ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbags18j23
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AC127415.3| Mus musculus BAC clone RP23-450L4 from chromosome... 44 0.64
2gb|AC145568.4| Mus musculus BAC clone RP24-473H20 from 6, comple... 44 0.64
3gb|AC120339.18| Mus musculus chromosome 14, clone RP23-126A8, co... 42 2.5
4gb|AC148824.5| Pan troglodytes BAC clone CH251-507H8 from chromo... 42 2.5
5gb|AC135114.4| Mus musculus BAC clone RP24-69H7 from chromosome ... 42 2.5
6gb|AC127368.3| Mus musculus BAC clone RP23-22J14 from chromosome... 42 2.5
7gb|AC104073.3| Homo sapiens BAC clone RP11-328P23 from 7, comple... 42 2.5
8gb|AC073107.7| Homo sapiens BAC clone RP11-479O9 from 7, complet... 42 2.5
9gb|AC104057.4| Homo sapiens BAC clone RP13-157F18 from 7, comple... 42 2.5
10gb|AC112001.6| Rattus norvegicus 2 BAC CH230-54E3 (Children's Ho... 42 2.5
11emb|AL161584.2|ATCHRIV80 Arabidopsis thaliana DNA chromosome 4, ... 42 2.5
12emb|AL031394.1|ATT16L1 Arabidopsis thaliana DNA chromosome 4, BA... 42 2.5
13dbj|AP002812.3| Homo sapiens genomic DNA, chromosome 11q clone:R... 42 2.5

>gb|AC127415.3| Mus musculus BAC clone RP23-450L4 from chromosome 19, complete sequence
          Length = 177302

 Score = 44.1 bits (22), Expect = 0.64
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                           
Query: 292   ttgtcaagcttatccctcacaagtaaggac 321
             ||||||||||||||| |||||||| |||||
Sbjct: 53163 ttgtcaagcttatccatcacaagtcaggac 53134



to top

>gb|AC145568.4| Mus musculus BAC clone RP24-473H20 from 6, complete sequence
          Length = 201210

 Score = 44.1 bits (22), Expect = 0.64
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 73    ccttcccagcagggcaacagtt 94
             ||||||||||||||||||||||
Sbjct: 83319 ccttcccagcagggcaacagtt 83340



to top

>gb|AC120339.18| Mus musculus chromosome 14, clone RP23-126A8, complete sequence
          Length = 228458

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 52     tattacataatgatgaaggta 72
              |||||||||||||||||||||
Sbjct: 208509 tattacataatgatgaaggta 208529



 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 6      tattacataatgatgaaggta 26
              |||||||||||||||||||||
Sbjct: 208509 tattacataatgatgaaggta 208529



to top

>gb|AC148824.5| Pan troglodytes BAC clone CH251-507H8 from chromosome 7, complete
              sequence
          Length = 189932

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 574    attctgtgtaactttttatgctgat 598
              ||||||| |||||||||||||||||
Sbjct: 161322 attctgtttaactttttatgctgat 161298



to top

>gb|AC135114.4| Mus musculus BAC clone RP24-69H7 from chromosome 14, complete sequence
          Length = 181062

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 52    tattacataatgatgaaggta 72
             |||||||||||||||||||||
Sbjct: 23142 tattacataatgatgaaggta 23162



 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 6     tattacataatgatgaaggta 26
             |||||||||||||||||||||
Sbjct: 23142 tattacataatgatgaaggta 23162



to top

>gb|AC127368.3| Mus musculus BAC clone RP23-22J14 from chromosome 18, complete sequence
          Length = 206102

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 432    ttctgtgtaactttttatgat 452
              |||||||||||||||||||||
Sbjct: 145472 ttctgtgtaactttttatgat 145452



to top

>gb|AC104073.3| Homo sapiens BAC clone RP11-328P23 from 7, complete sequence
          Length = 178670

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 574   attctgtgtaactttttatgctgat 598
             ||||||| |||||||||||||||||
Sbjct: 68026 attctgtttaactttttatgctgat 68002



to top

>gb|AC073107.7| Homo sapiens BAC clone RP11-479O9 from 7, complete sequence
          Length = 194178

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 574   attctgtgtaactttttatgctgat 598
             ||||||| |||||||||||||||||
Sbjct: 83866 attctgtttaactttttatgctgat 83842



to top

>gb|AC104057.4| Homo sapiens BAC clone RP13-157F18 from 7, complete sequence
          Length = 196523

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 574    attctgtgtaactttttatgctgat 598
              ||||||| |||||||||||||||||
Sbjct: 164261 attctgtttaactttttatgctgat 164237



to top

>gb|AC112001.6| Rattus norvegicus 2 BAC CH230-54E3 (Children's Hospital Oakland
             Research Institute) complete sequence
          Length = 225052

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 105   agcaaaagaaaacatgtctacttag 129
             |||||||||||||||| ||||||||
Sbjct: 69625 agcaaaagaaaacatgactacttag 69601



to top

>emb|AL161584.2|ATCHRIV80 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 80
          Length = 192861

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 204   caacaaagttctaagcttgat 224
             |||||||||||||||||||||
Sbjct: 36204 caacaaagttctaagcttgat 36224



to top

>emb|AL031394.1|ATT16L1 Arabidopsis thaliana DNA chromosome 4, BAC clone T16L1 (ESSAII project)
          Length = 98124

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 204   caacaaagttctaagcttgat 224
             |||||||||||||||||||||
Sbjct: 83422 caacaaagttctaagcttgat 83442



to top

>dbj|AP002812.3| Homo sapiens genomic DNA, chromosome 11q clone:RP11-91P24, complete
             sequences
          Length = 169250

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 574   attctgtgtaactttttatgctgat 598
             ||||||| |||||||||||||||||
Sbjct: 73219 attctgtttaactttttatgctgat 73243


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 6,510,330
Number of Sequences: 3902068
Number of extensions: 6510330
Number of successful extensions: 135794
Number of sequences better than 10.0: 13
Number of HSP's better than 10.0 without gapping: 13
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 135744
Number of HSP's gapped (non-prelim): 50
length of query: 732
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 709
effective length of database: 17,143,297,704
effective search space: 12154598072136
effective search space used: 12154598072136
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 21 (42.1 bits)
to top