ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | rbags19j03 |
|---|---|
| Clone Library Name | barley_pub |
>gb|AF139814.1|AF139814 Triticum aestivum plasma membrane intrinsic protein 1 (PIP1) mRNA, complete cds Length = 1283 Score = 839 bits (423), Expect = 0.0 Identities = 566/606 (93%), Gaps = 17/606 (2%) Strand = Plus / Minus Query: 1 gacgttgggtcgatc-tacatatggtcgctaaattaaaaca------ggaaaaggaatgc 53 |||||||| |||||| ||||||||||||||||||| ||| | ||||||| ||||| Sbjct: 1235 gacgttggatcgatcatacatatggtcgctaaatttaaatacaagtaggaaaagcaatgc 1176 Query: 54 gggctaattaagacaagcgatcccatggaccgaattacaacacacggcacgcatgactgg 113 |||||||||||||||||||||||||||||||||||||||| |||||||||||||||| || Sbjct: 1175 gggctaattaagacaagcgatcccatggaccgaattacaagacacggcacgcatgaccgg 1116 Query: 114 gc-acatac---gcatatgcagctgccgacacataaataacacgaccattgcagcggcc- 168 | || ||| |||||||||||||||||||||||| ||||||||||||||| |||||| Sbjct: 1115 accacgtactacgcatatgcagctgccgacacataa-taacacgaccattgcggcggccg 1057 Query: 169 aactgaactgtcgagaagttgcaaaagcggctttctctttggatggatggacacagcaca 228 ||||||||||||||||||||||||||||| ||||||| |||||||||||||||| ||| Sbjct: 1056 aactgaactgtcgagaagttgcaaaagcgcatttctctctggatggatggacacaacacg 997 Query: 229 ggtcgccattgcttcaatcttgcatgcacatcacatggat---aactcgttacgcgttgc 285 |||||||||||||||| |||||||| || || |||||||| |||| |||||||||||| Sbjct: 996 ggtcgccattgcttcagtcttgcatacagatgacatggatgataacttgttacgcgttgc 937 Query: 286 tcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggtggtagaagg 345 |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| Sbjct: 936 tcctgaaggagccgagggccttgatggcgccggccctgaggatgtactggtggtagaagg 877 Query: 346 ccgcgatcgccgcgccgatcatggggccgacccagaagatccactgatcatcccaggcct 405 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 876 ccgcgatcgccgcgccgatcatggggccgacccagaagatccactgatcatcccaggcct 817 Query: 406 tgtccttgttgtagatgacggcggcccccaggctcctggccgggttgatgccggtgccgg 465 |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| Sbjct: 816 tgtccttgttgtagatgacggcggcccccaggctccgggccgggttgatgccggtgccgg 757 Query: 466 tgatcgggatggtggccaggtggaccatgaacacggcgaagccgatcgggaggggcgcca 525 |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 756 tgatggggatggtggccaggtggaccatgaacacggcgaagccgatcgggaggggcgcca 697 Query: 526 acaccgggacgtgagagttcgcgtgcgctgcgcttggggtcggtggcggagaagacggtg 585 |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| Sbjct: 696 gcaccgggacgtgagag-tcgcgtgcgctgcgcttggggtcggtggcggagaagacggtg 638 Query: 586 tagacg 591 |||||| Sbjct: 637 tagacg 632
>gb|BT016583.1| Zea mays clone Contig416 mRNA sequence Length = 1348 Score = 410 bits (207), Expect = e-111 Identities = 289/315 (91%), Gaps = 1/315 (0%) Strand = Plus / Minus Query: 277 acgcgttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggt 336 |||||||||||||||||||||||||||||||||||||||| |||| ||| |||||||||| Sbjct: 924 acgcgttgctcctgaaggagccgagggccttgatggcgccagcccggaggatgtactggt 865 Query: 337 ggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactgatcat 396 |||||||||||||||| || ||||| | | |||||| |||||||||||||| || || | Sbjct: 864 ggtagaaggccgcgatggcagcgcccacgagggggcccacccagaagatccagtggtcgt 805 Query: 397 cccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttgatgc 456 |||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||| Sbjct: 804 cccagggcttgtccttgttgtagatgacggcggcgcccaggctcctggccgggttgatgc 745 Query: 457 cggtgccggtgatcgggatggtggccaggtggaccatgaacacggcgaagccgatcggga 516 |||||||||||| ||||||||||||||||| ||||||||||||||||||||||| |||| Sbjct: 744 cggtgccggtgacggggatggtggccaggtgcaccatgaacacggcgaagccgatgggga 685 Query: 517 ggggcgccaacaccgggacgtgagagttcgcgtgcgctgcgcttggggtcggtggcggag 576 |||| |||| ||||||||||| ||| ||||| ||| ||||||||||||||||||||||| Sbjct: 684 ggggagccagaaccgggacgtgggag-tcgcgggcgttgcgcttggggtcggtggcggag 626 Query: 577 aagacggtgtagacg 591 ||||||||||||||| Sbjct: 625 aagacggtgtagacg 611
>gb|AY243801.1| Zea mays aquaporin (PIP2-1) mRNA, complete cds Length = 1133 Score = 402 bits (203), Expect = e-109 Identities = 288/315 (91%), Gaps = 1/315 (0%) Strand = Plus / Minus Query: 277 acgcgttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggt 336 |||||||||||||||||||||||||||||||||||||||| |||| ||| |||||||||| Sbjct: 872 acgcgttgctcctgaaggagccgagggccttgatggcgccagcccggaggatgtactggt 813 Query: 337 ggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactgatcat 396 |||||||||||||||| || ||||| | | ||||| |||||||||||||| || || | Sbjct: 812 ggtagaaggccgcgatggcagcgcccacgagagggcccacccagaagatccagtggtcgt 753 Query: 397 cccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttgatgc 456 |||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||| Sbjct: 752 cccagggcttgtccttgttgtagatgacggcggcgcccaggctcctggccgggttgatgc 693 Query: 457 cggtgccggtgatcgggatggtggccaggtggaccatgaacacggcgaagccgatcggga 516 |||||||||||| ||||||||||||||||| ||||||||||||||||||||||| |||| Sbjct: 692 cggtgccggtgacggggatggtggccaggtgcaccatgaacacggcgaagccgatgggga 633 Query: 517 ggggcgccaacaccgggacgtgagagttcgcgtgcgctgcgcttggggtcggtggcggag 576 |||| |||| ||||||||||| ||| ||||| ||| ||||||||||||||||||||||| Sbjct: 632 ggggagccagaaccgggacgtgggag-tcgcgggcgttgcgcttggggtcggtggcggag 574 Query: 577 aagacggtgtagacg 591 ||||||||||||||| Sbjct: 573 aagacggtgtagacg 559
>gb|AF326491.1|AF326491 Zea mays plasma membrane integral protein ZmPIP2-1 mRNA, complete cds Length = 1171 Score = 394 bits (199), Expect = e-106 Identities = 287/315 (91%), Gaps = 1/315 (0%) Strand = Plus / Minus Query: 277 acgcgttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggt 336 ||||||||||||||||||||||||||||||||||||| || |||| ||| |||||||||| Sbjct: 943 acgcgttgctcctgaaggagccgagggccttgatggccccagcccggaggatgtactggt 884 Query: 337 ggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactgatcat 396 |||||||||||||||| || ||||| | | ||||| |||||||||||||| || || | Sbjct: 883 ggtagaaggccgcgatggcagcgcccacgagagggcccacccagaagatccagtggtcgt 824 Query: 397 cccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttgatgc 456 |||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||| Sbjct: 823 cccagggcttgtccttgttgtagatgacggcggcgcccaggctcctggccgggttgatgc 764 Query: 457 cggtgccggtgatcgggatggtggccaggtggaccatgaacacggcgaagccgatcggga 516 |||||||||||| ||||||||||||||||| ||||||||||||||||||||||| |||| Sbjct: 763 cggtgccggtgacggggatggtggccaggtgcaccatgaacacggcgaagccgatgggga 704 Query: 517 ggggcgccaacaccgggacgtgagagttcgcgtgcgctgcgcttggggtcggtggcggag 576 |||| |||| ||||||||||| ||| ||||| ||| ||||||||||||||||||||||| Sbjct: 703 ggggagccagaaccgggacgtgggag-tcgcgggcgttgcgcttggggtcggtggcggag 645 Query: 577 aagacggtgtagacg 591 ||||||||||||||| Sbjct: 644 aagacggtgtagacg 630
>gb|AF326492.1|AF326492 Zea mays plasma membrane integral protein ZmPIP2-2 mRNA, complete cds Length = 1268 Score = 379 bits (191), Expect = e-102 Identities = 282/311 (90%), Gaps = 1/311 (0%) Strand = Plus / Minus Query: 277 acgcgttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggt 336 ||||||||||||||||||||||||| |||||||||||||| |||| ||| |||||||||| Sbjct: 996 acgcgttgctcctgaaggagccgagagccttgatggcgcccgcccggaggatgtactggt 937 Query: 337 ggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactgatcat 396 |||||||||||||||| || ||||| | | ||||| |||||||| ||||| || |||| Sbjct: 936 ggtagaaggccgcgatggcagcgcccaggagcgggcccacccagaaaatccagtggtcat 877 Query: 397 cccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttgatgc 456 |||| | ||||||||||||||||| ||||||||| ||||||||||||||||||||||||| Sbjct: 876 cccatggcttgtccttgttgtagacgacggcggcgcccaggctcctggccgggttgatgc 817 Query: 457 cggtgccggtgatcgggatggtggccaggtggaccatgaacacggcgaagccgatcggga 516 |||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||| Sbjct: 816 cggtgccggtgacggggatggtggccaggtggaccatgaacacggcgaagccgatgggga 757 Query: 517 ggggcgccaacaccgggacgtgagagttcgcgtgcgctgcgcttggggtcggtggcggag 576 |||| |||| ||||||||||| ||| ||||| ||| ||||||||||||||||||||||| Sbjct: 756 ggggagccagaaccgggacgtgggag-tcgcgggcgttgcgcttggggtcggtggcggag 698 Query: 577 aagacggtgta 587 ||||||||||| Sbjct: 697 aagacggtgta 687
>gb|AY109332.1| Zea mays CL502_5 mRNA sequence Length = 1969 Score = 379 bits (191), Expect = e-102 Identities = 282/311 (90%), Gaps = 1/311 (0%) Strand = Plus / Minus Query: 277 acgcgttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggt 336 ||||||||||||||||||||||||| |||||||||||||| |||| ||| |||||||||| Sbjct: 1646 acgcgttgctcctgaaggagccgagagccttgatggcgcccgcccggaggatgtactggt 1587 Query: 337 ggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactgatcat 396 |||||||||||||||| || ||||| | | ||||| |||||||| ||||| || |||| Sbjct: 1586 ggtagaaggccgcgatggcagcgcccaggagcgggcccacccagaaaatccagtggtcat 1527 Query: 397 cccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttgatgc 456 |||| | ||||||||||||||||| ||||||||| ||||||||||||||||||||||||| Sbjct: 1526 cccatggcttgtccttgttgtagacgacggcggcgcccaggctcctggccgggttgatgc 1467 Query: 457 cggtgccggtgatcgggatggtggccaggtggaccatgaacacggcgaagccgatcggga 516 |||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||| Sbjct: 1466 cggtgccggtgacggggatggtggccaggtggaccatgaacacggcgaagccgatgggga 1407 Query: 517 ggggcgccaacaccgggacgtgagagttcgcgtgcgctgcgcttggggtcggtggcggag 576 |||| |||| ||||||||||| ||| ||||| ||| ||||||||||||||||||||||| Sbjct: 1406 ggggagccagaaccgggacgtgggag-tcgcgggcgttgcgcttggggtcggtggcggag 1348 Query: 577 aagacggtgta 587 ||||||||||| Sbjct: 1347 aagacggtgta 1337 Score = 299 bits (151), Expect = 5e-78 Identities = 236/263 (89%), Gaps = 1/263 (0%) Strand = Plus / Minus Query: 329 gtactggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatcca 388 ||||||||||||| ||| ||||| || |||||||||| ||||| |||||||||||||| Sbjct: 321 gtactggtggtaggcggcggcgatggcggcgccgatcagtgggcccacccagaagatcca 262 Query: 389 ctgatcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgg 448 || || ||||||||||||||||||||||||||||| ||||| |||| |||||| ||||| Sbjct: 261 ttggtcgtcccaggccttgtccttgttgtagatgaccgcggctcccaagctcctcgccgg 202 Query: 449 gttgatgccggtgccggtgatcgggatggtggccaggtggaccatgaacacggcgaagcc 508 ||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||| || Sbjct: 201 gttgatgccggtgccggtgatggggatggtggccaggtgcaccatgaacacggcgaaccc 142 Query: 509 gatcgggaggggcgccaacaccgggacgtgagagttcgcgtgcgctgcgcttggggtcgg 568 ||||| || || ||||||||||||||||| ||| || || || |||||||||||||||| Sbjct: 141 aatcggaagaggggccaacaccgggacgtgggag-tcacgggcactgcgcttggggtcgg 83 Query: 569 tggcggagaagacggtgtagacg 591 ||||||||||||||||||||||| Sbjct: 82 tggcggagaagacggtgtagacg 60
>gb|AF062393.1|AF062393 Oryza sativa aquaporin (PIP2a) mRNA, complete cds Length = 1328 Score = 355 bits (179), Expect = 1e-94 Identities = 282/315 (89%), Gaps = 1/315 (0%) Strand = Plus / Minus Query: 277 acgcgttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggt 336 ||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||| Sbjct: 968 acgcgttgctcctgaaggagccgagggccttgatggcgccggcccggaggatgtactggt 909 Query: 337 ggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactgatcat 396 ||||||| |||||||| || ||||||| | |||||||||||||||||||| || | | Sbjct: 908 ggtagaacgccgcgatggcggcgccgacgaacgggccgacccagaagatccaatggttgt 849 Query: 397 cccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttgatgc 456 ||| ||||| || |||||| |||||||||| || || | |||||||||||||||||||| Sbjct: 848 gccacgccttctcgttgttgaagatgacggccgctccgatgctcctggccgggttgatgc 789 Query: 457 cggtgccggtgatcgggatggtggccaggtggaccatgaacacggcgaagccgatcggga 516 ||||||||||||||||||| || |||||||||||||||||||||||||||||||| || | Sbjct: 788 cggtgccggtgatcgggatcgtcgccaggtggaccatgaacacggcgaagccgattggca 729 Query: 517 ggggcgccaacaccgggacgtgagagttcgcgtgcgctgcgcttggggtcggtggcggag 576 | |||||||| |||||||| || ||| ||||| ||| ||||||||||||||||||||||| Sbjct: 728 gcggcgccaagaccgggacatgtgag-tcgcgggcgttgcgcttggggtcggtggcggag 670 Query: 577 aagacggtgtagacg 591 ||||||||||||||| Sbjct: 669 aagacggtgtagacg 655
>ref|NM_187092.2| Oryza sativa (japonica cultivar-group), mRNA Length = 1242 Score = 347 bits (175), Expect = 3e-92 Identities = 281/315 (89%), Gaps = 1/315 (0%) Strand = Plus / Minus Query: 277 acgcgttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggt 336 |||||||||||||||||||||||||||| |||||||||||||||| ||| |||||||||| Sbjct: 978 acgcgttgctcctgaaggagccgagggctttgatggcgccggcccggaggatgtactggt 919 Query: 337 ggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactgatcat 396 ||||||| |||||||| || ||||||| | |||||||||||||||||||| || | | Sbjct: 918 ggtagaacgccgcgatggcggcgccgacgaacgggccgacccagaagatccaatggttgt 859 Query: 397 cccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttgatgc 456 ||| ||||| || |||||| |||||||||| || || | |||||||||||||||||||| Sbjct: 858 gccacgccttctcgttgttgaagatgacggccgctccgatgctcctggccgggttgatgc 799 Query: 457 cggtgccggtgatcgggatggtggccaggtggaccatgaacacggcgaagccgatcggga 516 ||||||||||||||||||| || |||||||||||||||||||||||||||||||| || | Sbjct: 798 cggtgccggtgatcgggatcgtcgccaggtggaccatgaacacggcgaagccgattggca 739 Query: 517 ggggcgccaacaccgggacgtgagagttcgcgtgcgctgcgcttggggtcggtggcggag 576 | |||||||| |||||||| || ||| ||||| ||| ||||||||||||||||||||||| Sbjct: 738 gcggcgccaagaccgggacatgtgag-tcgcgggcgttgcgcttggggtcggtggcggag 680 Query: 577 aagacggtgtagacg 591 ||||||||||||||| Sbjct: 679 aagacggtgtagacg 665
>ref|XM_507363.1| PREDICTED Oryza sativa (japonica cultivar-group), OJ1047_A06.117 mRNA Length = 1257 Score = 347 bits (175), Expect = 3e-92 Identities = 281/315 (89%), Gaps = 1/315 (0%) Strand = Plus / Minus Query: 277 acgcgttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggt 336 |||||||||||||||||||||||||||| |||||||||||||||| ||| |||||||||| Sbjct: 980 acgcgttgctcctgaaggagccgagggctttgatggcgccggcccggaggatgtactggt 921 Query: 337 ggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactgatcat 396 ||||||| |||||||| || ||||||| | |||||||||||||||||||| || | | Sbjct: 920 ggtagaacgccgcgatggcggcgccgacgaacgggccgacccagaagatccaatggttgt 861 Query: 397 cccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttgatgc 456 ||| ||||| || |||||| |||||||||| || || | |||||||||||||||||||| Sbjct: 860 gccacgccttctcgttgttgaagatgacggccgctccgatgctcctggccgggttgatgc 801 Query: 457 cggtgccggtgatcgggatggtggccaggtggaccatgaacacggcgaagccgatcggga 516 ||||||||||||||||||| || |||||||||||||||||||||||||||||||| || | Sbjct: 800 cggtgccggtgatcgggatcgtcgccaggtggaccatgaacacggcgaagccgattggca 741 Query: 517 ggggcgccaacaccgggacgtgagagttcgcgtgcgctgcgcttggggtcggtggcggag 576 | |||||||| |||||||| || ||| ||||| ||| ||||||||||||||||||||||| Sbjct: 740 gcggcgccaagaccgggacatgtgag-tcgcgggcgttgcgcttggggtcggtggcggag 682 Query: 577 aagacggtgtagacg 591 ||||||||||||||| Sbjct: 681 aagacggtgtagacg 667
>ref|XM_506304.2| PREDICTED Oryza sativa (japonica cultivar-group), OJ1047_A06.117 mRNA Length = 1298 Score = 347 bits (175), Expect = 3e-92 Identities = 281/315 (89%), Gaps = 1/315 (0%) Strand = Plus / Minus Query: 277 acgcgttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggt 336 |||||||||||||||||||||||||||| |||||||||||||||| ||| |||||||||| Sbjct: 981 acgcgttgctcctgaaggagccgagggctttgatggcgccggcccggaggatgtactggt 922 Query: 337 ggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactgatcat 396 ||||||| |||||||| || ||||||| | |||||||||||||||||||| || | | Sbjct: 921 ggtagaacgccgcgatggcggcgccgacgaacgggccgacccagaagatccaatggttgt 862 Query: 397 cccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttgatgc 456 ||| ||||| || |||||| |||||||||| || || | |||||||||||||||||||| Sbjct: 861 gccacgccttctcgttgttgaagatgacggccgctccgatgctcctggccgggttgatgc 802 Query: 457 cggtgccggtgatcgggatggtggccaggtggaccatgaacacggcgaagccgatcggga 516 ||||||||||||||||||| || |||||||||||||||||||||||||||||||| || | Sbjct: 801 cggtgccggtgatcgggatcgtcgccaggtggaccatgaacacggcgaagccgattggca 742 Query: 517 ggggcgccaacaccgggacgtgagagttcgcgtgcgctgcgcttggggtcggtggcggag 576 | |||||||| |||||||| || ||| ||||| ||| ||||||||||||||||||||||| Sbjct: 741 gcggcgccaagaccgggacatgtgag-tcgcgggcgttgcgcttggggtcggtggcggag 683 Query: 577 aagacggtgtagacg 591 ||||||||||||||| Sbjct: 682 aagacggtgtagacg 668
>dbj|AK119656.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-130-H04, full insert sequence Length = 1216 Score = 347 bits (175), Expect = 3e-92 Identities = 281/315 (89%), Gaps = 1/315 (0%) Strand = Plus / Minus Query: 277 acgcgttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggt 336 |||||||||||||||||||||||||||| |||||||||||||||| ||| |||||||||| Sbjct: 978 acgcgttgctcctgaaggagccgagggctttgatggcgccggcccggaggatgtactggt 919 Query: 337 ggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactgatcat 396 ||||||| |||||||| || ||||||| | |||||||||||||||||||| || | | Sbjct: 918 ggtagaacgccgcgatggcggcgccgacgaacgggccgacccagaagatccaatggttgt 859 Query: 397 cccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttgatgc 456 ||| ||||| || |||||| |||||||||| || || | |||||||||||||||||||| Sbjct: 858 gccacgccttctcgttgttgaagatgacggccgctccgatgctcctggccgggttgatgc 799 Query: 457 cggtgccggtgatcgggatggtggccaggtggaccatgaacacggcgaagccgatcggga 516 ||||||||||||||||||| || |||||||||||||||||||||||||||||||| || | Sbjct: 798 cggtgccggtgatcgggatcgtcgccaggtggaccatgaacacggcgaagccgattggca 739 Query: 517 ggggcgccaacaccgggacgtgagagttcgcgtgcgctgcgcttggggtcggtggcggag 576 | |||||||| |||||||| || ||| ||||| ||| ||||||||||||||||||||||| Sbjct: 738 gcggcgccaagaccgggacatgtgag-tcgcgggcgttgcgcttggggtcggtggcggag 680 Query: 577 aagacggtgtagacg 591 ||||||||||||||| Sbjct: 679 aagacggtgtagacg 665
>dbj|AK105524.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-127-G02, full insert sequence Length = 1451 Score = 347 bits (175), Expect = 3e-92 Identities = 281/315 (89%), Gaps = 1/315 (0%) Strand = Plus / Minus Query: 277 acgcgttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggt 336 |||||||||||||||||||||||||||| |||||||||||||||| ||| |||||||||| Sbjct: 572 acgcgttgctcctgaaggagccgagggctttgatggcgccggcccggaggatgtactggt 513 Query: 337 ggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactgatcat 396 ||||||| |||||||| || ||||||| | |||||||||||||||||||| || | | Sbjct: 512 ggtagaacgccgcgatggcggcgccgacgaacgggccgacccagaagatccaatggttgt 453 Query: 397 cccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttgatgc 456 ||| ||||| || |||||| |||||||||| || || | |||||||||||||||||||| Sbjct: 452 gccacgccttctcgttgttgaagatgacggccgctccgatgctcctggccgggttgatgc 393 Query: 457 cggtgccggtgatcgggatggtggccaggtggaccatgaacacggcgaagccgatcggga 516 ||||||||||||||||||| || |||||||||||||||||||||||||||||||| || | Sbjct: 392 cggtgccggtgatcgggatcgtcgccaggtggaccatgaacacggcgaagccgattggca 333 Query: 517 ggggcgccaacaccgggacgtgagagttcgcgtgcgctgcgcttggggtcggtggcggag 576 | |||||||| |||||||| || ||| ||||| ||| ||||||||||||||||||||||| Sbjct: 332 gcggcgccaagaccgggacatgtgag-tcgcgggcgttgcgcttggggtcggtggcggag 274 Query: 577 aagacggtgtagacg 591 ||||||||||||||| Sbjct: 273 aagacggtgtagacg 259
>dbj|AK103970.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-016-B05, full insert sequence Length = 1242 Score = 347 bits (175), Expect = 3e-92 Identities = 281/315 (89%), Gaps = 1/315 (0%) Strand = Plus / Minus Query: 277 acgcgttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggt 336 |||||||||||||||||||||||||||| |||||||||||||||| ||| |||||||||| Sbjct: 978 acgcgttgctcctgaaggagccgagggctttgatggcgccggcccggaggatgtactggt 919 Query: 337 ggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactgatcat 396 ||||||| |||||||| || ||||||| | |||||||||||||||||||| || | | Sbjct: 918 ggtagaacgccgcgatggcggcgccgacgaacgggccgacccagaagatccaatggttgt 859 Query: 397 cccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttgatgc 456 ||| ||||| || |||||| |||||||||| || || | |||||||||||||||||||| Sbjct: 858 gccacgccttctcgttgttgaagatgacggccgctccgatgctcctggccgggttgatgc 799 Query: 457 cggtgccggtgatcgggatggtggccaggtggaccatgaacacggcgaagccgatcggga 516 ||||||||||||||||||| || |||||||||||||||||||||||||||||||| || | Sbjct: 798 cggtgccggtgatcgggatcgtcgccaggtggaccatgaacacggcgaagccgattggca 739 Query: 517 ggggcgccaacaccgggacgtgagagttcgcgtgcgctgcgcttggggtcggtggcggag 576 | |||||||| |||||||| || ||| ||||| ||| ||||||||||||||||||||||| Sbjct: 738 gcggcgccaagaccgggacatgtgag-tcgcgggcgttgcgcttggggtcggtggcggag 680 Query: 577 aagacggtgtagacg 591 ||||||||||||||| Sbjct: 679 aagacggtgtagacg 665
>dbj|AK072519.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023128K12, full insert sequence Length = 1298 Score = 347 bits (175), Expect = 3e-92 Identities = 281/315 (89%), Gaps = 1/315 (0%) Strand = Plus / Minus Query: 277 acgcgttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggt 336 |||||||||||||||||||||||||||| |||||||||||||||| ||| |||||||||| Sbjct: 981 acgcgttgctcctgaaggagccgagggctttgatggcgccggcccggaggatgtactggt 922 Query: 337 ggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactgatcat 396 ||||||| |||||||| || ||||||| | |||||||||||||||||||| || | | Sbjct: 921 ggtagaacgccgcgatggcggcgccgacgaacgggccgacccagaagatccaatggttgt 862 Query: 397 cccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttgatgc 456 ||| ||||| || |||||| |||||||||| || || | |||||||||||||||||||| Sbjct: 861 gccacgccttctcgttgttgaagatgacggccgctccgatgctcctggccgggttgatgc 802 Query: 457 cggtgccggtgatcgggatggtggccaggtggaccatgaacacggcgaagccgatcggga 516 ||||||||||||||||||| || |||||||||||||||||||||||||||||||| || | Sbjct: 801 cggtgccggtgatcgggatcgtcgccaggtggaccatgaacacggcgaagccgattggca 742 Query: 517 ggggcgccaacaccgggacgtgagagttcgcgtgcgctgcgcttggggtcggtggcggag 576 | |||||||| |||||||| || ||| ||||| ||| ||||||||||||||||||||||| Sbjct: 741 gcggcgccaagaccgggacatgtgag-tcgcgggcgttgcgcttggggtcggtggcggag 683 Query: 577 aagacggtgtagacg 591 ||||||||||||||| Sbjct: 682 aagacggtgtagacg 668
>dbj|AK103938.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-013-G03, full insert sequence Length = 1257 Score = 339 bits (171), Expect = 6e-90 Identities = 280/315 (88%), Gaps = 1/315 (0%) Strand = Plus / Minus Query: 277 acgcgttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggt 336 ||||||||||||||| |||||||||||| |||||||||||||||| ||| |||||||||| Sbjct: 980 acgcgttgctcctgagggagccgagggctttgatggcgccggcccggaggatgtactggt 921 Query: 337 ggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactgatcat 396 ||||||| |||||||| || ||||||| | |||||||||||||||||||| || | | Sbjct: 920 ggtagaacgccgcgatggcggcgccgacgaacgggccgacccagaagatccaatggttgt 861 Query: 397 cccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttgatgc 456 ||| ||||| || |||||| |||||||||| || || | |||||||||||||||||||| Sbjct: 860 gccacgccttctcgttgttgaagatgacggccgctccgatgctcctggccgggttgatgc 801 Query: 457 cggtgccggtgatcgggatggtggccaggtggaccatgaacacggcgaagccgatcggga 516 ||||||||||||||||||| || |||||||||||||||||||||||||||||||| || | Sbjct: 800 cggtgccggtgatcgggatcgtcgccaggtggaccatgaacacggcgaagccgattggca 741 Query: 517 ggggcgccaacaccgggacgtgagagttcgcgtgcgctgcgcttggggtcggtggcggag 576 | |||||||| |||||||| || ||| ||||| ||| ||||||||||||||||||||||| Sbjct: 740 gcggcgccaagaccgggacatgtgag-tcgcgggcgttgcgcttggggtcggtggcggag 682 Query: 577 aagacggtgtagacg 591 ||||||||||||||| Sbjct: 681 aagacggtgtagacg 667
>gb|AF326493.1|AF326493 Zea mays plasma membrane integral protein ZmPIP2-3 mRNA, complete cds Length = 1156 Score = 299 bits (151), Expect = 5e-78 Identities = 236/263 (89%), Gaps = 1/263 (0%) Strand = Plus / Minus Query: 329 gtactggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatcca 388 ||||||||||||| ||| ||||| || |||||||||| ||||| |||||||||||||| Sbjct: 893 gtactggtggtaggcggcggcgatggcggcgccgatcagtgggcccacccagaagatcca 834 Query: 389 ctgatcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgg 448 || || ||||||||||||||||||||||||||||| ||||| |||| |||||| ||||| Sbjct: 833 ttggtcgtcccaggccttgtccttgttgtagatgaccgcggctcccaagctcctcgccgg 774 Query: 449 gttgatgccggtgccggtgatcgggatggtggccaggtggaccatgaacacggcgaagcc 508 ||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||| || Sbjct: 773 gttgatgccggtgccggtgatggggatggtggccaggtgcaccatgaacacggcgaaccc 714 Query: 509 gatcgggaggggcgccaacaccgggacgtgagagttcgcgtgcgctgcgcttggggtcgg 568 ||||| || || ||||||||||||||||| ||| || || || |||||||||||||||| Sbjct: 713 aatcggaagaggggccaacaccgggacgtgggag-tcacgggcactgcgcttggggtcgg 655 Query: 569 tggcggagaagacggtgtagacg 591 ||||||||||||||||||||||| Sbjct: 654 tggcggagaagacggtgtagacg 632
>dbj|AB029446.1| Oryza sativa (indica cultivar-group) rwc-2 mRNA for water channel protein, partial cds Length = 880 Score = 299 bits (151), Expect = 5e-78 Identities = 275/315 (87%), Gaps = 1/315 (0%) Strand = Plus / Minus Query: 277 acgcgttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggt 336 |||||||||||||||||||||||||||||||||||| |||||||| ||| |||||||||| Sbjct: 544 acgcgttgctcctgaaggagccgagggccttgatggggccggcccggaggatgtactggt 485 Query: 337 ggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactgatcat 396 ||||||| |||||||| || ||||||| | |||||||||||||||||||| || | | Sbjct: 484 ggtagaacgccgcgatggcggcgccgacgaacgggccgacccagaagatccattggttgt 425 Query: 397 cccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttgatgc 456 ||||||||| || |||||| |||||||||| | || | |||||||||||||||||| Sbjct: 424 gccaggccttctcgttgttgaagatgacggccggtccggtggtcctggccgggttgatgc 365 Query: 457 cggtgccggtgatcgggatggtggccaggtggaccatgaacacggcgaagccgatcggga 516 ||||||||||||||||||| || ||||| |||||||||||| ||||||||||| || | Sbjct: 364 cggtgccggtgatcgggatcgtcgccagttggaccatgaaccacgcgaagccgattggca 305 Query: 517 ggggcgccaacaccgggacgtgagagttcgcgtgcgctgcgcttggggtcggtggcggag 576 | |||||||| |||||||| || |||| |||| ||| ||||||||||||||||||||||| Sbjct: 304 gcggcgccaagaccgggacatgtgagt-cgcgggcgttgcgcttggggtcggtggcggag 246 Query: 577 aagacggtgtagacg 591 ||||||||||||||| Sbjct: 245 aagacggtgtagacg 231
>ref|XM_466869.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1214 Score = 287 bits (145), Expect = 2e-74 Identities = 248/281 (88%), Gaps = 1/281 (0%) Strand = Plus / Minus Query: 311 ggcgccggccctgagtatgtactggtggtagaaggccgcgatcgccgcgccgatcatggg 370 ||||| |||||| || | ||||||||||||| ||| ||||| || |||||||||| ||| Sbjct: 901 ggcgctggccctcagcacgtactggtggtaggcggcggcgatggcggcgccgatcagggg 842 Query: 371 gccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggc 430 ||| |||||||||||||| || ||||||||||||||||||||||||||||| || |||| Sbjct: 841 gcccacccagaagatccattggtcatcccaggccttgtccttgttgtagataaccgcggt 782 Query: 431 ccccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggac 490 |||| |||||| |||||||| ||||||||||||||||| |||||||||||||| ||||| Sbjct: 781 tcccaagctcctcgccgggttaatgccggtgccggtgatggggatggtggccagatggac 722 Query: 491 catgaacacggcgaagccgatcgggaggggcgccaacaccgggacgtgagagttcgcgtg 550 ||||||||| ||||| || || ||||| || ||||||||||||| ||| ||| ||||| | Sbjct: 721 catgaacaccgcgaatccaattgggagaggagccaacaccgggatgtgggag-tcgcggg 663 Query: 551 cgctgcgcttggggtcggtggcggagaagacggtgtagacg 591 || |||||||||||||||||||||||||||||||||||||| Sbjct: 662 cgttgcgcttggggtcggtggcggagaagacggtgtagacg 622
>dbj|AK061782.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-039-E03, full insert sequence Length = 1214 Score = 287 bits (145), Expect = 2e-74 Identities = 248/281 (88%), Gaps = 1/281 (0%) Strand = Plus / Minus Query: 311 ggcgccggccctgagtatgtactggtggtagaaggccgcgatcgccgcgccgatcatggg 370 ||||| |||||| || | ||||||||||||| ||| ||||| || |||||||||| ||| Sbjct: 901 ggcgctggccctcagcacgtactggtggtaggcggcggcgatggcggcgccgatcagggg 842 Query: 371 gccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggc 430 ||| |||||||||||||| || ||||||||||||||||||||||||||||| || |||| Sbjct: 841 gcccacccagaagatccattggtcatcccaggccttgtccttgttgtagataaccgcggt 782 Query: 431 ccccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggac 490 |||| |||||| |||||||| ||||||||||||||||| |||||||||||||| ||||| Sbjct: 781 tcccaagctcctcgccgggttaatgccggtgccggtgatggggatggtggccagatggac 722 Query: 491 catgaacacggcgaagccgatcgggaggggcgccaacaccgggacgtgagagttcgcgtg 550 ||||||||| ||||| || || ||||| || ||||||||||||| ||| ||| ||||| | Sbjct: 721 catgaacaccgcgaatccaattgggagaggagccaacaccgggatgtgggag-tcgcggg 663 Query: 551 cgctgcgcttggggtcggtggcggagaagacggtgtagacg 591 || |||||||||||||||||||||||||||||||||||||| Sbjct: 662 cgttgcgcttggggtcggtggcggagaagacggtgtagacg 622
>gb|AF326494.1|AF326494 Zea mays plasma membrane integral protein ZmPIP2-4 mRNA, complete cds Length = 1171 Score = 283 bits (143), Expect = 3e-73 Identities = 252/287 (87%), Gaps = 1/287 (0%) Strand = Plus / Minus Query: 305 cttgatggcgccggccctgagtatgtactggtggtagaaggccgcgatcgccgcgccgat 364 |||| |||||| |||||| || | ||||||||||||| ||| ||||| || ||||| || Sbjct: 927 cttggtggcgctggccctcagcacgtactggtggtaggcggcggcgatggcggcgccaat 868 Query: 365 catggggccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgac 424 || ||||| |||||||||||||| || || ||||||||||||||||||||||||||||| Sbjct: 867 cagtgggcccacccagaagatccattggtcgtcccaggccttgtccttgttgtagatgac 808 Query: 425 ggcggcccccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccag 484 ||||| ||||||||||| |||||||||||||||||||||||||| |||||||||||||| Sbjct: 807 cgcggctcccaggctcctcgccgggttgatgccggtgccggtgatggggatggtggccag 748 Query: 485 gtggaccatgaacacggcgaagccgatcgggaggggcgccaacaccgggacgtgagagtt 544 ||| ||||||||||||||||| || || ||||| || || | |||||| ||||| ||| | Sbjct: 747 gtgcaccatgaacacggcgaacccaattgggagaggagctagcaccggaacgtgggag-t 689 Query: 545 cgcgtgcgctgcgcttggggtcggtggcggagaagacggtgtagacg 591 | || || ||||||||||||||||||||||||||||||||||||||| Sbjct: 688 cacgggcactgcgcttggggtcggtggcggagaagacggtgtagacg 642
>gb|AF139815.1|AF139815 Triticum aestivum plasma membrane intrinsic protein 2 (PIP2) mRNA, complete cds Length = 1235 Score = 248 bits (125), Expect = 2e-62 Identities = 238/273 (87%), Gaps = 2/273 (0%) Strand = Plus / Minus Query: 311 ggcgccggccctgagtatgtactggtggtagaaggccgcgatcgccgcgccgatcatggg 370 ||||| |||||| || | ||||||||||||| ||| ||||| || |||||||||| || Sbjct: 875 ggcgctggccctcagcacgtactggtggtaggcggcggcgatggcggcgccgatcagcgg 816 Query: 371 gccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggc 430 || |||||||||||||| || ||||||||||||||||| |||||||||||||| || || Sbjct: 815 ccccacccagaagatccattggtcatcccaggccttgtctttgttgtagatgacagcagc 756 Query: 431 ccccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggac 490 |||| ||| || |||||||||||||||||||||||||| |||||||||| ||||||||| Sbjct: 755 tcccaagcttctcgccgggttgatgccggtgccggtgatggggatggtgg-caggtggac 697 Query: 491 catgaacacggcgaagccgatcgggaggggcgccaacaccgggacgtgagagttcgcgtg 550 ||||||||||||||| ||||| ||||| || |||| |||||||| ||| ||| || || | Sbjct: 696 catgaacacggcgaatccgattgggagaggagccagcaccgggatgtgggag-tcacggg 638 Query: 551 cgctgcgcttggggtcggtggcggagaagacgg 583 || |||||||||||||||||||||||||||||| Sbjct: 637 cgttgcgcttggggtcggtggcggagaagacgg 605
>ref|NM_187084.1| Oryza sativa (japonica cultivar-group), mRNA Length = 852 Score = 246 bits (124), Expect = 7e-62 Identities = 212/240 (88%), Gaps = 1/240 (0%) Strand = Plus / Minus Query: 348 gcgatcgccgcgccgatcatggggccgacccagaagatccactgatcatcccaggccttg 407 ||||||||||| ||||| | || || ||||||||||||||||||||| ||| |||||| Sbjct: 782 gcgatcgccgccccgatgaacggcccaacccagaagatccactgatcactccatgccttg 723 Query: 408 tccttgttgtagatgacggcggcccccaggctcctggccgggttgatgccggtgccggtg 467 |||||||||| ||||||||| || |||||||| |||||||||||||||||||||||| Sbjct: 722 ctgttgttgtagacgacggcggcgccgaggctcctcgccgggttgatgccggtgccggtg 663 Query: 468 atcgggatggtggccaggtggaccatgaacacggcgaagccgatcgggaggggcgccaac 527 | |||||||| |||||||| ||||||||||||||||| |||||||| || ||||||||| Sbjct: 662 acggggatggtcgccaggtgcaccatgaacacggcgaacccgatcggcagcggcgccaac 603 Query: 528 accgggacgtgagagttcgcgtgcgctgcgcttggggtcggtggcggagaagacggtgta 587 |||||||| || ||| ||||| ||| |||||||||||||||||||||||||||||||||| Sbjct: 602 accgggacatgggag-tcgcgggcgttgcgcttggggtcggtggcggagaagacggtgta 544
>ref|XM_506303.1| PREDICTED Oryza sativa (japonica cultivar-group), P0475E07.134 mRNA Length = 619 Score = 246 bits (124), Expect = 7e-62 Identities = 212/240 (88%), Gaps = 1/240 (0%) Strand = Plus / Minus Query: 348 gcgatcgccgcgccgatcatggggccgacccagaagatccactgatcatcccaggccttg 407 ||||||||||| ||||| | || || ||||||||||||||||||||| ||| |||||| Sbjct: 340 gcgatcgccgccccgatgaacggcccaacccagaagatccactgatcactccatgccttg 281 Query: 408 tccttgttgtagatgacggcggcccccaggctcctggccgggttgatgccggtgccggtg 467 |||||||||| ||||||||| || |||||||| |||||||||||||||||||||||| Sbjct: 280 ctgttgttgtagacgacggcggcgccgaggctcctcgccgggttgatgccggtgccggtg 221 Query: 468 atcgggatggtggccaggtggaccatgaacacggcgaagccgatcgggaggggcgccaac 527 | |||||||| |||||||| ||||||||||||||||| |||||||| || ||||||||| Sbjct: 220 acggggatggtcgccaggtgcaccatgaacacggcgaacccgatcggcagcggcgccaac 161 Query: 528 accgggacgtgagagttcgcgtgcgctgcgcttggggtcggtggcggagaagacggtgta 587 |||||||| || ||| ||||| ||| |||||||||||||||||||||||||||||||||| Sbjct: 160 accgggacatgggag-tcgcgggcgttgcgcttggggtcggtggcggagaagacggtgta 102
>dbj|AK107700.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-132-C10, full insert sequence Length = 618 Score = 246 bits (124), Expect = 7e-62 Identities = 212/240 (88%), Gaps = 1/240 (0%) Strand = Plus / Minus Query: 348 gcgatcgccgcgccgatcatggggccgacccagaagatccactgatcatcccaggccttg 407 ||||||||||| ||||| | || || ||||||||||||||||||||| ||| |||||| Sbjct: 339 gcgatcgccgccccgatgaacggcccaacccagaagatccactgatcactccatgccttg 280 Query: 408 tccttgttgtagatgacggcggcccccaggctcctggccgggttgatgccggtgccggtg 467 |||||||||| ||||||||| || |||||||| |||||||||||||||||||||||| Sbjct: 279 ctgttgttgtagacgacggcggcgccgaggctcctcgccgggttgatgccggtgccggtg 220 Query: 468 atcgggatggtggccaggtggaccatgaacacggcgaagccgatcgggaggggcgccaac 527 | |||||||| |||||||| ||||||||||||||||| |||||||| || ||||||||| Sbjct: 219 acggggatggtcgccaggtgcaccatgaacacggcgaacccgatcggcagcggcgccaac 160 Query: 528 accgggacgtgagagttcgcgtgcgctgcgcttggggtcggtggcggagaagacggtgta 587 |||||||| || ||| ||||| ||| |||||||||||||||||||||||||||||||||| Sbjct: 159 accgggacatgggag-tcgcgggcgttgcgcttggggtcggtggcggagaagacggtgta 101
>gb|BT018182.1| Zea mays clone EL01N0557H10.c mRNA sequence Length = 1215 Score = 244 bits (123), Expect = 3e-61 Identities = 247/287 (86%), Gaps = 1/287 (0%) Strand = Plus / Minus Query: 305 cttgatggcgccggccctgagtatgtactggtggtagaaggccgcgatcgccgcgccgat 364 |||| |||||| |||||| || | ||||||||||||| ||| ||||| || ||||| || Sbjct: 935 cttggtggcgctggccctcagcacgtactggtggtaggcggcggcgatggcggcgccaat 876 Query: 365 catggggccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgac 424 || || || |||||||||||||| || || ||||||||||||||||||||||||||||| Sbjct: 875 cagtggacccacccagaagatccattggtcgtcccaggccttgtccttgttgtagatgac 816 Query: 425 ggcggcccccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccag 484 ||||| |||||| |||| |||||||||||||||||||||||||| |||||||| |||| Sbjct: 815 cgcggctcccaggatcctcgccgggttgatgccggtgccggtgatgcggatggtgtccag 756 Query: 485 gtggaccatgaacacggcgaagccgatcgggaggggcgccaacaccgggacgtgagagtt 544 ||| ||||||||||||||||| || || ||||| || || | |||||| ||||| ||| | Sbjct: 755 gtgcaccatgaacacggcgaacccaattgggagaggagctagcaccggaacgtgggag-t 697 Query: 545 cgcgtgcgctgcgcttggggtcggtggcggagaagacggtgtagacg 591 | || || |||||||||||||||||| |||||||||||||||||||| Sbjct: 696 cacgggcactgcgcttggggtcggtgtcggagaagacggtgtagacg 650
>dbj|AB219525.1| Hordeum vulgare HvPIP2;4 mRNA for PIP aquaporin isoform, complete cds Length = 1343 Score = 244 bits (123), Expect = 3e-61 Identities = 247/287 (86%), Gaps = 1/287 (0%) Strand = Plus / Minus Query: 305 cttgatggcgccggccctgagtatgtactggtggtagaaggccgcgatcgccgcgccgat 364 |||| |||||| |||||| || | |||||||||||| ||||| ||||| || || ||||| Sbjct: 913 cttggtggcgctggccctcagcacgtactggtggtacaaggcggcgatggcggccccgat 854 Query: 365 catggggccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgac 424 | || || |||||||| ||||| || |||||||||||||| || ||||||||||| || Sbjct: 853 gaatggccccacccagaacatccagtggtcatcccaggccttctcgttgttgtagatcac 794 Query: 425 ggcggcccccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccag 484 ||| || || | |||||| |||||||||||||||||||||||||||||||| ||||||| Sbjct: 793 ggcagctccgaagctcctcgccgggttgatgccggtgccggtgatcgggatagtggccaa 734 Query: 485 gtggaccatgaacacggcgaagccgatcgggaggggcgccaacaccgggacgtgagagtt 544 ||| ||||||||||| ||||||||||| || ||||| |||| || |||||||| ||| | Sbjct: 733 gtgcaccatgaacaccgcgaagccgattggcaggggagccaggactgggacgtgggag-t 675 Query: 545 cgcgtgcgctgcgcttggggtcggtggcggagaagacggtgtagacg 591 | || |||||||||||||||||||||||||||||||||||||||||| Sbjct: 674 cacgggcgctgcgcttggggtcggtggcggagaagacggtgtagacg 628
>gb|AY243802.1| Zea mays aquaporin (PIP2-5) mRNA, complete cds Length = 1104 Score = 232 bits (117), Expect = 1e-57 Identities = 241/281 (85%), Gaps = 1/281 (0%) Strand = Plus / Minus Query: 311 ggcgccggccctgagtatgtactggtggtagaaggccgcgatcgccgcgccgatcatggg 370 ||||| |||||| || | |||||||||||| || ||||| || |||||||| | || Sbjct: 825 ggcgctggccctcagcacgtactggtggtacgccgcggcgatggcggcgccgatgaatgg 766 Query: 371 gccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggc 430 || |||||||||||||| || ||||||||||||||||| |||||||||||||| || || Sbjct: 765 acccacccagaagatccagtggtcatcccaggccttgtcgttgttgtagatgacagcagc 706 Query: 431 ccccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggac 490 |||| ||||||||||||||||||||||||||||||||| ||||| |||||||| ||||| Sbjct: 705 gcccaagctcctggccgggttgatgccggtgccggtgatggggatcgtggccagatggac 646 Query: 491 catgaacacggcgaagccgatcgggaggggcgccaacaccgggacgtgagagttcgcgtg 550 ||||||||| || || ||||| ||||| || || | ||| ||||| |||||| || || | Sbjct: 645 catgaacaccgcaaacccgatggggagaggggcaagcacggggacatgagag-tcacggg 587 Query: 551 cgctgcgcttggggtcggtggcggagaagacggtgtagacg 591 || |||||||||||||||||||||||||||||||||||||| Sbjct: 586 cgttgcgcttggggtcggtggcggagaagacggtgtagacg 546
>gb|AF130975.1|AF130975 Zea mays plasma membrane intrinsic protein (pip2-5) mRNA, complete cds Length = 1207 Score = 232 bits (117), Expect = 1e-57 Identities = 241/281 (85%), Gaps = 1/281 (0%) Strand = Plus / Minus Query: 311 ggcgccggccctgagtatgtactggtggtagaaggccgcgatcgccgcgccgatcatggg 370 ||||| |||||| || | |||||||||||| || ||||| || |||||||| | || Sbjct: 880 ggcgctggccctcagcacgtactggtggtacgccgcggcgatggcggcgccgatgaatgg 821 Query: 371 gccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggc 430 || |||||||||||||| || ||||||||||||||||| |||||||||||||| || || Sbjct: 820 acccacccagaagatccagtggtcatcccaggccttgtcgttgttgtagatgacagcagc 761 Query: 431 ccccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggac 490 |||| ||||||||||||||||||||||||||||||||| ||||| |||||||| ||||| Sbjct: 760 gcccaagctcctggccgggttgatgccggtgccggtgatggggatcgtggccagatggac 701 Query: 491 catgaacacggcgaagccgatcgggaggggcgccaacaccgggacgtgagagttcgcgtg 550 ||||||||| || || ||||| ||||| || || | ||| ||||| |||||| || || | Sbjct: 700 catgaacaccgcaaacccgatggggagaggggcaagcacggggacatgagag-tcacggg 642 Query: 551 cgctgcgcttggggtcggtggcggagaagacggtgtagacg 591 || |||||||||||||||||||||||||||||||||||||| Sbjct: 641 cgttgcgcttggggtcggtggcggagaagacggtgtagacg 601
>ref|NM_187081.2| Oryza sativa (japonica cultivar-group), mRNA Length = 1215 Score = 230 bits (116), Expect = 4e-57 Identities = 222/256 (86%), Gaps = 1/256 (0%) Strand = Plus / Minus Query: 332 ctggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactg 391 ||||||||| | |||||||||||||||||||| | || || ||||||||||||||||| Sbjct: 901 ctggtggtacagcgccgcgatcgccgcgccgatgaacggcccaacccagaagatccactg 842 Query: 392 atcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggtt 451 |||| ||||||||||| |||||||||| |||||| | || ||||||||||||||||| Sbjct: 841 atcactccaggccttgttgttgttgtagaccacggcgacgccgaggctcctggccgggtt 782 Query: 452 gatgccggtgccggtgatcgggatggtggccaggtggaccatgaacacggcgaagccgat 511 |||||||||||||||||||||||| || |||||||| ||||||||||| ||||| ||||| Sbjct: 781 gatgccggtgccggtgatcgggatcgtcgccaggtgcaccatgaacaccgcgaacccgat 722 Query: 512 cgggaggggcgccaacaccgggacgtgagagttcgcgtgcgctgcgcttggggtcggtgg 571 || || || |||||||| || || || ||| ||||| ||| |||||||||| ||||||| Sbjct: 721 tggcagcggagccaacacgggaacatgtgag-tcgcgggcgttgcgcttgggatcggtgg 663 Query: 572 cggagaagacggtgta 587 |||||||||||||||| Sbjct: 662 cggagaagacggtgta 647 Score = 40.1 bits (20), Expect = 8.0 Identities = 23/24 (95%) Strand = Plus / Minus Query: 276 tacgcgttgctcctgaaggagccg 299 ||||||||||||| |||||||||| Sbjct: 954 tacgcgttgctccggaaggagccg 931
>dbj|AK072632.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023132K03, full insert sequence Length = 1215 Score = 230 bits (116), Expect = 4e-57 Identities = 222/256 (86%), Gaps = 1/256 (0%) Strand = Plus / Minus Query: 332 ctggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactg 391 ||||||||| | |||||||||||||||||||| | || || ||||||||||||||||| Sbjct: 901 ctggtggtacagcgccgcgatcgccgcgccgatgaacggcccaacccagaagatccactg 842 Query: 392 atcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggtt 451 |||| ||||||||||| |||||||||| |||||| | || ||||||||||||||||| Sbjct: 841 atcactccaggccttgttgttgttgtagaccacggcgacgccgaggctcctggccgggtt 782 Query: 452 gatgccggtgccggtgatcgggatggtggccaggtggaccatgaacacggcgaagccgat 511 |||||||||||||||||||||||| || |||||||| ||||||||||| ||||| ||||| Sbjct: 781 gatgccggtgccggtgatcgggatcgtcgccaggtgcaccatgaacaccgcgaacccgat 722 Query: 512 cgggaggggcgccaacaccgggacgtgagagttcgcgtgcgctgcgcttggggtcggtgg 571 || || || |||||||| || || || ||| ||||| ||| |||||||||| ||||||| Sbjct: 721 tggcagcggagccaacacgggaacatgtgag-tcgcgggcgttgcgcttgggatcggtgg 663 Query: 572 cggagaagacggtgta 587 |||||||||||||||| Sbjct: 662 cggagaagacggtgta 647 Score = 40.1 bits (20), Expect = 8.0 Identities = 23/24 (95%) Strand = Plus / Minus Query: 276 tacgcgttgctcctgaaggagccg 299 ||||||||||||| |||||||||| Sbjct: 954 tacgcgttgctccggaaggagccg 931
>dbj|AB219366.1| Hordeum vulgare HvPIP2;1 mRNA for PIP aquaporin, complete cds Length = 1318 Score = 218 bits (110), Expect = 2e-53 Identities = 225/262 (85%), Gaps = 1/262 (0%) Strand = Plus / Minus Query: 330 tactggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccac 389 |||||||||||| ||| || || || |||||||||| || || |||||||||||||| Sbjct: 944 tactggtggtaggcggcggcaatggcggcgccgatcagtggccccacccagaagatccat 885 Query: 390 tgatcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccggg 449 || ||||||||||||||||| ||||||||||||| || || |||| ||| || || ||| Sbjct: 884 tggtcatcccaggccttgtcagtgttgtagatgacagcagctcccaagcttctcgcgggg 825 Query: 450 ttgatgccggtgccggtgatcgggatggtggccaggtggaccatgaacacggcgaagccg 509 |||||||||||||||||||| ||||||||||||| ||||||||||||||| ||||| ||| Sbjct: 824 ttgatgccggtgccggtgatggggatggtggccaagtggaccatgaacacagcgaatccg 765 Query: 510 atcgggaggggcgccaacaccgggacgtgagagttcgcgtgcgctgcgcttggggtcggt 569 || ||||| || |||| |||||||| ||| || || || ||| |||||||||||||||| Sbjct: 764 attgggagaggagccagcaccgggatgtggga-atcacgggcgttgcgcttggggtcggt 706 Query: 570 ggcggagaagacggtgtagacg 591 |||||||||||| ||||||||| Sbjct: 705 ggcggagaagaccgtgtagacg 684
>dbj|AB009307.1| Hordeum vulgare HvPIP2;1 mRNA, complete cd Length = 1251 Score = 218 bits (110), Expect = 2e-53 Identities = 225/262 (85%), Gaps = 1/262 (0%) Strand = Plus / Minus Query: 330 tactggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccac 389 |||||||||||| ||| || || || |||||||||| || || |||||||||||||| Sbjct: 864 tactggtggtaggcggcggcaatggcggcgccgatcagtggccccacccagaagatccat 805 Query: 390 tgatcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccggg 449 || ||||||||||||||||| ||||||||||||| || || |||| ||| || || ||| Sbjct: 804 tggtcatcccaggccttgtcagtgttgtagatgacagcagctcccaagcttctcgcgggg 745 Query: 450 ttgatgccggtgccggtgatcgggatggtggccaggtggaccatgaacacggcgaagccg 509 |||||||||||||||||||| ||||||||||||| ||||||||||||||| ||||| ||| Sbjct: 744 ttgatgccggtgccggtgatggggatggtggccaagtggaccatgaacacagcgaatccg 685 Query: 510 atcgggaggggcgccaacaccgggacgtgagagttcgcgtgcgctgcgcttggggtcggt 569 || ||||| || |||| |||||||| ||| || || || ||| |||||||||||||||| Sbjct: 684 attgggagaggagccagcaccgggatgtggga-atcacgggcgttgcgcttggggtcggt 626 Query: 570 ggcggagaagacggtgtagacg 591 |||||||||||| ||||||||| Sbjct: 625 ggcggagaagaccgtgtagacg 604
>ref|XM_473219.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 873 Score = 216 bits (109), Expect = 6e-53 Identities = 239/281 (85%), Gaps = 1/281 (0%) Strand = Plus / Minus Query: 311 ggcgccggccctgagtatgtactggtggtagaaggccgcgatcgccgcgccgatcatggg 370 ||||| |||||| || | ||||||||||||| ||| ||||| || |||||||| | ||| Sbjct: 837 ggcgctggccctcaggacgtactggtggtaggcggcggcgatggcggcgccgatgagggg 778 Query: 371 gccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggc 430 || |||||||||||||| || |||| ||| ||||||| || ||||||||| || || || Sbjct: 777 ccccacccagaagatccagtggtcatgccatgccttgtgctggttgtagatcaccgcagc 718 Query: 431 ccccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggac 490 |||| |||||| |||||||||||||||||||||||||||||||| ||||||| ||| || Sbjct: 717 tcccaagctccttgccgggttgatgccggtgccggtgatcgggatcgtggccaagtgaac 658 Query: 491 catgaacacggcgaagccgatcgggaggggcgccaacaccgggacgtgagagttcgcgtg 550 ||||||||| ||||| || || || || || || | ||| |||||||| ||| ||||| | Sbjct: 657 catgaacaccgcgaacccaattggaagaggagcaagcacggggacgtgggag-tcgcggg 599 Query: 551 cgctgcgcttggggtcggtggcggagaagacggtgtagacg 591 || |||||||||||||||||||||||||||||||||||||| Sbjct: 598 cgttgcgcttggggtcggtggcggagaagacggtgtagacg 558
>gb|AF326495.1|AF326495 Zea mays plasma membrane integral protein ZmPIP2-6 mRNA, complete cds Length = 1257 Score = 214 bits (108), Expect = 2e-52 Identities = 211/244 (86%), Gaps = 1/244 (0%) Strand = Plus / Minus Query: 348 gcgatcgccgcgccgatcatggggccgacccagaagatccactgatcatcccaggccttg 407 ||||||||||| ||||| | ||||| ||||||||||||||||| || |||||| ||| Sbjct: 884 gcgatcgccgctccgatgaacgggcccacccagaagatccactggtcgctccaggctttg 825 Query: 408 tccttgttgtagatgacggcggcccccaggctcctggccgggttgatgccggtgccggtg 467 |||||||| | ||||||||| || |||||||| ||||||||||| |||||||| ||| Sbjct: 824 ctgttgttgtacacgacggcggcgccgaggctcctcgccgggttgataccggtgccagtg 765 Query: 468 atcgggatggtggccaggtggaccatgaacacggcgaagccgatcgggaggggcgccaac 527 |||||||| || |||||||| ||||||||||| ||||| |||||||| || ||||||| | Sbjct: 764 atcgggatcgtcgccaggtgcaccatgaacacagcgaacccgatcggaagcggcgccagc 705 Query: 528 accgggacgtgagagttcgcgtgcgctgcgcttggggtcggtggcggagaagacggtgta 587 ||||| ||||| ||| ||||| ||| |||||||||||||||||||||||||||||||||| Sbjct: 704 accggaacgtgggag-tcgcgagcgttgcgcttggggtcggtggcggagaagacggtgta 646 Query: 588 gacg 591 |||| Sbjct: 645 gacg 642
>gb|AF388171.1|AF388171 Triticum boeoticum plasma membrane intrinsic protein 2 (PIP2) mRNA, partial cds Length = 411 Score = 212 bits (107), Expect = 1e-51 Identities = 177/199 (88%), Gaps = 1/199 (0%) Strand = Plus / Minus Query: 393 tcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttg 452 |||| ||||||| |||| |||||||||||||| || || |||| ||| || ||||||||| Sbjct: 407 tcattccaggccctgtctttgttgtagatgacagcagctcccaagcttctcgccgggttg 348 Query: 453 atgccggtgccggtgatcgggatggtggccaggtggaccatgaacacggcgaagccgatc 512 ||||||||||||||||| ||||||||||| ||||||||||||||||||||||| ||||| Sbjct: 347 atgccggtgccggtgatggggatggtggctaggtggaccatgaacacggcgaatccgatt 288 Query: 513 gggaggggcgccaacaccgggacgtgagagttcgcgtgcgctgcgcttggggtcggtggc 572 ||||| || |||| |||||||| ||| ||| || || ||| ||||||||||||||||||| Sbjct: 287 gggagaggagccagcaccgggatgtgggag-tcacgagcgttgcgcttggggtcggtggc 229 Query: 573 ggagaagacggtgtagacg 591 ||||||||||||||||||| Sbjct: 228 ggagaagacggtgtagacg 210
>ref|XM_475029.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 849 Score = 206 bits (104), Expect = 6e-50 Identities = 189/216 (87%), Gaps = 1/216 (0%) Strand = Plus / Minus Query: 376 cccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccca 435 ||||||||||||| || || ||||| ||||| | || |||||||||||||||||| || | Sbjct: 742 cccagaagatccagtggtcgtcccatgccttcttctggttgtagatgacggcggcgccga 683 Query: 436 ggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatga 495 ||||| ||| ||||||||||| ||||||||||| ||||||||||||||||| ||||||| Sbjct: 682 tgctccgggcagggttgatgcccgtgccggtgatggggatggtggccaggtgcaccatga 623 Query: 496 acacggcgaagccgatcgggaggggcgccaacaccgggacgtgagagttcgcgtgcgctg 555 |||||||||| ||||| || || ||||| | |||||||||||| ||| ||||| || || Sbjct: 622 acacggcgaacccgatgggcagcggcgcgagcaccgggacgtgggag-tcgcgggcattg 564 Query: 556 cgcttggggtcggtggcggagaagacggtgtagacg 591 ||||| |||||||||||||||||||||||||||||| Sbjct: 563 cgctttgggtcggtggcggagaagacggtgtagacg 528 Score = 50.1 bits (25), Expect = 0.008 Identities = 49/57 (85%) Strand = Plus / Minus Query: 281 gttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggtg 337 |||||||| ||||||||| || ||||||||||| | |||| ||| ||||||||||| Sbjct: 837 gttgctccggaaggagcccagcgccttgatggctgccgcccggaggatgtactggtg 781
>dbj|AK119661.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-141-B01, full insert sequence Length = 1067 Score = 206 bits (104), Expect = 6e-50 Identities = 189/216 (87%), Gaps = 1/216 (0%) Strand = Plus / Minus Query: 376 cccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccca 435 ||||||||||||| || || ||||| ||||| | || |||||||||||||||||| || | Sbjct: 728 cccagaagatccagtggtcgtcccatgccttcttctggttgtagatgacggcggcgccga 669 Query: 436 ggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatga 495 ||||| ||| ||||||||||| ||||||||||| ||||||||||||||||| ||||||| Sbjct: 668 tgctccgggcagggttgatgcccgtgccggtgatggggatggtggccaggtgcaccatga 609 Query: 496 acacggcgaagccgatcgggaggggcgccaacaccgggacgtgagagttcgcgtgcgctg 555 |||||||||| ||||| || || ||||| | |||||||||||| ||| ||||| || || Sbjct: 608 acacggcgaacccgatgggcagcggcgcgagcaccgggacgtgggag-tcgcgggcattg 550 Query: 556 cgcttggggtcggtggcggagaagacggtgtagacg 591 ||||| |||||||||||||||||||||||||||||| Sbjct: 549 cgctttgggtcggtggcggagaagacggtgtagacg 514 Score = 46.1 bits (23), Expect = 0.13 Identities = 47/55 (85%) Strand = Plus / Minus Query: 283 tgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggtg 337 |||||| ||||||||| || ||||||||||| | |||| ||| ||||||||||| Sbjct: 821 tgctccggaaggagcccagcgccttgatggctgccgcccggaggatgtactggtg 767
>dbj|AK102155.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033086E18, full insert sequence Length = 1308 Score = 206 bits (104), Expect = 6e-50 Identities = 189/216 (87%), Gaps = 1/216 (0%) Strand = Plus / Minus Query: 376 cccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccca 435 ||||||||||||| || || ||||| ||||| | || |||||||||||||||||| || | Sbjct: 841 cccagaagatccagtggtcgtcccatgccttcttctggttgtagatgacggcggcgccga 782 Query: 436 ggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatga 495 ||||| ||| ||||||||||| ||||||||||| ||||||||||||||||| ||||||| Sbjct: 781 tgctccgggcagggttgatgcccgtgccggtgatggggatggtggccaggtgcaccatga 722 Query: 496 acacggcgaagccgatcgggaggggcgccaacaccgggacgtgagagttcgcgtgcgctg 555 |||||||||| ||||| || || ||||| | |||||||||||| ||| ||||| || || Sbjct: 721 acacggcgaacccgatgggcagcggcgcgagcaccgggacgtgggag-tcgcgggcattg 663 Query: 556 cgcttggggtcggtggcggagaagacggtgtagacg 591 ||||| |||||||||||||||||||||||||||||| Sbjct: 662 cgctttgggtcggtggcggagaagacggtgtagacg 627 Score = 50.1 bits (25), Expect = 0.008 Identities = 49/57 (85%) Strand = Plus / Minus Query: 281 gttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggtg 337 |||||||| ||||||||| || ||||||||||| | |||| ||| ||||||||||| Sbjct: 936 gttgctccggaaggagcccagcgccttgatggctgccgcccggaggatgtactggtg 880
>dbj|AK061491.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-309-B05, full insert sequence Length = 1309 Score = 206 bits (104), Expect = 6e-50 Identities = 189/216 (87%), Gaps = 1/216 (0%) Strand = Plus / Minus Query: 376 cccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccca 435 ||||||||||||| || || ||||| ||||| | || |||||||||||||||||| || | Sbjct: 835 cccagaagatccagtggtcgtcccatgccttcttctggttgtagatgacggcggcgccga 776 Query: 436 ggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatga 495 ||||| ||| ||||||||||| ||||||||||| ||||||||||||||||| ||||||| Sbjct: 775 tgctccgggcagggttgatgcccgtgccggtgatggggatggtggccaggtgcaccatga 716 Query: 496 acacggcgaagccgatcgggaggggcgccaacaccgggacgtgagagttcgcgtgcgctg 555 |||||||||| ||||| || || ||||| | |||||||||||| ||| ||||| || || Sbjct: 715 acacggcgaacccgatgggcagcggcgcgagcaccgggacgtgggag-tcgcgggcattg 657 Query: 556 cgcttggggtcggtggcggagaagacggtgtagacg 591 ||||| |||||||||||||||||||||||||||||| Sbjct: 656 cgctttgggtcggtggcggagaagacggtgtagacg 621 Score = 50.1 bits (25), Expect = 0.008 Identities = 49/57 (85%) Strand = Plus / Minus Query: 281 gttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggtg 337 |||||||| ||||||||| || ||||||||||| | |||| ||| ||||||||||| Sbjct: 930 gttgctccggaaggagcccagcgccttgatggctgccgcccggaggatgtactggtg 874
>dbj|AK061312.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-302-B10, full insert sequence Length = 1296 Score = 206 bits (104), Expect = 6e-50 Identities = 189/216 (87%), Gaps = 1/216 (0%) Strand = Plus / Minus Query: 376 cccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccca 435 ||||||||||||| || || ||||| ||||| | || |||||||||||||||||| || | Sbjct: 829 cccagaagatccagtggtcgtcccatgccttcttctggttgtagatgacggcggcgccga 770 Query: 436 ggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatga 495 ||||| ||| ||||||||||| ||||||||||| ||||||||||||||||| ||||||| Sbjct: 769 tgctccgggcagggttgatgcccgtgccggtgatggggatggtggccaggtgcaccatga 710 Query: 496 acacggcgaagccgatcgggaggggcgccaacaccgggacgtgagagttcgcgtgcgctg 555 |||||||||| ||||| || || ||||| | |||||||||||| ||| ||||| || || Sbjct: 709 acacggcgaacccgatgggcagcggcgcgagcaccgggacgtgggag-tcgcgggcattg 651 Query: 556 cgcttggggtcggtggcggagaagacggtgtagacg 591 ||||| |||||||||||||||||||||||||||||| Sbjct: 650 cgctttgggtcggtggcggagaagacggtgtagacg 615 Score = 50.1 bits (25), Expect = 0.008 Identities = 49/57 (85%) Strand = Plus / Minus Query: 281 gttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggtg 337 |||||||| ||||||||| || ||||||||||| | |||| ||| ||||||||||| Sbjct: 924 gttgctccggaaggagcccagcgccttgatggctgccgcccggaggatgtactggtg 868
>ref|NM_197034.1| Oryza sativa (japonica cultivar-group) putative aquaporin (OSJNBa0093B11.9), mRNA Length = 729 Score = 176 bits (89), Expect = 5e-41 Identities = 183/213 (85%), Gaps = 1/213 (0%) Strand = Plus / Minus Query: 375 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 434 |||||||||||||||||||| | ||| || ||| || |||||||| ||||||||| || Sbjct: 626 acccagaagatccactgatcgtgccaagcattgggctggttgtagacgacggcggcgccg 567 Query: 435 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 494 | |||||| ||||| |||||||| ||||||||||||||||||||||| ||||| |||| | Sbjct: 566 aagctcctcgccggattgatgcccgtgccggtgatcgggatggtggcgaggtgcaccacg 507 Query: 495 aacacggcgaagccgatcgggaggggcgccaacaccgggacgtgagagttcgcgtgcgct 554 ||||| ||||| ||||| || | |||||||||||||||| ||| | ||||| ||||| Sbjct: 506 aacaccgcgaaaccgatgggcaatggcgccaacaccgggatgtg-gctgtcgcgcgcgct 448 Query: 555 gcgcttggggtcggtggcggagaagacggtgta 587 |||||||| |||||||||||||||||||||||| Sbjct: 447 gcgcttggcgtcggtggcggagaagacggtgta 415
>dbj|AK106746.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-115-C02, full insert sequence Length = 1232 Score = 176 bits (89), Expect = 5e-41 Identities = 183/213 (85%), Gaps = 1/213 (0%) Strand = Plus / Minus Query: 375 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 434 |||||||||||||||||||| | ||| || ||| || |||||||| ||||||||| || Sbjct: 808 acccagaagatccactgatcgtgccaagcattgggctggttgtagacgacggcggcgccg 749 Query: 435 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 494 | |||||| ||||| |||||||| ||||||||||||||||||||||| ||||| |||| | Sbjct: 748 aagctcctcgccggattgatgcccgtgccggtgatcgggatggtggcgaggtgcaccacg 689 Query: 495 aacacggcgaagccgatcgggaggggcgccaacaccgggacgtgagagttcgcgtgcgct 554 ||||| ||||| ||||| || | |||||||||||||||| ||| | ||||| ||||| Sbjct: 688 aacaccgcgaaaccgatgggcaatggcgccaacaccgggatgtg-gctgtcgcgcgcgct 630 Query: 555 gcgcttggggtcggtggcggagaagacggtgta 587 |||||||| |||||||||||||||||||||||| Sbjct: 629 gcgcttggcgtcggtggcggagaagacggtgta 597
>dbj|AB009308.2| Hordeum vulgare HvPIP1;3 mRNA, complete cds Length = 1285 Score = 168 bits (85), Expect = 1e-38 Identities = 212/253 (83%), Gaps = 1/253 (0%) Strand = Plus / Minus Query: 335 gtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactgatc 394 |||||||| ||||| | |||||||||||| | || || |||||||||||||| || || Sbjct: 914 gtggtagatcgccgccagcgccgcgccgatgaacggtcccacccagaagatccagtggtc 855 Query: 395 atcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttgat 454 ||||| |||| | |||||||||||||| |||||| || ||| ||| ||||||||||| Sbjct: 854 gtcccacgcctgcttcttgttgtagatgatggcggcgccgagggacctcgccgggttgat 795 Query: 455 gccggtgccggtgatcgggatggtggccaggtggaccatgaacacggcgaagccgatcgg 514 ||||||||| ||||| ||||| || |||||||| |||| |||||| ||||| |||||||| Sbjct: 794 gccggtgcccgtgatggggatcgtcgccaggtgcaccaggaacaccgcgaacccgatcgg 735 Query: 515 gaggggcgccaacaccgggacgtgagagttcgcgtgcgctgcgcttggggtcggtggcgg 574 || |||||||| | |||||||| ||| || | ||||||||||||| ||||||||||| Sbjct: 734 aagcggcgccaaaatggggacgtgggag-tctctggcgctgcgcttggcgtcggtggcgg 676 Query: 575 agaagacggtgta 587 ||||||||||||| Sbjct: 675 agaagacggtgta 663
>emb|X76911.1|HVEMIP H.vulgare mRNA for transmembrane protein Length = 1225 Score = 167 bits (84), Expect = 5e-38 Identities = 156/180 (86%) Strand = Plus / Minus Query: 332 ctggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactg 391 ||||||||||| ||| || | ||| |||||||| | ||||||||||||||||||||| || Sbjct: 898 ctggtggtagatggcggccagcgcggcgccgatgaaggggccgacccagaagatccagtg 839 Query: 392 atcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggtt 451 || |||||| | ||| |||||||||||| ||| || || |||||||| |||||||| Sbjct: 838 gtctgaccaggcgtgctccctgttgtagatgatggccgcgccgaggctcctcgccgggtt 779 Query: 452 gatgccggtgccggtgatcgggatggtggccaggtggaccatgaacacggcgaagccgat 511 |||||||||||||||||| |||||||||||||||||||||| |||||||||||| ||||| Sbjct: 778 gatgccggtgccggtgatggggatggtggccaggtggaccaggaacacggcgaacccgat 719 Score = 60.0 bits (30), Expect = 9e-06 Identities = 33/34 (97%) Strand = Plus / Minus Query: 558 cttggggtcggtggcggagaagacggtgtagacg 591 ||||| |||||||||||||||||||||||||||| Sbjct: 673 cttggcgtcggtggcggagaagacggtgtagacg 640
>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete sequence Length = 35954743 Score = 155 bits (78), Expect = 2e-34 Identities = 123/138 (89%) Strand = Plus / Minus Query: 393 tcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttg 452 ||||||||||||||||||||||||||||| || |||| |||| |||||| |||||||| Sbjct: 25184038 tcatcccaggccttgtccttgttgtagataaccgcggttcccaagctcctcgccgggtta 25183979 Query: 453 atgccggtgccggtgatcgggatggtggccaggtggaccatgaacacggcgaagccgatc 512 ||||||||||||||||| |||||||||||||| |||||||||||||| ||||| || || Sbjct: 25183978 atgccggtgccggtgatggggatggtggccagatggaccatgaacaccgcgaatccaatt 25183919 Query: 513 gggaggggcgccaacacc 530 ||||| || ||||||||| Sbjct: 25183918 gggagaggagccaacacc 25183901 Score = 141 bits (71), Expect = 3e-30 Identities = 144/167 (86%), Gaps = 1/167 (0%) Strand = Plus / Minus Query: 425 ggcggcccccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccag 484 |||||| || ||||| | ||| ||||||||||||||||||||||| ||||||||||| || Sbjct: 35369049 ggcggcgccgaggctgcgggcggggttgatgccggtgccggtgatggggatggtggcgag 35368990 Query: 485 gtggaccatgaacacggcgaagccgatcgggaggggcgccaacaccgggacgtgagagtt 544 |||||| | ||| |||||||||||||| ||||| ||||||| | |||||||| ||| | Sbjct: 35368989 gtggacgaggaagacggcgaagccgatggggagcggcgccaggatggggacgtgggag-t 35368931 Query: 545 cgcgtgcgctgcgcttggggtcggtggcggagaagacggtgtagacg 591 | | ||| ||||||||| |||||||||||||||||||||||||||| Sbjct: 35368930 ccctggcgttgcgcttggcgtcggtggcggagaagacggtgtagacg 35368884 Score = 117 bits (59), Expect = 4e-23 Identities = 95/107 (88%) Strand = Plus / Minus Query: 393 tcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttg 452 |||| |||||| | ||||||||||||||||| ||| || || ||||||||||| |||||| Sbjct: 27065064 tcattccaggcatggtccttgttgtagatgatggcagcgccaaggctcctggctgggttg 27065005 Query: 453 atgccggtgccggtgatcgggatggtggccaggtggaccatgaacac 499 ||||| || |||||||| |||||||||||||||||||||| |||||| Sbjct: 27065004 atgccagtaccggtgatggggatggtggccaggtggaccaggaacac 27064958 Score = 81.8 bits (41), Expect = 2e-12 Identities = 60/65 (92%), Gaps = 1/65 (1%) Strand = Plus / Minus Query: 527 caccgggacgtgagagttcgcgtgcgctgcgcttggggtcggtggcggagaagacggtgt 586 |||||||| ||| |||| |||| ||| ||||||||||||||||||||||||||||||||| Sbjct: 25182163 caccgggatgtgggagt-cgcgggcgttgcgcttggggtcggtggcggagaagacggtgt 25182105 Query: 587 agacg 591 ||||| Sbjct: 25182104 agacg 25182100 Score = 75.8 bits (38), Expect = 1e-10 Identities = 71/82 (86%) Strand = Plus / Minus Query: 311 ggcgccggccctgagtatgtactggtggtagaaggccgcgatcgccgcgccgatcatggg 370 ||||| |||||| || | ||||||||||||| ||| ||||| || |||||||||| ||| Sbjct: 25184682 ggcgctggccctcagcacgtactggtggtaggcggcggcgatggcggcgccgatcagggg 25184623 Query: 371 gccgacccagaagatccactga 392 ||| |||||||||||||||||| Sbjct: 25184622 gcccacccagaagatccactga 25184601 Score = 40.1 bits (20), Expect = 8.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 30 aaattaaaacaggaaaagga 49 |||||||||||||||||||| Sbjct: 751943 aaattaaaacaggaaaagga 751962
>dbj|AP006168.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:B1469H02 Length = 136602 Score = 155 bits (78), Expect = 2e-34 Identities = 123/138 (89%) Strand = Plus / Minus Query: 393 tcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttg 452 ||||||||||||||||||||||||||||| || |||| |||| |||||| |||||||| Sbjct: 84431 tcatcccaggccttgtccttgttgtagataaccgcggttcccaagctcctcgccgggtta 84372 Query: 453 atgccggtgccggtgatcgggatggtggccaggtggaccatgaacacggcgaagccgatc 512 ||||||||||||||||| |||||||||||||| |||||||||||||| ||||| || || Sbjct: 84371 atgccggtgccggtgatggggatggtggccagatggaccatgaacaccgcgaatccaatt 84312 Query: 513 gggaggggcgccaacacc 530 ||||| || ||||||||| Sbjct: 84311 gggagaggagccaacacc 84294 Score = 81.8 bits (41), Expect = 2e-12 Identities = 60/65 (92%), Gaps = 1/65 (1%) Strand = Plus / Minus Query: 527 caccgggacgtgagagttcgcgtgcgctgcgcttggggtcggtggcggagaagacggtgt 586 |||||||| ||| |||| |||| ||| ||||||||||||||||||||||||||||||||| Sbjct: 82556 caccgggatgtgggagt-cgcgggcgttgcgcttggggtcggtggcggagaagacggtgt 82498 Query: 587 agacg 591 ||||| Sbjct: 82497 agacg 82493 Score = 75.8 bits (38), Expect = 1e-10 Identities = 71/82 (86%) Strand = Plus / Minus Query: 311 ggcgccggccctgagtatgtactggtggtagaaggccgcgatcgccgcgccgatcatggg 370 ||||| |||||| || | ||||||||||||| ||| ||||| || |||||||||| ||| Sbjct: 85075 ggcgctggccctcagcacgtactggtggtaggcggcggcgatggcggcgccgatcagggg 85016 Query: 371 gccgacccagaagatccactga 392 ||| |||||||||||||||||| Sbjct: 85015 gcccacccagaagatccactga 84994
>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete sequence Length = 29644043 Score = 153 bits (77), Expect = 8e-34 Identities = 113/125 (90%) Strand = Plus / Minus Query: 402 gccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttgatgccggtg 461 ||||| || |||||| |||||||||| || || | ||||||||||||||||||||||||| Sbjct: 15355603 gccttctcgttgttgaagatgacggccgctccgatgctcctggccgggttgatgccggtg 15355544 Query: 462 ccggtgatcgggatggtggccaggtggaccatgaacacggcgaagccgatcgggaggggc 521 |||||||||||||| || |||||||||||||||||||||||||||||||| || || ||| Sbjct: 15355543 ccggtgatcgggatcgtcgccaggtggaccatgaacacggcgaagccgattggcagcggc 15355484 Query: 522 gccaa 526 ||||| Sbjct: 15355483 gccaa 15355479 Score = 151 bits (76), Expect = 3e-33 Identities = 109/120 (90%) Strand = Plus / Minus Query: 411 ttgttgtagatgacggcggcccccaggctcctggccgggttgatgccggtgccggtgatc 470 |||||||||| ||||||||| || |||||||| ||||||||||||||||||||||||| Sbjct: 15324236 ttgttgtagacgacggcggcgccgaggctcctcgccgggttgatgccggtgccggtgacg 15324177 Query: 471 gggatggtggccaggtggaccatgaacacggcgaagccgatcgggaggggcgccaacacc 530 |||||||| |||||||| ||||||||||||||||| |||||||| || |||||||||||| Sbjct: 15324176 gggatggtcgccaggtgcaccatgaacacggcgaacccgatcggcagcggcgccaacacc 15324117 Score = 151 bits (76), Expect = 3e-33 Identities = 109/120 (90%) Strand = Plus / Minus Query: 411 ttgttgtagatgacggcggcccccaggctcctggccgggttgatgccggtgccggtgatc 470 |||||||| ||||||||||| || |||||||| ||||||||||||||||||||||||||| Sbjct: 15316356 ttgttgtacatgacggcggcgccgaggctcctcgccgggttgatgccggtgccggtgatc 15316297 Query: 471 gggatggtggccaggtggaccatgaacacggcgaagccgatcgggaggggcgccaacacc 530 ||||| || |||||||| ||||||||||| ||||| |||||||| || |||||||||||| Sbjct: 15316296 gggatcgtcgccaggtgcaccatgaacaccgcgaacccgatcggcagcggcgccaacacc 15316237 Score = 149 bits (75), Expect = 1e-32 Identities = 105/115 (91%) Strand = Plus / Minus Query: 277 acgcgttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggt 336 |||||||||||||||||||||||||||| |||||||||||||||| ||| |||||||||| Sbjct: 15355852 acgcgttgctcctgaaggagccgagggctttgatggcgccggcccggaggatgtactggt 15355793 Query: 337 ggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactg 391 ||||||| |||||||| || ||||||| | ||||||||||||||||||||||| Sbjct: 15355792 ggtagaacgccgcgatggcggcgccgacgaacgggccgacccagaagatccactg 15355738 Score = 139 bits (70), Expect = 1e-29 Identities = 124/142 (87%) Strand = Plus / Minus Query: 389 ctgatcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgg 448 ||||||| ||||||||||| |||||||||| |||||| | || |||||||||||||| Sbjct: 15306327 ctgatcactccaggccttgttgttgttgtagaccacggcgacgccgaggctcctggccgg 15306268 Query: 449 gttgatgccggtgccggtgatcgggatggtggccaggtggaccatgaacacggcgaagcc 508 ||||||||||||||||||||||||||| || |||||||| ||||||||||| ||||| || Sbjct: 15306267 gttgatgccggtgccggtgatcgggatcgtcgccaggtgcaccatgaacaccgcgaaccc 15306208 Query: 509 gatcgggaggggcgccaacacc 530 ||| || || || ||||||||| Sbjct: 15306207 gattggcagcggagccaacacc 15306186 Score = 79.8 bits (40), Expect = 9e-12 Identities = 46/48 (95%) Strand = Plus / Minus Query: 544 tcgcgtgcgctgcgcttggggtcggtggcggagaagacggtgtagacg 591 ||||| ||| |||||||||||||||||||||||||||||||||||||| Sbjct: 15353576 tcgcgggcgttgcgcttggggtcggtggcggagaagacggtgtagacg 15353529 Score = 71.9 bits (36), Expect = 2e-09 Identities = 42/44 (95%) Strand = Plus / Minus Query: 544 tcgcgtgcgctgcgcttggggtcggtggcggagaagacggtgta 587 ||||| ||| |||||||||||||||||||||||||||||||||| Sbjct: 15324009 tcgcgggcgttgcgcttggggtcggtggcggagaagacggtgta 15323966 Score = 71.9 bits (36), Expect = 2e-09 Identities = 42/44 (95%) Strand = Plus / Minus Query: 544 tcgcgtgcgctgcgcttggggtcggtggcggagaagacggtgta 587 ||||| ||| |||||||||||||||||||||||||||||||||| Sbjct: 15316141 tcgcgggcgttgcgcttggggtcggtggcggagaagacggtgta 15316098 Score = 63.9 bits (32), Expect = 6e-07 Identities = 41/44 (93%) Strand = Plus / Minus Query: 544 tcgcgtgcgctgcgcttggggtcggtggcggagaagacggtgta 587 ||||| ||| |||||||||| ||||||||||||||||||||||| Sbjct: 15306069 tcgcgggcgttgcgcttgggatcggtggcggagaagacggtgta 15306026 Score = 56.0 bits (28), Expect = 1e-04 Identities = 52/60 (86%) Strand = Plus / Minus Query: 332 ctggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactg 391 ||||||||| | |||||||||||||| ||||| | || |||||||||||||||||||| Sbjct: 15316534 ctggtggtacagcgccgcgatcgccgccccgatgaacggcccgacccagaagatccactg 15316475 Score = 56.0 bits (28), Expect = 1e-04 Identities = 52/60 (86%) Strand = Plus / Minus Query: 332 ctggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactg 391 ||||||||| | |||||||||||||||||||| | || || ||||||||||||||||| Sbjct: 15306498 ctggtggtacagcgccgcgatcgccgcgccgatgaacggcccaacccagaagatccactg 15306439 Score = 40.1 bits (20), Expect = 8.0 Identities = 38/44 (86%) Strand = Plus / Minus Query: 348 gcgatcgccgcgccgatcatggggccgacccagaagatccactg 391 ||||||||||| ||||| | || || ||||||||||||||||| Sbjct: 15324431 gcgatcgccgccccgatgaacggcccaacccagaagatccactg 15324388 Score = 40.1 bits (20), Expect = 8.0 Identities = 23/24 (95%) Strand = Plus / Minus Query: 276 tacgcgttgctcctgaaggagccg 299 ||||||||||||| |||||||||| Sbjct: 15306551 tacgcgttgctccggaaggagccg 15306528
>gb|AF326490.1|AF326490 Zea mays plasma membrane integral protein ZmPIP1-6 mRNA, complete cds Length = 1325 Score = 153 bits (77), Expect = 8e-34 Identities = 153/177 (86%), Gaps = 1/177 (0%) Strand = Plus / Minus Query: 411 ttgttgtagatgacggcggcccccaggctcctggccgggttgatgccggtgccggtgatc 470 |||| |||||||| |||||| || ||||||||||| ||||||||||||||||||||||| Sbjct: 968 ttgtcgtagatgatggcggcgccgaggctcctggcggggttgatgccggtgccggtgatg 909 Query: 471 gggatggtggccaggtggaccatgaacacggcgaagccgatcgggaggggcgccaacacc 530 ||||||||||| ||||| |||| ||| |||||||||||||| || || || |||| | | Sbjct: 908 gggatggtggcgaggtgcaccaggaatacggcgaagccgatgggcagcggggccagcgcg 849 Query: 531 gggacgtgagagttcgcgtgcgctgcgcttggggtcggtggcggagaagacggtgta 587 |||||||| ||| || | ||| ||||||||| |||||||||||||||||||||||| Sbjct: 848 gggacgtgggag-tccctggcggtgcgcttggcgtcggtggcggagaagacggtgta 793
>dbj|AP003802.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OJ1047_A06 Length = 111673 Score = 153 bits (77), Expect = 8e-34 Identities = 113/125 (90%) Strand = Plus / Minus Query: 402 gccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttgatgccggtg 461 ||||| || |||||| |||||||||| || || | ||||||||||||||||||||||||| Sbjct: 62602 gccttctcgttgttgaagatgacggccgctccgatgctcctggccgggttgatgccggtg 62543 Query: 462 ccggtgatcgggatggtggccaggtggaccatgaacacggcgaagccgatcgggaggggc 521 |||||||||||||| || |||||||||||||||||||||||||||||||| || || ||| Sbjct: 62542 ccggtgatcgggatcgtcgccaggtggaccatgaacacggcgaagccgattggcagcggc 62483 Query: 522 gccaa 526 ||||| Sbjct: 62482 gccaa 62478 Score = 151 bits (76), Expect = 3e-33 Identities = 109/120 (90%) Strand = Plus / Minus Query: 411 ttgttgtagatgacggcggcccccaggctcctggccgggttgatgccggtgccggtgatc 470 |||||||||| ||||||||| || |||||||| ||||||||||||||||||||||||| Sbjct: 31235 ttgttgtagacgacggcggcgccgaggctcctcgccgggttgatgccggtgccggtgacg 31176 Query: 471 gggatggtggccaggtggaccatgaacacggcgaagccgatcgggaggggcgccaacacc 530 |||||||| |||||||| ||||||||||||||||| |||||||| || |||||||||||| Sbjct: 31175 gggatggtcgccaggtgcaccatgaacacggcgaacccgatcggcagcggcgccaacacc 31116 Score = 151 bits (76), Expect = 3e-33 Identities = 109/120 (90%) Strand = Plus / Minus Query: 411 ttgttgtagatgacggcggcccccaggctcctggccgggttgatgccggtgccggtgatc 470 |||||||| ||||||||||| || |||||||| ||||||||||||||||||||||||||| Sbjct: 23355 ttgttgtacatgacggcggcgccgaggctcctcgccgggttgatgccggtgccggtgatc 23296 Query: 471 gggatggtggccaggtggaccatgaacacggcgaagccgatcgggaggggcgccaacacc 530 ||||| || |||||||| ||||||||||| ||||| |||||||| || |||||||||||| Sbjct: 23295 gggatcgtcgccaggtgcaccatgaacaccgcgaacccgatcggcagcggcgccaacacc 23236 Score = 149 bits (75), Expect = 1e-32 Identities = 105/115 (91%) Strand = Plus / Minus Query: 277 acgcgttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggt 336 |||||||||||||||||||||||||||| |||||||||||||||| ||| |||||||||| Sbjct: 62851 acgcgttgctcctgaaggagccgagggctttgatggcgccggcccggaggatgtactggt 62792 Query: 337 ggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactg 391 ||||||| |||||||| || ||||||| | ||||||||||||||||||||||| Sbjct: 62791 ggtagaacgccgcgatggcggcgccgacgaacgggccgacccagaagatccactg 62737 Score = 139 bits (70), Expect = 1e-29 Identities = 124/142 (87%) Strand = Plus / Minus Query: 389 ctgatcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgg 448 ||||||| ||||||||||| |||||||||| |||||| | || |||||||||||||| Sbjct: 13326 ctgatcactccaggccttgttgttgttgtagaccacggcgacgccgaggctcctggccgg 13267 Query: 449 gttgatgccggtgccggtgatcgggatggtggccaggtggaccatgaacacggcgaagcc 508 ||||||||||||||||||||||||||| || |||||||| ||||||||||| ||||| || Sbjct: 13266 gttgatgccggtgccggtgatcgggatcgtcgccaggtgcaccatgaacaccgcgaaccc 13207 Query: 509 gatcgggaggggcgccaacacc 530 ||| || || || ||||||||| Sbjct: 13206 gattggcagcggagccaacacc 13185 Score = 79.8 bits (40), Expect = 9e-12 Identities = 46/48 (95%) Strand = Plus / Minus Query: 544 tcgcgtgcgctgcgcttggggtcggtggcggagaagacggtgtagacg 591 ||||| ||| |||||||||||||||||||||||||||||||||||||| Sbjct: 60575 tcgcgggcgttgcgcttggggtcggtggcggagaagacggtgtagacg 60528 Score = 71.9 bits (36), Expect = 2e-09 Identities = 42/44 (95%) Strand = Plus / Minus Query: 544 tcgcgtgcgctgcgcttggggtcggtggcggagaagacggtgta 587 ||||| ||| |||||||||||||||||||||||||||||||||| Sbjct: 31008 tcgcgggcgttgcgcttggggtcggtggcggagaagacggtgta 30965 Score = 71.9 bits (36), Expect = 2e-09 Identities = 42/44 (95%) Strand = Plus / Minus Query: 544 tcgcgtgcgctgcgcttggggtcggtggcggagaagacggtgta 587 ||||| ||| |||||||||||||||||||||||||||||||||| Sbjct: 23140 tcgcgggcgttgcgcttggggtcggtggcggagaagacggtgta 23097 Score = 63.9 bits (32), Expect = 6e-07 Identities = 41/44 (93%) Strand = Plus / Minus Query: 544 tcgcgtgcgctgcgcttggggtcggtggcggagaagacggtgta 587 ||||| ||| |||||||||| ||||||||||||||||||||||| Sbjct: 13068 tcgcgggcgttgcgcttgggatcggtggcggagaagacggtgta 13025 Score = 56.0 bits (28), Expect = 1e-04 Identities = 52/60 (86%) Strand = Plus / Minus Query: 332 ctggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactg 391 ||||||||| | |||||||||||||| ||||| | || |||||||||||||||||||| Sbjct: 23533 ctggtggtacagcgccgcgatcgccgccccgatgaacggcccgacccagaagatccactg 23474 Score = 56.0 bits (28), Expect = 1e-04 Identities = 52/60 (86%) Strand = Plus / Minus Query: 332 ctggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactg 391 ||||||||| | |||||||||||||||||||| | || || ||||||||||||||||| Sbjct: 13497 ctggtggtacagcgccgcgatcgccgcgccgatgaacggcccaacccagaagatccactg 13438 Score = 40.1 bits (20), Expect = 8.0 Identities = 38/44 (86%) Strand = Plus / Minus Query: 348 gcgatcgccgcgccgatcatggggccgacccagaagatccactg 391 ||||||||||| ||||| | || || ||||||||||||||||| Sbjct: 31430 gcgatcgccgccccgatgaacggcccaacccagaagatccactg 31387 Score = 40.1 bits (20), Expect = 8.0 Identities = 23/24 (95%) Strand = Plus / Minus Query: 276 tacgcgttgctcctgaaggagccg 299 ||||||||||||| |||||||||| Sbjct: 13550 tacgcgttgctccggaaggagccg 13527
>gb|BT017668.1| Zea mays clone EL01N0441H09.c mRNA sequence Length = 698 Score = 151 bits (76), Expect = 3e-33 Identities = 154/180 (85%) Strand = Plus / Minus Query: 332 ctggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactg 391 ||||||||||| ||| || | ||| |||||||| | ||||||||||||||||||||| || Sbjct: 397 ctggtggtagatggcagccagcgcagcgccgatgaaggggccgacccagaagatccagtg 338 Query: 392 atcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggtt 451 ||| ||||||| | || || |||||| || |||||||| || ||||||| || ||||| Sbjct: 337 gtcagcccaggcatggtgctggttgtaaattacggcggcgccaaggctccgcgcggggtt 278 Query: 452 gatgccggtgccggtgatcgggatggtggccaggtggaccatgaacacggcgaagccgat 511 |||||||||||||||||| |||||||||||||||||||| | ||||||||| || ||||| Sbjct: 277 gatgccggtgccggtgatagggatggtggccaggtggacgaggaacacggcaaacccgat 218 Score = 60.0 bits (30), Expect = 9e-06 Identities = 33/34 (97%) Strand = Plus / Minus Query: 558 cttggggtcggtggcggagaagacggtgtagacg 591 ||||| |||||||||||||||||||||||||||| Sbjct: 172 cttggcgtcggtggcggagaagacggtgtagacg 139
>gb|AY243800.1| Zea mays plasma membrane intrinsic protein (PIP1-1) mRNA, complete cds Length = 1086 Score = 151 bits (76), Expect = 3e-33 Identities = 154/180 (85%) Strand = Plus / Minus Query: 332 ctggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactg 391 ||||||||||| ||| || | ||| |||||||| | ||||||||||||||||||||| || Sbjct: 828 ctggtggtagatggcagccagcgcagcgccgatgaaggggccgacccagaagatccagtg 769 Query: 392 atcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggtt 451 ||| ||||||| | || || |||||| || |||||||| || ||||||| || ||||| Sbjct: 768 gtcagcccaggcatggtgctggttgtaaattacggcggcgccaaggctccgcgcggggtt 709 Query: 452 gatgccggtgccggtgatcgggatggtggccaggtggaccatgaacacggcgaagccgat 511 |||||||||||||||||| |||||||||||||||||||| | ||||||||| || ||||| Sbjct: 708 gatgccggtgccggtgatagggatggtggccaggtggacgaggaacacggcaaacccgat 649 Score = 60.0 bits (30), Expect = 9e-06 Identities = 33/34 (97%) Strand = Plus / Minus Query: 558 cttggggtcggtggcggagaagacggtgtagacg 591 ||||| |||||||||||||||||||||||||||| Sbjct: 603 cttggcgtcggtggcggagaagacggtgtagacg 570
>dbj|AP004668.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC clone:P0475E07 Length = 139961 Score = 151 bits (76), Expect = 3e-33 Identities = 109/120 (90%) Strand = Plus / Minus Query: 411 ttgttgtagatgacggcggcccccaggctcctggccgggttgatgccggtgccggtgatc 470 |||||||||| ||||||||| || |||||||| ||||||||||||||||||||||||| Sbjct: 110249 ttgttgtagacgacggcggcgccgaggctcctcgccgggttgatgccggtgccggtgacg 110190 Query: 471 gggatggtggccaggtggaccatgaacacggcgaagccgatcgggaggggcgccaacacc 530 |||||||| |||||||| ||||||||||||||||| |||||||| || |||||||||||| Sbjct: 110189 gggatggtcgccaggtgcaccatgaacacggcgaacccgatcggcagcggcgccaacacc 110130 Score = 151 bits (76), Expect = 3e-33 Identities = 109/120 (90%) Strand = Plus / Minus Query: 411 ttgttgtagatgacggcggcccccaggctcctggccgggttgatgccggtgccggtgatc 470 |||||||| ||||||||||| || |||||||| ||||||||||||||||||||||||||| Sbjct: 102369 ttgttgtacatgacggcggcgccgaggctcctcgccgggttgatgccggtgccggtgatc 102310 Query: 471 gggatggtggccaggtggaccatgaacacggcgaagccgatcgggaggggcgccaacacc 530 ||||| || |||||||| ||||||||||| ||||| |||||||| || |||||||||||| Sbjct: 102309 gggatcgtcgccaggtgcaccatgaacaccgcgaacccgatcggcagcggcgccaacacc 102250 Score = 139 bits (70), Expect = 1e-29 Identities = 124/142 (87%) Strand = Plus / Minus Query: 389 ctgatcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgg 448 ||||||| ||||||||||| |||||||||| |||||| | || |||||||||||||| Sbjct: 92340 ctgatcactccaggccttgttgttgttgtagaccacggcgacgccgaggctcctggccgg 92281 Query: 449 gttgatgccggtgccggtgatcgggatggtggccaggtggaccatgaacacggcgaagcc 508 ||||||||||||||||||||||||||| || |||||||| ||||||||||| ||||| || Sbjct: 92280 gttgatgccggtgccggtgatcgggatcgtcgccaggtgcaccatgaacaccgcgaaccc 92221 Query: 509 gatcgggaggggcgccaacacc 530 ||| || || || ||||||||| Sbjct: 92220 gattggcagcggagccaacacc 92199 Score = 79.8 bits (40), Expect = 9e-12 Identities = 46/48 (95%) Strand = Plus / Minus Query: 544 tcgcgtgcgctgcgcttggggtcggtggcggagaagacggtgtagacg 591 ||||| ||| |||||||||||||||||||||||||||||||||||||| Sbjct: 139589 tcgcgggcgttgcgcttggggtcggtggcggagaagacggtgtagacg 139542 Score = 71.9 bits (36), Expect = 2e-09 Identities = 42/44 (95%) Strand = Plus / Minus Query: 544 tcgcgtgcgctgcgcttggggtcggtggcggagaagacggtgta 587 ||||| ||| |||||||||||||||||||||||||||||||||| Sbjct: 110022 tcgcgggcgttgcgcttggggtcggtggcggagaagacggtgta 109979 Score = 71.9 bits (36), Expect = 2e-09 Identities = 42/44 (95%) Strand = Plus / Minus Query: 544 tcgcgtgcgctgcgcttggggtcggtggcggagaagacggtgta 587 ||||| ||| |||||||||||||||||||||||||||||||||| Sbjct: 102154 tcgcgggcgttgcgcttggggtcggtggcggagaagacggtgta 102111 Score = 63.9 bits (32), Expect = 6e-07 Identities = 41/44 (93%) Strand = Plus / Minus Query: 544 tcgcgtgcgctgcgcttggggtcggtggcggagaagacggtgta 587 ||||| ||| |||||||||| ||||||||||||||||||||||| Sbjct: 92082 tcgcgggcgttgcgcttgggatcggtggcggagaagacggtgta 92039 Score = 56.0 bits (28), Expect = 1e-04 Identities = 52/60 (86%) Strand = Plus / Minus Query: 332 ctggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactg 391 ||||||||| | |||||||||||||| ||||| | || |||||||||||||||||||| Sbjct: 102547 ctggtggtacagcgccgcgatcgccgccccgatgaacggcccgacccagaagatccactg 102488 Score = 56.0 bits (28), Expect = 1e-04 Identities = 52/60 (86%) Strand = Plus / Minus Query: 332 ctggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactg 391 ||||||||| | |||||||||||||||||||| | || || ||||||||||||||||| Sbjct: 92511 ctggtggtacagcgccgcgatcgccgcgccgatgaacggcccaacccagaagatccactg 92452 Score = 40.1 bits (20), Expect = 8.0 Identities = 38/44 (86%) Strand = Plus / Minus Query: 348 gcgatcgccgcgccgatcatggggccgacccagaagatccactg 391 ||||||||||| ||||| | || || ||||||||||||||||| Sbjct: 110444 gcgatcgccgccccgatgaacggcccaacccagaagatccactg 110401 Score = 40.1 bits (20), Expect = 8.0 Identities = 23/24 (95%) Strand = Plus / Minus Query: 276 tacgcgttgctcctgaaggagccg 299 ||||||||||||| |||||||||| Sbjct: 92564 tacgcgttgctccggaaggagccg 92541
>dbj|AB009309.2| Hordeum vulgare HvPIP1;5 mRNA, complete cds Length = 1147 Score = 149 bits (75), Expect = 1e-32 Identities = 129/147 (87%) Strand = Plus / Minus Query: 368 ggggccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggc 427 |||||| |||||||||||||| || |||| |||||| | |||| |||||||||||| ||| Sbjct: 877 ggggcccacccagaagatccaatggtcattccaggcatggtccctgttgtagatgatggc 818 Query: 428 ggcccccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtg 487 ||||| |||||||| || ||||||||||||||||||||||| || |||||||||||||| Sbjct: 817 agccccaaggctcctagctgggttgatgccggtgccggtgatgggaatggtggccaggtg 758 Query: 488 gaccatgaacacggcgaagccgatcgg 514 ||||| |||||| ||||| || ||||| Sbjct: 757 gaccaggaacaccgcgaacccaatcgg 731 Score = 46.1 bits (23), Expect = 0.13 Identities = 23/23 (100%) Strand = Plus / Minus Query: 568 gtggcggagaagacggtgtagac 590 ||||||||||||||||||||||| Sbjct: 678 gtggcggagaagacggtgtagac 656
>emb|AJ001294.1|CPPIPC Craterostigma plantagineum mRNA for major intrinsic protein PIPc Length = 800 Score = 145 bits (73), Expect = 2e-31 Identities = 182/217 (83%), Gaps = 1/217 (0%) Strand = Plus / Minus Query: 375 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 434 |||||||| ||||| || |||||||| || || | |||||| |||| |||||||| || Sbjct: 501 acccagaaaatccaatggtcatcccaagcttttccgttgttgaagatcacggcggcgccg 442 Query: 435 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 494 | |||||| |||||||| || ||||||||||||||||| || || |||| ||| |||||| Sbjct: 441 aagctcctcgccgggttaatcccggtgccggtgatcggaatagttgccaagtgtaccatg 382 Query: 495 aacacggcgaagccgatcgggaggggcgccaacaccgggacgtgagagttcgcgtgcgct 554 ||||| || || || || ||||| ||||||||||| || ||||||||| || || ||||| Sbjct: 381 aacaccgcaaaacctattgggagaggcgccaacacgggaacgtgagag-tcacgcgcgct 323 Query: 555 gcgcttggggtcggtggcggagaagacggtgtagacg 591 | ||| |||||||||||||||||||||||||||||| Sbjct: 322 cctctttgggtcggtggcggagaagacggtgtagacg 286
>gb|AF141900.1|AF141900 Vitis berlandieri x Vitis rupestris putative aquaporin PIP2-2 (PIP2-2) mRNA, complete cds Length = 1171 Score = 145 bits (73), Expect = 2e-31 Identities = 112/125 (89%) Strand = Plus / Minus Query: 372 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcc 431 |||||||||||||||||||| || ||||| | || || |||||||||||||||||||| Sbjct: 787 ccgacccagaagatccactggtcgtcccaaactttttcattgttgtagatgacggcggcg 728 Query: 432 cccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggacc 491 || | ||||||||| ||||||||||||||||||||||| ||||||||||| ||||||||| Sbjct: 727 ccgaagctcctggcggggttgatgccggtgccggtgatggggatggtggcaaggtggacc 668 Query: 492 atgaa 496 ||||| Sbjct: 667 atgaa 663
>emb|X82633.1|ZMTRAPRO Z.mays mRNA for transmembrane protein Length = 1169 Score = 143 bits (72), Expect = 7e-31 Identities = 214/260 (82%), Gaps = 1/260 (0%) Strand = Plus / Minus Query: 332 ctggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactg 391 ||||||||||| ||| || | ||| |||||||| | ||||||||||||||||||||| || Sbjct: 885 ctggtggtagatggcagccagcgcagcgccgatgaaggggccgacccagaagatccagtg 826 Query: 392 atcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggtt 451 ||| ||||||| | || || |||||| || |||||||| || ||||||| || ||||| Sbjct: 825 gtcagcccaggcatggtgctggttgtaaattacggcggcgccaaggctccgcgcggggtt 766 Query: 452 gatgccggtgccggtgatcgggatggtggccaggtggaccatgaacacggcgaagccgat 511 |||||||||||||||||| ||||||||||||||||| | ||||||||| || ||||| Sbjct: 765 gatgccggtgccggtgatacccatggtggccaggtggacgaggaacacggcaaacccgat 706 Query: 512 cgggaggggcgccaacaccgggacgtgagagttcgcgtgcgctgcgcttggggtcggtgg 571 || || || |||| | ||| || || ||| || | ||| || | ||||| |||||||| Sbjct: 705 tggaagaggggccaggatcggcacatgggag-tcccttgccctcctcttggcgtcggtgg 647 Query: 572 cggagaagacggtgtagacg 591 |||||||||||||||||||| Sbjct: 646 cggagaagacggtgtagacg 627
>gb|AF366564.1| Triticum aestivum aquaporin PIP1 (Pip1) mRNA, complete cds Length = 1248 Score = 143 bits (72), Expect = 7e-31 Identities = 211/256 (82%), Gaps = 1/256 (0%) Strand = Plus / Minus Query: 335 gtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactgatc 394 |||||||| |||||| | |||||| ||||| | || || |||||||||||||| || || Sbjct: 899 gtggtagatggccgccagcgccgcaccgatgaacggaccaacccagaagatccagtggtc 840 Query: 395 atcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttgat 454 ||||| |||| | |||||||||||||| |||||| || ||| ||| ||||||||||| Sbjct: 839 gtcccacgcctgcttcttgttgtagatgatggcggcgccgagggacctcgccgggttgat 780 Query: 455 gccggtgccggtgatcgggatggtggccaggtggaccatgaacacggcgaagccgatcgg 514 |||||| || ||||| ||||| || |||||||| |||| |||||| ||||| ||||| || Sbjct: 779 gccggtccccgtgatggggatcgtcgccaggtgcaccaggaacaccgcgaacccgatggg 720 Query: 515 gaggggcgccaacaccgggacgtgagagttcgcgtgcgctgcgcttggggtcggtggcgg 574 || |||||||| | |||||||| ||| || | ||||||||||||| ||||||||| | Sbjct: 719 aagcggcgccaaaatggggacgtgggag-tctctggcgctgcgcttggcgtcggtggcag 661 Query: 575 agaagacggtgtagac 590 | |||||||||||||| Sbjct: 660 aaaagacggtgtagac 645
>ref|XM_468463.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1319 Score = 141 bits (71), Expect = 3e-30 Identities = 144/167 (86%), Gaps = 1/167 (0%) Strand = Plus / Minus Query: 425 ggcggcccccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccag 484 |||||| || ||||| | ||| ||||||||||||||||||||||| ||||||||||| || Sbjct: 887 ggcggcgccgaggctgcgggcggggttgatgccggtgccggtgatggggatggtggcgag 828 Query: 485 gtggaccatgaacacggcgaagccgatcgggaggggcgccaacaccgggacgtgagagtt 544 |||||| | ||| |||||||||||||| ||||| ||||||| | |||||||| ||| | Sbjct: 827 gtggacgaggaagacggcgaagccgatggggagcggcgccaggatggggacgtgggag-t 769 Query: 545 cgcgtgcgctgcgcttggggtcggtggcggagaagacggtgtagacg 591 | | ||| ||||||||| |||||||||||||||||||||||||||| Sbjct: 768 ccctggcgttgcgcttggcgtcggtggcggagaagacggtgtagacg 722
>dbj|AP004026.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ1136_C04 Length = 103194 Score = 141 bits (71), Expect = 3e-30 Identities = 144/167 (86%), Gaps = 1/167 (0%) Strand = Plus / Minus Query: 425 ggcggcccccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccag 484 |||||| || ||||| | ||| ||||||||||||||||||||||| ||||||||||| || Sbjct: 29597 ggcggcgccgaggctgcgggcggggttgatgccggtgccggtgatggggatggtggcgag 29538 Query: 485 gtggaccatgaacacggcgaagccgatcgggaggggcgccaacaccgggacgtgagagtt 544 |||||| | ||| |||||||||||||| ||||| ||||||| | |||||||| ||| | Sbjct: 29537 gtggacgaggaagacggcgaagccgatggggagcggcgccaggatggggacgtgggag-t 29479 Query: 545 cgcgtgcgctgcgcttggggtcggtggcggagaagacggtgtagacg 591 | | ||| ||||||||| |||||||||||||||||||||||||||| Sbjct: 29478 ccctggcgttgcgcttggcgtcggtggcggagaagacggtgtagacg 29432
>dbj|AK102174.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033086K14, full insert sequence Length = 1318 Score = 141 bits (71), Expect = 3e-30 Identities = 144/167 (86%), Gaps = 1/167 (0%) Strand = Plus / Minus Query: 425 ggcggcccccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccag 484 |||||| || ||||| | ||| ||||||||||||||||||||||| ||||||||||| || Sbjct: 886 ggcggcgccgaggctgcgggcggggttgatgccggtgccggtgatggggatggtggcgag 827 Query: 485 gtggaccatgaacacggcgaagccgatcgggaggggcgccaacaccgggacgtgagagtt 544 |||||| | ||| |||||||||||||| ||||| ||||||| | |||||||| ||| | Sbjct: 826 gtggacgaggaagacggcgaagccgatggggagcggcgccaggatggggacgtgggag-t 768 Query: 545 cgcgtgcgctgcgcttggggtcggtggcggagaagacggtgtagacg 591 | | ||| ||||||||| |||||||||||||||||||||||||||| Sbjct: 767 ccctggcgttgcgcttggcgtcggtggcggagaagacggtgtagacg 721
>gb|AY107589.1| Zea mays PCO085320 mRNA sequence Length = 569 Score = 139 bits (70), Expect = 1e-29 Identities = 145/170 (85%) Strand = Plus / Minus Query: 369 gggccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcg 428 |||||||||||||| ||||| ||||| ||||| ||||| || |||||| | ||||| Sbjct: 194 gggccgacccagaatatccagtgatcctcccacgcctttcgctggttgtacacaacggcc 135 Query: 429 gcccccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtgg 488 | |||||||||||| |||||||||||||| |||||||||| ||||||||||||||||| Sbjct: 134 ggccccaggctccttgccgggttgatgcccgtgccggtgacggggatggtggccaggtgc 75 Query: 489 accatgaacacggcgaagccgatcgggaggggcgccaacaccgggacgtg 538 ||||||||||| ||||| ||||| || || ||||||| ||||||||||| Sbjct: 74 accatgaacaccgcgaatccgatgggcagcggcgccaggaccgggacgtg 25
>emb|AJ224327.1|OSAJ4327 Oryza sativa mRNA for aquaporin, complete CDS Length = 1139 Score = 137 bits (69), Expect = 5e-29 Identities = 111/125 (88%) Strand = Plus / Minus Query: 375 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 434 |||||||||||||| || |||| |||||| | ||||||||||||||||| ||| || || Sbjct: 812 acccagaagatccaatggtcattccaggcatggtccttgttgtagatgatggcagcgcca 753 Query: 435 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 494 ||||||||||| ||||||||||| || |||||||| |||||||||||||||||||||| | Sbjct: 752 aggctcctggctgggttgatgccagtaccggtgatggggatggtggccaggtggaccagg 693 Query: 495 aacac 499 ||||| Sbjct: 692 aacac 688
>dbj|AK104658.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-311-D06, full insert sequence Length = 1128 Score = 137 bits (69), Expect = 5e-29 Identities = 111/125 (88%) Strand = Plus / Minus Query: 375 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 434 |||||||||||||| || |||| |||||| | ||||||||||||||||| ||| || || Sbjct: 845 acccagaagatccaatggtcattccaggcatggtccttgttgtagatgatggcagcgcca 786 Query: 435 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 494 ||||||||||| ||||||||||| || |||||||| |||||||||||||||||||||| | Sbjct: 785 aggctcctggctgggttgatgccagtaccggtgatggggatggtggccaggtggaccagg 726 Query: 495 aacac 499 ||||| Sbjct: 725 aacac 721
>dbj|AK103807.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033147A07, full insert sequence Length = 1205 Score = 137 bits (69), Expect = 5e-29 Identities = 111/125 (88%) Strand = Plus / Minus Query: 375 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 434 |||||||||||||| || |||| |||||| | ||||||||||||||||| ||| || || Sbjct: 900 acccagaagatccaatggtcattccaggcatggtccttgttgtagatgatggcagcgcca 841 Query: 435 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 494 ||||||||||| ||||||||||| || |||||||| |||||||||||||||||||||| | Sbjct: 840 aggctcctggctgggttgatgccagtaccggtgatggggatggtggccaggtggaccagg 781 Query: 495 aacac 499 ||||| Sbjct: 780 aacac 776
>dbj|AK061769.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-039-C05, full insert sequence Length = 1136 Score = 137 bits (69), Expect = 5e-29 Identities = 111/125 (88%) Strand = Plus / Minus Query: 375 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 434 |||||||||||||| || |||| |||||| | ||||||||||||||||| ||| || || Sbjct: 845 acccagaagatccaatggtcattccaggcatggtccttgttgtagatgatggcagcgcca 786 Query: 435 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 494 ||||||||||| ||||||||||| || |||||||| |||||||||||||||||||||| | Sbjct: 785 aggctcctggctgggttgatgccagtaccggtgatggggatggtggccaggtggaccagg 726 Query: 495 aacac 499 ||||| Sbjct: 725 aacac 721
>gb|AF022737.1|AF022737 Oryza sativa transmembrane protein mRNA, complete cds Length = 1140 Score = 137 bits (69), Expect = 5e-29 Identities = 111/125 (88%) Strand = Plus / Minus Query: 375 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 434 |||||||||||||| || |||| |||||| | ||||||||||||||||| ||| || || Sbjct: 840 acccagaagatccaatggtcattccaggcatggtccttgttgtagatgatggcagcgcca 781 Query: 435 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 494 ||||||||||| ||||||||||| || |||||||| |||||||||||||||||||||| | Sbjct: 780 aggctcctggctgggttgatgccagtaccggtgatggggatggtggccaggtggaccagg 721 Query: 495 aacac 499 ||||| Sbjct: 720 aacac 716
>dbj|AB009665.1| Oryza sativa (japonica cultivar-group) mRNA for water channel protein, complete cds Length = 1116 Score = 137 bits (69), Expect = 5e-29 Identities = 111/125 (88%) Strand = Plus / Minus Query: 375 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 434 |||||||||||||| || |||| |||||| | ||||||||||||||||| ||| || || Sbjct: 843 acccagaagatccaatggtcattccaggcatggtccttgttgtagatgatggcagcgcca 784 Query: 435 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 494 ||||||||||| ||||||||||| || |||||||| |||||||||||||||||||||| | Sbjct: 783 aggctcctggctgggttgatgccagtaccggtgatggggatggtggccaggtggaccagg 724 Query: 495 aacac 499 ||||| Sbjct: 723 aacac 719
>ref|XM_473480.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 849 Score = 135 bits (68), Expect = 2e-28 Identities = 116/132 (87%) Strand = Plus / Minus Query: 368 ggggccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggc 427 |||||| |||||||||||||| || ||||||||||| | | || |||||||||||| ||| Sbjct: 774 ggggccaacccagaagatccaatggtcatcccaggcatggcccctgttgtagatgatggc 715 Query: 428 ggcccccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtg 487 || || |||||||| || ||||||||||||||||||||||| ||||||||||||||||| Sbjct: 714 agcgccaaggctcctcgctgggttgatgccggtgccggtgatggggatggtggccaggtg 655 Query: 488 gaccatgaacac 499 |||| |||||| Sbjct: 654 aaccaagaacac 643 Score = 60.0 bits (30), Expect = 9e-06 Identities = 33/34 (97%) Strand = Plus / Minus Query: 558 cttggggtcggtggcggagaagacggtgtagacg 591 ||||| |||||||||||||||||||||||||||| Sbjct: 585 cttggcgtcggtggcggagaagacggtgtagacg 552
>emb|AJ310639.1|HVU310639 Hordeum vulgare partial pip1 gene for putative aquaporin Length = 1291 Score = 135 bits (68), Expect = 2e-28 Identities = 92/100 (92%) Strand = Plus / Minus Query: 412 tgttgtagatgacggcggcccccaggctcctggccgggttgatgccggtgccggtgatcg 471 |||||||||||| ||| || || |||||||| |||||||||||||||||||||||||| | Sbjct: 657 tgttgtagatgatggccgcgccgaggctcctcgccgggttgatgccggtgccggtgatgg 598 Query: 472 ggatggtggccaggtggaccatgaacacggcgaagccgat 511 ||||||||||||||||||||| |||||||||||| ||||| Sbjct: 597 ggatggtggccaggtggaccaggaacacggcgaacccgat 558 Score = 63.9 bits (32), Expect = 6e-07 Identities = 53/60 (88%) Strand = Plus / Minus Query: 332 ctggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactg 391 ||||||||||| ||| || | ||| |||||||| | |||||||||||||||||||||||| Sbjct: 1291 ctggtggtagatggcggccagcgcggcgccgatgaaggggccgacccagaagatccactg 1232 Score = 60.0 bits (30), Expect = 9e-06 Identities = 33/34 (97%) Strand = Plus / Minus Query: 558 cttggggtcggtggcggagaagacggtgtagacg 591 ||||| |||||||||||||||||||||||||||| Sbjct: 390 cttggcgtcggtggcggagaagacggtgtagacg 357
>emb|AJ271796.1|ZMA271796 Zea mays mRNA for plasma membrane intrinsic protein (pip4 gene) Length = 1364 Score = 135 bits (68), Expect = 2e-28 Identities = 153/180 (85%), Gaps = 1/180 (0%) Strand = Plus / Minus Query: 412 tgttgtagatgacggcggcccccaggctcctggccgggttgatgccggtgccggtgatcg 471 ||||||||| || |||||| || ||||| | || ||||||||||||||||||||||| | Sbjct: 829 tgttgtagacgatggcggcgccgaggctgcgcgcggggttgatgccggtgccggtgatgg 770 Query: 472 ggatggtggccaggtggaccatgaacacggcgaagccgatcgggaggggcgccaacaccg 531 ||||||| |||||||| || | ||| ||||||||||| || ||||| ||||| | | | Sbjct: 769 ggatggtcgccaggtgcacgaggaagacggcgaagcctatggggagcggcgcgaggatgg 710 Query: 532 ggacgtgagagttcgcgtgcgctgcgcttggggtcggtggcggagaagacggtgtagacg 591 | ||||| ||| ||||| ||||||||||||| |||||||||||||||||||||||||||| Sbjct: 709 gcacgtgggag-tcgcgggcgctgcgcttggcgtcggtggcggagaagacggtgtagacg 651
>gb|AF141642.1|AF141642 Vitis berlandieri x Vitis rupestris putative aquaporin PIP2-1 (PIP2-1) mRNA, complete cds Length = 1300 Score = 135 bits (68), Expect = 2e-28 Identities = 182/220 (82%) Strand = Plus / Minus Query: 283 tgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggtggtaga 342 |||||||||| || || || |||||||| || || || || | |||| |||||||||||| Sbjct: 912 tgctcctgaatgacccaagagccttgatagctccagctctcaatatgaactggtggtaga 853 Query: 343 aggccgcgatcgccgcgccgatcatggggccgacccagaagatccactgatcatcccagg 402 |||| || || || || || || | ||| || ||||| ||||||||||| |||||||||| Sbjct: 852 aggctgcaatggctgcaccaatgaagggtccaacccaaaagatccactggtcatcccagg 793 Query: 403 ccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttgatgccggtgc 462 |||| || ||||||||||| || || ||||||| |||||||| |||||||| ||||||| Sbjct: 792 ccttctcattgttgtagataacagcagcccccaaactcctggcagggttgataccggtgc 733 Query: 463 cggtgatcgggatggtggccaggtggaccatgaacacggc 502 | ||||| || || ||||||| ||| |||||||||||||| Sbjct: 732 cagtgataggaatagtggccaagtgaaccatgaacacggc 693 Score = 42.1 bits (21), Expect = 2.0 Identities = 30/33 (90%) Strand = Plus / Minus Query: 558 cttggggtcggtggcggagaagacggtgtagac 590 ||||||||| || || ||||||||||||||||| Sbjct: 638 cttggggtcagttgcagagaagacggtgtagac 606
>gb|AF326489.1|AF326489 Zea mays plasma membrane integral protein ZmPIP1-5 mRNA, complete cds Length = 1338 Score = 135 bits (68), Expect = 2e-28 Identities = 153/180 (85%), Gaps = 1/180 (0%) Strand = Plus / Minus Query: 412 tgttgtagatgacggcggcccccaggctcctggccgggttgatgccggtgccggtgatcg 471 ||||||||| || |||||| || ||||| | || ||||||||||||||||||||||| | Sbjct: 820 tgttgtagacgatggcggcgccgaggctgcgcgcggggttgatgccggtgccggtgatgg 761 Query: 472 ggatggtggccaggtggaccatgaacacggcgaagccgatcgggaggggcgccaacaccg 531 ||||||| |||||||| || | ||| ||||||||||| || ||||| ||||| | | | Sbjct: 760 ggatggtcgccaggtgcacgaggaagacggcgaagcctatggggagcggcgcgaggatgg 701 Query: 532 ggacgtgagagttcgcgtgcgctgcgcttggggtcggtggcggagaagacggtgtagacg 591 | ||||| ||| ||||| ||||||||||||| |||||||||||||||||||||||||||| Sbjct: 700 gcacgtgggag-tcgcgggcgctgcgcttggcgtcggtggcggagaagacggtgtagacg 642
>dbj|AK104736.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-038-D02, full insert sequence Length = 1163 Score = 135 bits (68), Expect = 2e-28 Identities = 116/132 (87%) Strand = Plus / Minus Query: 368 ggggccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggc 427 |||||| |||||||||||||| || ||||||||||| | | || |||||||||||| ||| Sbjct: 851 ggggccaacccagaagatccaatggtcatcccaggcatggcccctgttgtagatgatggc 792 Query: 428 ggcccccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtg 487 || || |||||||| || ||||||||||||||||||||||| ||||||||||||||||| Sbjct: 791 agcgccaaggctcctcgctgggttgatgccggtgccggtgatggggatggtggccaggtg 732 Query: 488 gaccatgaacac 499 |||| |||||| Sbjct: 731 aaccaagaacac 720 Score = 60.0 bits (30), Expect = 9e-06 Identities = 33/34 (97%) Strand = Plus / Minus Query: 558 cttggggtcggtggcggagaagacggtgtagacg 591 ||||| |||||||||||||||||||||||||||| Sbjct: 662 cttggcgtcggtggcggagaagacggtgtagacg 629
>dbj|AK098849.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013000E16, full insert sequence Length = 1164 Score = 135 bits (68), Expect = 2e-28 Identities = 143/168 (85%) Strand = Plus / Minus Query: 332 ctggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactg 391 ||||||||||| ||| || | || ||||| || | |||||| |||||||||||||| || Sbjct: 888 ctggtggtagatggcagcaagggcagcgccaatgaaggggccaacccagaagatccaatg 829 Query: 392 atcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggtt 451 ||||||||||| | | || |||||||||||| ||| || || |||||||| || ||||| Sbjct: 828 gtcatcccaggcatggcccctgttgtagatgatggcagcgccaaggctcctcgctgggtt 769 Query: 452 gatgccggtgccggtgatcgggatggtggccaggtggaccatgaacac 499 |||||||||||||||||| ||||||||||||||||| |||| |||||| Sbjct: 768 gatgccggtgccggtgatggggatggtggccaggtgaaccaagaacac 721 Score = 60.0 bits (30), Expect = 9e-06 Identities = 33/34 (97%) Strand = Plus / Minus Query: 558 cttggggtcggtggcggagaagacggtgtagacg 591 ||||| |||||||||||||||||||||||||||| Sbjct: 663 cttggcgtcggtggcggagaagacggtgtagacg 630
>dbj|AK065188.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013002E02, full insert sequence Length = 1167 Score = 135 bits (68), Expect = 2e-28 Identities = 116/132 (87%) Strand = Plus / Minus Query: 368 ggggccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggc 427 |||||| |||||||||||||| || ||||||||||| | | || |||||||||||| ||| Sbjct: 854 ggggccaacccagaagatccaatggtcatcccaggcatggcccctgttgtagatgatggc 795 Query: 428 ggcccccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtg 487 || || |||||||| || ||||||||||||||||||||||| ||||||||||||||||| Sbjct: 794 agcgccaaggctcctcgctgggttgatgccggtgccggtgatggggatggtggccaggtg 735 Query: 488 gaccatgaacac 499 |||| |||||| Sbjct: 734 aaccaagaacac 723 Score = 60.0 bits (30), Expect = 9e-06 Identities = 33/34 (97%) Strand = Plus / Minus Query: 558 cttggggtcggtggcggagaagacggtgtagacg 591 ||||| |||||||||||||||||||||||||||| Sbjct: 665 cttggcgtcggtggcggagaagacggtgtagacg 632
>dbj|AK058323.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-014-B07, full insert sequence Length = 1462 Score = 135 bits (68), Expect = 2e-28 Identities = 116/132 (87%) Strand = Plus / Minus Query: 368 ggggccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggc 427 |||||| |||||||||||||| || ||||||||||| | | || |||||||||||| ||| Sbjct: 1150 ggggccaacccagaagatccaatggtcatcccaggcatggcccctgttgtagatgatggc 1091 Query: 428 ggcccccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtg 487 || || |||||||| || ||||||||||||||||||||||| ||||||||||||||||| Sbjct: 1090 agcgccaaggctcctcgctgggttgatgccggtgccggtgatggggatggtggccaggtg 1031 Query: 488 gaccatgaacac 499 |||| |||||| Sbjct: 1030 aaccaagaacac 1019 Score = 60.0 bits (30), Expect = 9e-06 Identities = 33/34 (97%) Strand = Plus / Minus Query: 558 cttggggtcggtggcggagaagacggtgtagacg 591 ||||| |||||||||||||||||||||||||||| Sbjct: 961 cttggcgtcggtggcggagaagacggtgtagacg 928
>gb|AY107675.1| Zea mays PCO112712 mRNA sequence Length = 791 Score = 135 bits (68), Expect = 2e-28 Identities = 153/180 (85%), Gaps = 1/180 (0%) Strand = Plus / Minus Query: 412 tgttgtagatgacggcggcccccaggctcctggccgggttgatgccggtgccggtgatcg 471 ||||||||| || |||||| || ||||| | || ||||||||||||||||||||||| | Sbjct: 253 tgttgtagacgatggcggcgccgaggctgcgcgcggggttgatgccggtgccggtgatgg 194 Query: 472 ggatggtggccaggtggaccatgaacacggcgaagccgatcgggaggggcgccaacaccg 531 ||||||| |||||||| || | ||| ||||||||||| || ||||| ||||| | | | Sbjct: 193 ggatggtcgccaggtgcacgaggaagacggcgaagcctatggggagcggcgcgaggatgg 134 Query: 532 ggacgtgagagttcgcgtgcgctgcgcttggggtcggtggcggagaagacggtgtagacg 591 | ||||| ||| ||||| ||||||||||||| |||||||||||||||||||||||||||| Sbjct: 133 gcacgtgggag-tcgcgggcgctgcgcttggcgtcggtggcggagaagacggtgtagacg 75
>gb|AF326488.1|AF326488 Zea mays plasma membrane integral protein ZmPIP1-4 mRNA, complete cds Length = 1153 Score = 131 bits (66), Expect = 3e-27 Identities = 147/174 (84%) Strand = Plus / Minus Query: 332 ctggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactg 391 ||||||||||| ||| || | || |||||||| | ||||||||||||||||||||| || Sbjct: 940 ctggtggtagatggcagccagggcggcgccgatgaaggggccgacccagaagatccaatg 881 Query: 392 atcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggtt 451 || ||| || | ||| ||||||||||| |||||| || |||||||| |||||||| Sbjct: 880 gtcgctccacgcatgatcccggttgtagatgatggcggcgccaaggctcctagccgggtt 821 Query: 452 gatgccggtgccggtgatcgggatggtggccaggtggaccatgaacacggcgaa 505 |||||||||||||||||| ||||||||||| |||||||||| |||||| ||||| Sbjct: 820 gatgccggtgccggtgatggggatggtggcaaggtggaccaggaacaccgcgaa 767 Score = 44.1 bits (22), Expect = 0.51 Identities = 25/26 (96%) Strand = Plus / Minus Query: 565 tcggtggcggagaagacggtgtagac 590 |||||||| ||||||||||||||||| Sbjct: 708 tcggtggccgagaagacggtgtagac 683
>gb|AF326487.1|AF326487 Zea mays plasma membrane integral protein ZmPIP1-3 mRNA, complete cds Length = 1296 Score = 131 bits (66), Expect = 3e-27 Identities = 147/174 (84%) Strand = Plus / Minus Query: 332 ctggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactg 391 ||||||||||| ||| || | || |||||||| | ||||||||||||||||||||| || Sbjct: 935 ctggtggtagatggcagccagggcggcgccgatgaaggggccgacccagaagatccaatg 876 Query: 392 atcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggtt 451 || ||| || | ||| ||||||||||| |||||| || |||||||| |||||||| Sbjct: 875 gtcgctccacgcatgatcccggttgtagatgatggcggcgccaaggctcctagccgggtt 816 Query: 452 gatgccggtgccggtgatcgggatggtggccaggtggaccatgaacacggcgaa 505 |||||||||||||||||| ||||||||||| |||||||||| |||||| ||||| Sbjct: 815 gatgccggtgccggtgatggggatggtggcaaggtggaccaggaacaccgcgaa 762 Score = 44.1 bits (22), Expect = 0.51 Identities = 25/26 (96%) Strand = Plus / Minus Query: 565 tcggtggcggagaagacggtgtagac 590 |||||||| ||||||||||||||||| Sbjct: 703 tcggtggccgagaagacggtgtagac 678
>gb|AY103580.1| Zea mays PCO072544 mRNA sequence Length = 1633 Score = 131 bits (66), Expect = 3e-27 Identities = 147/174 (84%) Strand = Plus / Minus Query: 332 ctggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactg 391 ||||||||||| ||| || | || |||||||| | ||||||||||||||||||||| || Sbjct: 1264 ctggtggtagatggcagccagggcggcgccgatgaaggggccgacccagaagatccaatg 1205 Query: 392 atcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggtt 451 || ||| || | ||| ||||||||||| |||||| || |||||||| |||||||| Sbjct: 1204 gtcgctccacgcatgatcccggttgtagatgatggcggcgccaaggctcctagccgggtt 1145 Query: 452 gatgccggtgccggtgatcgggatggtggccaggtggaccatgaacacggcgaa 505 |||||||||||||||||| ||||||||||| |||||||||| |||||| ||||| Sbjct: 1144 gatgccggtgccggtgatggggatggtggcaaggtggaccaggaacaccgcgaa 1091 Score = 44.1 bits (22), Expect = 0.51 Identities = 25/26 (96%) Strand = Plus / Minus Query: 565 tcggtggcggagaagacggtgtagac 590 |||||||| ||||||||||||||||| Sbjct: 1032 tcggtggccgagaagacggtgtagac 1007
>gb|AY823263.1| Vitis vinifera aquaporin (PIP2-1) mRNA, complete cds Length = 1216 Score = 129 bits (65), Expect = 1e-26 Identities = 149/177 (84%) Strand = Plus / Minus Query: 326 tatgtactggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagat 385 |||| |||||||||||||||| || || || || || || | ||| || ||||| ||||| Sbjct: 873 tatgaactggtggtagaaggctgcaatggctgcaccaatgaagggtccaacccaaaagat 814 Query: 386 ccactgatcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggc 445 |||||| |||||||||||||| || ||||||||||| || || ||||||| |||||||| Sbjct: 813 ccactggtcatcccaggccttctcattgttgtagataacagcagcccccaaactcctggc 754 Query: 446 cgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatgaacacggc 502 |||||||| |||||||| ||||| || || ||||||| ||| |||||||||||||| Sbjct: 753 agggttgataccggtgccagtgataggaatagtggccaagtgaaccatgaacacggc 697 Score = 42.1 bits (21), Expect = 2.0 Identities = 30/33 (90%) Strand = Plus / Minus Query: 558 cttggggtcggtggcggagaagacggtgtagac 590 ||||||||| || || ||||||||||||||||| Sbjct: 642 cttggggtcagttgcagagaagacggtgtagac 610
>emb|AL731636.3|OSJN00281 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0093G06, complete sequence Length = 127420 Score = 127 bits (64), Expect = 4e-26 Identities = 103/116 (88%) Strand = Plus / Plus Query: 396 tcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttgatg 455 ||||| ||||| | || |||||||||||||||||| || | ||||| ||| ||||||||| Sbjct: 91210 tcccatgccttcttctggttgtagatgacggcggcgccgatgctccgggcagggttgatg 91269 Query: 456 ccggtgccggtgatcgggatggtggccaggtggaccatgaacacggcgaagccgat 511 || ||||||||||| ||||||||||||||||| ||||||||||||||||| ||||| Sbjct: 91270 cccgtgccggtgatggggatggtggccaggtgcaccatgaacacggcgaacccgat 91325 Score = 71.9 bits (36), Expect = 2e-09 Identities = 58/64 (90%), Gaps = 1/64 (1%) Strand = Plus / Plus Query: 528 accgggacgtgagagttcgcgtgcgctgcgcttggggtcggtggcggagaagacggtgta 587 ||||||||||| |||| |||| || ||||||| |||||||||||||||||||||||||| Sbjct: 91447 accgggacgtgggagt-cgcgggcattgcgctttgggtcggtggcggagaagacggtgta 91505 Query: 588 gacg 591 |||| Sbjct: 91506 gacg 91509 Score = 50.1 bits (25), Expect = 0.008 Identities = 49/57 (85%) Strand = Plus / Plus Query: 281 gttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggtg 337 |||||||| ||||||||| || ||||||||||| | |||| ||| ||||||||||| Sbjct: 91012 gttgctccggaaggagcccagcgccttgatggctgccgcccggaggatgtactggtg 91068
>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete sequence Length = 35498469 Score = 127 bits (64), Expect = 4e-26 Identities = 103/116 (88%) Strand = Plus / Plus Query: 396 tcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttgatg 455 ||||| ||||| | || |||||||||||||||||| || | ||||| ||| ||||||||| Sbjct: 8906901 tcccatgccttcttctggttgtagatgacggcggcgccgatgctccgggcagggttgatg 8906960 Query: 456 ccggtgccggtgatcgggatggtggccaggtggaccatgaacacggcgaagccgat 511 || ||||||||||| ||||||||||||||||| ||||||||||||||||| ||||| Sbjct: 8906961 cccgtgccggtgatggggatggtggccaggtgcaccatgaacacggcgaacccgat 8907016 Score = 113 bits (57), Expect = 7e-22 Identities = 99/113 (87%) Strand = Plus / Minus Query: 393 tcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttg 452 |||| ||| ||||||| || ||||||||| || || || |||| |||||| ||||||||| Sbjct: 26074238 tcatgccatgccttgtgctggttgtagatcaccgcagctcccaagctccttgccgggttg 26074179 Query: 453 atgccggtgccggtgatcgggatggtggccaggtggaccatgaacacggcgaa 505 ||||||||||||||||||||||| ||||||| ||| ||||||||||| ||||| Sbjct: 26074178 atgccggtgccggtgatcgggatcgtggccaagtgaaccatgaacaccgcgaa 26074126 Score = 109 bits (55), Expect = 1e-20 Identities = 94/107 (87%) Strand = Plus / Minus Query: 393 tcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttg 452 ||||||||||| | | || |||||||||||| ||| || || |||||||| || |||||| Sbjct: 28020793 tcatcccaggcatggcccctgttgtagatgatggcagcgccaaggctcctcgctgggttg 28020734 Query: 453 atgccggtgccggtgatcgggatggtggccaggtggaccatgaacac 499 ||||||||||||||||| ||||||||||||||||| |||| |||||| Sbjct: 28020733 atgccggtgccggtgatggggatggtggccaggtgaaccaagaacac 28020687 Score = 81.8 bits (41), Expect = 2e-12 Identities = 57/61 (93%), Gaps = 1/61 (1%) Strand = Plus / Minus Query: 531 gggacgtgagagttcgcgtgcgctgcgcttggggtcggtggcggagaagacggtgtagac 590 |||||||| |||| |||| ||| ||||||||||||||||||||||||||||||||||||| Sbjct: 26073390 gggacgtgggagt-cgcgggcgttgcgcttggggtcggtggcggagaagacggtgtagac 26073332 Query: 591 g 591 | Sbjct: 26073331 g 26073331 Score = 71.9 bits (36), Expect = 2e-09 Identities = 58/64 (90%), Gaps = 1/64 (1%) Strand = Plus / Plus Query: 528 accgggacgtgagagttcgcgtgcgctgcgcttggggtcggtggcggagaagacggtgta 587 ||||||||||| |||| |||| || ||||||| |||||||||||||||||||||||||| Sbjct: 8907138 accgggacgtgggagt-cgcgggcattgcgctttgggtcggtggcggagaagacggtgta 8907196 Query: 588 gacg 591 |||| Sbjct: 8907197 gacg 8907200 Score = 60.0 bits (30), Expect = 9e-06 Identities = 33/34 (97%) Strand = Plus / Minus Query: 558 cttggggtcggtggcggagaagacggtgtagacg 591 ||||| |||||||||||||||||||||||||||| Sbjct: 28020526 cttggcgtcggtggcggagaagacggtgtagacg 28020493 Score = 56.0 bits (28), Expect = 1e-04 Identities = 67/80 (83%) Strand = Plus / Minus Query: 311 ggcgccggccctgagtatgtactggtggtagaaggccgcgatcgccgcgccgatcatggg 370 ||||| |||||| || | ||||||||||||| ||| ||||| || |||||||| | ||| Sbjct: 26074829 ggcgctggccctcaggacgtactggtggtaggcggcggcgatggcggcgccgatgagggg 26074770 Query: 371 gccgacccagaagatccact 390 || |||||||||||||||| Sbjct: 26074769 ccccacccagaagatccact 26074750 Score = 50.1 bits (25), Expect = 0.008 Identities = 49/57 (85%) Strand = Plus / Plus Query: 281 gttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggtg 337 |||||||| ||||||||| || ||||||||||| | |||| ||| ||||||||||| Sbjct: 8906703 gttgctccggaaggagcccagcgccttgatggctgccgcccggaggatgtactggtg 8906759 Score = 40.1 bits (20), Expect = 8.0 Identities = 23/24 (95%) Strand = Plus / Minus Query: 368 ggggccgacccagaagatccactg 391 |||||| ||||||||||||||||| Sbjct: 28021379 ggggccaacccagaagatccactg 28021356
>gb|DQ339464.1| Vitis pseudoreticulata aquaporin protein (PIP2-1) mRNA, complete cds Length = 480 Score = 127 bits (64), Expect = 4e-26 Identities = 181/220 (82%) Strand = Plus / Minus Query: 283 tgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggtggtaga 342 |||||||||| || || || |||||||| || || || || | |||| |||||||||||| Sbjct: 466 tgctcctgaatgacccaagagccttgatagctccagctctcaatatgaactggtggtaga 407 Query: 343 aggccgcgatcgccgcgccgatcatggggccgacccagaagatccactgatcatcccagg 402 |||| || || || || || || | ||| || ||||| ||||||||||| |||||||||| Sbjct: 406 aggctgcaatggctgcaccaatgaagggtccaacccaaaagatccactggtcatcccagg 347 Query: 403 ccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttgatgccggtgc 462 |||| || ||||||||||| || || ||||||| |||||||| |||||||| ||||| | Sbjct: 346 ccttctcattgttgtagataacagcagcccccaaactcctggcagggttgataccggtac 287 Query: 463 cggtgatcgggatggtggccaggtggaccatgaacacggc 502 | ||||| || || ||||||| ||| |||||||||||||| Sbjct: 286 cagtgataggaatagtggccaagtgaaccatgaacacggc 247 Score = 42.1 bits (21), Expect = 2.0 Identities = 30/33 (90%) Strand = Plus / Minus Query: 558 cttggggtcggtggcggagaagacggtgtagac 590 ||||||||| || || ||||||||||||||||| Sbjct: 192 cttggggtcagttgcagagaagacggtgtagac 160
>gb|DQ358107.1| Vitis vinifera aquaporin PIP2 (pip2) mRNA, complete cds Length = 901 Score = 125 bits (63), Expect = 2e-25 Identities = 181/219 (82%), Gaps = 1/219 (0%) Strand = Plus / Minus Query: 372 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcc 431 ||||||||||| ||||| || ||||||||||||||||| ||||| |||||||| || || Sbjct: 771 ccgacccagaacatccaatggtcatcccaggccttgtcgttgttatagatgacagcagct 712 Query: 432 cccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggacc 491 || | ||| || ||||||||||| |||||||||||||| || || || |||||||| ||| Sbjct: 711 ccgaagcttctagccgggttgataccggtgccggtgatgggaattgttgccaggtgaacc 652 Query: 492 atgaacacggcgaagccgatcgggaggggcgccaacaccgggacgtgagagttcgcgtgc 551 |||||||| || || ||||| || || || ||||| || || || || ||| || || || Sbjct: 651 atgaacaccgcaaatccgatgggcagtggtgccaaaacaggaacatgggag-tctcgggc 593 Query: 552 gctgcgcttggggtcggtggcggagaagacggtgtagac 590 | | | ||||||||| ||||| ||||||||||||||||| Sbjct: 592 gttcctcttggggtcagtggcagagaagacggtgtagac 554
>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete sequence Length = 22696651 Score = 121 bits (61), Expect = 3e-24 Identities = 143/169 (84%), Gaps = 1/169 (0%) Strand = Plus / Minus Query: 423 acggcggcccccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggcc 482 |||||||| || |||||||| |||||||||||||| |||||||||||||| || || ||| Sbjct: 21009488 acggcggcgccgaggctcctcgccgggttgatgcccgtgccggtgatcggaatcgtcgcc 21009429 Query: 483 aggtggaccatgaacacggcgaagccgatcgggaggggcgccaacaccgggacgtgagag 542 ||||| || | |||||| ||||| |||||||| || ||| | | || |||| | ||| Sbjct: 21009428 aggtgcacgacgaacaccgcgaacccgatcggcagcggcacgagtacggggatgaaggag 21009369 Query: 543 ttcgcgtgcgctgcgcttggggtcggtggcggagaagacggtgtagacg 591 ||||| ||| |||||||||||||||||||||||||||||||||||||| Sbjct: 21009368 -tcgcgggcggtgcgcttggggtcggtggcggagaagacggtgtagacg 21009321
>dbj|AP006149.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC clone:B1274F11 Length = 171257 Score = 121 bits (61), Expect = 3e-24 Identities = 143/169 (84%), Gaps = 1/169 (0%) Strand = Plus / Minus Query: 423 acggcggcccccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggcc 482 |||||||| || |||||||| |||||||||||||| |||||||||||||| || || ||| Sbjct: 101577 acggcggcgccgaggctcctcgccgggttgatgcccgtgccggtgatcggaatcgtcgcc 101518 Query: 483 aggtggaccatgaacacggcgaagccgatcgggaggggcgccaacaccgggacgtgagag 542 ||||| || | |||||| ||||| |||||||| || ||| | | || |||| | ||| Sbjct: 101517 aggtgcacgacgaacaccgcgaacccgatcggcagcggcacgagtacggggatgaaggag 101458 Query: 543 ttcgcgtgcgctgcgcttggggtcggtggcggagaagacggtgtagacg 591 ||||| ||| |||||||||||||||||||||||||||||||||||||| Sbjct: 101457 -tcgcgggcggtgcgcttggggtcggtggcggagaagacggtgtagacg 101410
>dbj|AK109439.2| Oryza sativa (japonica cultivar-group) cDNA clone:006-310-H08, full insert sequence Length = 1247 Score = 121 bits (61), Expect = 3e-24 Identities = 143/169 (84%), Gaps = 1/169 (0%) Strand = Plus / Minus Query: 423 acggcggcccccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggcc 482 |||||||| || |||||||| |||||||||||||| |||||||||||||| || || ||| Sbjct: 750 acggcggcgccgaggctcctcgccgggttgatgcccgtgccggtgatcggaatcgtcgcc 691 Query: 483 aggtggaccatgaacacggcgaagccgatcgggaggggcgccaacaccgggacgtgagag 542 ||||| || | |||||| ||||| |||||||| || ||| | | || |||| | ||| Sbjct: 690 aggtgcacgacgaacaccgcgaacccgatcggcagcggcacgagtacggggatgaaggag 631 Query: 543 ttcgcgtgcgctgcgcttggggtcggtggcggagaagacggtgtagacg 591 ||||| ||| |||||||||||||||||||||||||||||||||||||| Sbjct: 630 -tcgcgggcggtgcgcttggggtcggtggcggagaagacggtgtagacg 583
>dbj|AK119719.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-157-G06, full insert sequence Length = 1066 Score = 121 bits (61), Expect = 3e-24 Identities = 143/169 (84%), Gaps = 1/169 (0%) Strand = Plus / Minus Query: 423 acggcggcccccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggcc 482 |||||||| || |||||||| |||||||||||||| |||||||||||||| || || ||| Sbjct: 648 acggcggcgccgaggctcctcgccgggttgatgcccgtgccggtgatcggaatcgtcgcc 589 Query: 483 aggtggaccatgaacacggcgaagccgatcgggaggggcgccaacaccgggacgtgagag 542 ||||| || | |||||| ||||| |||||||| || ||| | | || |||| | ||| Sbjct: 588 aggtgcacgacgaacaccgcgaacccgatcggcagcggcacgagtacggggatgaaggag 529 Query: 543 ttcgcgtgcgctgcgcttggggtcggtggcggagaagacggtgtagacg 591 ||||| ||| |||||||||||||||||||||||||||||||||||||| Sbjct: 528 -tcgcgggcggtgcgcttggggtcggtggcggagaagacggtgtagacg 481
>dbj|AK104786.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-039-D11, full insert sequence Length = 1249 Score = 121 bits (61), Expect = 3e-24 Identities = 143/169 (84%), Gaps = 1/169 (0%) Strand = Plus / Minus Query: 423 acggcggcccccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggcc 482 |||||||| || |||||||| |||||||||||||| |||||||||||||| || || ||| Sbjct: 748 acggcggcgccgaggctcctcgccgggttgatgcccgtgccggtgatcggaatcgtcgcc 689 Query: 483 aggtggaccatgaacacggcgaagccgatcgggaggggcgccaacaccgggacgtgagag 542 ||||| || | |||||| ||||| |||||||| || ||| | | || |||| | ||| Sbjct: 688 aggtgcacgacgaacaccgcgaacccgatcggcagcggcacgagtacggggatgaaggag 629 Query: 543 ttcgcgtgcgctgcgcttggggtcggtggcggagaagacggtgtagacg 591 ||||| ||| |||||||||||||||||||||||||||||||||||||| Sbjct: 628 -tcgcgggcggtgcgcttggggtcggtggcggagaagacggtgtagacg 581
>dbj|AK067792.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013118N06, full insert sequence Length = 1302 Score = 121 bits (61), Expect = 3e-24 Identities = 143/169 (84%), Gaps = 1/169 (0%) Strand = Plus / Minus Query: 423 acggcggcccccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggcc 482 |||||||| || |||||||| |||||||||||||| |||||||||||||| || || ||| Sbjct: 743 acggcggcgccgaggctcctcgccgggttgatgcccgtgccggtgatcggaatcgtcgcc 684 Query: 483 aggtggaccatgaacacggcgaagccgatcgggaggggcgccaacaccgggacgtgagag 542 ||||| || | |||||| ||||| |||||||| || ||| | | || |||| | ||| Sbjct: 683 aggtgcacgacgaacaccgcgaacccgatcggcagcggcacgagtacggggatgaaggag 624 Query: 543 ttcgcgtgcgctgcgcttggggtcggtggcggagaagacggtgtagacg 591 ||||| ||| |||||||||||||||||||||||||||||||||||||| Sbjct: 623 -tcgcgggcggtgcgcttggggtcggtggcggagaagacggtgtagacg 576
>dbj|AB109206.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC clone: P0478E02 Length = 140715 Score = 121 bits (61), Expect = 3e-24 Identities = 143/169 (84%), Gaps = 1/169 (0%) Strand = Plus / Minus Query: 423 acggcggcccccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggcc 482 |||||||| || |||||||| |||||||||||||| |||||||||||||| || || ||| Sbjct: 30788 acggcggcgccgaggctcctcgccgggttgatgcccgtgccggtgatcggaatcgtcgcc 30729 Query: 483 aggtggaccatgaacacggcgaagccgatcgggaggggcgccaacaccgggacgtgagag 542 ||||| || | |||||| ||||| |||||||| || ||| | | || |||| | ||| Sbjct: 30728 aggtgcacgacgaacaccgcgaacccgatcggcagcggcacgagtacggggatgaaggag 30669 Query: 543 ttcgcgtgcgctgcgcttggggtcggtggcggagaagacggtgtagacg 591 ||||| ||| |||||||||||||||||||||||||||||||||||||| Sbjct: 30668 -tcgcgggcggtgcgcttggggtcggtggcggagaagacggtgtagacg 30621
>dbj|AP004139.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ1486_E07 Length = 110494 Score = 117 bits (59), Expect = 4e-23 Identities = 95/107 (88%) Strand = Plus / Minus Query: 393 tcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttg 452 |||| |||||| | ||||||||||||||||| ||| || || ||||||||||| |||||| Sbjct: 36713 tcattccaggcatggtccttgttgtagatgatggcagcgccaaggctcctggctgggttg 36654 Query: 453 atgccggtgccggtgatcgggatggtggccaggtggaccatgaacac 499 ||||| || |||||||| |||||||||||||||||||||| |||||| Sbjct: 36653 atgccagtaccggtgatggggatggtggccaggtggaccaggaacac 36607
>dbj|AP005108.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P0461B08 Length = 153743 Score = 117 bits (59), Expect = 4e-23 Identities = 95/107 (88%) Strand = Plus / Minus Query: 393 tcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttg 452 |||| |||||| | ||||||||||||||||| ||| || || ||||||||||| |||||| Sbjct: 118266 tcattccaggcatggtccttgttgtagatgatggcagcgccaaggctcctggctgggttg 118207 Query: 453 atgccggtgccggtgatcgggatggtggccaggtggaccatgaacac 499 ||||| || |||||||| |||||||||||||||||||||| |||||| Sbjct: 118206 atgccagtaccggtgatggggatggtggccaggtggaccaggaacac 118160
>gb|DQ341104.1| Rhododendron catawbiense aquaporin PIP2-1 mRNA, complete cds Length = 1192 Score = 117 bits (59), Expect = 4e-23 Identities = 180/219 (82%), Gaps = 1/219 (0%) Strand = Plus / Minus Query: 372 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcc 431 |||||||| || ||||| ||||||||||||||||| ||||||||||| || || || Sbjct: 816 ccgacccaaaatatccattgatcatcccaggccttagaattgttgtagataaccgcagct 757 Query: 432 cccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggacc 491 || | ||| || || |||||||| |||||||| ||||| ||||||||||||||||| ||| Sbjct: 756 ccgaagcttctagcggggttgattccggtgcctgtgattgggatggtggccaggtgaacc 697 Query: 492 atgaacacggcgaagccgatcgggaggggcgccaacaccgggacgtgagagttcgcgtgc 551 ||||| |||||||| ||||| ||||| || ||||| || || || |||||| || | || Sbjct: 696 atgaatacggcgaatccgattgggagcggagccaaaacgggaacatgagag-tctctggc 638 Query: 552 gctgcgcttggggtcggtggcggagaagacggtgtagac 590 ||| | ||| || |||||||| |||||||| |||||||| Sbjct: 637 gctcctcttaggatcggtggctgagaagacagtgtagac 599
>gb|AY170841.1| Axonopus compressus plasma membrane MIP protein mRNA, partial cds Length = 423 Score = 115 bits (58), Expect = 2e-22 Identities = 145/174 (83%) Strand = Plus / Minus Query: 332 ctggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactg 391 ||||||||||| ||| || | || ||||| || | ||||||||||||||||||||| || Sbjct: 384 ctggtggtagatggcggctagggcagcgccaatgaaggggccgacccagaagatccaatg 325 Query: 392 atcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggtt 451 |||| |||||| | ||| |||||||||||| ||| || || |||||||| || ||||| Sbjct: 324 gtcattccaggcgtgctccctgttgtagatgatggcagcgccaaggctcctagctgggtt 265 Query: 452 gatgccggtgccggtgatcgggatggtggccaggtggaccatgaacacggcgaa 505 |||||| ||||| || || ||||||||||| |||||||||| |||||| ||||| Sbjct: 264 gatgccagtgccagtaatggggatggtggcaaggtggaccaagaacaccgcgaa 211
>ref|NM_116268.2| Arabidopsis thaliana TMP-C; water channel AT4G00430 (TMP-C) transcript variant AT4G00430.1 mRNA, complete cds Length = 1643 Score = 113 bits (57), Expect = 7e-22 Identities = 178/217 (82%), Gaps = 1/217 (0%) Strand = Plus / Minus Query: 375 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 434 |||||||| ||||| || |||||||| | | ||||||||||||||| | ||||| || Sbjct: 868 acccagaaaatccaatggtcatcccaagagtggtccttgttgtagataattgcggctcca 809 Query: 435 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 494 || || || || |||||||| ||||| ||||||||||| || || |||| ||| |||| | Sbjct: 808 agacttctagctgggttgattccggtcccggtgatcggtattgttgccaagtgtaccaag 749 Query: 495 aacacggcgaagccgatcgggaggggcgccaacaccgggacgtgagagttcgcgtgcgct 554 ||||| || || ||||| ||||| |||||||| | ||||||||| ||| || || ||||| Sbjct: 748 aacactgcaaatccgattgggagcggcgccaaaatcgggacgtgtgag-tcacgggcgct 690 Query: 555 gcgcttggggtcggtggcggagaagacggtgtagacg 591 | ||||| |||||||||||||||||| ||||||||| Sbjct: 689 tctcttggcgtcggtggcggagaagacagtgtagacg 653
>gb|BT000330.1| Arabidopsis thaliana probable plasma membrane intrinsic protein 1c (At4g00430) mRNA, complete cds Length = 1331 Score = 113 bits (57), Expect = 7e-22 Identities = 178/217 (82%), Gaps = 1/217 (0%) Strand = Plus / Minus Query: 375 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 434 |||||||| ||||| || |||||||| | | ||||||||||||||| | ||||| || Sbjct: 782 acccagaaaatccaatggtcatcccaagagtggtccttgttgtagataattgcggctcca 723 Query: 435 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 494 || || || || |||||||| ||||| ||||||||||| || || |||| ||| |||| | Sbjct: 722 agacttctagctgggttgattccggtcccggtgatcggtattgttgccaagtgtaccaag 663 Query: 495 aacacggcgaagccgatcgggaggggcgccaacaccgggacgtgagagttcgcgtgcgct 554 ||||| || || ||||| ||||| |||||||| | ||||||||| ||| || || ||||| Sbjct: 662 aacactgcaaatccgattgggagcggcgccaaaatcgggacgtgtgag-tcacgggcgct 604 Query: 555 gcgcttggggtcggtggcggagaagacggtgtagacg 591 | ||||| |||||||||||||||||| ||||||||| Sbjct: 603 tctcttggcgtcggtggcggagaagacagtgtagacg 567
>gb|AY120785.1| Arabidopsis thaliana probable plasma membrane intrinsic protein 1c (At4g00430) mRNA, complete cds Length = 1083 Score = 113 bits (57), Expect = 7e-22 Identities = 178/217 (82%), Gaps = 1/217 (0%) Strand = Plus / Minus Query: 375 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 434 |||||||| ||||| || |||||||| | | ||||||||||||||| | ||||| || Sbjct: 860 acccagaaaatccaatggtcatcccaagagtggtccttgttgtagataattgcggctcca 801 Query: 435 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 494 || || || || |||||||| ||||| ||||||||||| || || |||| ||| |||| | Sbjct: 800 agacttctagctgggttgattccggtcccggtgatcggtattgttgccaagtgtaccaag 741 Query: 495 aacacggcgaagccgatcgggaggggcgccaacaccgggacgtgagagttcgcgtgcgct 554 ||||| || || ||||| ||||| |||||||| | ||||||||| ||| || || ||||| Sbjct: 740 aacactgcaaatccgattgggagcggcgccaaaatcgggacgtgtgag-tcacgggcgct 682 Query: 555 gcgcttggggtcggtggcggagaagacggtgtagacg 591 | ||||| |||||||||||||||||| ||||||||| Sbjct: 681 tctcttggcgtcggtggcggagaagacagtgtagacg 645
>gb|AY099825.1| Arabidopsis thaliana probable plasma membrane intrinsic protein 1c (At4g00430) mRNA, complete cds Length = 1631 Score = 113 bits (57), Expect = 7e-22 Identities = 178/217 (82%), Gaps = 1/217 (0%) Strand = Plus / Minus Query: 375 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 434 |||||||| ||||| || |||||||| | | ||||||||||||||| | ||||| || Sbjct: 856 acccagaaaatccaatggtcatcccaagagtggtccttgttgtagataattgcggctcca 797 Query: 435 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 494 || || || || |||||||| ||||| ||||||||||| || || |||| ||| |||| | Sbjct: 796 agacttctagctgggttgattccggtcccggtgatcggtattgttgccaagtgtaccaag 737 Query: 495 aacacggcgaagccgatcgggaggggcgccaacaccgggacgtgagagttcgcgtgcgct 554 ||||| || || ||||| ||||| |||||||| | ||||||||| ||| || || ||||| Sbjct: 736 aacactgcaaatccgattgggagcggcgccaaaatcgggacgtgtgag-tcacgggcgct 678 Query: 555 gcgcttggggtcggtggcggagaagacggtgtagacg 591 | ||||| |||||||||||||||||| ||||||||| Sbjct: 677 tctcttggcgtcggtggcggagaagacagtgtagacg 641
>gb|AF141643.1|AF141643 Vitis berlandieri x Vitis rupestris putative aquaporin PIP1-1 (PIP1-1) mRNA, complete cds Length = 1115 Score = 113 bits (57), Expect = 7e-22 Identities = 117/137 (85%) Strand = Plus / Minus Query: 375 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 434 |||||||||||||| || || ||||| || | ||||||||||||||||| ||| || ||| Sbjct: 810 acccagaagatccagtggtcgtcccatgcgtggtccttgttgtagatgatggccgcaccc 751 Query: 435 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 494 ||||||| || |||||||||||||| ||||| || ||||||||||||| ||| |||| | Sbjct: 750 aggctccgagctgggttgatgccggttccggttatggggatggtggccaagtgcaccaag 691 Query: 495 aacacggcgaagccgat 511 ||||| ||||| ||||| Sbjct: 690 aacactgcgaacccgat 674
>gb|BT006313.1| Arabidopsis thaliana At4g00430 mRNA, complete cds Length = 864 Score = 113 bits (57), Expect = 7e-22 Identities = 178/217 (82%), Gaps = 1/217 (0%) Strand = Plus / Minus Query: 375 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 434 |||||||| ||||| || |||||||| | | ||||||||||||||| | ||||| || Sbjct: 782 acccagaaaatccaatggtcatcccaagagtggtccttgttgtagataattgcggctcca 723 Query: 435 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 494 || || || || |||||||| ||||| ||||||||||| || || |||| ||| |||| | Sbjct: 722 agacttctagctgggttgattccggtcccggtgatcggtattgttgccaagtgtaccaag 663 Query: 495 aacacggcgaagccgatcgggaggggcgccaacaccgggacgtgagagttcgcgtgcgct 554 ||||| || || ||||| ||||| |||||||| | ||||||||| ||| || || ||||| Sbjct: 662 aacactgcaaatccgattgggagcggcgccaaaatcgggacgtgtgag-tcacgggcgct 604 Query: 555 gcgcttggggtcggtggcggagaagacggtgtagacg 591 | ||||| |||||||||||||||||| ||||||||| Sbjct: 603 tctcttggcgtcggtggcggagaagacagtgtagacg 567
>gb|DQ269455.1| Stevia rebaudiana aquaporin mRNA, partial cds Length = 1070 Score = 113 bits (57), Expect = 7e-22 Identities = 141/169 (83%) Strand = Plus / Minus Query: 375 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 434 |||||||| ||||| ||||||||||| || ||||| ||||||||||| |||||||| || Sbjct: 746 acccagaaaatccattgatcatcccaagctttgtctttgttgtagattacggcggctccg 687 Query: 435 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 494 | ||| ||||| ||||| || ||||||||||||||||| |||||||| | ||| |||||| Sbjct: 686 aagcttctggcggggttaattccggtgccggtgatcggaatggtggctaagtgaaccatg 627 Query: 495 aacacggcgaagccgatcgggaggggcgccaacaccgggacgtgagagt 543 || ||||| || || || || || || |||||||| || || ||||||| Sbjct: 626 aagacggcaaaccctatgggtagtggtgccaacacgggaacatgagagt 578
>gb|AF133530.1|AF133530 Mesembryanthemum crystallinum water channel protein MipH (MipH) mRNA, complete cds Length = 1347 Score = 113 bits (57), Expect = 7e-22 Identities = 211/261 (80%), Gaps = 1/261 (0%) Strand = Plus / Minus Query: 327 atgtactggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatc 386 ||||| |||||||||| ||| ||||| || || || || | || ||||||||||| ||| Sbjct: 890 atgtattggtggtagatggcggcgatggcagccccaatgaacggtccgacccagaaaatc 831 Query: 387 cactgatcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggcc 446 |||||||||||||||||||||| ||||||||||| || || || || || || | || Sbjct: 830 cactgatcatcccaggccttgttgttgttgtagatcacagcagcaccaagactacgagca 771 Query: 447 gggttgatgccggtgccggtgatcgggatggtggccaggtggaccatgaacacggcgaag 506 |||||||| || |||||||| || ||||||||||||| ||| |||||||||||||| || Sbjct: 770 gggttgatacctgtgccggtaattgggatggtggccaagtgaaccatgaacacggcaaac 711 Query: 507 ccgatcgggaggggcgccaacaccgggacgtgagagttcgcgtgcgctgcgcttggggtc 566 || || || || || ||||| || || || |||||| || | || ||||| || ||||| Sbjct: 710 ccaattggaagaggtgccaatacgggcacatgagag-tccctagcactgcgttttgggtc 652 Query: 567 ggtggcggagaagacggtgta 587 ||||||||||| |||||||| Sbjct: 651 agtggcggagaaaacggtgta 631
>gb|AY903443.1| Astragalus membranaceus clone AM79 putative plasma membrane intrinsic protein mRNA, complete cds Length = 1120 Score = 113 bits (57), Expect = 7e-22 Identities = 108/125 (86%) Strand = Plus / Minus Query: 375 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 434 ||||||||||||||||| |||||||| ||||||||||||||||| || || || || || Sbjct: 746 acccagaagatccactggtcatcccatgccttgtccttgttgtaaattacagcagctccg 687 Query: 435 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 494 | |||||||| |||||||| ||||||||||| || ||||| ||||||| ||| |||||| Sbjct: 686 aaactcctggctgggttgataccggtgccggtaattgggatagtggccaagtgaaccatg 627 Query: 495 aacac 499 ||||| Sbjct: 626 aacac 622 Score = 48.1 bits (24), Expect = 0.033 Identities = 30/32 (93%) Strand = Plus / Minus Query: 282 ttgctcctgaaggagccgagggccttgatggc 313 |||||||||||||| ||||| ||||||||||| Sbjct: 839 ttgctcctgaaggatccgagagccttgatggc 808
>dbj|D26609.1|ATHTMP Arabidopsis thaliana mRNA for transmembrane protein, complete cds Length = 1100 Score = 113 bits (57), Expect = 7e-22 Identities = 178/217 (82%), Gaps = 1/217 (0%) Strand = Plus / Minus Query: 375 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 434 |||||||| ||||| || |||||||| | | ||||||||||||||| | ||||| || Sbjct: 915 acccagaaaatccaatggtcatcccaagagtggtccttgttgtagataattgcggctcca 856 Query: 435 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 494 || || || || |||||||| ||||| ||||||||||| || || |||| ||| |||| | Sbjct: 855 agacttctagctgggttgattccggtcccggtgatcggtattgttgccaagtgtaccaag 796 Query: 495 aacacggcgaagccgatcgggaggggcgccaacaccgggacgtgagagttcgcgtgcgct 554 ||||| || || ||||| ||||| |||||||| | ||||||||| ||| || || ||||| Sbjct: 795 aacactgcaaatccgattgggagcggcgccaaaatcgggacgtgtgag-tcacgggcgct 737 Query: 555 gcgcttggggtcggtggcggagaagacggtgtagacg 591 | ||||| |||||||||||||||||| ||||||||| Sbjct: 736 tctcttggcgtcggtggcggagaagacagtgtagacg 700
>emb|AL662958.3|OSJN00156 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0019D11, complete sequence Length = 163039 Score = 113 bits (57), Expect = 7e-22 Identities = 99/113 (87%) Strand = Plus / Minus Query: 393 tcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttg 452 |||| ||| ||||||| || ||||||||| || || || |||| |||||| ||||||||| Sbjct: 108565 tcatgccatgccttgtgctggttgtagatcaccgcagctcccaagctccttgccgggttg 108506 Query: 453 atgccggtgccggtgatcgggatggtggccaggtggaccatgaacacggcgaa 505 ||||||||||||||||||||||| ||||||| ||| ||||||||||| ||||| Sbjct: 108505 atgccggtgccggtgatcgggatcgtggccaagtgaaccatgaacaccgcgaa 108453 Score = 81.8 bits (41), Expect = 2e-12 Identities = 57/61 (93%), Gaps = 1/61 (1%) Strand = Plus / Minus Query: 531 gggacgtgagagttcgcgtgcgctgcgcttggggtcggtggcggagaagacggtgtagac 590 |||||||| |||| |||| ||| ||||||||||||||||||||||||||||||||||||| Sbjct: 107717 gggacgtgggagt-cgcgggcgttgcgcttggggtcggtggcggagaagacggtgtagac 107659 Query: 591 g 591 | Sbjct: 107658 g 107658 Score = 56.0 bits (28), Expect = 1e-04 Identities = 67/80 (83%) Strand = Plus / Minus Query: 311 ggcgccggccctgagtatgtactggtggtagaaggccgcgatcgccgcgccgatcatggg 370 ||||| |||||| || | ||||||||||||| ||| ||||| || |||||||| | ||| Sbjct: 109156 ggcgctggccctcaggacgtactggtggtaggcggcggcgatggcggcgccgatgagggg 109097 Query: 371 gccgacccagaagatccact 390 || |||||||||||||||| Sbjct: 109096 ccccacccagaagatccact 109077
>dbj|AB029325.1| Oryza sativa gene for water channel protein RWC3, promoter region and complete cds Length = 5325 Score = 113 bits (57), Expect = 7e-22 Identities = 141/167 (84%), Gaps = 4/167 (2%) Strand = Plus / Minus Query: 425 ggcggcccccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccag 484 |||||| || ||||| | ||| ||||||||||||||||||||||| ||||||||||| || Sbjct: 4551 ggcggcgccgaggctgcgggcggggttgatgccggtgccggtgatggggatggtggcgag 4492 Query: 485 gtggaccatgaacacggcgaagccgatcgggaggggcgccaacaccgggacgtgagagtt 544 |||||| | ||| |||||||| ||| ||||| ||||||| | |||||||| ||| | Sbjct: 4491 gtggacgaggaagacggcgaa---gatggggagcggcgccaggatggggacgtgggag-t 4436 Query: 545 cgcgtgcgctgcgcttggggtcggtggcggagaagacggtgtagacg 591 | | ||| ||||||||| |||||||||||||||||||||||||||| Sbjct: 4435 ccctggcgttgcgcttggcgtcggtggcggagaagacggtgtagacg 4389
>gb|AY333929.1| Pringlea antiscorbutica putative transmembrane protein mRNA, partial cds Length = 380 Score = 111 bits (56), Expect = 3e-21 Identities = 177/216 (81%), Gaps = 1/216 (0%) Strand = Plus / Minus Query: 372 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcc 431 ||||||||||| ||||| || || ||||| | | ||||||||||||||| | |||||| Sbjct: 219 ccgacccagaaaatccaatggtcgtcccaagagtggtccttgttgtagataatggcggct 160 Query: 432 cccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggacc 491 || ||||| || || |||||||| || || ||||| ||||| || || |||||||| ||| Sbjct: 159 ccaaggcttctagctgggttgattccagttccggttatcggaattgtcgccaggtgtacc 100 Query: 492 atgaacacggcgaagccgatcgggaggggcgccaacaccgggacgtgagagttcgcgtgc 551 | |||||| || || ||||| ||||| |||||||| | ||| ||||| ||| || || || Sbjct: 99 aagaacactgcaaacccgattgggagtggcgccaaaatcggaacgtgtgag-tcacgggc 41 Query: 552 gctgcgcttggggtcggtggcggagaagacggtgta 587 ||| | ||||| |||||||||||||||||||||||| Sbjct: 40 gcttctcttggcgtcggtggcggagaagacggtgta 5
>gb|AY714381.1| Aegiceras corniculatum aquaporin 2 mRNA, partial cds Length = 740 Score = 111 bits (56), Expect = 3e-21 Identities = 174/212 (82%), Gaps = 1/212 (0%) Strand = Plus / Minus Query: 376 cccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccca 435 ||||||| ||||||||||||||||| | ||| | ||||||||||| || ||||| |||| Sbjct: 481 cccagaaaatccactgatcatcccatgtcttttttttgttgtagatcacagcggctccca 422 Query: 436 ggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatga 495 ||| | ||||||||| ||||| || |||||||||||||| ||||||| ||||||||| | Sbjct: 421 agctacgggccgggttaatgccagttccggtgatcgggatcgtggccaagtggaccataa 362 Query: 496 acacggcgaagccgatcgggaggggcgccaacaccgggacgtgagagttcgcgtgcgctg 555 | ||||| || || || || || || ||||| ||||| || |||||| || || || || Sbjct: 361 aaacggcaaatcctattggaagtggtgccaaaaccggtacatgagag-tcacgggcactt 303 Query: 556 cgcttggggtcggtggcggagaagacggtgta 587 | ||||||||| || || |||||||||||||| Sbjct: 302 ctcttggggtcagtagcagagaagacggtgta 271
>gb|DQ149581.1| Xerophyta humilis PIP1 aquaporin mRNA, complete cds Length = 1262 Score = 111 bits (56), Expect = 3e-21 Identities = 150/180 (83%), Gaps = 1/180 (0%) Strand = Plus / Minus Query: 412 tgttgtagatgacggcggcccccaggctcctggccgggttgatgccggtgccggtgatcg 471 |||||||||||| ||| || ||||||||||| || ||||||||||||||||||||||||| Sbjct: 830 tgttgtagatgatggcagctcccaggctccttgcagggttgatgccggtgccggtgatcg 771 Query: 472 ggatggtggccaggtggaccatgaacacggcgaagccgatcgggaggggcgccaacaccg 531 |||| || |||| ||| |||| |||||| || || ||||| || | || ||||| | | Sbjct: 770 ggatcgtcgccaagtgcaccaagaacaccgcaaacccgatgggcaacggggccaagatag 711 Query: 532 ggacgtgagagttcgcgtgcgctgcgcttggggtcggtggcggagaagacggtgtagacg 591 | ||||| ||| || | ||||||||||| | ||||||||||||||||||||||||||| Sbjct: 710 gaacgtgggag-tccctggcgctgcgcttagcatcggtggcggagaagacggtgtagacg 652
>emb|AL606687.3|OSJN00087 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0084K11, complete sequence Length = 147806 Score = 109 bits (55), Expect = 1e-20 Identities = 94/107 (87%) Strand = Plus / Minus Query: 393 tcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttg 452 ||||||||||| | | || |||||||||||| ||| || || |||||||| || |||||| Sbjct: 28019 tcatcccaggcatggcccctgttgtagatgatggcagcgccaaggctcctcgctgggttg 27960 Query: 453 atgccggtgccggtgatcgggatggtggccaggtggaccatgaacac 499 ||||||||||||||||| ||||||||||||||||| |||| |||||| Sbjct: 27959 atgccggtgccggtgatggggatggtggccaggtgaaccaagaacac 27913 Score = 60.0 bits (30), Expect = 9e-06 Identities = 33/34 (97%) Strand = Plus / Minus Query: 558 cttggggtcggtggcggagaagacggtgtagacg 591 ||||| |||||||||||||||||||||||||||| Sbjct: 27752 cttggcgtcggtggcggagaagacggtgtagacg 27719 Score = 40.1 bits (20), Expect = 8.0 Identities = 23/24 (95%) Strand = Plus / Minus Query: 368 ggggccgacccagaagatccactg 391 |||||| ||||||||||||||||| Sbjct: 28605 ggggccaacccagaagatccactg 28582
>gb|BT018400.1| Zea mays clone EL01N0323H01.d mRNA sequence Length = 1154 Score = 107 bits (54), Expect = 4e-20 Identities = 144/174 (82%) Strand = Plus / Minus Query: 332 ctggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactg 391 ||||||||||| ||| || | || |||||||| | ||||||||||||||||||||| || Sbjct: 790 ctggtggtagatggcagccagggcggcgccgatgaaggggccgacccagaagatccaatg 731 Query: 392 atcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggtt 451 || ||| || | ||| ||||||||||| |||||| || |||||||| ||||| Sbjct: 730 gtcgctccacgcatgatcccggttgtagatgatggcggcgccaaggctcctaaaggggtt 671 Query: 452 gatgccggtgccggtgatcgggatggtggccaggtggaccatgaacacggcgaa 505 |||||||||||||||||| ||||||||||| |||||||||| |||||| ||||| Sbjct: 670 gatgccggtgccggtgatggggatggtggcaaggtggaccaggaacaccgcgaa 617 Score = 44.1 bits (22), Expect = 0.51 Identities = 25/26 (96%) Strand = Plus / Minus Query: 565 tcggtggcggagaagacggtgtagac 590 |||||||| ||||||||||||||||| Sbjct: 558 tcggtggccgagaagacggtgtagac 533
>gb|AC024594.9| Oryza sativa chromosome 10 BAC OSJNBa0093B11 genomic sequence, complete sequence Length = 178692 Score = 107 bits (54), Expect = 4e-20 Identities = 102/118 (86%) Strand = Plus / Plus Query: 413 gttgtagatgacggcggcccccaggctcctggccgggttgatgccggtgccggtgatcgg 472 |||||||| ||||||||| || | |||||| ||||| |||||||| |||||||||||||| Sbjct: 47653 gttgtagacgacggcggcgccgaagctcctcgccggattgatgcccgtgccggtgatcgg 47712 Query: 473 gatggtggccaggtggaccatgaacacggcgaagccgatcgggaggggcgccaacacc 530 ||||||||| ||||| |||| |||||| ||||| ||||| || | |||||||||||| Sbjct: 47713 gatggtggcgaggtgcaccacgaacaccgcgaaaccgatgggcaatggcgccaacacc 47770 Score = 71.9 bits (36), Expect = 2e-09 Identities = 42/44 (95%) Strand = Plus / Plus Query: 544 tcgcgtgcgctgcgcttggggtcggtggcggagaagacggtgta 587 ||||| ||||||||||||| |||||||||||||||||||||||| Sbjct: 47871 tcgcgcgcgctgcgcttggcgtcggtggcggagaagacggtgta 47914
>dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 10, complete sequence Length = 22685906 Score = 107 bits (54), Expect = 4e-20 Identities = 102/118 (86%) Strand = Plus / Minus Query: 413 gttgtagatgacggcggcccccaggctcctggccgggttgatgccggtgccggtgatcgg 472 |||||||| ||||||||| || | |||||| ||||| |||||||| |||||||||||||| Sbjct: 17626978 gttgtagacgacggcggcgccgaagctcctcgccggattgatgcccgtgccggtgatcgg 17626919 Query: 473 gatggtggccaggtggaccatgaacacggcgaagccgatcgggaggggcgccaacacc 530 ||||||||| ||||| |||| |||||| ||||| ||||| || | |||||||||||| Sbjct: 17626918 gatggtggcgaggtgcaccacgaacaccgcgaaaccgatgggcaatggcgccaacacc 17626861 Score = 71.9 bits (36), Expect = 2e-09 Identities = 42/44 (95%) Strand = Plus / Minus Query: 544 tcgcgtgcgctgcgcttggggtcggtggcggagaagacggtgta 587 ||||| ||||||||||||| |||||||||||||||||||||||| Sbjct: 17626760 tcgcgcgcgctgcgcttggcgtcggtggcggagaagacggtgta 17626717 Score = 40.1 bits (20), Expect = 8.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 340 agaaggccgcgatcgccgcg 359 |||||||||||||||||||| Sbjct: 13136748 agaaggccgcgatcgccgcg 13136767
>gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence Length = 22698374 Score = 107 bits (54), Expect = 4e-20 Identities = 102/118 (86%) Strand = Plus / Minus Query: 413 gttgtagatgacggcggcccccaggctcctggccgggttgatgccggtgccggtgatcgg 472 |||||||| ||||||||| || | |||||| ||||| |||||||| |||||||||||||| Sbjct: 17636018 gttgtagacgacggcggcgccgaagctcctcgccggattgatgcccgtgccggtgatcgg 17635959 Query: 473 gatggtggccaggtggaccatgaacacggcgaagccgatcgggaggggcgccaacacc 530 ||||||||| ||||| |||| |||||| ||||| ||||| || | |||||||||||| Sbjct: 17635958 gatggtggcgaggtgcaccacgaacaccgcgaaaccgatgggcaatggcgccaacacc 17635901 Score = 71.9 bits (36), Expect = 2e-09 Identities = 42/44 (95%) Strand = Plus / Minus Query: 544 tcgcgtgcgctgcgcttggggtcggtggcggagaagacggtgta 587 ||||| ||||||||||||| |||||||||||||||||||||||| Sbjct: 17635800 tcgcgcgcgctgcgcttggcgtcggtggcggagaagacggtgta 17635757 Score = 40.1 bits (20), Expect = 8.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 340 agaaggccgcgatcgccgcg 359 |||||||||||||||||||| Sbjct: 13144088 agaaggccgcgatcgccgcg 13144107
>gb|AF131201.1| Zea mays plasma membrane MIP protein (pip1-2) mRNA, complete cds Length = 1280 Score = 107 bits (54), Expect = 4e-20 Identities = 117/138 (84%) Strand = Plus / Minus Query: 368 ggggccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggc 427 ||||||||||||||||||||| || || | |||||| | ||| |||||||||||| ||| Sbjct: 855 ggggccgacccagaagatccaatggtcgttccaggcgtgatccctgttgtagatgatggc 796 Query: 428 ggcccccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtg 487 || || |||||||| || ||||||||||| ||||| || || ||||||||||| ||||| Sbjct: 795 agcgccaaggctcctagctgggttgatgccagtgccagtaatggggatggtggcaaggtg 736 Query: 488 gaccatgaacacggcgaa 505 ||||| |||||| ||||| Sbjct: 735 gaccaggaacaccgcgaa 718 Score = 44.1 bits (22), Expect = 0.51 Identities = 25/26 (96%) Strand = Plus / Minus Query: 565 tcggtggcggagaagacggtgtagac 590 |||||||| ||||||||||||||||| Sbjct: 659 tcggtggctgagaagacggtgtagac 634
>emb|AJ849327.1| Populus tremula x Populus tremuloides mRNA for putative plasma membrane intrinsic protein (pip2.4 gene) Length = 1135 Score = 105 bits (53), Expect = 2e-19 Identities = 107/125 (85%) Strand = Plus / Minus Query: 375 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 434 |||||||||||||| || | |||||||||||||| | ||||||||| || ||||| ||| Sbjct: 771 acccagaagatccagtggtggtcccaggccttgtcttggttgtagataacagcggctccc 712 Query: 435 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 494 || ||||| || ||||||||||| || || ||||| ||||||||||||| ||| |||||| Sbjct: 711 agactcctagcagggttgatgccagttccagtgatggggatggtggccaagtgaaccatg 652 Query: 495 aacac 499 ||||| Sbjct: 651 aacac 647
>emb|AJ849325.1| Populus tremula x Populus tremuloides mRNA for putative plasma membrane intrinsic protein (pip2.2 gene) Length = 978 Score = 105 bits (53), Expect = 2e-19 Identities = 140/169 (82%) Strand = Plus / Minus Query: 375 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 434 |||||||| ||||| |||||||||||||| || || |||||| ||||||| || || || Sbjct: 826 acccagaaaatccaatgatcatcccaggctttttcattgttgaagatgacagcagcgcca 767 Query: 435 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 494 | ||||||||| ||||||||||| || || || || ||||| ||||||| ||| |||||| Sbjct: 766 aagctcctggcagggttgatgccagttccagttatagggattgtggccaagtgtaccatg 707 Query: 495 aacacggcgaagccgatcgggaggggcgccaacaccgggacgtgagagt 543 ||||| ||||| ||||| || || || |||||||| |||| ||| |||| Sbjct: 706 aacacagcgaacccgattggaagaggagccaacacagggatgtgggagt 658
>emb|BX829233.1|CNS0A3FQ Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTSIL83ZB07 of Silique of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1000 Score = 105 bits (53), Expect = 2e-19 Identities = 177/217 (81%), Gaps = 1/217 (0%) Strand = Plus / Minus Query: 375 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 434 |||||||| ||||| || |||||||| | | ||||||||||||||| | ||||| || Sbjct: 843 acccagaaaatccaatggtcatcccaagagtggtccttgttgtagataattgcggctcca 784 Query: 435 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 494 || || || || |||||||| ||||| ||||||||||| || || |||| ||| |||| | Sbjct: 783 agacttctagctgggttgattccggtcccggtgatcggtattgttgccaagtgtaccaag 724 Query: 495 aacacggcgaagccgatcgggaggggcgccaacaccgggacgtgagagttcgcgtgcgct 554 ||||| || || ||||| ||||| |||||||| | ||||||||| ||| | || ||||| Sbjct: 723 aacactgcaaatccgattgggagcggcgccaaaatcgggacgtgtgag-taacgggcgct 665 Query: 555 gcgcttggggtcggtggcggagaagacggtgtagacg 591 | ||||| |||||||||||||||||| ||||||||| Sbjct: 664 tctcttggcgtcggtggcggagaagacagtgtagacg 628
>dbj|AB100870.1| Malus x domestica MdPIP1b mRNA for plasma membrane intrinsic protein, complete cds Length = 1223 Score = 105 bits (53), Expect = 2e-19 Identities = 177/217 (81%), Gaps = 1/217 (0%) Strand = Plus / Minus Query: 375 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 434 |||||||| ||||| || ||||||||||| | |||||||||||||| ||| || || Sbjct: 874 acccagaatatccagtggtcatcccaggcatgccgcttgttgtagatgatggcagcgccg 815 Query: 435 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 494 || |||||||| ||||||||||| || ||||||| ||||||||||||| ||| |||| | Sbjct: 814 agactcctggctgggttgatgccagttccggtgacggggatggtggccaagtgcaccaag 755 Query: 495 aacacggcgaagccgatcgggaggggcgccaacaccgggacgtgagagttcgcgtgcgct 554 ||||||||||| || || || | || ||||| | ||| ||||| ||| || | ||||| Sbjct: 754 aacacggcgaacccaattggcaacggagccaaaatcggaacgtgggag-tctctggcgct 696 Query: 555 gcgcttggggtcggtggcggagaagacggtgtagacg 591 ||||| | ||||||||||||||| |||||||||||| Sbjct: 695 acgcttagcgtcggtggcggagaaaacggtgtagacg 659
>gb|AF067185.1|AF067185 Samanea saman aquaporin 2 (Aqp2) mRNA, complete cds Length = 1201 Score = 105 bits (53), Expect = 2e-19 Identities = 107/125 (85%) Strand = Plus / Minus Query: 375 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 434 |||||||||||||| || ||||||||||| || | | |||| |||| || || || || Sbjct: 814 acccagaagatccaatggtcatcccaggctttctgttggttgaagataacagcagctccg 755 Query: 435 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 494 || ||||||||||||||||||||||||||||||| ||||||||||||| ||| |||||| Sbjct: 754 agactcctggccgggttgatgccggtgccggtgactgggatggtggccaagtgaaccatg 695 Query: 495 aacac 499 ||||| Sbjct: 694 aacac 690
>dbj|AB016623.1| Oryza sativa gene for RWC-3, complete cds Length = 1403 Score = 105 bits (53), Expect = 2e-19 Identities = 140/167 (83%), Gaps = 4/167 (2%) Strand = Plus / Minus Query: 425 ggcggcccccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccag 484 |||||| || ||||| | ||| ||||||||||||||||||||||| ||||||||||| || Sbjct: 864 ggcggcgccgaggctgcgggcggggttgatgccggtgccggtgatggggatggtggcgag 805 Query: 485 gtggaccatgaacacggcgaagccgatcgggaggggcgccaacaccgggacgtgagagtt 544 |||||| | ||| |||||||| || ||||| ||||||| | |||||||| ||| | Sbjct: 804 gtggacgaggaagacggcgaa---catggggagcggcgccaggatggggacgtgggag-t 749 Query: 545 cgcgtgcgctgcgcttggggtcggtggcggagaagacggtgtagacg 591 | | ||| ||||||||| |||||||||||||||||||||||||||| Sbjct: 748 ccctggcgttgcgcttggcgtcggtggcggagaagacggtgtagacg 702
>emb|AJ849328.1| Populus tremula x Populus tremuloides mRNA for putative plasma membrane intrinsic protein (pip2.5 gene) Length = 1094 Score = 103 bits (52), Expect = 6e-19 Identities = 179/220 (81%), Gaps = 1/220 (0%) Strand = Plus / Minus Query: 372 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcc 431 ||||||||||||||||| || |||||||| |||||||| | |||||| || || || || Sbjct: 809 ccgacccagaagatccaatggtcatcccatgccttgtcttcgttgtatatcacagcagct 750 Query: 432 cccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggacc 491 || | |||||| ||||||||||| || || |||||||| ||||| ||||||||||| ||| Sbjct: 749 ccaaagctcctagccgggttgataccagttccggtgattgggatagtggccaggtgaacc 690 Query: 492 atgaacacggcgaagccgatcgggaggggcgccaacaccgggacgtgagagttcgcgtgc 551 ||||| || || || ||||| || || || |||||||| || || || ||| || | ||| Sbjct: 689 atgaagacagcaaatccgatgggaagtggtgccaacacaggaacatgggag-tcccttgc 631 Query: 552 gctgcgcttggggtcggtggcggagaagacggtgtagacg 591 | | | ||| ||||| || ||||||||||| ||||||||| Sbjct: 630 gttcctctttgggtcagtagcggagaagacagtgtagacg 591
>dbj|AB030698.1| Raphanus sativus PAQ2c mRNA for Plasma membrane aquaporin 2c, complete cds Length = 1065 Score = 103 bits (52), Expect = 6e-19 Identities = 176/216 (81%), Gaps = 1/216 (0%) Strand = Plus / Minus Query: 375 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 434 |||||||| ||||| || |||||||| | |||| || ||||||||| || ||||| || Sbjct: 788 acccagaatatccagtggtcatcccacggcttggactcgttgtagataaccgcggctccg 729 Query: 435 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 494 | |||||||||||||| || ||||| ||||||||||| || ||||||| ||| |||||| Sbjct: 728 aaactcctggccgggttaataccggttccggtgatcggaatagtggccaagtgaaccatg 669 Query: 495 aacacggcgaagccgatcgggaggggcgccaacaccgggacgtgagagttcgcgtgcgct 554 ||||| || || || ||||| || ||||||||||| || ||||| ||| || ||||| | Sbjct: 668 aacaccgcaaatccaatcggaagtggcgccaacacgggaacgtgggag-tcacgtgcatt 610 Query: 555 gcgcttggggtcggtggcggagaagacggtgtagac 590 | |||||||| ||||||||||| || |||||||| Sbjct: 609 tcttttggggtctgtggcggagaacacagtgtagac 574
>gb|U73466.1|MCU73466 Mesembryanthemum crystallinum water channel protein MipC mRNA, complete cds Length = 1066 Score = 101 bits (51), Expect = 3e-18 Identities = 111/131 (84%) Strand = Plus / Minus Query: 375 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 434 |||||||| ||||| ||||||||||||||||| | | ||||||||| ||||| || || Sbjct: 838 acccagaaaatccaatgatcatcccaggccttctgttggttgtagatcacggcagctccg 779 Query: 435 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 494 | || || || ||||||||||| ||||||||||| ||||||||||||| ||| |||||| Sbjct: 778 aaacttctagctgggttgatgccagtgccggtgattgggatggtggccaagtgaaccatg 719 Query: 495 aacacggcgaa 505 ||||| ||||| Sbjct: 718 aacaccgcgaa 708
>gb|L36096.1|CIPMIPC Mesembryanthemum crystallinum mipC mRNA Length = 582 Score = 101 bits (51), Expect = 3e-18 Identities = 111/131 (84%) Strand = Plus / Minus Query: 375 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 434 |||||||| ||||| ||||||||||||||||| | | ||||||||| ||||| || || Sbjct: 354 acccagaaaatccaatgatcatcccaggccttctgttggttgtagatcacggcagctccg 295 Query: 435 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 494 | || || || ||||||||||| ||||||||||| ||||||||||||| ||| |||||| Sbjct: 294 aaacttctagctgggttgatgccagtgccggtgattgggatggtggccaagtgaaccatg 235 Query: 495 aacacggcgaa 505 ||||| ||||| Sbjct: 234 aacaccgcgaa 224
>dbj|AB058680.1| Pyrus communis Py-PIP2-2 mRNA for plasma membrane intrinsic protein 2-2, complete cds Length = 1051 Score = 101 bits (51), Expect = 3e-18 Identities = 205/255 (80%), Gaps = 1/255 (0%) Strand = Plus / Minus Query: 333 tggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactga 392 |||||||||||||| || || || || || || | ||| || |||||||| ||||| || Sbjct: 874 tggtggtagaaggctgcaattgctgctccaatgaagggtcctacccagaaaatccattgg 815 Query: 393 tcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttg 452 |||||||| |||||||| ||||||||||| || || || || || || || || |||||| Sbjct: 814 tcatcccaagccttgtctttgttgtagataacagcagctccaagacttctagcggggttg 755 Query: 453 atgccggtgccggtgatcgggatggtggccaggtggaccatgaacacggcgaagccgatc 512 ||||| ||||| ||||| ||||||||||||| |||||| |||||||| || || || || Sbjct: 754 atgccagtgccagtgattgggatggtggccaagtggacaatgaacacagcaaacccaatt 695 Query: 513 gggaggggcgccaacaccgggacgtgagagttcgcgtgcgctgcgcttggggtcggtggc 572 || || || ||||| ||||| || || |||| | | || || | ||||||||| ||||| Sbjct: 694 ggcagtggagccaaaaccggaacatgggagt-ctctagcactcctcttggggtcagtggc 636 Query: 573 ggagaagacggtgta 587 |||||||||||||| Sbjct: 635 agagaagacggtgta 621
>emb|X75882.1|ATPIP1C A.thaliana mRNA for plasma membrane intrinsic protein 1c Length = 986 Score = 99.6 bits (50), Expect = 1e-17 Identities = 177/218 (81%), Gaps = 1/218 (0%) Strand = Plus / Minus Query: 372 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcc 431 ||||||||||| ||||| || || ||||| || | ||||||||||||||||| || || Sbjct: 814 ccgacccagaatatccagtggtcgtcccaagcgtggtccttgttgtagatgattgcagct 755 Query: 432 cccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggacc 491 || || ||||| || |||||||| || || |||||||| |||||| | |||| ||| ||| Sbjct: 754 ccaagactcctagctgggttgattcctgttccggtgattgggatgctcgccaagtgaacc 695 Query: 492 atgaacacggcgaagccgatcgggaggggcgccaacaccgggacgtgagagttcgcgtgc 551 | |||||| ||||| ||||| ||||| || ||||| | ||| ||||| ||| || || || Sbjct: 694 aagaacaccgcgaatccgattgggagtggtgccaaaatcggaacgtgggag-tcacgagc 636 Query: 552 gctgcgcttggggtcggtggcggagaagacggtgtaga 589 ||| | ||||| ||| |||||||||||||| ||||||| Sbjct: 635 gcttctcttggcgtcagtggcggagaagaccgtgtaga 598
>emb|BX819407.1|CNS0A8TU Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB75ZE10 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1128 Score = 99.6 bits (50), Expect = 1e-17 Identities = 110/130 (84%) Strand = Plus / Minus Query: 372 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcc 431 ||||||||||||||||||||||||||||| ||||| | ||||||||||||||||| || Sbjct: 819 ccgacccagaagatccactgatcatcccaagccttttgattgttgtagatgacggcagct 760 Query: 432 cccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggacc 491 || | ||||| |||||||| || |||||||| ||||| || || ||||| | || ||| Sbjct: 759 ccaaaactcctagccgggtttattccggtgccagtgattggaattgtggctaaatgaacc 700 Query: 492 atgaacacgg 501 |||||||||| Sbjct: 699 atgaacacgg 690 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Minus Query: 562 gggtcggtggcggagaagacggtgtagacg 591 |||||||| ||||||||||||||||||||| Sbjct: 630 gggtcggtagcggagaagacggtgtagacg 601
>gb|U87981.1|SBU87981 Sorghum bicolor membrane intrinsic protein (Mip1) mRNA, partial cds Length = 539 Score = 99.6 bits (50), Expect = 1e-17 Identities = 116/138 (84%) Strand = Plus / Minus Query: 368 ggggccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggc 427 ||||||||||||||||||||| || || |||||| | ||| |||||||||||| ||| Sbjct: 280 ggggccgacccagaagatccaatggtcgctccaggcatgatccctgttgtagatgatggc 221 Query: 428 ggcccccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtg 487 || || |||||||| || ||||||||||| ||||| || || ||||||||||| ||||| Sbjct: 220 agcgccaaggctcctagctgggttgatgccagtgccagtaatggggatggtggcaaggtg 161 Query: 488 gaccatgaacacggcgaa 505 ||||| |||||| ||||| Sbjct: 160 gaccaggaacaccgcgaa 143
>gb|DQ202709.1| Olea europaea plasma membrane intrinsic protein (pip2) mRNA, complete cds Length = 1260 Score = 97.6 bits (49), Expect = 4e-17 Identities = 106/125 (84%) Strand = Plus / Minus Query: 375 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 434 ||||| || ||||| || |||||||||| |||||| | |||||||||||| || || || Sbjct: 843 acccaaaaaatccaatggtcatcccagggcttgtcttcgttgtagatgacagcagctcca 784 Query: 435 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 494 | |||||| || ||||||||||| || |||||||| ||||||||||| ||||| |||||| Sbjct: 783 aagctcctagcagggttgatgccagttccggtgatggggatggtggcaaggtgaaccatg 724 Query: 495 aacac 499 ||||| Sbjct: 723 aacac 719 Score = 40.1 bits (20), Expect = 8.0 Identities = 35/40 (87%) Strand = Plus / Minus Query: 303 gccttgatggcgccggccctgagtatgtactggtggtaga 342 ||||||||||| || ||||| || ||||| |||||||||| Sbjct: 915 gccttgatggctcctgcccttaggatgtattggtggtaga 876
>gb|AY714380.1| Aegiceras corniculatum aquaporin 1 mRNA, partial cds Length = 534 Score = 97.6 bits (49), Expect = 4e-17 Identities = 94/109 (86%) Strand = Plus / Minus Query: 375 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 434 |||||||| ||||| || ||||||||||| | |||||||||||||||| ||||| || Sbjct: 458 acccagaatatccaatgttcatcccaggcttgatccttgttgtagatgattgcggcacca 399 Query: 435 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggcca 483 ||||||||||| |||||||| ||||| || ||||| ||||||||||||| Sbjct: 398 aggctcctggcggggttgataccggtacctgtgattgggatggtggcca 350
>gb|AY671949.1| Aegiceras corniculatum aquaporin 1 (PIP1) mRNA, complete cds Length = 867 Score = 97.6 bits (49), Expect = 4e-17 Identities = 94/109 (86%) Strand = Plus / Minus Query: 375 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 434 |||||||| ||||| || ||||||||||| | |||||||||||||||| ||||| || Sbjct: 788 acccagaatatccaatgttcatcccaggcttgatccttgttgtagatgattgcggcacca 729 Query: 435 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggcca 483 ||||||||||| |||||||| ||||| || ||||| ||||||||||||| Sbjct: 728 aggctcctggcggggttgataccggtacctgtgattgggatggtggcca 680
>gb|AF188843.1|AF188843 Vitis vinifera cultivar Pinot Noir plasma membrane aquaporin (PIP1a) mRNA, complete cds Length = 1129 Score = 97.6 bits (49), Expect = 4e-17 Identities = 106/125 (84%) Strand = Plus / Minus Query: 375 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 434 |||||||| |||||| ||||||||||| | || |||||||||||| |||||||||| Sbjct: 833 acccagaaaatccacatgtcatcccaggcatgctctctgttgtagatgatggcggccccc 774 Query: 435 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 494 || ||||| || |||||||||||||| |||||||| |||||||| ||||| || |||| | Sbjct: 773 agactcctagcagggttgatgccggttccggtgatggggatggttgccagatgaaccaag 714 Query: 495 aacac 499 ||||| Sbjct: 713 aacac 709
>dbj|D85192.1| Arabidopsis thaliana mRNA for transmembrane protein, complete cds Length = 1024 Score = 97.6 bits (49), Expect = 4e-17 Identities = 176/217 (81%), Gaps = 1/217 (0%) Strand = Plus / Minus Query: 375 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 434 |||||||| ||||| || |||||||| | | ||||||||||||||| | ||||| || Sbjct: 819 acccagaaaatccaatggtcatcccaagagtggtccttgttgtagataattgcggctcca 760 Query: 435 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 494 || || || || |||||||| ||||| ||||||||||| || || |||| ||| |||| | Sbjct: 759 agacttctagctgggttgattccggtcccggtgatcggtattgttgccaagtgtaccaag 700 Query: 495 aacacggcgaagccgatcgggaggggcgccaacaccgggacgtgagagttcgcgtgcgct 554 ||||| || || ||||| ||||| |||||||| | ||||||||| |||| | || |||| Sbjct: 699 aacactgcaaatccgattgggagcggcgccaaaatcgggacgtgtgagt-cacggacgct 641 Query: 555 gcgcttggggtcggtggcggagaagacggtgtagacg 591 | |||| |||||||||||||||||| ||||||||| Sbjct: 640 tctcttgtcgtcggtggcggagaagacagtgtagacg 604
>gb|AF067184.1|AF067184 Samanea saman aquaporin 1 (Aqp1) mRNA, complete cds Length = 1298 Score = 97.6 bits (49), Expect = 4e-17 Identities = 122/145 (84%), Gaps = 1/145 (0%) Strand = Plus / Minus Query: 447 gggttgatgccggtgccggtgatcgggatggtggccaggtggaccatgaacacggcgaag 506 |||||||||||||| |||||||| ||||||||||||| ||| |||| ||||| ||||| Sbjct: 774 gggttgatgccggttccggtgatggggatggtggccaagtgaaccaaaaacacagcgaac 715 Query: 507 ccgatcgggaggggcgccaacaccgggacgtgagagttcgcgtgcgctgcgcttggggtc 566 || || || | |||||||| | |||||||| ||| || || ||||| ||||||| || Sbjct: 714 ccaataggcaacggcgccaaaatggggacgtgggag-tcacgagcgctacgcttggcatc 656 Query: 567 ggtggcggagaagacggtgtagacg 591 ||||||||||||||||||||||||| Sbjct: 655 ggtggcggagaagacggtgtagacg 631
>dbj|AB030697.1| Raphanus sativus PAQ2b mRNA for Plasma membrane aquaporin 2b, complete cds Length = 1087 Score = 97.6 bits (49), Expect = 4e-17 Identities = 139/169 (82%) Strand = Plus / Minus Query: 375 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 434 |||||||| ||||| || |||||||| | |||| || ||||||||| || ||||| || Sbjct: 789 acccagaaaatccagtggtcatcccacggcttggactcgttgtagataaccgcggctcca 730 Query: 435 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 494 | |||||||||||||| || ||||| |||||||| || || ||||||| ||| |||||| Sbjct: 729 aaactcctggccgggttaatcccggttccggtgattggaatagtggccaagtgaaccatg 670 Query: 495 aacacggcgaagccgatcgggaggggcgccaacaccgggacgtgagagt 543 |||||||| || || || || || ||||||||||| |||||||| |||| Sbjct: 669 aacacggcaaatccaattggaagtggcgccaacacggggacgtgggagt 621
>dbj|AB058679.1| Pyrus communis Py-PIP1-1 mRNA for plasma membrane intrinsic protein 1-1, complete cds Length = 1351 Score = 97.6 bits (49), Expect = 4e-17 Identities = 176/217 (81%), Gaps = 1/217 (0%) Strand = Plus / Minus Query: 375 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 434 |||||||| | ||| || ||||||||||| | | |||||||||||||| ||| || || Sbjct: 1015 acccagaaaacccagtggtcatcccaggcatgctgcttgttgtagatgatggcagcgcca 956 Query: 435 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 494 || |||||||| ||||||||||| || ||||||| ||||||||||||| ||| |||| | Sbjct: 955 agactcctggctgggttgatgccagttccggtgacggggatggtggccaagtgcaccaag 896 Query: 495 aacacggcgaagccgatcgggaggggcgccaacaccgggacgtgagagttcgcgtgcgct 554 ||||||||||| || || || | || ||||| | ||| || || ||| || | ||||| Sbjct: 895 aacacggcgaacccaattggcaacggagccaaaatcggaacatgcgag-tctctggcgct 837 Query: 555 gcgcttggggtcggtggcggagaagacggtgtagacg 591 ||||| | ||||||||||||||| |||||||||||| Sbjct: 836 acgcttagcgtcggtggcggagaaaacggtgtagacg 800
>dbj|AB058678.1| Pyrus communis Py-PIP2-1 mRNA for plasma membrane intrinsic protein 2-1, complete cds Length = 1311 Score = 97.6 bits (49), Expect = 4e-17 Identities = 245/309 (79%), Gaps = 1/309 (0%) Strand = Plus / Minus Query: 282 ttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggtggtag 341 ||||| ||||| || || || ||||||||||| || || || || ||||| ||||||||| Sbjct: 907 ttgcttctgaaagatcccagagccttgatggctcctgctctcagaatgtattggtggtag 848 Query: 342 aaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactgatcatcccag 401 ||||| || || || || || || | || || | |||||||||||| || |||||||| Sbjct: 847 aaggcagcaatggcagctccaatgaaaggtccaagccagaagatccattggtcatcccaa 788 Query: 402 gccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttgatgccggtg 461 || ||||||||||| |||||||| || || || | ||||| || ||||||||||| || Sbjct: 787 gctttgtccttgttatagatgacagcagctcctaaactcctagcagggttgatgccagtt 728 Query: 462 ccggtgatcgggatggtggccaggtggaccatgaacacggcgaagccgatcgggaggggc 521 || ||||| || || ||||||| ||| || |||||||| || || || || || || || Sbjct: 727 ccagtgatgggaatagtggccaagtgaacaatgaacacagcaaatccaatgggaagtggg 668 Query: 522 gccaacaccgggacgtgagagttcgcgtgcgctgcgcttggggtcggtggcggagaagac 581 ||||| || |||||||||||| || | || | | ||||||||| |||||||||||||| Sbjct: 667 gccaagacagggacgtgagag-tctctggcatttctcttggggtcagtggcggagaagac 609 Query: 582 ggtgtagac 590 ||||||||| Sbjct: 608 ggtgtagac 600
>ref|NM_115202.1| Arabidopsis thaliana PIP2A; water channel AT3G53420 (PIP2A) transcript variant AT3G53420.1 mRNA, complete cds Length = 1347 Score = 95.6 bits (48), Expect = 2e-16 Identities = 175/216 (81%), Gaps = 1/216 (0%) Strand = Plus / Minus Query: 375 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 434 ||||| || ||||| || |||||||| | |||| |||||||||||| ||||| || || Sbjct: 1017 acccaaaatatccagtggtcatcccatggcttgctcttgttgtagattacggcagctccg 958 Query: 435 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 494 | ||||| |||||||| || ||||| ||||| || || ||||| |||| || |||||| Sbjct: 957 aaactccttgccgggttaattccggttccggtaatgggaatggtagccaaatgtaccatg 898 Query: 495 aacacggcgaagccgatcgggaggggcgccaacaccgggacgtgagagttcgcgtgcgct 554 |||||||| || ||||| || || |||||||||||||| ||||| ||| || | || || Sbjct: 897 aacacggcaaatccgattggaagtggcgccaacaccggaacgtgggag-tctctggcact 839 Query: 555 gcgcttggggtcggtggcggagaagacggtgtagac 590 || |||||||| ||||| ||||||||||||||||| Sbjct: 838 acgtttggggtcagtggcagagaagacggtgtagac 803
>ref|NM_001035774.1| Arabidopsis thaliana PIP2A AT3G53420 (PIP2A) transcript variant AT3G53420.2 mRNA, complete cds Length = 1278 Score = 95.6 bits (48), Expect = 2e-16 Identities = 175/216 (81%), Gaps = 1/216 (0%) Strand = Plus / Minus Query: 375 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 434 ||||| || ||||| || |||||||| | |||| |||||||||||| ||||| || || Sbjct: 967 acccaaaatatccagtggtcatcccatggcttgctcttgttgtagattacggcagctccg 908 Query: 435 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 494 | ||||| |||||||| || ||||| ||||| || || ||||| |||| || |||||| Sbjct: 907 aaactccttgccgggttaattccggttccggtaatgggaatggtagccaaatgtaccatg 848 Query: 495 aacacggcgaagccgatcgggaggggcgccaacaccgggacgtgagagttcgcgtgcgct 554 |||||||| || ||||| || || |||||||||||||| ||||| ||| || | || || Sbjct: 847 aacacggcaaatccgattggaagtggcgccaacaccggaacgtgggag-tctctggcact 789 Query: 555 gcgcttggggtcggtggcggagaagacggtgtagac 590 || |||||||| ||||| ||||||||||||||||| Sbjct: 788 acgtttggggtcagtggcagagaagacggtgtagac 753
>gb|AY372191.1| Spinacia oleracea PIP1;2 (Pip1;2) mRNA, complete cds Length = 1248 Score = 95.6 bits (48), Expect = 2e-16 Identities = 148/180 (82%), Gaps = 1/180 (0%) Strand = Plus / Minus Query: 411 ttgttgtagatgacggcggcccccaggctcctggccgggttgatgccggtgccggtgatc 470 ||||||||||||| |||| || || ||||| || |||||||| ||||||||||| || Sbjct: 785 ttgttgtagatgatagcggtaccaagactcctagcagggttgataccggtgccggtaatg 726 Query: 471 gggatggtggccaggtggaccatgaacacggcgaagccgatcgggaggggcgccaacacc 530 ||||||||||||| ||| |||| |||||| ||||| ||||| |||||||| ||||| | Sbjct: 725 gggatggtggccaagtgaaccaagaacacagcgaacccgattgggaggggtgccaagata 666 Query: 531 gggacgtgagagttcgcgtgcgctgcgcttggggtcggtggcggagaagacggtgtagac 590 || || |||||| || | ||||| | ||||| ||| ||||| ||||||||||||||||| Sbjct: 665 ggaacatgagag-tccctagcgcttctcttggcgtcagtggcagagaagacggtgtagac 607
>gb|AF141898.1|AF141898 Vitis berlandieri x Vitis rupestris putative aquaporin PIP1-2 (PIP1-2) mRNA, complete cds Length = 1154 Score = 95.6 bits (48), Expect = 2e-16 Identities = 126/152 (82%) Strand = Plus / Minus Query: 375 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 434 |||||||| |||||| ||||||||||| | || |||||||||| || |||||||||| Sbjct: 841 acccagaaaatccacatgtcatcccaggcatgctctttgttgtagacgatggcggccccc 782 Query: 435 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 494 || ||||| || |||||||||||||| || ||||| |||||||| ||||| || |||| | Sbjct: 781 agactcctagcagggttgatgccggttccagtgatggggatggttgccagatgaaccaag 722 Query: 495 aacacggcgaagccgatcgggaggggcgccaa 526 ||||| || || || |||||||| || ||||| Sbjct: 721 aacactgcaaacccaatcgggagaggagccaa 690
>gb|AY072374.1| Arabidopsis thaliana plasma membrane intrinsic protein 2a (At3g53420) mRNA, complete cds Length = 1122 Score = 95.6 bits (48), Expect = 2e-16 Identities = 175/216 (81%), Gaps = 1/216 (0%) Strand = Plus / Minus Query: 375 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 434 ||||| || ||||| || |||||||| | |||| |||||||||||| ||||| || || Sbjct: 809 acccaaaatatccagtggtcatcccatggcttgctcttgttgtagattacggcagctccg 750 Query: 435 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 494 | ||||| |||||||| || ||||| ||||| || || ||||| |||| || |||||| Sbjct: 749 aaactccttgccgggttaattccggttccggtaatgggaatggtagccaaatgtaccatg 690 Query: 495 aacacggcgaagccgatcgggaggggcgccaacaccgggacgtgagagttcgcgtgcgct 554 |||||||| || ||||| || || |||||||||||||| ||||| ||| || | || || Sbjct: 689 aacacggcaaatccgattggaagtggcgccaacaccggaacgtgggag-tctctggcact 631 Query: 555 gcgcttggggtcggtggcggagaagacggtgtagac 590 || |||||||| ||||| ||||||||||||||||| Sbjct: 630 acgtttggggtcagtggcagagaagacggtgtagac 595
>gb|AF428426.1|AF428426 Arabidopsis thaliana AT3g53420/F4P12_120 mRNA, complete cds Length = 1112 Score = 95.6 bits (48), Expect = 2e-16 Identities = 175/216 (81%), Gaps = 1/216 (0%) Strand = Plus / Minus Query: 375 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 434 ||||| || ||||| || |||||||| | |||| |||||||||||| ||||| || || Sbjct: 817 acccaaaatatccagtggtcatcccatggcttgctcttgttgtagattacggcagctccg 758 Query: 435 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 494 | ||||| |||||||| || ||||| ||||| || || ||||| |||| || |||||| Sbjct: 757 aaactccttgccgggttaattccggttccggtaatgggaatggtagccaaatgtaccatg 698 Query: 495 aacacggcgaagccgatcgggaggggcgccaacaccgggacgtgagagttcgcgtgcgct 554 |||||||| || ||||| || || |||||||||||||| ||||| ||| || | || || Sbjct: 697 aacacggcaaatccgattggaagtggcgccaacaccggaacgtgggag-tctctggcact 639 Query: 555 gcgcttggggtcggtggcggagaagacggtgtagac 590 || |||||||| ||||| ||||||||||||||||| Sbjct: 638 acgtttggggtcagtggcagagaagacggtgtagac 603
>gb|AY056085.1| Arabidopsis thaliana AT3g53420/F4P12_120 mRNA, complete cds Length = 864 Score = 95.6 bits (48), Expect = 2e-16 Identities = 175/216 (81%), Gaps = 1/216 (0%) Strand = Plus / Minus Query: 375 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 434 ||||| || ||||| || |||||||| | |||| |||||||||||| ||||| || || Sbjct: 758 acccaaaatatccagtggtcatcccatggcttgctcttgttgtagattacggcagctccg 699 Query: 435 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 494 | ||||| |||||||| || ||||| ||||| || || ||||| |||| || |||||| Sbjct: 698 aaactccttgccgggttaattccggttccggtaatgggaatggtagccaaatgtaccatg 639 Query: 495 aacacggcgaagccgatcgggaggggcgccaacaccgggacgtgagagttcgcgtgcgct 554 |||||||| || ||||| || || |||||||||||||| ||||| ||| || | || || Sbjct: 638 aacacggcaaatccgattggaagtggcgccaacaccggaacgtgggag-tctctggcact 580 Query: 555 gcgcttggggtcggtggcggagaagacggtgtagac 590 || |||||||| ||||| ||||||||||||||||| Sbjct: 579 acgtttggggtcagtggcagagaagacggtgtagac 544
>gb|AY671950.1| Aegiceras corniculatum aquaporin 2 (PIP2) mRNA, complete cds Length = 855 Score = 95.6 bits (48), Expect = 2e-16 Identities = 172/212 (81%), Gaps = 1/212 (0%) Strand = Plus / Minus Query: 376 cccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccca 435 ||||||| ||||||||||||||||| | ||| | ||| |||||| || ||||| |||| Sbjct: 754 cccagaaaatccactgatcatcccatgtcttttttttgccgtagatcacagcggctccca 695 Query: 436 ggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatga 495 ||| | ||||||||| ||||| || |||||||||||||| ||||||| ||||||||| | Sbjct: 694 agctacgggccgggttaatgccagttccggtgatcgggatcgtggccaagtggaccataa 635 Query: 496 acacggcgaagccgatcgggaggggcgccaacaccgggacgtgagagttcgcgtgcgctg 555 | ||||| || || || || || || ||||| ||||| || |||||| || || || || Sbjct: 634 aaacggcaaatcctattggaagtggtgccaaaaccggtacatgagag-tcacgggcactt 576 Query: 556 cgcttggggtcggtggcggagaagacggtgta 587 | ||||||||| || || |||||||||||||| Sbjct: 575 ctcttggggtcagtagcagagaagacggtgta 544
>gb|AY044327.1| Arabidopsis thaliana plasma membrane intrinsic protein 2a (F4P12.12) mRNA, complete cds Length = 956 Score = 95.6 bits (48), Expect = 2e-16 Identities = 175/216 (81%), Gaps = 1/216 (0%) Strand = Plus / Minus Query: 375 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 434 ||||| || ||||| || |||||||| | |||| |||||||||||| ||||| || || Sbjct: 758 acccaaaatatccagtggtcatcccatggcttgctcttgttgtagattacggcagctccg 699 Query: 435 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 494 | ||||| |||||||| || ||||| ||||| || || ||||| |||| || |||||| Sbjct: 698 aaactccttgccgggttaattccggttccggtaatgggaatggtagccaaatgtaccatg 639 Query: 495 aacacggcgaagccgatcgggaggggcgccaacaccgggacgtgagagttcgcgtgcgct 554 |||||||| || ||||| || || |||||||||||||| ||||| ||| || | || || Sbjct: 638 aacacggcaaatccgattggaagtggcgccaacaccggaacgtgggag-tctctggcact 580 Query: 555 gcgcttggggtcggtggcggagaagacggtgtagac 590 || |||||||| ||||| ||||||||||||||||| Sbjct: 579 acgtttggggtcagtggcagagaagacggtgtagac 544
>gb|AY039579.1| Arabidopsis thaliana AT3g53420/F4P12_120 mRNA, complete cds Length = 1129 Score = 95.6 bits (48), Expect = 2e-16 Identities = 175/216 (81%), Gaps = 1/216 (0%) Strand = Plus / Minus Query: 375 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 434 ||||| || ||||| || |||||||| | |||| |||||||||||| ||||| || || Sbjct: 817 acccaaaatatccagtggtcatcccatggcttgctcttgttgtagattacggcagctccg 758 Query: 435 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 494 | ||||| |||||||| || ||||| ||||| || || ||||| |||| || |||||| Sbjct: 757 aaactccttgccgggttaattccggttccggtaatgggaatggtagccaaatgtaccatg 698 Query: 495 aacacggcgaagccgatcgggaggggcgccaacaccgggacgtgagagttcgcgtgcgct 554 |||||||| || ||||| || || |||||||||||||| ||||| ||| || | || || Sbjct: 697 aacacggcaaatccgattggaagtggcgccaacaccggaacgtgggag-tctctggcact 639 Query: 555 gcgcttggggtcggtggcggagaagacggtgtagac 590 || |||||||| ||||| ||||||||||||||||| Sbjct: 638 acgtttggggtcagtggcagagaagacggtgtagac 603
>emb|BX823952.1|CNS0A4TL Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH10ZA03 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1071 Score = 95.6 bits (48), Expect = 2e-16 Identities = 175/216 (81%), Gaps = 1/216 (0%) Strand = Plus / Minus Query: 375 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 434 ||||| || ||||| || |||||||| | |||| |||||||||||| ||||| || || Sbjct: 805 acccaaaatatccagtggtcatcccatggcttgctcttgttgtagattacggcagctccg 746 Query: 435 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 494 | ||||| |||||||| || ||||| ||||| || || ||||| |||| || |||||| Sbjct: 745 aaactccttgccgggttaattccggttccggtaatgggaatggtagccaaatgtaccatg 686 Query: 495 aacacggcgaagccgatcgggaggggcgccaacaccgggacgtgagagttcgcgtgcgct 554 |||||||| || ||||| || || |||||||||||||| ||||| ||| || | || || Sbjct: 685 aacacggcaaatccgattggaagtggcgccaacaccggaacgtgggag-tctctggcact 627 Query: 555 gcgcttggggtcggtggcggagaagacggtgtagac 590 || |||||||| ||||| ||||||||||||||||| Sbjct: 626 acgtttggggtcagtggcagagaagacggtgtagac 591
>dbj|AB206102.1| Mimosa pudica pip2;4 mRNA for plasma membrane intrinsic protein 2;4, complete cds Length = 1263 Score = 95.6 bits (48), Expect = 2e-16 Identities = 148/180 (82%), Gaps = 1/180 (0%) Strand = Plus / Minus Query: 411 ttgttgtagatgacggcggcccccaggctcctggccgggttgatgccggtgccggtgatc 470 |||||||| ||||| || ||||| | |||||||||||||||||| || ||||| ||||| Sbjct: 759 ttgttgtacatgactgcagccccaaagctcctggccgggttgataccagtgccagtgatg 700 Query: 471 gggatggtggccaggtggaccatgaacacggcgaagccgatcgggaggggcgccaacacc 530 || ||||||| ||||| |||||||| ||||| || || || || || || ||||| || Sbjct: 699 ggaatggtggttaggtgaaccatgaaaacggcaaatccaataggaagaggagccaatacg 640 Query: 531 gggacgtgagagttcgcgtgcgctgcgcttggggtcggtggcggagaagacggtgtagac 590 |||||||||||| || || || | || |||||||| ||||||||||| ||||||||||| Sbjct: 639 gggacgtgagag-tctcgggcatttcgtttggggtcagtggcggagaaaacggtgtagac 581
>gb|AF366565.1| Triticum aestivum aquaporin PIP2 (Pip2) mRNA, complete cds Length = 1071 Score = 93.7 bits (47), Expect = 6e-16 Identities = 177/219 (80%), Gaps = 1/219 (0%) Strand = Plus / Minus Query: 369 gggccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcg 428 ||||| ||||||||||||||||| || ||||| |||||| | ||||| | |||||| Sbjct: 777 gggccaacccagaagatccactggtcgtcccaagccttgccgccattgtacaccacggcg 718 Query: 429 gcccccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtgg 488 || || | |||||| || || ||||| ||||| ||||||| ||||| ||||| ||||| Sbjct: 717 gcgccaaagctccttgctggattgatcccggttccggtgacggggatagtggcgaggtgc 658 Query: 489 accatgaacacggcgaagccgatcgggaggggcgccaacaccgggacgtgagagttcgcg 548 |||||| ||||||||| ||||| | || ||||||| |||||||||||| | | || || Sbjct: 657 gccatgagcacggcgaacccgatgagcagcggcgccagcaccgggacgtgtg-gatcccg 599 Query: 549 tgcgctgcgcttggggtcggtggcggagaagacggtgta 587 ||| ||||||| |||||||| || |||||||||||||| Sbjct: 598 ggcgatgcgcttcgggtcggtcgctgagaagacggtgta 560
>dbj|AB002149.1| Nicotiana excelsior mRNA for water channel protein, complete cds Length = 1064 Score = 93.7 bits (47), Expect = 6e-16 Identities = 110/131 (83%) Strand = Plus / Minus Query: 375 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 434 |||||||||||||| ||||||||||| |||| ||| | |||| |||||| || || || Sbjct: 815 acccagaagatccagtgatcatcccatgcctggtcgtggttgaagatgatagcagctcca 756 Query: 435 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 494 ||||||| ||| |||||||||||||| || ||||| ||||||||||||| || |||| | Sbjct: 755 aggctccgggcggggttgatgccggttccagtgatagggatggtggccaaatgaaccaag 696 Query: 495 aacacggcgaa 505 ||||| ||||| Sbjct: 695 aacaccgcgaa 685
>ref|NM_129458.2| Arabidopsis thaliana PIP2;6/PIP2E; water channel AT2G39010 (PIP2;6/PIP2E) mRNA, complete cds Length = 1245 Score = 91.7 bits (46), Expect = 2e-15 Identities = 109/130 (83%) Strand = Plus / Minus Query: 372 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcc 431 ||||||||||||||||||||||||||||| ||||| | ||||||||||||||||| || Sbjct: 845 ccgacccagaagatccactgatcatcccaagccttttgattgttgtagatgacggcagct 786 Query: 432 cccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggacc 491 || | ||||| |||||||| || |||||||| || || || || ||||| | || ||| Sbjct: 785 ccaaaactcctagccgggtttattccggtgccagtaattggaattgtggctaaatgaacc 726 Query: 492 atgaacacgg 501 |||||||||| Sbjct: 725 atgaacacgg 716 Score = 56.0 bits (28), Expect = 1e-04 Identities = 34/36 (94%) Strand = Plus / Minus Query: 556 cgcttggggtcggtggcggagaagacggtgtagacg 591 ||||| |||||||| ||||||||||||||||||||| Sbjct: 662 cgcttagggtcggtagcggagaagacggtgtagacg 627
>gb|DQ235182.1| Solanum tuberosum clone 163E01 major intrinsic protein 2-like mRNA, complete cds Length = 1277 Score = 91.7 bits (46), Expect = 2e-15 Identities = 112/134 (83%) Strand = Plus / Minus Query: 372 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcc 431 ||||||||||| ||||| || |||||||| |||||||| |||| | || ||||| ||| Sbjct: 828 ccgacccagaaaatccagtgttcatcccacgccttgtcgccgttgaaaatcacggccgcc 769 Query: 432 cccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggacc 491 || | ||||| ||||||||||| ||||| ||||||||||| || ||||| ||||| ||| Sbjct: 768 ccgaaactcctcgccgggttgattccggtaccggtgatcggaatagtggcaaggtgaacc 709 Query: 492 atgaacacggcgaa 505 ||||| |||||||| Sbjct: 708 atgaatacggcgaa 695
>gb|DQ226558.1| Boechera divaricarpa isolate SLW-1-E08 mRNA sequence Length = 591 Score = 91.7 bits (46), Expect = 2e-15 Identities = 89/102 (87%), Gaps = 1/102 (0%) Strand = Plus / Plus Query: 489 accatgaacacggcgaagccgatcgggaggggcgccaacaccgggacgtgagagttcgcg 548 ||||||||||||||||| |||||||| || |||||||||||||||||||| ||| || | Sbjct: 1 accatgaacacggcgaatccgatcggaagtggcgccaacaccgggacgtgggag-tctct 59 Query: 549 tgcgctgcgcttggggtcggtggcggagaagacggtgtagac 590 || || || |||||||| ||||| ||||||||||||||||| Sbjct: 60 ggcactacgtttggggtcagtggcagagaagacggtgtagac 101
>gb|AY057559.1| Arabidopsis thaliana At2g39010/T7F6.18 mRNA, complete cds Length = 1201 Score = 91.7 bits (46), Expect = 2e-15 Identities = 109/130 (83%) Strand = Plus / Minus Query: 372 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcc 431 ||||||||||||||||||||||||||||| ||||| | ||||||||||||||||| || Sbjct: 840 ccgacccagaagatccactgatcatcccaagccttttgattgttgtagatgacggcagct 781 Query: 432 cccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggacc 491 || | ||||| |||||||| || |||||||| || || || || ||||| | || ||| Sbjct: 780 ccaaaactcctagccgggtttattccggtgccagtaattggaattgtggctaaatgaacc 721 Query: 492 atgaacacgg 501 |||||||||| Sbjct: 720 atgaacacgg 711 Score = 56.0 bits (28), Expect = 1e-04 Identities = 34/36 (94%) Strand = Plus / Minus Query: 556 cgcttggggtcggtggcggagaagacggtgtagacg 591 ||||| |||||||| ||||||||||||||||||||| Sbjct: 657 cgcttagggtcggtagcggagaagacggtgtagacg 622
>gb|AY054142.1| Arabidopsis thaliana At2g39010/T7F6.18 mRNA, complete cds Length = 870 Score = 91.7 bits (46), Expect = 2e-15 Identities = 109/130 (83%) Strand = Plus / Minus Query: 372 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcc 431 ||||||||||||||||||||||||||||| ||||| | ||||||||||||||||| || Sbjct: 758 ccgacccagaagatccactgatcatcccaagccttttgattgttgtagatgacggcagct 699 Query: 432 cccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggacc 491 || | ||||| |||||||| || |||||||| || || || || ||||| | || ||| Sbjct: 698 ccaaaactcctagccgggtttattccggtgccagtaattggaattgtggctaaatgaacc 639 Query: 492 atgaacacgg 501 |||||||||| Sbjct: 638 atgaacacgg 629 Score = 56.0 bits (28), Expect = 1e-04 Identities = 34/36 (94%) Strand = Plus / Minus Query: 556 cgcttggggtcggtggcggagaagacggtgtagacg 591 ||||| |||||||| ||||||||||||||||||||| Sbjct: 575 cgcttagggtcggtagcggagaagacggtgtagacg 540
>gb|AY045690.1| Arabidopsis thaliana At2g39010/T7F6.18 mRNA, complete cds Length = 1169 Score = 91.7 bits (46), Expect = 2e-15 Identities = 109/130 (83%) Strand = Plus / Minus Query: 372 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcc 431 ||||||||||||||||||||||||||||| ||||| | ||||||||||||||||| || Sbjct: 842 ccgacccagaagatccactgatcatcccaagccttttgattgttgtagatgacggcagct 783 Query: 432 cccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggacc 491 || | ||||| |||||||| || |||||||| || || || || ||||| | || ||| Sbjct: 782 ccaaaactcctagccgggtttattccggtgccagtaattggaattgtggctaaatgaacc 723 Query: 492 atgaacacgg 501 |||||||||| Sbjct: 722 atgaacacgg 713 Score = 56.0 bits (28), Expect = 1e-04 Identities = 34/36 (94%) Strand = Plus / Minus Query: 556 cgcttggggtcggtggcggagaagacggtgtagacg 591 ||||| |||||||| ||||||||||||||||||||| Sbjct: 659 cgcttagggtcggtagcggagaagacggtgtagacg 624
>emb|BX818826.1|CNS0A9YK Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB17ZB02 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1041 Score = 91.7 bits (46), Expect = 2e-15 Identities = 139/170 (81%) Strand = Plus / Minus Query: 375 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 434 |||||||| ||||| || |||||||| | |||| |||||| ||||| ||||| || || Sbjct: 800 acccagaatatccagtggtcatcccatggcttgctcttgttatagattacggcagctccg 741 Query: 435 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 494 | ||||| ||||||||||||||||| ||||||||||| || ||||||| || ||||| Sbjct: 740 aaactcctagccgggttgatgccggttccggtgatcggaatagtggccaaatgtaccata 681 Query: 495 aacacggcgaagccgatcgggaggggcgccaacaccgggacgtgagagtt 544 ||||| || || || ||||| || |||||||| ||||| ||||| ||||| Sbjct: 680 aacaccgcaaacccaatcggaagtggcgccaaaaccggaacgtgggagtt 631
>emb|BX820104.1|CNS0A8J8 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS74ZC11 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1160 Score = 91.7 bits (46), Expect = 2e-15 Identities = 109/130 (83%) Strand = Plus / Minus Query: 372 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcc 431 ||||||||||||||||||||||||||||| ||||| | ||||||||||||||||| || Sbjct: 829 ccgacccagaagatccactgatcatcccaagccttttgattgttgtagatgacggcagct 770 Query: 432 cccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggacc 491 || | ||||| |||||||| || |||||||| || || || || ||||| | || ||| Sbjct: 769 ccaaaactcctagccgggtttattccggtgccagtaattggaattgtggctaaatgaacc 710 Query: 492 atgaacacgg 501 |||||||||| Sbjct: 709 atgaacacgg 700 Score = 56.0 bits (28), Expect = 1e-04 Identities = 34/36 (94%) Strand = Plus / Minus Query: 556 cgcttggggtcggtggcggagaagacggtgtagacg 591 ||||| |||||||| ||||||||||||||||||||| Sbjct: 646 cgcttagggtcggtagcggagaagacggtgtagacg 611
>ref|NM_129273.3| Arabidopsis thaliana PIP2B; water channel AT2G37170 (PIP2B) mRNA, complete cds Length = 1143 Score = 89.7 bits (45), Expect = 1e-14 Identities = 138/169 (81%) Strand = Plus / Minus Query: 375 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 434 |||||||| ||||| || |||||||| | |||| |||||| ||||| ||||| || || Sbjct: 815 acccagaatatccagtggtcatcccatggcttgctcttgttatagattacggcagctccg 756 Query: 435 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 494 | ||||| ||||||||||||||||| ||||||||||| || ||||||| || ||||| Sbjct: 755 aaactcctagccgggttgatgccggttccggtgatcggaatagtggccaaatgtaccata 696 Query: 495 aacacggcgaagccgatcgggaggggcgccaacaccgggacgtgagagt 543 ||||| || || || ||||| || |||||||| ||||| ||||| |||| Sbjct: 695 aacaccgcaaacccaatcggaagtggcgccaaaaccggaacgtgggagt 647
>emb|BX820621.1|CNS0A9PE Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH53ZA12 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1078 Score = 89.7 bits (45), Expect = 1e-14 Identities = 138/169 (81%) Strand = Plus / Minus Query: 375 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 434 |||||||| ||||| || |||||||| | |||| |||||| ||||| ||||| || || Sbjct: 791 acccagaatatccagtggtcatcccatggcttgctcttgttatagattacggcagctccg 732 Query: 435 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 494 | ||||| ||||||||||||||||| ||||||||||| || ||||||| || ||||| Sbjct: 731 aaactcctagccgggttgatgccggttccggtgatcggaatagtggccaaatgtaccata 672 Query: 495 aacacggcgaagccgatcgggaggggcgccaacaccgggacgtgagagt 543 ||||| || || || ||||| || |||||||| ||||| ||||| |||| Sbjct: 671 aacaccgcaaacccaatcggaagtggcgccaaaaccggaacgtgggagt 623
>emb|BX820573.1|CNS0A9O0 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH49ZD05 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1074 Score = 89.7 bits (45), Expect = 1e-14 Identities = 138/169 (81%) Strand = Plus / Minus Query: 375 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 434 |||||||| ||||| || |||||||| | |||| |||||| ||||| ||||| || || Sbjct: 800 acccagaatatccagtggtcatcccatggcttgctcttgttatagattacggcagctccg 741 Query: 435 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 494 | ||||| ||||||||||||||||| ||||||||||| || ||||||| || ||||| Sbjct: 740 aaactcctagccgggttgatgccggttccggtgatcggaatagtggccaaatgtaccata 681 Query: 495 aacacggcgaagccgatcgggaggggcgccaacaccgggacgtgagagt 543 ||||| || || || ||||| || |||||||| ||||| ||||| |||| Sbjct: 680 aacaccgcaaacccaatcggaagtggcgccaaaaccggaacgtgggagt 632
>emb|BX820548.1|CNS0A9HO Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH47ZD11 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1095 Score = 89.7 bits (45), Expect = 1e-14 Identities = 138/169 (81%) Strand = Plus / Minus Query: 375 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 434 |||||||| ||||| || |||||||| | |||| |||||| ||||| ||||| || || Sbjct: 800 acccagaatatccagtggtcatcccatggcttgctcttgttatagattacggcagctccg 741 Query: 435 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 494 | ||||| ||||||||||||||||| ||||||||||| || ||||||| || ||||| Sbjct: 740 aaactcctagccgggttgatgccggttccggtgatcggaatagtggccaaatgtaccata 681 Query: 495 aacacggcgaagccgatcgggaggggcgccaacaccgggacgtgagagt 543 ||||| || || || ||||| || |||||||| ||||| ||||| |||| Sbjct: 680 aacaccgcaaacccaatcggaagtggcgccaaaaccggaacgtgggagt 632
>emb|BX819847.1|CNS0A9GD Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS38ZC08 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 821 Score = 89.7 bits (45), Expect = 1e-14 Identities = 138/169 (81%) Strand = Plus / Minus Query: 375 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 434 |||||||| ||||| || |||||||| | |||| |||||| ||||| ||||| || || Sbjct: 492 acccagaatatccagtggtcatcccatggcttgctcttgttatagattacggcagctccg 433 Query: 435 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 494 | ||||| ||||||||||||||||| ||||||||||| || ||||||| || ||||| Sbjct: 432 aaactcctagccgggttgatgccggttccggtgatcggaatagtggccaaatgtaccata 373 Query: 495 aacacggcgaagccgatcgggaggggcgccaacaccgggacgtgagagt 543 ||||| || || || ||||| || |||||||| ||||| ||||| |||| Sbjct: 372 aacaccgcaaacccaatcggaagtggcgccaaaaccggaacgtgggagt 324
>emb|BX820418.1|CNS0A81D Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH30ZA07 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1083 Score = 89.7 bits (45), Expect = 1e-14 Identities = 138/169 (81%) Strand = Plus / Minus Query: 375 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 434 |||||||| ||||| || |||||||| | |||| |||||| ||||| ||||| || || Sbjct: 801 acccagaatatccagtggtcatcccatggcttgctcttgttatagattacggcagctccg 742 Query: 435 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 494 | ||||| ||||||||||||||||| ||||||||||| || ||||||| || ||||| Sbjct: 741 aaactcctagccgggttgatgccggttccggtgatcggaatagtggccaaatgtaccata 682 Query: 495 aacacggcgaagccgatcgggaggggcgccaacaccgggacgtgagagt 543 ||||| || || || ||||| || |||||||| ||||| ||||| |||| Sbjct: 681 aacaccgcaaacccaatcggaagtggcgccaaaaccggaacgtgggagt 633
>gb|AY086460.1| Arabidopsis thaliana clone 25220 mRNA, complete sequence Length = 1104 Score = 89.7 bits (45), Expect = 1e-14 Identities = 138/169 (81%) Strand = Plus / Minus Query: 375 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 434 |||||||| ||||| || |||||||| | |||| |||||| ||||| ||||| || || Sbjct: 816 acccagaatatccagtggtcatcccatggcttgctcttgttatagattacggcagctccg 757 Query: 435 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 494 | ||||| ||||||||||||||||| ||||||||||| || ||||||| || ||||| Sbjct: 756 aaactcctagccgggttgatgccggttccggtgatcggaatagtggccaaatgtaccata 697 Query: 495 aacacggcgaagccgatcgggaggggcgccaacaccgggacgtgagagt 543 ||||| || || || ||||| || |||||||| ||||| ||||| |||| Sbjct: 696 aacaccgcaaacccaatcggaagtggcgccaaaaccggaacgtgggagt 648
>dbj|AB100869.1| Malus x domestica MdPIP1a mRNA for plasma membrane intrinsic protein, complete cds Length = 1260 Score = 89.7 bits (45), Expect = 1e-14 Identities = 175/217 (80%), Gaps = 1/217 (0%) Strand = Plus / Minus Query: 375 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 434 |||||||| ||||| || ||||||||||| | | |||||||||||||| ||| || || Sbjct: 878 acccagaatatccagtggtcatcccaggcatgcttcttgttgtagatgatggcagcgcca 819 Query: 435 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 494 || || || || ||||||||||| || ||||||| ||||||||||||| ||| |||| | Sbjct: 818 agacttcttgctgggttgatgccagttccggtgacggggatggtggccaagtgcaccaag 759 Query: 495 aacacggcgaagccgatcgggaggggcgccaacaccgggacgtgagagttcgcgtgcgct 554 ||||||||||| || || || | || ||||| | ||| ||||| ||| || | ||||| Sbjct: 758 aacacggcgaacccaattggcaacggagccaaaatcggaacgtgggag-tctctggcgct 700 Query: 555 gcgcttggggtcggtggcggagaagacggtgtagacg 591 ||||| | ||| ||||||||||| |||||||||||| Sbjct: 699 acgcttagcgtcagtggcggagaaaacggtgtagacg 663
>ref|NM_129274.2| Arabidopsis thaliana RD28; water channel AT2G37180 (RD28) mRNA, complete cds Length = 1143 Score = 87.7 bits (44), Expect = 4e-14 Identities = 174/216 (80%), Gaps = 1/216 (0%) Strand = Plus / Minus Query: 375 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 434 |||||||| ||||| || |||||||| | |||| |||||| |||| |||||||| || Sbjct: 819 acccagaatatccagtggtcatcccatggcttgctcttgttaaagattacggcggctccg 760 Query: 435 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 494 | ||||| ||||||||||| ||||| ||||||||||| || ||||||| || ||||| Sbjct: 759 aaactcctagccgggttgataccggttccggtgatcggaatagtggccaaatgtaccata 700 Query: 495 aacacggcgaagccgatcgggaggggcgccaacaccgggacgtgagagttcgcgtgcgct 554 ||||| || || || ||||| || |||||||| ||||| ||||| ||| || | ||| | Sbjct: 699 aacaccgcaaacccaatcggaagtggcgccaaaaccggaacgtgggag-tctctagcgtt 641 Query: 555 gcgcttggggtcggtggcggagaagacggtgtagac 590 ||| ||||| || || ||||||||||| |||||||| Sbjct: 640 gcgtttgggatcagtagcggagaagactgtgtagac 605
>emb|AJ249384.1|SOL249384 Spinacia oleracea mRNA for PM28B protein (pm28b gene) Length = 913 Score = 87.7 bits (44), Expect = 4e-14 Identities = 125/152 (82%) Strand = Plus / Minus Query: 375 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 434 |||||||| ||||| |||| |||||| || | |||||||||| |||| | || || ||| Sbjct: 809 acccagaaaatccaatgatgatcccaagcatggtccttgttgaagataatagcagcaccc 750 Query: 435 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 494 || |||||||| |||||||| ||||| || ||||| ||||||||||||| ||| |||| | Sbjct: 749 agactcctggctgggttgattccggtacctgtgatggggatggtggccaagtgaaccagg 690 Query: 495 aacacggcgaagccgatcgggaggggcgccaa 526 ||||| || || ||||| || || |||||||| Sbjct: 689 aacaccgcaaatccgataggcagtggcgccaa 658
>gb|AY096701.1| Arabidopsis thaliana putative aquaporin protein (At2g37180) mRNA, complete cds Length = 889 Score = 87.7 bits (44), Expect = 4e-14 Identities = 174/216 (80%), Gaps = 1/216 (0%) Strand = Plus / Minus Query: 375 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 434 |||||||| ||||| || |||||||| | |||| |||||| |||| |||||||| || Sbjct: 752 acccagaatatccagtggtcatcccatggcttgctcttgttaaagattacggcggctccg 693 Query: 435 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 494 | ||||| ||||||||||| ||||| ||||||||||| || ||||||| || ||||| Sbjct: 692 aaactcctagccgggttgataccggttccggtgatcggaatagtggccaaatgtaccata 633 Query: 495 aacacggcgaagccgatcgggaggggcgccaacaccgggacgtgagagttcgcgtgcgct 554 ||||| || || || ||||| || |||||||| ||||| ||||| ||| || | ||| | Sbjct: 632 aacaccgcaaacccaatcggaagtggcgccaaaaccggaacgtgggag-tctctagcgtt 574 Query: 555 gcgcttggggtcggtggcggagaagacggtgtagac 590 ||| ||||| || || ||||||||||| |||||||| Sbjct: 573 gcgtttgggatcagtagcggagaagactgtgtagac 538
>gb|AY064029.1| Arabidopsis thaliana putative aquaporin, plasma membrane intrinsic protein 2C (At2g37180) mRNA, complete cds Length = 1151 Score = 87.7 bits (44), Expect = 4e-14 Identities = 174/216 (80%), Gaps = 1/216 (0%) Strand = Plus / Minus Query: 375 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 434 |||||||| ||||| || |||||||| | |||| |||||| |||| |||||||| || Sbjct: 819 acccagaatatccagtggtcatcccatggcttgctcttgttaaagattacggcggctccg 760 Query: 435 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 494 | ||||| ||||||||||| ||||| ||||||||||| || ||||||| || ||||| Sbjct: 759 aaactcctagccgggttgataccggttccggtgatcggaatagtggccaaatgtaccata 700 Query: 495 aacacggcgaagccgatcgggaggggcgccaacaccgggacgtgagagttcgcgtgcgct 554 ||||| || || || ||||| || |||||||| ||||| ||||| ||| || | ||| | Sbjct: 699 aacaccgcaaacccaatcggaagtggcgccaaaaccggaacgtgggag-tctctagcgtt 641 Query: 555 gcgcttggggtcggtggcggagaagacggtgtagac 590 ||| ||||| || || ||||||||||| |||||||| Sbjct: 640 gcgtttgggatcagtagcggagaagactgtgtagac 605
>emb|BX820743.1|CNS0A9N0 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH65ZF08 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1079 Score = 87.7 bits (44), Expect = 4e-14 Identities = 134/164 (81%) Strand = Plus / Minus Query: 375 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 434 |||||||| ||||| || |||||||| | |||| |||||| ||||| ||||| || || Sbjct: 800 acccagaatatccagtggtcatcccatggcttgctcttgttatagattacggcagctccg 741 Query: 435 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 494 | ||||| ||||||||||||||||| ||||||||||| || ||||||| || ||||| Sbjct: 740 aaactcctagccgggttgatgccggttccggtgatcggaatagtggccaaatgtaccata 681 Query: 495 aacacggcgaagccgatcgggaggggcgccaacaccgggacgtg 538 ||||| || || || ||||| || |||||||| ||||| ||||| Sbjct: 680 aacaccgcaaacccaatcggaagtggcgccaaaaccggaacgtg 637
>emb|BX824659.1|CNS0A6W2 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH62ZH05 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1056 Score = 87.7 bits (44), Expect = 4e-14 Identities = 173/216 (80%) Strand = Plus / Minus Query: 375 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 434 ||||| || ||||| || |||||||| | |||| |||||||||||| ||||| || || Sbjct: 800 acccaaaatatccagtggtcatcccatggcttgctcttgttgtagattacggcagctccg 741 Query: 435 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 494 | ||||| |||||||| || ||||| ||||| || || ||||| |||| || |||||| Sbjct: 740 aaactccttgccgggttaattccggttccggtaatgggaatggtagccaaatgtaccatg 681 Query: 495 aacacggcgaagccgatcgggaggggcgccaacaccgggacgtgagagttcgcgtgcgct 554 |||||||| || ||||| || || |||||||||||||| ||||| |||| | || || Sbjct: 680 aacacggcaaatccgattggaagtggcgccaacaccggaacgtgggagtctctgagcact 621 Query: 555 gcgcttggggtcggtggcggagaagacggtgtagac 590 || |||||||| || || ||||||||||||||||| Sbjct: 620 acgtttggggtcagttgcagagaagacggtgtagac 585
>emb|BX824010.1|CNS0A6YX Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH14ZC12 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1035 Score = 87.7 bits (44), Expect = 4e-14 Identities = 174/216 (80%), Gaps = 1/216 (0%) Strand = Plus / Minus Query: 375 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 434 ||||| || ||||| || |||||||| | |||| |||||||||||| ||||| || || Sbjct: 797 acccaaaatatccagtggtcatcccatggcttgctcttgttgtagattacggcagctccg 738 Query: 435 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 494 | ||||| |||||||| || ||||| ||||| || || ||||| |||| || |||||| Sbjct: 737 aaactccttgccgggttaattccggttccggtaatgggaatggtagccaaatgtaccatg 678 Query: 495 aacacggcgaagccgatcgggaggggcgccaacaccgggacgtgagagttcgcgtgcgct 554 |||||||| || ||||| || || |||||||||||||| ||||| ||| | | || || Sbjct: 677 aacacggcaaatccgattggaagtggcgccaacaccggaacgtgggag-tatctggcact 619 Query: 555 gcgcttggggtcggtggcggagaagacggtgtagac 590 || |||||||| ||||| ||||||||||||||||| Sbjct: 618 acgtttggggtcagtggcagagaagacggtgtagac 583
>emb|BX842136.1|CNS09YDO Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS52ZB11 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1117 Score = 87.7 bits (44), Expect = 4e-14 Identities = 175/216 (81%), Gaps = 2/216 (0%) Strand = Plus / Minus Query: 375 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 434 ||||| || ||||| || |||||||| | |||| |||||||||||| ||||| || || Sbjct: 801 acccaaaatatccagtggtcatcccatggcttgctcttgttgtagattacggcagctccg 742 Query: 435 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 494 | ||||| |||||||| || ||||| ||||| || || ||||| |||| || |||||| Sbjct: 741 aaactccttgccgggttaattccggttccggtaatgggaatggtagccaaatgtaccatg 682 Query: 495 aacacggcgaagccgatcgggaggggcgccaacaccgggacgtgagagttcgcgtgcgct 554 |||||||| || ||||| || || |||||||||||||| ||||| ||| || | || | | Sbjct: 681 aacacggcaaatccgattggaagtggcgccaacaccggaacgtgggag-tctc-tgggat 624 Query: 555 gcgcttggggtcggtggcggagaagacggtgtagac 590 || |||||||| ||||| ||||||||||||||||| Sbjct: 623 acgtttggggtcagtggcagagaagacggtgtagac 588
>gb|AY087854.1| Arabidopsis thaliana clone 38965 mRNA, complete sequence Length = 1352 Score = 87.7 bits (44), Expect = 4e-14 Identities = 174/216 (80%), Gaps = 1/216 (0%) Strand = Plus / Minus Query: 375 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 434 ||||| || ||||| || |||||||| | |||| |||||||||||| ||||| || || Sbjct: 1019 acccaaaatatccagtggtcatcccatggcttgctcttgttgtagattacggcagctccg 960 Query: 435 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 494 | ||||| |||||||| || ||||| ||||| || || ||||| |||| || |||||| Sbjct: 959 aaactccttgccgggttaattccggttccggtaatgggaatggtagccaaatgtaccatg 900 Query: 495 aacacggcgaagccgatcgggaggggcgccaacaccgggacgtgagagttcgcgtgcgct 554 |||||||| || ||||| || || |||||||||||||| ||||| ||| || | || || Sbjct: 899 aacacggcaaatccgattggaagtggcgccaacaccggaacgtgggag-tctctagcact 841 Query: 555 gcgcttggggtcggtggcggagaagacggtgtagac 590 || |||||||| ||||| |||||||| |||||||| Sbjct: 840 acgtttggggtcagtggcagagaagacagtgtagac 805
>gb|AY084875.1| Arabidopsis thaliana clone 11998 mRNA, complete sequence Length = 1060 Score = 87.7 bits (44), Expect = 4e-14 Identities = 174/216 (80%), Gaps = 1/216 (0%) Strand = Plus / Minus Query: 375 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 434 |||||||| ||||| || |||||||| | |||| |||||| |||| |||||||| || Sbjct: 819 acccagaatatccagtggtcatcccatggcttgctcttgttaaagattacggcggctccg 760 Query: 435 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 494 | ||||| ||||||||||| ||||| ||||||||||| || ||||||| || ||||| Sbjct: 759 aaactcctagccgggttgataccggttccggtgatcggaatagtggccaaatgtaccata 700 Query: 495 aacacggcgaagccgatcgggaggggcgccaacaccgggacgtgagagttcgcgtgcgct 554 ||||| || || || ||||| || |||||||| ||||| ||||| ||| || | ||| | Sbjct: 699 aacaccgcaaacccaatcggaagtggcgccaaaaccggaacgtgggag-tctctagcgtt 641 Query: 555 gcgcttggggtcggtggcggagaagacggtgtagac 590 ||| ||||| || || ||||||||||| |||||||| Sbjct: 640 gcgtttgggatcagtagcggagaagactgtgtagac 605
>dbj|D13254.1|ATHRD28 Arabidopsis thaliana mRNA for putative transmenbrane channel protein Length = 1121 Score = 87.7 bits (44), Expect = 4e-14 Identities = 174/216 (80%), Gaps = 1/216 (0%) Strand = Plus / Minus Query: 375 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 434 |||||||| ||||| || |||||||| | |||| |||||| |||| |||||||| || Sbjct: 802 acccagaatatccagtggtcatcccatggcttgctcttgttaaagattacggcggctccg 743 Query: 435 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 494 | ||||| ||||||||||| ||||| ||||||||||| || ||||||| || ||||| Sbjct: 742 aaactcctagccgggttgataccggttccggtgatcggaatagtggccaaatgtaccata 683 Query: 495 aacacggcgaagccgatcgggaggggcgccaacaccgggacgtgagagttcgcgtgcgct 554 ||||| || || || ||||| || |||||||| ||||| ||||| ||| || | ||| | Sbjct: 682 aacaccgcaaacccaatcggaagtggcgccaaaaccggaacgtgggag-tctctagcgtt 624 Query: 555 gcgcttggggtcggtggcggagaagacggtgtagac 590 ||| ||||| || || ||||||||||| |||||||| Sbjct: 623 gcgtttgggatcagtagcggagaagactgtgtagac 588
>dbj|AB012045.1| Raphanus sativus mRNA for Plasma membrane aquaporin (PAQ2), complete cds Length = 1126 Score = 87.7 bits (44), Expect = 4e-14 Identities = 174/216 (80%), Gaps = 1/216 (0%) Strand = Plus / Minus Query: 375 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 434 ||||| || ||||| || |||||||||| |||| || |||| |||||||||| || || Sbjct: 804 acccaaaatatccagtggtcatcccagggcttgctctcgttgaagatgacggctgctccg 745 Query: 435 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 494 | ||||| |||||||| || || || |||||||| || ||||| |||| ||| |||||| Sbjct: 744 aaactccttgccgggttaataccagttccggtgatgggaatggtagccaagtgcaccatg 685 Query: 495 aacacggcgaagccgatcgggaggggcgccaacaccgggacgtgagagttcgcgtgcgct 554 ||||| || || || || || || ||||||||||| || ||||| ||| || | || || Sbjct: 684 aacaccgcaaatccaattggaagtggcgccaacactggaacgtgggag-tctctggcact 626 Query: 555 gcgcttggggtcggtggcggagaagacggtgtagac 590 ||| || ||||| ||||||||||||||||||||||| Sbjct: 625 gcgtttagggtcagtggcggagaagacggtgtagac 590
>ref|NM_100044.3| Arabidopsis thaliana PIP1C; water channel AT1G01620 (PIP1C) mRNA, complete cds Length = 1251 Score = 85.7 bits (43), Expect = 2e-13 Identities = 176/219 (80%), Gaps = 1/219 (0%) Strand = Plus / Minus Query: 372 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcc 431 ||||||||||| ||||| || || ||||| || | ||||||||||||||||| || || Sbjct: 908 ccgacccagaatatccagtggtcgtcccaagcgtggtccttgttgtagatgattgcagct 849 Query: 432 cccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggacc 491 || || ||||| || ||||| || || || |||||||| || || || |||| ||| ||| Sbjct: 848 ccaagactcctagctgggttaattcctgttccggtgattggaatcgtcgccaagtgaacc 789 Query: 492 atgaacacggcgaagccgatcgggaggggcgccaacaccgggacgtgagagttcgcgtgc 551 | |||||| ||||| ||||| ||||| || ||||| | ||| ||||| ||| || || || Sbjct: 788 aagaacacagcgaatccgattgggagtggtgccaaaatcggaacgtgggag-tcacgagc 730 Query: 552 gctgcgcttggggtcggtggcggagaagacggtgtagac 590 ||| | ||||| ||| |||||||||||||| |||||||| Sbjct: 729 gcttctcttggcgtcagtggcggagaagaccgtgtagac 691
>gb|DQ228330.1| Solanum tuberosum clone 137E08 major intrinsic protein 1-like protein mRNA, complete cds Length = 1086 Score = 85.7 bits (43), Expect = 2e-13 Identities = 109/131 (83%) Strand = Plus / Minus Query: 375 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 434 |||||||| ||||| || |||||||| |||| ||| ||||||||||||| || || || Sbjct: 815 acccagaaaatccagtggtcatcccatgcctcgtctttgttgtagatgatagcagctcca 756 Query: 435 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 494 || |||||||| |||||||| || || |||||||| ||||||||||||| || |||| | Sbjct: 755 agactcctggcagggttgataccagttccggtgattgggatggtggccaaatgaaccaag 696 Query: 495 aacacggcgaa 505 ||||| ||||| Sbjct: 695 aacaccgcgaa 685
>emb|X69294.1|ATTMPB A.thaliana mRNA for transmembrane protein TMP-B Length = 1057 Score = 85.7 bits (43), Expect = 2e-13 Identities = 176/219 (80%), Gaps = 1/219 (0%) Strand = Plus / Minus Query: 372 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcc 431 ||||||||||| ||||| || || ||||| || | ||||||||||||||||| || || Sbjct: 795 ccgacccagaatatccagtggtcgtcccaagcgtggtccttgttgtagatgattgcagct 736 Query: 432 cccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggacc 491 || || ||||| || ||||| || || || |||||||| || || || |||| ||| ||| Sbjct: 735 ccaagactcctagctgggttaattcctgttccggtgattggaatcgtcgccaagtgaacc 676 Query: 492 atgaacacggcgaagccgatcgggaggggcgccaacaccgggacgtgagagttcgcgtgc 551 | |||||| ||||| ||||| ||||| || ||||| | ||| ||||| ||| || || || Sbjct: 675 aagaacacagcgaatccgattgggagtggtgccaaaatcggaacgtgggag-tcacgagc 617 Query: 552 gctgcgcttggggtcggtggcggagaagacggtgtagac 590 ||| | ||||| ||| |||||||||||||| |||||||| Sbjct: 616 gcttctcttggcgtcagtggcggagaagaccgtgtagac 578
>gb|AF348574.1| Arabidopsis thaliana clone C00104 (e) putative plasma membrane intrinsic protein 1c (At1g01620) mRNA, complete cds Length = 861 Score = 85.7 bits (43), Expect = 2e-13 Identities = 176/219 (80%), Gaps = 1/219 (0%) Strand = Plus / Minus Query: 372 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcc 431 ||||||||||| ||||| || || ||||| || | ||||||||||||||||| || || Sbjct: 782 ccgacccagaatatccagtggtcgtcccaagcgtggtccttgttgtagatgattgcagct 723 Query: 432 cccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggacc 491 || || ||||| || ||||| || || || |||||||| || || || |||| ||| ||| Sbjct: 722 ccaagactcctagctgggttaattcctgttccggtgattggaatcgtcgccaagtgaacc 663 Query: 492 atgaacacggcgaagccgatcgggaggggcgccaacaccgggacgtgagagttcgcgtgc 551 | |||||| ||||| ||||| ||||| || ||||| | ||| ||||| ||| || || || Sbjct: 662 aagaacacagcgaatccgattgggagtggtgccaaaatcggaacgtgggag-tcacgagc 604 Query: 552 gctgcgcttggggtcggtggcggagaagacggtgtagac 590 ||| | ||||| ||| |||||||||||||| |||||||| Sbjct: 603 gcttctcttggcgtcagtggcggagaagaccgtgtagac 565
>emb|BX816517.1|CNS0AD43 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH53ZE08 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress) Length = 963 Score = 85.7 bits (43), Expect = 2e-13 Identities = 176/219 (80%), Gaps = 1/219 (0%) Strand = Plus / Minus Query: 372 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcc 431 ||||||||||| ||||| || || ||||| || | ||||||||||||||||| || || Sbjct: 826 ccgacccagaatatccagtggtcgtcccaagcgtggtccttgttgtagatgattgcagct 767 Query: 432 cccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggacc 491 || || ||||| || ||||| || || || |||||||| || || || |||| ||| ||| Sbjct: 766 ccaagactcctagctgggttaattcctgttccggtgattggaatcgtcgccaagtgaacc 707 Query: 492 atgaacacggcgaagccgatcgggaggggcgccaacaccgggacgtgagagttcgcgtgc 551 | |||||| ||||| ||||| ||||| || ||||| | ||| ||||| ||| || || || Sbjct: 706 aagaacacagcgaatccgattgggagtggtgccaaaatcggaacgtgggag-tcacgagc 648 Query: 552 gctgcgcttggggtcggtggcggagaagacggtgtagac 590 ||| | ||||| ||| |||||||||||||| |||||||| Sbjct: 647 gcttctcttggcgtcagtggcggagaagaccgtgtagac 609
>gb|DQ294260.1| Solanum tuberosum clone 108A04 major intrinsic protein 1-like protein mRNA, complete cds Length = 1153 Score = 85.7 bits (43), Expect = 2e-13 Identities = 109/131 (83%) Strand = Plus / Minus Query: 375 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 434 |||||||||||||| || |||| ||| |||| ||| ||||||||||||| || || || Sbjct: 825 acccagaagatccagtggtcattccatgcctcgtctttgttgtagatgatagcagctcca 766 Query: 435 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 494 || |||||||| |||||||| || || |||||||| ||||||||||||| || |||| | Sbjct: 765 agactcctggcagggttgataccagttccggtgattgggatggtggccaaatgaaccaag 706 Query: 495 aacacggcgaa 505 ||||| ||||| Sbjct: 705 aacaccgcgaa 695
>emb|AJ849326.1| Populus tremula x Populus tremuloides mRNA for putative plasma membrane intrinsic protein (pip2.3 gene) Length = 1187 Score = 83.8 bits (42), Expect = 6e-13 Identities = 102/122 (83%) Strand = Plus / Minus Query: 375 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 434 |||||||| ||||| || |||||||| ||||| |||||||||||||| || || || || Sbjct: 800 acccagaaaatccagtggtcatcccatgccttttccttgttgtagatcaccgcagctccg 741 Query: 435 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 494 | |||||| || |||||||| || || |||||||| || |||||||||| ||| |||||| Sbjct: 740 aagctcctagcagggttgataccagtaccggtgattggaatggtggccaagtgaaccatg 681 Query: 495 aa 496 || Sbjct: 680 aa 679
>emb|AJ299449.1|PTR299449 Populus tremula x Populus tremuloides mRNA for major intrinsic protein 1 (mip1 gene) Length = 1187 Score = 83.8 bits (42), Expect = 6e-13 Identities = 102/122 (83%) Strand = Plus / Minus Query: 375 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 434 |||||||| ||||| || |||||||| ||||| |||||||||||||| || || || || Sbjct: 800 acccagaaaatccagtggtcatcccatgccttttccttgttgtagatcaccgcagctccg 741 Query: 435 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 494 | |||||| || |||||||| || || |||||||| || |||||||||| ||| |||||| Sbjct: 740 aagctcctagcagggttgataccagtaccggtgattggaatggtggccaagtgaaccatg 681 Query: 495 aa 496 || Sbjct: 680 aa 679
>ref|NM_118469.2| Arabidopsis thaliana PIP1;5/PIP1D; water channel AT4G23400 (PIP1;5/PIP1D) mRNA, complete cds Length = 1128 Score = 81.8 bits (41), Expect = 2e-12 Identities = 101/121 (83%) Strand = Plus / Minus Query: 372 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcc 431 ||||||||||||||||| || |||||||| || | |||||||||||||||| ||| || Sbjct: 834 ccgacccagaagatccaatggtcatcccaagcatgatccttgttgtagatgatggcagct 775 Query: 432 cccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggacc 491 || || |||||||||||||| ||||| || || || || |||||||| |||| ||| ||| Sbjct: 774 ccgagactcctggccgggttaatgccagttccagtaattgggatggtagccaagtgcacc 715 Query: 492 a 492 | Sbjct: 714 a 714
>gb|DQ202708.1| Olea europaea plasma membrane intrinsic protein (pip1) mRNA, complete cds Length = 1152 Score = 81.8 bits (41), Expect = 2e-12 Identities = 104/125 (83%) Strand = Plus / Minus Query: 375 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 434 |||||||| ||||| ||||||||||| |||||||| ||||||||||||| || || || Sbjct: 799 acccagaatatccagtgatcatcccatgccttgtctttgttgtagatgattgctgcacca 740 Query: 435 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 494 || |||||||| ||||| || || || ||||| || |||||||| |||| ||| |||| | Sbjct: 739 agactcctggcggggttaatacctgtaccggtaatagggatggttgccaagtgcaccaag 680 Query: 495 aacac 499 ||||| Sbjct: 679 aacac 675
>emb|X75884.1|ATPIP2B A.thaliana mRNA for plasma membrane intrinsic protein 2b Length = 1095 Score = 81.8 bits (41), Expect = 2e-12 Identities = 137/169 (81%) Strand = Plus / Minus Query: 375 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 434 |||||||| ||||| || |||||||| | |||| |||||| ||||| |||| || || Sbjct: 767 acccagaatatccagtggtcatcccatggcttgctcttgttatagattacggacgctccg 708 Query: 435 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 494 | ||||| ||||||||||||||||| ||||||||||| || ||||||| || ||||| Sbjct: 707 aaactcctagccgggttgatgccggttccggtgatcggaatagtggccaaatgtaccata 648 Query: 495 aacacggcgaagccgatcgggaggggcgccaacaccgggacgtgagagt 543 ||||| || || || ||||| || |||||||| ||||| ||||| |||| Sbjct: 647 aacaccgcaaacccaatcggaagtggcgccaaaaccggaacgtgggagt 599
>emb|X75883.1|ATPIP2A A.thaliana mRNA for plasma membrane intrinsic protein 2a Length = 1112 Score = 81.8 bits (41), Expect = 2e-12 Identities = 137/169 (81%) Strand = Plus / Minus Query: 375 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 434 ||||| || ||||| || |||||||| | |||| |||||||||||| ||||| || || Sbjct: 797 acccaaaatatccagtggtcatcccatggcttgctcttgttgtagattacggcagctccg 738 Query: 435 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 494 | ||||| |||||||| || ||||| ||||| || || ||||| |||| || |||||| Sbjct: 737 aaactccttgccgggttaattccggttccggtaatgggaatggtagccaaatgtaccatg 678 Query: 495 aacacggcgaagccgatcgggaggggcgccaacaccgggacgtgagagt 543 |||||||| || ||||| || || |||||||||||||| ||||| |||| Sbjct: 677 aacacggcaaatccgattggaagtggcgccaacaccggaacgtgggagt 629
>gb|AY081593.1| Arabidopsis thaliana water channel-like protein (At4g23400) mRNA, complete cds Length = 956 Score = 81.8 bits (41), Expect = 2e-12 Identities = 101/121 (83%) Strand = Plus / Minus Query: 372 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcc 431 ||||||||||||||||| || |||||||| || | |||||||||||||||| ||| || Sbjct: 785 ccgacccagaagatccaatggtcatcccaagcatgatccttgttgtagatgatggcagct 726 Query: 432 cccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggacc 491 || || |||||||||||||| ||||| || || || || |||||||| |||| ||| ||| Sbjct: 725 ccgagactcctggccgggttaatgccagttccagtaattgggatggtagccaagtgcacc 666 Query: 492 a 492 | Sbjct: 665 a 665
>gb|AF452014.1|AF452014 Petunia x hybrida aquaporin-like protein (PIP2;3) mRNA, complete cds Length = 1279 Score = 81.8 bits (41), Expect = 2e-12 Identities = 137/169 (81%) Strand = Plus / Minus Query: 375 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 434 ||||| |||||||| || || | ||| || ||||| | |||| |||| ||||| || || Sbjct: 797 acccaaaagatccaatggtctttccaagctttgtcttggttgaagataacggcagctcca 738 Query: 435 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 494 || ||||| || |||||||||||||||||||| ||||| |||||||| | ||| |||||| Sbjct: 737 agactccttgctgggttgatgccggtgccggtaatcggaatggtggctaagtgaaccatg 678 Query: 495 aacacggcgaagccgatcgggaggggcgccaacaccgggacgtgagagt 543 ||||| || || || || || || || |||||||| ||||| ||||||| Sbjct: 677 aacactgcaaatccaattggaagtggtgccaacacagggacatgagagt 629
>gb|AY059948.1| Arabidopsis thaliana water channel - like protein (At4g23400; F16G20.100) mRNA, complete cds Length = 1125 Score = 81.8 bits (41), Expect = 2e-12 Identities = 101/121 (83%) Strand = Plus / Minus Query: 372 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcc 431 ||||||||||||||||| || |||||||| || | |||||||||||||||| ||| || Sbjct: 834 ccgacccagaagatccaatggtcatcccaagcatgatccttgttgtagatgatggcagct 775 Query: 432 cccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggacc 491 || || |||||||||||||| ||||| || || || || |||||||| |||| ||| ||| Sbjct: 774 ccgagactcctggccgggttaatgccagttccagtaattgggatggtagccaagtgcacc 715 Query: 492 a 492 | Sbjct: 714 a 714
>emb|BX826565.1|CNS0A4GR Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB41ZD01 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 454 Score = 81.8 bits (41), Expect = 2e-12 Identities = 101/121 (83%) Strand = Plus / Minus Query: 372 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcc 431 ||||||||||||||||| || |||||||| || | |||||||||||||||| ||| || Sbjct: 158 ccgacccagaagatccaatggtcatcccaagcatgatccttgttgtagatgatggcagct 99 Query: 432 cccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggacc 491 || || |||||||||||||| ||||| || || || || |||||||| |||| ||| ||| Sbjct: 98 ccgagactcctggccgggttaatgccagttccagtaattgggatggtagccaagtgcacc 39 Query: 492 a 492 | Sbjct: 38 a 38
>emb|BX826657.1|CNS0A38E Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB51ZF11 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 710 Score = 81.8 bits (41), Expect = 2e-12 Identities = 101/121 (83%) Strand = Plus / Minus Query: 372 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcc 431 ||||||||||||||||| || |||||||| || | |||||||||||||||| ||| || Sbjct: 417 ccgacccagaagatccaatggtcatcccaagcatgatccttgttgtagatgatggcagct 358 Query: 432 cccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggacc 491 || || |||||||||||||| ||||| || || || || |||||||| |||| ||| ||| Sbjct: 357 ccgagactcctggccgggttaatgccagttccagtaattgggatggtagccaagtgcacc 298 Query: 492 a 492 | Sbjct: 297 a 297
>emb|BX827146.1|CNS0A2UM Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS16ZB08 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1066 Score = 81.8 bits (41), Expect = 2e-12 Identities = 101/121 (83%) Strand = Plus / Minus Query: 372 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcc 431 ||||||||||||||||| || |||||||| || | |||||||||||||||| ||| || Sbjct: 823 ccgacccagaagatccaatggtcatcccaagcatgatccttgttgtagatgatggcagct 764 Query: 432 cccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggacc 491 || || |||||||||||||| ||||| || || || || |||||||| |||| ||| ||| Sbjct: 763 ccgagactcctggccgggttaatgccagttccagtaattgggatggtagccaagtgcacc 704 Query: 492 a 492 | Sbjct: 703 a 703
>emb|BX827200.1|CNS0A2RC Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS21ZB06 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1078 Score = 81.8 bits (41), Expect = 2e-12 Identities = 101/121 (83%) Strand = Plus / Minus Query: 372 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcc 431 ||||||||||||||||| || |||||||| || | |||||||||||||||| ||| || Sbjct: 798 ccgacccagaagatccaatggtcatcccaagcatgatccttgttgtagatgatggcagct 739 Query: 432 cccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggacc 491 || || |||||||||||||| ||||| || || || || |||||||| |||| ||| ||| Sbjct: 738 ccgagactcctggccgggttaatgccagttccagtaattgggatggtagccaagtgcacc 679 Query: 492 a 492 | Sbjct: 678 a 678
>gb|AY087945.1| Arabidopsis thaliana clone 3982 mRNA, complete sequence Length = 1089 Score = 81.8 bits (41), Expect = 2e-12 Identities = 101/121 (83%) Strand = Plus / Minus Query: 372 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcc 431 ||||||||||||||||| || |||||||| || | |||||||||||||||| ||| || Sbjct: 832 ccgacccagaagatccaatggtcatcccaagcatgatccttgttgtagatgatggcagct 773 Query: 432 cccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggacc 491 || || |||||||||||||| ||||| || || || || |||||||| |||| ||| ||| Sbjct: 772 ccgagactcctggccgggttaatgccagttccagtaattgggatggtagccaagtgcacc 713 Query: 492 a 492 | Sbjct: 712 a 712
>gb|AY547266.2| Ipomoea nil aquaporin-like protein (AQP1) mRNA, complete cds Length = 1189 Score = 81.8 bits (41), Expect = 2e-12 Identities = 171/213 (80%), Gaps = 1/213 (0%) Strand = Plus / Minus Query: 375 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 434 |||||||||||||| ||||||| ||| || | || ||||||||||||| ||| || || Sbjct: 867 acccagaagatccaatgatcattccatgcgtgttcattgttgtagatgatggctgcaccg 808 Query: 435 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 494 || || | ||||||||| || || |||||||||||||| ||||| |||| ||| |||| | Sbjct: 807 agacttcgggccgggttaatacccgtgccggtgatcggaatggtagccaagtgcaccaag 748 Query: 495 aacacggcgaagccgatcgggaggggcgccaacaccgggacgtgagagttcgcgtgcgct 554 || |||||||| || || || | || |||||||| ||||| || ||| || | ||| | Sbjct: 747 aagacggcgaacccaatgggcaacggtgccaacacagggacatgggag-tctctggcgtt 689 Query: 555 gcgcttggggtcggtggcggagaagacggtgta 587 ||| |||| || |||||||||||||||||||| Sbjct: 688 gcgtttggcatcagtggcggagaagacggtgta 656
>gb|U73467.1|MCU73467 Mesembryanthemum crystallinum water channel protein MipE mRNA, complete cds Length = 1179 Score = 81.8 bits (41), Expect = 2e-12 Identities = 126/153 (82%), Gaps = 1/153 (0%) Strand = Plus / Minus Query: 438 ctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatgaac 497 ||||| || ||||||||||||||||| ||||| ||||||||||||| || ||||||||| Sbjct: 808 ctcctagcagggttgatgccggtgccagtgatggggatggtggccaaatgaaccatgaac 749 Query: 498 acggcgaagccgatcgggaggggcgccaacaccgggacgtgagagttcgcgtgcgctgcg 557 || || || || || || || || || | ||| || ||||||||| || || ||||| | Sbjct: 748 acagcaaaaccaatgggaagaggggcaagcactggcacgtgagag-tcacgcgcgctcct 690 Query: 558 cttggggtcggtggcggagaagacggtgtagac 590 ||| ||||| |||||||||||||| |||||||| Sbjct: 689 cttagggtcagtggcggagaagactgtgtagac 657
>gb|U26538.1|MCU26538 Mesembryanthemum crystallinum major intrinsic protein homolog (mipE) mRNA, partial cds Length = 963 Score = 81.8 bits (41), Expect = 2e-12 Identities = 126/153 (82%), Gaps = 1/153 (0%) Strand = Plus / Minus Query: 438 ctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatgaac 497 ||||| || ||||||||||||||||| ||||| ||||||||||||| || ||||||||| Sbjct: 592 ctcctagcagggttgatgccggtgccagtgatggggatggtggccaaatgaaccatgaac 533 Query: 498 acggcgaagccgatcgggaggggcgccaacaccgggacgtgagagttcgcgtgcgctgcg 557 || || || || || || || || || | ||| || ||||||||| || || ||||| | Sbjct: 532 acagcaaaaccaatgggaagaggggcaagcactggcacgtgagag-tcacgcgcgctcct 474 Query: 558 cttggggtcggtggcggagaagacggtgtagac 590 ||| ||||| |||||||||||||| |||||||| Sbjct: 473 cttagggtcagtggcggagaagactgtgtagac 441
>ref|NM_125459.2| Arabidopsis thaliana PIP2;4/PIP2F; water channel AT5G60660 (PIP2;4/PIP2F) mRNA, complete cds Length = 1139 Score = 79.8 bits (40), Expect = 9e-12 Identities = 182/228 (79%), Gaps = 1/228 (0%) Strand = Plus / Minus Query: 360 ccgatcatggggccgacccagaagatccactgatcatcccaggccttgtccttgttgtag 419 |||||||| || || ||||| || ||||| || || ||||||||||| || |||||||| Sbjct: 823 ccgatcatcggtccaacccaaaaaatccattggtcgtcccaggccttttcgttgttgtaa 764 Query: 420 atgacggcggcccccaggctcctggccgggttgatgccggtgccggtgatcgggatggtg 479 || ||||| || || | ||| | ||||||||||| ||||| |||||||| || |||||| Sbjct: 763 ataacggcagctccaaagctacgagccgggttgataccggttccggtgatgggaatggtg 704 Query: 480 gccaggtggaccatgaacacggcgaagccgatcgggaggggcgccaacaccgggacgtga 539 || | || |||||||| ||||| ||||| || || || || ||||| || || |||||| Sbjct: 703 gctaaatgaaccatgaagacggcaaagccaatgggaagtggagccaaaactggcacgtga 644 Query: 540 gagttcgcgtgcgctgcgcttggggtcggtggcggagaagacggtgta 587 |||| | || || | |||||||| ||||| || |||||||||||||| Sbjct: 643 gagt-cacgagcatttcgcttgggatcggttgccgagaagacggtgta 597
>gb|BT013307.1| Lycopersicon esculentum clone 134975R, mRNA sequence Length = 1260 Score = 79.8 bits (40), Expect = 9e-12 Identities = 119/144 (82%), Gaps = 1/144 (0%) Strand = Plus / Minus Query: 438 ctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatgaac 497 ||||| ||||||||||| ||||| ||||||||||| || ||||| ||||| |||||||| Sbjct: 791 ctcctcgccgggttgattccggtaccggtgatcggaatagtggcaaggtgaaccatgaat 732 Query: 498 acggcgaagccgatcgggaggggcgccaacaccgggacgtgagagttcgcgtgcgctgcg 557 ||||| || || || ||||| || ||||| || ||||| |||||| || | ||||| || Sbjct: 731 acggcaaatccaatggggagtggggccaagacagggacatgagag-tctctggcgcttcg 673 Query: 558 cttggggtcggtggcggagaagac 581 || ||||||||||| |||||||| Sbjct: 672 tttagggtcggtggcagagaagac 649
>dbj|AB206103.1| Mimosa pudica pip2;5 mRNA for plasma membrane intrinsic protein 2;5, complete cds Length = 1126 Score = 79.8 bits (40), Expect = 9e-12 Identities = 173/216 (80%), Gaps = 1/216 (0%) Strand = Plus / Minus Query: 375 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 434 |||||||||||||| || |||||||| |||||| | |||||||| || || || || || Sbjct: 786 acccagaagatccaatggtcatcccaagccttgccattgttgtaaataacagccgcacca 727 Query: 435 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 494 | ||||| |||||||| || || || || ||||| || ||||| |||| ||| |||||| Sbjct: 726 aaactcctagccgggttaatcccagttccagtgatgggaatggtagccaagtgaaccatg 667 Query: 495 aacacggcgaagccgatcgggaggggcgccaacaccgggacgtgagagttcgcgtgcgct 554 || || || || || || || | || ||||| || || |||||||||| | |||||||| Sbjct: 666 aaaacagcaaatccaataggcaatggagccaaaacgggaacgtgagagt-cacgtgcgct 608 Query: 555 gcgcttggggtcggtggcggagaagacggtgtagac 590 |||||||||||| |||| |||||||| |||||||| Sbjct: 607 acgcttggggtcgatggctgagaagacagtgtagac 572
>gb|AY087245.1| Arabidopsis thaliana clone 33231 mRNA, complete sequence Length = 1120 Score = 79.8 bits (40), Expect = 9e-12 Identities = 182/228 (79%), Gaps = 1/228 (0%) Strand = Plus / Minus Query: 360 ccgatcatggggccgacccagaagatccactgatcatcccaggccttgtccttgttgtag 419 |||||||| || || ||||| || ||||| || || ||||||||||| || |||||||| Sbjct: 823 ccgatcatcggtccaacccaaaaaatccattggtcgtcccaggccttttcgttgttgtaa 764 Query: 420 atgacggcggcccccaggctcctggccgggttgatgccggtgccggtgatcgggatggtg 479 || ||||| || || | ||| | ||||||||||| ||||| |||||||| || |||||| Sbjct: 763 ataacggcagctccaaagctacgagccgggttgataccggttccggtgatgggaatggtg 704 Query: 480 gccaggtggaccatgaacacggcgaagccgatcgggaggggcgccaacaccgggacgtga 539 || | || |||||||| ||||| ||||| || || || || ||||| || || |||||| Sbjct: 703 gctaaatgaaccatgaagacggcaaagccaatgggaagtggagccaaaactggcacgtga 644 Query: 540 gagttcgcgtgcgctgcgcttggggtcggtggcggagaagacggtgta 587 |||| | || || | |||||||| ||||| || |||||||||||||| Sbjct: 643 gagt-cacgagcatttcgcttgggatcggttgccgagaagacggtgta 597
>gb|AF118383.1|AF118383 Brassica napus plasma membrane intrinsic protein 2 (PIP2) mRNA, complete cds Length = 1026 Score = 79.8 bits (40), Expect = 9e-12 Identities = 173/216 (80%), Gaps = 1/216 (0%) Strand = Plus / Minus Query: 375 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 434 |||||||| ||||| || |||||||| | |||| || ||||||||| || || || || Sbjct: 777 acccagaatatccagtggtcatcccacggcttggactcgttgtagataaccgcagctccg 718 Query: 435 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 494 | ||||| |||||||| || || || ||||||||||| || ||||||| ||| |||||| Sbjct: 717 aaactccttgccgggttaattcctgttccggtgatcggaatagtggccaagtgaaccatg 658 Query: 495 aacacggcgaagccgatcgggaggggcgccaacaccgggacgtgagagttcgcgtgcgct 554 || || || || || ||||| || ||||||||||| || ||||| ||| || |||||| | Sbjct: 657 aagaccgcaaaccctatcggaagtggcgccaacacgggaacgtgggag-tctcgtgcgtt 599 Query: 555 gcgcttggggtcggtggcggagaagacggtgtagac 590 | |||||||| ||||| |||||||| |||||||| Sbjct: 598 tcttttggggtctgtggctgagaagacagtgtagac 563
>gb|AY062610.1| Arabidopsis thaliana plasma membrane intrinsic protein 1C (transmembrane protein B) (F22L4.16) mRNA, complete cds Length = 1031 Score = 77.8 bits (39), Expect = 4e-11 Identities = 175/219 (79%), Gaps = 1/219 (0%) Strand = Plus / Minus Query: 372 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcc 431 ||||||||||| ||||| || || ||||| || | ||||||||||||||||| || || Sbjct: 836 ccgacccagaatatccagtggtcgtcccaagcgtggtccttgttgtagatgattgcagct 777 Query: 432 cccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggacc 491 || || ||||| || ||||| || || || |||||||| || | || |||| ||| ||| Sbjct: 776 ccaagactcctagctgggttaattcctgttccggtgattggaaacgtcgccaagtgaacc 717 Query: 492 atgaacacggcgaagccgatcgggaggggcgccaacaccgggacgtgagagttcgcgtgc 551 | |||||| ||||| ||||| ||||| || ||||| | ||| ||||| ||| || || || Sbjct: 716 aagaacacagcgaatccgattgggagtggtgccaaaatcggaacgtgggag-tcacgagc 658 Query: 552 gctgcgcttggggtcggtggcggagaagacggtgtagac 590 ||| | ||||| ||| |||||||||||||| |||||||| Sbjct: 657 gcttctcttggcgtcagtggcggagaagaccgtgtagac 619
>gb|AF299050.1|AF299050 Brassica oleracea aquaporin PIP1b1 mRNA, complete cds Length = 1084 Score = 77.8 bits (39), Expect = 4e-11 Identities = 108/131 (82%) Strand = Plus / Minus Query: 375 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 434 |||||||||| ||| || |||||||| || |||||||||||| |||||| ||| || || Sbjct: 815 acccagaagacccaatggtcatcccaagcgttgtccttgttgaagatgatggcagcacca 756 Query: 435 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 494 || || || || |||||||| || || || ||||| |||||||| |||| |||||||| | Sbjct: 755 agacttcttgctgggttgattccagttccagtgatggggatggttgccaagtggaccaag 696 Query: 495 aacacggcgaa 505 ||||| ||||| Sbjct: 695 aacacagcgaa 685
>gb|BT002101.1| Arabidopsis thaliana plasma membrane intrinsic protein 1C (transmembrane protein B) (At1g01620) mRNA, complete cds Length = 903 Score = 77.8 bits (39), Expect = 4e-11 Identities = 175/219 (79%), Gaps = 1/219 (0%) Strand = Plus / Minus Query: 372 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcc 431 ||||||||||| ||||| || || ||||| || | ||||||||||||||||| || || Sbjct: 782 ccgacccagaatatccagtggtcgtcccaagcgtggtccttgttgtagatgattgcagct 723 Query: 432 cccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggacc 491 || || ||||| || ||||| || || || |||||||| || | || |||| ||| ||| Sbjct: 722 ccaagactcctagctgggttaattcctgttccggtgattggaaacgtcgccaagtgaacc 663 Query: 492 atgaacacggcgaagccgatcgggaggggcgccaacaccgggacgtgagagttcgcgtgc 551 | |||||| ||||| ||||| ||||| || ||||| | ||| ||||| ||| || || || Sbjct: 662 aagaacacagcgaatccgattgggagtggtgccaaaatcggaacgtgggag-tcacgagc 604 Query: 552 gctgcgcttggggtcggtggcggagaagacggtgtagac 590 ||| | ||||| ||| |||||||||||||| |||||||| Sbjct: 603 gcttctcttggcgtcagtggcggagaagaccgtgtagac 565
>gb|U62280.1|NTU62280 Nicotiana tabacum aquaporin (NT2) mRNA, complete cds Length = 1049 Score = 77.8 bits (39), Expect = 4e-11 Identities = 108/131 (82%) Strand = Plus / Minus Query: 375 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 434 |||||||||||||| ||||||||||| ||| ||| | |||| |||||| || || || Sbjct: 797 acccagaagatccagtgatcatcccatgcccggtcttggttgaagatgatagcagctcca 738 Query: 435 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 494 ||||||| ||| ||| |||| ||||| |||||||| ||||||||||||| || |||| | Sbjct: 737 aggctccgggcgggggtgataccggttccggtgattgggatggtggccaaatgaaccaag 678 Query: 495 aacacggcgaa 505 ||||| ||||| Sbjct: 677 aacaccgcgaa 667
>gb|L36097.1|CIPMIPB Mesembryanthemum crystallinum aquaporin (mipB) mRNA, complete cds Length = 1217 Score = 77.8 bits (39), Expect = 4e-11 Identities = 108/131 (82%) Strand = Plus / Minus Query: 375 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 434 |||||||| ||||| ||||||||||| || | | |||||||| |||||| || || || Sbjct: 805 acccagaaaatccagtgatcatcccaagcgtggcccttgttgaagatgatagcagcaccg 746 Query: 435 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 494 || ||||| || |||||||||||||| || ||||| |||||||| |||| ||| |||| | Sbjct: 745 agactccttgctgggttgatgccggttccagtgattgggatggttgccaagtgaaccaag 686 Query: 495 aacacggcgaa 505 ||||| ||||| Sbjct: 685 aacactgcgaa 675
>emb|Y18312.1|STU18312 Solanum tuberosum mRNA for major intrinsic protein 2 Length = 1214 Score = 75.8 bits (38), Expect = 1e-10 Identities = 110/134 (82%) Strand = Plus / Minus Query: 372 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcc 431 ||||||||||| ||||| || || ||||| |||||||| |||| | || ||||| ||| Sbjct: 794 ccgacccagaaaatccagtgttcgtcccatgccttgtcgccgttgaaaatcacggccgcc 735 Query: 432 cccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggacc 491 || | ||||| ||||||||||| ||||| |||||||| || || ||||| ||||| ||| Sbjct: 734 ccgaaactcctcgccgggttgattccggtaccggtgattggaatagtggcaaggtgaacc 675 Query: 492 atgaacacggcgaa 505 ||||| |||||||| Sbjct: 674 atgaatacggcgaa 661
>emb|AJ849323.1| Populus tremula x Populus tremuloides mRNA for putative plasma membrane intrinsic protein (pip1.1 gene) Length = 943 Score = 75.8 bits (38), Expect = 1e-10 Identities = 113/138 (81%) Strand = Plus / Minus Query: 368 ggggccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggc 427 |||||| |||||||| ||||| |||||||||||||| ||||||||||| |||||| || Sbjct: 883 ggggccaacccagaaaatccagtgatcatcccaggcgctgtccttgttgaagatgattgc 824 Query: 428 ggcccccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtg 487 || ||||| |||| || |||||||| || || || || || ||||| ||||||| ||| Sbjct: 823 agcacccagactccgagctgggttgatcccagttcctgtaattgggattgtggccaagtg 764 Query: 488 gaccatgaacacggcgaa 505 |||| |||||| ||||| Sbjct: 763 caccaagaacacagcgaa 746
>dbj|AK221275.1| Arabidopsis thaliana mRNA for water channel - like protein, partial cds, clone: RAFL24-17-A12 Length = 392 Score = 75.8 bits (38), Expect = 1e-10 Identities = 74/86 (86%) Strand = Plus / Minus Query: 372 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcc 431 ||||||||||||||||| || |||||||| || | |||||||||||||||| ||| || Sbjct: 90 ccgacccagaagatccaatggtcatcccaagcatgatccttgttgtagatgatggcagct 31 Query: 432 cccaggctcctggccgggttgatgcc 457 || || |||||||||||||| ||||| Sbjct: 30 ccgagactcctggccgggttaatgcc 5
>dbj|AB206101.1| Mimosa pudica pip2;3 mRNA for plasma membrane intrinsic protein 2;3, complete cds Length = 1218 Score = 75.8 bits (38), Expect = 1e-10 Identities = 56/62 (90%) Strand = Plus / Minus Query: 438 ctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatgaac 497 |||||||||||||| |||||||| ||||||| ||||||||||||| ||| ||||||||| Sbjct: 790 ctcctggccgggttaatgccggtaccggtgactgggatggtggccaagtgaaccatgaac 731 Query: 498 ac 499 || Sbjct: 730 ac 729
>emb|Y08962.1|OSTRAMBPR O.sativa mRNA for transmembrane protein Length = 1179 Score = 73.8 bits (37), Expect = 6e-10 Identities = 49/53 (92%) Strand = Plus / Minus Query: 447 gggttgatgccggtgccggtgatcgggatggtggccaggtggaccatgaacac 499 |||||||| |||||||||||||| ||||||||||||||||| |||| |||||| Sbjct: 778 gggttgattccggtgccggtgatggggatggtggccaggtgaaccaagaacac 726 Score = 60.0 bits (30), Expect = 9e-06 Identities = 33/34 (97%) Strand = Plus / Minus Query: 558 cttggggtcggtggcggagaagacggtgtagacg 591 ||||| |||||||||||||||||||||||||||| Sbjct: 668 cttggcgtcggtggcggagaagacggtgtagacg 635
>gb|AF314656.1|AF314656 Brassica oleracea aquaporin (PIP3) mRNA, complete cds Length = 909 Score = 73.8 bits (37), Expect = 6e-10 Identities = 170/213 (79%), Gaps = 1/213 (0%) Strand = Plus / Minus Query: 375 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 434 |||||||||||||| || |||||||| ||||| || ||||||||||| || || || || Sbjct: 740 acccagaagatccaatggtcatcccacgccttctcgttgttgtagataacagcagcacca 681 Query: 435 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 494 | ||| || || ||||| || || || ||||| || ||||| || |||| || |||||| Sbjct: 680 aagcttctcgctgggttaattccagttccggtaatggggatagtagccaaatgcaccatg 621 Query: 495 aacacggcgaagccgatcgggaggggcgccaacaccgggacgtgagagttcgcgtgcgct 554 ||||| ||||| || || || || || ||||| || |||| ||||||| || || ||||| Sbjct: 620 aacacagcgaatccaattggaagtggagccaaaacagggatgtgagag-tcacgagcgct 562 Query: 555 gcgcttggggtcggtggcggagaagacggtgta 587 | ||| ||||| || ||||||||||||||||| Sbjct: 561 tctcttagggtcagtcgcggagaagacggtgta 529
>gb|AF118382.1|AF118382 Brassica napus plasma membrane intrinsic protein 1 (PIP1) mRNA, complete cds Length = 1093 Score = 73.8 bits (37), Expect = 6e-10 Identities = 125/153 (81%), Gaps = 1/153 (0%) Strand = Plus / Minus Query: 438 ctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatgaac 497 ||||| ||||||||||| || || || ||||| || ||||| |||| ||| ||||||||| Sbjct: 705 ctccttgccgggttgattccagttccagtgatgggaatggtagccaagtgcaccatgaac 646 Query: 498 acggcgaagccgatcgggaggggcgccaacaccgggacgtgagagttcgcgtgcgctgcg 557 || || || || || || || ||||||||||| |||||||| ||| || | || || || Sbjct: 645 accgcaaatccaatgggaagtggcgccaacactgggacgtgggag-tctctggcactacg 587 Query: 558 cttggggtcggtggcggagaagacggtgtagac 590 || ||||| ||||||||||||||||||||||| Sbjct: 586 tttagggtcagtggcggagaagacggtgtagac 554
>gb|U77297.1|OSU77297 Oryza sativa transmembrane protein mRNA, complete cds Length = 1179 Score = 73.8 bits (37), Expect = 6e-10 Identities = 49/53 (92%) Strand = Plus / Minus Query: 447 gggttgatgccggtgccggtgatcgggatggtggccaggtggaccatgaacac 499 |||||||| |||||||||||||| ||||||||||||||||| |||| |||||| Sbjct: 778 gggttgattccggtgccggtgatggggatggtggccaggtgaaccaagaacac 726 Score = 60.0 bits (30), Expect = 9e-06 Identities = 33/34 (97%) Strand = Plus / Minus Query: 558 cttggggtcggtggcggagaagacggtgtagacg 591 ||||| |||||||||||||||||||||||||||| Sbjct: 668 cttggcgtcggtggcggagaagacggtgtagacg 635
>ref|NM_202760.1| Arabidopsis thaliana TMP-C AT4G00430 (TMP-C) transcript variant AT4G00430.2 mRNA, complete cds Length = 1367 Score = 71.9 bits (36), Expect = 2e-09 Identities = 123/152 (80%) Strand = Plus / Minus Query: 375 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 434 |||||||| ||||| || |||||||| | | ||||||||||||||| | ||||| || Sbjct: 996 acccagaaaatccaatggtcatcccaagagtggtccttgttgtagataattgcggctcca 937 Query: 435 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 494 || || || || |||||||| ||||| ||||||||||| || || |||| ||| |||| | Sbjct: 936 agacttctagctgggttgattccggtcccggtgatcggtattgttgccaagtgtaccaag 877 Query: 495 aacacggcgaagccgatcgggaggggcgccaa 526 ||||| || || ||||| ||||| |||||||| Sbjct: 876 aacactgcaaatccgattgggagcggcgccaa 845 Score = 56.0 bits (28), Expect = 1e-04 Identities = 56/64 (87%), Gaps = 1/64 (1%) Strand = Plus / Minus Query: 528 accgggacgtgagagttcgcgtgcgctgcgcttggggtcggtggcggagaagacggtgta 587 ||||||||||| |||| | || ||||| | ||||| |||||||||||||||||| ||||| Sbjct: 715 accgggacgtgtgagt-cacgggcgcttctcttggcgtcggtggcggagaagacagtgta 657 Query: 588 gacg 591 |||| Sbjct: 656 gacg 653
>emb|AJ000031.1|CPPMIP1 Carica papaya mRNA for membrane channel protein, partial Length = 821 Score = 71.9 bits (36), Expect = 2e-09 Identities = 172/216 (79%), Gaps = 1/216 (0%) Strand = Plus / Minus Query: 375 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 434 |||||||| ||||| || |||||||| ||||||||| ||||| |||||| ||| || || Sbjct: 446 acccagaaaatccaatggtcatcccaagccttgtccctgttgaagatgatggctgcacca 387 Query: 435 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 494 || |||||||| ||||| || || || || ||||| || |||||||| | ||| |||| | Sbjct: 386 agactcctggctgggttaataccagttcctgtgattggaatggtggctaagtgcaccaag 327 Query: 495 aacacggcgaagccgatcgggaggggcgccaacaccgggacgtgagagttcgcgtgcgct 554 ||||| ||||| || || || || || ||||| | || ||||| |||| | | ||| | Sbjct: 326 aacactgcgaacccaattggtagaggtgccaaaattggaacgtgggagt-ctctggcgtt 268 Query: 555 gcgcttggggtcggtggcggagaagacggtgtagac 590 |||||||| ||| ||||| || |||||||||||||| Sbjct: 267 gcgcttggcgtcagtggccgacaagacggtgtagac 232
>gb|DQ451602.1| Salicornia bigelovii plasma membrane major intrinsic protein (PIP1) mRNA, complete cds Length = 1268 Score = 71.9 bits (36), Expect = 2e-09 Identities = 145/180 (80%), Gaps = 1/180 (0%) Strand = Plus / Minus Query: 412 tgttgtagatgacggcggcccccaggctcctggccgggttgatgccggtgccggtgatcg 471 |||||||||||| ||| | || || ||||| || |||||||| |||||||| || | | Sbjct: 824 tgttgtagatgatggcagtaccaagactcctagcagggttgataccggtgccagtaacgg 765 Query: 472 ggatggtggccaggtggaccatgaacacggcgaagccgatcgggaggggcgccaacaccg 531 |||||||||||| ||| |||| |||||||||||| || || || | ||| ||||| | | Sbjct: 764 ggatggtggccaagtgaaccaagaacacggcgaatccaataggcaagggagccaagatag 705 Query: 532 ggacgtgagagttcgcgtgcgctgcgcttggggtcggtggcggagaagacggtgtagacg 591 | || |||||| || | ||||| ||||||| ||| ||||| |||||||||||||||||| Sbjct: 704 gaacatgagag-tccctagcgcttcgcttggcgtcagtggcagagaagacggtgtagacg 646
>emb|X95640.1|BOMIPBTCP B.oleracea mRNA for transmembrane channel protein (mipB) Length = 1114 Score = 71.9 bits (36), Expect = 2e-09 Identities = 114/140 (81%) Strand = Plus / Minus Query: 372 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcc 431 |||||||| |||| ||| || |||||||| || |||||||||||| |||||| ||| || Sbjct: 800 ccgacccaaaagacccaatggtcatcccaagcgttgtccttgttgaagatgatggcagct 741 Query: 432 cccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggacc 491 || || ||||| || |||||||| || || || || || |||||||| || | ||||||| Sbjct: 740 ccaagactccttgctgggttgattccagttccagtaatggggatggttgctaagtggacc 681 Query: 492 atgaacacggcgaagccgat 511 | |||||| ||||| ||||| Sbjct: 680 aagaacacagcgaatccgat 661
>emb|AJ001293.1|CPPIPB Craterostigma plantagineum mRNA for major intrinsic protein PIPb Length = 1179 Score = 71.9 bits (36), Expect = 2e-09 Identities = 114/140 (81%) Strand = Plus / Minus Query: 372 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcc 431 ||||||||||| | ||| || |||||||| || | || |||||||| |||| ||| || Sbjct: 843 ccgacccagaaaacccagtggtcatcccaagcatgatctttgttgtaaatgatggctgca 784 Query: 432 cccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggacc 491 || || || | ||| ||||||||||| || || |||||||| ||||| ||||||||||| Sbjct: 783 ccaagactacgggcggggttgatgcccgtcccagtgatcggaatggtcgccaggtggact 724 Query: 492 atgaacacggcgaagccgat 511 | |||||||||||| ||||| Sbjct: 723 aagaacacggcgaatccgat 704
>dbj|AB218716.1| Prunus mume Pm3 mRNA for aquaporin, complete cds Length = 1278 Score = 71.9 bits (36), Expect = 2e-09 Identities = 99/120 (82%) Strand = Plus / Minus Query: 377 ccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcccccag 436 |||||||||||| || |||||||| || ||||||||||||||||| || || || || | Sbjct: 768 ccagaagatccattggtcatcccaagctttgtccttgttgtagatcacagcagctccaaa 709 Query: 437 gctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatgaa 496 || || || |||||||| || || || ||||| ||||||||||||||||| || ||||| Sbjct: 708 acttctagcagggttgataccagttccagtgattgggatggtggccaggtgaacgatgaa 649
>emb|BX827573.1|CNS0A3MW Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS77ZD01 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1155 Score = 71.9 bits (36), Expect = 2e-09 Identities = 123/152 (80%) Strand = Plus / Minus Query: 375 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 434 |||||||| ||||| || |||||||| | | ||||||||||||||| | ||||| || Sbjct: 975 acccagaaaatccaatggtcatcccaagagtggtccttgttgtagataattgcggctcca 916 Query: 435 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 494 || || || || |||||||| ||||| ||||||||||| || || |||| ||| |||| | Sbjct: 915 agacttctagctgggttgattccggtcccggtgatcggtattgttgccaagtgtaccaag 856 Query: 495 aacacggcgaagccgatcgggaggggcgccaa 526 ||||| || || ||||| ||||| |||||||| Sbjct: 855 aacactgcaaatccgattgggagcggcgccaa 824 Score = 56.0 bits (28), Expect = 1e-04 Identities = 56/64 (87%), Gaps = 1/64 (1%) Strand = Plus / Minus Query: 528 accgggacgtgagagttcgcgtgcgctgcgcttggggtcggtggcggagaagacggtgta 587 ||||||||||| |||| | || ||||| | ||||| |||||||||||||||||| ||||| Sbjct: 693 accgggacgtgtgagt-cacgggcgcttctcttggcgtcggtggcggagaagacagtgta 635 Query: 588 gacg 591 |||| Sbjct: 634 gacg 631
>dbj|AB206098.1| Mimosa pudica pip1;1 mRNA for plasma membrane intrinsic protein 1;1, complete cds Length = 1096 Score = 71.9 bits (36), Expect = 2e-09 Identities = 118/144 (81%), Gaps = 1/144 (0%) Strand = Plus / Minus Query: 447 gggttgatgccggtgccggtgatcgggatggtggccaggtggaccatgaacacggcgaag 506 |||||||| ||||| |||||||| |||||||| |||| ||| |||| ||||| ||||| Sbjct: 792 gggttgataccggttccggtgattgggatggtagccaagtgaaccaaaaacacagcgaac 733 Query: 507 ccgatcgggaggggcgccaacaccgggacgtgagagttcgcgtgcgctgcgcttggggtc 566 || || || | || ||||| | |||||||| |||| | || ||||| ||||||| || Sbjct: 732 ccaataggcaatggtgccaaaatggggacgtgggagt-cacgggcgctacgcttggcatc 674 Query: 567 ggtggcggagaagacggtgtagac 590 |||||||||||||||||||||||| Sbjct: 673 ggtggcggagaagacggtgtagac 650
>dbj|AB005246.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MUP24 Length = 77999 Score = 71.9 bits (36), Expect = 2e-09 Identities = 154/192 (80%), Gaps = 1/192 (0%) Strand = Plus / Plus Query: 396 tcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttgatg 455 ||||||||||| || |||||||| || ||||| || || | ||| | ||||||||||| Sbjct: 19109 tcccaggccttttcgttgttgtaaataacggcagctccaaagctacgagccgggttgata 19168 Query: 456 ccggtgccggtgatcgggatggtggccaggtggaccatgaacacggcgaagccgatcggg 515 ||||| |||||||| || |||||||| | || |||||||| ||||| ||||| || || Sbjct: 19169 ccggttccggtgatgggaatggtggctaaatgaaccatgaagacggcaaagccaatggga 19228 Query: 516 aggggcgccaacaccgggacgtgagagttcgcgtgcgctgcgcttggggtcggtggcgga 575 || || ||||| || || |||||||||| | || || | |||||||| ||||| || || Sbjct: 19229 agtggagccaaaactggcacgtgagagt-cacgagcatttcgcttgggatcggttgccga 19287 Query: 576 gaagacggtgta 587 |||||||||||| Sbjct: 19288 gaagacggtgta 19299
>gb|DQ241832.1| Solanum tuberosum clone 174H05 water channel protein-like mRNA, complete cds Length = 1172 Score = 71.9 bits (36), Expect = 2e-09 Identities = 109/132 (82%), Gaps = 1/132 (0%) Strand = Plus / Minus Query: 375 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 434 |||||||||||||| || |||| ||| |||| ||| ||||||||||||| || || || Sbjct: 815 acccagaagatccagtggtcattccatgcctcgtctttgttgtagatgatagcagctcca 756 Query: 435 aggctcctggc-cgggttgatgccggtgccggtgatcgggatggtggccaggtggaccat 493 || |||||||| |||||||| || || |||||||| ||||||||||||| || |||| Sbjct: 755 agactcctggcaggggttgataccagttccggtgattgggatggtggccaaatgaaccaa 696 Query: 494 gaacacggcgaa 505 |||||| ||||| Sbjct: 695 gaacaccgcgaa 684
>gb|BT012927.1| Lycopersicon esculentum clone 114090R, mRNA sequence Length = 1159 Score = 69.9 bits (35), Expect = 9e-09 Identities = 107/131 (81%) Strand = Plus / Minus Query: 375 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 434 |||||||||||||| || |||| ||| || | || | ||||||||||| || || || Sbjct: 854 acccagaagatccagtggtcattccatgcatgctcgtcgttgtagatgatagcagctcca 795 Query: 435 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 494 || |||||||| ||||||||||| || |||||||| ||||||||||||| || |||| | Sbjct: 794 agactcctggcggggttgatgccagttccggtgatggggatggtggccaaatgaaccaag 735 Query: 495 aacacggcgaa 505 ||||| ||||| Sbjct: 734 aacactgcgaa 724
>emb|X95639.1|BOMIPATCP B.oleracea mRNA for transmembrane channel protein (mipA) Length = 1104 Score = 69.9 bits (35), Expect = 9e-09 Identities = 107/131 (81%) Strand = Plus / Minus Query: 375 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 434 |||||||||| ||| || |||||||| || ||||||||||| |||||| ||| || || Sbjct: 816 acccagaagacccaatggtcatcccaagcgttgtccttgttcaagatgatggcagcacca 757 Query: 435 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 494 || || || || |||||||| || || || ||||| |||||||| |||| |||||||| | Sbjct: 756 agacttcttgctgggttgattccagttccagtgatggggatggttgccaagtggaccaag 697 Query: 495 aacacggcgaa 505 ||||| ||||| Sbjct: 696 aacacagcgaa 686
>emb|X73848.1|LETRAMP2 L.esculentum mRNA for tomato ripening membrane protein, clone pNY507 Length = 1107 Score = 69.9 bits (35), Expect = 9e-09 Identities = 107/131 (81%) Strand = Plus / Minus Query: 375 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 434 |||||||||||||| || |||| ||| || | || | ||||||||||| || || || Sbjct: 794 acccagaagatccagtggtcattccatgcatgctcgtcgttgtagatgatagcagctcca 735 Query: 435 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 494 || |||||||| ||||||||||| || |||||||| ||||||||||||| || |||| | Sbjct: 734 agactcctggcggggttgatgccagttccggtgatggggatggtggccaaatgaaccaag 675 Query: 495 aacacggcgaa 505 ||||| ||||| Sbjct: 674 aacactgcgaa 664
>emb|X73847.1|LETRAMP1 L.esculentum mRNA for tomato ripening membrane protein, clone pTOM75 Length = 859 Score = 69.9 bits (35), Expect = 9e-09 Identities = 107/131 (81%) Strand = Plus / Minus Query: 375 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 434 |||||||||||||| || |||| ||| || | || | ||||||||||| || || || Sbjct: 605 acccagaagatccagtggtcattccatgcatgctcgtcgttgtagatgatagcagctcca 546 Query: 435 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 494 || |||||||| ||||||||||| || |||||||| ||||||||||||| || |||| | Sbjct: 545 agactcctggcggggttgatgccagttccggtgatggggatggtggccaaatgaaccaag 486 Query: 495 aacacggcgaa 505 ||||| ||||| Sbjct: 485 aacactgcgaa 475
>emb|AJ849322.1| Populus tremula x Populus tremuloides mRNA for putative plasma membrane intrinsic protein (pip1.2 gene) Length = 1124 Score = 69.9 bits (35), Expect = 9e-09 Identities = 95/115 (82%) Strand = Plus / Minus Query: 369 gggccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcg 428 ||||| |||||||||||||| || |||||||| || | ||| |||||| |||||| |||| Sbjct: 866 gggccaacccagaagatccagtggtcatcccatgcatggtctttgttgaagatgatggcg 807 Query: 429 gcccccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggcca 483 || || || ||||| |||||||| ||||| || || || || |||||||| |||| Sbjct: 806 gctccaagactccttgccgggttaatgccagttccagttatggggatggtagcca 752
>emb|AJ843992.1| Plantago major partial mRNA for aquaporin 2 (aqp2 gene) Length = 1089 Score = 69.9 bits (35), Expect = 9e-09 Identities = 107/131 (81%) Strand = Plus / Minus Query: 375 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 434 |||||||||||||| || ||||||||||| | |||| |||||||||||| ||||| || Sbjct: 770 acccagaagatccagtggtcatcccaggcgtggtccctgttgtagatgattgcggcacca 711 Query: 435 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 494 || || | || ||||| || || || |||||||| |||||||| |||| ||| |||| | Sbjct: 710 agactacgtgcggggttaatacctgtaccggtgattgggatggtagccaagtgcaccaag 651 Query: 495 aacacggcgaa 505 || |||||||| Sbjct: 650 aatacggcgaa 640
>gb|U27347.1|GMU27347 Glycine max putative water channel protein (Pip1) mRNA, complete cds Length = 1255 Score = 69.9 bits (35), Expect = 9e-09 Identities = 134/167 (80%) Strand = Plus / Minus Query: 375 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 434 ||||| |||||||| || |||||||||||||| | | |||||| ||||| || || || Sbjct: 848 acccaaaagatccaatggtcatcccaggccttctgttggttgtacatgacagcagctcct 789 Query: 435 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 494 |||||||| || ||||| ||||| ||||| || | |||||| |||||| ||| |||||| Sbjct: 788 aggctcctagcagggttaatgccagtgcctgttactgggatgttggccaagtgaaccatg 729 Query: 495 aacacggcgaagccgatcgggaggggcgccaacaccgggacgtgaga 541 ||||| || ||||| || || || || ||||| ||||| || ||||| Sbjct: 728 aacacagcaaagccaattggaagtggtgccaaaaccggcacatgaga 682
>gb|AC006260.4| Arabidopsis thaliana chromosome 2 clone T2N18 map ve018, complete sequence Length = 80736 Score = 67.9 bits (34), Expect = 4e-08 Identities = 109/134 (81%) Strand = Plus / Minus Query: 393 tcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttg 452 |||||||| | |||| |||||| ||||| ||||| || || | ||||| ||||||||| Sbjct: 25113 tcatcccatggcttgctcttgttatagattacggcagctccgaaactcctagccgggttg 25054 Query: 453 atgccggtgccggtgatcgggatggtggccaggtggaccatgaacacggcgaagccgatc 512 |||||||| ||||||||||| || ||||||| || ||||| ||||| || || || ||| Sbjct: 25053 atgccggttccggtgatcggaatagtggccaaatgtaccataaacaccgcaaacccaatc 24994 Query: 513 gggaggggcgccaa 526 || || |||||||| Sbjct: 24993 ggaagtggcgccaa 24980 Score = 60.0 bits (30), Expect = 9e-06 Identities = 108/134 (80%) Strand = Plus / Plus Query: 393 tcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttg 452 |||||||| | |||| |||||| |||| |||||||| || | ||||| ||||||||| Sbjct: 20235 tcatcccatggcttgctcttgttaaagattacggcggctccgaaactcctagccgggttg 20294 Query: 453 atgccggtgccggtgatcgggatggtggccaggtggaccatgaacacggcgaagccgatc 512 || ||||| ||||||||||| || ||||||| || ||||| ||||| || || || ||| Sbjct: 20295 ataccggttccggtgatcggaatagtggccaaatgtaccataaacaccgcaaacccaatc 20354 Query: 513 gggaggggcgccaa 526 || || |||||||| Sbjct: 20355 ggaagtggcgccaa 20368
>gb|AF141899.1|AF141899 Vitis berlandieri x Vitis rupestris putative aquaporin PIP1-3 (PIP1-3) mRNA, complete cds Length = 1159 Score = 67.9 bits (34), Expect = 4e-08 Identities = 88/106 (83%) Strand = Plus / Minus Query: 438 ctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatgaac 497 |||||||| ||||| ||||| || || ||||| ||||||||||||| ||| |||| |||| Sbjct: 775 ctcctggctgggttaatgccagttcctgtgatggggatggtggccaagtgaaccaagaac 716 Query: 498 acggcgaagccgatcgggaggggcgccaacaccgggacgtgagagt 543 || || || || || |||||||| ||||| | ||||||||||||| Sbjct: 715 actgcaaacccaatggggaggggggccaaaatagggacgtgagagt 670
>gb|AF290620.1|AF290620 Nicotiana glauca putative PIP2 (MIP4) mRNA, complete cds Length = 1108 Score = 67.9 bits (34), Expect = 4e-08 Identities = 100/122 (81%) Strand = Plus / Minus Query: 413 gttgtagatgacggcggcccccaggctcctggccgggttgatgccggtgccggtgatcgg 472 |||| |||| ||||| || || || ||||| ||||||||||| ||||||||||||||||| Sbjct: 742 gttgaagataacggcagcgccaagactcctagccgggttgattccggtgccggtgatcgg 683 Query: 473 gatggtggccaggtggaccatgaacacggcgaagccgatcgggaggggcgccaacaccgg 532 |||||||| | || |||||||| || || || || || ||||| || |||||||| || Sbjct: 682 aatggtggctaaatgaaccatgaaaactgcaaatccaatggggagtggtgccaacacagg 623 Query: 533 ga 534 || Sbjct: 622 ga 621
>gb|AF188844.1|AF188844 Vitis vinifera cultivar Pinot Noir plasma membrane aquaporin (PIP1b) mRNA, complete cds Length = 1119 Score = 67.9 bits (34), Expect = 4e-08 Identities = 88/106 (83%) Strand = Plus / Minus Query: 438 ctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatgaac 497 |||||||| ||||| ||||| || || ||||| ||||||||||||| ||| |||| |||| Sbjct: 776 ctcctggctgggttaatgccagttcctgtgatggggatggtggccaagtgaaccaagaac 717 Query: 498 acggcgaagccgatcgggaggggcgccaacaccgggacgtgagagt 543 || || || || || |||||||| ||||| | ||||||||||||| Sbjct: 716 actgcaaacccaatggggaggggggccaaaatagggacgtgagagt 671
>emb|AL132966.1|ATF4P12 Arabidopsis thaliana DNA chromosome 3, BAC clone F4P12 Length = 144628 Score = 67.9 bits (34), Expect = 4e-08 Identities = 112/138 (81%) Strand = Plus / Plus Query: 393 tcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttg 452 |||||||| | |||| |||||||||||| ||||| || || | ||||| |||||||| Sbjct: 44790 tcatcccatggcttgctcttgttgtagattacggcagctccgaaactccttgccgggtta 44849 Query: 453 atgccggtgccggtgatcgggatggtggccaggtggaccatgaacacggcgaagccgatc 512 || ||||| ||||| || || ||||| |||| || |||||||||||||| || ||||| Sbjct: 44850 attccggttccggtaatgggaatggtagccaaatgtaccatgaacacggcaaatccgatt 44909 Query: 513 gggaggggcgccaacacc 530 || || |||||||||||| Sbjct: 44910 ggaagtggcgccaacacc 44927 Score = 48.1 bits (24), Expect = 0.033 Identities = 30/32 (93%) Strand = Plus / Plus Query: 559 ttggggtcggtggcggagaagacggtgtagac 590 |||||||| ||||| ||||||||||||||||| Sbjct: 45082 ttggggtcagtggcagagaagacggtgtagac 45113
>dbj|AB030695.1| Raphanus sativus PAQ1b mRNA for plasma membrane aquaporin 1b, complete cds Length = 1053 Score = 67.9 bits (34), Expect = 4e-08 Identities = 100/122 (81%) Strand = Plus / Minus Query: 396 tcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttgatg 455 ||||| || |||||||||||| |||||| || || || || ||||| || ||||||||| Sbjct: 779 tcccaagcgttgtccttgttgaagatgattgcagctccaagactccttgctgggttgatg 720 Query: 456 ccggtgccggtgatcgggatggtggccaggtggaccatgaacacggcgaagccgatcggg 515 || || || ||||| |||||||| || | |||||||| |||||| ||||| ||||| ||| Sbjct: 719 ccagtaccagtgatggggatggttgctaagtggaccaagaacacagcgaatccgataggg 660 Query: 516 ag 517 || Sbjct: 659 ag 658
>ref|XM_470514.1| Oryza sativa (japonica cultivar-group), mRNA Length = 843 Score = 65.9 bits (33), Expect = 1e-07 Identities = 81/97 (83%) Strand = Plus / Minus Query: 447 gggttgatgccggtgccggtgatcgggatggtggccaggtggaccatgaacacggcgaag 506 ||||||||||| ||||||||||| ||||||||||| ||||| || | | ||| || || Sbjct: 656 gggttgatgccagtgccggtgatggggatggtggcaaggtgcacaaccagcaccgccaac 597 Query: 507 ccgatcgggaggggcgccaacaccgggacgtgagagt 543 ||||| || || ||||||| |||||| |||||||||| Sbjct: 596 ccgatgggaagcggcgccagcaccggcacgtgagagt 560
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 Length = 36102668 Score = 65.9 bits (33), Expect = 1e-07 Identities = 81/97 (83%) Strand = Plus / Minus Query: 447 gggttgatgccggtgccggtgatcgggatggtggccaggtggaccatgaacacggcgaag 506 ||||||||||| ||||||||||| ||||||||||| ||||| || | | ||| || || Sbjct: 36057500 gggttgatgccagtgccggtgatggggatggtggcaaggtgcacaaccagcaccgccaac 36057441 Query: 507 ccgatcgggaggggcgccaacaccgggacgtgagagt 543 ||||| || || ||||||| |||||| |||||||||| Sbjct: 36057440 ccgatgggaagcggcgccagcaccggcacgtgagagt 36057404
>gb|AY189974.1| Juglans regia plasma intrinsic protein 2,2 mRNA, complete cds Length = 1278 Score = 65.9 bits (33), Expect = 1e-07 Identities = 147/185 (79%) Strand = Plus / Minus Query: 327 atgtactggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatc 386 ||||||||||| ||||| || || || || || || || | ||| ||||||||||| ||| Sbjct: 937 atgtactggtgatagaatgcagctattgcggcaccaatgaagggtccgacccagaaaatc 878 Query: 387 cactgatcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggcc 446 || || |||||||| ||||| |||||| ||||| || || || || | ||| | ||| Sbjct: 877 cattggtcatcccatgccttatccttgccatagatcacagcagctccgaagcttcgagcc 818 Query: 447 gggttgatgccggtgccggtgatcgggatggtggccaggtggaccatgaacacggcgaag 506 || || || || || |||||||| || |||||||||||||| |||||||||||||| || Sbjct: 817 ggattaataccagttccggtgattggaatggtggccaggtgaaccatgaacacggcaaat 758 Query: 507 ccgat 511 ||||| Sbjct: 757 ccgat 753 Score = 50.1 bits (25), Expect = 0.008 Identities = 31/33 (93%) Strand = Plus / Minus Query: 558 cttggggtcggtggcggagaagacggtgtagac 590 |||||| |||||||| ||||||||||||||||| Sbjct: 707 cttgggatcggtggcagagaagacggtgtagac 675
>gb|DQ445128.1| Striga asiatica isolate St489 major intrinsic protein 1-like protein mRNA, partial cds Length = 474 Score = 65.9 bits (33), Expect = 1e-07 Identities = 45/49 (91%) Strand = Plus / Minus Query: 435 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggcca 483 ||||||||||| ||||||||||| ||||||||||| || |||||||||| Sbjct: 380 aggctcctggcagggttgatgccagtgccggtgataggtatggtggcca 332 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 4,463,163 Number of Sequences: 3902068 Number of extensions: 4463163 Number of successful extensions: 85344 Number of sequences better than 10.0: 416 Number of HSP's better than 10.0 without gapping: 415 Number of HSP's successfully gapped in prelim test: 6 Number of HSP's that attempted gapping in prelim test: 82704 Number of HSP's gapped (non-prelim): 2518 length of query: 591 length of database: 17,233,045,268 effective HSP length: 23 effective length of query: 568 effective length of database: 17,143,297,704 effective search space: 9737393095872 effective search space used: 9737393095872 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)
