ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | rbags19e05 |
|---|---|
| Clone Library Name | barley_pub |
>gb|AC134434.4| Mus musculus BAC clone RP24-420E8 from chromosome 7, complete sequence Length = 214856 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 5 cttcctttagcatttttatag 25 ||||||||||||||||||||| Sbjct: 201627 cttcctttagcatttttatag 201607
>gb|AC099930.11| Mus musculus chromosome 7, clone RP23-17C12, complete sequence Length = 224617 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 5 cttcctttagcatttttatag 25 ||||||||||||||||||||| Sbjct: 22766 cttcctttagcatttttatag 22746
>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12, complete sequence Length = 27566993 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 276 aacagcaacactgagatggtg 296 ||||||||||||||||||||| Sbjct: 25552024 aacagcaacactgagatggtg 25552044
>dbj|AK072382.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023075D08, full insert sequence Length = 2374 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 276 aacagcaacactgagatggtg 296 ||||||||||||||||||||| Sbjct: 2183 aacagcaacactgagatggtg 2163
>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence Length = 27492551 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 276 aacagcaacactgagatggtg 296 ||||||||||||||||||||| Sbjct: 25480200 aacagcaacactgagatggtg 25480220
>emb|AL928781.4|CNS08CCB Oryza sativa chromosome 12, . BAC OSJNBa0070E09 of library OSJNBa from chromosome 12 of cultivar Nipponbare of ssp. japonica of Oryza sativa (rice), complete sequence Length = 144084 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 276 aacagcaacactgagatggtg 296 ||||||||||||||||||||| Sbjct: 121406 aacagcaacactgagatggtg 121426
>emb|AL732537.4|CNS08C9C Oryza sativa chromosome 12, . BAC OSJNBa0036L12 of library OSJNBa from chromosome 12 of cultivar Nipponbare of ssp. japonica of Oryza sativa (rice), complete sequence Length = 127003 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 276 aacagcaacactgagatggtg 296 ||||||||||||||||||||| Sbjct: 121694 aacagcaacactgagatggtg 121674
>emb|AL358394.14| Human DNA sequence from clone RP11-445N18 on chromosome 10 Contains four novel genes, the 5' end of a novel gene, a Ras suppressor protein 1 pseudogene, a pseudogene similar to part of cubilin (intrinsic factor-cobalamin receptor, CUBN), the 5' end of a breast cancer antigen (NY-BR-1) pseudogene, a ribosomal protein S19 pseudogene, and a novel pseudogene similar to part of KIAA1052 protein, complete sequence Length = 116859 Score = 40.1 bits (20), Expect = 4.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 5 cttcctttagcatttttata 24 |||||||||||||||||||| Sbjct: 28311 cttcctttagcatttttata 28292
>gb|AC123978.5| Papio anubis clone rp41-211d5, complete sequence Length = 180097 Score = 40.1 bits (20), Expect = 4.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 5 cttcctttagcatttttata 24 |||||||||||||||||||| Sbjct: 151878 cttcctttagcatttttata 151859
>gb|AC022447.6| Homo sapiens chromosome 5 clone RP11-5N11, complete sequence Length = 143009 Score = 40.1 bits (20), Expect = 4.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 144 caaggtccttgccagatcca 163 |||||||||||||||||||| Sbjct: 71558 caaggtccttgccagatcca 71577
>gb|AC010363.7| Homo sapiens chromosome 5 clone CTD-2039P12, complete sequence Length = 138587 Score = 40.1 bits (20), Expect = 4.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 144 caaggtccttgccagatcca 163 |||||||||||||||||||| Sbjct: 93645 caaggtccttgccagatcca 93626 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 2,303,641 Number of Sequences: 3902068 Number of extensions: 2303641 Number of successful extensions: 37779 Number of sequences better than 10.0: 11 Number of HSP's better than 10.0 without gapping: 11 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 37753 Number of HSP's gapped (non-prelim): 26 length of query: 364 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 342 effective length of database: 17,147,199,772 effective search space: 5864342322024 effective search space used: 5864342322024 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)
