| Clone Name | rbags19d23 |
|---|---|
| Clone Library Name | barley_pub |
>dbj|AK107906.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-134-G01, full insert sequence Length = 832 Score = 268 bits (135), Expect = 2e-68 Identities = 300/355 (84%) Strand = Plus / Minus Query: 146 ggacttgatctgctcaaccaggtggggcaggaccctgatgctgtcgtcgatggacctgtt 205 |||||||||||| |||||||| ||||||||||||||||| ||||| || || || ||||| Sbjct: 554 ggacttgatctgatcaaccagatggggcaggaccctgatactgtcatcaatagatctgtt 495 Query: 206 cacgcacgactccagctcgttggttgcgtccgtcttcatcttctggagctttgctgcttc 265 ||||| | || ||||| | || || | || |||||||||||||||||||||||||| Sbjct: 494 tacgcatgcttctagctcctcagtcgcatgtgttttcatcttctggagctttgctgcttc 435 Query: 266 aaacttgtcttggcagaccatcaacgagcgattcaacctttcctggaacttggccatctc 325 ||| || |||||||| |||||||| || ||||||| || |||||||| || |||||||| Sbjct: 434 aaatttatcttggcacaccatcaaagatcgattcagccgctcctggaatttagccatctc 375 Query: 326 agtctcaacgacattgttggcagaaagagcgggcacaccacagttctcaacacaattggt 385 ||||||||| ||||||||||||| ||| | ||||| | |||||||||||||||||| | Sbjct: 374 agtctcaacaacattgttggcagtaaggacaggcacgctgcagttctcaacacaattgtt 315 Query: 386 gattccctcttgactctgtcgcctatcaaagcagtcatgtgcacacttgaagtacgcttt 445 ||| || |||||||| ||| | ||||||||| |||| ||||||||||||||||||| Sbjct: 314 gatcccttcttgacttcttcggcgatcaaagcattcatacgcacacttgaagtacgcttg 255 Query: 446 ctgcagggtgaagttgacgtggtcctgcacgccctcgaggtgcttctgtgcggcg 500 ||||| ||||||||||||||||||||| ||||| ||||||||||||| |||||| Sbjct: 254 ctgcatggtgaagttgacgtggtcctggacgccggcgaggtgcttctgcgcggcg 200
>gb|AY104565.1| Zea mays PCO085521 mRNA sequence Length = 680 Score = 182 bits (92), Expect = 7e-43 Identities = 257/312 (82%) Strand = Plus / Minus Query: 178 ccctgatgctgtcgtcgatggacctgttcacgcacgactccagctcgttggttgcgtccg 237 ||||||||||||| ||||| || ||||| || || || ||||| || | ||||| || | Sbjct: 485 ccctgatgctgtcatcgatagatctgttgacacaggattccagttcctgagttgcatctg 426 Query: 238 tcttcatcttctggagctttgctgcttcaaacttgtcttggcagaccatcaacgagcgat 297 | ||||||||||||||||| || ||||||||||| ||||| ||||||||||| || || | Sbjct: 425 ttttcatcttctggagcttggcagcttcaaacttatcttgacagaccatcaatgaccggt 366 Query: 298 tcaacctttcctggaacttggccatctcagtctcaacgacattgttggcagaaagagcgg 357 |||||| |||||| ||||||||||||||| |||||| ||||||||| ||| ||| | | Sbjct: 365 tcaaccgttcctgaaacttggccatctcactctcaaaaacattgttgacagcaaggacag 306 Query: 358 gcacaccacagttctcaacacaattggtgattccctcttgactctgtcgcctatcaaagc 417 ||| |||||| ||||| ||||||||| |||| | || ||| | | |||| ||| |||| Sbjct: 305 gcataccacaattctccacacaattgttgatcgcttcctgagtacggcgccgatcgaagc 246 Query: 418 agtcatgtgcacacttgaagtacgctttctgcagggtgaagttgacgtggtcctgcacgc 477 | |||| ||| ||||||||||| |||| ||||| ||||||||||||||||||||| | || Sbjct: 245 aatcatatgcgcacttgaagtatgcttgctgcatggtgaagttgacgtggtcctggatgc 186 Query: 478 cctcgaggtgct 489 | ||||||||| Sbjct: 185 cggcgaggtgct 174
>gb|AY108007.1| Zea mays PCO128617 mRNA sequence Length = 808 Score = 139 bits (70), Expect = 1e-29 Identities = 205/250 (82%) Strand = Plus / Minus Query: 240 ttcatcttctggagctttgctgcttcaaacttgtcttggcagaccatcaacgagcgattc 299 |||| ||||||||| || || ||||||||||| ||||| |||||| |||| || || ||| Sbjct: 421 ttcaacttctggagattggcagcttcaaacttatcttgacagaccctcaatgaccggttc 362 Query: 300 aacctttcctggaacttggccatctcagtctcaacgacattgttggcagaaagagcgggc 359 ||| || |||| ||||||||||||||| |||||| | ||||||||||| ||| | ||| Sbjct: 361 aacattccctgaaacttggccatctcactctcaaaaatattgttggcagcaaggacaggc 302 Query: 360 acaccacagttctcaacacaattggtgattccctcttgactctgtcgcctatcaaagcag 419 |||| ||| ||||| ||||| ||| |||| | || ||| | || |||| ||||||||| Sbjct: 301 acactacaattctccacacagttgctgatcgcttcctgagtatggcgccgatcaaagcaa 242 Query: 420 tcatgtgcacacttgaagtacgctttctgcagggtgaagttgacgtggtcctgcacgccc 479 ||| ||| ||||||||||| |||| ||||| ||||||||||| ||||||||| || ||| Sbjct: 241 ccatatgcgcacttgaagtatgcttgctgcatggtgaagttgatgtggtcctggacaccc 182 Query: 480 tcgaggtgct 489 ||||||||| Sbjct: 181 gcgaggtgct 172
>gb|AC145365.3| Oryza sativa (japonica cultivar-group) chromosome 11 clone OSJNBa0069E11, complete sequence Length = 136959 Score = 109 bits (55), Expect = 9e-21 Identities = 130/155 (83%) Strand = Plus / Plus Query: 146 ggacttgatctgctcaaccaggtggggcaggaccctgatgctgtcgtcgatggacctgtt 205 |||||||||||| |||||||| ||||||||||||||||| ||||| || || || ||||| Sbjct: 40988 ggacttgatctgatcaaccagatggggcaggaccctgatactgtcatcaatagatctgtt 41047 Query: 206 cacgcacgactccagctcgttggttgcgtccgtcttcatcttctggagctttgctgcttc 265 ||||| | || ||||| | || || | || |||||||||||||||||||||||||| Sbjct: 41048 tacgcatgcttctagctcctcagtcgcatgtgttttcatcttctggagctttgctgcttc 41107 Query: 266 aaacttgtcttggcagaccatcaacgagcgattca 300 ||| || |||||||| |||||||| || ||||||| Sbjct: 41108 aaatttatcttggcacaccatcaaagatcgattca 41142 Score = 107 bits (54), Expect = 3e-20 Identities = 117/138 (84%) Strand = Plus / Plus Query: 307 cctggaacttggccatctcagtctcaacgacattgttggcagaaagagcgggcacaccac 366 ||||||| || ||||||||||||||||| ||||||||||||| ||| | ||||| | | Sbjct: 42137 cctggaatttagccatctcagtctcaacaacattgttggcagtaaggacaggcacgctgc 42196 Query: 367 agttctcaacacaattggtgattccctcttgactctgtcgcctatcaaagcagtcatgtg 426 ||||||||||||||||| |||| || |||||||| ||| | ||||||||| |||| | Sbjct: 42197 agttctcaacacaattgttgatcccttcttgacttcttcggcgatcaaagcattcatacg 42256 Query: 427 cacacttgaagtacgctt 444 |||||||||||||||||| Sbjct: 42257 cacacttgaagtacgctt 42274 Score = 69.9 bits (35), Expect = 8e-09 Identities = 50/55 (90%) Strand = Plus / Plus Query: 446 ctgcagggtgaagttgacgtggtcctgcacgccctcgaggtgcttctgtgcggcg 500 ||||| ||||||||||||||||||||| ||||| ||||||||||||| |||||| Sbjct: 43316 ctgcatggtgaagttgacgtggtcctggacgccggcgaggtgcttctgcgcggcg 43370
>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11, complete sequence Length = 28386948 Score = 109 bits (55), Expect = 9e-21 Identities = 130/155 (83%) Strand = Plus / Plus Query: 146 ggacttgatctgctcaaccaggtggggcaggaccctgatgctgtcgtcgatggacctgtt 205 |||||||||||| |||||||| ||||||||||||||||| ||||| || || || ||||| Sbjct: 8362062 ggacttgatctgatcaaccagatggggcaggaccctgatactgtcatcaatagatctgtt 8362121 Query: 206 cacgcacgactccagctcgttggttgcgtccgtcttcatcttctggagctttgctgcttc 265 ||||| | || ||||| | || || | || |||||||||||||||||||||||||| Sbjct: 8362122 tacgcatgcttctagctcctcagtcgcatgtgttttcatcttctggagctttgctgcttc 8362181 Query: 266 aaacttgtcttggcagaccatcaacgagcgattca 300 ||| || |||||||| |||||||| || ||||||| Sbjct: 8362182 aaatttatcttggcacaccatcaaagatcgattca 8362216 Score = 107 bits (54), Expect = 3e-20 Identities = 117/138 (84%) Strand = Plus / Plus Query: 307 cctggaacttggccatctcagtctcaacgacattgttggcagaaagagcgggcacaccac 366 ||||||| || ||||||||||||||||| ||||||||||||| ||| | ||||| | | Sbjct: 8363211 cctggaatttagccatctcagtctcaacaacattgttggcagtaaggacaggcacgctgc 8363270 Query: 367 agttctcaacacaattggtgattccctcttgactctgtcgcctatcaaagcagtcatgtg 426 ||||||||||||||||| |||| || |||||||| ||| | ||||||||| |||| | Sbjct: 8363271 agttctcaacacaattgttgatcccttcttgacttcttcggcgatcaaagcattcatacg 8363330 Query: 427 cacacttgaagtacgctt 444 |||||||||||||||||| Sbjct: 8363331 cacacttgaagtacgctt 8363348 Score = 69.9 bits (35), Expect = 8e-09 Identities = 50/55 (90%) Strand = Plus / Plus Query: 446 ctgcagggtgaagttgacgtggtcctgcacgccctcgaggtgcttctgtgcggcg 500 ||||| ||||||||||||||||||||| ||||| ||||||||||||| |||||| Sbjct: 8364390 ctgcatggtgaagttgacgtggtcctggacgccggcgaggtgcttctgcgcggcg 8364444
>gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome 11, complete sequence Length = 28369397 Score = 109 bits (55), Expect = 9e-21 Identities = 130/155 (83%) Strand = Plus / Plus Query: 146 ggacttgatctgctcaaccaggtggggcaggaccctgatgctgtcgtcgatggacctgtt 205 |||||||||||| |||||||| ||||||||||||||||| ||||| || || || ||||| Sbjct: 8432825 ggacttgatctgatcaaccagatggggcaggaccctgatactgtcatcaatagatctgtt 8432884 Query: 206 cacgcacgactccagctcgttggttgcgtccgtcttcatcttctggagctttgctgcttc 265 ||||| | || ||||| | || || | || |||||||||||||||||||||||||| Sbjct: 8432885 tacgcatgcttctagctcctcagtcgcatgtgttttcatcttctggagctttgctgcttc 8432944 Query: 266 aaacttgtcttggcagaccatcaacgagcgattca 300 ||| || |||||||| |||||||| || ||||||| Sbjct: 8432945 aaatttatcttggcacaccatcaaagatcgattca 8432979 Score = 107 bits (54), Expect = 3e-20 Identities = 117/138 (84%) Strand = Plus / Plus Query: 307 cctggaacttggccatctcagtctcaacgacattgttggcagaaagagcgggcacaccac 366 ||||||| || ||||||||||||||||| ||||||||||||| ||| | ||||| | | Sbjct: 8433974 cctggaatttagccatctcagtctcaacaacattgttggcagtaaggacaggcacgctgc 8434033 Query: 367 agttctcaacacaattggtgattccctcttgactctgtcgcctatcaaagcagtcatgtg 426 ||||||||||||||||| |||| || |||||||| ||| | ||||||||| |||| | Sbjct: 8434034 agttctcaacacaattgttgatcccttcttgacttcttcggcgatcaaagcattcatacg 8434093 Query: 427 cacacttgaagtacgctt 444 |||||||||||||||||| Sbjct: 8434094 cacacttgaagtacgctt 8434111 Score = 69.9 bits (35), Expect = 8e-09 Identities = 50/55 (90%) Strand = Plus / Plus Query: 446 ctgcagggtgaagttgacgtggtcctgcacgccctcgaggtgcttctgtgcggcg 500 ||||| ||||||||||||||||||||| ||||| ||||||||||||| |||||| Sbjct: 8435153 ctgcatggtgaagttgacgtggtcctggacgccggcgaggtgcttctgcgcggcg 8435207
>ref|NM_128730.2| Arabidopsis thaliana unknown protein AT2G31725 mRNA, complete cds Length = 634 Score = 46.1 bits (23), Expect = 0.11 Identities = 32/35 (91%) Strand = Plus / Minus Query: 243 atcttctggagctttgctgcttcaaacttgtcttg 277 |||||||||||||||| || |||||||||||||| Sbjct: 386 atcttctggagctttgaggcctcaaacttgtcttg 352 Score = 46.1 bits (23), Expect = 0.11 Identities = 47/55 (85%) Strand = Plus / Minus Query: 408 ctatcaaagcagtcatgtgcacacttgaagtacgctttctgcagggtgaagttga 462 ||||||||||| |||| |||||| ||||| || |||| ||| |||||||| |||| Sbjct: 221 ctatcaaagcactcatatgcacatttgaaataagcttgctgaagggtgaaattga 167
>ref|NM_100453.2| Arabidopsis thaliana unknown protein AT1G05730 mRNA, complete cds Length = 1146 Score = 46.1 bits (23), Expect = 0.11 Identities = 38/43 (88%) Strand = Plus / Minus Query: 244 tcttctggagctttgctgcttcaaacttgtcttggcagaccat 286 |||| ||||||||||| || ||||| |||||||| |||||||| Sbjct: 883 tcttatggagctttgcagcctcaaatttgtcttgacagaccat 841
>gb|DQ446231.1| Arabidopsis thaliana clone pENTR221-At1g05740 unknown (At1g05740) mRNA, complete cds Length = 450 Score = 46.1 bits (23), Expect = 0.11 Identities = 38/43 (88%) Strand = Plus / Minus Query: 244 tcttctggagctttgctgcttcaaacttgtcttggcagaccat 286 |||| ||||||||||| || ||||| |||||||| |||||||| Sbjct: 331 tcttatggagctttgcagcctcaaatttgtcttgacagaccat 289
>gb|AC007071.7| Arabidopsis thaliana chromosome 2 clone T9H9 map nga361, complete sequence Length = 79734 Score = 46.1 bits (23), Expect = 0.11 Identities = 32/35 (91%) Strand = Plus / Plus Query: 243 atcttctggagctttgctgcttcaaacttgtcttg 277 |||||||||||||||| || |||||||||||||| Sbjct: 75309 atcttctggagctttgaggcctcaaacttgtcttg 75343
>gb|AC006533.8| Arabidopsis thaliana chromosome 2 clone F20M17 map nga361, complete sequence Length = 100665 Score = 46.1 bits (23), Expect = 0.11 Identities = 32/35 (91%) Strand = Plus / Minus Query: 243 atcttctggagctttgctgcttcaaacttgtcttg 277 |||||||||||||||| || |||||||||||||| Sbjct: 99873 atcttctggagctttgaggcctcaaacttgtcttg 99839
>emb|BX814392.1|CNS0AC6K Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB71ZC09 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1146 Score = 46.1 bits (23), Expect = 0.11 Identities = 38/43 (88%) Strand = Plus / Minus Query: 244 tcttctggagctttgctgcttcaaacttgtcttggcagaccat 286 |||| ||||||||||| || ||||| |||||||| |||||||| Sbjct: 883 tcttatggagctttgcagcctcaaatttgtcttgacagaccat 841
>gb|AY086445.1| Arabidopsis thaliana clone 25159 mRNA, complete sequence Length = 611 Score = 46.1 bits (23), Expect = 0.11 Identities = 32/35 (91%) Strand = Plus / Minus Query: 243 atcttctggagctttgctgcttcaaacttgtcttg 277 |||||||||||||||| || |||||||||||||| Sbjct: 386 atcttctggagctttgaggcctcaaacttgtcttg 352
>gb|AY924655.1| Arabidopsis thaliana hypothetical protein (At1g05730) mRNA, complete cds Length = 450 Score = 46.1 bits (23), Expect = 0.11 Identities = 38/43 (88%) Strand = Plus / Minus Query: 244 tcttctggagctttgctgcttcaaacttgtcttggcagaccat 286 |||| ||||||||||| || ||||| |||||||| |||||||| Sbjct: 331 tcttatggagctttgcagcctcaaatttgtcttgacagaccat 289
>gb|AC007153.2| Arabidopsis thaliana chromosome I BAC F3F20 genomic sequence, complete sequence Length = 103223 Score = 46.1 bits (23), Expect = 0.11 Identities = 38/43 (88%) Strand = Plus / Minus Query: 244 tcttctggagctttgctgcttcaaacttgtcttggcagaccat 286 |||| ||||||||||| || ||||| |||||||| |||||||| Sbjct: 101564 tcttatggagctttgcagcctcaaatttgtcttgacagaccat 101522
>gb|CP000110.1| Synechococcus sp. CC9605, complete genome Length = 2510659 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 155 ctgctcaaccaggtggggcagg 176 |||||||||||||||||||||| Sbjct: 353095 ctgctcaaccaggtggggcagg 353116
>gb|CP000251.1| Anaeromyxobacter dehalogenans 2CP-C, complete genome Length = 5013479 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 472 gcacgccctcgaggtgcttctg 493 |||||||||||||||||||||| Sbjct: 550585 gcacgccctcgaggtgcttctg 550564
>gb|AC092834.3| Homo sapiens BAC clone RP13-497K6 from 4, complete sequence Length = 146708 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 78 ctagactttggatggcaaaaa 98 ||||||||||||||||||||| Sbjct: 33921 ctagactttggatggcaaaaa 33901
>gb|AC138010.13| Medicago truncatula clone mth2-21i21, complete sequence Length = 109275 Score = 40.1 bits (20), Expect = 6.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 351 agagcgggcacaccacagttctca 374 ||||||| |||||||||||||||| Sbjct: 39162 agagcggccacaccacagttctca 39139
>gb|AC147013.4| Medicago truncatula clone mth2-159f24, complete sequence Length = 118017 Score = 40.1 bits (20), Expect = 6.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 351 agagcgggcacaccacagttctca 374 ||||||| |||||||||||||||| Sbjct: 47672 agagcggccacaccacagttctca 47649
>emb|BX664615.10| Human DNA sequence from clone RP11-104G3 on chromosome 9 Contains a RAB28, member RAS oncogene family pseudogene (RAB28), a pseudogene similar to part of recombining binding protein suppressor of hairless (Drosophila) (RBPSUH), two novel pseudogenes, a pseudogene similar to part of fibroblast growth factor 7 (keratinocyte growth factor) (FGF7), the 3' end of a novel gene and two CpG islands, complete sequence Length = 163837 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 33 caccattatgtaatgctctc 52 |||||||||||||||||||| Sbjct: 144013 caccattatgtaatgctctc 143994
>emb|CR769767.5| Human DNA sequence from clone RP11-204M4 on chromosome 9 Contains the 5' end of a novel gene, a novel pseudogene and a pseudogene similar to part of ribosomal protein L10 (RPL10), complete sequence Length = 153630 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 33 caccattatgtaatgctctc 52 |||||||||||||||||||| Sbjct: 22026 caccattatgtaatgctctc 22007
>emb|AL356458.13| Human DNA sequence from clone RP4-666O22 on chromosome 1p34.1-35.1 Contains a ribosomal protein L21 (RPL21) pseudogene, and an ATPase, H+ transporting, lysosomal 9kDa, V0 subunit e (ATP6V0E) pseudogene, complete sequence Length = 115828 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 302 cctttcctggaacttggcca 321 |||||||||||||||||||| Sbjct: 55973 cctttcctggaacttggcca 55992
>emb|AL109752.14|HSJ321O10 Human DNA sequence from clone RP1-321O10 on chromosome Xq13.1-21.2 Contains the 5' end of the DACH2 gene for dachshund homolog 2 (Drosophila), aeukaryotic translation elongation factor 1 alpha 1 (EEF1A1) pseudogene and a CpG island, complete sequence Length = 79562 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 33 caccattatgtaatgctctc 52 |||||||||||||||||||| Sbjct: 55897 caccattatgtaatgctctc 55878
>emb|CR792458.6| Zebrafish DNA sequence from clone RP71-47I2, complete sequence Length = 186632 Score = 40.1 bits (20), Expect = 6.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 149 cttgatctgctcaaccaggtgggg 172 |||||||| ||||||||||||||| Sbjct: 179168 cttgatcttctcaaccaggtgggg 179145
>emb|CR788307.3| Human DNA sequence from clone RP11-384N15 on chromosome 9, complete sequence Length = 166827 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 33 caccattatgtaatgctctc 52 |||||||||||||||||||| Sbjct: 71506 caccattatgtaatgctctc 71525
>ref|XM_682749.1| PREDICTED: Danio rerio similar to putative nuclear protein, with a coiled coil domain, of bilaterial origin (15.0 kD) (1O20) (LOC559409), mRNA Length = 1184 Score = 40.1 bits (20), Expect = 6.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 238 tcttcatcttctggagctttgctg 261 ||||||||||||||| |||||||| Sbjct: 866 tcttcatcttctggatctttgctg 843
>gb|AC151970.5| Mus musculus BAC clone RP24-255F16 from chromosome 15, complete sequence Length = 181163 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 379 aattggtgattccctcttga 398 |||||||||||||||||||| Sbjct: 41645 aattggtgattccctcttga 41664
>gb|AC140977.1| Arabidopsis thaliana chromosome 5 BAC F13M11 genomic sequence, complete sequence Length = 112600 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 agtagtgatctcatgttaca 77 |||||||||||||||||||| Sbjct: 102385 agtagtgatctcatgttaca 102404
>gb|AC069325.6|AC069325 Genomic Sequence For Arabidopsis thaliana Clone T10F18 From Chromosome V, complete sequence Length = 84413 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 agtagtgatctcatgttaca 77 |||||||||||||||||||| Sbjct: 37471 agtagtgatctcatgttaca 37490
>gb|AC140403.3| Mus musculus BAC clone RP23-144M22 from 15, complete sequence Length = 192144 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 379 aattggtgattccctcttga 398 |||||||||||||||||||| Sbjct: 160261 aattggtgattccctcttga 160280
>emb|AL772264.8| Mouse DNA sequence from clone RP23-15I21 on chromosome 2, complete sequence Length = 189540 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 391 cctcttgactctgtcgccta 410 |||||||||||||||||||| Sbjct: 120146 cctcttgactctgtcgccta 120165 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 3,941,700 Number of Sequences: 3902068 Number of extensions: 3941700 Number of successful extensions: 80174 Number of sequences better than 10.0: 32 Number of HSP's better than 10.0 without gapping: 32 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 80043 Number of HSP's gapped (non-prelim): 130 length of query: 502 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 480 effective length of database: 17,147,199,772 effective search space: 8230655890560 effective search space used: 8230655890560 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)