| Clone Name | rbags19i08 |
|---|---|
| Clone Library Name | barley_pub |
>ref|XM_468756.1| Oryza sativa (japonica cultivar-group), mRNA Length = 635 Score = 339 bits (171), Expect = 5e-90 Identities = 258/287 (89%) Strand = Plus / Minus Query: 206 tggtcaagatcacgccttccctgggaggtgatgagccttccacccttggggtcgacatca 265 ||||| ||||||||||||||||||||||||||||| ||||||||||| |||||||||||| Sbjct: 460 tggtccagatcacgccttccctgggaggtgatgagtcttccacccttcgggtcgacatca 401 Query: 266 atgatgcccatcttctgcaactcctgaaggatgttgcgggaaacagcaccactgctcttg 325 ||||||||||||||||||| || ||||||||||||||| || | ||| || ||||||||| Sbjct: 400 atgatgcccatcttctgcagctgctgaaggatgttgcgtgagatagcgccgctgctcttg 341 Query: 326 cagaagtgtggggggcgtgaaccgttcctctgacggccaccatagatcttctggaatcca 385 |||||||| ||||||||||| ||||||||||| ||||||||||||||||||||||| ||| Sbjct: 340 cagaagtgcggggggcgtgagccgttcctctggcggccaccatagatcttctggaagcca 281 Query: 386 ccaatcccaattccctgcctcaggtagatcttccttgccatcgaggcagccctgatgtag 445 || | ||||| |||||||||||||||||||||||||| |||||||||||||| ||||| Sbjct: 280 cctacaccaataccctgcctcaggtagatcttccttgcaatcgaggcagccctcgtgtag 221 Query: 446 taccagtcagcgtcagtaggcggcagctccttgaaccttgcagtctt 492 |||||||| | ||| ||| || |||||||||||||| |||||||| Sbjct: 220 taccagtccggatcataaggagggagctccttgaacctcgcagtctt 174
>ref|XM_468752.1| Oryza sativa (japonica cultivar-group), mRNA Length = 829 Score = 315 bits (159), Expect = 8e-83 Identities = 255/287 (88%) Strand = Plus / Minus Query: 206 tggtcaagatcacgccttccctgggaggtgatgagccttccacccttggggtcgacatca 265 ||||| ||||||||||||||||||||||||||||| ||||| ||||||||||||||||| Sbjct: 483 tggtccagatcacgccttccctgggaggtgatgagtcttccgcccttggggtcgacatcg 424 Query: 266 atgatgcccatcttctgcaactcctgaaggatgttgcgggaaacagcaccactgctcttg 325 ||||||||||||||||||| || ||||||||||||||| || | ||| || ||||||||| Sbjct: 423 atgatgcccatcttctgcagctgctgaaggatgttgcgtgagatagcgccgctgctcttg 364 Query: 326 cagaagtgtggggggcgtgaaccgttcctctgacggccaccatagatcttctggaatcca 385 |||||||| ||||| ||||| || |||||||| ||||||||||||||||||||||| ||| Sbjct: 363 cagaagtgcgggggacgtgagccattcctctggcggccaccatagatcttctggaagcca 304 Query: 386 ccaatcccaattccctgcctcaggtagatcttccttgccatcgaggcagccctgatgtag 445 || | ||||| |||||||||||||||||||||||||| |||||||||||||| ||||| Sbjct: 303 cctacaccaataccctgcctcaggtagatcttccttgcaatcgaggcagccctcgtgtag 244 Query: 446 taccagtcagcgtcagtaggcggcagctccttgaaccttgcagtctt 492 |||||||| | ||| ||| || |||||||||||||| |||||||| Sbjct: 243 taccagtccggatcataaggagggagctccttgaacctcgcagtctt 197
>dbj|AK104954.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-045-G11, full insert sequence Length = 786 Score = 315 bits (159), Expect = 8e-83 Identities = 255/287 (88%) Strand = Plus / Minus Query: 206 tggtcaagatcacgccttccctgggaggtgatgagccttccacccttggggtcgacatca 265 ||||| ||||||||||||||||||||||||||||| ||||| ||||||||||||||||| Sbjct: 491 tggtccagatcacgccttccctgggaggtgatgagtcttccgcccttggggtcgacatcg 432 Query: 266 atgatgcccatcttctgcaactcctgaaggatgttgcgggaaacagcaccactgctcttg 325 ||||||||||||||||||| || ||||||||||||||| || | ||| || ||||||||| Sbjct: 431 atgatgcccatcttctgcagctgctgaaggatgttgcgtgagatagcgccgctgctcttg 372 Query: 326 cagaagtgtggggggcgtgaaccgttcctctgacggccaccatagatcttctggaatcca 385 |||||||| ||||| ||||| || |||||||| ||||||||||||||||||||||| ||| Sbjct: 371 cagaagtgcgggggacgtgagccattcctctggcggccaccatagatcttctggaagcca 312 Query: 386 ccaatcccaattccctgcctcaggtagatcttccttgccatcgaggcagccctgatgtag 445 || | ||||| |||||||||||||||||||||||||| |||||||||||||| ||||| Sbjct: 311 cctacaccaataccctgcctcaggtagatcttccttgcaatcgaggcagccctcgtgtag 252 Query: 446 taccagtcagcgtcagtaggcggcagctccttgaaccttgcagtctt 492 |||||||| | ||| ||| || |||||||||||||| |||||||| Sbjct: 251 taccagtccggatcataaggagggagctccttgaacctcgcagtctt 205
>dbj|AK099047.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013147E16, full insert sequence Length = 937 Score = 315 bits (159), Expect = 8e-83 Identities = 255/287 (88%) Strand = Plus / Minus Query: 206 tggtcaagatcacgccttccctgggaggtgatgagccttccacccttggggtcgacatca 265 ||||| ||||||||||||||||||||||||||||| ||||| ||||||||||||||||| Sbjct: 492 tggtccagatcacgccttccctgggaggtgatgagtcttccgcccttggggtcgacatcg 433 Query: 266 atgatgcccatcttctgcaactcctgaaggatgttgcgggaaacagcaccactgctcttg 325 ||||||||||||||||||| || ||||||||||||||| || | ||| || ||||||||| Sbjct: 432 atgatgcccatcttctgcagctgctgaaggatgttgcgtgagatagcgccgctgctcttg 373 Query: 326 cagaagtgtggggggcgtgaaccgttcctctgacggccaccatagatcttctggaatcca 385 |||||||| ||||| ||||| || |||||||| ||||||||||||||||||||||| ||| Sbjct: 372 cagaagtgcgggggacgtgagccattcctctggcggccaccatagatcttctggaagcca 313 Query: 386 ccaatcccaattccctgcctcaggtagatcttccttgccatcgaggcagccctgatgtag 445 || | ||||| |||||||||||||||||||||||||| |||||||||||||| ||||| Sbjct: 312 cctacaccaataccctgcctcaggtagatcttccttgcaatcgaggcagccctcgtgtag 253 Query: 446 taccagtcagcgtcagtaggcggcagctccttgaaccttgcagtctt 492 |||||||| | ||| ||| || |||||||||||||| |||||||| Sbjct: 252 taccagtccggatcataaggagggagctccttgaacctcgcagtctt 206
>dbj|AK067470.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013106H18, full insert sequence Length = 862 Score = 315 bits (159), Expect = 8e-83 Identities = 255/287 (88%) Strand = Plus / Minus Query: 206 tggtcaagatcacgccttccctgggaggtgatgagccttccacccttggggtcgacatca 265 ||||| ||||||||||||||||||||||||||||| ||||| ||||||||||||||||| Sbjct: 494 tggtccagatcacgccttccctgggaggtgatgagtcttccgcccttggggtcgacatcg 435 Query: 266 atgatgcccatcttctgcaactcctgaaggatgttgcgggaaacagcaccactgctcttg 325 ||||||||||||||||||| || ||||||||||||||| || | ||| || ||||||||| Sbjct: 434 atgatgcccatcttctgcagctgctgaaggatgttgcgtgagatagcgccgctgctcttg 375 Query: 326 cagaagtgtggggggcgtgaaccgttcctctgacggccaccatagatcttctggaatcca 385 |||||||| ||||| ||||| || |||||||| ||||||||||||||||||||||| ||| Sbjct: 374 cagaagtgcgggggacgtgagccattcctctggcggccaccatagatcttctggaagcca 315 Query: 386 ccaatcccaattccctgcctcaggtagatcttccttgccatcgaggcagccctgatgtag 445 || | ||||| |||||||||||||||||||||||||| |||||||||||||| ||||| Sbjct: 314 cctacaccaataccctgcctcaggtagatcttccttgcaatcgaggcagccctcgtgtag 255 Query: 446 taccagtcagcgtcagtaggcggcagctccttgaaccttgcagtctt 492 |||||||| | ||| ||| || |||||||||||||| |||||||| Sbjct: 254 taccagtccggatcataaggagggagctccttgaacctcgcagtctt 208
>gb|BT016991.1| Zea mays clone EK07D2305A08.c mRNA sequence Length = 737 Score = 305 bits (154), Expect = 7e-80 Identities = 262/298 (87%) Strand = Plus / Minus Query: 195 ttccagcaacctggtcaagatcacgccttccctgggaggtgatgagccttccacccttgg 254 ||||||| |||||||| ||||||||||||||||||||||||| | ||| ||||||||||| Sbjct: 488 ttccagccacctggtccagatcacgccttccctgggaggtgaggcgccgtccacccttgg 429 Query: 255 ggtcgacatcaatgatgcccatcttctgcaactcctgaaggatgttgcgggaaacagcac 314 | |||||||||||||||||||||| ||||| || ||| ||||||||||| |||| |||| Sbjct: 428 gatcgacatcaatgatgcccatctcctgcagctgctggaggatgttgcgtgaaatggcac 369 Query: 315 cactgctcttgcagaagtgtggggggcgtgaaccgttcctctgacggccaccatagatct 374 ||||||||||||||||||| || |||||||| || |||||||| ||||||||||| |||| Sbjct: 368 cactgctcttgcagaagtgaggtgggcgtgagccattcctctggcggccaccataaatct 309 Query: 375 tctggaatccaccaatcccaattccctgcctcaggtagatcttccttgccatcgaggcag 434 ||||||| ||||||| ||||| || || |||| ||||||||||||||| | || |||| Sbjct: 308 tctggaagccaccaacaccaatgccttgtctcaagtagatcttccttgctacagatgcag 249 Query: 435 ccctgatgtagtaccagtcagcgtcagtaggcggcagctccttgaaccttgcagtctt 492 ||||||||||||||||||||| |||| ||| || |||||||||||||| |||||||| Sbjct: 248 ccctgatgtagtaccagtcagggtcataaggagggagctccttgaacctcgcagtctt 191
>gb|AY110589.1| Zea mays CL4331_3 mRNA sequence Length = 860 Score = 305 bits (154), Expect = 7e-80 Identities = 262/298 (87%) Strand = Plus / Plus Query: 195 ttccagcaacctggtcaagatcacgccttccctgggaggtgatgagccttccacccttgg 254 ||||||| |||||||| ||||||||||||||||||||||||||| ||| ||||||||||| Sbjct: 387 ttccagccacctggtccagatcacgccttccctgggaggtgatgcgccgtccacccttgg 446 Query: 255 ggtcgacatcaatgatgcccatcttctgcaactcctgaaggatgttgcgggaaacagcac 314 | |||||||||||||||||||||| ||||| || ||| ||||||||||| |||| |||| Sbjct: 447 gatcgacatcaatgatgcccatctcctgcagctgctggaggatgttgcgtgaaatggcac 506 Query: 315 cactgctcttgcagaagtgtggggggcgtgaaccgttcctctgacggccaccatagatct 374 ||||||||||||||||||| || ||||| || || |||||||| ||||||||||| |||| Sbjct: 507 cactgctcttgcagaagtgaggtgggcgggagccattcctctggcggccaccataaatct 566 Query: 375 tctggaatccaccaatcccaattccctgcctcaggtagatcttccttgccatcgaggcag 434 ||||||| ||||||| ||||| || || |||| ||||||||||||||| | || |||| Sbjct: 567 tctggaagccaccaacaccaatgccttgtctcaagtagatcttccttgctacagatgcag 626 Query: 435 ccctgatgtagtaccagtcagcgtcagtaggcggcagctccttgaaccttgcagtctt 492 ||||||||||||||||||||| |||| ||| || |||||||||||||| |||||||| Sbjct: 627 ccctgatgtagtaccagtcagggtcataaggagggagctccttgaacctcgcagtctt 684
>gb|AY109388.1| Zea mays CL4331_2 mRNA sequence Length = 1008 Score = 258 bits (130), Expect = 2e-65 Identities = 256/298 (85%) Strand = Plus / Plus Query: 195 ttccagcaacctggtcaagatcacgccttccctgggaggtgatgagccttccacccttgg 254 ||||||| || ||||| |||||||||||||||||| ||||||||| | ||||||||||| Sbjct: 223 ttccagccacttggtccagatcacgccttccctggttggtgatgaggcgtccacccttgg 282 Query: 255 ggtcgacatcaatgatgcccatcttctgcaactcctgaaggatgttgcgggaaacagcac 314 | |||||||| ||||||||||| |||||| || ||| ||||||||||| |||| |||| Sbjct: 283 gatcgacatcgatgatgcccataatctgcagctgctgcaggatgttgcgtgaaatggcac 342 Query: 315 cactgctcttgcagaagtgtggggggcgtgaaccgttcctctgacggccaccatagatct 374 |||||||||||||||||||||| ||||| || || |||||||| |||||||| ||||||| Sbjct: 343 cactgctcttgcagaagtgtggtgggcgggagccattcctctggcggccaccgtagatct 402 Query: 375 tctggaatccaccaatcccaattccctgcctcaggtagatcttccttgccatcgaggcag 434 |||| || ||||| | || || || ||||| ||||||||||||||||| || || |||| Sbjct: 403 tctgaaagccacccacaccgatgccttgccttaggtagatcttccttgcaatggatgcag 462 Query: 435 ccctgatgtagtaccagtcagcgtcagtaggcggcagctccttgaaccttgcagtctt 492 ||||||||||||||||||||| ||| ||| || |||||||||||||| |||||||| Sbjct: 463 ccctgatgtagtaccagtcaggatcataaggaggaagctccttgaacctcgcagtctt 520
>gb|AC114983.6| Oryza sativa (japonica cultivar-group) chromosome 3 clone OSJNBa0032H19 map E30331S, complete sequence Length = 164820 Score = 232 bits (117), Expect = 9e-58 Identities = 168/185 (90%) Strand = Plus / Plus Query: 248 cccttggggtcgacatcaatgatgcccatcttctgcaactcctgaaggatgttgcgggaa 307 ||||| ||||||||||||||||||||||||||||||| || ||||||||||||||| || Sbjct: 23077 cccttcgggtcgacatcaatgatgcccatcttctgcagctgctgaaggatgttgcgtgag 23136 Query: 308 acagcaccactgctcttgcagaagtgtggggggcgtgaaccgttcctctgacggccacca 367 | ||| || ||||||||||||||||| ||||||||||| ||||||||||| ||||||||| Sbjct: 23137 atagcgccgctgctcttgcagaagtgcggggggcgtgagccgttcctctggcggccacca 23196 Query: 368 tagatcttctggaatccaccaatcccaattccctgcctcaggtagatcttccttgccatc 427 |||||||||||||| ||||| | ||||| |||||||||||||||||||||||||| ||| Sbjct: 23197 tagatcttctggaagccacctacaccaataccctgcctcaggtagatcttccttgcaatc 23256 Query: 428 gaggc 432 ||||| Sbjct: 23257 gaggc 23261 Score = 216 bits (109), Expect = 5e-53 Identities = 166/185 (89%) Strand = Plus / Plus Query: 248 cccttggggtcgacatcaatgatgcccatcttctgcaactcctgaaggatgttgcgggaa 307 ||||||||||||||||| ||||||||||||||||||| || ||||||||||||||| || Sbjct: 35214 cccttggggtcgacatcgatgatgcccatcttctgcagctgctgaaggatgttgcgtgag 35273 Query: 308 acagcaccactgctcttgcagaagtgtggggggcgtgaaccgttcctctgacggccacca 367 | ||| || ||||||||||||||||| ||||| ||||| || |||||||| ||||||||| Sbjct: 35274 atagcgccgctgctcttgcagaagtgcgggggacgtgagccattcctctggcggccacca 35333 Query: 368 tagatcttctggaatccaccaatcccaattccctgcctcaggtagatcttccttgccatc 427 |||||||||||||| ||||| | ||||| |||||||||||||||||||||||||| ||| Sbjct: 35334 tagatcttctggaagccacctacaccaataccctgcctcaggtagatcttccttgcaatc 35393 Query: 428 gaggc 432 ||||| Sbjct: 35394 gaggc 35398 Score = 69.9 bits (35), Expect = 7e-09 Identities = 41/43 (95%) Strand = Plus / Plus Query: 206 tggtcaagatcacgccttccctgggaggtgatgagccttccac 248 ||||| ||||||||||||||||||||||||||||| ||||||| Sbjct: 22951 tggtccagatcacgccttccctgggaggtgatgagtcttccac 22993 Score = 65.9 bits (33), Expect = 1e-07 Identities = 39/41 (95%) Strand = Plus / Plus Query: 206 tggtcaagatcacgccttccctgggaggtgatgagccttcc 246 ||||| ||||||||||||||||||||||||||||| ||||| Sbjct: 35094 tggtccagatcacgccttccctgggaggtgatgagtcttcc 35134 Score = 42.1 bits (21), Expect = 1.7 Identities = 51/61 (83%) Strand = Plus / Plus Query: 432 cagccctgatgtagtaccagtcagcgtcagtaggcggcagctccttgaaccttgcagtct 491 ||||||| ||||||||||||| | ||| ||| || |||||||||||||| ||||||| Sbjct: 35543 cagccctcgtgtagtaccagtccggatcataaggagggagctccttgaacctcgcagtct 35602 Query: 492 t 492 | Sbjct: 35603 t 35603 Score = 42.1 bits (21), Expect = 1.7 Identities = 51/61 (83%) Strand = Plus / Plus Query: 432 cagccctgatgtagtaccagtcagcgtcagtaggcggcagctccttgaaccttgcagtct 491 ||||||| ||||||||||||| | ||| ||| || |||||||||||||| ||||||| Sbjct: 23406 cagccctcgtgtagtaccagtccggatcataaggagggagctccttgaacctcgcagtct 23465 Query: 492 t 492 | Sbjct: 23466 t 23466
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 Length = 36102668 Score = 232 bits (117), Expect = 9e-58 Identities = 168/185 (90%) Strand = Plus / Minus Query: 248 cccttggggtcgacatcaatgatgcccatcttctgcaactcctgaaggatgttgcgggaa 307 ||||| ||||||||||||||||||||||||||||||| || ||||||||||||||| || Sbjct: 17540666 cccttcgggtcgacatcaatgatgcccatcttctgcagctgctgaaggatgttgcgtgag 17540607 Query: 308 acagcaccactgctcttgcagaagtgtggggggcgtgaaccgttcctctgacggccacca 367 | ||| || ||||||||||||||||| ||||||||||| ||||||||||| ||||||||| Sbjct: 17540606 atagcgccgctgctcttgcagaagtgcggggggcgtgagccgttcctctggcggccacca 17540547 Query: 368 tagatcttctggaatccaccaatcccaattccctgcctcaggtagatcttccttgccatc 427 |||||||||||||| ||||| | ||||| |||||||||||||||||||||||||| ||| Sbjct: 17540546 tagatcttctggaagccacctacaccaataccctgcctcaggtagatcttccttgcaatc 17540487 Query: 428 gaggc 432 ||||| Sbjct: 17540486 gaggc 17540482 Score = 216 bits (109), Expect = 5e-53 Identities = 166/185 (89%) Strand = Plus / Minus Query: 248 cccttggggtcgacatcaatgatgcccatcttctgcaactcctgaaggatgttgcgggaa 307 ||||||||||||||||| ||||||||||||||||||| || ||||||||||||||| || Sbjct: 17528529 cccttggggtcgacatcgatgatgcccatcttctgcagctgctgaaggatgttgcgtgag 17528470 Query: 308 acagcaccactgctcttgcagaagtgtggggggcgtgaaccgttcctctgacggccacca 367 | ||| || ||||||||||||||||| ||||| ||||| || |||||||| ||||||||| Sbjct: 17528469 atagcgccgctgctcttgcagaagtgcgggggacgtgagccattcctctggcggccacca 17528410 Query: 368 tagatcttctggaatccaccaatcccaattccctgcctcaggtagatcttccttgccatc 427 |||||||||||||| ||||| | ||||| |||||||||||||||||||||||||| ||| Sbjct: 17528409 tagatcttctggaagccacctacaccaataccctgcctcaggtagatcttccttgcaatc 17528350 Query: 428 gaggc 432 ||||| Sbjct: 17528349 gaggc 17528345 Score = 69.9 bits (35), Expect = 7e-09 Identities = 41/43 (95%) Strand = Plus / Minus Query: 206 tggtcaagatcacgccttccctgggaggtgatgagccttccac 248 ||||| ||||||||||||||||||||||||||||| ||||||| Sbjct: 17540792 tggtccagatcacgccttccctgggaggtgatgagtcttccac 17540750 Score = 65.9 bits (33), Expect = 1e-07 Identities = 39/41 (95%) Strand = Plus / Minus Query: 206 tggtcaagatcacgccttccctgggaggtgatgagccttcc 246 ||||| ||||||||||||||||||||||||||||| ||||| Sbjct: 17528649 tggtccagatcacgccttccctgggaggtgatgagtcttcc 17528609 Score = 42.1 bits (21), Expect = 1.7 Identities = 51/61 (83%) Strand = Plus / Minus Query: 432 cagccctgatgtagtaccagtcagcgtcagtaggcggcagctccttgaaccttgcagtct 491 ||||||| ||||||||||||| | ||| ||| || |||||||||||||| ||||||| Sbjct: 17540337 cagccctcgtgtagtaccagtccggatcataaggagggagctccttgaacctcgcagtct 17540278 Query: 492 t 492 | Sbjct: 17540277 t 17540277 Score = 42.1 bits (21), Expect = 1.7 Identities = 51/61 (83%) Strand = Plus / Minus Query: 432 cagccctgatgtagtaccagtcagcgtcagtaggcggcagctccttgaaccttgcagtct 491 ||||||| ||||||||||||| | ||| ||| || |||||||||||||| ||||||| Sbjct: 17528200 cagccctcgtgtagtaccagtccggatcataaggagggagctccttgaacctcgcagtct 17528141 Query: 492 t 492 | Sbjct: 17528140 t 17528140
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete sequence Length = 36192742 Score = 232 bits (117), Expect = 9e-58 Identities = 168/185 (90%) Strand = Plus / Minus Query: 248 cccttggggtcgacatcaatgatgcccatcttctgcaactcctgaaggatgttgcgggaa 307 ||||| ||||||||||||||||||||||||||||||| || ||||||||||||||| || Sbjct: 17534207 cccttcgggtcgacatcaatgatgcccatcttctgcagctgctgaaggatgttgcgtgag 17534148 Query: 308 acagcaccactgctcttgcagaagtgtggggggcgtgaaccgttcctctgacggccacca 367 | ||| || ||||||||||||||||| ||||||||||| ||||||||||| ||||||||| Sbjct: 17534147 atagcgccgctgctcttgcagaagtgcggggggcgtgagccgttcctctggcggccacca 17534088 Query: 368 tagatcttctggaatccaccaatcccaattccctgcctcaggtagatcttccttgccatc 427 |||||||||||||| ||||| | ||||| |||||||||||||||||||||||||| ||| Sbjct: 17534087 tagatcttctggaagccacctacaccaataccctgcctcaggtagatcttccttgcaatc 17534028 Query: 428 gaggc 432 ||||| Sbjct: 17534027 gaggc 17534023 Score = 216 bits (109), Expect = 5e-53 Identities = 166/185 (89%) Strand = Plus / Minus Query: 248 cccttggggtcgacatcaatgatgcccatcttctgcaactcctgaaggatgttgcgggaa 307 ||||||||||||||||| ||||||||||||||||||| || ||||||||||||||| || Sbjct: 17522070 cccttggggtcgacatcgatgatgcccatcttctgcagctgctgaaggatgttgcgtgag 17522011 Query: 308 acagcaccactgctcttgcagaagtgtggggggcgtgaaccgttcctctgacggccacca 367 | ||| || ||||||||||||||||| ||||| ||||| || |||||||| ||||||||| Sbjct: 17522010 atagcgccgctgctcttgcagaagtgcgggggacgtgagccattcctctggcggccacca 17521951 Query: 368 tagatcttctggaatccaccaatcccaattccctgcctcaggtagatcttccttgccatc 427 |||||||||||||| ||||| | ||||| |||||||||||||||||||||||||| ||| Sbjct: 17521950 tagatcttctggaagccacctacaccaataccctgcctcaggtagatcttccttgcaatc 17521891 Query: 428 gaggc 432 ||||| Sbjct: 17521890 gaggc 17521886 Score = 69.9 bits (35), Expect = 7e-09 Identities = 41/43 (95%) Strand = Plus / Minus Query: 206 tggtcaagatcacgccttccctgggaggtgatgagccttccac 248 ||||| ||||||||||||||||||||||||||||| ||||||| Sbjct: 17534333 tggtccagatcacgccttccctgggaggtgatgagtcttccac 17534291 Score = 65.9 bits (33), Expect = 1e-07 Identities = 39/41 (95%) Strand = Plus / Minus Query: 206 tggtcaagatcacgccttccctgggaggtgatgagccttcc 246 ||||| ||||||||||||||||||||||||||||| ||||| Sbjct: 17522190 tggtccagatcacgccttccctgggaggtgatgagtcttcc 17522150 Score = 42.1 bits (21), Expect = 1.7 Identities = 51/61 (83%) Strand = Plus / Minus Query: 432 cagccctgatgtagtaccagtcagcgtcagtaggcggcagctccttgaaccttgcagtct 491 ||||||| ||||||||||||| | ||| ||| || |||||||||||||| ||||||| Sbjct: 17533878 cagccctcgtgtagtaccagtccggatcataaggagggagctccttgaacctcgcagtct 17533819 Query: 492 t 492 | Sbjct: 17533818 t 17533818 Score = 42.1 bits (21), Expect = 1.7 Identities = 51/61 (83%) Strand = Plus / Minus Query: 432 cagccctgatgtagtaccagtcagcgtcagtaggcggcagctccttgaaccttgcagtct 491 ||||||| ||||||||||||| | ||| ||| || |||||||||||||| ||||||| Sbjct: 17521741 cagccctcgtgtagtaccagtccggatcataaggagggagctccttgaacctcgcagtct 17521682 Query: 492 t 492 | Sbjct: 17521681 t 17521681
>dbj|D29730.1|RICYK44 Oryza sativa mRNA, partial homologous to ribosomal protein S19 gene Length = 314 Score = 159 bits (80), Expect = 1e-35 Identities = 134/152 (88%) Strand = Plus / Minus Query: 341 cgtgaaccgttcctctgacggccaccatagatcttctggaatccaccaatcccaattccc 400 ||||| ||||||||||| ||||||||||||||||||||||| ||||| | ||||| ||| Sbjct: 314 cgtgagccgttcctctggcggccaccatagatcttctggaagccacctacaccaataccc 255 Query: 401 tgcctcaggtagatcttccttgccatcgaggcagccctgatgtagtaccagtcagcgtca 460 ||||||||||||||||||||||| |||||||||||||| ||||||||||||| | ||| Sbjct: 254 tgcctcaggtagatcttccttgcaatcgaggcagccctcgtgtagtaccagtccggatca 195 Query: 461 gtaggcggcagctccttgaaccttgcagtctt 492 ||| || |||||||||||||| |||||||| Sbjct: 194 taaggagggagctccttgaacctcgcagtctt 163
>ref|NM_125510.3| Arabidopsis thaliana structural constituent of ribosome AT5G61170 mRNA, complete cds Length = 645 Score = 60.0 bits (30), Expect = 7e-06 Identities = 51/58 (87%) Strand = Plus / Minus Query: 403 cctcaggtagatcttccttgccatcgaggcagccctgatgtagtaccagtcagcgtca 460 ||||||||| | |||||| ||||| || ||||| ||||||||||||||||||| |||| Sbjct: 263 cctcaggtaaaccttcctagccatggaagcagctctgatgtagtaccagtcagggtca 206 Score = 40.1 bits (20), Expect = 6.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 307 aacagcaccactgctcttgcagaa 330 |||| ||||||||||||||||||| Sbjct: 359 aacaccaccactgctcttgcagaa 336
>gb|BT010524.1| Arabidopsis thaliana At5g61170 gene, complete cds Length = 432 Score = 60.0 bits (30), Expect = 7e-06 Identities = 51/58 (87%) Strand = Plus / Minus Query: 403 cctcaggtagatcttccttgccatcgaggcagccctgatgtagtaccagtcagcgtca 460 ||||||||| | |||||| ||||| || ||||| ||||||||||||||||||| |||| Sbjct: 204 cctcaggtaaaccttcctagccatggaagcagctctgatgtagtaccagtcagggtca 147 Score = 40.1 bits (20), Expect = 6.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 307 aacagcaccactgctcttgcagaa 330 |||| ||||||||||||||||||| Sbjct: 300 aacaccaccactgctcttgcagaa 277
>emb|BX832341.1|CNS09ZKD Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH66ZF08 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress) Length = 645 Score = 60.0 bits (30), Expect = 7e-06 Identities = 51/58 (87%) Strand = Plus / Minus Query: 403 cctcaggtagatcttccttgccatcgaggcagccctgatgtagtaccagtcagcgtca 460 ||||||||| | |||||| ||||| || ||||| ||||||||||||||||||| |||| Sbjct: 263 cctcaggtaaaccttcctagccatggaagcagctctgatgtagtaccagtcagggtca 206 Score = 40.1 bits (20), Expect = 6.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 307 aacagcaccactgctcttgcagaa 330 |||| ||||||||||||||||||| Sbjct: 359 aacaccaccactgctcttgcagaa 336
>dbj|AK175989.1| Arabidopsis thaliana mRNA for 40S ribosomal protein S19 - like, complete cds, clone: RAFL22-68-D20 Length = 737 Score = 60.0 bits (30), Expect = 7e-06 Identities = 51/58 (87%) Strand = Plus / Minus Query: 403 cctcaggtagatcttccttgccatcgaggcagccctgatgtagtaccagtcagcgtca 460 ||||||||| | |||||| ||||| || ||||| ||||||||||||||||||| |||| Sbjct: 274 cctcaggtaaaccttcctagccatggaagcagctctgatgtagtaccagtcagggtca 217 Score = 40.1 bits (20), Expect = 6.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 307 aacagcaccactgctcttgcagaa 330 |||| ||||||||||||||||||| Sbjct: 370 aacaccaccactgctcttgcagaa 347
>ref|NM_111074.2| Arabidopsis thaliana structural constituent of ribosome AT3G02080 mRNA, complete cds Length = 746 Score = 58.0 bits (29), Expect = 3e-05 Identities = 47/53 (88%) Strand = Plus / Minus Query: 403 cctcaggtagatcttccttgccatcgaggcagccctgatgtagtaccagtcag 455 ||||||||| | |||||||||||| || ||||| |||||||||||||| |||| Sbjct: 291 cctcaggtaaaccttccttgccatagatgcagctctgatgtagtaccaatcag 239
>gb|AY063012.1| Arabidopsis thaliana putative 40S ribosomal protein S19 (At3g02080) mRNA, complete cds Length = 463 Score = 58.0 bits (29), Expect = 3e-05 Identities = 47/53 (88%) Strand = Plus / Minus Query: 403 cctcaggtagatcttccttgccatcgaggcagccctgatgtagtaccagtcag 455 ||||||||| | |||||||||||| || ||||| |||||||||||||| |||| Sbjct: 204 cctcaggtaaaccttccttgccatagatgcagctctgatgtagtaccaatcag 152
>gb|AF370277.1| Arabidopsis thaliana putative 40S ribosomal protein S19 (At3g02080) mRNA, complete cds Length = 670 Score = 58.0 bits (29), Expect = 3e-05 Identities = 47/53 (88%) Strand = Plus / Minus Query: 403 cctcaggtagatcttccttgccatcgaggcagccctgatgtagtaccagtcag 455 ||||||||| | |||||||||||| || ||||| |||||||||||||| |||| Sbjct: 287 cctcaggtaaaccttccttgccatagatgcagctctgatgtagtaccaatcag 235
>emb|BX822422.1|CNS0A71W Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB36ZG05 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 649 Score = 58.0 bits (29), Expect = 3e-05 Identities = 47/53 (88%) Strand = Plus / Minus Query: 403 cctcaggtagatcttccttgccatcgaggcagccctgatgtagtaccagtcag 455 ||||||||| | |||||||||||| || ||||| |||||||||||||| |||| Sbjct: 283 cctcaggtaaaccttccttgccatagatgcagctctgatgtagtaccaatcag 231
>emb|BX825648.1|CNS0A6BC Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTSIL53ZD11 of Silique of strain col-0 of Arabidopsis thaliana (thale cress) Length = 641 Score = 58.0 bits (29), Expect = 3e-05 Identities = 47/53 (88%) Strand = Plus / Minus Query: 403 cctcaggtagatcttccttgccatcgaggcagccctgatgtagtaccagtcag 455 ||||||||| | |||||||||||| || ||||| |||||||||||||| |||| Sbjct: 273 cctcaggtaaaccttccttgccatagatgcagctctgatgtagtaccaatcag 221
>gb|AY088134.1| Arabidopsis thaliana clone 41619 mRNA, complete sequence Length = 694 Score = 58.0 bits (29), Expect = 3e-05 Identities = 47/53 (88%) Strand = Plus / Minus Query: 403 cctcaggtagatcttccttgccatcgaggcagccctgatgtagtaccagtcag 455 ||||||||| | |||||||||||| || ||||| |||||||||||||| |||| Sbjct: 291 cctcaggtaaaccttccttgccatagatgcagctctgatgtagtaccaatcag 239
>emb|AJ012684.1|CAR012684 Cicer arietinum mRNA for 40S ribosomal protein S19, partial Length = 550 Score = 58.0 bits (29), Expect = 3e-05 Identities = 113/141 (80%) Strand = Plus / Minus Query: 313 accactgctcttgcagaagtgtggggggcgtgaaccgttcctctgacggccaccatagat 372 |||||||||||||||||| || || || || |||||||||||| | |||||||| || Sbjct: 181 accactgctcttgcagaaatgaggtggccgactaccgttcctctggctcccaccataaat 122 Query: 373 cttctggaatccaccaatcccaattccctgcctcaggtagatcttccttgccatcgaggc 432 | ||||||| |||||| |||| ||| ||||| ||||||||| |||||||| || || Sbjct: 121 cctctggaaagcaccaacaccaagtcctcccctcaagtagatctttcttgccattgaagc 62 Query: 433 agccctgatgtagtaccagtc 453 ||| || | ||||||||||| Sbjct: 61 agctctaacatagtaccagtc 41
>gb|DQ241845.1| Solanum tuberosum clone 186F02 40S ribosomal protein S19-like mRNA, complete cds Length = 759 Score = 54.0 bits (27), Expect = 4e-04 Identities = 45/51 (88%) Strand = Plus / Minus Query: 410 tagatcttccttgccatcgaggcagccctgatgtagtaccagtcagcgtca 460 |||||||| || ||||| ||||| ||||||||||||||||| |||| |||| Sbjct: 249 tagatctttctggccatagaggctgccctgatgtagtaccaatcagggtca 199 Score = 48.1 bits (24), Expect = 0.027 Identities = 45/52 (86%) Strand = Plus / Minus Query: 279 tctgcaactcctgaaggatgttgcgggaaacagcaccactgctcttgcagaa 330 ||||||| | ||||||||||| ||| | ||| | |||||||||||||||||| Sbjct: 380 tctgcaattgctgaaggatgtggcgtgcaactgaaccactgctcttgcagaa 329
>gb|AY496117.1| Capsicum annuum 40S ribosomal protein S19 mRNA, complete sequence Length = 672 Score = 52.0 bits (26), Expect = 0.002 Identities = 74/90 (82%) Strand = Plus / Minus Query: 241 ccttccacccttggggtcgacatcaatgatgcccatcttctgcaactcctgaaggatgtt 300 ||||||||||||||| || | || |||||| ||| |||||| || ||||||||||| Sbjct: 417 ccttccacccttgggttcaaagtcgatgatgttcatggtctgcagctgctgaaggatgtg 358 Query: 301 gcgggaaacagcaccactgctcttgcagaa 330 ||| | ||| | |||||||||||||||||| Sbjct: 357 gcgtgcaactgaaccactgctcttgcagaa 328 Score = 44.1 bits (22), Expect = 0.43 Identities = 40/46 (86%) Strand = Plus / Minus Query: 410 tagatcttccttgccatcgaggcagccctgatgtagtaccagtcag 455 |||||||| |||||||| || || ||||| ||||||||||| |||| Sbjct: 248 tagatctttcttgccatagaagccgccctaatgtagtaccaatcag 203
>gb|AY496133.1| Capsicum annuum 40S ribosomal protein S19 mRNA, complete cds Length = 398 Score = 52.0 bits (26), Expect = 0.002 Identities = 74/90 (82%) Strand = Plus / Minus Query: 241 ccttccacccttggggtcgacatcaatgatgcccatcttctgcaactcctgaaggatgtt 300 ||||||||||||||| || | || |||||| ||| |||||| || ||||||||||| Sbjct: 119 ccttccacccttgggttcaaagtcgatgatgttcatggtctgcagctgctgaaggatgtg 60 Query: 301 gcgggaaacagcaccactgctcttgcagaa 330 ||| | ||| | |||||||||||||||||| Sbjct: 59 gcgtgcaactgaaccactgctcttgcagaa 30
>gb|DQ104695.1| Lycopersicon pimpinellifolium 40S ribosomal protein S19 (CT189) gene, CT189-7277b allele, partial cds Length = 1409 Score = 46.1 bits (23), Expect = 0.11 Identities = 59/71 (83%) Strand = Plus / Minus Query: 263 tcaatgatgcccatcttctgcaactcctgaaggatgttgcgggaaacagcaccactgctc 322 ||||||||| ||| |||||||||| ||||| |||| ||| | ||| | |||||||||| Sbjct: 775 tcaatgatgttcatgttctgcaactgttgaagaatgtggcgtgcaactgaaccactgctc 716 Query: 323 ttgcagaagtg 333 ||||| ||||| Sbjct: 715 ttgcaaaagtg 705
>gb|DQ104694.1| Lycopersicon pimpinellifolium 40S ribosomal protein S19 (CT189) gene, CT189-7277a allele, partial cds Length = 1410 Score = 46.1 bits (23), Expect = 0.11 Identities = 59/71 (83%) Strand = Plus / Minus Query: 263 tcaatgatgcccatcttctgcaactcctgaaggatgttgcgggaaacagcaccactgctc 322 ||||||||| ||| |||||||||| ||||| |||| ||| | ||| | |||||||||| Sbjct: 776 tcaatgatgttcatgttctgcaactgttgaagaatgtggcgtgcaactgaaccactgctc 717 Query: 323 ttgcagaagtg 333 ||||| ||||| Sbjct: 716 ttgcaaaagtg 706
>gb|DQ104693.1| Lycopersicon pimpinellifolium 40S ribosomal protein S19 (CT189) gene, CT189-7276b allele, partial cds Length = 1411 Score = 46.1 bits (23), Expect = 0.11 Identities = 59/71 (83%) Strand = Plus / Minus Query: 263 tcaatgatgcccatcttctgcaactcctgaaggatgttgcgggaaacagcaccactgctc 322 ||||||||| ||| |||||||||| ||||| |||| ||| | ||| | |||||||||| Sbjct: 777 tcaatgatgttcatgttctgcaactgttgaagaatgtggcgtgcaactgaaccactgctc 718 Query: 323 ttgcagaagtg 333 ||||| ||||| Sbjct: 717 ttgcaaaagtg 707
>gb|DQ104692.1| Lycopersicon pimpinellifolium 40S ribosomal protein S19 (CT189) gene, CT189-7276a allele, partial cds Length = 1412 Score = 46.1 bits (23), Expect = 0.11 Identities = 59/71 (83%) Strand = Plus / Minus Query: 263 tcaatgatgcccatcttctgcaactcctgaaggatgttgcgggaaacagcaccactgctc 322 ||||||||| ||| |||||||||| ||||| |||| ||| | ||| | |||||||||| Sbjct: 778 tcaatgatgttcatgttctgcaactgttgaagaatgtggcgtgcaactgaaccactgctc 719 Query: 323 ttgcagaagtg 333 ||||| ||||| Sbjct: 718 ttgcaaaagtg 708
>gb|DQ104691.1| Lycopersicon pimpinellifolium 40S ribosomal protein S19 (CT189) gene, CT189-7275b allele, partial cds Length = 1412 Score = 46.1 bits (23), Expect = 0.11 Identities = 59/71 (83%) Strand = Plus / Minus Query: 263 tcaatgatgcccatcttctgcaactcctgaaggatgttgcgggaaacagcaccactgctc 322 ||||||||| ||| |||||||||| ||||| |||| ||| | ||| | |||||||||| Sbjct: 778 tcaatgatgttcatgttctgcaactgttgaagaatgtggcgtgcaactgaaccactgctc 719 Query: 323 ttgcagaagtg 333 ||||| ||||| Sbjct: 718 ttgcaaaagtg 708
>gb|DQ104690.1| Lycopersicon pimpinellifolium 40S ribosomal protein S19 (CT189) gene, CT189-7275a allele, partial cds Length = 1413 Score = 46.1 bits (23), Expect = 0.11 Identities = 59/71 (83%) Strand = Plus / Minus Query: 263 tcaatgatgcccatcttctgcaactcctgaaggatgttgcgggaaacagcaccactgctc 322 ||||||||| ||| |||||||||| ||||| |||| ||| | ||| | |||||||||| Sbjct: 779 tcaatgatgttcatgttctgcaactgttgaagaatgtggcgtgcaactgaaccactgctc 720 Query: 323 ttgcagaagtg 333 ||||| ||||| Sbjct: 719 ttgcaaaagtg 709
>gb|DQ104689.1| Lycopersicon pimpinellifolium 40S ribosomal protein S19 (CT189) gene, CT189-7274b allele, partial cds Length = 1412 Score = 46.1 bits (23), Expect = 0.11 Identities = 59/71 (83%) Strand = Plus / Minus Query: 263 tcaatgatgcccatcttctgcaactcctgaaggatgttgcgggaaacagcaccactgctc 322 ||||||||| ||| |||||||||| ||||| |||| ||| | ||| | |||||||||| Sbjct: 778 tcaatgatgttcatgttctgcaactgttgaagaatgtggcgtgcaactgaaccactgctc 719 Query: 323 ttgcagaagtg 333 ||||| ||||| Sbjct: 718 ttgcaaaagtg 708
>gb|DQ104688.1| Lycopersicon pimpinellifolium 40S ribosomal protein S19 (CT189) gene, CT189-7274a allele, partial cds Length = 1413 Score = 46.1 bits (23), Expect = 0.11 Identities = 59/71 (83%) Strand = Plus / Minus Query: 263 tcaatgatgcccatcttctgcaactcctgaaggatgttgcgggaaacagcaccactgctc 322 ||||||||| ||| |||||||||| ||||| |||| ||| | ||| | |||||||||| Sbjct: 779 tcaatgatgttcatgttctgcaactgttgaagaatgtggcgtgcaactgaaccactgctc 720 Query: 323 ttgcagaagtg 333 ||||| ||||| Sbjct: 719 ttgcaaaagtg 709
>gb|DQ104687.1| Lycopersicon pimpinellifolium 40S ribosomal protein S19 (CT189) gene, CT189-7272b allele, partial cds Length = 1412 Score = 46.1 bits (23), Expect = 0.11 Identities = 59/71 (83%) Strand = Plus / Minus Query: 263 tcaatgatgcccatcttctgcaactcctgaaggatgttgcgggaaacagcaccactgctc 322 ||||||||| ||| |||||||||| ||||| |||| ||| | ||| | |||||||||| Sbjct: 778 tcaatgatgttcatgttctgcaactgttgaagaatgtggcgtgcaactgaaccactgctc 719 Query: 323 ttgcagaagtg 333 ||||| ||||| Sbjct: 718 ttgcaaaagtg 708
>gb|DQ104686.1| Lycopersicon pimpinellifolium 40S ribosomal protein S19 (CT189) gene, CT189-7272a allele, partial cds Length = 1413 Score = 46.1 bits (23), Expect = 0.11 Identities = 59/71 (83%) Strand = Plus / Minus Query: 263 tcaatgatgcccatcttctgcaactcctgaaggatgttgcgggaaacagcaccactgctc 322 ||||||||| ||| |||||||||| ||||| |||| ||| | ||| | |||||||||| Sbjct: 779 tcaatgatgttcatgttctgcaactgttgaagaatgtggcgtgcaactgaaccactgctc 720 Query: 323 ttgcagaagtg 333 ||||| ||||| Sbjct: 719 ttgcaaaagtg 709
>gb|DQ104675.1| Lycopersicon hirsutum 40S ribosomal protein S19 (CT189) gene, CT189-7223b allele, partial cds Length = 1398 Score = 46.1 bits (23), Expect = 0.11 Identities = 59/71 (83%) Strand = Plus / Minus Query: 263 tcaatgatgcccatcttctgcaactcctgaaggatgttgcgggaaacagcaccactgctc 322 ||||||||| ||| |||||||||| ||||| |||| ||| | ||| | |||||||||| Sbjct: 779 tcaatgatgttcatgttctgcaactgttgaagaatgtggcgtgcaactgaaccactgctc 720 Query: 323 ttgcagaagtg 333 ||||| ||||| Sbjct: 719 ttgcaaaagtg 709
>gb|DQ104674.1| Lycopersicon hirsutum 40S ribosomal protein S19 (CT189) gene, CT189-7223a allele, partial cds Length = 1398 Score = 46.1 bits (23), Expect = 0.11 Identities = 59/71 (83%) Strand = Plus / Minus Query: 263 tcaatgatgcccatcttctgcaactcctgaaggatgttgcgggaaacagcaccactgctc 322 ||||||||| ||| |||||||||| ||||| |||| ||| | ||| | |||||||||| Sbjct: 779 tcaatgatgttcatgttctgcaactgttgaagaatgtggcgtgcaactgaaccactgctc 720 Query: 323 ttgcagaagtg 333 ||||| ||||| Sbjct: 719 ttgcaaaagtg 709
>gb|DQ104673.1| Lycopersicon hirsutum 40S ribosomal protein S19 (CT189) gene, CT189-7219b allele, partial cds Length = 1398 Score = 46.1 bits (23), Expect = 0.11 Identities = 59/71 (83%) Strand = Plus / Minus Query: 263 tcaatgatgcccatcttctgcaactcctgaaggatgttgcgggaaacagcaccactgctc 322 ||||||||| ||| |||||||||| ||||| |||| ||| | ||| | |||||||||| Sbjct: 779 tcaatgatgttcatgttctgcaactgttgaagaatgtggcgtgcaactgaaccactgctc 720 Query: 323 ttgcagaagtg 333 ||||| ||||| Sbjct: 719 ttgcaaaagtg 709
>gb|DQ104672.1| Lycopersicon hirsutum 40S ribosomal protein S19 (CT189) gene, CT189-7219a allele, partial cds Length = 1398 Score = 46.1 bits (23), Expect = 0.11 Identities = 59/71 (83%) Strand = Plus / Minus Query: 263 tcaatgatgcccatcttctgcaactcctgaaggatgttgcgggaaacagcaccactgctc 322 ||||||||| ||| |||||||||| ||||| |||| ||| | ||| | |||||||||| Sbjct: 779 tcaatgatgttcatgttctgcaactgttgaagaatgtggcgtgcaactgaaccactgctc 720 Query: 323 ttgcagaagtg 333 ||||| ||||| Sbjct: 719 ttgcaaaagtg 709
>gb|DQ104671.1| Lycopersicon hirsutum 40S ribosomal protein S19 (CT189) gene, CT189-7216b allele, partial cds Length = 1398 Score = 46.1 bits (23), Expect = 0.11 Identities = 59/71 (83%) Strand = Plus / Minus Query: 263 tcaatgatgcccatcttctgcaactcctgaaggatgttgcgggaaacagcaccactgctc 322 ||||||||| ||| |||||||||| ||||| |||| ||| | ||| | |||||||||| Sbjct: 779 tcaatgatgttcatgttctgcaactgttgaagaatgtggcgtgcaactgaaccactgctc 720 Query: 323 ttgcagaagtg 333 ||||| ||||| Sbjct: 719 ttgcaaaagtg 709
>gb|DQ104670.1| Lycopersicon hirsutum 40S ribosomal protein S19 (CT189) gene, CT189-7216a allele, partial cds Length = 1398 Score = 46.1 bits (23), Expect = 0.11 Identities = 59/71 (83%) Strand = Plus / Minus Query: 263 tcaatgatgcccatcttctgcaactcctgaaggatgttgcgggaaacagcaccactgctc 322 ||||||||| ||| |||||||||| ||||| |||| ||| | ||| | |||||||||| Sbjct: 779 tcaatgatgttcatgttctgcaactgttgaagaatgtggcgtgcaactgaaccactgctc 720 Query: 323 ttgcagaagtg 333 ||||| ||||| Sbjct: 719 ttgcaaaagtg 709
>gb|DQ104669.1| Lycopersicon hirsutum 40S ribosomal protein S19 (CT189) gene, CT189-7215b allele, partial cds Length = 1398 Score = 46.1 bits (23), Expect = 0.11 Identities = 59/71 (83%) Strand = Plus / Minus Query: 263 tcaatgatgcccatcttctgcaactcctgaaggatgttgcgggaaacagcaccactgctc 322 ||||||||| ||| |||||||||| ||||| |||| ||| | ||| | |||||||||| Sbjct: 779 tcaatgatgttcatgttctgcaactgttgaagaatgtggcgtgcaactgaaccactgctc 720 Query: 323 ttgcagaagtg 333 ||||| ||||| Sbjct: 719 ttgcaaaagtg 709
>gb|DQ104668.1| Lycopersicon hirsutum 40S ribosomal protein S19 (CT189) gene, CT189-7215a allele, partial cds Length = 1398 Score = 46.1 bits (23), Expect = 0.11 Identities = 59/71 (83%) Strand = Plus / Minus Query: 263 tcaatgatgcccatcttctgcaactcctgaaggatgttgcgggaaacagcaccactgctc 322 ||||||||| ||| |||||||||| ||||| |||| ||| | ||| | |||||||||| Sbjct: 779 tcaatgatgttcatgttctgcaactgttgaagaatgtggcgtgcaactgaaccactgctc 720 Query: 323 ttgcagaagtg 333 ||||| ||||| Sbjct: 719 ttgcaaaagtg 709
>gb|DQ104667.1| Lycopersicon chilense 40S ribosomal protein S19 (CT189) gene, CT189-7184b allele, partial cds Length = 1413 Score = 46.1 bits (23), Expect = 0.11 Identities = 59/71 (83%) Strand = Plus / Minus Query: 263 tcaatgatgcccatcttctgcaactcctgaaggatgttgcgggaaacagcaccactgctc 322 ||||||||| ||| |||||||||| ||||| |||| ||| | ||| | |||||||||| Sbjct: 778 tcaatgatgttcatgttctgcaactgttgaagaatgtggcgtgcaactgaaccactgctc 719 Query: 323 ttgcagaagtg 333 ||||| ||||| Sbjct: 718 ttgcaaaagtg 708
>gb|DQ104666.1| Lycopersicon chilense 40S ribosomal protein S19 (CT189) gene, CT189-7184a allele, partial cds Length = 1413 Score = 46.1 bits (23), Expect = 0.11 Identities = 59/71 (83%) Strand = Plus / Minus Query: 263 tcaatgatgcccatcttctgcaactcctgaaggatgttgcgggaaacagcaccactgctc 322 ||||||||| ||| |||||||||| ||||| |||| ||| | ||| | |||||||||| Sbjct: 778 tcaatgatgttcatgttctgcaactgttgaagaatgtggcgtgcaactgaaccactgctc 719 Query: 323 ttgcagaagtg 333 ||||| ||||| Sbjct: 718 ttgcaaaagtg 708
>gb|DQ104665.1| Lycopersicon chilense 40S ribosomal protein S19 (CT189) gene, CT189-7183b allele, partial cds Length = 1413 Score = 46.1 bits (23), Expect = 0.11 Identities = 59/71 (83%) Strand = Plus / Minus Query: 263 tcaatgatgcccatcttctgcaactcctgaaggatgttgcgggaaacagcaccactgctc 322 ||||||||| ||| |||||||||| ||||| |||| ||| | ||| | |||||||||| Sbjct: 778 tcaatgatgttcatgttctgcaactgttgaagaatgtggcgtgcaactgaaccactgctc 719 Query: 323 ttgcagaagtg 333 ||||| ||||| Sbjct: 718 ttgcaaaagtg 708
>gb|DQ104664.1| Lycopersicon chilense 40S ribosomal protein S19 (CT189) gene, CT189-7183a allele, partial cds Length = 1413 Score = 46.1 bits (23), Expect = 0.11 Identities = 59/71 (83%) Strand = Plus / Minus Query: 263 tcaatgatgcccatcttctgcaactcctgaaggatgttgcgggaaacagcaccactgctc 322 ||||||||| ||| |||||||||| ||||| |||| ||| | ||| | |||||||||| Sbjct: 778 tcaatgatgttcatgttctgcaactgttgaagaatgtggcgtgcaactgaaccactgctc 719 Query: 323 ttgcagaagtg 333 ||||| ||||| Sbjct: 718 ttgcaaaagtg 708
>gb|DQ104663.1| Lycopersicon chilense 40S ribosomal protein S19 (CT189) gene, CT189-7180b allele, partial cds Length = 1413 Score = 46.1 bits (23), Expect = 0.11 Identities = 59/71 (83%) Strand = Plus / Minus Query: 263 tcaatgatgcccatcttctgcaactcctgaaggatgttgcgggaaacagcaccactgctc 322 ||||||||| ||| |||||||||| ||||| |||| ||| | ||| | |||||||||| Sbjct: 778 tcaatgatgttcatgttctgcaactgttgaagaatgtggcgtgcaactgaaccactgctc 719 Query: 323 ttgcagaagtg 333 ||||| ||||| Sbjct: 718 ttgcaaaagtg 708
>gb|DQ104662.1| Lycopersicon chilense 40S ribosomal protein S19 (CT189) gene, CT189-7180a allele, partial cds Length = 1413 Score = 46.1 bits (23), Expect = 0.11 Identities = 59/71 (83%) Strand = Plus / Minus Query: 263 tcaatgatgcccatcttctgcaactcctgaaggatgttgcgggaaacagcaccactgctc 322 ||||||||| ||| |||||||||| ||||| |||| ||| | ||| | |||||||||| Sbjct: 778 tcaatgatgttcatgttctgcaactgttgaagaatgtggcgtgcaactgaaccactgctc 719 Query: 323 ttgcagaagtg 333 ||||| ||||| Sbjct: 718 ttgcaaaagtg 708
>gb|DQ104661.1| Lycopersicon chilense 40S ribosomal protein S19 (CT189) gene, CT189-7179b allele, partial cds Length = 1413 Score = 46.1 bits (23), Expect = 0.11 Identities = 59/71 (83%) Strand = Plus / Minus Query: 263 tcaatgatgcccatcttctgcaactcctgaaggatgttgcgggaaacagcaccactgctc 322 ||||||||| ||| |||||||||| ||||| |||| ||| | ||| | |||||||||| Sbjct: 778 tcaatgatgttcatgttctgcaactgttgaagaatgtggcgtgcaactgaaccactgctc 719 Query: 323 ttgcagaagtg 333 ||||| ||||| Sbjct: 718 ttgcaaaagtg 708
>gb|DQ104660.1| Lycopersicon chilense 40S ribosomal protein S19 (CT189) gene, CT189-7179a allele, partial cds Length = 1413 Score = 46.1 bits (23), Expect = 0.11 Identities = 59/71 (83%) Strand = Plus / Minus Query: 263 tcaatgatgcccatcttctgcaactcctgaaggatgttgcgggaaacagcaccactgctc 322 ||||||||| ||| |||||||||| ||||| |||| ||| | ||| | |||||||||| Sbjct: 778 tcaatgatgttcatgttctgcaactgttgaagaatgtggcgtgcaactgaaccactgctc 719 Query: 323 ttgcagaagtg 333 ||||| ||||| Sbjct: 718 ttgcaaaagtg 708
>gb|DQ104659.1| Lycopersicon chilense 40S ribosomal protein S19 (CT189) gene, CT189-7177b allele, partial cds Length = 1413 Score = 46.1 bits (23), Expect = 0.11 Identities = 59/71 (83%) Strand = Plus / Minus Query: 263 tcaatgatgcccatcttctgcaactcctgaaggatgttgcgggaaacagcaccactgctc 322 ||||||||| ||| |||||||||| ||||| |||| ||| | ||| | |||||||||| Sbjct: 778 tcaatgatgttcatgttctgcaactgttgaagaatgtggcgtgcaactgaaccactgctc 719 Query: 323 ttgcagaagtg 333 ||||| ||||| Sbjct: 718 ttgcaaaagtg 708
>gb|DQ104658.1| Lycopersicon chilense 40S ribosomal protein S19 (CT189) gene, CT189-7177a allele, partial cds Length = 1413 Score = 46.1 bits (23), Expect = 0.11 Identities = 59/71 (83%) Strand = Plus / Minus Query: 263 tcaatgatgcccatcttctgcaactcctgaaggatgttgcgggaaacagcaccactgctc 322 ||||||||| ||| |||||||||| ||||| |||| ||| | ||| | |||||||||| Sbjct: 778 tcaatgatgttcatgttctgcaactgttgaagaatgtggcgtgcaactgaaccactgctc 719 Query: 323 ttgcagaagtg 333 ||||| ||||| Sbjct: 718 ttgcaaaagtg 708
>gb|DQ104657.1| Lycopersicon peruvianum 40S ribosomal protein S19 (CT189) gene, CT189-7236b allele, partial cds Length = 1408 Score = 46.1 bits (23), Expect = 0.11 Identities = 59/71 (83%) Strand = Plus / Minus Query: 263 tcaatgatgcccatcttctgcaactcctgaaggatgttgcgggaaacagcaccactgctc 322 ||||||||| ||| |||||||||| ||||| |||| ||| | ||| | |||||||||| Sbjct: 775 tcaatgatgttcatgttctgcaactgttgaagaatgtggcgtgcaactgaaccactgctc 716 Query: 323 ttgcagaagtg 333 ||||| ||||| Sbjct: 715 ttgcaaaagtg 705
>gb|DQ104656.1| Lycopersicon peruvianum 40S ribosomal protein S19 (CT189) gene, CT189-7236a allele, partial cds Length = 1408 Score = 46.1 bits (23), Expect = 0.11 Identities = 59/71 (83%) Strand = Plus / Minus Query: 263 tcaatgatgcccatcttctgcaactcctgaaggatgttgcgggaaacagcaccactgctc 322 ||||||||| ||| |||||||||| ||||| |||| ||| | ||| | |||||||||| Sbjct: 775 tcaatgatgttcatgttctgcaactgttgaagaatgtggcgtgcaactgaaccactgctc 716 Query: 323 ttgcagaagtg 333 ||||| ||||| Sbjct: 715 ttgcaaaagtg 705
>gb|DQ104655.1| Lycopersicon peruvianum 40S ribosomal protein S19 (CT189) gene, CT189-7235b allele, partial cds Length = 1408 Score = 46.1 bits (23), Expect = 0.11 Identities = 59/71 (83%) Strand = Plus / Minus Query: 263 tcaatgatgcccatcttctgcaactcctgaaggatgttgcgggaaacagcaccactgctc 322 ||||||||| ||| |||||||||| ||||| |||| ||| | ||| | |||||||||| Sbjct: 775 tcaatgatgttcatgttctgcaactgttgaagaatgtggcgtgcaactgaaccactgctc 716 Query: 323 ttgcagaagtg 333 ||||| ||||| Sbjct: 715 ttgcaaaagtg 705
>gb|DQ104654.1| Lycopersicon peruvianum 40S ribosomal protein S19 (CT189) gene, CT189-7235a allele, partial cds Length = 1411 Score = 46.1 bits (23), Expect = 0.11 Identities = 59/71 (83%) Strand = Plus / Minus Query: 263 tcaatgatgcccatcttctgcaactcctgaaggatgttgcgggaaacagcaccactgctc 322 ||||||||| ||| |||||||||| ||||| |||| ||| | ||| | |||||||||| Sbjct: 781 tcaatgatgttcatgttctgcaactgttgaagaatgtggcgtgcaactgaaccactgctc 722 Query: 323 ttgcagaagtg 333 ||||| ||||| Sbjct: 721 ttgcaaaagtg 711
>gb|DQ104653.1| Lycopersicon peruvianum 40S ribosomal protein S19 (CT189) gene, CT189-7234b allele, partial cds Length = 1408 Score = 46.1 bits (23), Expect = 0.11 Identities = 59/71 (83%) Strand = Plus / Minus Query: 263 tcaatgatgcccatcttctgcaactcctgaaggatgttgcgggaaacagcaccactgctc 322 ||||||||| ||| |||||||||| ||||| |||| ||| | ||| | |||||||||| Sbjct: 775 tcaatgatgttcatgttctgcaactgttgaagaatgtggcgtgcaactgaaccactgctc 716 Query: 323 ttgcagaagtg 333 ||||| ||||| Sbjct: 715 ttgcaaaagtg 705
>gb|DQ104652.1| Lycopersicon peruvianum 40S ribosomal protein S19 (CT189) gene, CT189-7234a allele, partial cds Length = 1402 Score = 46.1 bits (23), Expect = 0.11 Identities = 59/71 (83%) Strand = Plus / Minus Query: 263 tcaatgatgcccatcttctgcaactcctgaaggatgttgcgggaaacagcaccactgctc 322 ||||||||| ||| |||||||||| ||||| |||| ||| | ||| | |||||||||| Sbjct: 779 tcaatgatgttcatgttctgcaactgttgaagaatgtggcgtgcaactgaaccactgctc 720 Query: 323 ttgcagaagtg 333 ||||| ||||| Sbjct: 719 ttgcaaaagtg 709
>gb|DQ104651.1| Lycopersicon peruvianum 40S ribosomal protein S19 (CT189) gene, CT189-7233b allele, partial cds Length = 1410 Score = 46.1 bits (23), Expect = 0.11 Identities = 59/71 (83%) Strand = Plus / Minus Query: 263 tcaatgatgcccatcttctgcaactcctgaaggatgttgcgggaaacagcaccactgctc 322 ||||||||| ||| |||||||||| ||||| |||| ||| | ||| | |||||||||| Sbjct: 775 tcaatgatgttcatgttctgcaactgttgaagaatgtggcgtgcaactgaaccactgctc 716 Query: 323 ttgcagaagtg 333 ||||| ||||| Sbjct: 715 ttgcaaaagtg 705
>gb|DQ104650.1| Lycopersicon peruvianum 40S ribosomal protein S19 (CT189) gene, CT189-7233a allele, partial cds Length = 1408 Score = 46.1 bits (23), Expect = 0.11 Identities = 59/71 (83%) Strand = Plus / Minus Query: 263 tcaatgatgcccatcttctgcaactcctgaaggatgttgcgggaaacagcaccactgctc 322 ||||||||| ||| |||||||||| ||||| |||| ||| | ||| | |||||||||| Sbjct: 775 tcaatgatgttcatgttctgcaactgttgaagaatgtggcgtgcaactgaaccactgctc 716 Query: 323 ttgcagaagtg 333 ||||| ||||| Sbjct: 715 ttgcaaaagtg 705
>gb|DQ104649.1| Lycopersicon peruvianum 40S ribosomal protein S19 (CT189) gene, CT189-7232b allele, partial cds Length = 1408 Score = 46.1 bits (23), Expect = 0.11 Identities = 59/71 (83%) Strand = Plus / Minus Query: 263 tcaatgatgcccatcttctgcaactcctgaaggatgttgcgggaaacagcaccactgctc 322 ||||||||| ||| |||||||||| ||||| |||| ||| | ||| | |||||||||| Sbjct: 775 tcaatgatgttcatgttctgcaactgttgaagaatgtggcgtgcaactgaaccactgctc 716 Query: 323 ttgcagaagtg 333 ||||| ||||| Sbjct: 715 ttgcaaaagtg 705
>gb|DQ104648.1| Lycopersicon peruvianum 40S ribosomal protein S19 (CT189) gene, CT189-7232a allele, partial cds Length = 1408 Score = 46.1 bits (23), Expect = 0.11 Identities = 59/71 (83%) Strand = Plus / Minus Query: 263 tcaatgatgcccatcttctgcaactcctgaaggatgttgcgggaaacagcaccactgctc 322 ||||||||| ||| |||||||||| ||||| |||| ||| | ||| | |||||||||| Sbjct: 775 tcaatgatgttcatgttctgcaactgttgaagaatgtggcgtgcaactgaaccactgctc 716 Query: 323 ttgcagaagtg 333 ||||| ||||| Sbjct: 715 ttgcaaaagtg 705
>gb|DQ104647.1| Solanum ochranthum 40S ribosomal protein S19 (CT189) gene, partial cds Length = 1543 Score = 46.1 bits (23), Expect = 0.11 Identities = 59/71 (83%) Strand = Plus / Minus Query: 263 tcaatgatgcccatcttctgcaactcctgaaggatgttgcgggaaacagcaccactgctc 322 ||||||||| ||| |||||||||| ||||| |||| ||| | ||| | |||||||||| Sbjct: 776 tcaatgatgttcatgttctgcaactgttgaagaatgtggcgtgcaactgaaccactgctc 717 Query: 323 ttgcagaagtg 333 ||||| ||||| Sbjct: 716 ttgcaaaagtg 706
>gb|AC149197.13| Medicago truncatula clone mth2-33p18, complete sequence Length = 115362 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 310 agcaccactgctcttgcagaa 330 ||||||||||||||||||||| Sbjct: 53651 agcaccactgctcttgcagaa 53671
>emb|AL161941.18| Human DNA sequence from clone RP11-494B22 on chromosome 20 Contains the PPIP11 gene for peptidylprolyl isomerase (cyclophilin) pseudogene 11 and a CpG island, complete sequence Length = 81304 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 111 ataattcaaaactgtagccaa 131 ||||||||||||||||||||| Sbjct: 34162 ataattcaaaactgtagccaa 34142
>gb|AC148395.12| Medicago truncatula clone mth2-28d22, complete sequence Length = 116174 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 310 agcaccactgctcttgcagaa 330 ||||||||||||||||||||| Sbjct: 62524 agcaccactgctcttgcagaa 62504
>gb|AC079755.6| Homo sapiens BAC clone RP11-85L2 from 4, complete sequence Length = 184471 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 20 taattaaaaactcagacaatt 40 ||||||||||||||||||||| Sbjct: 160083 taattaaaaactcagacaatt 160063
>gb|AC013272.5| Homo sapiens BAC clone RP11-401C13 from 2, complete sequence Length = 172705 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 316 actgctcttgcagaagtgtgg 336 ||||||||||||||||||||| Sbjct: 2468 actgctcttgcagaagtgtgg 2488
>dbj|AB006696.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MAF19 Length = 78379 Score = 42.1 bits (21), Expect = 1.7 Identities = 27/29 (93%) Strand = Plus / Minus Query: 432 cagccctgatgtagtaccagtcagcgtca 460 |||| ||||||||||||||||||| |||| Sbjct: 60524 cagctctgatgtagtaccagtcagggtca 60496 Score = 40.1 bits (20), Expect = 6.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 307 aacagcaccactgctcttgcagaa 330 |||| ||||||||||||||||||| Sbjct: 60721 aacaccaccactgctcttgcagaa 60698
>gb|AF153049.1|AF153049 Myxine glutinosa 40S ribosomal protein S19 mRNA, complete cds Length = 510 Score = 42.1 bits (21), Expect = 1.7 Identities = 27/29 (93%) Strand = Plus / Minus Query: 422 gccatcgaggcagccctgatgtagtacca 450 |||| |||||||| ||||||||||||||| Sbjct: 190 gccaccgaggcagtcctgatgtagtacca 162
>ref|XM_535846.2| PREDICTED: Canis familiaris similar to HRAS-like suppressor (LOC478677), mRNA Length = 694 Score = 40.1 bits (20), Expect = 6.7 Identities = 26/28 (92%) Strand = Plus / Plus Query: 281 tgcaactcctgaaggatgttgcgggaaa 308 ||||||| ||||||||||||| |||||| Sbjct: 244 tgcaactgctgaaggatgttgtgggaaa 271
>emb|AL358134.11| Human DNA sequence from clone RP11-306O13 on chromosome 6, complete sequence Length = 144828 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 ttaaaaactcagacaattaa 42 |||||||||||||||||||| Sbjct: 46411 ttaaaaactcagacaattaa 46430
>gb|BC054381.1| Mus musculus cDNA clone IMAGE:6468809, partial cds Length = 7392 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 310 agcaccactgctcttgcaga 329 |||||||||||||||||||| Sbjct: 2817 agcaccactgctcttgcaga 2798
>gb|AC092999.3| Homo sapiens 3 BAC RP11-170K4 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 167084 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 24 taaaaactcagacaattaac 43 |||||||||||||||||||| Sbjct: 126331 taaaaactcagacaattaac 126350
>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete sequence Length = 28434780 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 87 cataacaaacacagggaggg 106 |||||||||||||||||||| Sbjct: 28400536 cataacaaacacagggaggg 28400555
>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete sequence Length = 30731886 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 312 caccactgctcttgcagaag 331 |||||||||||||||||||| Sbjct: 3306778 caccactgctcttgcagaag 3306759
>emb|BX664619.13| Mouse DNA sequence from clone RP23-349B9 on chromosome 11, complete sequence Length = 154608 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 87 cataacaaacacagggaggg 106 |||||||||||||||||||| Sbjct: 27471 cataacaaacacagggaggg 27452
>dbj|AP002536.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC clone:OSJNBa0015I14 Length = 150650 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 312 caccactgctcttgcagaag 331 |||||||||||||||||||| Sbjct: 94141 caccactgctcttgcagaag 94122
>dbj|AP005411.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC clone:OSJNBa0044E16 Length = 153296 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 87 cataacaaacacagggaggg 106 |||||||||||||||||||| Sbjct: 129342 cataacaaacacagggaggg 129361
>dbj|AP006848.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, fosmid clone:OSJNOa199K18 Length = 39582 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 87 cataacaaacacagggaggg 106 |||||||||||||||||||| Sbjct: 5338 cataacaaacacagggaggg 5357
>gb|AC117684.10| Mus musculus chromosome 9, clone RP23-438A6, complete sequence Length = 196053 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 224 ccctgggaggtgatgagcct 243 |||||||||||||||||||| Sbjct: 127161 ccctgggaggtgatgagcct 127180
>gb|AC168063.3| Mus musculus BAC clone RP23-197G3 from chromosome 17, complete sequence Length = 213263 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 310 agcaccactgctcttgcaga 329 |||||||||||||||||||| Sbjct: 85787 agcaccactgctcttgcaga 85768
>emb|CT009627.9| Mouse DNA sequence from clone RP23-71E4 on chromosome 16, complete sequence Length = 257276 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 310 agcaccactgctcttgcaga 329 |||||||||||||||||||| Sbjct: 168365 agcaccactgctcttgcaga 168384
>gb|DQ104685.1| Lycopersicon chmielewskii 40S ribosomal protein S19 (CT189) gene, CT189-7206b allele, partial cds Length = 1403 Score = 40.1 bits (20), Expect = 6.7 Identities = 47/56 (83%) Strand = Plus / Minus Query: 278 ttctgcaactcctgaaggatgttgcgggaaacagcaccactgctcttgcagaagtg 333 |||||||||| ||||| |||| ||| | ||| | ||||||||||||||| ||||| Sbjct: 763 ttctgcaactgttgaagaatgtggcgtgcaactgaaccactgctcttgcaaaagtg 708
>gb|DQ104684.1| Lycopersicon chmielewskii 40S ribosomal protein S19 (CT189) gene, CT189-7206a allele, partial cds Length = 1403 Score = 40.1 bits (20), Expect = 6.7 Identities = 47/56 (83%) Strand = Plus / Minus Query: 278 ttctgcaactcctgaaggatgttgcgggaaacagcaccactgctcttgcagaagtg 333 |||||||||| ||||| |||| ||| | ||| | ||||||||||||||| ||||| Sbjct: 763 ttctgcaactgttgaagaatgtggcgtgcaactgaaccactgctcttgcaaaagtg 708
>gb|DQ104683.1| Lycopersicon chmielewskii 40S ribosomal protein S19 (CT189) gene, CT189-7205b allele, partial cds Length = 1403 Score = 40.1 bits (20), Expect = 6.7 Identities = 47/56 (83%) Strand = Plus / Minus Query: 278 ttctgcaactcctgaaggatgttgcgggaaacagcaccactgctcttgcagaagtg 333 |||||||||| ||||| |||| ||| | ||| | ||||||||||||||| ||||| Sbjct: 763 ttctgcaactgttgaagaatgtggcgtgcaactgaaccactgctcttgcaaaagtg 708
>gb|DQ104682.1| Lycopersicon chmielewskii 40S ribosomal protein S19 (CT189) gene, CT189-7205a allele, partial cds Length = 1403 Score = 40.1 bits (20), Expect = 6.7 Identities = 47/56 (83%) Strand = Plus / Minus Query: 278 ttctgcaactcctgaaggatgttgcgggaaacagcaccactgctcttgcagaagtg 333 |||||||||| ||||| |||| ||| | ||| | ||||||||||||||| ||||| Sbjct: 763 ttctgcaactgttgaagaatgtggcgtgcaactgaaccactgctcttgcaaaagtg 708
>gb|DQ104681.1| Lycopersicon chmielewskii 40S ribosomal protein S19 (CT189) gene, CT189-7204b allele, partial cds Length = 1403 Score = 40.1 bits (20), Expect = 6.7 Identities = 47/56 (83%) Strand = Plus / Minus Query: 278 ttctgcaactcctgaaggatgttgcgggaaacagcaccactgctcttgcagaagtg 333 |||||||||| ||||| |||| ||| | ||| | ||||||||||||||| ||||| Sbjct: 763 ttctgcaactgttgaagaatgtggcgtgcaactgaaccactgctcttgcaaaagtg 708
>gb|DQ104680.1| Lycopersicon chmielewskii 40S ribosomal protein S19 (CT189) gene, CT189-7204a allele, partial cds Length = 1403 Score = 40.1 bits (20), Expect = 6.7 Identities = 47/56 (83%) Strand = Plus / Minus Query: 278 ttctgcaactcctgaaggatgttgcgggaaacagcaccactgctcttgcagaagtg 333 |||||||||| ||||| |||| ||| | ||| | ||||||||||||||| ||||| Sbjct: 763 ttctgcaactgttgaagaatgtggcgtgcaactgaaccactgctcttgcaaaagtg 708
>gb|DQ104679.1| Lycopersicon chmielewskii 40S ribosomal protein S19 (CT189) gene, CT189-7203b allele, partial cds Length = 1403 Score = 40.1 bits (20), Expect = 6.7 Identities = 47/56 (83%) Strand = Plus / Minus Query: 278 ttctgcaactcctgaaggatgttgcgggaaacagcaccactgctcttgcagaagtg 333 |||||||||| ||||| |||| ||| | ||| | ||||||||||||||| ||||| Sbjct: 763 ttctgcaactgttgaagaatgtggcgtgcaactgaaccactgctcttgcaaaagtg 708
>gb|DQ104678.1| Lycopersicon chmielewskii 40S ribosomal protein S19 (CT189) gene, CT189-7203a allele, partial cds Length = 1403 Score = 40.1 bits (20), Expect = 6.7 Identities = 47/56 (83%) Strand = Plus / Minus Query: 278 ttctgcaactcctgaaggatgttgcgggaaacagcaccactgctcttgcagaagtg 333 |||||||||| ||||| |||| ||| | ||| | ||||||||||||||| ||||| Sbjct: 763 ttctgcaactgttgaagaatgtggcgtgcaactgaaccactgctcttgcaaaagtg 708
>gb|DQ104677.1| Lycopersicon chmielewskii 40S ribosomal protein S19 (CT189) gene, CT189-7201b allele, partial cds Length = 1403 Score = 40.1 bits (20), Expect = 6.7 Identities = 47/56 (83%) Strand = Plus / Minus Query: 278 ttctgcaactcctgaaggatgttgcgggaaacagcaccactgctcttgcagaagtg 333 |||||||||| ||||| |||| ||| | ||| | ||||||||||||||| ||||| Sbjct: 763 ttctgcaactgttgaagaatgtggcgtgcaactgaaccactgctcttgcaaaagtg 708
>gb|DQ104676.1| Lycopersicon chmielewskii 40S ribosomal protein S19 (CT189) gene, CT189-7201a allele, partial cds Length = 1403 Score = 40.1 bits (20), Expect = 6.7 Identities = 47/56 (83%) Strand = Plus / Minus Query: 278 ttctgcaactcctgaaggatgttgcgggaaacagcaccactgctcttgcagaagtg 333 |||||||||| ||||| |||| ||| | ||| | ||||||||||||||| ||||| Sbjct: 763 ttctgcaactgttgaagaatgtggcgtgcaactgaaccactgctcttgcaaaagtg 708
>emb|AL808017.4| Mouse DNA sequence from clone RP23-145G21 on chromosome X, complete sequence Length = 183291 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 ttaaaaactcagacaattaa 42 |||||||||||||||||||| Sbjct: 165612 ttaaaaactcagacaattaa 165631 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 4,355,832 Number of Sequences: 3902068 Number of extensions: 4355832 Number of successful extensions: 81832 Number of sequences better than 10.0: 96 Number of HSP's better than 10.0 without gapping: 96 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 81503 Number of HSP's gapped (non-prelim): 314 length of query: 495 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 473 effective length of database: 17,147,199,772 effective search space: 8110625492156 effective search space used: 8110625492156 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)