>dbj|AK107906.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-134-G01, full
           insert sequence
          Length = 832

 Score =  268 bits (135), Expect = 2e-68
 Identities = 300/355 (84%)
 Strand = Plus / Minus

                                                                       
Query: 146 ggacttgatctgctcaaccaggtggggcaggaccctgatgctgtcgtcgatggacctgtt 205
           |||||||||||| |||||||| ||||||||||||||||| ||||| || || || |||||
Sbjct: 554 ggacttgatctgatcaaccagatggggcaggaccctgatactgtcatcaatagatctgtt 495

                                                                       
Query: 206 cacgcacgactccagctcgttggttgcgtccgtcttcatcttctggagctttgctgcttc 265
            ||||| |  || ||||| |  || || |  || ||||||||||||||||||||||||||
Sbjct: 494 tacgcatgcttctagctcctcagtcgcatgtgttttcatcttctggagctttgctgcttc 435

                                                                       
Query: 266 aaacttgtcttggcagaccatcaacgagcgattcaacctttcctggaacttggccatctc 325
           ||| || |||||||| |||||||| || ||||||| ||  |||||||| || ||||||||
Sbjct: 434 aaatttatcttggcacaccatcaaagatcgattcagccgctcctggaatttagccatctc 375

                                                                       
Query: 326 agtctcaacgacattgttggcagaaagagcgggcacaccacagttctcaacacaattggt 385
           ||||||||| ||||||||||||| |||  | ||||| |  |||||||||||||||||| |
Sbjct: 374 agtctcaacaacattgttggcagtaaggacaggcacgctgcagttctcaacacaattgtt 315

                                                                       
Query: 386 gattccctcttgactctgtcgcctatcaaagcagtcatgtgcacacttgaagtacgcttt 445
           ||| || ||||||||   ||| | ||||||||| ||||  ||||||||||||||||||| 
Sbjct: 314 gatcccttcttgacttcttcggcgatcaaagcattcatacgcacacttgaagtacgcttg 255

                                                                  
Query: 446 ctgcagggtgaagttgacgtggtcctgcacgccctcgaggtgcttctgtgcggcg 500
           ||||| ||||||||||||||||||||| |||||  ||||||||||||| ||||||
Sbjct: 254 ctgcatggtgaagttgacgtggtcctggacgccggcgaggtgcttctgcgcggcg 200

>gb|AY104565.1| Zea mays PCO085521 mRNA sequence
          Length = 680

 Score =  182 bits (92), Expect = 7e-43
 Identities = 257/312 (82%)
 Strand = Plus / Minus

                                                                       
Query: 178 ccctgatgctgtcgtcgatggacctgttcacgcacgactccagctcgttggttgcgtccg 237
           ||||||||||||| ||||| || ||||| || || || ||||| || |  ||||| || |
Sbjct: 485 ccctgatgctgtcatcgatagatctgttgacacaggattccagttcctgagttgcatctg 426

                                                                       
Query: 238 tcttcatcttctggagctttgctgcttcaaacttgtcttggcagaccatcaacgagcgat 297
           | ||||||||||||||||| || ||||||||||| ||||| ||||||||||| || || |
Sbjct: 425 ttttcatcttctggagcttggcagcttcaaacttatcttgacagaccatcaatgaccggt 366

                                                                       
Query: 298 tcaacctttcctggaacttggccatctcagtctcaacgacattgttggcagaaagagcgg 357
           |||||| |||||| ||||||||||||||| ||||||  ||||||||| ||| |||  | |
Sbjct: 365 tcaaccgttcctgaaacttggccatctcactctcaaaaacattgttgacagcaaggacag 306

                                                                       
Query: 358 gcacaccacagttctcaacacaattggtgattccctcttgactctgtcgcctatcaaagc 417
           ||| |||||| ||||| ||||||||| ||||  | || ||| |  | |||| ||| ||||
Sbjct: 305 gcataccacaattctccacacaattgttgatcgcttcctgagtacggcgccgatcgaagc 246

                                                                       
Query: 418 agtcatgtgcacacttgaagtacgctttctgcagggtgaagttgacgtggtcctgcacgc 477
           | |||| ||| ||||||||||| |||| ||||| ||||||||||||||||||||| | ||
Sbjct: 245 aatcatatgcgcacttgaagtatgcttgctgcatggtgaagttgacgtggtcctggatgc 186

                       
Query: 478 cctcgaggtgct 489
           |  |||||||||
Sbjct: 185 cggcgaggtgct 174

>gb|AY108007.1| Zea mays PCO128617 mRNA sequence
          Length = 808

 Score =  139 bits (70), Expect = 1e-29
 Identities = 205/250 (82%)
 Strand = Plus / Minus

                                                                       
Query: 240 ttcatcttctggagctttgctgcttcaaacttgtcttggcagaccatcaacgagcgattc 299
           |||| ||||||||| || || ||||||||||| ||||| |||||| |||| || || |||
Sbjct: 421 ttcaacttctggagattggcagcttcaaacttatcttgacagaccctcaatgaccggttc 362

                                                                       
Query: 300 aacctttcctggaacttggccatctcagtctcaacgacattgttggcagaaagagcgggc 359
           ||| || |||| ||||||||||||||| ||||||  | ||||||||||| |||  | |||
Sbjct: 361 aacattccctgaaacttggccatctcactctcaaaaatattgttggcagcaaggacaggc 302

                                                                       
Query: 360 acaccacagttctcaacacaattggtgattccctcttgactctgtcgcctatcaaagcag 419
           |||| ||| ||||| ||||| ||| ||||  | || ||| | || |||| ||||||||| 
Sbjct: 301 acactacaattctccacacagttgctgatcgcttcctgagtatggcgccgatcaaagcaa 242

                                                                       
Query: 420 tcatgtgcacacttgaagtacgctttctgcagggtgaagttgacgtggtcctgcacgccc 479
            ||| ||| ||||||||||| |||| ||||| ||||||||||| ||||||||| || |||
Sbjct: 241 ccatatgcgcacttgaagtatgcttgctgcatggtgaagttgatgtggtcctggacaccc 182

                     
Query: 480 tcgaggtgct 489
            |||||||||
Sbjct: 181 gcgaggtgct 172

>gb|AC145365.3| Oryza sativa (japonica cultivar-group) chromosome 11 clone
             OSJNBa0069E11, complete sequence
          Length = 136959

 Score =  109 bits (55), Expect = 9e-21
 Identities = 130/155 (83%)
 Strand = Plus / Plus

                                                                         
Query: 146   ggacttgatctgctcaaccaggtggggcaggaccctgatgctgtcgtcgatggacctgtt 205
             |||||||||||| |||||||| ||||||||||||||||| ||||| || || || |||||
Sbjct: 40988 ggacttgatctgatcaaccagatggggcaggaccctgatactgtcatcaatagatctgtt 41047

                                                                         
Query: 206   cacgcacgactccagctcgttggttgcgtccgtcttcatcttctggagctttgctgcttc 265
              ||||| |  || ||||| |  || || |  || ||||||||||||||||||||||||||
Sbjct: 41048 tacgcatgcttctagctcctcagtcgcatgtgttttcatcttctggagctttgctgcttc 41107

                                                
Query: 266   aaacttgtcttggcagaccatcaacgagcgattca 300
             ||| || |||||||| |||||||| || |||||||
Sbjct: 41108 aaatttatcttggcacaccatcaaagatcgattca 41142



 Score =  107 bits (54), Expect = 3e-20
 Identities = 117/138 (84%)
 Strand = Plus / Plus

                                                                         
Query: 307   cctggaacttggccatctcagtctcaacgacattgttggcagaaagagcgggcacaccac 366
             ||||||| || ||||||||||||||||| ||||||||||||| |||  | ||||| |  |
Sbjct: 42137 cctggaatttagccatctcagtctcaacaacattgttggcagtaaggacaggcacgctgc 42196

                                                                         
Query: 367   agttctcaacacaattggtgattccctcttgactctgtcgcctatcaaagcagtcatgtg 426
             ||||||||||||||||| |||| || ||||||||   ||| | ||||||||| ||||  |
Sbjct: 42197 agttctcaacacaattgttgatcccttcttgacttcttcggcgatcaaagcattcatacg 42256

                               
Query: 427   cacacttgaagtacgctt 444
             ||||||||||||||||||
Sbjct: 42257 cacacttgaagtacgctt 42274



 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 50/55 (90%)
 Strand = Plus / Plus

                                                                    
Query: 446   ctgcagggtgaagttgacgtggtcctgcacgccctcgaggtgcttctgtgcggcg 500
             ||||| ||||||||||||||||||||| |||||  ||||||||||||| ||||||
Sbjct: 43316 ctgcatggtgaagttgacgtggtcctggacgccggcgaggtgcttctgcgcggcg 43370

>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11, complete
               sequence
          Length = 28386948

 Score =  109 bits (55), Expect = 9e-21
 Identities = 130/155 (83%)
 Strand = Plus / Plus

                                                                           
Query: 146     ggacttgatctgctcaaccaggtggggcaggaccctgatgctgtcgtcgatggacctgtt 205
               |||||||||||| |||||||| ||||||||||||||||| ||||| || || || |||||
Sbjct: 8362062 ggacttgatctgatcaaccagatggggcaggaccctgatactgtcatcaatagatctgtt 8362121

                                                                           
Query: 206     cacgcacgactccagctcgttggttgcgtccgtcttcatcttctggagctttgctgcttc 265
                ||||| |  || ||||| |  || || |  || ||||||||||||||||||||||||||
Sbjct: 8362122 tacgcatgcttctagctcctcagtcgcatgtgttttcatcttctggagctttgctgcttc 8362181

                                                  
Query: 266     aaacttgtcttggcagaccatcaacgagcgattca 300
               ||| || |||||||| |||||||| || |||||||
Sbjct: 8362182 aaatttatcttggcacaccatcaaagatcgattca 8362216



 Score =  107 bits (54), Expect = 3e-20
 Identities = 117/138 (84%)
 Strand = Plus / Plus

                                                                           
Query: 307     cctggaacttggccatctcagtctcaacgacattgttggcagaaagagcgggcacaccac 366
               ||||||| || ||||||||||||||||| ||||||||||||| |||  | ||||| |  |
Sbjct: 8363211 cctggaatttagccatctcagtctcaacaacattgttggcagtaaggacaggcacgctgc 8363270

                                                                           
Query: 367     agttctcaacacaattggtgattccctcttgactctgtcgcctatcaaagcagtcatgtg 426
               ||||||||||||||||| |||| || ||||||||   ||| | ||||||||| ||||  |
Sbjct: 8363271 agttctcaacacaattgttgatcccttcttgacttcttcggcgatcaaagcattcatacg 8363330

                                 
Query: 427     cacacttgaagtacgctt 444
               ||||||||||||||||||
Sbjct: 8363331 cacacttgaagtacgctt 8363348



 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 50/55 (90%)
 Strand = Plus / Plus

                                                                      
Query: 446     ctgcagggtgaagttgacgtggtcctgcacgccctcgaggtgcttctgtgcggcg 500
               ||||| ||||||||||||||||||||| |||||  ||||||||||||| ||||||
Sbjct: 8364390 ctgcatggtgaagttgacgtggtcctggacgccggcgaggtgcttctgcgcggcg 8364444

>gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome 11, complete sequence
          Length = 28369397

 Score =  109 bits (55), Expect = 9e-21
 Identities = 130/155 (83%)
 Strand = Plus / Plus

                                                                           
Query: 146     ggacttgatctgctcaaccaggtggggcaggaccctgatgctgtcgtcgatggacctgtt 205
               |||||||||||| |||||||| ||||||||||||||||| ||||| || || || |||||
Sbjct: 8432825 ggacttgatctgatcaaccagatggggcaggaccctgatactgtcatcaatagatctgtt 8432884

                                                                           
Query: 206     cacgcacgactccagctcgttggttgcgtccgtcttcatcttctggagctttgctgcttc 265
                ||||| |  || ||||| |  || || |  || ||||||||||||||||||||||||||
Sbjct: 8432885 tacgcatgcttctagctcctcagtcgcatgtgttttcatcttctggagctttgctgcttc 8432944

                                                  
Query: 266     aaacttgtcttggcagaccatcaacgagcgattca 300
               ||| || |||||||| |||||||| || |||||||
Sbjct: 8432945 aaatttatcttggcacaccatcaaagatcgattca 8432979



 Score =  107 bits (54), Expect = 3e-20
 Identities = 117/138 (84%)
 Strand = Plus / Plus

                                                                           
Query: 307     cctggaacttggccatctcagtctcaacgacattgttggcagaaagagcgggcacaccac 366
               ||||||| || ||||||||||||||||| ||||||||||||| |||  | ||||| |  |
Sbjct: 8433974 cctggaatttagccatctcagtctcaacaacattgttggcagtaaggacaggcacgctgc 8434033

                                                                           
Query: 367     agttctcaacacaattggtgattccctcttgactctgtcgcctatcaaagcagtcatgtg 426
               ||||||||||||||||| |||| || ||||||||   ||| | ||||||||| ||||  |
Sbjct: 8434034 agttctcaacacaattgttgatcccttcttgacttcttcggcgatcaaagcattcatacg 8434093

                                 
Query: 427     cacacttgaagtacgctt 444
               ||||||||||||||||||
Sbjct: 8434094 cacacttgaagtacgctt 8434111



 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 50/55 (90%)
 Strand = Plus / Plus

                                                                      
Query: 446     ctgcagggtgaagttgacgtggtcctgcacgccctcgaggtgcttctgtgcggcg 500
               ||||| ||||||||||||||||||||| |||||  ||||||||||||| ||||||
Sbjct: 8435153 ctgcatggtgaagttgacgtggtcctggacgccggcgaggtgcttctgcgcggcg 8435207

>ref|NM_128730.2| Arabidopsis thaliana unknown protein AT2G31725 mRNA, complete cds
          Length = 634

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 243 atcttctggagctttgctgcttcaaacttgtcttg 277
           ||||||||||||||||  || ||||||||||||||
Sbjct: 386 atcttctggagctttgaggcctcaaacttgtcttg 352



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                  
Query: 408 ctatcaaagcagtcatgtgcacacttgaagtacgctttctgcagggtgaagttga 462
           ||||||||||| |||| |||||| ||||| || |||| ||| |||||||| ||||
Sbjct: 221 ctatcaaagcactcatatgcacatttgaaataagcttgctgaagggtgaaattga 167

>ref|NM_100453.2| Arabidopsis thaliana unknown protein AT1G05730 mRNA, complete cds
          Length = 1146

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 244 tcttctggagctttgctgcttcaaacttgtcttggcagaccat 286
           |||| ||||||||||| || ||||| |||||||| ||||||||
Sbjct: 883 tcttatggagctttgcagcctcaaatttgtcttgacagaccat 841

>gb|DQ446231.1| Arabidopsis thaliana clone pENTR221-At1g05740 unknown (At1g05740)
           mRNA, complete cds
          Length = 450

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 244 tcttctggagctttgctgcttcaaacttgtcttggcagaccat 286
           |||| ||||||||||| || ||||| |||||||| ||||||||
Sbjct: 331 tcttatggagctttgcagcctcaaatttgtcttgacagaccat 289

>gb|AC007071.7| Arabidopsis thaliana chromosome 2 clone T9H9 map nga361, complete
             sequence
          Length = 79734

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                                
Query: 243   atcttctggagctttgctgcttcaaacttgtcttg 277
             ||||||||||||||||  || ||||||||||||||
Sbjct: 75309 atcttctggagctttgaggcctcaaacttgtcttg 75343

>gb|AC006533.8| Arabidopsis thaliana chromosome 2 clone F20M17 map nga361, complete
             sequence
          Length = 100665

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                                
Query: 243   atcttctggagctttgctgcttcaaacttgtcttg 277
             ||||||||||||||||  || ||||||||||||||
Sbjct: 99873 atcttctggagctttgaggcctcaaacttgtcttg 99839

>emb|BX814392.1|CNS0AC6K Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB71ZC09 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 1146

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 244 tcttctggagctttgctgcttcaaacttgtcttggcagaccat 286
           |||| ||||||||||| || ||||| |||||||| ||||||||
Sbjct: 883 tcttatggagctttgcagcctcaaatttgtcttgacagaccat 841

>gb|AY086445.1| Arabidopsis thaliana clone 25159 mRNA, complete sequence
          Length = 611

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 243 atcttctggagctttgctgcttcaaacttgtcttg 277
           ||||||||||||||||  || ||||||||||||||
Sbjct: 386 atcttctggagctttgaggcctcaaacttgtcttg 352

>gb|AY924655.1| Arabidopsis thaliana hypothetical protein (At1g05730) mRNA,
           complete cds
          Length = 450

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 244 tcttctggagctttgctgcttcaaacttgtcttggcagaccat 286
           |||| ||||||||||| || ||||| |||||||| ||||||||
Sbjct: 331 tcttatggagctttgcagcctcaaatttgtcttgacagaccat 289

>gb|AC007153.2| Arabidopsis thaliana chromosome I BAC F3F20 genomic sequence, complete
              sequence
          Length = 103223

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                         
Query: 244    tcttctggagctttgctgcttcaaacttgtcttggcagaccat 286
              |||| ||||||||||| || ||||| |||||||| ||||||||
Sbjct: 101564 tcttatggagctttgcagcctcaaatttgtcttgacagaccat 101522

>gb|CP000110.1| Synechococcus sp. CC9605, complete genome
          Length = 2510659

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 155    ctgctcaaccaggtggggcagg 176
              ||||||||||||||||||||||
Sbjct: 353095 ctgctcaaccaggtggggcagg 353116

>gb|CP000251.1| Anaeromyxobacter dehalogenans 2CP-C, complete genome
          Length = 5013479

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 472    gcacgccctcgaggtgcttctg 493
              ||||||||||||||||||||||
Sbjct: 550585 gcacgccctcgaggtgcttctg 550564

>gb|AC092834.3| Homo sapiens BAC clone RP13-497K6 from 4, complete sequence
          Length = 146708

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 78    ctagactttggatggcaaaaa 98
             |||||||||||||||||||||
Sbjct: 33921 ctagactttggatggcaaaaa 33901

>gb|AC138010.13| Medicago truncatula clone mth2-21i21, complete sequence
          Length = 109275

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 351   agagcgggcacaccacagttctca 374
             ||||||| ||||||||||||||||
Sbjct: 39162 agagcggccacaccacagttctca 39139

>gb|AC147013.4| Medicago truncatula clone mth2-159f24, complete sequence
          Length = 118017

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 351   agagcgggcacaccacagttctca 374
             ||||||| ||||||||||||||||
Sbjct: 47672 agagcggccacaccacagttctca 47649

>emb|BX664615.10| Human DNA sequence from clone RP11-104G3 on chromosome 9 Contains a
              RAB28, member RAS oncogene family pseudogene (RAB28), a
              pseudogene similar to part of recombining binding protein
              suppressor of hairless (Drosophila) (RBPSUH), two novel
              pseudogenes, a pseudogene similar to part of fibroblast
              growth factor 7 (keratinocyte growth factor) (FGF7), the 3'
              end of a novel gene and two CpG islands, complete sequence
          Length = 163837

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 33     caccattatgtaatgctctc 52
              ||||||||||||||||||||
Sbjct: 144013 caccattatgtaatgctctc 143994

>emb|CR769767.5| Human DNA sequence from clone RP11-204M4 on chromosome 9 Contains the
             5' end of a novel gene, a novel pseudogene and a
             pseudogene similar to part of ribosomal protein L10
             (RPL10), complete sequence
          Length = 153630

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 33    caccattatgtaatgctctc 52
             ||||||||||||||||||||
Sbjct: 22026 caccattatgtaatgctctc 22007

>emb|AL356458.13| Human DNA sequence from clone RP4-666O22 on chromosome 1p34.1-35.1
             Contains a ribosomal protein L21 (RPL21) pseudogene, and
             an  ATPase, H+ transporting, lysosomal 9kDa, V0 subunit e
             (ATP6V0E) pseudogene, complete sequence
          Length = 115828

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 302   cctttcctggaacttggcca 321
             ||||||||||||||||||||
Sbjct: 55973 cctttcctggaacttggcca 55992

>emb|AL109752.14|HSJ321O10 Human DNA sequence from clone RP1-321O10 on chromosome Xq13.1-21.2
             Contains the 5' end of the DACH2 gene for dachshund
             homolog 2 (Drosophila), aeukaryotic translation elongation
             factor 1 alpha 1 (EEF1A1) pseudogene and a CpG island,
             complete sequence
          Length = 79562

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 33    caccattatgtaatgctctc 52
             ||||||||||||||||||||
Sbjct: 55897 caccattatgtaatgctctc 55878

>emb|CR792458.6| Zebrafish DNA sequence from clone RP71-47I2, complete sequence
          Length = 186632

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 149    cttgatctgctcaaccaggtgggg 172
              |||||||| |||||||||||||||
Sbjct: 179168 cttgatcttctcaaccaggtgggg 179145

>emb|CR788307.3| Human DNA sequence from clone RP11-384N15 on chromosome 9, complete
             sequence
          Length = 166827

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 33    caccattatgtaatgctctc 52
             ||||||||||||||||||||
Sbjct: 71506 caccattatgtaatgctctc 71525

>ref|XM_682749.1| PREDICTED: Danio rerio similar to putative nuclear protein, with a
           coiled coil domain, of bilaterial origin (15.0 kD)
           (1O20) (LOC559409), mRNA
          Length = 1184

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 238 tcttcatcttctggagctttgctg 261
           ||||||||||||||| ||||||||
Sbjct: 866 tcttcatcttctggatctttgctg 843

>gb|AC151970.5| Mus musculus BAC clone RP24-255F16 from chromosome 15, complete
             sequence
          Length = 181163

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 379   aattggtgattccctcttga 398
             ||||||||||||||||||||
Sbjct: 41645 aattggtgattccctcttga 41664

>gb|AC140977.1| Arabidopsis thaliana chromosome 5 BAC F13M11 genomic sequence, complete
              sequence
          Length = 112600

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 58     agtagtgatctcatgttaca 77
              ||||||||||||||||||||
Sbjct: 102385 agtagtgatctcatgttaca 102404

>gb|AC069325.6|AC069325 Genomic Sequence For Arabidopsis thaliana Clone T10F18 From Chromosome
             V, complete sequence
          Length = 84413

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 58    agtagtgatctcatgttaca 77
             ||||||||||||||||||||
Sbjct: 37471 agtagtgatctcatgttaca 37490

>gb|AC140403.3| Mus musculus BAC clone RP23-144M22 from 15, complete sequence
          Length = 192144

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 379    aattggtgattccctcttga 398
              ||||||||||||||||||||
Sbjct: 160261 aattggtgattccctcttga 160280

>emb|AL772264.8| Mouse DNA sequence from clone RP23-15I21 on chromosome 2, complete
              sequence
          Length = 189540

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 391    cctcttgactctgtcgccta 410
              ||||||||||||||||||||
Sbjct: 120146 cctcttgactctgtcgccta 120165


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,941,700
Number of Sequences: 3902068
Number of extensions: 3941700
Number of successful extensions: 80174
Number of sequences better than 10.0: 32
Number of HSP's better than 10.0 without gapping: 32
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 80043
Number of HSP's gapped (non-prelim): 130
length of query: 502
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 480
effective length of database: 17,147,199,772
effective search space: 8230655890560
effective search space used: 8230655890560
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)