051.1| Mus musculus cDNA, clone:Y2G0140H13, strand:plus... 54 6e-04
297dbj|AK217000.1| Mus musculus cDNA, clone:Y2G0140E22, strand:minu... 54 6e-04
298dbj|AK215080.1| Mus musculus cDNA, clone:Y2G0133O11, strand:minu... 54 6e-04
299dbj|AK210805.1| Mus musculus cDNA, clone:Y2G0119K13, strand:plus... 54 6e-04
300dbj|AK204472.1| Mus musculus cDNA, clone:Y1G0148I21, strand:minu... 54 6e-04
301dbj|AK204416.1| Mus musculus cDNA, clone:Y1G0148F16, strand:plus... 54 6e-04
302dbj|AK197127.1| Mus musculus cDNA, clone:Y1G0124B21, strand:plus... 54 6e-04
303dbj|AK199284.1| Mus musculus cDNA, clone:Y1G0130L14, strand:minu... 54 6e-04
304dbj|AK197524.1| Mus musculus cDNA, clone:Y1G0125F19, strand:minu... 54 6e-04
305dbj|AK197383.1| Mus musculus cDNA, clone:Y1G0124P06, strand:plus... 54 6e-04
306dbj|AK186515.1| Mus musculus cDNA, clone:Y0G0137J18, strand:minu... 54 6e-04
307dbj|AK186449.1| Mus musculus cDNA, clone:Y0G0137G01, strand:minu... 54 6e-04
308dbj|AK178263.1| Mus musculus cDNA, clone:Y0G0106A17, strand:minu... 54 6e-04
309dbj|AK177099.1| Mus musculus cDNA, clone:Y0G0101J12, strand:minu... 54 6e-04
310emb|AL845356.8| Mouse DNA sequence from clone RP23-29O14 on chro... 54 6e-04
311dbj|AB096859.1| Trypanosoma congolense MTP70 mRNA for mitochondr... 54 6e-04
312gb|BC066191.1| Mus musculus heat shock protein 8, mRNA (cDNA clo... 54 6e-04
313gb|BC006722.1| Mus musculus heat shock protein 8, mRNA (cDNA clo... 54 6e-04
314gb|BC089457.1| Mus musculus heat shock protein 8, mRNA (cDNA clo... 54 6e-04
315gb|BC089322.1| Mus musculus heat shock protein 8, mRNA (cDNA clo... 54 6e-04
316gb|U73744.1|MMU73744 Mus musculus heat shock 70 protein (Hsc70) ... 54 6e-04
317gb|AY861684.1| Mytilus galloprovincialis HSP70 (HSP70) mRNA, com... 54 6e-04
318dbj|D21824.1|LILLIM18 Lilium longiflorum LIM18 mRNA, complete cd... 54 6e-04
319gb|U27129.1|MMU27129 Mus musculus breast heat shock 73 protein (... 54 6e-04
320ref|NM_174345.3| Bos taurus heat shock 70 kDa protein 8 (HSPA8),... 54 6e-04
321emb|X53827.1|BTHSCP Bovine mRNA for 7O KDa heat shock cognate pr... 54 6e-04
322emb|X53335.1|BT70HSP Bovine mRNA for a 70 Kd heat shock cognate ... 54 6e-04
323gb|M19141.1|MUSHSPCA Mouse heat shock protein 70 cognate mRNA, c... 54 6e-04
324gb|M34561.1|CRUHSP70A Chinese hamster heat shock protein (cognat... 54 6e-04
325gb|CP000069.1| Trypanosoma brucei chromosome 6, complete sequence 52 0.002
326gb|AC009259.8| Trypanosoma brucei chromosome 6 clone RPCI93-4F7,... 52 0.002
327gb|AE013061.1| Thermoanaerobacter tengcongensis MB4, section 88 ... 52 0.002
328gb|AC101093.9| Mus musculus chromosome 3, clone RP23-90B11, comp... 52 0.002
329ref|NM_010481.1| Mus musculus heat shock protein 9A (Hspa9a), mRNA 52 0.002
330ref|XR_002695.1| PREDICTED: Mus musculus similar to heat shock p... 52 0.002
331ref|XR_002283.1| PREDICTED: Mus musculus similar to heat shock p... 52 0.002
332ref|XR_003352.1| PREDICTED: Mus musculus similar to heat shock p... 52 0.002
333ref|XR_004778.1| PREDICTED: Mus musculus similar to heat shock p... 52 0.002
334ref|XR_001882.1| PREDICTED: Mus musculus similar to heat shock p... 52 0.002
335ref|XM_533290.2| PREDICTED: Canis familiaris similar to Heat sho... 52 0.002
336ref|XM_821586.1| Trypanosoma brucei TREU927 clone RPCI93-4F7 hea... 52 0.002
337ref|XM_821584.1| Trypanosoma brucei TREU927 clone RPCI93-4F7 hea... 52 0.002
338ref|XM_821574.1| Trypanosoma brucei TREU927 clone RPCI93-4F7 hea... 52 0.002
339ref|XM_847924.1| PREDICTED: Canis familiaris similar to heat sho... 52 0.002
340ref|XM_845937.1| PREDICTED: Canis familiaris similar to Heat sho... 52 0.002
341gb|AC114820.4| Mus musculus BAC clone RP23-70M6 from 18, complet... 52 0.002
342ref|XM_536543.2| PREDICTED: Canis familiaris similar to Heat sho... 52 0.002
343ref|XM_854379.1| PREDICTED: Canis familiaris similar to Heat sho... 52 0.002
344ref|XM_854344.1| PREDICTED: Canis familiaris similar to Heat sho... 52 0.002
345gb|AY143693.1| Gallus gallus heat shock protein Hsp70 (hsp70) ge... 52 0.002
346gb|AY143692.1| Gallus gallus heat shock protein Hsp70 (hsp70) ge... 52 0.002
347gb|AY143691.1| Gallus gallus heat shock protein Hsp70 (hsp70) ge... 52 0.002
348gb|AC144564.12| Medicago truncatula clone mth2-17n4, complete se... 52 0.002
349gb|AF502463.1| Lamna ditropis isolate Ladi2 Hsp70 protein (Hsp70... 52 0.002
350gb|AF502452.1| Alopias superciliosus isolate Alsu2 Hsp70 protein... 52 0.002
351gb|AF502451.1| Alopias superciliosus isolate Alsu1 Hsp70 protein... 52 0.002
352emb|BX571658.1| Wolinella succinogenes, complete genome; segment... 52 0.002
353gb|AY288303.1| Gallus gallus isolate Br-3-2 heat shock protein 7... 52 0.002
354gb|AY288302.1| Gallus gallus isolate Br-3-1 heat shock protein 7... 52 0.002
355gb|AY288301.1| Gallus gallus isolate Br-2-2 heat shock protein 7... 52 0.002
356gb|AY288300.1| Gallus gallus isolate Br-2-1 heat shock protein 7... 52 0.002
357gb|AY288299.1| Gallus gallus isolate Br-1-2 heat shock protein 7... 52 0.002
358gb|AY288298.1| Gallus gallus isolate Br-1-1 heat shock protein 7... 52 0.002
359ref|NM_001006685.1| Gallus gallus heat shock protein 70 (HSP70),... 52 0.002
360gb|AC117478.3| Homo sapiens 3 BAC RP11-598P12 (Roswell Park Canc... 52 0.002
361dbj|AB096696.1| Numida meleagris hsp70 mRNA for heat shock prote... 52 0.002
362dbj|AK133501.1| Mus musculus 11 days pregnant adult female ovary... 52 0.002
363dbj|AK137109.1| Mus musculus 12 days embryo embryonic body betwe... 52 0.002
364dbj|AK145965.1| Mus musculus 11 days pregnant adult female place... 52 0.002
365dbj|AK159791.1| Mus musculus osteoclast-like cell cDNA, RIKEN fu... 52 0.002
366dbj|AK161587.1| Mus musculus adult male pituitary gland cDNA, RI... 52 0.002
367gb|CP000254.1| Methanospirillum hungatei JF-1, complete genome 52 0.002
368dbj|AK167856.1| Mus musculus CRL-1722 L5178Y-R cDNA, RIKEN full-... 52 0.002
369dbj|AK165958.1| Mus musculus lung RCB-0558 LLC cDNA, RIKEN full-... 52 0.002
370gb|S78556.1| grp75=75 kda glucose regulated protein [rats, Sprag... 52 0.002
371gb|S75280.1| Rattus sp. pre-mtHSP70 mRNA, complete cds; nuclear ... 52 0.002
372dbj|AK002634.1| Mus musculus adult male kidney cDNA, RIKEN full-... 52 0.002
373dbj|AK004946.1| Mus musculus adult male liver cDNA, RIKEN full-l... 52 0.002
374dbj|AK030299.1| Mus musculus 11 days pregnant adult female ovary... 52 0.002
375emb|BX827178.1|CNS0A4AW Arabidopsis thaliana Full-length cDNA Co... 52 0.002
376dbj|D17666.2| Mus musculus domesticus gene for stress-70 protein... 52 0.002
377dbj|AB201748.1| Pocillopora damicornis mRNA for heat shock prote... 52 0.002
378gb|AY188684.1| Anaplasma centrale heat shock protein 70 gene, pa... 52 0.002
379ref|XM_214583.3| PREDICTED: Rattus norvegicus heat shock protein... 52 0.002
380ref|XM_579802.1| PREDICTED: Rattus norvegicus LOC498243 (LOC4982... 52 0.002
381ref|XM_575049.1| PREDICTED: Rattus norvegicus similar to heat sh... 52 0.002
382dbj|AK213508.1| Mus musculus cDNA, clone:Y2G0128I19, strand:minu... 52 0.002
383gb|AC107674.10| Mus musculus chromosome 1, clone RP24-302H24, co... 52 0.002
384gb|AY929184.1| Latimeria chalumnae heat shock protein 70 (Hsp70)... 52 0.002
385dbj|D11089.2|MUSP66 Mus musculus mRNA for p66 mot1, complete cds 52 0.002
386dbj|D17556.1|MUSPBP74 Mus musculus PBP74 mRNA for mitochondrial ... 52 0.002
387gb|AY582834.1| Corallochytrium limacisporum HSP70 gene, partial cds 52 0.002
388gb|AF026518.1|AF026518 Eunicella cavolini heat-shock protein Hsp... 52 0.002
389gb|BC057343.1| Mus musculus heat shock protein 9A, mRNA (cDNA cl... 52 0.002
390gb|BC052727.1| Mus musculus heat shock protein 9A, mRNA (cDNA cl... 52 0.002
391emb|X60059.1|NTBLP2 Nicotiana tabacum blp2 mRNA for luminal bind... 52 0.002
392gb|AC148774.4| Mus musculus chromosome 3, clone RP24-400J22, com... 52 0.002
393emb|AL844221.6| Mouse DNA sequence from clone RP23-445C3 on chro... 52 0.002
394gb|AC166749.6| Mus musculus chromosome 1, clone RP23-463A15, com... 52 0.002
395gb|J02579.1|CHKHSP Chicken 70 kd heat shock protein (HSP), compl... 52 0.002
396dbj|AB016836.1| Bombyx mori mRNA for heat shock 70 kD protein co... 52 0.002
397ref|XM_601626.2| PREDICTED: Bos taurus similar to Stress-70 prot... 50 0.010
398gb|U51235.1|MCU51235 Mycoplasma capricolum ClpB (clpB) gene, par... 50 0.010
399gb|AY380459.1| Cryptosporidium hominis isolate A29 70 kDa heat s... 50 0.010
400gb|AY380458.1| Cryptosporidium hominis isolate A5 70 kDa heat sh... 50 0.010
401ref|XM_446506.1| Candida glabrata CBS138, CAGL0G03289g partial mRNA 50 0.010
402ref|XM_858776.1| PREDICTED: Canis familiaris similar to Stress-7... 50 0.010
403ref|XM_858752.1| PREDICTED: Canis familiaris similar to Stress-7... 50 0.010
404ref|XM_858735.1| PREDICTED: Canis familiaris similar to Stress-7... 50 0.010
405ref|XM_858712.1| PREDICTED: Canis familiaris similar to Stress-7... 50 0.010
406ref|XM_858690.1| PREDICTED: Canis familiaris similar to Stress-7... 50 0.010
407ref|XM_858665.1| PREDICTED: Canis familiaris similar to Stress-7... 50 0.010
408ref|XM_858642.1| PREDICTED: Canis familiaris similar to Stress-7... 50 0.010
409ref|XM_858617.1| PREDICTED: Canis familiaris similar to Stress-7... 50 0.010
410ref|XM_858597.1| PREDICTED: Canis familiaris similar to Stress-7... 50 0.010
411ref|XM_858580.1| PREDICTED: Canis familiaris similar to Stress-7... 50 0.010
412ref|XM_858555.1| PREDICTED: Canis familiaris similar to Stress-7... 50 0.010
413ref|XM_858538.1| PREDICTED: Canis familiaris similar to Stress-7... 50 0.010
414ref|XM_858515.1| PREDICTED: Canis familiaris similar to Stress-7... 50 0.010
415ref|XM_858489.1| PREDICTED: Canis familiaris similar to Stress-7... 50 0.010
416ref|XM_858468.1| PREDICTED: Canis familiaris similar to Stress-7... 50 0.010
417ref|XM_858443.1| PREDICTED: Canis familiaris similar to Stress-7... 50 0.010
418ref|XM_531923.2| PREDICTED: Canis familiaris similar to Stress-7... 50 0.010
419ref|XM_661662.1| Cryptosporidium hominis TU502 heat shock protei... 50 0.010
420emb|X63106.1|NTHSP70 N.tabacum Nthsp70 mRNA for heat shock prote... 50 0.010
421emb|X54739.1|PSPHSP1 P.sativum PHSP1 mRNA for HSP70 50 0.010
422gb|AF502512.1| Isurus oxyrinchus isolate Isox9 Hsp70 pseudogene,... 50 0.010
423gb|AF502459.1| Alopias vulpinus isolate Alvu3 Hsp70 protein (Hsp... 50 0.010
424emb|CR380953.1| Candida glabrata strain CBS138 chromosome G comp... 50 0.010
425emb|BX842643.1| Mycoplasma mycoides subsp. mycoides SC genomic D... 50 0.010
426dbj|AK074834.1| Homo sapiens cDNA FLJ90353 fis, clone NT2RP2003383 50 0.010
427gb|AF401507.1| Cryptosporidium parvum isolate H299 heat shock pr... 50 0.010
428gb|AF401506.1| Cryptosporidium parvum isolate H83 heat shock pro... 50 0.010
429gb|AF401505.1| Cryptosporidium parvum isolate H419 heat shock pr... 50 0.010
430gb|AF401504.1| Cryptosporidium parvum isolate H180 heat shock pr... 50 0.010
431gb|AF401503.1| Cryptosporidium parvum isolate H135 heat shock pr... 50 0.010
432gb|CP000123.1| Mycoplasma capricolum subsp. capricolum ATCC 2734... 50 0.010
433gb|S85730.1| hsc71=major heat-shock-protein-like gene [rainbow t... 50 0.010
434gb|DQ295226.1| Trimastix marina cytosolic heat shock protein 70 ... 50 0.010
435gb|BC102334.1| Bos taurus heat shock 70kDa protein 9B (mortalin-... 50 0.010
436dbj|AB196460.1| Oncorhynchus mykiss HSC70A mRNA for heat shock 7... 50 0.010
437gb|AF221536.1|AF221536 Cryptosporidium wrairi heat shock protein... 50 0.010
438gb|AF221534.1|AF221534 Cryptosporidium parvum isolate 518 heat s... 50 0.010
439gb|AF221531.1|AF221531 Cryptosporidium parvum isolate 428 heat s... 50 0.010
440gb|AF150827.1|AF150827 Cryptosporidium parvum strain AWS12 heat ... 50 0.010
441gb|DQ324856.1| Haliotis discus hannai heat shock protein 70 mRNA... 50 0.010
442gb|DQ157867.1| Mycoplasma capricolum strain ULB-A heat shock pro... 50 0.010
443gb|DQ157866.1| Mycoplasma capricolum strain 700 heat shock prote... 50 0.010
444ref|NM_001034524.1| Bos taurus heat shock 70kDa protein 9B (mort... 50 0.010
445gb|DQ115005.1| Cryptosporidium hominis isolate SW21 heat shock p... 50 0.010
446gb|DQ115004.1| Cryptosporidium hominis isolate SW20 heat shock p... 50 0.010
447gb|DQ114996.1| Cryptosporidium hominis isolate CBHRC5 heat shock... 50 0.010
448gb|DQ114995.1| Cryptosporidium hominis isolate CBHRC4 heat shock... 50 0.010
449gb|DQ114992.1| Cryptosporidium hominis isolate CBHRC2 heat shock... 50 0.010
450gb|M90978.1|PFAHSP70B Plasmodium cynomolgi heat shock protein 70... 50 0.010
451ref|NM_119952.2| Arabidopsis thaliana MTHSC70-1; ATP binding AT4... 48 0.038
452ref|NM_120996.2| Arabidopsis thaliana mtHSC70-2 (HEAT SHOCK PROT... 48 0.038
453gb|BC056797.1| Danio rerio zgc:63663, mRNA (cDNA clone MGC:63663... 48 0.038
454gb|BT014578.1| Lycopersicon esculentum clone 134033R, mRNA sequence 48 0.038
455gb|AC107834.13| Mus musculus chromosome 1, clone RP23-251L12, co... 48 0.038
456gb|CP000121.1| Anabaena variabilis ATCC 29413 plasmid C, complet... 48 0.038
457ref|XM_848217.1| PREDICTED: Canis familiaris similar to Heat sho... 48 0.038
458ref|XM_848211.1| PREDICTED: Canis familiaris similar to heat sho... 48 0.038
459gb|AC122879.3| Mus musculus BAC clone RP23-76C10 from 1, complet... 48 0.038
460emb|X99197.1|MS70KDHSP M.sativa mRNA for 70 kD heat shock protein 48 0.038
461emb|X68213.1|SSHSP70 S.scrofa mRNA for heat shock protein 70 48 0.038
462gb|AF502481.1| Odontaspis ferox isolate Odfe4 Hsp70 protein (Hsp... 48 0.038
463gb|AF502472.1| Megachasma pelagios isolate Mepe3 Hsp70 protein (... 48 0.038
464gb|AF502471.1| Megachasma pelagios isolate Mepe2 Hsp70 protein (... 48 0.038
465gb|AF502460.1| Alopias vulpinus isolate Alvu4 Hsp70 protein (Hsp... 48 0.038
466gb|AF502458.1| Alopias vulpinus isolate Alvu2 Hsp70 protein (Hsp... 48 0.038
467gb|AF502444.1| Odontaspis ferox isolate Odfe3 Hsp70 protein (Hsp... 48 0.038
468gb|AF502437.1| Carcharias taurus isolate Cata2 Hsp70 protein (Hs... 48 0.038
469gb|AF502436.1| Carcharias taurus isolate Cata1 Hsp70 protein (Hs... 48 0.038
470emb|AL161592.2|ATCHRIV88 Arabidopsis thaliana DNA chromosome 4, ... 48 0.038
471emb|AL035538.1|ATF20D10 Arabidopsis thaliana DNA chromosome 4, B... 48 0.038
472gb|BT008430.1| Arabidopsis thaliana At4g37910 gene, complete cds 48 0.038
473ref|NM_200614.1| Danio rerio zgc:63663 (zgc:63663), mRNA 48 0.038
474gb|DQ224263.1| Semiaquilegia adoxoides putative heat shock prote... 48 0.038
475gb|DQ224262.1| Aquilegia olympica putative heat shock protein 70... 48 0.038
476gb|DQ224261.1| Aquilegia pyrenaica putative heat shock protein 7... 48 0.038
477gb|DQ224260.1| Aquilegia brevistyla putative heat shock protein ... 48 0.038
478gb|DQ224259.1| Aquilegia chrysantha putative heat shock protein ... 48 0.038
479gb|DQ224258.1| Aquilegia formosa putative heat shock protein 70 ... 48 0.038
480gb|CP000235.1| Anaplasma phagocytophilum HZ, complete genome 48 0.038
481dbj|AK221937.1| Arabidopsis thaliana mRNA for heat shock protein... 48 0.038
482gb|AF217458.1|AF217458 Arabidopsis thaliana heat shock protein 7... 48 0.038
483ref|XM_623127.1| PREDICTED: Apis mellifera similar to heat shock... 48 0.038
484gb|BT002390.1| Arabidopsis thaliana heat shock protein 70 like p... 48 0.038
485dbj|AK178505.1| Mus musculus cDNA, clone:Y0G0107A03, strand:minu... 48 0.038
486dbj|AB122062.1| Crassostrea gigas HSP68 mRNA for 68kDa heat shoc... 48 0.038
487emb|Z33364.1|MCABB M.capricolum DNA for CONTIG MCABB 48 0.038
488gb|AF029321.1|AF029321 Ehrlichia sp. 'HGE agent' heat shock prot... 48 0.038
489gb|AY582836.1| Ministeria vibrans strain ATCC 50519 HSP70 mRNA, ... 48 0.038
490emb|AL353994.1|ATF17I14 Arabidopsis thaliana DNA chromosome 5, B... 48 0.038
491ref|NM_120328.2| Arabidopsis thaliana HSC70-1; ATP binding AT5G0... 46 0.15
492ref|XM_521845.1| PREDICTED: Pan troglodytes similar to RIKEN cDN... 46 0.15
493ref|XM_517960.1| PREDICTED: Pan troglodytes heat shock 70kDa pro... 46 0.15
494gb|AE017354.1| Legionella pneumophila subsp. pneumophila str. Ph... 46 0.15
495gb|AC102469.7| Mus musculus chromosome 1, clone RP24-356O3, comp... 46 0.15
496gb|BC077998.1| Xenopus laevis cDNA clone MGC:82390 IMAGE:4406669... 46 0.15
497gb|BC078115.1| Xenopus laevis cDNA clone MGC:83630 IMAGE:5084801... 46 0.15
498gb|DQ531046.1| Homo sapiens heat shock 70kDa protein 9B (mortali... 46 0.15
499gb|BC024034.2| Homo sapiens heat shock 70kDa protein 9B (mortali... 46 0.15
500ref|NM_004134.4| Homo sapiens heat shock 70kDa protein 9B (morta... 46 0.15

>gb|AC108762.2| Oryza sativa (japonica cultivar-group) chromosome 9 clone
             OSJNBb0052C07, complete sequence
          Length = 154528

 Score =  408 bits (206), Expect = e-111
 Identities = 416/486 (85%)
 Strand = Plus / Minus

                                                                         
Query: 198   tcctggtactcagcttcctgagtctggtcgccaccactgctgccgctgtcaccgtcgccg 257
             |||||||| ||||| ||  |||||||||| ||||||||||||| ||||   ||| |||| 
Sbjct: 52264 tcctggtattcagcctcaggagtctggtcaccaccactgctgctgctgctgccgccgcca 52205

                                                                         
Query: 258   ccggcagcgccgccaccaccctgcatgtgctgtccaatctttgagactgccttgttcgct 317
             | | |  | ||||||||    |||||||||| |||||||||||| ||||||||||| || 
Sbjct: 52204 ctgccgccaccgccaccttgttgcatgtgctctccaatctttgaaactgccttgtttgca 52145

                                                                         
Query: 318   gcctccagcttctgcttgatggcgtccaaatcatcaccagccattgctgctctcagatca 377
             ||||| ||||||||||||||    |||||||||||  |||||||||||||||| ||||||
Sbjct: 52144 gcctcaagcttctgcttgatcttctccaaatcatcctcagccattgctgctcttagatca 52085

                                                                         
Query: 378   gaaacagcagactggatttccgtgacgacttcagcaggaaccttgtctttgtactcgctg 437
             || ||||||||||| || ||  ||  ||||||||||||||||||||| |||||||| |||
Sbjct: 52084 gatacagcagactgaatctcattggtgacttcagcaggaaccttgtccttgtactcactg 52025

                                                                         
Query: 438   acgctcttctcgatgctgtagatggtggtatcggcagagttcctgaggtcaatcaaagac 497
             || |||||||| ||||||||||| ||||| || ||||||||| | || |||||||| || 
Sbjct: 52024 acactcttctcaatgctgtagatcgtggtgtctgcagagttcttcagatcaatcaatgat 51965

                                                                         
Query: 498   ttcctttcctgatccctctgagaatttagctcagcctccttcaccatcttttcgatgtca 557
             ||||||||||||||| ||||||||| ||||||||||||| |||||||||| ||||| |||
Sbjct: 51964 ttcctttcctgatccttctgagaatgtagctcagcctccctcaccatcttctcgatatca 51905

                                                                         
Query: 558   ctgtcagacaaaccacctgaagatttgatggtgatatcctgctctttgcccgtggactta 617
             || ||||||||||| |||||||| || || ||||| || ||||||||||| |||||||| 
Sbjct: 51904 ctttcagacaaaccgcctgaagactttatagtgatttcttgctctttgccagtggacttg 51845

                                                                         
Query: 618   tcctttgctgacaccttgacaataccattggcatcaatgtcaaaagtgacctcaatctgt 677
             ||||| ||||||||||||||||||||||||||||| ||||| || |||||||||||||| 
Sbjct: 51844 tccttggctgacaccttgacaataccattggcatcgatgtcgaatgtgacctcaatctga 51785

                   
Query: 678   ggcata 683
             ||||||
Sbjct: 51784 ggcata 51779



to top

>dbj|AK069787.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023030H18, full
            insert sequence
          Length = 2362

 Score =  400 bits (202), Expect = e-108
 Identities = 415/486 (85%)
 Strand = Plus / Minus

                                                                        
Query: 198  tcctggtactcagcttcctgagtctggtcgccaccactgctgccgctgtcaccgtcgccg 257
            |||||||| ||||| ||  |||||||||| ||||||||||||| ||||   ||| |||| 
Sbjct: 2147 tcctggtattcagcctcaggagtctggtcaccaccactgctgctgctgctgccgccgcca 2088

                                                                        
Query: 258  ccggcagcgccgccaccaccctgcatgtgctgtccaatctttgagactgccttgttcgct 317
            | | |  | ||||||||    |||||||||| |||||||||||| ||||||||||| || 
Sbjct: 2087 ctgccgccaccgccaccttgttgcatgtgctctccaatctttgaaactgccttgtttgca 2028

                                                                        
Query: 318  gcctccagcttctgcttgatggcgtccaaatcatcaccagccattgctgctctcagatca 377
            ||||| ||||||||||||||    |||||||||||  |||||||||||||||| ||||||
Sbjct: 2027 gcctcaagcttctgcttgatcttctccaaatcatcctcagccattgctgctcttagatca 1968

                                                                        
Query: 378  gaaacagcagactggatttccgtgacgacttcagcaggaaccttgtctttgtactcgctg 437
            || ||||||||||| || ||  ||  ||||||||||||||||||||| |||||||| |||
Sbjct: 1967 gatacagcagactgaatctcattggtgacttcagcaggaaccttgtccttgtactcactg 1908

                                                                        
Query: 438  acgctcttctcgatgctgtagatggtggtatcggcagagttcctgaggtcaatcaaagac 497
            || |||||||| ||||||||||| ||||| || ||||||||| | || |||||||| || 
Sbjct: 1907 acactcttctcaatgctgtagatcgtggtgtctgcagagttcttcagatcaatcaatgat 1848

                                                                        
Query: 498  ttcctttcctgatccctctgagaatttagctcagcctccttcaccatcttttcgatgtca 557
            ||||||||||||||| ||||||||| ||||||||||||| |||||||||| ||||| |||
Sbjct: 1847 ttcctttcctgatccttctgagaatgtagctcagcctccctcaccatcttctcgatatca 1788

                                                                        
Query: 558  ctgtcagacaaaccacctgaagatttgatggtgatatcctgctctttgcccgtggactta 617
            || ||||||||||| |||||||| || || ||||| || ||||||||||| |||||||| 
Sbjct: 1787 ctttcagacaaaccgcctgaagactttatagtgatttcttgctctttgccagtggacttg 1728

                                                                        
Query: 618  tcctttgctgacaccttgacaataccattggcatcaatgtcaaaagtgacctcaatctgt 677
            ||| | ||||||||||||||||||||||||||||| ||||| || |||||||||||||| 
Sbjct: 1727 tccctggctgacaccttgacaataccattggcatcgatgtcgaatgtgacctcaatctga 1668

                  
Query: 678  ggcata 683
            ||||||
Sbjct: 1667 ggcata 1662



to top

>gb|AY109275.1| Zea mays PCO093820 mRNA sequence
          Length = 1420

 Score =  337 bits (170), Expect = 3e-89
 Identities = 426/510 (83%), Gaps = 6/510 (1%)
 Strand = Plus / Minus

                                                                        
Query: 176  ctacatcttggcctccttggggtcctggtactcagcttcctgagtctggtcgccaccac- 234
            |||||||||||| ||||| | ||||||||||||||||||  |||||||||| || |||| 
Sbjct: 1218 ctacatcttggcttcctttgcgtcctggtactcagcttctggagtctggtctcctccact 1159

                                                                        
Query: 235  --tgctgccgctgtcaccgtcgccgccggcagcgccgccaccaccctgcatgtgctgtcc 292
              ||||||||||| | ||  ||| ||||     |||||||||    |||||||||| |||
Sbjct: 1158 gctgctgccgctgccgccagcgctgccgct---gccgccaccttgttgcatgtgctctcc 1102

                                                                        
Query: 293  aatctttgagactgccttgttcgctgcctccagcttctgcttgatggcgtccaaatcatc 352
            ||||||||| || |||||||| ||||| |||||||||||||||||   ||||| ||| ||
Sbjct: 1101 aatctttgaaacagccttgtttgctgcttccagcttctgcttgatcttgtccagatcgtc 1042

                                                                        
Query: 353  accagccattgctgctctcagatcagaaacagcagactggatttccgtgacgacttcagc 412
              ||||||| ||||| ||||||||||| ||||||||||  || ||| ||  |||||||||
Sbjct: 1041 ctcagccatagctgccctcagatcagagacagcagactcaatctccttggtgacttcagc 982

                                                                        
Query: 413  aggaaccttgtctttgtactcgctgacgctcttctcgatgctgtagatggtggtatcggc 472
            ||| |||||||| |||||||||||||| |||||||| ||||||||||| |||||||| ||
Sbjct: 981  agggaccttgtccttgtactcgctgacactcttctcaatgctgtagatcgtggtatctgc 922

                                                                        
Query: 473  agagttcctgaggtcaatcaaagacttcctttcctgatccctctgagaatttagctcagc 532
            ||||||| |||| ||||| | ||||||||||||||| ||| ||||||||| |||||| ||
Sbjct: 921  agagttcttgagatcaataagagacttcctttcctggtccttctgagaatgtagctctgc 862

                                                                        
Query: 533  ctccttcaccatcttttcgatgtcactgtcagacaaaccacctgaagatttgatggtgat 592
            ||||||||||||||| || || ||    || ||||||||||| ||||| |||||||||||
Sbjct: 861  ctccttcaccatcttctcaatttcgacctctgacaaaccaccagaagacttgatggtgat 802

                                                                        
Query: 593  atcctgctctttgcccgtggacttatcctttgctgacaccttgacaataccattggcatc 652
             || || |||||||| ||||  || ||| | ||||||||||| ||||| |||||||||||
Sbjct: 801  ttcttgttctttgcctgtggctttgtccctagctgacacctttacaatgccattggcatc 742

                                          
Query: 653  aatgtcaaaagtgacctcaatctgtggcat 682
            ||||||||| || ||||| ||||| |||||
Sbjct: 741  aatgtcaaaggtaacctcgatctggggcat 712



to top

>gb|AC148396.3| Medicago truncatula chromosome 2 BAC clone mth2-17k4, complete sequence
          Length = 108273

 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 77/88 (87%)
 Strand = Plus / Minus

                                                                         
Query: 596   ctgctctttgcccgtggacttatcctttgctgacaccttgacaataccattggcatcaat 655
             ||||||||| || |||||||| ||||| || |||||  | |||||||| |||||||||||
Sbjct: 38406 ctgctctttaccagtggacttgtccttggcagacacggtaacaataccgttggcatcaat 38347

                                         
Query: 656   gtcaaaagtgacctcaatctgtggcata 683
             |||||| |||||||||||||| ||||||
Sbjct: 38346 gtcaaaggtgacctcaatctgaggcata 38319



to top

>ref|XM_855139.1| PREDICTED: Canis familiaris similar to heat shock 70kDa protein
            1-like, transcript variant 2 (LOC474850), mRNA
          Length = 2252

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 69/79 (87%)
 Strand = Plus / Minus

                                                                        
Query: 603  ttgcccgtggacttatcctttgctgacaccttgacaataccattggcatcaatgtcaaaa 662
            |||||||||||||| ||| | ||||  || |||| |||||||||||||||||||||||| 
Sbjct: 1520 ttgcccgtggacttgtccatggctgttacattgagaataccattggcatcaatgtcaaag 1461

                               
Query: 663  gtgacctcaatctgtggca 681
            || ||||||||||| ||||
Sbjct: 1460 gtcacctcaatctggggca 1442



to top

>ref|XM_532082.2| PREDICTED: Canis familiaris similar to heat shock 70kDa protein
            1-like, transcript variant 1 (LOC474850), mRNA
          Length = 2324

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 69/79 (87%)
 Strand = Plus / Minus

                                                                        
Query: 603  ttgcccgtggacttatcctttgctgacaccttgacaataccattggcatcaatgtcaaaa 662
            |||||||||||||| ||| | ||||  || |||| |||||||||||||||||||||||| 
Sbjct: 1592 ttgcccgtggacttgtccatggctgttacattgagaataccattggcatcaatgtcaaag 1533

                               
Query: 663  gtgacctcaatctgtggca 681
            || ||||||||||| ||||
Sbjct: 1532 gtcacctcaatctggggca 1514



to top

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 62/70 (88%)
 Strand = Plus / Plus

                                                                          
Query: 614    cttatcctttgctgacaccttgacaataccattggcatcaatgtcaaaagtgacctcaat 673
              ||||||||||||||| ||| | || || ||||||||||| ||||| || |||||||||||
Sbjct: 745859 cttatcctttgctgagaccgtcacgattccattggcatcgatgtcgaatgtgacctcaat 745918

                        
Query: 674    ctgtggcata 683
              ||||||||||
Sbjct: 745919 ctgtggcata 745928



 Score = 42.1 bits (21), Expect = 2.4
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                               
Query: 281    catgtgctgtccaatctttgagactgccttgtt 313
              |||||| || |||||||||||||| ||||||||
Sbjct: 745526 catgtgttgcccaatctttgagacagccttgtt 745558



 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 258      ccggcagcgccgccaccacc 277
                ||||||||||||||||||||
Sbjct: 26026064 ccggcagcgccgccaccacc 26026045



 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 253     cgccgccggcagcgccgcca 272
               ||||||||||||||||||||
Sbjct: 9628507 cgccgccggcagcgccgcca 9628488



to top

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3,
              complete sequence
          Length = 36192742

 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 62/70 (88%)
 Strand = Plus / Plus

                                                                          
Query: 614    cttatcctttgctgacaccttgacaataccattggcatcaatgtcaaaagtgacctcaat 673
              ||||||||||||||| ||| | || || ||||||||||| ||||| || |||||||||||
Sbjct: 745857 cttatcctttgctgagaccgtcacgattccattggcatcgatgtcgaatgtgacctcaat 745916

                        
Query: 674    ctgtggcata 683
              ||||||||||
Sbjct: 745917 ctgtggcata 745926



 Score = 42.1 bits (21), Expect = 2.4
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                               
Query: 281    catgtgctgtccaatctttgagactgccttgtt 313
              |||||| || |||||||||||||| ||||||||
Sbjct: 745524 catgtgttgcccaatctttgagacagccttgtt 745556



 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 258      ccggcagcgccgccaccacc 277
                ||||||||||||||||||||
Sbjct: 26117327 ccggcagcgccgccaccacc 26117308



 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 253     cgccgccggcagcgccgcca 272
               ||||||||||||||||||||
Sbjct: 9626628 cgccgccggcagcgccgcca 9626609



to top

>gb|AC134237.2| Oryza sativa (japonica cultivar-group) chromosome 3 clone
             OSJNBa0090O10, complete sequence
          Length = 162132

 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 62/70 (88%)
 Strand = Plus / Plus

                                                                         
Query: 614   cttatcctttgctgacaccttgacaataccattggcatcaatgtcaaaagtgacctcaat 673
             ||||||||||||||| ||| | || || ||||||||||| ||||| || |||||||||||
Sbjct: 41404 cttatcctttgctgagaccgtcacgattccattggcatcgatgtcgaatgtgacctcaat 41463

                       
Query: 674   ctgtggcata 683
             ||||||||||
Sbjct: 41464 ctgtggcata 41473



 Score = 42.1 bits (21), Expect = 2.4
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                              
Query: 281   catgtgctgtccaatctttgagactgccttgtt 313
             |||||| || |||||||||||||| ||||||||
Sbjct: 41071 catgtgttgcccaatctttgagacagccttgtt 41103



to top

>gb|AC121490.2| Oryza sativa (japonica cultivar-group) chromosome 3 clone OSJNBb0005F16,
              complete sequence
          Length = 160053

 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 62/70 (88%)
 Strand = Plus / Plus

                                                                          
Query: 614    cttatcctttgctgacaccttgacaataccattggcatcaatgtcaaaagtgacctcaat 673
              ||||||||||||||| ||| | || || ||||||||||| ||||| || |||||||||||
Sbjct: 131740 cttatcctttgctgagaccgtcacgattccattggcatcgatgtcgaatgtgacctcaat 131799

                        
Query: 674    ctgtggcata 683
              ||||||||||
Sbjct: 131800 ctgtggcata 131809



 Score = 42.1 bits (21), Expect = 2.4
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                               
Query: 281    catgtgctgtccaatctttgagactgccttgtt 313
              |||||| || |||||||||||||| ||||||||
Sbjct: 131407 catgtgttgcccaatctttgagacagccttgtt 131439



to top

>dbj|AK103835.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033148E17, full
            insert sequence
          Length = 2485

 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 62/70 (88%)
 Strand = Plus / Minus

                                                                        
Query: 614  cttatcctttgctgacaccttgacaataccattggcatcaatgtcaaaagtgacctcaat 673
            ||||||||||||||| ||| | || || ||||||||||| ||||| || |||||||||||
Sbjct: 1733 cttatcctttgctgagaccgtcacgattccattggcatcgatgtcgaatgtgacctcaat 1674

                      
Query: 674  ctgtggcata 683
            ||||||||||
Sbjct: 1673 ctgtggcata 1664



 Score = 42.1 bits (21), Expect = 2.4
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                             
Query: 281  catgtgctgtccaatctttgagactgccttgtt 313
            |||||| || |||||||||||||| ||||||||
Sbjct: 2066 catgtgttgcccaatctttgagacagccttgtt 2034



to top

>ref|XM_468043.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 2332

 Score = 71.9 bits (36), Expect = 3e-09
 Identities = 84/100 (84%)
 Strand = Plus / Minus

                                                                        
Query: 584  gatggtgatatcctgctctttgcccgtggacttatcctttgctgacaccttgacaatacc 643
            ||||||||| | |||||| || || || ||||| || ||||| || ||| | ||||| ||
Sbjct: 1724 gatggtgatttgctgctccttcccggtagacttgtcttttgcagagaccgtcacaattcc 1665

                                                    
Query: 644  attggcatcaatgtcaaaagtgacctcaatctgtggcata 683
            ||||||||| |||||||| |||||||| ||||||||||||
Sbjct: 1664 attggcatcgatgtcaaatgtgacctcgatctgtggcata 1625



to top

>emb|AJ719486.1| Gallus gallus mRNA for hypothetical protein, clone 2m8
          Length = 3084

 Score = 71.9 bits (36), Expect = 3e-09
 Identities = 57/64 (89%)
 Strand = Plus / Minus

                                                                        
Query: 618  tcctttgctgacaccttgacaataccattggcatcaatgtcaaaagtgacctcaatctgt 677
            ||||| |||||||| |  || |||||||| ||||||||||||||||||||||||||||| 
Sbjct: 1969 tccttggctgacacatgaacgataccattagcatcaatgtcaaaagtgacctcaatctgg 1910

                
Query: 678  ggca 681
            ||||
Sbjct: 1909 ggca 1906



to top

>ref|NM_001006147.1| Gallus gallus heat shock 70kDa protein 9B (mortalin-2) (HSPA9B), mRNA
          Length = 3084

 Score = 71.9 bits (36), Expect = 3e-09
 Identities = 57/64 (89%)
 Strand = Plus / Minus

                                                                        
Query: 618  tcctttgctgacaccttgacaataccattggcatcaatgtcaaaagtgacctcaatctgt 677
            ||||| |||||||| |  || |||||||| ||||||||||||||||||||||||||||| 
Sbjct: 1969 tccttggctgacacatgaacgataccattagcatcaatgtcaaaagtgacctcaatctgg 1910

                
Query: 678  ggca 681
            ||||
Sbjct: 1909 ggca 1906



to top

>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
                sequence
          Length = 35954743

 Score = 71.9 bits (36), Expect = 3e-09
 Identities = 84/100 (84%)
 Strand = Plus / Plus

                                                                            
Query: 584      gatggtgatatcctgctctttgcccgtggacttatcctttgctgacaccttgacaatacc 643
                ||||||||| | |||||| || || || ||||| || ||||| || ||| | ||||| ||
Sbjct: 32707873 gatggtgatttgctgctccttcccggtagacttgtcttttgcagagaccgtcacaattcc 32707932

                                                        
Query: 644      attggcatcaatgtcaaaagtgacctcaatctgtggcata 683
                ||||||||| |||||||| |||||||| ||||||||||||
Sbjct: 32707933 attggcatcgatgtcaaatgtgacctcgatctgtggcata 32707972



to top

>dbj|AP004853.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OJ1448_G06
          Length = 136823

 Score = 71.9 bits (36), Expect = 3e-09
 Identities = 84/100 (84%)
 Strand = Plus / Plus

                                                                         
Query: 584   gatggtgatatcctgctctttgcccgtggacttatcctttgctgacaccttgacaatacc 643
             ||||||||| | |||||| || || || ||||| || ||||| || ||| | ||||| ||
Sbjct: 36108 gatggtgatttgctgctccttcccggtagacttgtcttttgcagagaccgtcacaattcc 36167

                                                     
Query: 644   attggcatcaatgtcaaaagtgacctcaatctgtggcata 683
             ||||||||| |||||||| |||||||| ||||||||||||
Sbjct: 36168 attggcatcgatgtcaaatgtgacctcgatctgtggcata 36207



to top

>dbj|AP004068.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
              clone:OJ1611_C08
          Length = 135386

 Score = 71.9 bits (36), Expect = 3e-09
 Identities = 84/100 (84%)
 Strand = Plus / Plus

                                                                          
Query: 584    gatggtgatatcctgctctttgcccgtggacttatcctttgctgacaccttgacaatacc 643
              ||||||||| | |||||| || || || ||||| || ||||| || ||| | ||||| ||
Sbjct: 135244 gatggtgatttgctgctccttcccggtagacttgtcttttgcagagaccgtcacaattcc 135303

                                                      
Query: 644    attggcatcaatgtcaaaagtgacctcaatctgtggcata 683
              ||||||||| |||||||| |||||||| ||||||||||||
Sbjct: 135304 attggcatcgatgtcaaatgtgacctcgatctgtggcata 135343



to top

>dbj|AK065228.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013002H04, full
            insert sequence
          Length = 2397

 Score = 71.9 bits (36), Expect = 3e-09
 Identities = 84/100 (84%)
 Strand = Plus / Minus

                                                                        
Query: 584  gatggtgatatcctgctctttgcccgtggacttatcctttgctgacaccttgacaatacc 643
            ||||||||| | |||||| || || || ||||| || ||||| || ||| | ||||| ||
Sbjct: 1724 gatggtgatttgctgctccttcccggtagacttgtcttttgcagagaccgtcacaattcc 1665

                                                    
Query: 644  attggcatcaatgtcaaaagtgacctcaatctgtggcata 683
            ||||||||| |||||||| |||||||| ||||||||||||
Sbjct: 1664 attggcatcgatgtcaaatgtgacctcgatctgtggcata 1625



to top

>dbj|AK060740.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-032-D07, full
            insert sequence
          Length = 1675

 Score = 71.9 bits (36), Expect = 3e-09
 Identities = 84/100 (84%)
 Strand = Plus / Minus

                                                                        
Query: 584  gatggtgatatcctgctctttgcccgtggacttatcctttgctgacaccttgacaatacc 643
            ||||||||| | |||||| || || || ||||| || ||||| || ||| | ||||| ||
Sbjct: 1044 gatggtgatttgctgctccttcccggtagacttgtcttttgcagagaccgtcacaattcc 985

                                                    
Query: 644  attggcatcaatgtcaaaagtgacctcaatctgtggcata 683
            ||||||||| |||||||| |||||||| ||||||||||||
Sbjct: 984  attggcatcgatgtcaaatgtgacctcgatctgtggcata 945



to top

>emb|BX897700.1| Bartonella quintana str. Toulouse, complete genome
          Length = 1581384

 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 59/67 (88%)
 Strand = Plus / Minus

                                                                         
Query: 615   ttatcctttgctgacaccttgacaataccattggcatcaatgtcaaaagtgacctcaatc 674
             ||||||||||| || || || ||||||||||| |||||||| |||||||| |||||||||
Sbjct: 81065 ttatcctttgccgaaacatttacaataccattcgcatcaatatcaaaagtaacctcaatc 81006

                    
Query: 675   tgtggca 681
             || ||||
Sbjct: 81005 tgaggca 80999



to top

>emb|BX897699.1| Bartonella henselae strain Houston-1, complete genome
          Length = 1931047

 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 59/67 (88%)
 Strand = Plus / Minus

                                                                         
Query: 615   ttatcctttgctgacaccttgacaataccattggcatcaatgtcaaaagtgacctcaatc 674
             |||||||| || || || |||||||||||||| |||||||| |||||||| |||||||||
Sbjct: 89288 ttatccttggccgaaacattgacaataccattcgcatcaatatcaaaagtaacctcaatc 89229

                    
Query: 675   tgtggca 681
             || ||||
Sbjct: 89228 tgaggca 89222



to top

>gb|AF142571.1|AF142571 Saguinus oedipus intracellular vitamin D binding protein 1 (IDBP1)
            mRNA, complete cds
          Length = 2260

 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                               
Query: 642  ccattggcatcaatgtcaaaagtgacctcaatctg 676
            |||||||||||||||||||||||||||||||||||
Sbjct: 1519 ccattggcatcaatgtcaaaagtgacctcaatctg 1485



to top

>ref|XM_508830.1| PREDICTED: Pan troglodytes heat shock 70kDa protein 8 (LOC451629),
            mRNA
          Length = 3500

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 37/38 (97%)
 Strand = Plus / Minus

                                                  
Query: 639  ataccattggcatcaatgtcaaaagtgacctcaatctg 676
            ||||||||||||||||||||||||||||| ||||||||
Sbjct: 2759 ataccattggcatcaatgtcaaaagtgacttcaatctg 2722



to top

>gb|BC016660.1| Homo sapiens heat shock 70kDa protein 8, transcript variant 1, mRNA
            (cDNA clone MGC:9495 IMAGE:3923981), complete cds
          Length = 2259

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 37/38 (97%)
 Strand = Plus / Minus

                                                  
Query: 639  ataccattggcatcaatgtcaaaagtgacctcaatctg 676
            ||||||||||||||||||||||||||||| ||||||||
Sbjct: 1512 ataccattggcatcaatgtcaaaagtgacttcaatctg 1475



to top

>gb|BC016179.1| Homo sapiens heat shock 70kDa protein 8, transcript variant 1, mRNA
            (cDNA clone MGC:17984 IMAGE:3920744), complete cds
          Length = 2276

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 37/38 (97%)
 Strand = Plus / Minus

                                                  
Query: 639  ataccattggcatcaatgtcaaaagtgacctcaatctg 676
            ||||||||||||||||||||||||||||| ||||||||
Sbjct: 1512 ataccattggcatcaatgtcaaaagtgacttcaatctg 1475



to top

>gb|BC019816.2| Homo sapiens heat shock 70kDa protein 8, transcript variant 1, mRNA
            (cDNA clone MGC:29929 IMAGE:2899894), complete cds
          Length = 2250

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 37/38 (97%)
 Strand = Plus / Minus

                                                  
Query: 639  ataccattggcatcaatgtcaaaagtgacctcaatctg 676
            ||||||||||||||||||||||||||||| ||||||||
Sbjct: 1512 ataccattggcatcaatgtcaaaagtgacttcaatctg 1475



to top

>gb|BC007276.1| Homo sapiens heat shock 70kDa protein 8, mRNA (cDNA clone
            IMAGE:3162067), partial cds
          Length = 2031

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 37/38 (97%)
 Strand = Plus / Minus

                                                  
Query: 639  ataccattggcatcaatgtcaaaagtgacctcaatctg 676
            ||||||||||||||||||||||||||||| ||||||||
Sbjct: 1279 ataccattggcatcaatgtcaaaagtgacttcaatctg 1242



to top

>ref|NM_006597.3| Homo sapiens heat shock 70kDa protein 8 (HSPA8), transcript variant
            1, mRNA
          Length = 2276

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 37/38 (97%)
 Strand = Plus / Minus

                                                  
Query: 639  ataccattggcatcaatgtcaaaagtgacctcaatctg 676
            ||||||||||||||||||||||||||||| ||||||||
Sbjct: 1532 ataccattggcatcaatgtcaaaagtgacttcaatctg 1495



to top

>gb|BC008907.2| Homo sapiens heat shock 70kDa protein 8, mRNA (cDNA clone
           IMAGE:3836086), partial cds
          Length = 919

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 37/38 (97%)
 Strand = Plus / Minus

                                                 
Query: 639 ataccattggcatcaatgtcaaaagtgacctcaatctg 676
           ||||||||||||||||||||||||||||| ||||||||
Sbjct: 174 ataccattggcatcaatgtcaaaagtgacttcaatctg 137



to top

>gb|BC002423.1| Homo sapiens ribosomal protein L8, mRNA (cDNA clone IMAGE:3163368),
           **** WARNING: chimeric clone ****
          Length = 1912

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 37/38 (97%)
 Strand = Plus / Minus

                                                 
Query: 639 ataccattggcatcaatgtcaaaagtgacctcaatctg 676
           ||||||||||||||||||||||||||||| ||||||||
Sbjct: 274 ataccattggcatcaatgtcaaaagtgacttcaatctg 237



to top

>gb|BC041201.1| Xenopus laevis Heat shock cognate protein 70, mRNA (cDNA clone
            MGC:52655 IMAGE:4681532), complete cds
          Length = 2238

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 37/38 (97%)
 Strand = Plus / Minus

                                                  
Query: 639  ataccattggcatcaatgtcaaaagtgacctcaatctg 676
            |||||||||||||||||||||||||| |||||||||||
Sbjct: 1522 ataccattggcatcaatgtcaaaagtcacctcaatctg 1485



to top

>gb|AC009945.2| Homo sapiens BAC clone CTD-2060L22 from 7, complete sequence
          Length = 75517

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 37/38 (97%)
 Strand = Plus / Plus

                                                   
Query: 639   ataccattggcatcaatgtcaaaagtgacctcaatctg 676
             ||||||||||||||||||||||||||||| ||||||||
Sbjct: 46181 ataccattggcatcaatgtcaaaagtgacttcaatctg 46218



to top

>gb|BC002644.2| Homo sapiens hypothetical protein MGC4859 similar to HSPA8, mRNA
           (cDNA clone IMAGE:3605453), partial cds
          Length = 3142

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 37/38 (97%)
 Strand = Plus / Plus

                                                 
Query: 639 ataccattggcatcaatgtcaaaagtgacctcaatctg 676
           ||||||||||||||||||||||||||||| ||||||||
Sbjct: 174 ataccattggcatcaatgtcaaaagtgacttcaatctg 211



to top

>gb|BC112920.1| Homo sapiens cDNA clone IMAGE:7484542, **** WARNING: chimeric clone
           ****
          Length = 1273

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 37/38 (97%)
 Strand = Plus / Minus

                                                 
Query: 639 ataccattggcatcaatgtcaaaagtgacctcaatctg 676
           ||||||||||||||||||||||||||||| ||||||||
Sbjct: 525 ataccattggcatcaatgtcaaaagtgacttcaatctg 488



to top

>emb|Y00371.1|HSHSC70 Human hsc70 gene for 71 kd heat shock cognate protein
          Length = 5408

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 37/38 (97%)
 Strand = Plus / Minus

                                                  
Query: 639  ataccattggcatcaatgtcaaaagtgacctcaatctg 676
            ||||||||||||||||||||||||||||| ||||||||
Sbjct: 3665 ataccattggcatcaatgtcaaaagtgacttcaatctg 3628



to top

>emb|CR925990.1| Pongo pygmaeus mRNA; cDNA DKFZp459M2220 (from clone DKFZp459M2220)
          Length = 2297

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 37/38 (97%)
 Strand = Plus / Minus

                                                  
Query: 639  ataccattggcatcaatgtcaaaagtgacctcaatctg 676
            ||||||||||||||||||||||||||||| ||||||||
Sbjct: 1551 ataccattggcatcaatgtcaaaagtgacttcaatctg 1514



to top

>emb|CR861166.1| Pongo pygmaeus mRNA; cDNA DKFZp459P2416 (from clone DKFZp459P2416)
          Length = 2324

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 37/38 (97%)
 Strand = Plus / Minus

                                                  
Query: 639  ataccattggcatcaatgtcaaaagtgacctcaatctg 676
            ||||||||||||||||||||||||||||| ||||||||
Sbjct: 1579 ataccattggcatcaatgtcaaaagtgacttcaatctg 1542



to top

>emb|CR860584.1| Pongo pygmaeus mRNA; cDNA DKFZp459L1519 (from clone DKFZp459L1519)
          Length = 2041

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 37/38 (97%)
 Strand = Plus / Minus

                                                  
Query: 639  ataccattggcatcaatgtcaaaagtgacctcaatctg 676
            ||||||||||||||||||||||||||||| ||||||||
Sbjct: 1304 ataccattggcatcaatgtcaaaagtgacttcaatctg 1267



to top

>emb|CR859135.1| Pongo pygmaeus mRNA; cDNA DKFZp459D1928 (from clone DKFZp459D1928)
          Length = 2362

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 37/38 (97%)
 Strand = Plus / Minus

                                                  
Query: 639  ataccattggcatcaatgtcaaaagtgacctcaatctg 676
            ||||||||||||||||||||||||||||| ||||||||
Sbjct: 1575 ataccattggcatcaatgtcaaaagtgacttcaatctg 1538



to top

>emb|CR623327.1| full-length cDNA clone CL0BB012ZA08 of Neuroblastoma of Homo
           sapiens (human)
          Length = 1178

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 37/38 (97%)
 Strand = Plus / Minus

                                                 
Query: 639 ataccattggcatcaatgtcaaaagtgacctcaatctg 676
           ||||||||||||||||||||||||||||| ||||||||
Sbjct: 470 ataccattggcatcaatgtcaaaagtgacttcaatctg 433



to top

>emb|CR618855.1| full-length cDNA clone CS0DA004YH14 of Neuroblastoma of Homo
           sapiens (human)
          Length = 1308

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 37/38 (97%)
 Strand = Plus / Minus

                                                 
Query: 639 ataccattggcatcaatgtcaaaagtgacctcaatctg 676
           ||||||||||||||||||||||||||||| ||||||||
Sbjct: 606 ataccattggcatcaatgtcaaaagtgacttcaatctg 569



to top

>dbj|AK096100.1| Homo sapiens cDNA FLJ38781 fis, clone LIVER2000216, highly similar to
            HEAT SHOCK COGNATE 71 KDA PROTEIN
          Length = 2229

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 37/38 (97%)
 Strand = Plus / Minus

                                                  
Query: 639  ataccattggcatcaatgtcaaaagtgacctcaatctg 676
            ||||||||||||||||||||||||||||| ||||||||
Sbjct: 1457 ataccattggcatcaatgtcaaaagtgacttcaatctg 1420



to top

>emb|CR619085.1| full-length cDNA clone CS0DF008YL15 of Fetal brain of Homo sapiens
           (human)
          Length = 1582

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 37/38 (97%)
 Strand = Plus / Minus

                                                 
Query: 639 ataccattggcatcaatgtcaaaagtgacctcaatctg 676
           ||||||||||||||||||||||||||||| ||||||||
Sbjct: 887 ataccattggcatcaatgtcaaaagtgacttcaatctg 850



to top

>emb|CR618452.1| full-length cDNA clone CS0DA004YF21 of Neuroblastoma of Homo sapiens
            (human)
          Length = 1698

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 37/38 (97%)
 Strand = Plus / Minus

                                                  
Query: 639  ataccattggcatcaatgtcaaaagtgacctcaatctg 676
            ||||||||||||||||||||||||||||| ||||||||
Sbjct: 1002 ataccattggcatcaatgtcaaaagtgacttcaatctg 965



to top

>emb|CR617847.1| full-length cDNA clone CS0DN003YP05 of Adult brain of Homo sapiens
            (human)
          Length = 2212

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 37/38 (97%)
 Strand = Plus / Minus

                                                  
Query: 639  ataccattggcatcaatgtcaaaagtgacctcaatctg 676
            ||||||||||||||||||||||||||||| ||||||||
Sbjct: 1515 ataccattggcatcaatgtcaaaagtgacttcaatctg 1478



to top

>emb|CR614382.1| full-length cDNA clone CS0CAP006YL11 of Thymus of Homo sapiens
           (human)
          Length = 1626

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 37/38 (97%)
 Strand = Plus / Minus

                                                 
Query: 639 ataccattggcatcaatgtcaaaagtgacctcaatctg 676
           ||||||||||||||||||||||||||||| ||||||||
Sbjct: 947 ataccattggcatcaatgtcaaaagtgacttcaatctg 910



to top

>emb|CR609237.1| full-length cDNA clone CL0BA012ZA08 of Placenta of Homo sapiens
           (human)
          Length = 1197

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 37/38 (97%)
 Strand = Plus / Minus

                                                 
Query: 639 ataccattggcatcaatgtcaaaagtgacctcaatctg 676
           ||||||||||||||||||||||||||||| ||||||||
Sbjct: 470 ataccattggcatcaatgtcaaaagtgacttcaatctg 433



to top

>emb|CR605894.1| full-length cDNA clone CS0DA003YN07 of Neuroblastoma of Homo
           sapiens (human)
          Length = 1523

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 37/38 (97%)
 Strand = Plus / Minus

                                                 
Query: 639 ataccattggcatcaatgtcaaaagtgacctcaatctg 676
           ||||||||||||||||||||||||||||| ||||||||
Sbjct: 833 ataccattggcatcaatgtcaaaagtgacttcaatctg 796



to top

>emb|CR599778.1| full-length cDNA clone CS0DE006YC12 of Placenta of Homo sapiens
           (human)
          Length = 1073

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 37/38 (97%)
 Strand = Plus / Minus

                                                 
Query: 639 ataccattggcatcaatgtcaaaagtgacctcaatctg 676
           ||||||||||||||||||||||||||||| ||||||||
Sbjct: 586 ataccattggcatcaatgtcaaaagtgacttcaatctg 549



to top

>emb|CR598455.1| full-length cDNA clone CS0DA003YC01 of Neuroblastoma of Homo
           sapiens (human)
          Length = 1668

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 37/38 (97%)
 Strand = Plus / Minus

                                                 
Query: 639 ataccattggcatcaatgtcaaaagtgacctcaatctg 676
           ||||||||||||||||||||||||||||| ||||||||
Sbjct: 952 ataccattggcatcaatgtcaaaagtgacttcaatctg 915



to top

>emb|CR598352.1| full-length cDNA clone CS0DF006YL22 of Fetal brain of Homo sapiens
           (human)
          Length = 1586

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 37/38 (97%)
 Strand = Plus / Minus

                                                 
Query: 639 ataccattggcatcaatgtcaaaagtgacctcaatctg 676
           ||||||||||||||||||||||||||||| ||||||||
Sbjct: 892 ataccattggcatcaatgtcaaaagtgacttcaatctg 855



to top

>ref|NG_005513.1| Homo sapiens heat shock 70kDa protein 8 pseudogene (LOC401308) on
           chromosome 7
          Length = 2474

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 37/38 (97%)
 Strand = Plus / Plus

                                                 
Query: 639 ataccattggcatcaatgtcaaaagtgacctcaatctg 676
           ||||||||||||||||||||||||||||| ||||||||
Sbjct: 846 ataccattggcatcaatgtcaaaagtgacttcaatctg 883



to top

>emb|CR597390.1| full-length cDNA clone CS0DF009YO17 of Fetal brain of Homo sapiens
            (human)
          Length = 2234

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 37/38 (97%)
 Strand = Plus / Minus

                                                  
Query: 639  ataccattggcatcaatgtcaaaagtgacctcaatctg 676
            ||||||||||||||||||||||||||||| ||||||||
Sbjct: 1522 ataccattggcatcaatgtcaaaagtgacttcaatctg 1485



to top

>dbj|AB073886.1| Homo sapiens primary neuroblastoma cDNA, clone:Nbla02874, full insert
            sequence
          Length = 2142

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 37/38 (97%)
 Strand = Plus / Minus

                                                  
Query: 639  ataccattggcatcaatgtcaaaagtgacctcaatctg 676
            ||||||||||||||||||||||||||||| ||||||||
Sbjct: 1409 ataccattggcatcaatgtcaaaagtgacttcaatctg 1372



to top

>ref|XM_936755.1| PREDICTED: Homo sapiens similar to Chain , Heat-Shock Cognate 70kd
            Protein (44kd Atpase N-Terminal Fragment) (E.C.3.6.1.3)
            Mutant With Asp 206 Replaced By Ser (D206s) (LOC401308),
            mRNA
          Length = 2197

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 37/38 (97%)
 Strand = Plus / Minus

                                                  
Query: 639  ataccattggcatcaatgtcaaaagtgacctcaatctg 676
            ||||||||||||||||||||||||||||| ||||||||
Sbjct: 1452 ataccattggcatcaatgtcaaaagtgacttcaatctg 1415



to top

>ref|XM_935683.1| PREDICTED: Homo sapiens similar to Chain , Heat-Shock Cognate 70kd
            Protein (44kd Atpase N-Terminal Fragment) (E.C.3.6.1.3)
            Mutant With Asp 206 Replaced By Ser (D206s) (LOC401308),
            mRNA
          Length = 2197

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 37/38 (97%)
 Strand = Plus / Minus

                                                  
Query: 639  ataccattggcatcaatgtcaaaagtgacctcaatctg 676
            ||||||||||||||||||||||||||||| ||||||||
Sbjct: 1452 ataccattggcatcaatgtcaaaagtgacttcaatctg 1415



to top

>ref|XM_376576.3| PREDICTED: Homo sapiens similar to Chain , Heat-Shock Cognate 70kd
            Protein (44kd Atpase N-Terminal Fragment) (E.C.3.6.1.3)
            Mutant With Asp 206 Replaced By Ser (D206s) (LOC401308),
            mRNA
          Length = 2197

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 37/38 (97%)
 Strand = Plus / Minus

                                                  
Query: 639  ataccattggcatcaatgtcaaaagtgacctcaatctg 676
            ||||||||||||||||||||||||||||| ||||||||
Sbjct: 1452 ataccattggcatcaatgtcaaaagtgacttcaatctg 1415



to top

>gb|BC015699.1|BC015699 Homo sapiens, clone IMAGE:3906958, mRNA, partial cds
          Length = 1066

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 37/38 (97%)
 Strand = Plus / Minus

                                                 
Query: 639 ataccattggcatcaatgtcaaaagtgacctcaatctg 676
           ||||||||||||||||||||||||||||| ||||||||
Sbjct: 325 ataccattggcatcaatgtcaaaagtgacttcaatctg 288



to top

>gb|AF352832.1|AF352832 Homo sapiens constitutive heat shock protein 70 (HSC70) mRNA,
            complete cds
          Length = 2085

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 37/38 (97%)
 Strand = Plus / Minus

                                                  
Query: 639  ataccattggcatcaatgtcaaaagtgacctcaatctg 676
            ||||||||||||||||||||||||||||| ||||||||
Sbjct: 1518 ataccattggcatcaatgtcaaaagtgacttcaatctg 1481



to top

>dbj|AK222785.1| Homo sapiens mRNA for heat shock 70kDa protein 8 isoform 1 variant,
            clone: HEP02822
          Length = 2068

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 37/38 (97%)
 Strand = Plus / Minus

                                                  
Query: 639  ataccattggcatcaatgtcaaaagtgacctcaatctg 676
            ||||||||||||||||||||||||||||| ||||||||
Sbjct: 1529 ataccattggcatcaatgtcaaaagtgacttcaatctg 1492



to top

>dbj|AB072749.1| Macaca fascicularis testis cDNA clone:QtsA-16150, similar to human
            heat shock 70kDa protein 8 (HSPA8), isoform 1, mRNA,
            NM_006597.3
          Length = 2283

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 37/38 (97%)
 Strand = Plus / Minus

                                                  
Query: 639  ataccattggcatcaatgtcaaaagtgacctcaatctg 676
            ||||||||||||||||||||||||||||| ||||||||
Sbjct: 1534 ataccattggcatcaatgtcaaaagtgacttcaatctg 1497



to top

>emb|Z49896.1|XLHS7CU14 X.laevis DNA for intronic U14 small nucleolar RNAs
          Length = 4757

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 37/38 (97%)
 Strand = Plus / Minus

                                                  
Query: 639  ataccattggcatcaatgtcaaaagtgacctcaatctg 676
            |||||||||||||||||||||||||| |||||||||||
Sbjct: 3290 ataccattggcatcaatgtcaaaagtcacctcaatctg 3253



to top

>dbj|AK129885.1| Homo sapiens cDNA FLJ26375 fis, clone HRT06292, highly similar to
            Heat shock cognate 71 kDa protein
          Length = 2261

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 37/38 (97%)
 Strand = Plus / Minus

                                                  
Query: 639  ataccattggcatcaatgtcaaaagtgacctcaatctg 676
            ||||||||||||||||||||||||||||| ||||||||
Sbjct: 1533 ataccattggcatcaatgtcaaaagtgacttcaatctg 1496



to top

>gb|AY104983.1| Zea mays PCO092463 mRNA sequence
          Length = 2588

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 46/50 (92%)
 Strand = Plus / Minus

                                                              
Query: 441  ctcttctcgatgctgtagatggtggtatcggcagagttcctgaggtcaat 490
            |||||||||||||||||||||||||| ||||||  |||||||| ||||||
Sbjct: 1912 ctcttctcgatgctgtagatggtggtgtcggcattgttcctgatgtcaat 1863



 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                            
Query: 281  catgtgctgtccaatctttgagactgccttgttcgctgcctccagctt 328
            |||||||||||||||||| ||||| |||||||| || ||||| |||||
Sbjct: 2072 catgtgctgtccaatcttcgagacagccttgttggcagcctcaagctt 2025



to top

>dbj|AP000926.6| Homo sapiens genomic DNA, chromosome 11 clone:RP11-762B21, complete
             sequence
          Length = 196972

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 37/38 (97%)
 Strand = Plus / Plus

                                                   
Query: 639   ataccattggcatcaatgtcaaaagtgacctcaatctg 676
             ||||||||||||||||||||||||||||| ||||||||
Sbjct: 36611 ataccattggcatcaatgtcaaaagtgacttcaatctg 36648



to top

>gb|U30885.1|U30885 Xenopus laevis heat shock cognate 70.I (hsc70.I) mRNA, complete cds
          Length = 2210

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 37/38 (97%)
 Strand = Plus / Minus

                                                  
Query: 639  ataccattggcatcaatgtcaaaagtgacctcaatctg 676
            |||||||||||||||||||||||||| |||||||||||
Sbjct: 1521 ataccattggcatcaatgtcaaaagtcacctcaatctg 1484



to top

>gb|U55070.1|XLU55070 Xenopus laevis heat shock cognate 70.II protein (hsc70.II) mRNA,
            complete cds
          Length = 2199

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 37/38 (97%)
 Strand = Plus / Minus

                                                  
Query: 639  ataccattggcatcaatgtcaaaagtgacctcaatctg 676
            |||||||||||||||||||||||||| |||||||||||
Sbjct: 1508 ataccattggcatcaatgtcaaaagtcacctcaatctg 1471



to top

>gb|U55176.1|XLU55176 Xenopus laevis heat shock cognate 70.II mRNA, complete cds
          Length = 2199

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 37/38 (97%)
 Strand = Plus / Minus

                                                  
Query: 639  ataccattggcatcaatgtcaaaagtgacctcaatctg 676
            |||||||||||||||||||||||||| |||||||||||
Sbjct: 1508 ataccattggcatcaatgtcaaaagtcacctcaatctg 1471



to top

>emb|X73685.1|CAHSP C.aethiops hsp70 mRNA
          Length = 2177

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 37/38 (97%)
 Strand = Plus / Minus

                                                  
Query: 639  ataccattggcatcaatgtcaaaagtgacctcaatctg 676
            ||||||||||||||||||||||||||||| ||||||||
Sbjct: 1455 ataccattggcatcaatgtcaaaagtgacttcaatctg 1418



to top

>emb|X66874.1|PV70HSP P.vulgaris mRNA for 70 kD heat shock protein
          Length = 2405

 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 39/41 (95%)
 Strand = Plus / Minus

                                                     
Query: 636  acaataccattggcatcaatgtcaaaagtgacctcaatctg 676
            ||||| |||||||||||||||||||| ||||||||||||||
Sbjct: 1710 acaattccattggcatcaatgtcaaacgtgacctcaatctg 1670



to top

>gb|AY120919.1| Cryptosporidium sp. 1453 70 kDa heat shock protein gene, partial cds
          Length = 1873

 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 39/41 (95%)
 Strand = Plus / Minus

                                                     
Query: 639  ataccattggcatcaatgtcaaaagtgacctcaatctgtgg 679
            |||||||| |||||||||||||||||||||||||| |||||
Sbjct: 1367 ataccattagcatcaatgtcaaaagtgacctcaatttgtgg 1327



to top

>dbj|AB102771.1| Cryptosporidium sp. MNJ-1 HSP70 gene for heat shock protein 70,
           partial cds
          Length = 536

 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 39/41 (95%)
 Strand = Plus / Minus

                                                    
Query: 639 ataccattggcatcaatgtcaaaagtgacctcaatctgtgg 679
           ||||||||||||||||| ||||||||||||||||| |||||
Sbjct: 279 ataccattggcatcaatatcaaaagtgacctcaatttgtgg 239



to top

>gb|AF502479.1| Mitsukurina owstoni isolate Miow3 Hsp70 protein (Hsp70) gene, partial
            cds
          Length = 1386

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 38/40 (95%)
 Strand = Plus / Minus

                                                    
Query: 642  ccattggcatcaatgtcaaaagtgacctcaatctgtggca 681
            |||||||||||||| ||||| |||||||||||||||||||
Sbjct: 1334 ccattggcatcaatatcaaaggtgacctcaatctgtggca 1295



to top

>ref|XM_575798.1| PREDICTED: Rattus norvegicus similar to heat shock protein 8
            (LOC500436), mRNA
          Length = 1962

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 41/44 (93%)
 Strand = Plus / Minus

                                                        
Query: 633  ttgacaataccattggcatcaatgtcaaaagtgacctcaatctg 676
            |||| ||| ||||||||||||||||||||||| |||||||||||
Sbjct: 1409 ttgagaatgccattggcatcaatgtcaaaagtaacctcaatctg 1366



to top

>ref|XM_529112.1| PREDICTED: Pan troglodytes similar to heat shock protein 8; heat
           shock protein cognate 70; heat shock 70kD protein 8
           (LOC473739), mRNA
          Length = 993

 Score = 61.9 bits (31), Expect = 3e-06
 Identities = 34/35 (97%)
 Strand = Plus / Minus

                                              
Query: 642 ccattggcatcaatgtcaaaagtgacctcaatctg 676
           |||||||||||||||||||||||||| ||||||||
Sbjct: 494 ccattggcatcaatgtcaaaagtgacttcaatctg 460



to top

>ref|XR_002535.1| PREDICTED: Mus musculus similar to heat shock protein 8 (LOC669493),
            mRNA
          Length = 2149

 Score = 61.9 bits (31), Expect = 3e-06
 Identities = 34/35 (97%)
 Strand = Plus / Minus

                                               
Query: 642  ccattggcatcaatgtcaaaagtgacctcaatctg 676
            ||||||||||||||||||||||| |||||||||||
Sbjct: 1545 ccattggcatcaatgtcaaaagtaacctcaatctg 1511



to top

>gb|AC126431.3| Mus musculus BAC clone RP24-407P8 from chromosome 6, complete sequence
          Length = 144924

 Score = 61.9 bits (31), Expect = 3e-06
 Identities = 34/35 (97%)
 Strand = Plus / Minus

                                                
Query: 642   ccattggcatcaatgtcaaaagtgacctcaatctg 676
             ||||||||||||||||||||||| |||||||||||
Sbjct: 89794 ccattggcatcaatgtcaaaagtaacctcaatctg 89760



to top

>gb|AC129187.4| Mus musculus BAC clone RP23-427D4 from chromosome 5, complete sequence
          Length = 198245

 Score = 61.9 bits (31), Expect = 3e-06
 Identities = 34/35 (97%)
 Strand = Plus / Minus

                                                 
Query: 642    ccattggcatcaatgtcaaaagtgacctcaatctg 676
              ||||||||||||||||||||||| |||||||||||
Sbjct: 180934 ccattggcatcaatgtcaaaagtaacctcaatctg 180900



to top

>emb|AL390728.37| Human DNA sequence from clone RP11-488L18 on chromosome 1 Contains a
              pseudogene similar to part of fibroblast growth factor
              receptor 3 (achondroplasia, thanatophoric dwarfism)
              (FGFR3), the ZNF124 gene for zinc finger protein 124
              (HZF-16), a peroxisomal biogenesis factor 5 (PEX5)
              pseudogene, a zinc finger protein pseudogene, the 3' end of
              a novel transcript, a heat shock 70kDa protein 8 (HSPA8)
              pseudogene and five CpG islands, complete sequence
          Length = 123668

 Score = 61.9 bits (31), Expect = 3e-06
 Identities = 34/35 (97%)
 Strand = Plus / Minus

                                                 
Query: 642    ccattggcatcaatgtcaaaagtgacctcaatctg 676
              |||||||||||||||||||||||||| ||||||||
Sbjct: 121503 ccattggcatcaatgtcaaaagtgacttcaatctg 121469



to top

>gb|BC098914.1| Rattus norvegicus heat shock protein 8, mRNA (cDNA clone MGC:114311
            IMAGE:7104230), complete cds
          Length = 2086

 Score = 61.9 bits (31), Expect = 3e-06
 Identities = 34/35 (97%)
 Strand = Plus / Minus

                                               
Query: 642  ccattggcatcaatgtcaaaagtgacctcaatctg 676
            ||||||||||||||||||||||| |||||||||||
Sbjct: 1483 ccattggcatcaatgtcaaaagtaacctcaatctg 1449



to top

>emb|AJ318883.1|OED318883 Ostrea edulis partial hsp70 gene for heat shock protein 70
          Length = 1797

 Score = 61.9 bits (31), Expect = 3e-06
 Identities = 40/43 (93%)
 Strand = Plus / Minus

                                                       
Query: 639  ataccattggcatcaatgtcaaaagtgacctcaatctgtggca 681
            ||||| ||||||||||||||||| |||||||||||||| ||||
Sbjct: 1472 ataccgttggcatcaatgtcaaatgtgacctcaatctggggca 1430



to top

>gb|BC061547.1| Rattus norvegicus heat shock protein 8, mRNA (cDNA clone MGC:72807
            IMAGE:6921606), complete cds
          Length = 2137

 Score = 61.9 bits (31), Expect = 3e-06
 Identities = 34/35 (97%)
 Strand = Plus / Minus

                                               
Query: 642  ccattggcatcaatgtcaaaagtgacctcaatctg 676
            ||||||||||||||||||||||| |||||||||||
Sbjct: 1538 ccattggcatcaatgtcaaaagtaacctcaatctg 1504



to top

>gb|DQ399046.1| Ictalurus punctatus clone SQE05 heat shock cognate 70 kDa protein
           mRNA, partial cds
          Length = 597

 Score = 61.9 bits (31), Expect = 3e-06
 Identities = 34/35 (97%)
 Strand = Plus / Minus

                                              
Query: 642 ccattggcatcaatgtcaaaagtgacctcaatctg 676
           |||||||||||||||||||| ||||||||||||||
Sbjct: 218 ccattggcatcaatgtcaaatgtgacctcaatctg 184



to top

>ref|NG_004796.1| Rattus norvegicus heat shock cognate protein 70 pseudogene
            (Hsc70-ps1) on chromosome 2
          Length = 2141

 Score = 61.9 bits (31), Expect = 3e-06
 Identities = 34/35 (97%)
 Strand = Plus / Minus

                                               
Query: 642  ccattggcatcaatgtcaaaagtgacctcaatctg 676
            ||||||||||||||||||||||| |||||||||||
Sbjct: 1551 ccattggcatcaatgtcaaaagtaacctcaatctg 1517



to top

>ref|NG_004795.1| Rattus norvegicus heat shock cognate protein 70 pseudogene
            (LOC291729) on chromosome 18
          Length = 2270

 Score = 61.9 bits (31), Expect = 3e-06
 Identities = 34/35 (97%)
 Strand = Plus / Minus

                                               
Query: 642  ccattggcatcaatgtcaaaagtgacctcaatctg 676
            ||||||||||||||||||||||| |||||||||||
Sbjct: 1602 ccattggcatcaatgtcaaaagtaacctcaatctg 1568



to top

>gb|AC092404.2| Mus musculus strain C57BL6/J chromosome 5 clone RP23-261D18, complete
             sequence
          Length = 225503

 Score = 61.9 bits (31), Expect = 3e-06
 Identities = 34/35 (97%)
 Strand = Plus / Minus

                                                
Query: 642   ccattggcatcaatgtcaaaagtgacctcaatctg 676
             ||||||||||||||||||||||| |||||||||||
Sbjct: 81758 ccattggcatcaatgtcaaaagtaacctcaatctg 81724



to top

>gb|AF144646.1|AF144646 Crassostrea gigas heat shock protein 70 (hsp70) mRNA, complete cds
          Length = 2381

 Score = 61.9 bits (31), Expect = 3e-06
 Identities = 40/43 (93%)
 Strand = Plus / Minus

                                                       
Query: 639  ataccattggcatcaatgtcaaaagtgacctcaatctgtggca 681
            ||||| ||||||||||||||||| |||||||||||||| ||||
Sbjct: 1555 ataccgttggcatcaatgtcaaatgtgacctcaatctggggca 1513



to top

>gb|AY195744.1| Carassius auratus gibelio heat shock cognate 70 kDa protein mRNA,
            complete cds
          Length = 2207

 Score = 61.9 bits (31), Expect = 3e-06
 Identities = 34/35 (97%)
 Strand = Plus / Minus

                                               
Query: 642  ccattggcatcaatgtcaaaagtgacctcaatctg 676
            |||||||||||||||||||| ||||||||||||||
Sbjct: 1556 ccattggcatcaatgtcaaaggtgacctcaatctg 1522



to top

>ref|XM_341392.2| PREDICTED: Rattus norvegicus BM259 protein (Bm259), mRNA
          Length = 17226

 Score = 61.9 bits (31), Expect = 3e-06
 Identities = 34/35 (97%)
 Strand = Plus / Plus

                                                
Query: 642   ccattggcatcaatgtcaaaagtgacctcaatctg 676
             ||||||||||||||||||||||| |||||||||||
Sbjct: 13040 ccattggcatcaatgtcaaaagtaacctcaatctg 13074



to top

>dbj|AB092840.1| Carassius auratus HSC70 mRNA for heat shock cognate 70 kDa, partial
            cds
          Length = 2208

 Score = 61.9 bits (31), Expect = 3e-06
 Identities = 34/35 (97%)
 Strand = Plus / Minus

                                               
Query: 642  ccattggcatcaatgtcaaaagtgacctcaatctg 676
            |||||||||||||||||||| ||||||||||||||
Sbjct: 1399 ccattggcatcaatgtcaaaggtgacctcaatctg 1365



to top

>dbj|AB122064.1| Crassostrea gigas HSC71 mRNA for 71kDa heat shock connate protein,
            complete cds
          Length = 2265

 Score = 61.9 bits (31), Expect = 3e-06
 Identities = 40/43 (93%)
 Strand = Plus / Minus

                                                       
Query: 639  ataccattggcatcaatgtcaaaagtgacctcaatctgtggca 681
            ||||| ||||||||||||||||| |||||||||||||| ||||
Sbjct: 1504 ataccgttggcatcaatgtcaaatgtgacctcaatctggggca 1462



to top

>gb|AC004822.1|AC004822 Homo sapiens PAC clone RP1-170D19 from Xq23, complete sequence
          Length = 127824

 Score = 61.9 bits (31), Expect = 3e-06
 Identities = 34/35 (97%)
 Strand = Plus / Minus

                                                
Query: 642   ccattggcatcaatgtcaaaagtgacctcaatctg 676
             |||||||||||||||||||||||||| ||||||||
Sbjct: 21178 ccattggcatcaatgtcaaaagtgacttcaatctg 21144



to top

>emb|Y00054.1|RNHSC73 Rat gene for hsc73 , the major hsp70-like protein
          Length = 4320

 Score = 61.9 bits (31), Expect = 3e-06
 Identities = 34/35 (97%)
 Strand = Plus / Minus

                                               
Query: 642  ccattggcatcaatgtcaaaagtgacctcaatctg 676
            ||||||||||||||||||||||| |||||||||||
Sbjct: 3376 ccattggcatcaatgtcaaaagtaacctcaatctg 3342



to top

>emb|X70065.1|RNHSP72PS R.norvegicus Hsc70-ps1 gene
          Length = 2242

 Score = 61.9 bits (31), Expect = 3e-06
 Identities = 34/35 (97%)
 Strand = Plus / Minus

                                               
Query: 642  ccattggcatcaatgtcaaaagtgacctcaatctg 676
            ||||||||||||||||||||||| |||||||||||
Sbjct: 1607 ccattggcatcaatgtcaaaagtaacctcaatctg 1573



to top

>gb|U40994.1|PCU40994 Pneumocystis carinii f. sp. rattus BiP precursor homolog (Prbip)
            gene, complete cds
          Length = 2669

 Score = 61.9 bits (31), Expect = 3e-06
 Identities = 34/35 (97%)
 Strand = Plus / Minus

                                               
Query: 642  ccattggcatcaatgtcaaaagtgacctcaatctg 676
            |||||||||||||| ||||||||||||||||||||
Sbjct: 2196 ccattggcatcaatctcaaaagtgacctcaatctg 2162



to top

>ref|NM_024351.2| Rattus norvegicus heat shock protein 8 (Hspa8), mRNA
          Length = 2130

 Score = 61.9 bits (31), Expect = 3e-06
 Identities = 34/35 (97%)
 Strand = Plus / Minus

                                               
Query: 642  ccattggcatcaatgtcaaaagtgacctcaatctg 676
            ||||||||||||||||||||||| |||||||||||
Sbjct: 1531 ccattggcatcaatgtcaaaagtaacctcaatctg 1497



to top

>gb|M11942.1|RATHSPA Rat 70 kd heat-shock-like protein mRNA, complete cds
          Length = 2073

 Score = 61.9 bits (31), Expect = 3e-06
 Identities = 34/35 (97%)
 Strand = Plus / Minus

                                               
Query: 642  ccattggcatcaatgtcaaaagtgacctcaatctg 676
            ||||||||||||||||||||||| |||||||||||
Sbjct: 1502 ccattggcatcaatgtcaaaagtaacctcaatctg 1468



to top

>gb|AC134426.20| Mus musculus chromosome 1, clone RP24-342A12, complete sequence
          Length = 196208

 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 33/34 (97%)
 Strand = Plus / Plus

                                                
Query: 642    ccattggcatcaatgtcaaaagtgacctcaatct 675
              ||||||||||||||||||||||| ||||||||||
Sbjct: 182892 ccattggcatcaatgtcaaaagtaacctcaatct 182925



to top

>gb|BC067910.2| Xenopus tropicalis hypothetical protein MGC69535, mRNA (cDNA clone
            MGC:69535 IMAGE:5336625), complete cds
          Length = 2348

 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 42/46 (91%)
 Strand = Plus / Minus

                                                          
Query: 636  acaataccattggcatcaatgtcaaaagtgacctcaatctgtggca 681
            ||||| ||||| |||||||||||||||||||| |||||||| ||||
Sbjct: 1676 acaattccatttgcatcaatgtcaaaagtgacttcaatctgaggca 1631



to top

>gb|BC046262.1| Xenopus laevis similar to Heat shock cognate protein 70, mRNA (cDNA
            clone MGC:53952 IMAGE:5570547), complete cds
          Length = 2202

 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 36/38 (94%)
 Strand = Plus / Minus

                                                  
Query: 639  ataccattggcatcaatgtcaaaagtgacctcaatctg 676
            ||||| ||||||||||||||||| ||||||||||||||
Sbjct: 1502 ataccgttggcatcaatgtcaaatgtgacctcaatctg 1465



to top

>gb|BC045259.1| Xenopus laevis similar to heat shock protein, 74 kDa, A, mRNA (cDNA
            clone MGC:52616 IMAGE:4681245), complete cds
          Length = 2293

 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 42/46 (91%)
 Strand = Plus / Minus

                                                          
Query: 636  acaataccattggcatcaatgtcaaaagtgacctcaatctgtggca 681
            ||||| ||||| |||||||||||||||||||| |||||||| ||||
Sbjct: 1632 acaattccatttgcatcaatgtcaaaagtgacttcaatctgaggca 1587



to top

>gb|AC102133.27| Mus musculus chromosome 1, clone RP23-241J21, complete sequence
          Length = 203349

 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 33/34 (97%)
 Strand = Plus / Minus

                                                
Query: 642    ccattggcatcaatgtcaaaagtgacctcaatct 675
              ||||||||||||||||||||||| ||||||||||
Sbjct: 196489 ccattggcatcaatgtcaaaagtaacctcaatct 196456



to top

>emb|AJ318882.1|CGI318882 Crassostrea gigas partial hsp70 gene for heat shock protein 70
          Length = 1797

 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 36/38 (94%)
 Strand = Plus / Minus

                                                  
Query: 639  ataccattggcatcaatgtcaaaagtgacctcaatctg 676
            ||||| ||||||||||||||||| ||||||||||||||
Sbjct: 1472 ataccgttggcatcaatgtcaaatgtgacctcaatctg 1435



to top

>emb|AJ305315.1|CGI305315 Crassostrea gigas hsc70 gene, exons 1-6
          Length = 2553

 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 36/38 (94%)
 Strand = Plus / Minus

                                                  
Query: 639  ataccattggcatcaatgtcaaaagtgacctcaatctg 676
            ||||| ||||||||||||||||| ||||||||||||||
Sbjct: 2004 ataccgttggcatcaatgtcaaatgtgacctcaatctg 1967



to top

>ref|NM_001001229.2| Xenopus tropicalis hypothetical protein MGC69535 (MGC69535), mRNA
          Length = 2348

 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 42/46 (91%)
 Strand = Plus / Minus

                                                          
Query: 636  acaataccattggcatcaatgtcaaaagtgacctcaatctgtggca 681
            ||||| ||||| |||||||||||||||||||| |||||||| ||||
Sbjct: 1676 acaattccatttgcatcaatgtcaaaagtgacttcaatctgaggca 1631



to top

>gb|AC149875.2| Xenopus tropicalis clone CH216-151P11, complete sequence
          Length = 155394

 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 42/46 (91%)
 Strand = Plus / Plus

                                                            
Query: 636    acaataccattggcatcaatgtcaaaagtgacctcaatctgtggca 681
              ||||| ||||| |||||||||||||||||||| |||||||| ||||
Sbjct: 134367 acaattccatttgcatcaatgtcaaaagtgacttcaatctgaggca 134412



to top

>emb|CR760959.2| Xenopus tropicalis finished cDNA, clone TEgg043g04
          Length = 2264

 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 42/46 (91%)
 Strand = Plus / Minus

                                                          
Query: 636  acaataccattggcatcaatgtcaaaagtgacctcaatctgtggca 681
            ||||| ||||| |||||||||||||||||||| |||||||| ||||
Sbjct: 1613 acaattccatttgcatcaatgtcaaaagtgacttcaatctgaggca 1568



to top

>gb|AF106835.1|AF106835 Methylovorus sp. strain SS1 putative GrpE (grpE), DnaK (dnaK), and
            putative DnaJ (dnaJ) genes, complete cds
          Length = 4874

 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 36/38 (94%)
 Strand = Plus / Minus

                                                  
Query: 645  ttggcatcaatgtcaaaagtgacctcaatctgtggcat 682
            ||||||||||||||||| || |||||||||||||||||
Sbjct: 2317 ttggcatcaatgtcaaaggtcacctcaatctgtggcat 2280



to top

>gb|U22460.1|IPU22460 Ictalurus punctatus heat shock protein 70 (CF Hsp70) mRNA, complete
            cds
          Length = 2301

 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 36/38 (94%)
 Strand = Plus / Minus

                                                  
Query: 639  ataccattggcatcaatgtcaaaagtgacctcaatctg 676
            |||||||| |||||||||||||| ||||||||||||||
Sbjct: 1489 ataccattagcatcaatgtcaaatgtgacctcaatctg 1452



to top

>ref|XM_592191.2| PREDICTED: Bos taurus similar to heat shock 70kDa protein 1-like
            (LOC540190), mRNA
          Length = 1854

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 44/49 (89%)
 Strand = Plus / Minus

                                                             
Query: 633  ttgacaataccattggcatcaatgtcaaaagtgacctcaatctgtggca 681
            |||| ||||||||||||||| |||||||| || ||||||||||| ||||
Sbjct: 1394 ttgagaataccattggcatcgatgtcaaaggtcacctcaatctgaggca 1346



to top

>emb|Z83108.1|CEF44E5 Caenorhabditis elegans Cosmid F44E5, complete sequence
          Length = 28999

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 56/65 (86%)
 Strand = Plus / Minus

                                                                         
Query: 615   ttatcctttgctgacaccttgacaataccattggcatcaatgtcaaaagtgacctcaatc 674
             |||||||  |||||||| |||| ||| ||||| |||||||| ||||||||||| ||||| 
Sbjct: 12873 ttatcctcagctgacacattgagaattccatttgcatcaatatcaaaagtgacttcaatt 12814

                  
Query: 675   tgtgg 679
             |||||
Sbjct: 12813 tgtgg 12809



 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 56/65 (86%)
 Strand = Plus / Plus

                                                                        
Query: 615  ttatcctttgctgacaccttgacaataccattggcatcaatgtcaaaagtgacctcaatc 674
            |||||||  |||||||| |||| ||| ||||| |||||||| ||||||||||| ||||| 
Sbjct: 9248 ttatcctcagctgacacattgagaattccatttgcatcaatatcaaaagtgacttcaatt 9307

                 
Query: 675  tgtgg 679
            |||||
Sbjct: 9308 tgtgg 9312



to top

>ref|NM_064109.2| Caenorhabditis elegans F44E5.5 (F44E5.5) mRNA, complete cds
          Length = 2004

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 56/65 (86%)
 Strand = Plus / Minus

                                                                        
Query: 615  ttatcctttgctgacaccttgacaataccattggcatcaatgtcaaaagtgacctcaatc 674
            |||||||  |||||||| |||| ||| ||||| |||||||| ||||||||||| ||||| 
Sbjct: 1505 ttatcctcagctgacacattgagaattccatttgcatcaatatcaaaagtgacttcaatt 1446

                 
Query: 675  tgtgg 679
            |||||
Sbjct: 1445 tgtgg 1441



to top

>ref|NM_064108.2| Caenorhabditis elegans F44E5.4 (F44E5.4) mRNA, complete cds
          Length = 2036

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 56/65 (86%)
 Strand = Plus / Minus

                                                                        
Query: 615  ttatcctttgctgacaccttgacaataccattggcatcaatgtcaaaagtgacctcaatc 674
            |||||||  |||||||| |||| ||| ||||| |||||||| ||||||||||| ||||| 
Sbjct: 1481 ttatcctcagctgacacattgagaattccatttgcatcaatatcaaaagtgacttcaatt 1422

                 
Query: 675  tgtgg 679
            |||||
Sbjct: 1421 tgtgg 1417



to top

>gb|AY120920.1| Cryptosporidium canis 70 kDa heat shock protein gene, partial cds
          Length = 1901

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 38/41 (92%)
 Strand = Plus / Minus

                                                     
Query: 639  ataccattggcatcaatgtcaaaagtgacctcaatctgtgg 679
            |||||||||||||| || ||||| |||||||||||||||||
Sbjct: 1414 ataccattggcatcgatatcaaaggtgacctcaatctgtgg 1374



to top

>gb|AF221529.1|AF221529 Cryptosporidium parvum isolate 244 heat shock protein 70 (HSP70)
            gene, partial cds
          Length = 1883

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 38/41 (92%)
 Strand = Plus / Minus

                                                     
Query: 639  ataccattggcatcaatgtcaaaagtgacctcaatctgtgg 679
            |||||||||||||| || ||||| |||||||||||||||||
Sbjct: 1409 ataccattggcatcgatatcaaaggtgacctcaatctgtgg 1369



to top

>gb|AY422994.1| Danio rerio heat shock 70kDa protein 8 (HSPA8) mRNA, complete cds
          Length = 2317

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 31/32 (96%)
 Strand = Plus / Minus

                                            
Query: 642  ccattggcatcaatgtcaaaagtgacctcaat 673
            |||||||||||||||||||| |||||||||||
Sbjct: 1517 ccattggcatcaatgtcaaaggtgacctcaat 1486



to top

>ref|XM_527345.1| PREDICTED: Pan troglodytes similar to heat shock 70kDa protein
            1-like; heat shock 70kD protein-like 1 (LOC471967), mRNA
          Length = 2469

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 40/44 (90%)
 Strand = Plus / Minus

                                                        
Query: 633  ttgacaataccattggcatcaatgtcaaaagtgacctcaatctg 676
            |||| |||||||||||||||||||||||| || ||||| |||||
Sbjct: 2009 ttgagaataccattggcatcaatgtcaaacgtcacctcgatctg 1966



to top

>gb|AF134726.1| Homo sapiens BAC clone 215O12 NG35, NG36, G9A, NG22, G9, HSP70-2,
              HSP70-1, HSP70-HOM, snRNP, G7A, NG37, NG23, and MutSH5
              genes, complete cds
          Length = 180283

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 40/44 (90%)
 Strand = Plus / Minus

                                                          
Query: 633    ttgacaataccattggcatcaatgtcaaaagtgacctcaatctg 676
              |||| |||||||||||||||||||||||| || ||||| |||||
Sbjct: 107660 ttgagaataccattggcatcaatgtcaaacgtcacctcgatctg 107617



to top

>gb|BC034483.1| Homo sapiens heat shock 70kDa protein 1-like, mRNA (cDNA clone
            MGC:26463 IMAGE:4824979), complete cds
          Length = 2418

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 40/44 (90%)
 Strand = Plus / Minus

                                                        
Query: 633  ttgacaataccattggcatcaatgtcaaaagtgacctcaatctg 676
            |||| |||||||||||||||||||||||| || ||||| |||||
Sbjct: 1626 ttgagaataccattggcatcaatgtcaaacgtcacctcgatctg 1583



to top

>gb|AY286123.1| Cyanidioschyzon merolae DBV201 chloroplast, complete genome
          Length = 149705

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 37/40 (92%)
 Strand = Plus / Minus

                                                      
Query: 642    ccattggcatcaatgtcaaaagtgacctcaatctgtggca 681
              |||||||||||||||||||| || |||||||| |||||||
Sbjct: 110202 ccattggcatcaatgtcaaatgtcacctcaatttgtggca 110163



to top

>gb|BC045130.1| Xenopus laevis heat shock protein, 74 kDa, A, mRNA (cDNA clone
            MGC:53528 IMAGE:5572721), complete cds
          Length = 2246

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 37/40 (92%)
 Strand = Plus / Minus

                                                    
Query: 642  ccattggcatcaatgtcaaaagtgacctcaatctgtggca 681
            ||||| |||||||||||||||||||| |||||||| ||||
Sbjct: 1619 ccatttgcatcaatgtcaaaagtgacttcaatctgaggca 1580



to top

>ref|NM_005527.2| Homo sapiens heat shock 70kDa protein 1-like (HSPA1L), mRNA
          Length = 2509

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 40/44 (90%)
 Strand = Plus / Minus

                                                        
Query: 633  ttgacaataccattggcatcaatgtcaaaagtgacctcaatctg 676
            |||| |||||||||||||||||||||||| || ||||| |||||
Sbjct: 1621 ttgagaataccattggcatcaatgtcaaacgtcacctcgatctg 1578



to top

>emb|AL929592.8| Human DNA sequence from clone DAQB-147D11 on chromosome 6 Contains the
             5' end of the VARS2 gene for valyl-tRNA synthetase 2, the
             LSM2 gene for the LSM2 homolog, U6 small nuclear RNA
             associated (S. cerevisiae) factor, the HSPA1L gene for the
             heat shock 10kDa protein 1-like factor, the HSPA1A gene
             for the heat shock 70kDa protein 1A, the HSPA1B gene for
             the heat shock 70kDa protein 1B, the C6orf48 gene for
             chromosome 6 open reading frame 48, and 4 CpG islands,
             complete sequence
          Length = 59836

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 40/44 (90%)
 Strand = Plus / Plus

                                                         
Query: 633   ttgacaataccattggcatcaatgtcaaaagtgacctcaatctg 676
             |||| |||||||||||||||||||||||| || ||||| |||||
Sbjct: 22325 ttgagaataccattggcatcaatgtcaaacgtcacctcgatctg 22368



to top

>emb|AL671762.10| Human DNA sequence from clone XXbac-254B15 on chromosome 6 contains the
             5' end of the VARS2 gene for valyl-tRNA synthetase 2, the
             gene for  chromosome 6 open reading frame 28, the HSPA1L
             gene for heat shock 70kDa protein 1-like, the HSPA1A gene
             for heat shock 70kDa protein 1A, the HSPA1B gene for heat
             shock 70kDa protein 1B, the gene for chromosome 6 open
             reading frame 48, the NEU1 gene for sialidase 1 (lysosomal
             sialidase), the gene forchromosome 6 open reading frame
             29, the gene for  HLA-B associated transcript 8, the gene
             for chromosome 6 open reading frame 46 and eight CpG
             islands, complete sequence
          Length = 113582

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 40/44 (90%)
 Strand = Plus / Plus

                                                         
Query: 633   ttgacaataccattggcatcaatgtcaaaagtgacctcaatctg 676
             |||| |||||||||||||||||||||||| || ||||| |||||
Sbjct: 18355 ttgagaataccattggcatcaatgtcaaacgtcacctcgatctg 18398



to top

>emb|AL662834.8| Human DNA sequence from clone XXbac-40G17 on chromosome 6 contains the
             MSH5 gene for mutS homolog 5 (e. coli), the gene for NG23
             protein, the gene for chromosome 6 open reading frame 27,
             the VARS2 gene for valyl-tRNA synthetase 2, the gene for
             chromosome 6 open reading frame 28, the HSPA1L gene for
             heat shock 70kDa protein 1-like, the HSPA1A gene for heat
             shock 70kDa protein 1A, the HSPA1B gene for heat shock
             70kDa protein 1B, the gene for chromosome 6 open reading
             frame 48, the NEU1 gene for sialidase 1 (lysosomal
             sialidase), the gene for chromosome 6 open reading frame
             29, the BAT8 gene for HLA-B associated transcript 8, the
             gene for chromosome 6 open reading frame 46 and nine CpG
             islands, complete sequence
          Length = 179894

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 40/44 (90%)
 Strand = Plus / Plus

                                                         
Query: 633   ttgacaataccattggcatcaatgtcaaaagtgacctcaatctg 676
             |||| |||||||||||||||||||||||| || ||||| |||||
Sbjct: 74393 ttgagaataccattggcatcaatgtcaaacgtcacctcgatctg 74436



to top

>emb|Y11413.1|DRHSC70 D.rerio hsc70 mRNA
          Length = 2306

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 31/32 (96%)
 Strand = Plus / Minus

                                            
Query: 642  ccattggcatcaatgtcaaaagtgacctcaat 673
            |||||||||||||||||||| |||||||||||
Sbjct: 1517 ccattggcatcaatgtcaaaggtgacctcaat 1486



to top

>gb|AF502513.1| Isurus oxyrinchus isolate Isox10 Hsp70 pseudogene, partial sequence
          Length = 681

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 37/40 (92%)
 Strand = Plus / Minus

                                                   
Query: 642 ccattggcatcaatgtcaaaagtgacctcaatctgtggca 681
           |||||||||||||| || || |||||||||||||||||||
Sbjct: 629 ccattggcatcaatatcgaaggtgacctcaatctgtggca 590



to top

>gb|AF502488.1| Pseudocarcharias kamoharai isolate Pska5 Hsp70 protein (Hsp70) gene,
            partial cds
          Length = 1377

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 37/40 (92%)
 Strand = Plus / Minus

                                                    
Query: 642  ccattggcatcaatgtcaaaagtgacctcaatctgtggca 681
            |||||||||||||| ||||| |||||||| ||||||||||
Sbjct: 1325 ccattggcatcaatatcaaaggtgacctcgatctgtggca 1286



to top

>gb|AF502487.1| Pseudocarcharias kamoharai isolate Pska4 Hsp70 protein (Hsp70) gene,
            partial cds
          Length = 1386

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 37/40 (92%)
 Strand = Plus / Minus

                                                    
Query: 642  ccattggcatcaatgtcaaaagtgacctcaatctgtggca 681
            |||||||||||||| ||||| |||||||| ||||||||||
Sbjct: 1334 ccattggcatcaatatcaaaggtgacctcgatctgtggca 1295



to top

>gb|AF502486.1| Pseudocarcharias kamoharai isolate Pska3 Hsp70 protein (Hsp70) gene,
            partial cds
          Length = 1386

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 37/40 (92%)
 Strand = Plus / Minus

                                                    
Query: 642  ccattggcatcaatgtcaaaagtgacctcaatctgtggca 681
            |||||||||||||| ||||| |||||||| ||||||||||
Sbjct: 1334 ccattggcatcaatatcaaaggtgacctcgatctgtggca 1295



to top

>gb|AF502485.1| Pseudocarcharias kamoharai isolate Pska2 Hsp70 protein (Hsp70) gene,
            partial cds
          Length = 1386

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 37/40 (92%)
 Strand = Plus / Minus

                                                    
Query: 642  ccattggcatcaatgtcaaaagtgacctcaatctgtggca 681
            |||||||||||||| ||||| |||||||| ||||||||||
Sbjct: 1334 ccattggcatcaatatcaaaggtgacctcgatctgtggca 1295



to top

>gb|AF502484.1| Pseudocarcharias kamoharai isolate Pska1 Hsp70 protein (Hsp70) gene,
            partial cds
          Length = 1386

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 37/40 (92%)
 Strand = Plus / Minus

                                                    
Query: 642  ccattggcatcaatgtcaaaagtgacctcaatctgtggca 681
            |||||||||||||| ||||| |||||||| ||||||||||
Sbjct: 1334 ccattggcatcaatatcaaaggtgacctcgatctgtggca 1295



to top

>gb|AF502483.1| Odontaspis ferox isolate Odfe6 Hsp70 protein (Hsp70) gene, partial
            cds
          Length = 1386

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 37/40 (92%)
 Strand = Plus / Minus

                                                    
Query: 642  ccattggcatcaatgtcaaaagtgacctcaatctgtggca 681
            |||||||||||||| ||||| |||||||| ||||||||||
Sbjct: 1334 ccattggcatcaatatcaaaggtgacctcgatctgtggca 1295



to top

>gb|AF502482.1| Odontaspis ferox isolate Odfe5 Hsp70 protein (Hsp70) gene, partial
            cds
          Length = 1386

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 37/40 (92%)
 Strand = Plus / Minus

                                                    
Query: 642  ccattggcatcaatgtcaaaagtgacctcaatctgtggca 681
            |||||||||||||| ||||| |||||||| ||||||||||
Sbjct: 1334 ccattggcatcaatatcaaaggtgacctcgatctgtggca 1295



to top

>gb|AF502478.1| Mitsukurina owstoni isolate Miow2 Hsp70 protein (Hsp70) gene, partial
            cds
          Length = 1386

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 37/40 (92%)
 Strand = Plus / Minus

                                                    
Query: 642  ccattggcatcaatgtcaaaagtgacctcaatctgtggca 681
            |||||||||||||| ||||| |||||||| ||||||||||
Sbjct: 1334 ccattggcatcaatatcaaaggtgacctcgatctgtggca 1295



to top

>gb|AF502476.1| Megachasma pelagios isolate Mepe7 Hsp70 protein (Hsp70) gene, partial
            cds
          Length = 1386

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 37/40 (92%)
 Strand = Plus / Minus

                                                    
Query: 642  ccattggcatcaatgtcaaaagtgacctcaatctgtggca 681
            |||||||||||||| ||||| |||||||| ||||||||||
Sbjct: 1334 ccattggcatcaatatcaaaggtgacctcgatctgtggca 1295



to top

>gb|AF502475.1| Megachasma pelagios isolate Mepe6 Hsp70 protein (Hsp70) gene, partial
            cds
          Length = 1386

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 37/40 (92%)
 Strand = Plus / Minus

                                                    
Query: 642  ccattggcatcaatgtcaaaagtgacctcaatctgtggca 681
            |||||||||||||| ||||| |||||||| ||||||||||
Sbjct: 1334 ccattggcatcaatatcaaaggtgacctcgatctgtggca 1295



to top

>gb|AF502474.1| Megachasma pelagios isolate Mepe5 Hsp70 protein (Hsp70) gene, partial
            cds
          Length = 1386

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 37/40 (92%)
 Strand = Plus / Minus

                                                    
Query: 642  ccattggcatcaatgtcaaaagtgacctcaatctgtggca 681
            |||||||||||||| ||||| |||||||| ||||||||||
Sbjct: 1334 ccattggcatcaatatcaaaggtgacctcgatctgtggca 1295



to top

>gb|AF502473.1| Megachasma pelagios isolate Mepe4 Hsp70 protein (Hsp70) gene, partial
            cds
          Length = 1386

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 37/40 (92%)
 Strand = Plus / Minus

                                                    
Query: 642  ccattggcatcaatgtcaaaagtgacctcaatctgtggca 681
            |||||||||||||| ||||| |||||||| ||||||||||
Sbjct: 1334 ccattggcatcaatatcaaaggtgacctcgatctgtggca 1295



to top

>gb|AF502470.1| Megachasma pelagios isolate Mepe1 Hsp70 protein (Hsp70) gene, partial
            cds
          Length = 1386

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 37/40 (92%)
 Strand = Plus / Minus

                                                    
Query: 642  ccattggcatcaatgtcaaaagtgacctcaatctgtggca 681
            |||||||||||||| ||||| |||||||| ||||||||||
Sbjct: 1334 ccattggcatcaatatcaaaggtgacctcgatctgtggca 1295



to top

>gb|AF502461.1| Alopias vulpinus isolate Alvu5 Hsp70 protein (Hsp70) gene, partial
            cds
          Length = 1386

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 37/40 (92%)
 Strand = Plus / Minus

                                                    
Query: 642  ccattggcatcaatgtcaaaagtgacctcaatctgtggca 681
            |||||||||||||| ||||| |||||||| ||||||||||
Sbjct: 1334 ccattggcatcaatatcaaaggtgacctcgatctgtggca 1295



to top

>gb|AF502455.1| Alopias superciliosus isolate Alsu5 Hsp70 protein (Hsp70) gene,
            partial cds
          Length = 1386

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 37/40 (92%)
 Strand = Plus / Minus

                                                    
Query: 642  ccattggcatcaatgtcaaaagtgacctcaatctgtggca 681
            |||||||||||||| ||||| |||||||| ||||||||||
Sbjct: 1334 ccattggcatcaatatcaaaggtgacctcgatctgtggca 1295



to top

>gb|AF502454.1| Alopias superciliosus isolate Alsu4 Hsp70 protein (Hsp70) gene,
            partial cds
          Length = 1386

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 37/40 (92%)
 Strand = Plus / Minus

                                                    
Query: 642  ccattggcatcaatgtcaaaagtgacctcaatctgtggca 681
            |||||||||||||| ||||| |||||||| ||||||||||
Sbjct: 1334 ccattggcatcaatatcaaaggtgacctcgatctgtggca 1295



to top

>gb|AF502453.1| Alopias superciliosus isolate Alsu3 Hsp70 protein (Hsp70) gene,
            partial cds
          Length = 1386

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 37/40 (92%)
 Strand = Plus / Minus

                                                    
Query: 642  ccattggcatcaatgtcaaaagtgacctcaatctgtggca 681
            |||||||||||||| ||||| |||||||| ||||||||||
Sbjct: 1334 ccattggcatcaatatcaaaggtgacctcgatctgtggca 1295



to top

>gb|AF502450.1| Alopias pelagicus isolate Alpe6 Hsp70 protein (Hsp70) gene, partial
            cds
          Length = 1386

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 37/40 (92%)
 Strand = Plus / Minus

                                                    
Query: 642  ccattggcatcaatgtcaaaagtgacctcaatctgtggca 681
            |||||||||||||| ||||| |||||||| ||||||||||
Sbjct: 1334 ccattggcatcaatatcaaaggtgacctcgatctgtggca 1295



to top

>gb|AF502449.1| Alopias pelagicus isolate Alpe5 Hsp70 protein (Hsp70) gene, partial
            cds
          Length = 1386

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 37/40 (92%)
 Strand = Plus / Minus

                                                    
Query: 642  ccattggcatcaatgtcaaaagtgacctcaatctgtggca 681
            |||||||||||||| ||||| |||||||| ||||||||||
Sbjct: 1334 ccattggcatcaatatcaaaggtgacctcgatctgtggca 1295



to top

>gb|AF502448.1| Alopias pelagicus isolate Alpe4 Hsp70 protein (Hsp70) gene, partial
            cds
          Length = 1386

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 37/40 (92%)
 Strand = Plus / Minus

                                                    
Query: 642  ccattggcatcaatgtcaaaagtgacctcaatctgtggca 681
            |||||||||||||| ||||| |||||||| ||||||||||
Sbjct: 1334 ccattggcatcaatatcaaaggtgacctcgatctgtggca 1295



to top

>gb|AF502447.1| Alopias pelagicus isolate Alpe3 Hsp70 protein (Hsp70) gene, partial
            cds
          Length = 1386

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 37/40 (92%)
 Strand = Plus / Minus

                                                    
Query: 642  ccattggcatcaatgtcaaaagtgacctcaatctgtggca 681
            |||||||||||||| ||||| |||||||| ||||||||||
Sbjct: 1334 ccattggcatcaatatcaaaggtgacctcgatctgtggca 1295



to top

>gb|AF502446.1| Alopias pelagicus isolate Alpe2 Hsp70 protein (Hsp70) gene, partial
            cds
          Length = 1386

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 37/40 (92%)
 Strand = Plus / Minus

                                                    
Query: 642  ccattggcatcaatgtcaaaagtgacctcaatctgtggca 681
            |||||||||||||| ||||| |||||||| ||||||||||
Sbjct: 1334 ccattggcatcaatatcaaaggtgacctcgatctgtggca 1295



to top

>gb|AF502443.1| Odontaspis ferox isolate Odfe2 Hsp70 protein (Hsp70) gene, partial
            cds
          Length = 1386

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 37/40 (92%)
 Strand = Plus / Minus

                                                    
Query: 642  ccattggcatcaatgtcaaaagtgacctcaatctgtggca 681
            |||||||||||||| ||||| |||||||| ||||||||||
Sbjct: 1334 ccattggcatcaatatcaaaggtgacctcgatctgtggca 1295



to top

>gb|AF502442.1| Odontaspis ferox isolate Odfe1 Hsp70 protein (Hsp70) gene, partial
            cds
          Length = 1386

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 37/40 (92%)
 Strand = Plus / Minus

                                                    
Query: 642  ccattggcatcaatgtcaaaagtgacctcaatctgtggca 681
            |||||||||||||| ||||| |||||||| ||||||||||
Sbjct: 1334 ccattggcatcaatatcaaaggtgacctcgatctgtggca 1295



to top

>emb|CR759915.6| Human DNA sequence from clone DAAP-21F2 on chromosome 6, complete
             sequence
          Length = 85491

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 40/44 (90%)
 Strand = Plus / Plus

                                                         
Query: 633   ttgacaataccattggcatcaatgtcaaaagtgacctcaatctg 676
             |||| |||||||||||||||||||||||| || ||||| |||||
Sbjct: 55563 ttgagaataccattggcatcaatgtcaaacgtcacctcgatctg 55606



to top

>emb|CR388202.9| Human DNA sequence from clone DADB-333F21 on chromosome 6, complete
            sequence
          Length = 80364

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 40/44 (90%)
 Strand = Plus / Plus

                                                        
Query: 633  ttgacaataccattggcatcaatgtcaaaagtgacctcaatctg 676
            |||| |||||||||||||||||||||||| || ||||| |||||
Sbjct: 3592 ttgagaataccattggcatcaatgtcaaacgtcacctcgatctg 3635



to top

>gb|DQ383515.2| Homo sapiens heat shock 70kDa protein 1-like (HSPA1L) gene, complete
            cds
          Length = 7745

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 40/44 (90%)
 Strand = Plus / Minus

                                                        
Query: 633  ttgacaataccattggcatcaatgtcaaaagtgacctcaatctg 676
            |||| |||||||||||||||||||||||| || ||||| |||||
Sbjct: 5253 ttgagaataccattggcatcaatgtcaaacgtcacctcgatctg 5210



to top

>ref|XM_687844.1| PREDICTED: Danio rerio similar to Heat shock protein 8 (LOC573376),
            mRNA
          Length = 2439

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 31/32 (96%)
 Strand = Plus / Minus

                                            
Query: 642  ccattggcatcaatgtcaaaagtgacctcaat 673
            |||||||||||||||||||| |||||||||||
Sbjct: 1535 ccattggcatcaatgtcaaaggtgacctcaat 1504



to top

>dbj|AB168812.1| Macaca fascicularis testis cDNA, clone: QtsA-15024, similar to human
            heat shock 70kDa protein 1-like (HSPA1L), mRNA, RefSeq:
            NM_005527.2
          Length = 2449

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 40/44 (90%)
 Strand = Plus / Minus

                                                        
Query: 633  ttgacaataccattggcatcaatgtcaaaagtgacctcaatctg 676
            |||| |||||||||||||||||||||||| || ||||| |||||
Sbjct: 1619 ttgagaataccattggcatcaatgtcaaacgtcacctcgatctg 1576



to top

>dbj|AB168570.1| Macaca fascicularis testis cDNA clone: QtsA-13086, similar to human
            heat shock 70kDa protein 1-like (HSPA1L), mRNA, RefSeq:
            NM_005527.2
          Length = 2422

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 40/44 (90%)
 Strand = Plus / Minus

                                                        
Query: 633  ttgacaataccattggcatcaatgtcaaaagtgacctcaatctg 676
            |||| |||||||||||||||||||||||| || ||||| |||||
Sbjct: 1632 ttgagaataccattggcatcaatgtcaaacgtcacctcgatctg 1589



to top

>gb|AF217511.1|AF217511 Homo sapiens uncharacterized bone marrow protein BM034 mRNA,
           complete cds
          Length = 923

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 31/32 (96%)
 Strand = Plus / Minus

                                           
Query: 645 ttggcatcaatgtcaaaagtgacctcaatctg 676
           ||||||||||||||||||||||| ||||||||
Sbjct: 170 ttggcatcaatgtcaaaagtgacttcaatctg 139



to top

>gb|AC148662.1| Macaca mulatta Major Histocompatibility Complex BAC MMU009PO6, complete
             sequence
          Length = 191271

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 40/44 (90%)
 Strand = Plus / Plus

                                                         
Query: 633   ttgacaataccattggcatcaatgtcaaaagtgacctcaatctg 676
             |||| |||||||||||||||||||||||| || ||||| |||||
Sbjct: 62579 ttgagaataccattggcatcaatgtcaaacgtcacctcgatctg 62622



to top

>emb|BX276087.14| Zebrafish DNA sequence from clone CH211-270M20 in linkage group 10,
             complete sequence
          Length = 167208

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 31/32 (96%)
 Strand = Plus / Minus

                                             
Query: 642   ccattggcatcaatgtcaaaagtgacctcaat 673
             |||||||||||||||||||| |||||||||||
Sbjct: 12878 ccattggcatcaatgtcaaaggtgacctcaat 12847



to top

>dbj|AK223386.1| Homo sapiens mRNA for heat shock 70kDa protein 1-like variant, clone:
            FCC106F11
          Length = 2411

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 40/44 (90%)
 Strand = Plus / Minus

                                                        
Query: 633  ttgacaataccattggcatcaatgtcaaaagtgacctcaatctg 676
            |||| |||||||||||||||||||||||| || ||||| |||||
Sbjct: 1623 ttgagaataccattggcatcaatgtcaaacgtcacctcgatctg 1580



to top

>gb|BC063228.1| Danio rerio heat shock protein 8, mRNA (cDNA clone MGC:77588
            IMAGE:6997248), complete cds
          Length = 2346

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 31/32 (96%)
 Strand = Plus / Minus

                                            
Query: 642  ccattggcatcaatgtcaaaagtgacctcaat 673
            |||||||||||||||||||| |||||||||||
Sbjct: 1520 ccattggcatcaatgtcaaaggtgacctcaat 1489



to top

>gb|BC045841.1| Danio rerio heat shock protein 8, mRNA (cDNA clone MGC:55272
            IMAGE:3819770), complete cds
          Length = 2358

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 31/32 (96%)
 Strand = Plus / Minus

                                            
Query: 642  ccattggcatcaatgtcaaaagtgacctcaat 673
            |||||||||||||||||||| |||||||||||
Sbjct: 1541 ccattggcatcaatgtcaaaggtgacctcaat 1510



to top

>ref|NM_131401.1| Danio rerio heat shock protein 8 (hspa8), mRNA
          Length = 2317

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 31/32 (96%)
 Strand = Plus / Minus

                                            
Query: 642  ccattggcatcaatgtcaaaagtgacctcaat 673
            |||||||||||||||||||| |||||||||||
Sbjct: 1517 ccattggcatcaatgtcaaaggtgacctcaat 1486



to top

>dbj|BA000025.2| Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region
          Length = 2229817

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 40/44 (90%)
 Strand = Plus / Minus

                                                          
Query: 633    ttgacaataccattggcatcaatgtcaaaagtgacctcaatctg 676
              |||| |||||||||||||||||||||||| || ||||| |||||
Sbjct: 133501 ttgagaataccattggcatcaatgtcaaacgtcacctcgatctg 133458



to top

>gb|AY892966.1| Synthetic construct Homo sapiens clone FLH141345.01L heat shock 70kDa
            protein 1-like (HSPA1L) mRNA, partial cds
          Length = 1926

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 40/44 (90%)
 Strand = Plus / Minus

                                                        
Query: 633  ttgacaataccattggcatcaatgtcaaaagtgacctcaatctg 676
            |||| |||||||||||||||||||||||| || ||||| |||||
Sbjct: 1466 ttgagaataccattggcatcaatgtcaaacgtcacctcgatctg 1423



to top

>gb|AY890508.1| Synthetic construct Homo sapiens clone FLH141349.01X heat shock 70kDa
            protein 1-like (HSPA1L) mRNA, complete cds
          Length = 1926

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 40/44 (90%)
 Strand = Plus / Minus

                                                        
Query: 633  ttgacaataccattggcatcaatgtcaaaagtgacctcaatctg 676
            |||| |||||||||||||||||||||||| || ||||| |||||
Sbjct: 1466 ttgagaataccattggcatcaatgtcaaacgtcacctcgatctg 1423



to top

>gb|L77146.1|ZEFHSC7R Danio rerio heat shock cognate (hsc70) mRNA, complete cds
          Length = 2372

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 31/32 (96%)
 Strand = Plus / Minus

                                            
Query: 642  ccattggcatcaatgtcaaaagtgacctcaat 673
            |||||||||||||||||||| |||||||||||
Sbjct: 1569 ccattggcatcaatgtcaaaggtgacctcaat 1538



to top

>emb|BX120005.6| Zebrafish DNA sequence from clone RP71-56I13 in linkage group 10,
             complete sequence
          Length = 129782

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 31/32 (96%)
 Strand = Plus / Minus

                                             
Query: 642   ccattggcatcaatgtcaaaagtgacctcaat 673
             |||||||||||||||||||| |||||||||||
Sbjct: 59273 ccattggcatcaatgtcaaaggtgacctcaat 59242



to top

>dbj|AB002583.1| Cyanidioschyzon merolae chloroplast DNA, complete genome, strain:10D
          Length = 149987

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 37/40 (92%)
 Strand = Plus / Plus

                                                      
Query: 642    ccattggcatcaatgtcaaaagtgacctcaatctgtggca 681
              |||||||||||||||||||| || |||||||| |||||||
Sbjct: 105128 ccattggcatcaatgtcaaatgtcacctcaatttgtggca 105167



to top

>gb|BC066491.1| Danio rerio heat shock protein 8, mRNA (cDNA clone MGC:76861
            IMAGE:6525762), complete cds
          Length = 2317

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 31/32 (96%)
 Strand = Plus / Minus

                                            
Query: 642  ccattggcatcaatgtcaaaagtgacctcaat 673
            |||||||||||||||||||| |||||||||||
Sbjct: 1511 ccattggcatcaatgtcaaaggtgacctcaat 1480



to top

>emb|AL132713.11|HSDJ71I17 Human DNA sequence from clone RP1-71I17 on chromosome 6p21.2-22.1,
            complete sequence
          Length = 163682

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 40/44 (90%)
 Strand = Plus / Minus

                                                        
Query: 633  ttgacaataccattggcatcaatgtcaaaagtgacctcaatctg 676
            |||| |||||||||||||||||||||||| || ||||| |||||
Sbjct: 1223 ttgagaataccattggcatcaatgtcaaacgtcacctcgatctg 1180



to top

>gb|M59829.1|HUMMHHSPHO Human MHC class III HSP70-HOM gene (HLA), complete cds
          Length = 3330

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 40/44 (90%)
 Strand = Plus / Minus

                                                        
Query: 633  ttgacaataccattggcatcaatgtcaaaagtgacctcaatctg 676
            |||| |||||||||||||||||||||||| || ||||| |||||
Sbjct: 2425 ttgagaataccattggcatcaatgtcaaacgtcacctcgatctg 2382



to top

>dbj|D85730.1| Homo sapiens HSPA1L mRNA for Heat shock protein 70 testis variant,
            complete cds
          Length = 2371

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 40/44 (90%)
 Strand = Plus / Minus

                                                        
Query: 633  ttgacaataccattggcatcaatgtcaaaagtgacctcaatctg 676
            |||| |||||||||||||||||||||||| || ||||| |||||
Sbjct: 1601 ttgagaataccattggcatcaatgtcaaacgtcacctcgatctg 1558



to top

>gb|BC106169.1| Mus musculus heat shock protein 8, mRNA (cDNA clone IMAGE:4237567),
            partial cds
          Length = 1804

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                               
Query: 642  ccattggcatcaatgtcaaaagtgacctcaatctg 676
            ||||||||||| ||||||||||| |||||||||||
Sbjct: 1210 ccattggcatcgatgtcaaaagtaacctcaatctg 1176



to top

>gb|BC106193.1| Mus musculus heat shock protein 8, mRNA (cDNA clone MGC:118485
            IMAGE:6329283), complete cds
          Length = 2129

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                               
Query: 642  ccattggcatcaatgtcaaaagtgacctcaatctg 676
            ||||||||||| ||||||||||| |||||||||||
Sbjct: 1514 ccattggcatcgatgtcaaaagtaacctcaatctg 1480



to top

>gb|BC085486.1| Mus musculus heat shock protein 8, mRNA (cDNA clone MGC:102008
            IMAGE:30540914), complete cds
          Length = 2129

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                               
Query: 642  ccattggcatcaatgtcaaaagtgacctcaatctg 676
            ||||||||||| ||||||||||| |||||||||||
Sbjct: 1518 ccattggcatcgatgtcaaaagtaacctcaatctg 1484



to top

>gb|AY466445.1| Macrobrachium rosenbergii heat shock protein 70 mRNA, complete cds
          Length = 2448

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 39/43 (90%)
 Strand = Plus / Minus

                                                       
Query: 639  ataccattggcatcaatgtcaaaagtgacctcaatctgtggca 681
            ||||||||||||||||| |||||||| || ||||| |||||||
Sbjct: 1548 ataccattggcatcaatatcaaaagtcacttcaatttgtggca 1506



to top

>ref|NM_031165.3| Mus musculus heat shock protein 8 (Hspa8), mRNA
          Length = 2146

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                               
Query: 642  ccattggcatcaatgtcaaaagtgacctcaatctg 676
            ||||||||||| ||||||||||| |||||||||||
Sbjct: 1554 ccattggcatcgatgtcaaaagtaacctcaatctg 1520



to top

>ref|XM_986932.1| PREDICTED: Mus musculus similar to heat shock protein 8 (LOC666904),
            mRNA
          Length = 2140

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                               
Query: 642  ccattggcatcaatgtcaaaagtgacctcaatctg 676
            ||||||||||| ||||||||||| |||||||||||
Sbjct: 1541 ccattggcatcgatgtcaaaagtaacctcaatctg 1507



to top

>ref|XM_989582.1| PREDICTED: Mus musculus similar to heat shock protein 8 (LOC621284),
            mRNA
          Length = 2179

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                               
Query: 642  ccattggcatcaatgtcaaaagtgacctcaatctg 676
            ||||||||||| ||||||||||| |||||||||||
Sbjct: 1640 ccattggcatcgatgtcaaaagtaacctcaatctg 1606



to top

>ref|XR_001853.1| PREDICTED: Mus musculus similar to heat shock protein 8 (LOC666292),
            mRNA
          Length = 1953

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                               
Query: 642  ccattggcatcaatgtcaaaagtgacctcaatctg 676
            ||||||||||| ||||||||||| |||||||||||
Sbjct: 1467 ccattggcatcgatgtcaaaagtaacctcaatctg 1433



to top

>ref|XR_003182.1| PREDICTED: Mus musculus similar to heat shock protein 8 (LOC435663),
            mRNA
          Length = 1815

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                               
Query: 642  ccattggcatcaatgtcaaaagtgacctcaatctg 676
            ||||||||||| ||||||||||| |||||||||||
Sbjct: 1467 ccattggcatcgatgtcaaaagtaacctcaatctg 1433



to top

>emb|AJ783715.1| Mytilus galloprovincialis partial hsc70 gene for heat shock cognate
            70, exons 4-5
          Length = 4487

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 39/43 (90%)
 Strand = Plus / Minus

                                                       
Query: 639  ataccattggcatcaatgtcaaaagtgacctcaatctgtggca 681
            ||||||||||||||||||||||| || || |||||||| ||||
Sbjct: 4263 ataccattggcatcaatgtcaaaggtcacttcaatctggggca 4221



to top

>emb|AJ783714.1| Mytilus galloprovincialis hsc71 gene for heat shock cognate 71, exons
            1-6
          Length = 7254

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 39/43 (90%)
 Strand = Plus / Minus

                                                       
Query: 639  ataccattggcatcaatgtcaaaagtgacctcaatctgtggca 681
            ||||||||||||||||||||||| || || |||||||| ||||
Sbjct: 5899 ataccattggcatcaatgtcaaaggtcacttcaatctggggca 5857



to top

>gb|AC109329.8| Homo sapiens chromosome 8, clone CTD-3107M8, complete sequence
          Length = 215644

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                               
Query: 642  ccattggcatcaatgtcaaaagtgacctcaatctg 676
            |||||||||||||||||||||||||| || |||||
Sbjct: 5400 ccattggcatcaatgtcaaaagtgacttcgatctg 5366



to top

>gb|AC111044.9| Mus musculus chromosome 10, clone RP23-299H4, complete sequence
          Length = 165614

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                                 
Query: 642    ccattggcatcaatgtcaaaagtgacctcaatctg 676
              ||||||||||| ||||||||||| |||||||||||
Sbjct: 141001 ccattggcatcgatgtcaaaagtaacctcaatctg 140967



to top

>gb|AY219845.1| Cyprinus carpio constitutive heat shock protein HSC70-2 (hsc70-2)
            mRNA, partial cds
          Length = 1935

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                               
Query: 642  ccattggcatcaatgtcaaaagtgacctcaatctg 676
            |||||||||||||||||||| |||||||| |||||
Sbjct: 1436 ccattggcatcaatgtcaaaggtgacctctatctg 1402



to top

>gb|AY219844.1| Cyprinus carpio constitutive heat shock protein HSC70-1 (hsc70-1)
            gene, partial cds
          Length = 4257

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 48/55 (87%)
 Strand = Plus / Minus

                                                                   
Query: 627  gacaccttgacaataccattggcatcaatgtcaaaagtgacctcaatctgtggca 681
            ||||| |||| ||| |||||||||||||||||||| || || ||||| |||||||
Sbjct: 3270 gacacattgagaatgccattggcatcaatgtcaaatgtaacttcaatttgtggca 3216



to top

>gb|AY226078.1| Monosiga brevicollis type Mb_C 70-kDa heat-shock protein-like (hsp70)
            mRNA, partial sequence
          Length = 2083

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 39/43 (90%)
 Strand = Plus / Minus

                                                       
Query: 639  ataccattggcatcaatgtcaaaagtgacctcaatctgtggca 681
            ||||| ||||| ||||||||||| |||||||||||||| ||||
Sbjct: 1469 ataccgttggcgtcaatgtcaaaggtgacctcaatctggggca 1427



to top

>gb|AY120893.1| Cyprinus carpio muscle-specific heat shock protein Hsc70-1 mRNA,
            partial cds
          Length = 1917

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 48/55 (87%)
 Strand = Plus / Minus

                                                                   
Query: 627  gacaccttgacaataccattggcatcaatgtcaaaagtgacctcaatctgtggca 681
            ||||| |||| ||| |||||||||||||||||||| || || ||||| |||||||
Sbjct: 1442 gacacattgagaatgccattggcatcaatgtcaaatgtaacttcaatttgtggca 1388



to top

>emb|Z49764.2|PM5LBIPRT Pseudotsuga menziesii mRNA for luminal binding protein (BiP gene)
          Length = 2626

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 39/43 (90%)
 Strand = Plus / Minus

                                                       
Query: 639  ataccattggcatcaatgtcaaaagtgacctcaatctgtggca 681
            ||||| ||||||||||  ||||| |||||||||||||||||||
Sbjct: 1893 ataccgttggcatcaacctcaaaggtgacctcaatctgtggca 1851



to top

>emb|Y15109.1|SRY15109 Sycon raphanus mRNA for heat shock protein 70
          Length = 2327

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 39/43 (90%)
 Strand = Plus / Minus

                                                       
Query: 639  ataccattggcatcaatgtcaaaagtgacctcaatctgtggca 681
            ||||| |||||||||||||||||||| ||||| || |||||||
Sbjct: 1445 ataccgttggcatcaatgtcaaaagttacctcgatttgtggca 1403



to top

>emb|AJ305316.1|OED305316 Ostrea edulis hsc70 gene, exons 1-6
          Length = 2569

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 39/43 (90%)
 Strand = Plus / Minus

                                                       
Query: 639  ataccattggcatcaatgtcaaaagtgacctcaatctgtggca 681
            ||||| ||||| ||||||||||| |||||||||||||| ||||
Sbjct: 2021 ataccgttggcgtcaatgtcaaatgtgacctcaatctggggca 1979



to top

>gb|AC125311.3| Mus musculus BAC clone RP24-325G24 from chromosome 14, complete
             sequence
          Length = 162530

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 33/35 (94%)
 Strand = Plus / Plus

                                                
Query: 642   ccattggcatcaatgtcaaaagtgacctcaatctg 676
             ||||||||||| ||||||||||| |||||||||||
Sbjct: 60756 ccattggcatcgatgtcaaaagtaacctcaatctg 60790



to top

>gb|AC158355.2| Mus musculus BAC clone RP24-374N16 from chromosome 9, complete sequence
          Length = 172612

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                                
Query: 642   ccattggcatcaatgtcaaaagtgacctcaatctg 676
             ||||||||||| ||||||||||| |||||||||||
Sbjct: 93714 ccattggcatcgatgtcaaaagtaacctcaatctg 93680



to top

>dbj|AK098074.1| Mus musculus cDNA fis, clone TRACH2001651,highly similar to HEAT
            SHOCK COGNATE 71 KDA PROTEIN
          Length = 2104

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                               
Query: 642  ccattggcatcaatgtcaaaagtgacctcaatctg 676
            ||||||||||| ||||||||||| |||||||||||
Sbjct: 1529 ccattggcatcgatgtcaaaagtaacctcaatctg 1495



to top

>dbj|AK145416.1| Mus musculus morula whole body morula cDNA, RIKEN full-length
            enriched library, clone:I0C0040N18 product:heat shock
            protein 8, full insert sequence
          Length = 2024

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                               
Query: 642  ccattggcatcaatgtcaaaagtgacctcaatctg 676
            ||||||||||| ||||||||||| |||||||||||
Sbjct: 1452 ccattggcatcgatgtcaaaagtaacctcaatctg 1418



to top

>dbj|AK151065.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length enriched
            library, clone:I830022G24 product:heat shock protein 8,
            full insert sequence
          Length = 2102

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                               
Query: 642  ccattggcatcaatgtcaaaagtgacctcaatctg 676
            ||||||||||| ||||||||||| |||||||||||
Sbjct: 1530 ccattggcatcgatgtcaaaagtaacctcaatctg 1496



to top

>dbj|AK151041.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length enriched
            library, clone:I830022A04 product:heat shock protein 8,
            full insert sequence
          Length = 2102

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                               
Query: 642  ccattggcatcaatgtcaaaagtgacctcaatctg 676
            ||||||||||| ||||||||||| |||||||||||
Sbjct: 1530 ccattggcatcgatgtcaaaagtaacctcaatctg 1496



to top

>dbj|AK150958.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length enriched
            library, clone:I830018M07 product:heat shock protein 8,
            full insert sequence
          Length = 2099

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                               
Query: 642  ccattggcatcaatgtcaaaagtgacctcaatctg 676
            ||||||||||| ||||||||||| |||||||||||
Sbjct: 1527 ccattggcatcgatgtcaaaagtaacctcaatctg 1493



to top

>dbj|AK149954.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length enriched
            library, clone:G530109P04 product:heat shock protein 8,
            full insert sequence
          Length = 1736

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                               
Query: 642  ccattggcatcaatgtcaaaagtgacctcaatctg 676
            ||||||||||| ||||||||||| |||||||||||
Sbjct: 1527 ccattggcatcgatgtcaaaagtaacctcaatctg 1493



to top

>dbj|AK135281.1| Mus musculus 12 days embryo male wolffian duct includes surrounding
           region cDNA, RIKEN full-length enriched library,
           clone:6720454D15 product:heat shock protein 8, full
           insert sequence
          Length = 1270

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                              
Query: 642 ccattggcatcaatgtcaaaagtgacctcaatctg 676
           ||||||||||| ||||||||||| |||||||||||
Sbjct: 701 ccattggcatcgatgtcaaaagtaacctcaatctg 667



to top

>dbj|AK151997.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length enriched
            library, clone:I830044M06 product:heat shock protein 8,
            full insert sequence
          Length = 2102

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                               
Query: 642  ccattggcatcaatgtcaaaagtgacctcaatctg 676
            ||||||||||| ||||||||||| |||||||||||
Sbjct: 1530 ccattggcatcgatgtcaaaagtaacctcaatctg 1496



to top

>dbj|AK151948.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length enriched
            library, clone:I830043K24 product:heat shock protein 8,
            full insert sequence
          Length = 2105

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                               
Query: 642  ccattggcatcaatgtcaaaagtgacctcaatctg 676
            ||||||||||| ||||||||||| |||||||||||
Sbjct: 1533 ccattggcatcgatgtcaaaagtaacctcaatctg 1499



to top

>dbj|AK153032.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length enriched
            library, clone:I830119K01 product:heat shock protein 8,
            full insert sequence
          Length = 2104

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                               
Query: 642  ccattggcatcaatgtcaaaagtgacctcaatctg 676
            ||||||||||| ||||||||||| |||||||||||
Sbjct: 1532 ccattggcatcgatgtcaaaagtaacctcaatctg 1498



to top

>dbj|AK151892.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length enriched
            library, clone:I830041P06 product:heat shock protein 8,
            full insert sequence
          Length = 2104

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                               
Query: 642  ccattggcatcaatgtcaaaagtgacctcaatctg 676
            ||||||||||| ||||||||||| |||||||||||
Sbjct: 1532 ccattggcatcgatgtcaaaagtaacctcaatctg 1498



to top

>dbj|AK151865.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length enriched
            library, clone:I830041E10 product:heat shock protein 8,
            full insert sequence
          Length = 2102

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                               
Query: 642  ccattggcatcaatgtcaaaagtgacctcaatctg 676
            ||||||||||| ||||||||||| |||||||||||
Sbjct: 1530 ccattggcatcgatgtcaaaagtaacctcaatctg 1496



to top

>dbj|AK151808.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length enriched
            library, clone:I830037O20 product:heat shock protein 8,
            full insert sequence
          Length = 2105

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                               
Query: 642  ccattggcatcaatgtcaaaagtgacctcaatctg 676
            ||||||||||| ||||||||||| |||||||||||
Sbjct: 1533 ccattggcatcgatgtcaaaagtaacctcaatctg 1499



to top

>dbj|AK151775.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length enriched
            library, clone:I830037D02 product:heat shock protein 8,
            full insert sequence
          Length = 2104

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                               
Query: 642  ccattggcatcaatgtcaaaagtgacctcaatctg 676
            ||||||||||| ||||||||||| |||||||||||
Sbjct: 1532 ccattggcatcgatgtcaaaagtaacctcaatctg 1498



to top

>dbj|AK151741.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length enriched
            library, clone:I830036A03 product:heat shock protein 8,
            full insert sequence
          Length = 2102

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                               
Query: 642  ccattggcatcaatgtcaaaagtgacctcaatctg 676
            ||||||||||| ||||||||||| |||||||||||
Sbjct: 1530 ccattggcatcgatgtcaaaagtaacctcaatctg 1496



to top

>dbj|AK150846.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length
           enriched library, clone:I830015P17 product:heat shock
           protein 8, full insert sequence
          Length = 838

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                              
Query: 642 ccattggcatcaatgtcaaaagtgacctcaatctg 676
           ||||||||||| ||||||||||| |||||||||||
Sbjct: 266 ccattggcatcgatgtcaaaagtaacctcaatctg 232



to top

>dbj|AK146985.1| Mus musculus 17 days embryo kidney cDNA, RIKEN full-length enriched
            library, clone:I920082E06 product:heat shock protein 8,
            full insert sequence
          Length = 2099

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                               
Query: 642  ccattggcatcaatgtcaaaagtgacctcaatctg 676
            ||||||||||| ||||||||||| |||||||||||
Sbjct: 1530 ccattggcatcgatgtcaaaagtaacctcaatctg 1496



to top

>dbj|AK146708.1| Mus musculus 16 days embryo heart cDNA, RIKEN full-length enriched
            library, clone:I920045H19 product:heat shock protein 8,
            full insert sequence
          Length = 2100

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                               
Query: 642  ccattggcatcaatgtcaaaagtgacctcaatctg 676
            ||||||||||| ||||||||||| |||||||||||
Sbjct: 1527 ccattggcatcgatgtcaaaagtaacctcaatctg 1493



to top

>dbj|AK153834.1| Mus musculus 2 days neonate thymus thymic cells cDNA, RIKEN
            full-length enriched library, clone:C920013M21
            product:heat shock protein 8, full insert sequence
          Length = 2099

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                               
Query: 642  ccattggcatcaatgtcaaaagtgacctcaatctg 676
            ||||||||||| ||||||||||| |||||||||||
Sbjct: 1530 ccattggcatcgatgtcaaaagtaacctcaatctg 1496



to top

>dbj|AK152803.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length enriched
            library, clone:I830086I04 product:heat shock protein 8,
            full insert sequence
          Length = 2108

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                               
Query: 642  ccattggcatcaatgtcaaaagtgacctcaatctg 676
            ||||||||||| ||||||||||| |||||||||||
Sbjct: 1536 ccattggcatcgatgtcaaaagtaacctcaatctg 1502



to top

>dbj|AK152768.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length enriched
            library, clone:I830084I22 product:heat shock protein 8,
            full insert sequence
          Length = 2105

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                               
Query: 642  ccattggcatcaatgtcaaaagtgacctcaatctg 676
            ||||||||||| ||||||||||| |||||||||||
Sbjct: 1533 ccattggcatcgatgtcaaaagtaacctcaatctg 1499



to top

>dbj|AK152703.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length enriched
            library, clone:I830082N12 product:heat shock protein 8,
            full insert sequence
          Length = 2102

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                               
Query: 642  ccattggcatcaatgtcaaaagtgacctcaatctg 676
            ||||||||||| ||||||||||| |||||||||||
Sbjct: 1530 ccattggcatcgatgtcaaaagtaacctcaatctg 1496



to top

>gb|AC090820.6| Homo sapiens chromosome 8, clone CTD-2345M20, complete sequence
          Length = 138021

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                                
Query: 642   ccattggcatcaatgtcaaaagtgacctcaatctg 676
             |||||||||||||||||||||||||| || |||||
Sbjct: 51935 ccattggcatcaatgtcaaaagtgacttcgatctg 51901



to top

>dbj|AK151537.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length enriched
            library, clone:I830031H16 product:heat shock protein 8,
            full insert sequence
          Length = 2099

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                               
Query: 642  ccattggcatcaatgtcaaaagtgacctcaatctg 676
            ||||||||||| ||||||||||| |||||||||||
Sbjct: 1527 ccattggcatcgatgtcaaaagtaacctcaatctg 1493



to top

>dbj|AK151516.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length enriched
            library, clone:I830031E11 product:heat shock protein 8,
            full insert sequence
          Length = 2108

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                               
Query: 642  ccattggcatcaatgtcaaaagtgacctcaatctg 676
            ||||||||||| ||||||||||| |||||||||||
Sbjct: 1536 ccattggcatcgatgtcaaaagtaacctcaatctg 1502



to top

>dbj|AK150701.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length enriched
            library, clone:I830013N08 product:heat shock protein 8,
            full insert sequence
          Length = 2106

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                               
Query: 642  ccattggcatcaatgtcaaaagtgacctcaatctg 676
            ||||||||||| ||||||||||| |||||||||||
Sbjct: 1534 ccattggcatcgatgtcaaaagtaacctcaatctg 1500



to top

>dbj|AK147864.1| Mus musculus melanocyte cDNA, RIKEN full-length enriched library,
            clone:G270072A03 product:heat shock protein 8, full
            insert sequence
          Length = 2099

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                               
Query: 642  ccattggcatcaatgtcaaaagtgacctcaatctg 676
            ||||||||||| ||||||||||| |||||||||||
Sbjct: 1530 ccattggcatcgatgtcaaaagtaacctcaatctg 1496



to top

>dbj|AK146547.1| Mus musculus 17 days embryo kidney cDNA, RIKEN full-length enriched
            library, clone:I920024I20 product:heat shock protein 8,
            full insert sequence
          Length = 2108

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                               
Query: 642  ccattggcatcaatgtcaaaagtgacctcaatctg 676
            ||||||||||| ||||||||||| |||||||||||
Sbjct: 1536 ccattggcatcgatgtcaaaagtaacctcaatctg 1502



to top

>dbj|AK152697.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length enriched
            library, clone:I830082M21 product:heat shock protein 8,
            full insert sequence
          Length = 2099

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                               
Query: 642  ccattggcatcaatgtcaaaagtgacctcaatctg 676
            ||||||||||| ||||||||||| |||||||||||
Sbjct: 1530 ccattggcatcgatgtcaaaagtaacctcaatctg 1496



to top

>dbj|AK152598.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length enriched
            library, clone:I830080L14 product:heat shock protein 8,
            full insert sequence
          Length = 2102

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                               
Query: 642  ccattggcatcaatgtcaaaagtgacctcaatctg 676
            ||||||||||| ||||||||||| |||||||||||
Sbjct: 1530 ccattggcatcgatgtcaaaagtaacctcaatctg 1496



to top

>dbj|AK152315.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length enriched
            library, clone:I830061H09 product:heat shock protein 8,
            full insert sequence
          Length = 2105

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                               
Query: 642  ccattggcatcaatgtcaaaagtgacctcaatctg 676
            ||||||||||| ||||||||||| |||||||||||
Sbjct: 1533 ccattggcatcgatgtcaaaagtaacctcaatctg 1499



to top

>dbj|AK151435.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length enriched
            library, clone:I830030C04 product:heat shock protein 8,
            full insert sequence
          Length = 2102

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                               
Query: 642  ccattggcatcaatgtcaaaagtgacctcaatctg 676
            ||||||||||| ||||||||||| |||||||||||
Sbjct: 1530 ccattggcatcgatgtcaaaagtaacctcaatctg 1496



to top

>dbj|AK150498.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length enriched
            library, clone:I830008K12 product:heat shock protein 8,
            full insert sequence
          Length = 2096

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                               
Query: 642  ccattggcatcaatgtcaaaagtgacctcaatctg 676
            ||||||||||| ||||||||||| |||||||||||
Sbjct: 1524 ccattggcatcgatgtcaaaagtaacctcaatctg 1490



to top

>dbj|AK150474.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length enriched
            library, clone:I830008D07 product:heat shock protein 8,
            full insert sequence
          Length = 2096

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                               
Query: 642  ccattggcatcaatgtcaaaagtgacctcaatctg 676
            ||||||||||| ||||||||||| |||||||||||
Sbjct: 1524 ccattggcatcgatgtcaaaagtaacctcaatctg 1490



to top

>dbj|AK157831.1| Mus musculus cDNA, RIKEN full-length enriched library,
            clone:I6C0023J11 product:heat shock protein 8, full
            insert sequence
          Length = 2105

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                               
Query: 642  ccattggcatcaatgtcaaaagtgacctcaatctg 676
            ||||||||||| ||||||||||| |||||||||||
Sbjct: 1530 ccattggcatcgatgtcaaaagtaacctcaatctg 1496



to top

>dbj|AK166808.1| Mus musculus blastocyst blastocyst cDNA, RIKEN full-length enriched
            library, clone:I1C0014P22 product:heat shock protein 8,
            full insert sequence
          Length = 2102

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                               
Query: 642  ccattggcatcaatgtcaaaagtgacctcaatctg 676
            ||||||||||| ||||||||||| |||||||||||
Sbjct: 1530 ccattggcatcgatgtcaaaagtaacctcaatctg 1496



to top

>dbj|AK166776.1| Mus musculus blastocyst blastocyst cDNA, RIKEN full-length enriched
            library, clone:I1C0011G03 product:heat shock protein 8,
            full insert sequence
          Length = 2105

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                               
Query: 642  ccattggcatcaatgtcaaaagtgacctcaatctg 676
            ||||||||||| ||||||||||| |||||||||||
Sbjct: 1533 ccattggcatcgatgtcaaaagtaacctcaatctg 1499



to top

>dbj|AK166767.1| Mus musculus blastocyst blastocyst cDNA, RIKEN full-length enriched
            library, clone:I1C0010B18 product:heat shock protein 8,
            full insert sequence
          Length = 2102

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                               
Query: 642  ccattggcatcaatgtcaaaagtgacctcaatctg 676
            ||||||||||| ||||||||||| |||||||||||
Sbjct: 1530 ccattggcatcgatgtcaaaagtaacctcaatctg 1496



to top

>dbj|AK166721.1| Mus musculus blastocyst blastocyst cDNA, RIKEN full-length enriched
            library, clone:I1C0007E14 product:heat shock protein 8,
            full insert sequence
          Length = 2099

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                               
Query: 642  ccattggcatcaatgtcaaaagtgacctcaatctg 676
            ||||||||||| ||||||||||| |||||||||||
Sbjct: 1527 ccattggcatcgatgtcaaaagtaacctcaatctg 1493



to top

>dbj|AK166643.1| Mus musculus morula whole body morula cDNA, RIKEN full-length
            enriched library, clone:I0C0044M21 product:heat shock
            protein 8, full insert sequence
          Length = 2113

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                               
Query: 642  ccattggcatcaatgtcaaaagtgacctcaatctg 676
            ||||||||||| ||||||||||| |||||||||||
Sbjct: 1544 ccattggcatcgatgtcaaaagtaacctcaatctg 1510



to top

>dbj|AK151287.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length enriched
            library, clone:I830027K22 product:heat shock protein 8,
            full insert sequence
          Length = 2099

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                               
Query: 642  ccattggcatcaatgtcaaaagtgacctcaatctg 676
            ||||||||||| ||||||||||| |||||||||||
Sbjct: 1530 ccattggcatcgatgtcaaaagtaacctcaatctg 1496



to top

>dbj|AK151127.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length enriched
            library, clone:I830025J15 product:heat shock protein 8,
            full insert sequence
          Length = 2105

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                               
Query: 642  ccattggcatcaatgtcaaaagtgacctcaatctg 676
            ||||||||||| ||||||||||| |||||||||||
Sbjct: 1533 ccattggcatcgatgtcaaaagtaacctcaatctg 1499



to top

>dbj|AK168934.1| Mus musculus 17 days pregnant adult female amnion cDNA, RIKEN
            full-length enriched library, clone:I920066C08
            product:heat shock protein 8, full insert sequence
          Length = 2105

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                               
Query: 642  ccattggcatcaatgtcaaaagtgacctcaatctg 676
            ||||||||||| ||||||||||| |||||||||||
Sbjct: 1533 ccattggcatcgatgtcaaaagtaacctcaatctg 1499



to top

>dbj|AK168887.1| Mus musculus 16 days embryo kidney cDNA, RIKEN full-length enriched
            library, clone:I920062I24 product:heat shock protein 8,
            full insert sequence
          Length = 2104

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                               
Query: 642  ccattggcatcaatgtcaaaagtgacctcaatctg 676
            ||||||||||| ||||||||||| |||||||||||
Sbjct: 1532 ccattggcatcgatgtcaaaagtaacctcaatctg 1498



to top

>dbj|AK168776.1| Mus musculus 17 days embryo stomach cDNA, RIKEN full-length enriched
            library, clone:I920052L10 product:heat shock protein 8,
            full insert sequence
          Length = 2102

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                               
Query: 642  ccattggcatcaatgtcaaaagtgacctcaatctg 676
            ||||||||||| ||||||||||| |||||||||||
Sbjct: 1533 ccattggcatcgatgtcaaaagtaacctcaatctg 1499



to top

>dbj|AK168750.1| Mus musculus 17 days embryo kidney cDNA, RIKEN full-length enriched
            library, clone:I920049L15 product:heat shock protein 8,
            full insert sequence
          Length = 2102

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                               
Query: 642  ccattggcatcaatgtcaaaagtgacctcaatctg 676
            ||||||||||| ||||||||||| |||||||||||
Sbjct: 1533 ccattggcatcgatgtcaaaagtaacctcaatctg 1499



to top

>dbj|AK168711.1| Mus musculus 16 days embryo kidney cDNA, RIKEN full-length enriched
            library, clone:I920046J15 product:heat shock protein 8,
            full insert sequence
          Length = 2102

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                               
Query: 642  ccattggcatcaatgtcaaaagtgacctcaatctg 676
            ||||||||||| ||||||||||| |||||||||||
Sbjct: 1530 ccattggcatcgatgtcaaaagtaacctcaatctg 1496



to top

>dbj|AK168654.1| Mus musculus 13 days embryo liver cDNA, RIKEN full-length enriched
            library, clone:I920041K08 product:heat shock protein 8,
            full insert sequence
          Length = 2103

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                               
Query: 642  ccattggcatcaatgtcaaaagtgacctcaatctg 676
            ||||||||||| ||||||||||| |||||||||||
Sbjct: 1531 ccattggcatcgatgtcaaaagtaacctcaatctg 1497



to top

>dbj|AK168625.1| Mus musculus 13 days embryo liver cDNA, RIKEN full-length enriched
            library, clone:I920039G10 product:heat shock protein 8,
            full insert sequence
          Length = 2103

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                               
Query: 642  ccattggcatcaatgtcaaaagtgacctcaatctg 676
            ||||||||||| ||||||||||| |||||||||||
Sbjct: 1531 ccattggcatcgatgtcaaaagtaacctcaatctg 1497



to top

>dbj|AK166545.1| Mus musculus morula whole body morula cDNA, RIKEN full-length
            enriched library, clone:I0C0014J21 product:heat shock
            protein 8, full insert sequence
          Length = 2104

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                               
Query: 642  ccattggcatcaatgtcaaaagtgacctcaatctg 676
            ||||||||||| ||||||||||| |||||||||||
Sbjct: 1532 ccattggcatcgatgtcaaaagtaacctcaatctg 1498



to top

>dbj|AK168577.1| Mus musculus 16 days embryo heart cDNA, RIKEN full-length enriched
            library, clone:I920036H22 product:heat shock protein 8,
            full insert sequence
          Length = 2103

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                               
Query: 642  ccattggcatcaatgtcaaaagtgacctcaatctg 676
            ||||||||||| ||||||||||| |||||||||||
Sbjct: 1531 ccattggcatcgatgtcaaaagtaacctcaatctg 1497



to top

>dbj|AK168542.1| Mus musculus 16 days embryo kidney cDNA, RIKEN full-length enriched
            library, clone:I920030J02 product:heat shock protein 8,
            full insert sequence
          Length = 2104

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                               
Query: 642  ccattggcatcaatgtcaaaagtgacctcaatctg 676
            ||||||||||| ||||||||||| |||||||||||
Sbjct: 1532 ccattggcatcgatgtcaaaagtaacctcaatctg 1498



to top

>dbj|AK168519.1| Mus musculus 17 days pregnant adult female amnion cDNA, RIKEN
            full-length enriched library, clone:I920029D12
            product:heat shock protein 8, full insert sequence
          Length = 2102

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                               
Query: 642  ccattggcatcaatgtcaaaagtgacctcaatctg 676
            ||||||||||| ||||||||||| |||||||||||
Sbjct: 1530 ccattggcatcgatgtcaaaagtaacctcaatctg 1496



to top

>dbj|AK168511.1| Mus musculus 17 days embryo stomach cDNA, RIKEN full-length enriched
            library, clone:I920028N21 product:heat shock protein 8,
            full insert sequence
          Length = 1635

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                               
Query: 642  ccattggcatcaatgtcaaaagtgacctcaatctg 676
            ||||||||||| ||||||||||| |||||||||||
Sbjct: 1068 ccattggcatcgatgtcaaaagtaacctcaatctg 1034


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 7,139,914
Number of Sequences: 3902068
Number of extensions: 7139914
Number of successful extensions: 160998
Number of sequences better than 10.0: 863
Number of HSP's better than 10.0 without gapping: 870
Number of HSP's successfully gapped in prelim test: 1
Number of HSP's that attempted gapping in prelim test: 157422
Number of HSP's gapped (non-prelim): 3572
length of query: 683
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 660
effective length of database: 17,143,297,704
effective search space: 11314576484640
effective search space used: 11314576484640
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top