| Clone Name | rbags19d12 |
|---|---|
| Clone Library Name | barley_pub |
>gb|AC118232.10| Mus musculus chromosome 9, clone RP23-462C3, complete sequence Length = 192990 Score = 44.1 bits (22), Expect = 0.26 Identities = 22/22 (100%) Strand = Plus / Minus Query: 243 catgctcaggccatcaacgcct 264 |||||||||||||||||||||| Sbjct: 95354 catgctcaggccatcaacgcct 95333
>gb|AC159993.10| Mus musculus chromosome 8, clone RP23-39P7, complete sequence Length = 211785 Score = 40.1 bits (20), Expect = 4.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 261 gcctaacaattagagaaaga 280 |||||||||||||||||||| Sbjct: 185603 gcctaacaattagagaaaga 185584
>gb|L39769.1|PIP501AA Plasmid pIP501 (from Streptococcus) genes, six complete coding regions Length = 8136 Score = 40.1 bits (20), Expect = 4.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 79 tgattgccattttcatctag 98 |||||||||||||||||||| Sbjct: 1890 tgattgccattttcatctag 1871
>emb|X92945.2|EFCAT501 Enterococcus faecalis plasmid pRE25 DNA Length = 50237 Score = 40.1 bits (20), Expect = 4.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 79 tgattgccattttcatctag 98 |||||||||||||||||||| Sbjct: 20112 tgattgccattttcatctag 20093
>emb|AL663115.11| Mouse DNA sequence from clone RP23-452C23 on chromosome 11 Contains the gene for a novel protein simialr to cell division cycle associated 4 Cdca4, a ribosomal protein L15 (Rpl15) pseudogene, the 3' end of a novel gene and two CpG islands, complete sequence Length = 183089 Score = 40.1 bits (20), Expect = 4.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 202 aaggctatcagcgtgaaact 221 |||||||||||||||||||| Sbjct: 117482 aaggctatcagcgtgaaact 117501
>gb|AC092673.3| Homo sapiens BAC clone RP11-624A4 from 4, complete sequence Length = 166339 Score = 40.1 bits (20), Expect = 4.1 Identities = 23/24 (95%) Strand = Plus / Plus Query: 182 atgaaactaaaggggaaataaagg 205 |||||||||||||||||| ||||| Sbjct: 85574 atgaaactaaaggggaaaaaaagg 85597
>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete sequence Length = 22696651 Score = 40.1 bits (20), Expect = 4.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 26 tttttatttttcctcgacta 45 |||||||||||||||||||| Sbjct: 20167693 tttttatttttcctcgacta 20167674
>gb|AC016763.8| Homo sapiens BAC clone RP11-548K3 from 2, complete sequence Length = 143283 Score = 40.1 bits (20), Expect = 4.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 160 caagggcaaggctatatata 179 |||||||||||||||||||| Sbjct: 120623 caagggcaaggctatatata 120642
>dbj|AP005864.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC clone:OSJNBa0047P18 Length = 169128 Score = 40.1 bits (20), Expect = 4.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 26 tttttatttttcctcgacta 45 |||||||||||||||||||| Sbjct: 61193 tttttatttttcctcgacta 61174
>gb|AC090227.10| Homo sapiens chromosome 18, clone RP11-813F20, complete sequence Length = 224366 Score = 40.1 bits (20), Expect = 4.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 217 aaactgaagggcaaaaacat 236 |||||||||||||||||||| Sbjct: 140323 aaactgaagggcaaaaacat 140304 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 3,655,400 Number of Sequences: 3902068 Number of extensions: 3655400 Number of successful extensions: 65926 Number of sequences better than 10.0: 10 Number of HSP's better than 10.0 without gapping: 10 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 65905 Number of HSP's gapped (non-prelim): 21 length of query: 312 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 290 effective length of database: 17,147,199,772 effective search space: 4972687933880 effective search space used: 4972687933880 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)