| Clone Name | rbags18j23 |
|---|---|
| Clone Library Name | barley_pub |
>gb|AC127415.3| Mus musculus BAC clone RP23-450L4 from chromosome 19, complete sequence Length = 177302 Score = 44.1 bits (22), Expect = 0.64 Identities = 28/30 (93%) Strand = Plus / Minus Query: 292 ttgtcaagcttatccctcacaagtaaggac 321 ||||||||||||||| |||||||| ||||| Sbjct: 53163 ttgtcaagcttatccatcacaagtcaggac 53134
>gb|AC145568.4| Mus musculus BAC clone RP24-473H20 from 6, complete sequence Length = 201210 Score = 44.1 bits (22), Expect = 0.64 Identities = 22/22 (100%) Strand = Plus / Plus Query: 73 ccttcccagcagggcaacagtt 94 |||||||||||||||||||||| Sbjct: 83319 ccttcccagcagggcaacagtt 83340
>gb|AC120339.18| Mus musculus chromosome 14, clone RP23-126A8, complete sequence Length = 228458 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 52 tattacataatgatgaaggta 72 ||||||||||||||||||||| Sbjct: 208509 tattacataatgatgaaggta 208529 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 6 tattacataatgatgaaggta 26 ||||||||||||||||||||| Sbjct: 208509 tattacataatgatgaaggta 208529
>gb|AC148824.5| Pan troglodytes BAC clone CH251-507H8 from chromosome 7, complete sequence Length = 189932 Score = 42.1 bits (21), Expect = 2.5 Identities = 24/25 (96%) Strand = Plus / Minus Query: 574 attctgtgtaactttttatgctgat 598 ||||||| ||||||||||||||||| Sbjct: 161322 attctgtttaactttttatgctgat 161298
>gb|AC135114.4| Mus musculus BAC clone RP24-69H7 from chromosome 14, complete sequence Length = 181062 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 52 tattacataatgatgaaggta 72 ||||||||||||||||||||| Sbjct: 23142 tattacataatgatgaaggta 23162 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 6 tattacataatgatgaaggta 26 ||||||||||||||||||||| Sbjct: 23142 tattacataatgatgaaggta 23162
>gb|AC127368.3| Mus musculus BAC clone RP23-22J14 from chromosome 18, complete sequence Length = 206102 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 432 ttctgtgtaactttttatgat 452 ||||||||||||||||||||| Sbjct: 145472 ttctgtgtaactttttatgat 145452
>gb|AC104073.3| Homo sapiens BAC clone RP11-328P23 from 7, complete sequence Length = 178670 Score = 42.1 bits (21), Expect = 2.5 Identities = 24/25 (96%) Strand = Plus / Minus Query: 574 attctgtgtaactttttatgctgat 598 ||||||| ||||||||||||||||| Sbjct: 68026 attctgtttaactttttatgctgat 68002
>gb|AC073107.7| Homo sapiens BAC clone RP11-479O9 from 7, complete sequence Length = 194178 Score = 42.1 bits (21), Expect = 2.5 Identities = 24/25 (96%) Strand = Plus / Minus Query: 574 attctgtgtaactttttatgctgat 598 ||||||| ||||||||||||||||| Sbjct: 83866 attctgtttaactttttatgctgat 83842
>gb|AC104057.4| Homo sapiens BAC clone RP13-157F18 from 7, complete sequence Length = 196523 Score = 42.1 bits (21), Expect = 2.5 Identities = 24/25 (96%) Strand = Plus / Minus Query: 574 attctgtgtaactttttatgctgat 598 ||||||| ||||||||||||||||| Sbjct: 164261 attctgtttaactttttatgctgat 164237
>gb|AC112001.6| Rattus norvegicus 2 BAC CH230-54E3 (Children's Hospital Oakland Research Institute) complete sequence Length = 225052 Score = 42.1 bits (21), Expect = 2.5 Identities = 24/25 (96%) Strand = Plus / Minus Query: 105 agcaaaagaaaacatgtctacttag 129 |||||||||||||||| |||||||| Sbjct: 69625 agcaaaagaaaacatgactacttag 69601
>emb|AL161584.2|ATCHRIV80 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 80 Length = 192861 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 204 caacaaagttctaagcttgat 224 ||||||||||||||||||||| Sbjct: 36204 caacaaagttctaagcttgat 36224
>emb|AL031394.1|ATT16L1 Arabidopsis thaliana DNA chromosome 4, BAC clone T16L1 (ESSAII project) Length = 98124 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 204 caacaaagttctaagcttgat 224 ||||||||||||||||||||| Sbjct: 83422 caacaaagttctaagcttgat 83442
>dbj|AP002812.3| Homo sapiens genomic DNA, chromosome 11q clone:RP11-91P24, complete sequences Length = 169250 Score = 42.1 bits (21), Expect = 2.5 Identities = 24/25 (96%) Strand = Plus / Plus Query: 574 attctgtgtaactttttatgctgat 598 ||||||| ||||||||||||||||| Sbjct: 73219 attctgtttaactttttatgctgat 73243 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 6,510,330 Number of Sequences: 3902068 Number of extensions: 6510330 Number of successful extensions: 135794 Number of sequences better than 10.0: 13 Number of HSP's better than 10.0 without gapping: 13 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 135744 Number of HSP's gapped (non-prelim): 50 length of query: 732 length of database: 17,233,045,268 effective HSP length: 23 effective length of query: 709 effective length of database: 17,143,297,704 effective search space: 12154598072136 effective search space used: 12154598072136 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 21 (42.1 bits)