>dbj|AP001137.2| Homo sapiens genomic DNA, chromosome 21q21.1-q21.2, LL56-APP region,
clone:B812P3
Length = 203959
Score = 40.1 bits (20), Expect = 9.6
Identities = 23/24 (95%)
Strand = Plus / Plus
Query: 8 tccctttattatttgtaaccttaa 31
|||||||||||||| |||||||||
Sbjct: 188330 tccctttattatttttaaccttaa 188353
Database: nt
Posted date: May 29, 2006 11:10 AM
Number of letters in database: 3,984,495,279
Number of sequences in database: 917,343
Database: /shigen/export/home/twatanab/db/nt/nt.01
Posted date: May 29, 2006 11:16 AM
Number of letters in database: 3,988,174,986
Number of sequences in database: 835,257
Database: /shigen/export/home/twatanab/db/nt/nt.02
Posted date: May 29, 2006 11:21 AM
Number of letters in database: 3,991,246,324
Number of sequences in database: 771,481
Database: /shigen/export/home/twatanab/db/nt/nt.03
Posted date: May 29, 2006 11:27 AM
Number of letters in database: 3,990,718,311
Number of sequences in database: 977,174
Database: /shigen/export/home/twatanab/db/nt/nt.04
Posted date: May 29, 2006 11:29 AM
Number of letters in database: 1,278,410,368
Number of sequences in database: 400,813
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 5,239,782
Number of Sequences: 3902068
Number of extensions: 5239782
Number of successful extensions: 85816
Number of sequences better than 10.0: 21
Number of HSP's better than 10.0 without gapping: 21
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 85723
Number of HSP's gapped (non-prelim): 92
length of query: 700
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 677
effective length of database: 17,143,297,704
effective search space: 11606012545608
effective search space used: 11606012545608
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)