| Clone Name | rbags19h02 |
|---|---|
| Clone Library Name | barley_pub |
>gb|AY136627.1| Hordeum vulgare subsp. vulgare plasma membrane P-type proton pump ATPase (Ha1) mRNA, complete cds Length = 3446 Score = 480 bits (242), Expect = e-132 Identities = 283/293 (96%), Gaps = 4/293 (1%) Strand = Plus / Minus Query: 1 gaaagggtaaaacgattacaccacgccgtgctncaaacacggtaatagactccactagaa 60 |||||||||||||||||||||||||||||||| ||||||||||| || |||||||||||| Sbjct: 3294 gaaagggtaaaacgattacaccacgccgtgctccaaacacggta-ta-actccactagaa 3237 Query: 61 acattaaaacctntctagcaagacgggacaaccganaccatatatttggtagcactttac 120 ||||||||||| ||||| |||||||||||||||| |||||||||||||||||||||||| Sbjct: 3236 -cattaaaacctctctag-aagacgggacaaccgaaaccatatatttggtagcactttac 3179 Query: 121 aactnggggctggtcagatcaggcatgtttctttcattcatgcaccggaaaaatcttaaa 180 |||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||| Sbjct: 3178 aactaggggctggtcagatcagccatgtttctttcattcatgcaccggaaaaatcttaaa 3119 Query: 181 gcggagctccattccaatctcgctccaatacggangtcatgttgtttggtccaatgccca 240 |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| Sbjct: 3118 gcggagctccattccaatctcgctccaatacggatgtcatgttgtttggtccaatgccca 3059 Query: 241 aattcctcacacggtgtagttttggttgatggtgtcgatgtcaaggcccttga 293 ||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 3058 aattcctcacacggtgtagttttggttgatggtgtcgatgtcaaggcccttga 3006
>emb|AJ344078.1|HVU344078 Hordeum vulgare partial mRNA for plasma membrane H+-ATPase (ha1 gene) Length = 2280 Score = 472 bits (238), Expect = e-130 Identities = 282/293 (96%), Gaps = 4/293 (1%) Strand = Plus / Minus Query: 1 gaaagggtaaaacgattacaccacgccgtgctncaaacacggtaatagactccactagaa 60 |||||||||||||||||||||||||||||||| ||||||||||| || |||||||||||| Sbjct: 2151 gaaagggtaaaacgattacaccacgccgtgctccaaacacggta-ta-actccactagaa 2094 Query: 61 acattaaaacctntctagcaagacgggacaaccganaccatatatttggtagcactttac 120 ||||||||||| ||||| |||||||||||||||| |||||||||||||||||||||||| Sbjct: 2093 -cattaaaacctctctag-aagacgggacaaccgaaaccatatatttggtagcactttac 2036 Query: 121 aactnggggctggtcagatcaggcatgtttctttcattcatgcaccggaaaaatcttaaa 180 |||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||| Sbjct: 2035 aactaggggctggtcagatcagccatgtttctttcattcatgcaccggaaaaatcttaaa 1976 Query: 181 gcggagctccattccaatctcgctccaatacggangtcatgttgtttggtccaatgccca 240 |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| Sbjct: 1975 gcggagctccattccaatctcgctccaatacggatgtcatgttgtttggtccaatgccca 1916 Query: 241 aattcctcacacggtgtagttttggttgatggtgtcgatgtcaaggcccttga 293 |||| |||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1915 aatttctcacacggtgtagttttggttgatggtgtcgatgtcaaggcccttga 1863
>emb|Y09815.1|TAPSB5 T.aestivum mRNA for transmembrane proton pump, partial Length = 863 Score = 355 bits (179), Expect = 5e-95 Identities = 261/282 (92%), Gaps = 6/282 (2%) Strand = Plus / Minus Query: 9 aaaacgattaca-ccacgccgtgctncaaacacggtaatagactccactagaaacattaa 67 |||||||||||| |||||||||||| ||||||||||| || |||||||||||| |||||| Sbjct: 830 aaaacgattacaaccacgccgtgctccaaacacggta-ta-actccactagaa-cattaa 774 Query: 68 aacctntctagcaagacgggacaaccganaccatatatttggtagcactttacaactngg 127 ||||| ||||| |||||||| ||||||| |||||||||||||||||||||||||||| || Sbjct: 773 aacctctctag-aagacggg-caaccgaaaccatatatttggtagcactttacaactagg 716 Query: 128 ggctggtcagatcaggcatgtttctttcattcatgcaccggaaaaatcttaaagcggagc 187 ||||||||||||||| ||||||| |||||||||| ||||||||||||||||||||||||| Sbjct: 715 ggctggtcagatcagccatgtttgtttcattcattcaccggaaaaatcttaaagcggagc 656 Query: 188 tccattccaatctcgctccaatacggangtcatgttgtttggtccaatgcccaaattcct 247 ||||||||||||||||||||||||||| |||||||| ||||||||||||| | | |||| Sbjct: 655 tccattccaatctcgctccaatacggatgtcatgtttgttggtccaatgccgatactcct 596 Query: 248 cacacggtgtagttttggttgatggtgtcgatgtcaaggccc 289 |||||||||||||| |||||||||||||||||||| |||||| Sbjct: 595 cacacggtgtagttctggttgatggtgtcgatgtccaggccc 554
>gb|AF384148.1|AF384148 Triticum aestivum H+-ATPase mRNA, partial cds Length = 437 Score = 95.6 bits (48), Expect = 7e-17 Identities = 54/56 (96%) Strand = Plus / Minus Query: 238 ccaaattcctcacacggtgtagttttggttgatggtgtcgatgtcaaggcccttga 293 |||| ||||||||||||||||||| ||||||||||||||||||||||||||||||| Sbjct: 420 ccaatttcctcacacggtgtagttctggttgatggtgtcgatgtcaaggcccttga 365
>gb|AY829002.2| Triticum aestivum plasma membrane H+-ATPase gene, promoter region and complete cds Length = 6132 Score = 89.7 bits (45), Expect = 5e-15 Identities = 48/49 (97%) Strand = Plus / Minus Query: 245 cctcacacggtgtagttttggttgatggtgtcgatgtcaaggcccttga 293 ||||||||||||||||| ||||||||||||||||||||||||||||||| Sbjct: 6126 cctcacacggtgtagttctggttgatggtgtcgatgtcaaggcccttga 6078
>gb|AY543630.1| Triticum aestivum plasma membrane H+-ATPase (ha1) mRNA, complete cds Length = 2856 Score = 85.7 bits (43), Expect = 7e-14 Identities = 46/47 (97%) Strand = Plus / Minus Query: 247 tcacacggtgtagttttggttgatggtgtcgatgtcaaggcccttga 293 ||||||||||||||| ||||||||||||||||||||||||||||||| Sbjct: 2856 tcacacggtgtagttctggttgatggtgtcgatgtcaaggcccttga 2810
>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete sequence Length = 35498469 Score = 69.9 bits (35), Expect = 4e-09 Identities = 50/54 (92%), Gaps = 1/54 (1%) Strand = Plus / Minus Query: 97 accatatatttggtagcactttacaactnggggctggtcagatcaggcatgttt 150 |||||||||||||||||||||||||||| |||||| ||||||||| ||||||| Sbjct: 33498418 accatatatttggtagcactttacaacta-gggctgttcagatcagccatgttt 33498366 Score = 42.1 bits (21), Expect = 0.97 Identities = 42/49 (85%) Strand = Plus / Minus Query: 243 ttcctcacacggtgtagttttggttgatggtgtcgatgtcaaggccctt 291 |||||||||| |||||||| || | ||| ||||||||||| || ||||| Sbjct: 33498255 ttcctcacactgtgtagttctgctggatcgtgtcgatgtccagcccctt 33498207
>emb|AL442117.1|H0421H08 Oryza sativa genomic DNA, chromosome X, BAC clone: H0421H08, complete sequence Length = 55574 Score = 69.9 bits (35), Expect = 4e-09 Identities = 50/54 (92%), Gaps = 1/54 (1%) Strand = Plus / Minus Query: 97 accatatatttggtagcactttacaactnggggctggtcagatcaggcatgttt 150 |||||||||||||||||||||||||||| |||||| ||||||||| ||||||| Sbjct: 11975 accatatatttggtagcactttacaacta-gggctgttcagatcagccatgttt 11923 Score = 42.1 bits (21), Expect = 0.97 Identities = 42/49 (85%) Strand = Plus / Minus Query: 243 ttcctcacacggtgtagttttggttgatggtgtcgatgtcaaggccctt 291 |||||||||| |||||||| || | ||| ||||||||||| || ||||| Sbjct: 11812 ttcctcacactgtgtagttctgctggatcgtgtcgatgtccagcccctt 11764
>dbj|AK105082.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-046-C08, full insert sequence Length = 2062 Score = 69.9 bits (35), Expect = 4e-09 Identities = 50/54 (92%), Gaps = 1/54 (1%) Strand = Plus / Minus Query: 97 accatatatttggtagcactttacaactnggggctggtcagatcaggcatgttt 150 |||||||||||||||||||||||||||| |||||| ||||||||| ||||||| Sbjct: 1884 accatatatttggtagcactttacaacta-gggctgttcagatcagccatgttt 1832 Score = 42.1 bits (21), Expect = 0.97 Identities = 42/49 (85%) Strand = Plus / Minus Query: 243 ttcctcacacggtgtagttttggttgatggtgtcgatgtcaaggccctt 291 |||||||||| |||||||| || | ||| ||||||||||| || ||||| Sbjct: 1721 ttcctcacactgtgtagttctgctggatcgtgtcgatgtccagcccctt 1673
>dbj|AK100435.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023088J16, full insert sequence Length = 3560 Score = 69.9 bits (35), Expect = 4e-09 Identities = 50/54 (92%), Gaps = 1/54 (1%) Strand = Plus / Minus Query: 97 accatatatttggtagcactttacaactnggggctggtcagatcaggcatgttt 150 |||||||||||||||||||||||||||| |||||| ||||||||| ||||||| Sbjct: 3329 accatatatttggtagcactttacaacta-gggctgttcagatcagccatgttt 3277 Score = 42.1 bits (21), Expect = 0.97 Identities = 42/49 (85%) Strand = Plus / Minus Query: 243 ttcctcacacggtgtagttttggttgatggtgtcgatgtcaaggccctt 291 |||||||||| |||||||| || | ||| ||||||||||| || ||||| Sbjct: 3166 ttcctcacactgtgtagttctgctggatcgtgtcgatgtccagcccctt 3118
>dbj|AK073066.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033023L01, full insert sequence Length = 2444 Score = 69.9 bits (35), Expect = 4e-09 Identities = 50/54 (92%), Gaps = 1/54 (1%) Strand = Plus / Minus Query: 97 accatatatttggtagcactttacaactnggggctggtcagatcaggcatgttt 150 |||||||||||||||||||||||||||| |||||| ||||||||| ||||||| Sbjct: 2258 accatatatttggtagcactttacaacta-gggctgttcagatcagccatgttt 2206 Score = 42.1 bits (21), Expect = 0.97 Identities = 42/49 (85%) Strand = Plus / Minus Query: 243 ttcctcacacggtgtagttttggttgatggtgtcgatgtcaaggccctt 291 |||||||||| |||||||| || | ||| ||||||||||| || ||||| Sbjct: 2095 ttcctcacactgtgtagttctgctggatcgtgtcgatgtccagcccctt 2047
>emb|AL606685.3|OSJN00090 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0071I13, complete sequence Length = 152264 Score = 69.9 bits (35), Expect = 4e-09 Identities = 50/54 (92%), Gaps = 1/54 (1%) Strand = Plus / Minus Query: 97 accatatatttggtagcactttacaactnggggctggtcagatcaggcatgttt 150 |||||||||||||||||||||||||||| |||||| ||||||||| ||||||| Sbjct: 74707 accatatatttggtagcactttacaacta-gggctgttcagatcagccatgttt 74655 Score = 42.1 bits (21), Expect = 0.97 Identities = 42/49 (85%) Strand = Plus / Minus Query: 243 ttcctcacacggtgtagttttggttgatggtgtcgatgtcaaggccctt 291 |||||||||| |||||||| || | ||| ||||||||||| || ||||| Sbjct: 74544 ttcctcacactgtgtagttctgctggatcgtgtcgatgtccagcccctt 74496
>emb|X85805.1|ZMPMHATP Z.mays mRNA for plasma membrane H+ ATPase Length = 3369 Score = 56.0 bits (28), Expect = 6e-05 Identities = 43/48 (89%) Strand = Plus / Minus Query: 246 ctcacacggtgtagttttggttgatggtgtcgatgtcaaggcccttga 293 ||||||| |||||||| || | ||||||||||||||| |||||||||| Sbjct: 3053 ctcacaccgtgtagttctgctggatggtgtcgatgtccaggcccttga 3006
>gb|AF480431.1| Zea mays plasma membrane H+ ATPase-like gene, partial sequence Length = 6539 Score = 56.0 bits (28), Expect = 6e-05 Identities = 43/48 (89%) Strand = Plus / Plus Query: 246 ctcacacggtgtagttttggttgatggtgtcgatgtcaaggcccttga 293 ||||||| |||||||| || | ||||||||||||||| |||||||||| Sbjct: 2494 ctcacaccgtgtagttctgctggatggtgtcgatgtccaggcccttga 2541
>gb|AF498616.1| Zea mays cultivar C_9 plasma membrane H+-transporting ATPase-like protein gene, 3'UTR and partial cds Length = 408 Score = 56.0 bits (28), Expect = 6e-05 Identities = 43/48 (89%) Strand = Plus / Minus Query: 246 ctcacacggtgtagttttggttgatggtgtcgatgtcaaggcccttga 293 ||||||| |||||||| || | ||||||||||||||| |||||||||| Sbjct: 154 ctcacaccgtgtagttctgctggatggtgtcgatgtccaggcccttga 107
>gb|AF498615.1| Zea mays cultivar D_9 plasma membrane H+-transporting ATPase-like protein gene, 3'UTR and partial cds Length = 413 Score = 56.0 bits (28), Expect = 6e-05 Identities = 43/48 (89%) Strand = Plus / Minus Query: 246 ctcacacggtgtagttttggttgatggtgtcgatgtcaaggcccttga 293 ||||||| |||||||| || | ||||||||||||||| |||||||||| Sbjct: 159 ctcacaccgtgtagttctgctggatggtgtcgatgtccaggcccttga 112
>gb|AF498614.1| Zea mays cultivar D_6 plasma membrane H+-transporting ATPase-like protein gene, 3'UTR and partial cds Length = 413 Score = 56.0 bits (28), Expect = 6e-05 Identities = 43/48 (89%) Strand = Plus / Minus Query: 246 ctcacacggtgtagttttggttgatggtgtcgatgtcaaggcccttga 293 ||||||| |||||||| || | ||||||||||||||| |||||||||| Sbjct: 159 ctcacaccgtgtagttctgctggatggtgtcgatgtccaggcccttga 112
>gb|AF498613.1| Zea mays cultivar F_1 plasma membrane H+-transporting ATPase-like protein gene, 3'UTR and partial cds Length = 413 Score = 56.0 bits (28), Expect = 6e-05 Identities = 43/48 (89%) Strand = Plus / Minus Query: 246 ctcacacggtgtagttttggttgatggtgtcgatgtcaaggcccttga 293 ||||||| |||||||| || | ||||||||||||||| |||||||||| Sbjct: 159 ctcacaccgtgtagttctgctggatggtgtcgatgtccaggcccttga 112
>gb|AF498612.1| Zea mays cultivar Mo17 plasma membrane H+-transporting ATPase-like protein gene, 3'UTR and partial cds Length = 413 Score = 56.0 bits (28), Expect = 6e-05 Identities = 43/48 (89%) Strand = Plus / Minus Query: 246 ctcacacggtgtagttttggttgatggtgtcgatgtcaaggcccttga 293 ||||||| |||||||| || | ||||||||||||||| |||||||||| Sbjct: 159 ctcacaccgtgtagttctgctggatggtgtcgatgtccaggcccttga 112
>gb|AF498611.1| Zea mays cultivar D_7 plasma membrane H+-transporting ATPase-like protein gene, 3'UTR and partial cds Length = 410 Score = 56.0 bits (28), Expect = 6e-05 Identities = 43/48 (89%) Strand = Plus / Minus Query: 246 ctcacacggtgtagttttggttgatggtgtcgatgtcaaggcccttga 293 ||||||| |||||||| || | ||||||||||||||| |||||||||| Sbjct: 156 ctcacaccgtgtagttctgctggatggtgtcgatgtccaggcccttga 109
>gb|AF498610.1| Zea mays cultivar TX601 plasma membrane H+-transporting ATPase-like protein gene, 3'UTR and partial cds Length = 395 Score = 56.0 bits (28), Expect = 6e-05 Identities = 43/48 (89%) Strand = Plus / Minus Query: 246 ctcacacggtgtagttttggttgatggtgtcgatgtcaaggcccttga 293 ||||||| |||||||| || | ||||||||||||||| |||||||||| Sbjct: 154 ctcacaccgtgtagttctgctggatggtgtcgatgtccaggcccttga 107
>gb|AF498609.1| Zea mays cultivar B84 plasma membrane H+-transporting ATPase-like protein gene, 3'UTR and partial cds Length = 413 Score = 56.0 bits (28), Expect = 6e-05 Identities = 43/48 (89%) Strand = Plus / Minus Query: 246 ctcacacggtgtagttttggttgatggtgtcgatgtcaaggcccttga 293 ||||||| |||||||| || | ||||||||||||||| |||||||||| Sbjct: 159 ctcacaccgtgtagttctgctggatggtgtcgatgtccaggcccttga 112
>gb|AF498608.1| Zea mays cultivar DE811 plasma membrane H+-transporting ATPase-like protein gene, 3'UTR and partial cds Length = 413 Score = 56.0 bits (28), Expect = 6e-05 Identities = 43/48 (89%) Strand = Plus / Minus Query: 246 ctcacacggtgtagttttggttgatggtgtcgatgtcaaggcccttga 293 ||||||| |||||||| || | ||||||||||||||| |||||||||| Sbjct: 159 ctcacaccgtgtagttctgctggatggtgtcgatgtccaggcccttga 112
>gb|AF498607.1| Zea mays cultivar 684 plasma membrane H+-transporting ATPase-like protein gene, 3'UTR and partial cds Length = 413 Score = 56.0 bits (28), Expect = 6e-05 Identities = 43/48 (89%) Strand = Plus / Minus Query: 246 ctcacacggtgtagttttggttgatggtgtcgatgtcaaggcccttga 293 ||||||| |||||||| || | ||||||||||||||| |||||||||| Sbjct: 159 ctcacaccgtgtagttctgctggatggtgtcgatgtccaggcccttga 112
>gb|AF498606.1| Zea mays cultivar D71-4HT plasma membrane H+-transporting ATPase-like protein gene, 3'UTR and partial cds Length = 413 Score = 56.0 bits (28), Expect = 6e-05 Identities = 43/48 (89%) Strand = Plus / Minus Query: 246 ctcacacggtgtagttttggttgatggtgtcgatgtcaaggcccttga 293 ||||||| |||||||| || | ||||||||||||||| |||||||||| Sbjct: 159 ctcacaccgtgtagttctgctggatggtgtcgatgtccaggcccttga 112
>gb|AF498605.1| Zea mays cultivar H99 plasma membrane H+-transporting ATPase-like protein gene, 3'UTR and partial cds Length = 264 Score = 56.0 bits (28), Expect = 6e-05 Identities = 43/48 (89%) Strand = Plus / Minus Query: 246 ctcacacggtgtagttttggttgatggtgtcgatgtcaaggcccttga 293 ||||||| |||||||| || | ||||||||||||||| |||||||||| Sbjct: 156 ctcacaccgtgtagttctgctggatggtgtcgatgtccaggcccttga 109
>gb|AF498604.1| Zea mays cultivar IVANA plasma membrane H+-transporting ATPase-like protein gene, 3'UTR and partial cds Length = 414 Score = 56.0 bits (28), Expect = 6e-05 Identities = 43/48 (89%) Strand = Plus / Minus Query: 246 ctcacacggtgtagttttggttgatggtgtcgatgtcaaggcccttga 293 ||||||| |||||||| || | ||||||||||||||| |||||||||| Sbjct: 160 ctcacaccgtgtagttctgctggatggtgtcgatgtccaggcccttga 113
>gb|AF498603.1| Zea mays cultivar CO109 plasma membrane H+-transporting ATPase-like protein gene, 3'UTR and partial cds Length = 412 Score = 56.0 bits (28), Expect = 6e-05 Identities = 43/48 (89%) Strand = Plus / Minus Query: 246 ctcacacggtgtagttttggttgatggtgtcgatgtcaaggcccttga 293 ||||||| |||||||| || | ||||||||||||||| |||||||||| Sbjct: 158 ctcacaccgtgtagttctgctggatggtgtcgatgtccaggcccttga 111
>gb|AF498602.1| Zea mays cultivar I_1 plasma membrane H+-transporting ATPase-like protein gene, 3'UTR and partial cds Length = 413 Score = 56.0 bits (28), Expect = 6e-05 Identities = 43/48 (89%) Strand = Plus / Minus Query: 246 ctcacacggtgtagttttggttgatggtgtcgatgtcaaggcccttga 293 ||||||| |||||||| || | ||||||||||||||| |||||||||| Sbjct: 159 ctcacaccgtgtagttctgctggatggtgtcgatgtccaggcccttga 112
>gb|AF498601.1| Zea mays cultivar B73 plasma membrane H+-transporting ATPase-like protein gene, 3'UTR and partial cds Length = 335 Score = 56.0 bits (28), Expect = 6e-05 Identities = 43/48 (89%) Strand = Plus / Minus Query: 246 ctcacacggtgtagttttggttgatggtgtcgatgtcaaggcccttga 293 ||||||| |||||||| || | ||||||||||||||| |||||||||| Sbjct: 157 ctcacaccgtgtagttctgctggatggtgtcgatgtccaggcccttga 110
>gb|AF498600.1| Zea mays cultivar F_2 plasma membrane H+-transporting ATPase-like protein gene, 3'UTR and partial cds Length = 411 Score = 56.0 bits (28), Expect = 6e-05 Identities = 43/48 (89%) Strand = Plus / Minus Query: 246 ctcacacggtgtagttttggttgatggtgtcgatgtcaaggcccttga 293 ||||||| |||||||| || | ||||||||||||||| |||||||||| Sbjct: 157 ctcacaccgtgtagttctgctggatggtgtcgatgtccaggcccttga 110
>gb|AF498599.1| Zea mays cultivar G_1 plasma membrane H+-transporting ATPase-like protein gene, 3'UTR and partial cds Length = 406 Score = 56.0 bits (28), Expect = 6e-05 Identities = 43/48 (89%) Strand = Plus / Minus Query: 246 ctcacacggtgtagttttggttgatggtgtcgatgtcaaggcccttga 293 ||||||| |||||||| || | ||||||||||||||| |||||||||| Sbjct: 159 ctcacaccgtgtagttctgctggatggtgtcgatgtccaggcccttga 112
>gb|AF498598.1| Zea mays cultivar B_6 plasma membrane H+-transporting ATPase-like protein gene, 3'UTR and partial cds Length = 413 Score = 56.0 bits (28), Expect = 6e-05 Identities = 43/48 (89%) Strand = Plus / Minus Query: 246 ctcacacggtgtagttttggttgatggtgtcgatgtcaaggcccttga 293 ||||||| |||||||| || | ||||||||||||||| |||||||||| Sbjct: 159 ctcacaccgtgtagttctgctggatggtgtcgatgtccaggcccttga 112
>gb|AF498597.1| Zea mays cultivar H_4 plasma membrane H+-transporting ATPase-like protein gene, 3'UTR and partial cds Length = 412 Score = 56.0 bits (28), Expect = 6e-05 Identities = 43/48 (89%) Strand = Plus / Minus Query: 246 ctcacacggtgtagttttggttgatggtgtcgatgtcaaggcccttga 293 ||||||| |||||||| || | ||||||||||||||| |||||||||| Sbjct: 156 ctcacaccgtgtagttctgctggatggtgtcgatgtccaggcccttga 109
>gb|AF498596.1| Zea mays cultivar F_4 plasma membrane H+-transporting ATPase-like protein gene, 3'UTR and partial cds Length = 413 Score = 56.0 bits (28), Expect = 6e-05 Identities = 43/48 (89%) Strand = Plus / Minus Query: 246 ctcacacggtgtagttttggttgatggtgtcgatgtcaaggcccttga 293 ||||||| |||||||| || | ||||||||||||||| |||||||||| Sbjct: 159 ctcacaccgtgtagttctgctggatggtgtcgatgtccaggcccttga 112
>gb|AF498595.1| Zea mays cultivar F_3 plasma membrane H+-transporting ATPase-like protein gene, 3'UTR and partial cds Length = 410 Score = 56.0 bits (28), Expect = 6e-05 Identities = 43/48 (89%) Strand = Plus / Minus Query: 246 ctcacacggtgtagttttggttgatggtgtcgatgtcaaggcccttga 293 ||||||| |||||||| || | ||||||||||||||| |||||||||| Sbjct: 156 ctcacaccgtgtagttctgctggatggtgtcgatgtccaggcccttga 109
>gb|AF498594.1| Zea mays cultivar F_5 plasma membrane H+-transporting ATPase-like protein gene, 3'UTR and partial cds Length = 413 Score = 56.0 bits (28), Expect = 6e-05 Identities = 43/48 (89%) Strand = Plus / Minus Query: 246 ctcacacggtgtagttttggttgatggtgtcgatgtcaaggcccttga 293 ||||||| |||||||| || | ||||||||||||||| |||||||||| Sbjct: 159 ctcacaccgtgtagttctgctggatggtgtcgatgtccaggcccttga 112
>gb|AF498593.1| Zea mays cultivar H_5 plasma membrane H+-transporting ATPase-like protein gene, 3'UTR and partial cds Length = 413 Score = 56.0 bits (28), Expect = 6e-05 Identities = 43/48 (89%) Strand = Plus / Minus Query: 246 ctcacacggtgtagttttggttgatggtgtcgatgtcaaggcccttga 293 ||||||| |||||||| || | ||||||||||||||| |||||||||| Sbjct: 159 ctcacaccgtgtagttctgctggatggtgtcgatgtccaggcccttga 112
>gb|AF498592.1| Zea mays cultivar H_3 plasma membrane H+-transporting ATPase-like protein gene, 3'UTR and partial cds Length = 413 Score = 56.0 bits (28), Expect = 6e-05 Identities = 43/48 (89%) Strand = Plus / Minus Query: 246 ctcacacggtgtagttttggttgatggtgtcgatgtcaaggcccttga 293 ||||||| |||||||| || | ||||||||||||||| |||||||||| Sbjct: 159 ctcacaccgtgtagttctgctggatggtgtcgatgtccaggcccttga 112
>gb|AF498591.1| Zea mays cultivar J40 plasma membrane H+-transporting ATPase-like protein gene, 3'UTR and partial cds Length = 397 Score = 56.0 bits (28), Expect = 6e-05 Identities = 43/48 (89%) Strand = Plus / Minus Query: 246 ctcacacggtgtagttttggttgatggtgtcgatgtcaaggcccttga 293 ||||||| |||||||| || | ||||||||||||||| |||||||||| Sbjct: 159 ctcacaccgtgtagttctgctggatggtgtcgatgtccaggcccttga 112
>gb|AF498590.1| Zea mays cultivar 647 plasma membrane H+-transporting ATPase-like protein gene, 3'UTR and partial cds Length = 413 Score = 56.0 bits (28), Expect = 6e-05 Identities = 43/48 (89%) Strand = Plus / Minus Query: 246 ctcacacggtgtagttttggttgatggtgtcgatgtcaaggcccttga 293 ||||||| |||||||| || | ||||||||||||||| |||||||||| Sbjct: 159 ctcacaccgtgtagttctgctggatggtgtcgatgtccaggcccttga 112
>gb|AF498589.1| Zea mays cultivar B_1 plasma membrane H+-transporting ATPase-like protein gene, 3'UTR and partial cds Length = 413 Score = 56.0 bits (28), Expect = 6e-05 Identities = 43/48 (89%) Strand = Plus / Minus Query: 246 ctcacacggtgtagttttggttgatggtgtcgatgtcaaggcccttga 293 ||||||| |||||||| || | ||||||||||||||| |||||||||| Sbjct: 159 ctcacaccgtgtagttctgctggatggtgtcgatgtccaggcccttga 112
>gb|AF498588.1| Zea mays cultivar F_6 plasma membrane H+-transporting ATPase-like protein gene, 3'UTR and partial cds Length = 413 Score = 56.0 bits (28), Expect = 6e-05 Identities = 43/48 (89%) Strand = Plus / Minus Query: 246 ctcacacggtgtagttttggttgatggtgtcgatgtcaaggcccttga 293 ||||||| |||||||| || | ||||||||||||||| |||||||||| Sbjct: 159 ctcacaccgtgtagttctgctggatggtgtcgatgtccaggcccttga 112
>gb|AF498587.1| Zea mays cultivar C_5 plasma membrane H+-transporting ATPase-like protein gene, 3'UTR and partial cds Length = 413 Score = 56.0 bits (28), Expect = 6e-05 Identities = 43/48 (89%) Strand = Plus / Minus Query: 246 ctcacacggtgtagttttggttgatggtgtcgatgtcaaggcccttga 293 ||||||| |||||||| || | ||||||||||||||| |||||||||| Sbjct: 159 ctcacaccgtgtagttctgctggatggtgtcgatgtccaggcccttga 112
>gb|AF498586.1| Zea mays cultivar H_1 plasma membrane H+-transporting ATPase-like protein gene, 3'UTR and partial cds Length = 404 Score = 56.0 bits (28), Expect = 6e-05 Identities = 43/48 (89%) Strand = Plus / Minus Query: 246 ctcacacggtgtagttttggttgatggtgtcgatgtcaaggcccttga 293 ||||||| |||||||| || | ||||||||||||||| |||||||||| Sbjct: 157 ctcacaccgtgtagttctgctggatggtgtcgatgtccaggcccttga 110
>emb|AJ441084.1|ZMA441084 Zea mays partial mRNA for proton-exporting ATPase (mha3 gene) Length = 1259 Score = 56.0 bits (28), Expect = 6e-05 Identities = 43/48 (89%) Strand = Plus / Minus Query: 246 ctcacacggtgtagttttggttgatggtgtcgatgtcaaggcccttga 293 ||||||| |||||||| || | ||||||||||||||| |||||||||| Sbjct: 940 ctcacaccgtgtagttctgctggatggtgtcgatgtccaggcccttga 893
>emb|AJ539534.1|ZMA539534 Zea mays partial mRNA for proton-exporting ATPase (mha4 gene) Length = 1359 Score = 56.0 bits (28), Expect = 6e-05 Identities = 43/48 (89%) Strand = Plus / Minus Query: 246 ctcacacggtgtagttttggttgatggtgtcgatgtcaaggcccttga 293 ||||||| |||||||| || | ||||||||||||||| |||||||||| Sbjct: 940 ctcacaccgtgtagttctgctggatggtgtcgatgtccaggcccttga 893
>gb|DQ090006.1| Puccinellia tenuiflora plasma membrane H+-ATPase mRNA, partial cds Length = 153 Score = 52.0 bits (26), Expect = 0.001 Identities = 35/38 (92%) Strand = Plus / Minus Query: 254 gtgtagttttggttgatggtgtcgatgtcaaggccctt 291 |||||||| |||||||||||||||||||| || ||||| Sbjct: 149 gtgtagttctggttgatggtgtcgatgtccagcccctt 112
>gb|AC134344.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBb0059K16, complete sequence Length = 139615 Score = 44.1 bits (22), Expect = 0.25 Identities = 25/26 (96%) Strand = Plus / Plus Query: 268 gatggtgtcgatgtcaaggcccttga 293 ||||||||||||||| |||||||||| Sbjct: 131582 gatggtgtcgatgtcgaggcccttga 131607
>gb|AC136224.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBb0006B22, complete sequence Length = 166052 Score = 44.1 bits (22), Expect = 0.25 Identities = 25/26 (96%) Strand = Plus / Plus Query: 268 gatggtgtcgatgtcaaggcccttga 293 ||||||||||||||| |||||||||| Sbjct: 50702 gatggtgtcgatgtcgaggcccttga 50727
>emb|AJ440002.1|OSA440002 Oryza sativa (japonica cultivar-group) a4 gene for plasma membrane H+ ATPase, exons 1-12 Length = 3894 Score = 44.1 bits (22), Expect = 0.25 Identities = 25/26 (96%) Strand = Plus / Minus Query: 268 gatggtgtcgatgtcaaggcccttga 293 ||||||||||||||| |||||||||| Sbjct: 3873 gatggtgtcgatgtcgaggcccttga 3848
>emb|AL390169.1|HSM802781 Homo sapiens genomic DNA; cDNA DKFZp547D064 (from clone DKFZp547D064) Length = 2555 Score = 44.1 bits (22), Expect = 0.25 Identities = 22/22 (100%) Strand = Plus / Plus Query: 47 agactccactagaaacattaaa 68 |||||||||||||||||||||| Sbjct: 15 agactccactagaaacattaaa 36
>gb|AC094022.3| Homo sapiens chromosome 1 clone RP11-88N11, complete sequence Length = 187268 Score = 44.1 bits (22), Expect = 0.25 Identities = 22/22 (100%) Strand = Plus / Plus Query: 47 agactccactagaaacattaaa 68 |||||||||||||||||||||| Sbjct: 48676 agactccactagaaacattaaa 48697 Score = 44.1 bits (22), Expect = 0.25 Identities = 22/22 (100%) Strand = Plus / Plus Query: 47 agactccactagaaacattaaa 68 |||||||||||||||||||||| Sbjct: 48512 agactccactagaaacattaaa 48533 Score = 44.1 bits (22), Expect = 0.25 Identities = 22/22 (100%) Strand = Plus / Plus Query: 47 agactccactagaaacattaaa 68 |||||||||||||||||||||| Sbjct: 48184 agactccactagaaacattaaa 48205 Score = 44.1 bits (22), Expect = 0.25 Identities = 22/22 (100%) Strand = Plus / Plus Query: 47 agactccactagaaacattaaa 68 |||||||||||||||||||||| Sbjct: 47856 agactccactagaaacattaaa 47877 Score = 44.1 bits (22), Expect = 0.25 Identities = 22/22 (100%) Strand = Plus / Plus Query: 47 agactccactagaaacattaaa 68 |||||||||||||||||||||| Sbjct: 47690 agactccactagaaacattaaa 47711 Score = 44.1 bits (22), Expect = 0.25 Identities = 22/22 (100%) Strand = Plus / Plus Query: 47 agactccactagaaacattaaa 68 |||||||||||||||||||||| Sbjct: 47525 agactccactagaaacattaaa 47546 Score = 44.1 bits (22), Expect = 0.25 Identities = 22/22 (100%) Strand = Plus / Plus Query: 47 agactccactagaaacattaaa 68 |||||||||||||||||||||| Sbjct: 47442 agactccactagaaacattaaa 47463 Score = 44.1 bits (22), Expect = 0.25 Identities = 22/22 (100%) Strand = Plus / Plus Query: 47 agactccactagaaacattaaa 68 |||||||||||||||||||||| Sbjct: 47194 agactccactagaaacattaaa 47215 Score = 42.1 bits (21), Expect = 0.97 Identities = 21/21 (100%) Strand = Plus / Plus Query: 47 agactccactagaaacattaa 67 ||||||||||||||||||||| Sbjct: 47277 agactccactagaaacattaa 47297
>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete sequence Length = 29737217 Score = 44.1 bits (22), Expect = 0.25 Identities = 25/26 (96%) Strand = Plus / Plus Query: 268 gatggtgtcgatgtcaaggcccttga 293 ||||||||||||||| |||||||||| Sbjct: 14715288 gatggtgtcgatgtcgaggcccttga 14715313 Score = 40.1 bits (20), Expect = 3.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 134 tcagatcaggcatgtttctt 153 |||||||||||||||||||| Sbjct: 3042242 tcagatcaggcatgtttctt 3042223
>gb|BC012465.1| Homo sapiens, clone IMAGE:4449356, mRNA Length = 3331 Score = 44.1 bits (22), Expect = 0.25 Identities = 22/22 (100%) Strand = Plus / Plus Query: 47 agactccactagaaacattaaa 68 |||||||||||||||||||||| Sbjct: 1627 agactccactagaaacattaaa 1648 Score = 44.1 bits (22), Expect = 0.25 Identities = 22/22 (100%) Strand = Plus / Plus Query: 47 agactccactagaaacattaaa 68 |||||||||||||||||||||| Sbjct: 1380 agactccactagaaacattaaa 1401 Score = 44.1 bits (22), Expect = 0.25 Identities = 22/22 (100%) Strand = Plus / Plus Query: 47 agactccactagaaacattaaa 68 |||||||||||||||||||||| Sbjct: 1297 agactccactagaaacattaaa 1318
>dbj|AK100483.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023097B04, full insert sequence Length = 3538 Score = 44.1 bits (22), Expect = 0.25 Identities = 25/26 (96%) Strand = Plus / Minus Query: 268 gatggtgtcgatgtcaaggcccttga 293 ||||||||||||||| |||||||||| Sbjct: 3132 gatggtgtcgatgtcgaggcccttga 3107
>dbj|AK099106.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023028O04, full insert sequence Length = 1472 Score = 44.1 bits (22), Expect = 0.25 Identities = 25/26 (96%) Strand = Plus / Minus Query: 268 gatggtgtcgatgtcaaggcccttga 293 ||||||||||||||| |||||||||| Sbjct: 1184 gatggtgtcgatgtcgaggcccttga 1159
>dbj|AK069666.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023028O05, full insert sequence Length = 1472 Score = 44.1 bits (22), Expect = 0.25 Identities = 25/26 (96%) Strand = Plus / Minus Query: 268 gatggtgtcgatgtcaaggcccttga 293 ||||||||||||||| |||||||||| Sbjct: 1184 gatggtgtcgatgtcgaggcccttga 1159
>emb|BX548055.7| Zebrafish DNA sequence from clone CH211-246K22 in linkage group 20, complete sequence Length = 105935 Score = 42.1 bits (21), Expect = 0.97 Identities = 21/21 (100%) Strand = Plus / Plus Query: 99 catatatttggtagcacttta 119 ||||||||||||||||||||| Sbjct: 100126 catatatttggtagcacttta 100146
>gb|AC093492.3| Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBa0059G01, complete sequence Length = 141661 Score = 40.1 bits (20), Expect = 3.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 134 tcagatcaggcatgtttctt 153 |||||||||||||||||||| Sbjct: 29486 tcagatcaggcatgtttctt 29467
>gb|AC093493.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBa0072C16, complete sequence Length = 159525 Score = 40.1 bits (20), Expect = 3.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 134 tcagatcaggcatgtttctt 153 |||||||||||||||||||| Sbjct: 136258 tcagatcaggcatgtttctt 136239
>emb|CR387983.8| Zebrafish DNA sequence from clone DKEY-90D6 in linkage group 21, complete sequence Length = 131428 Score = 40.1 bits (20), Expect = 3.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 105 tttggtagcactttacaact 124 |||||||||||||||||||| Sbjct: 112529 tttggtagcactttacaact 112510
>emb|BX005140.18| Zebrafish DNA sequence from clone CH211-11F22, complete sequence Length = 177312 Score = 40.1 bits (20), Expect = 3.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 105 tttggtagcactttacaact 124 |||||||||||||||||||| Sbjct: 40685 tttggtagcactttacaact 40704
>gb|AC067937.1|AC067937 Neurospora crassa chromosome 7, clone X11-G8, complete sequence Length = 43556 Score = 40.1 bits (20), Expect = 3.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 268 gatggtgtcgatgtcaaggc 287 |||||||||||||||||||| Sbjct: 22122 gatggtgtcgatgtcaaggc 22141
>emb|BX908788.1| Neurospora crassa DNA linkage group VII BAC clone B23N11 Length = 46353 Score = 40.1 bits (20), Expect = 3.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 268 gatggtgtcgatgtcaaggc 287 |||||||||||||||||||| Sbjct: 17824 gatggtgtcgatgtcaaggc 17843
>emb|BX649250.6| Zebrafish DNA sequence from clone DKEY-53B2 in linkage group 20, complete sequence Length = 165729 Score = 40.1 bits (20), Expect = 3.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 103 tatttggtagcactttacaa 122 |||||||||||||||||||| Sbjct: 127450 tatttggtagcactttacaa 127431 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 1,930,287 Number of Sequences: 3902068 Number of extensions: 1930287 Number of successful extensions: 31625 Number of sequences better than 10.0: 66 Number of HSP's better than 10.0 without gapping: 67 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 31432 Number of HSP's gapped (non-prelim): 187 length of query: 293 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 271 effective length of database: 17,147,199,772 effective search space: 4646891138212 effective search space used: 4646891138212 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)