| Clone Name | rbags18j06 |
|---|---|
| Clone Library Name | barley_pub |
>tpg|BK005644.1| TPA: TPA_inf: Triticum aestivum histidine-containing phosphotransfer protein 2 (HP) mRNA, complete cds Length = 1212 Score = 444 bits (224), Expect = e-121 Identities = 255/264 (96%), Gaps = 1/264 (0%) Strand = Plus / Plus Query: 1 aaatcagtacaaagtaacttacaatccagtagcaacataggagaaacaattatttcgcac 60 ||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 88 aaatcagtataaaacaacttacaatccagtagcaacataggagaaacaattatttcgcac 147 Query: 61 tgcaaatgaacttcagtaggtaacagtggatcaccattgtgatagtcctgaaacaaaaac 120 ||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||| Sbjct: 148 tgcaaatgaacttcagtaggtaacagtggatcaccgttgcgatagtcctgaaacaaaaac 207 Query: 121 tcctagccacattgagaacaaaataacagcgcaacaggaattcactcctgtggagaatat 180 ||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||| Sbjct: 208 tcctagccacattgaaaacaaaataacagcgcaacaggaattcactcctgtcgagaatat 267 Query: 181 atgttggtaggtactggtctttaggctcttagcctatgagcatcttgttatcttccaaga 240 |||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||| Sbjct: 268 atgtcggtaggtactggt-tttaggctcttagcctatgagcatcttgttatcttccaaga 326 Query: 241 aactgtaggtgggcacctcaaggt 264 |||||||||||||||||||||||| Sbjct: 327 aactgtaggtgggcacctcaaggt 350
>gb|AY109584.1| Zea mays CL2436_1 mRNA sequence Length = 1746 Score = 313 bits (158), Expect = 3e-82 Identities = 278/318 (87%) Strand = Plus / Minus Query: 208 cttagcctatgagcatcttgttatcttccaagaaactgtaggtgggcacctcaaggttgt 267 ||||||||||||||| ||||| || ||||||||||||||||| || ||||| |||||| Sbjct: 1439 cttagcctatgagcagtttgttctcctccaagaaactgtaggtagggacctcgaggttga 1380 Query: 268 acggggcagggcccttgcggattctgccagagatgtcgtagtgggagccatggcacgggc 327 |||| ||||||||||||||||| || || || ||||| |||||||| |||||||| |||| Sbjct: 1379 acggcgcagggcccttgcggatcctcccggaaatgtcatagtgggaaccatggcatgggc 1320 Query: 328 agaaccaaccaccaaagtctccagagttgggaagggggatgcaaccaagatgagtgcaga 387 ||||||| || ||||||||||| | || || || |||||||| || || || ||||| | Sbjct: 1319 agaaccagccgccaaagtctccggcattaggtagtgggatgcagccgaggtgcgtgcaca 1260 Query: 388 caccaataaccaccagccactctgggttcttcacacgctcagcgtcttgctctgggtggc 447 | ||||| |||||||||||||| ||||||||||||||||| || || ||||||||||||| Sbjct: 1259 cgccaatgaccaccagccactcagggttcttcacacgctctgcatcctgctctgggtggc 1200 Query: 448 gcagggatgcaacatccacgctgttggccagcttgatgtcatcgtctgtccgtcgcctga 507 |||||||||| |||||||| |||||||| |||||||||||||| |||||||| ||||||| Sbjct: 1199 gcagggatgccacatccacactgttggcaagcttgatgtcatcctctgtccgacgcctga 1140 Query: 508 tgaagactggctttccac 525 |||||||||||||||||| Sbjct: 1139 tgaagactggctttccac 1122
>gb|BT018238.1| Zea mays clone EL01N0563B05.c mRNA sequence Length = 971 Score = 311 bits (157), Expect = 1e-81 Identities = 280/321 (87%) Strand = Plus / Minus Query: 205 gctcttagcctatgagcatcttgttatcttccaagaaactgtaggtgggcacctcaaggt 264 ||||||| |||||||||| ||||| || ||||||||||||||||| || ||||| |||| Sbjct: 790 gctcttaacctatgagcagtttgttctcctccaagaaactgtaggtcgggacctcgaggt 731 Query: 265 tgtacggggcagggcccttgcggattctgccagagatgtcgtagtgggagccatggcacg 324 || |||| ||||||||||||||||| || || || |||||||||||||| |||||||| | Sbjct: 730 tgaacggcgcagggcccttgcggatcctcccggatatgtcgtagtgggaaccatggcatg 671 Query: 325 ggcagaaccaaccaccaaagtctccagagttgggaagggggatgcaaccaagatgagtgc 384 |||||||||| || ||||||||||| | ||| || || |||||||| || || ||||||| Sbjct: 670 ggcagaaccagccgccaaagtctccggcgttcggtagtgggatgcagccgaggtgagtgc 611 Query: 385 agacaccaataaccaccagccactctgggttcttcacacgctcagcgtcttgctctgggt 444 | || ||||| |||||||||||||| || |||||||||||||| || || |||||||||| Sbjct: 610 acacgccaatgaccaccagccactcgggattcttcacacgctctgcatcctgctctgggt 551 Query: 445 ggcgcagggatgcaacatccacgctgttggccagcttgatgtcatcgtctgtccgtcgcc 504 ||||||||||||| |||||||| |||||||| ||||||||||| ||||| ||||| || | Sbjct: 550 ggcgcagggatgccacatccacactgttggcaagcttgatgtcgtcgtccgtccggcgtc 491 Query: 505 tgatgaagactggctttccac 525 ||||||||||||||||||||| Sbjct: 490 tgatgaagactggctttccac 470
>gb|M77224.1|MZERFESPA Zea mays mitochondrial Rieske Fe-S protein mRNA, complete cds Length = 1197 Score = 311 bits (157), Expect = 1e-81 Identities = 280/321 (87%) Strand = Plus / Minus Query: 205 gctcttagcctatgagcatcttgttatcttccaagaaactgtaggtgggcacctcaaggt 264 |||||||||||| ||||| ||||| || ||||||||||||||||| || ||||| |||| Sbjct: 933 gctcttagcctacgagcagtttgttctcctccaagaaactgtaggtagggacctcgaggt 874 Query: 265 tgtacggggcagggcccttgcggattctgccagagatgtcgtagtgggagccatggcacg 324 || |||| ||||||||||||||||| || || || ||||| |||||||| |||||||| | Sbjct: 873 tgaacggcgcagggcccttgcggatcctcccggaaatgtcatagtgggaaccatggcatg 814 Query: 325 ggcagaaccaaccaccaaagtctccagagttgggaagggggatgcaaccaagatgagtgc 384 |||||||||| || ||||||||||| | || || || |||||||| || || || |||| Sbjct: 813 ggcagaaccagccgccaaagtctccggcattaggtagtgggatgcagccgaggtgcgtgc 754 Query: 385 agacaccaataaccaccagccactctgggttcttcacacgctcagcgtcttgctctgggt 444 | || ||||| |||||||||||||| ||||||||||||||||| || || |||||||||| Sbjct: 753 acacgccaatgaccaccagccactcagggttcttcacacgctctgcatcctgctctgggt 694 Query: 445 ggcgcagggatgcaacatccacgctgttggccagcttgatgtcatcgtctgtccgtcgcc 504 ||||||||||||| |||||||| |||||||| |||||||||||||| |||||||| |||| Sbjct: 693 ggcgcagggatgccacatccacactgttggcaagcttgatgtcatcctctgtccgacgcc 634 Query: 505 tgatgaagactggctttccac 525 ||||||||||||||||||||| Sbjct: 633 tgatgaagactggctttccac 613
>gb|BT017520.1| Zea mays clone EL01N0421A02.c mRNA sequence Length = 1172 Score = 291 bits (147), Expect = 1e-75 Identities = 276/319 (86%) Strand = Plus / Minus Query: 207 tcttagcctatgagcatcttgttatcttccaagaaactgtaggtgggcacctcaaggttg 266 ||||| |||||||||| ||||| || ||||||||||||||||| || ||||| |||||| Sbjct: 900 tcttaacctatgagcagtttgttctcctccaagaaactgtaggtcgggacctcgaggttg 841 Query: 267 tacggggcagggcccttgcggattctgccagagatgtcgtagtgggagccatggcacggg 326 |||||||||||||||||||||| || || || |||| ||||||||| |||||||| ||| Sbjct: 840 aacggggcagggcccttgcggatcctcccggatatgtagtagtgggaaccatggcatggg 781 Query: 327 cagaaccaaccaccaaagtctccagagttgggaagggggatgcaaccaagatgagtgcag 386 |||||||| || ||||||||||| | ||| || || ||||||||||| || |||||||| Sbjct: 780 cagaaccagccgccaaagtctccggcgttcggtagtgggatgcaaccgaggtgagtgcac 721 Query: 387 acaccaataaccaccagccactctgggttcttcacacgctcagcgtcttgctctgggtgg 446 || ||||| |||||||||||||| || ||||||||||||| || || |||||||||||| Sbjct: 720 acgccaatgaccaccagccactcgggattcttcacacgctatgcatcctgctctgggtgg 661 Query: 447 cgcagggatgcaacatccacgctgttggccagcttgatgtcatcgtctgtccgtcgcctg 506 ||||||||||| |||||||| |||||||| ||||||| || ||||| ||||| || ||| Sbjct: 660 cgcagggatgccacatccacactgttggcaagcttgaagtagtcgtccgtccggcgtctg 601 Query: 507 atgaagactggctttccac 525 ||||||||||||||||||| Sbjct: 600 atgaagactggctttccac 582
>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete sequence Length = 35498469 Score = 276 bits (139), Expect = 7e-71 Identities = 277/323 (85%) Strand = Plus / Minus Query: 203 aggctcttagcctatgagcatcttgttatcttccaagaaactgtaggtgggcacctcaag 262 |||||||||||||||||| | |||||| || ||||||||||||||||| || ||||| || Sbjct: 19696266 aggctcttagcctatgaggagcttgttctcctccaagaaactgtaggtagggacctccag 19696207 Query: 263 gttgtacggggcagggcccttgcggattctgccagagatgtcgtagtgggagccatggca 322 |||| | || || ||||||||||| || |||||||||||||||||||||||||||||||| Sbjct: 19696206 gttgaatggagcggggcccttgcgaatcctgccagagatgtcgtagtgggagccatggca 19696147 Query: 323 cgggcagaaccaaccaccaaagtctccagagttgggaagggggatgcaaccaagatgagt 382 ||||||||||||||| || || ||||||| ||||| || || ||||||||||| || || Sbjct: 19696146 cgggcagaaccaacctccgaaatctccagcattggggagaggaatgcaaccaaggtgggt 19696087 Query: 383 gcagacaccaataaccaccagccactctgggttcttcacacgctcagcgtcttgctctgg 442 |||||| ||||| ||||| |||||||||||||||||||||||||| ||||| |||| || Sbjct: 19696086 gcagacgccaatgaccactagccactctgggttcttcacacgctctgcgtcctgctgggg 19696027 Query: 443 gtggcgcagggatgcaacatccacgctgttggccagcttgatgtcatcgtctgtccgtcg 502 ||||||||||| |||| |||||||| ||||||||| ||||| || ||||||| | Sbjct: 19696026 atggcgcagggacccaacgtccacgctattggccagcgctatgtcgtcctctgtcctcct 19695967 Query: 503 cctgatgaagactggctttccac 525 |||||||| |||||||| |||| Sbjct: 19695966 tctgatgaaaactggcttcccac 19695944
>dbj|AK059519.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-029-C04, full insert sequence Length = 1242 Score = 276 bits (139), Expect = 7e-71 Identities = 277/323 (85%) Strand = Plus / Minus Query: 203 aggctcttagcctatgagcatcttgttatcttccaagaaactgtaggtgggcacctcaag 262 |||||||||||||||||| | |||||| || ||||||||||||||||| || ||||| || Sbjct: 972 aggctcttagcctatgaggagcttgttctcctccaagaaactgtaggtagggacctccag 913 Query: 263 gttgtacggggcagggcccttgcggattctgccagagatgtcgtagtgggagccatggca 322 |||| | || || ||||||||||| || |||||||||||||||||||||||||||||||| Sbjct: 912 gttgaatggagcggggcccttgcgaatcctgccagagatgtcgtagtgggagccatggca 853 Query: 323 cgggcagaaccaaccaccaaagtctccagagttgggaagggggatgcaaccaagatgagt 382 ||||||||||||||| || || ||||||| ||||| || || ||||||||||| || || Sbjct: 852 cgggcagaaccaacctccgaaatctccagcattggggagaggaatgcaaccaaggtgggt 793 Query: 383 gcagacaccaataaccaccagccactctgggttcttcacacgctcagcgtcttgctctgg 442 |||||| ||||| ||||| |||||||||||||||||||||||||| ||||| |||| || Sbjct: 792 gcagacgccaatgaccactagccactctgggttcttcacacgctctgcgtcctgctgggg 733 Query: 443 gtggcgcagggatgcaacatccacgctgttggccagcttgatgtcatcgtctgtccgtcg 502 ||||||||||| |||| |||||||| ||||||||| ||||| || ||||||| | Sbjct: 732 atggcgcagggacccaacgtccacgctattggccagcgctatgtcgtcctctgtcctcct 673 Query: 503 cctgatgaagactggctttccac 525 |||||||| |||||||| |||| Sbjct: 672 tctgatgaaaactggcttcccac 650
>emb|AL731591.3|OSJN00240 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0039C07, complete sequence Length = 166410 Score = 276 bits (139), Expect = 7e-71 Identities = 277/323 (85%) Strand = Plus / Minus Query: 203 aggctcttagcctatgagcatcttgttatcttccaagaaactgtaggtgggcacctcaag 262 |||||||||||||||||| | |||||| || ||||||||||||||||| || ||||| || Sbjct: 146992 aggctcttagcctatgaggagcttgttctcctccaagaaactgtaggtagggacctccag 146933 Query: 263 gttgtacggggcagggcccttgcggattctgccagagatgtcgtagtgggagccatggca 322 |||| | || || ||||||||||| || |||||||||||||||||||||||||||||||| Sbjct: 146932 gttgaatggagcggggcccttgcgaatcctgccagagatgtcgtagtgggagccatggca 146873 Query: 323 cgggcagaaccaaccaccaaagtctccagagttgggaagggggatgcaaccaagatgagt 382 ||||||||||||||| || || ||||||| ||||| || || ||||||||||| || || Sbjct: 146872 cgggcagaaccaacctccgaaatctccagcattggggagaggaatgcaaccaaggtgggt 146813 Query: 383 gcagacaccaataaccaccagccactctgggttcttcacacgctcagcgtcttgctctgg 442 |||||| ||||| ||||| |||||||||||||||||||||||||| ||||| |||| || Sbjct: 146812 gcagacgccaatgaccactagccactctgggttcttcacacgctctgcgtcctgctgggg 146753 Query: 443 gtggcgcagggatgcaacatccacgctgttggccagcttgatgtcatcgtctgtccgtcg 502 ||||||||||| |||| |||||||| ||||||||| ||||| || ||||||| | Sbjct: 146752 atggcgcagggacccaacgtccacgctattggccagcgctatgtcgtcctctgtcctcct 146693 Query: 503 cctgatgaagactggctttccac 525 |||||||| |||||||| |||| Sbjct: 146692 tctgatgaaaactggcttcccac 146670
>ref|XM_472343.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 837 Score = 264 bits (133), Expect = 3e-67 Identities = 271/317 (85%) Strand = Plus / Minus Query: 209 ttagcctatgagcatcttgttatcttccaagaaactgtaggtgggcacctcaaggttgta 268 |||||||||||| | |||||| || ||||||||||||||||| || ||||| |||||| | Sbjct: 837 ttagcctatgaggagcttgttctcctccaagaaactgtaggtagggacctccaggttgaa 778 Query: 269 cggggcagggcccttgcggattctgccagagatgtcgtagtgggagccatggcacgggca 328 || || ||||||||||| || |||||||||||||||||||||||||||||||||||||| Sbjct: 777 tggagcggggcccttgcgaatcctgccagagatgtcgtagtgggagccatggcacgggca 718 Query: 329 gaaccaaccaccaaagtctccagagttgggaagggggatgcaaccaagatgagtgcagac 388 ||||||||| || || ||||||| ||||| || || ||||||||||| || |||||||| Sbjct: 717 gaaccaacctccgaaatctccagcattggggagaggaatgcaaccaaggtgggtgcagac 658 Query: 389 accaataaccaccagccactctgggttcttcacacgctcagcgtcttgctctgggtggcg 448 ||||| ||||| |||||||||||||||||||||||||| ||||| |||| || ||||| Sbjct: 657 gccaatgaccactagccactctgggttcttcacacgctctgcgtcctgctggggatggcg 598 Query: 449 cagggatgcaacatccacgctgttggccagcttgatgtcatcgtctgtccgtcgcctgat 508 |||||| |||| |||||||| ||||||||| ||||| || ||||||| | ||||| Sbjct: 597 cagggacccaacgtccacgctattggccagcgctatgtcgtcctctgtcctccttctgat 538 Query: 509 gaagactggctttccac 525 ||| |||||||| |||| Sbjct: 537 gaaaactggcttcccac 521
>gb|AY105531.1| Zea mays PCO113958 mRNA sequence Length = 1217 Score = 228 bits (115), Expect = 1e-56 Identities = 265/315 (84%) Strand = Plus / Minus Query: 211 agcctatgagcatcttgttatcttccaagaaactgtaggtgggcacctcaaggttgtacg 270 |||| ||||| | |||||| ||||||||||| ||||| || ||||| || |||||| | | Sbjct: 960 agccgatgagaagcttgttctcttccaagaagctgtatgtcggcacttccaggttgaagg 901 Query: 271 gggcagggcccttgcggattctgccagagatgtcgtagtgggagccatggcacgggcaga 330 | || |||||||||||||| || ||||| ||||||||||| ||||| ||||||||||||| Sbjct: 900 gtgccgggcccttgcggatcctaccagaaatgtcgtagtgcgagccgtggcacgggcaga 841 Query: 331 accaaccaccaaagtctccagagttgggaagggggatgcaaccaagatgagtgcagacac 390 |||| |||||||||||||| | || || || |||||||| || || ||||||||||| | Sbjct: 840 accagccaccaaagtctcctgcattagggagcgggatgcagcccaggtgagtgcagaccc 781 Query: 391 caataaccaccagccactctgggttcttcacacgctcagcgtcttgctctgggtggcgca 450 |||| || |||||||| || |||||||| || ||||| || ||||||||||||||||| | Sbjct: 780 caatgacgaccagccattcggggttcttgacgcgctctgcatcttgctctgggtggcgga 721 Query: 451 gggatgcaacatccacgctgttggccagcttgatgtcatcgtctgtccgtcgcctgatga 510 ||||||| || || || |||||||||| |||||| ||||| ||||||| ||||| |||| Sbjct: 720 gggatgcgacgtcaacactgttggccaacttgatatcatcctctgtcctccgccttatga 661 Query: 511 agactggctttccac 525 |||| ||||| |||| Sbjct: 660 agaccggcttgccac 646
>gb|BT014059.1| Lycopersicon esculentum clone 133157F, mRNA sequence Length = 1087 Score = 123 bits (62), Expect = 6e-25 Identities = 242/302 (80%) Strand = Plus / Minus Query: 224 cttgttatcttccaagaaactgtaggtgggcacctcaaggttgtacggggcagggccctt 283 |||||| |||||||||||||||||||| |||||||| || || ||||| || || || || Sbjct: 853 cttgttctcttccaagaaactgtaggtaggcacctccagattatacggtgcgggtccttt 794 Query: 284 gcggattctgccagagatgtcgtagtgggagccatggcacgggcagaaccaaccaccaaa 343 ||| || || |||||||||||||| || ||||||||||| ||||| |||||||||||||| Sbjct: 793 gcgaatcctaccagagatgtcgtaatgagagccatggcatgggcaaaaccaaccaccaaa 734 Query: 344 gtctccagagttgggaagggggatgcaaccaagatgagtgcagacaccaataaccaccag 403 || |||| || || | || ||||| || |||||||| || || |||| |||||| || Sbjct: 733 atcaccagcatttggtaaaggaatgcaccctagatgagtacataccccaacaaccacaag 674 Query: 404 ccactctgggttcttcacacgctcagcgtcttgctctgggtggcgcagggatgcaacatc 463 ||| ||||| || || || | |||||| ||||| | |||| || |||| ||| ||| Sbjct: 673 ccattctggatttttgaccctctcagcatcttgttgcgggtcacgaagggtgccaagatc 614 Query: 464 cacgctgttggccagcttgatgtcatcgtctgtccgtcgcctgatgaagactggctttcc 523 || ||||| |||| ||||||||||||||| || || || |||||||| || || ||||| Sbjct: 613 aacactgtttgccaacttgatgtcatcgtcagtgcggcgtctgatgaaaacaggttttcc 554 Query: 524 ac 525 || Sbjct: 553 ac 552
>ref|XM_466001.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1157 Score = 119 bits (60), Expect = 1e-23 Identities = 210/260 (80%) Strand = Plus / Minus Query: 261 aggttgtacggggcagggcccttgcggattctgccagagatgtcgtagtgggagccatgg 320 |||||||| || ||||||||||| |||||||| || || || || || || || |||||| Sbjct: 857 aggttgtatggtgcagggcccttacggattctacctgatatatcataatgtgatccatgg 798 Query: 321 cacgggcagaaccaaccaccaaagtctccagagttgggaagggggatgcaaccaagatga 380 || || |||||||| ||||||||||| |||| ||||||||| || ||||| || |||||| Sbjct: 797 catggacagaaccagccaccaaagtcaccagcgttgggaagtggaatgcagcccagatga 738 Query: 381 gtgcagacaccaataaccaccagccactctgggttcttcacacgctcagcgtcttgctct 440 || || || ||||| || ||||||||||| |||||||| || || || || || |||| | Sbjct: 737 gtacacaccccaatcacaaccagccactcagggttcttgactcgttccgcatcctgctgt 678 Query: 441 gggtggcgcagggatgcaacatccacgctgttggccagcttgatgtcatcgtctgtccgt 500 |||| || || ||| ||| || |||||||| |||| |||||||| || ||||||| Sbjct: 677 gggtcacgaagagatccaatgtcaacgctgttcgccaagttgatgtcttcctctgtcctg 618 Query: 501 cgcctgatgaagactggctt 520 |||||||| || |||||||| Sbjct: 617 cgcctgataaaaactggctt 598
>gb|DQ207870.1| Solanum tuberosum clone 087E11 rieske iron-sulfur protein-like mRNA, complete cds Length = 1098 Score = 119 bits (60), Expect = 1e-23 Identities = 105/120 (87%) Strand = Plus / Minus Query: 224 cttgttatcttccaagaaactgtaggtgggcacctcaaggttgtacggggcagggccctt 283 |||||| |||||||||||||||||||| |||||||| || || ||||| || || || || Sbjct: 841 cttgttctcttccaagaaactgtaggtaggcacctccagattatacggtgcgggtccttt 782 Query: 284 gcggattctgccagagatgtcgtagtgggagccatggcacgggcagaaccaaccaccaaa 343 ||| || || |||||||||||||| |||||||||||||| ||||| |||||||||||||| Sbjct: 781 gcgaatcctaccagagatgtcgtaatgggagccatggcatgggcaaaaccaaccaccaaa 722 Score = 44.1 bits (22), Expect = 0.45 Identities = 40/46 (86%) Strand = Plus / Minus Query: 480 ttgatgtcatcgtctgtccgtcgcctgatgaagactggctttccac 525 |||||||||||||| || || || |||||||| || |||||||||| Sbjct: 585 ttgatgtcatcgtcagttcggcgtctgatgaaaacaggctttccac 540
>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete sequence Length = 35954743 Score = 119 bits (60), Expect = 1e-23 Identities = 210/260 (80%) Strand = Plus / Plus Query: 261 aggttgtacggggcagggcccttgcggattctgccagagatgtcgtagtgggagccatgg 320 |||||||| || ||||||||||| |||||||| || || || || || || || |||||| Sbjct: 19000643 aggttgtatggtgcagggcccttacggattctacctgatatatcataatgtgatccatgg 19000702 Query: 321 cacgggcagaaccaaccaccaaagtctccagagttgggaagggggatgcaaccaagatga 380 || || |||||||| ||||||||||| |||| ||||||||| || ||||| || |||||| Sbjct: 19000703 catggacagaaccagccaccaaagtcaccagcgttgggaagtggaatgcagcccagatga 19000762 Query: 381 gtgcagacaccaataaccaccagccactctgggttcttcacacgctcagcgtcttgctct 440 || || || ||||| || ||||||||||| |||||||| || || || || || |||| | Sbjct: 19000763 gtacacaccccaatcacaaccagccactcagggttcttgactcgttccgcatcctgctgt 19000822 Query: 441 gggtggcgcagggatgcaacatccacgctgttggccagcttgatgtcatcgtctgtccgt 500 |||| || || ||| ||| || |||||||| |||| |||||||| || ||||||| Sbjct: 19000823 gggtcacgaagagatccaatgtcaacgctgttcgccaagttgatgtcttcctctgtcctg 19000882 Query: 501 cgcctgatgaagactggctt 520 |||||||| || |||||||| Sbjct: 19000883 cgcctgataaaaactggctt 19000902 Score = 40.1 bits (20), Expect = 7.1 Identities = 23/24 (95%) Strand = Plus / Plus Query: 2 aatcagtacaaagtaacttacaat 25 ||||| |||||||||||||||||| Sbjct: 18847869 aatcaatacaaagtaacttacaat 18847892
>dbj|AP005842.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OSJNBb0003H22 Length = 68256 Score = 119 bits (60), Expect = 1e-23 Identities = 210/260 (80%) Strand = Plus / Plus Query: 261 aggttgtacggggcagggcccttgcggattctgccagagatgtcgtagtgggagccatgg 320 |||||||| || ||||||||||| |||||||| || || || || || || || |||||| Sbjct: 55964 aggttgtatggtgcagggcccttacggattctacctgatatatcataatgtgatccatgg 56023 Query: 321 cacgggcagaaccaaccaccaaagtctccagagttgggaagggggatgcaaccaagatga 380 || || |||||||| ||||||||||| |||| ||||||||| || ||||| || |||||| Sbjct: 56024 catggacagaaccagccaccaaagtcaccagcgttgggaagtggaatgcagcccagatga 56083 Query: 381 gtgcagacaccaataaccaccagccactctgggttcttcacacgctcagcgtcttgctct 440 || || || ||||| || ||||||||||| |||||||| || || || || || |||| | Sbjct: 56084 gtacacaccccaatcacaaccagccactcagggttcttgactcgttccgcatcctgctgt 56143 Query: 441 gggtggcgcagggatgcaacatccacgctgttggccagcttgatgtcatcgtctgtccgt 500 |||| || || ||| ||| || |||||||| |||| |||||||| || ||||||| Sbjct: 56144 gggtcacgaagagatccaatgtcaacgctgttcgccaagttgatgtcttcctctgtcctg 56203 Query: 501 cgcctgatgaagactggctt 520 |||||||| || |||||||| Sbjct: 56204 cgcctgataaaaactggctt 56223
>dbj|AP005749.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OSJNBa0047A17 Length = 149142 Score = 119 bits (60), Expect = 1e-23 Identities = 210/260 (80%) Strand = Plus / Plus Query: 261 aggttgtacggggcagggcccttgcggattctgccagagatgtcgtagtgggagccatgg 320 |||||||| || ||||||||||| |||||||| || || || || || || || |||||| Sbjct: 6164 aggttgtatggtgcagggcccttacggattctacctgatatatcataatgtgatccatgg 6223 Query: 321 cacgggcagaaccaaccaccaaagtctccagagttgggaagggggatgcaaccaagatga 380 || || |||||||| ||||||||||| |||| ||||||||| || ||||| || |||||| Sbjct: 6224 catggacagaaccagccaccaaagtcaccagcgttgggaagtggaatgcagcccagatga 6283 Query: 381 gtgcagacaccaataaccaccagccactctgggttcttcacacgctcagcgtcttgctct 440 || || || ||||| || ||||||||||| |||||||| || || || || || |||| | Sbjct: 6284 gtacacaccccaatcacaaccagccactcagggttcttgactcgttccgcatcctgctgt 6343 Query: 441 gggtggcgcagggatgcaacatccacgctgttggccagcttgatgtcatcgtctgtccgt 500 |||| || || ||| ||| || |||||||| |||| |||||||| || ||||||| Sbjct: 6344 gggtcacgaagagatccaatgtcaacgctgttcgccaagttgatgtcttcctctgtcctg 6403 Query: 501 cgcctgatgaagactggctt 520 |||||||| || |||||||| Sbjct: 6404 cgcctgataaaaactggctt 6423
>dbj|AK102815.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033108M09, full insert sequence Length = 1157 Score = 119 bits (60), Expect = 1e-23 Identities = 210/260 (80%) Strand = Plus / Minus Query: 261 aggttgtacggggcagggcccttgcggattctgccagagatgtcgtagtgggagccatgg 320 |||||||| || ||||||||||| |||||||| || || || || || || || |||||| Sbjct: 857 aggttgtatggtgcagggcccttacggattctacctgatatatcataatgtgatccatgg 798 Query: 321 cacgggcagaaccaaccaccaaagtctccagagttgggaagggggatgcaaccaagatga 380 || || |||||||| ||||||||||| |||| ||||||||| || ||||| || |||||| Sbjct: 797 catggacagaaccagccaccaaagtcaccagcgttgggaagtggaatgcagcccagatga 738 Query: 381 gtgcagacaccaataaccaccagccactctgggttcttcacacgctcagcgtcttgctct 440 || || || ||||| || ||||||||||| |||||||| || || || || || |||| | Sbjct: 737 gtacacaccccaatcacaaccagccactcagggttcttgactcgttccgcatcctgctgt 678 Query: 441 gggtggcgcagggatgcaacatccacgctgttggccagcttgatgtcatcgtctgtccgt 500 |||| || || ||| ||| || |||||||| |||| |||||||| || ||||||| Sbjct: 677 gggtcacgaagagatccaatgtcaacgctgttcgccaagttgatgtcttcctctgtcctg 618 Query: 501 cgcctgatgaagactggctt 520 |||||||| || |||||||| Sbjct: 617 cgcctgataaaaactggctt 598
>gb|L16813.1|TOBFESD Nicotiana tabacum clone 32.10 Rieske iron-sulfur protein mRNA, complete cds; mitochondrial Length = 1121 Score = 115 bits (58), Expect = 1e-22 Identities = 241/302 (79%) Strand = Plus / Minus Query: 224 cttgttatcttccaagaaactgtaggtgggcacctcaaggttgtacggggcagggccctt 283 |||||| || |||| |||||||||||| |||||||| || || || || ||||| || || Sbjct: 891 cttgttctcctccatgaaactgtaggtaggcacctccagattatatggcgcaggtccttt 832 Query: 284 gcggattctgccagagatgtcgtagtgggagccatggcacgggcagaaccaaccaccaaa 343 ||| || || ||||||||||| |||||||| |||||||| ||||| |||||||||||||| Sbjct: 831 gcgaatcctaccagagatgtcatagtgggaaccatggcatgggcaaaaccaaccaccaaa 772 Query: 344 gtctccagagttgggaagggggatgcaaccaagatgagtgcagacaccaataaccaccag 403 || |||| || || | || ||||| || ||||||||||| || || |||||||| || Sbjct: 771 atcaccagcatttggtaaaggtatgcaccctagatgagtgcataccccgataaccacaag 712 Query: 404 ccactctgggttcttcacacgctcagcgtcttgctctgggtggcgcagggatgcaacatc 463 ||| ||||| || || || | |||||| ||||| | |||| ||| ||||| ||| ||| Sbjct: 711 ccattctggattttttaccctctcagcatcttgttgcgggtcgcgaagggagccaagatc 652 Query: 464 cacgctgttggccagcttgatgtcatcgtctgtccgtcgcctgatgaagactggctttcc 523 || ||||| |||| |||||||| ||||| || || || |||||||| || ||||| || Sbjct: 651 aacactgttcgccaaattgatgtcttcgtcagtgcggcgtctgatgaaaacaggcttccc 592 Query: 524 ac 525 || Sbjct: 591 ac 590
>emb|X79332.1|STFES1G S.tuberosum (Desiree) FeS1 mRNA for Rieske iron-sulfur protein Length = 993 Score = 111 bits (56), Expect = 2e-21 Identities = 104/120 (86%) Strand = Plus / Minus Query: 224 cttgttatcttccaagaaactgtaggtgggcacctcaaggttgtacggggcagggccctt 283 |||||| |||||||||||||| ||||| |||||||| || || ||||| || || || || Sbjct: 804 cttgttctcttccaagaaactataggtaggcacctccagattatacggtgcgggtccttt 745 Query: 284 gcggattctgccagagatgtcgtagtgggagccatggcacgggcagaaccaaccaccaaa 343 ||| || || |||||||||||||| |||||||||||||| ||||| |||||||||||||| Sbjct: 744 gcgaatcctaccagagatgtcgtaatgggagccatggcatgggcaaaaccaaccaccaaa 685
>gb|M77225.1|TOBRFESP Nicotiana tabacum mitochondrial Rieske Fe-S protein mRNA, complete cds Length = 956 Score = 109 bits (55), Expect = 9e-21 Identities = 160/195 (82%) Strand = Plus / Minus Query: 224 cttgttatcttccaagaaactgtaggtgggcacctcaaggttgtacggggcagggccctt 283 |||||| || |||| |||||| || || |||||||| || || || || ||||| ||||| Sbjct: 762 cttgttctcctccaggaaactataagtaggcacctccagattatatggtgcaggtccctt 703 Query: 284 gcggattctgccagagatgtcgtagtgggagccatggcacgggcagaaccaaccaccaaa 343 |||||| || ||||||||||| || |||||||| ||||| ||||| |||||||||||||| Sbjct: 702 gcggatcctaccagagatgtcataatgggagccgtggcaagggcaaaaccaaccaccaaa 643 Query: 344 gtctccagagttgggaagggggatgcaaccaagatgagtgcagacaccaataaccaccag 403 || |||| || || | || ||||| |||||||| ||||| || ||||||||||| || Sbjct: 642 atcaccagcatttggcaaaggaatgcacccaagatgggtgcataccccaataaccacaag 583 Query: 404 ccactctgggttctt 418 ||| ||||| ||||| Sbjct: 582 ccattctggattctt 568
>gb|L16812.1|TOBFESC Nicotiana tabacum clone 36.14 Rieske iron-sulfur protein mRNA, complete cds; mitochondrial Length = 1286 Score = 105 bits (53), Expect = 1e-19 Identities = 155/189 (82%) Strand = Plus / Minus Query: 224 cttgttatcttccaagaaactgtaggtgggcacctcaaggttgtacggggcagggccctt 283 |||||| ||||||| |||||| || || |||||||| || || || || ||||| ||||| Sbjct: 1014 cttgttctcttccaggaaactataagtaggcacctccagattatatggtgcaggtccctt 955 Query: 284 gcggattctgccagagatgtcgtagtgggagccatggcacgggcagaaccaaccaccaaa 343 |||||| || ||||||||||| || |||||||| ||||| ||||| |||||||||||||| Sbjct: 954 gcggatcctaccagagatgtcataatgggagccgtggcaagggcaaaaccaaccaccaaa 895 Query: 344 gtctccagagttgggaagggggatgcaaccaagatgagtgcagacaccaataaccaccag 403 || || | || || | || ||||| |||||||| ||||| || ||||||||||| || Sbjct: 894 atcaccggcatttggcaaaggaatgcacccaagatgggtgcataccccaataaccacaag 835 Query: 404 ccactctgg 412 ||| ||||| Sbjct: 834 ccattctgg 826
>gb|L16810.1|TOBFESA Nicotiana tabacum clone 17.12 Rieske iron-sulfur protein mRNA, complete cds; mitochondrial Length = 1210 Score = 105 bits (53), Expect = 1e-19 Identities = 155/189 (82%) Strand = Plus / Minus Query: 224 cttgttatcttccaagaaactgtaggtgggcacctcaaggttgtacggggcagggccctt 283 |||||| ||||||| |||||| || || |||||||| || || || || ||||| ||||| Sbjct: 954 cttgttctcttccaggaaactataagtaggcacctccagattatatggtgcaggtccctt 895 Query: 284 gcggattctgccagagatgtcgtagtgggagccatggcacgggcagaaccaaccaccaaa 343 |||||| || ||||||||||| || |||||||| ||||| ||||| |||||||||||||| Sbjct: 894 gcggatcctaccagagatgtcataatgggagccgtggcaagggcaaaaccaaccaccaaa 835 Query: 344 gtctccagagttgggaagggggatgcaaccaagatgagtgcagacaccaataaccaccag 403 || || | || || | || ||||| |||||||| ||||| || ||||||||||| || Sbjct: 834 atcaccggcatttggcaaaggaatgcacccaagatgggtgcataccccaataaccacaag 775 Query: 404 ccactctgg 412 ||| ||||| Sbjct: 774 ccattctgg 766
>gb|AY085370.1| Arabidopsis thaliana clone 1482 mRNA, complete sequence Length = 1068 Score = 105 bits (53), Expect = 1e-19 Identities = 71/77 (92%) Strand = Plus / Minus Query: 449 cagggatgcaacatccacgctgttggccagcttgatgtcatcgtctgtccgtcgcctgat 508 ||||||| |||||||||| ||||||||||||||||||||||| ||||| | ||||||||| Sbjct: 684 cagggatccaacatccacactgttggccagcttgatgtcatcttctgttcttcgcctgat 625 Query: 509 gaagactggctttccac 525 |||||| |||||||||| Sbjct: 624 gaagacgggctttccac 608
>gb|L16811.1|TOBFESB Nicotiana tabacum clone 8.8 Rieske iron-sulfur protein mRNA, complete cds; mitochondrial Length = 1202 Score = 103 bits (52), Expect = 6e-19 Identities = 103/120 (85%) Strand = Plus / Minus Query: 224 cttgttatcttccaagaaactgtaggtgggcacctcaaggttgtacggggcagggccctt 283 |||||| || |||| |||||||||||| |||||||| || || || || ||||| || || Sbjct: 907 cttgttctcctccatgaaactgtaggtaggcacctccagattatatggtgcaggtccttt 848 Query: 284 gcggattctgccagagatgtcgtagtgggagccatggcacgggcagaaccaaccaccaaa 343 ||| || || ||||||||||| ||||||||||||||||| ||||| |||||||||||||| Sbjct: 847 gcgaatcctaccagagatgtcatagtgggagccatggcatgggcaaaaccaaccaccaaa 788
>ref|NM_121346.2| Arabidopsis thaliana oxidoreductase/ ubiquinol-cytochrome-c reductase AT5G13430 mRNA, complete cds Length = 1222 Score = 101 bits (51), Expect = 2e-18 Identities = 234/295 (79%) Strand = Plus / Minus Query: 231 tcttccaagaaactgtaggtgggcacctcaaggttgtacggggcagggcccttgcggatt 290 ||||||| ||| |||||||| || || || |||||||| || ||||| || || | ||| Sbjct: 911 tcttccaggaagctgtaggttggtacttccaggttgtatggtgcaggacctttcctaatt 852 Query: 291 ctgccagagatgtcgtagtgggagccatggcacgggcagaaccaaccaccaaagtctcca 350 || ||||| || ||||| || || || || ||||| || |||||||||||| | || ||| Sbjct: 851 cttccagatatatcgtaatgtgatccgtgacacggacaaaaccaaccaccataatcacca 792 Query: 351 gagttgggaagggggatgcaaccaagatgagtgcagacaccaataaccaccagccactct 410 | || || | ||||||||| || | ||||||||| || |||| |||||| | ||| ||| Sbjct: 791 gcattaggcaaggggatgcaccccaaatgagtgcacactccaacaaccactaaccattct 732 Query: 411 gggttcttcacacgctcagcgtcttgctctgggtggcgcagggatgcaacatccacgctg 470 || ||||| || | | | ||||| | ||||| | ||||||| |||||||||| || Sbjct: 731 ggattcttgaccctaaccgagtcttcttgtgggtccctcagggatccaacatccacacta 672 Query: 471 ttggccagcttgatgtcatcgtctgtccgtcgcctgatgaagactggctttccac 525 |||||||||||||||||||| ||||| | ||||||||||||||| |||||||||| Sbjct: 671 ttggccagcttgatgtcatcttctgttcttcgcctgatgaagacgggctttccac 617
>emb|AL163572.1|ATT22N19 Arabidopsis thaliana DNA chromosome 5, BAC clone T22N19 (ESSA project) Length = 68948 Score = 101 bits (51), Expect = 2e-18 Identities = 234/295 (79%) Strand = Plus / Plus Query: 231 tcttccaagaaactgtaggtgggcacctcaaggttgtacggggcagggcccttgcggatt 290 ||||||| ||| |||||||| || || || |||||||| || ||||| || || | ||| Sbjct: 48600 tcttccaggaagctgtaggttggtacttccaggttgtatggtgcaggacctttcctaatt 48659 Query: 291 ctgccagagatgtcgtagtgggagccatggcacgggcagaaccaaccaccaaagtctcca 350 || ||||| || ||||| || || || || ||||| || |||||||||||| | || ||| Sbjct: 48660 cttccagatatatcgtaatgtgatccgtgacacggacaaaaccaaccaccataatcacca 48719 Query: 351 gagttgggaagggggatgcaaccaagatgagtgcagacaccaataaccaccagccactct 410 | || || | ||||||||| || | ||||||||| || |||| |||||| | ||| ||| Sbjct: 48720 gcattaggcaaggggatgcaccccaaatgagtgcacactccaacaaccactaaccattct 48779 Query: 411 gggttcttcacacgctcagcgtcttgctctgggtggcgcagggatgcaacatccacgctg 470 || ||||| || | | | ||||| | ||||| | ||||||| |||||||||| || Sbjct: 48780 ggattcttgaccctaaccgagtcttcttgtgggtccctcagggatccaacatccacacta 48839 Query: 471 ttggccagcttgatgtcatcgtctgtccgtcgcctgatgaagactggctttccac 525 |||||||||||||||||||| ||||| | ||||||||||||||| |||||||||| Sbjct: 48840 ttggccagcttgatgtcatcttctgttcttcgcctgatgaagacgggctttccac 48894 Score = 97.6 bits (49), Expect = 4e-17 Identities = 70/77 (90%) Strand = Plus / Plus Query: 449 cagggatgcaacatccacgctgttggccagcttgatgtcatcgtctgtccgtcgcctgat 508 ||||||| |||||||||| || |||||||||||||||||||| ||||| | ||||||||| Sbjct: 51835 cagggatccaacatccacactattggccagcttgatgtcatcttctgttcttcgcctgat 51894 Query: 509 gaagactggctttccac 525 |||||| |||||||||| Sbjct: 51895 gaagacgggctttccac 51911
>gb|AF375413.1| Arabidopsis thaliana AT5g13430/T22N19_80 mRNA, complete cds Length = 1067 Score = 101 bits (51), Expect = 2e-18 Identities = 234/295 (79%) Strand = Plus / Minus Query: 231 tcttccaagaaactgtaggtgggcacctcaaggttgtacggggcagggcccttgcggatt 290 ||||||| ||| |||||||| || || || |||||||| || ||||| || || | ||| Sbjct: 877 tcttccaggaagctgtaggttggtacttccaggttgtatggtgcaggacctttcctaatt 818 Query: 291 ctgccagagatgtcgtagtgggagccatggcacgggcagaaccaaccaccaaagtctcca 350 || ||||| || ||||| || || || || ||||| || |||||||||||| | || ||| Sbjct: 817 cttccagatatatcgtaatgtgatccgtgacacggacaaaaccaaccaccataatcacca 758 Query: 351 gagttgggaagggggatgcaaccaagatgagtgcagacaccaataaccaccagccactct 410 | || || | ||||||||| || | ||||||||| || |||| |||||| | ||| ||| Sbjct: 757 gcattaggcaaggggatgcaccccaaatgagtgcacactccaacaaccactaaccattct 698 Query: 411 gggttcttcacacgctcagcgtcttgctctgggtggcgcagggatgcaacatccacgctg 470 || ||||| || | | | ||||| | ||||| | ||||||| |||||||||| || Sbjct: 697 ggattcttgaccctaaccgagtcttcttgtgggtccctcagggatccaacatccacacta 638 Query: 471 ttggccagcttgatgtcatcgtctgtccgtcgcctgatgaagactggctttccac 525 |||||||||||||||||||| ||||| | ||||||||||||||| |||||||||| Sbjct: 637 ttggccagcttgatgtcatcttctgttcttcgcctgatgaagacgggctttccac 583
>gb|AY066055.1| Arabidopsis thaliana AT5g13430/T22N19_80 mRNA, complete cds Length = 819 Score = 101 bits (51), Expect = 2e-18 Identities = 234/295 (79%) Strand = Plus / Minus Query: 231 tcttccaagaaactgtaggtgggcacctcaaggttgtacggggcagggcccttgcggatt 290 ||||||| ||| |||||||| || || || |||||||| || ||||| || || | ||| Sbjct: 797 tcttccaggaagctgtaggttggtacttccaggttgtatggtgcaggacctttcctaatt 738 Query: 291 ctgccagagatgtcgtagtgggagccatggcacgggcagaaccaaccaccaaagtctcca 350 || ||||| || ||||| || || || || ||||| || |||||||||||| | || ||| Sbjct: 737 cttccagatatatcgtaatgtgatccgtgacacggacaaaaccaaccaccataatcacca 678 Query: 351 gagttgggaagggggatgcaaccaagatgagtgcagacaccaataaccaccagccactct 410 | || || | ||||||||| || | ||||||||| || |||| |||||| | ||| ||| Sbjct: 677 gcattaggcaaggggatgcaccccaaatgagtgcacactccaacaaccactaaccattct 618 Query: 411 gggttcttcacacgctcagcgtcttgctctgggtggcgcagggatgcaacatccacgctg 470 || ||||| || | | | ||||| | ||||| | ||||||| |||||||||| || Sbjct: 617 ggattcttgaccctaaccgagtcttcttgtgggtccctcagggatccaacatccacacta 558 Query: 471 ttggccagcttgatgtcatcgtctgtccgtcgcctgatgaagactggctttccac 525 |||||||||||||||||||| ||||| | ||||||||||||||| |||||||||| Sbjct: 557 ttggccagcttgatgtcatcttctgttcttcgcctgatgaagacgggctttccac 503
>dbj|AK221169.1| Arabidopsis thaliana mRNA for ubiquinol--cytochrome-c reductase -like protein, partial cds, clone: RAFL22-96-P11 Length = 800 Score = 101 bits (51), Expect = 2e-18 Identities = 234/295 (79%) Strand = Plus / Minus Query: 231 tcttccaagaaactgtaggtgggcacctcaaggttgtacggggcagggcccttgcggatt 290 ||||||||||| |||||||| || || || |||||||| || ||||| || || | ||| Sbjct: 521 tcttccaagaagctgtaggtcggtacttccaggttgtatggtgcaggacctttcctaatt 462 Query: 291 ctgccagagatgtcgtagtgggagccatggcacgggcagaaccaaccaccaaagtctcca 350 || ||||| || ||||| || || || || ||||| || |||||||||||| | || ||| Sbjct: 461 cttccagatatatcgtaatgtgatccgtgacacggacaaaaccaaccaccataatcacca 402 Query: 351 gagttgggaagggggatgcaaccaagatgagtgcagacaccaataaccaccagccactct 410 | || || | ||||||||| || | ||||||||| || |||| || | || ||||||| Sbjct: 401 gcattaggcaaggggatgcaccccaaatgagtgcatactccaaccacgatcaaccactct 342 Query: 411 gggttcttcacacgctcagcgtcttgctctgggtggcgcagggatgcaacatccacgctg 470 || ||||| || | | | ||||| | ||||| | ||||||| |||||||||| || Sbjct: 341 ggattcttgactctaaccgagtcttcttgtgggtccctcagggatccaacatccacacta 282 Query: 471 ttggccagcttgatgtcatcgtctgtccgtcgcctgatgaagactggctttccac 525 |||||||||||||||||||| ||||| | ||||||||||||||| |||||||||| Sbjct: 281 ttggccagcttgatgtcatcttctgttcttcgcctgatgaagacgggctttccac 227
>emb|BX830387.1|CNS0A1JK Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB77ZD09 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1011 Score = 101 bits (51), Expect = 2e-18 Identities = 234/295 (79%) Strand = Plus / Minus Query: 231 tcttccaagaaactgtaggtgggcacctcaaggttgtacggggcagggcccttgcggatt 290 ||||||| ||| |||||||| || || || |||||||| || ||||| || || | ||| Sbjct: 829 tcttccaggaagctgtaggttggtacttccaggttgtatggtgcaggacctttcctaatt 770 Query: 291 ctgccagagatgtcgtagtgggagccatggcacgggcagaaccaaccaccaaagtctcca 350 || ||||| || ||||| || || || || ||||| || |||||||||||| | || ||| Sbjct: 769 cttccagatatatcgtaatgtgatccgtgacacggacaaaaccaaccaccataatcacca 710 Query: 351 gagttgggaagggggatgcaaccaagatgagtgcagacaccaataaccaccagccactct 410 | || || | ||||||||| || | ||||||||| || |||| |||||| | ||| ||| Sbjct: 709 gcattaggcaaggggatgcaccccaaatgagtgcacactccaacaaccactaaccattct 650 Query: 411 gggttcttcacacgctcagcgtcttgctctgggtggcgcagggatgcaacatccacgctg 470 || ||||| || | | | ||||| | ||||| | ||||||| |||||||||| || Sbjct: 649 ggattcttgaccctaaccgagtcttcttgtgggtccctcagggatccaacatccacacta 590 Query: 471 ttggccagcttgatgtcatcgtctgtccgtcgcctgatgaagactggctttccac 525 |||||||||||||||||||| ||||| | ||||||||||||||| |||||||||| Sbjct: 589 ttggccagcttgatgtcatcttctgttcttcgcctgatgaagacgggctttccac 535
>emb|BX829878.1|CNS0A1B9 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB42ZG11 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1031 Score = 101 bits (51), Expect = 2e-18 Identities = 234/295 (79%) Strand = Plus / Minus Query: 231 tcttccaagaaactgtaggtgggcacctcaaggttgtacggggcagggcccttgcggatt 290 ||||||| ||| |||||||| || || || |||||||| || ||||| || || | ||| Sbjct: 866 tcttccaggaagctgtaggttggtacttccaggttgtatggtgcaggacctttcctaatt 807 Query: 291 ctgccagagatgtcgtagtgggagccatggcacgggcagaaccaaccaccaaagtctcca 350 || ||||| || ||||| || || || || ||||| || |||||||||||| | || ||| Sbjct: 806 cttccagatatatcgtaatgtgatccgtgacacggacaaaaccaaccaccataatcacca 747 Query: 351 gagttgggaagggggatgcaaccaagatgagtgcagacaccaataaccaccagccactct 410 | || || | ||||||||| || | ||||||||| || |||| |||||| | ||| ||| Sbjct: 746 gcattaggcaaggggatgcaccccaaatgagtgcacactccaacaaccactaaccattct 687 Query: 411 gggttcttcacacgctcagcgtcttgctctgggtggcgcagggatgcaacatccacgctg 470 || ||||| || | | | ||||| | ||||| | ||||||| |||||||||| || Sbjct: 686 ggattcttgaccctaaccgagtcttcttgtgggtccctcagggatccaacatccacacta 627 Query: 471 ttggccagcttgatgtcatcgtctgtccgtcgcctgatgaagactggctttccac 525 |||||||||||||||||||| ||||| | ||||||||||||||| |||||||||| Sbjct: 626 ttggccagcttgatgtcatcttctgttcttcgcctgatgaagacgggctttccac 572
>emb|BX831700.1|CNS0A14K Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH24ZF01 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress) Length = 542 Score = 101 bits (51), Expect = 2e-18 Identities = 234/295 (79%) Strand = Plus / Minus Query: 231 tcttccaagaaactgtaggtgggcacctcaaggttgtacggggcagggcccttgcggatt 290 ||||||| ||| |||||||| || || || |||||||| || ||||| || || | ||| Sbjct: 322 tcttccaggaagctgtaggttggtacttccaggttgtatggtgcaggacctttcctaatt 263 Query: 291 ctgccagagatgtcgtagtgggagccatggcacgggcagaaccaaccaccaaagtctcca 350 || ||||| || ||||| || || || || ||||| || |||||||||||| | || ||| Sbjct: 262 cttccagatatatcgtaatgtgatccgtgacacggacaaaaccaaccaccataatcacca 203 Query: 351 gagttgggaagggggatgcaaccaagatgagtgcagacaccaataaccaccagccactct 410 | || || | ||||||||| || | ||||||||| || |||| |||||| | ||| ||| Sbjct: 202 gcattaggcaaggggatgcaccccaaatgagtgcacactccaacaaccactaaccattct 143 Query: 411 gggttcttcacacgctcagcgtcttgctctgggtggcgcagggatgcaacatccacgctg 470 || ||||| || | | | ||||| | ||||| | ||||||| |||||||||| || Sbjct: 142 ggattcttgaccctaaccgagtcttcttgtgggtccctcagggatccaacatccacacta 83 Query: 471 ttggccagcttgatgtcatcgtctgtccgtcgcctgatgaagactggctttccac 525 |||||||||||||||||||| ||||| | ||||||||||||||| |||||||||| Sbjct: 82 ttggccagcttgatgtcatcttctgttcttcgcctgatgaagacgggctttccac 28
>ref|NM_121347.3| Arabidopsis thaliana oxidoreductase/ ubiquinol-cytochrome-c reductase AT5G13440 mRNA, complete cds Length = 1286 Score = 97.6 bits (49), Expect = 4e-17 Identities = 70/77 (90%) Strand = Plus / Minus Query: 449 cagggatgcaacatccacgctgttggccagcttgatgtcatcgtctgtccgtcgcctgat 508 ||||||| |||||||||| || |||||||||||||||||||| ||||| | ||||||||| Sbjct: 744 cagggatccaacatccacactattggccagcttgatgtcatcttctgttcttcgcctgat 685 Query: 509 gaagactggctttccac 525 |||||| |||||||||| Sbjct: 684 gaagacgggctttccac 668
>gb|AY081510.1| Arabidopsis thaliana ubiquinol--cytochrome-c reductase-like protein (At5g13440) mRNA, complete cds Length = 932 Score = 97.6 bits (49), Expect = 4e-17 Identities = 70/77 (90%) Strand = Plus / Minus Query: 449 cagggatgcaacatccacgctgttggccagcttgatgtcatcgtctgtccgtcgcctgat 508 ||||||| |||||||||| || |||||||||||||||||||| ||||| | ||||||||| Sbjct: 585 cagggatccaacatccacactattggccagcttgatgtcatcttctgttcttcgcctgat 526 Query: 509 gaagactggctttccac 525 |||||| |||||||||| Sbjct: 525 gaagacgggctttccac 509
>gb|AF370533.1|AF370533 Arabidopsis thaliana ubiquinol--cytochrome-c reductase-like protein (T22N19_90) mRNA, complete cds Length = 1080 Score = 97.6 bits (49), Expect = 4e-17 Identities = 70/77 (90%) Strand = Plus / Minus Query: 449 cagggatgcaacatccacgctgttggccagcttgatgtcatcgtctgtccgtcgcctgat 508 ||||||| |||||||||| || |||||||||||||||||||| ||||| | ||||||||| Sbjct: 641 cagggatccaacatccacactattggccagcttgatgtcatcttctgttcttcgcctgat 582 Query: 509 gaagactggctttccac 525 |||||| |||||||||| Sbjct: 581 gaagacgggctttccac 565
>emb|BX829960.1|CNS0A1KF Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB49ZG05 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1003 Score = 97.6 bits (49), Expect = 4e-17 Identities = 70/77 (90%) Strand = Plus / Minus Query: 449 cagggatgcaacatccacgctgttggccagcttgatgtcatcgtctgtccgtcgcctgat 508 ||||||| |||||||||| || |||||||||||||||||||| ||||| | ||||||||| Sbjct: 600 cagggatccaacatccacactattggccagcttgatgtcatcttctgttcttcgcctgat 541 Query: 509 gaagactggctttccac 525 |||||| |||||||||| Sbjct: 540 gaagacgggctttccac 524
>emb|BX833733.1|CNS0A0BW Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTSIL74ZC05 of Silique of strain col-0 of Arabidopsis thaliana (thale cress) Length = 992 Score = 97.6 bits (49), Expect = 4e-17 Identities = 70/77 (90%) Strand = Plus / Minus Query: 449 cagggatgcaacatccacgctgttggccagcttgatgtcatcgtctgtccgtcgcctgat 508 ||||||| |||||||||| || |||||||||||||||||||| ||||| | ||||||||| Sbjct: 649 cagggatccaacatccacactattggccagcttgatgtcatcttctgttcttcgcctgat 590 Query: 509 gaagactggctttccac 525 |||||| |||||||||| Sbjct: 589 gaagacgggctttccac 573
>gb|AY086148.1| Arabidopsis thaliana clone 21819 mRNA, complete sequence Length = 1226 Score = 97.6 bits (49), Expect = 4e-17 Identities = 70/77 (90%) Strand = Plus / Minus Query: 449 cagggatgcaacatccacgctgttggccagcttgatgtcatcgtctgtccgtcgcctgat 508 ||||||| |||||||||| || |||||||||||||||||||| ||||| | ||||||||| Sbjct: 745 cagggatccaacatccacactattggccagcttgatgtcatcttctgttcttcgcctgat 686 Query: 509 gaagactggctttccac 525 |||||| |||||||||| Sbjct: 685 gaagacgggctttccac 669
>dbj|D21116.1|RICSS126 Oryza sativa mRNA for Rieske Fe-S protein, partial sequence Length = 299 Score = 91.7 bits (46), Expect = 2e-15 Identities = 112/135 (82%) Strand = Plus / Minus Query: 345 tctccagagttgggaagggggatgcaaccaagatgagtgcagacaccaataaccaccagc 404 ||||||| ||||| || || ||||||||||| || |||||||| | ||| ||||| ||| Sbjct: 296 tctccagcattggggagaggaatgcaaccaaggtgggtgcagacgcnaatgaccactagc 237 Query: 405 cactctgggttcttcacacgctcagcgtcttgctctgggtggcgcagggatgcaacatcc 464 |||||||||||||| |||||||| ||||| |||| | ||||||||||| ||| ||| Sbjct: 236 cactctgggttcttnacacgctctgcgtcctgctgggaatggcgcagggaccnaacgtcc 177 Query: 465 acgctgttggccagc 479 ||||| ||||||||| Sbjct: 176 acgctattggccagc 162
>emb|BX829847.1|CNS0A1CH Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB40ZE04 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1039 Score = 89.7 bits (45), Expect = 9e-15 Identities = 69/77 (89%) Strand = Plus / Minus Query: 449 cagggatgcaacatccacgctgttggccagcttgatgtcatcgtctgtccgtcgcctgat 508 ||||||| |||||||||| || |||||||||||||||||||| ||||| | ||||||||| Sbjct: 649 cagggatccaacatccacactattggccagcttgatgtcatcttctgttcttcgcctgat 590 Query: 509 gaagactggctttccac 525 ||||| |||||||||| Sbjct: 589 gaagaggggctttccac 573
>emb|BX829679.1|CNS0A1GR Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB29ZG10 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1095 Score = 81.8 bits (41), Expect = 2e-12 Identities = 68/77 (88%) Strand = Plus / Minus Query: 449 cagggatgcaacatccacgctgttggccagcttgatgtcatcgtctgtccgtcgcctgat 508 ||||||| |||||||||| || |||||||||||||||| ||| ||||| | |||||||| Sbjct: 649 cagggatccaacatccacactattggccagcttgatgttatcttctgttcttcgcctgaa 590 Query: 509 gaagactggctttccac 525 |||||| |||||||||| Sbjct: 589 gaagacgggctttccac 573
>emb|AJ719669.1| Gallus gallus mRNA for hypothetical protein, clone 5b19 Length = 1070 Score = 71.9 bits (36), Expect = 2e-09 Identities = 117/144 (81%) Strand = Plus / Minus Query: 245 gtaggtgggcacctcaaggttgtacggggcagggcccttgcggattctgccagagatgtc 304 |||||| || ||||| ||||| || |||||||| || || | ||||||||||||| || Sbjct: 845 gtaggttggaacctccaggttatagggggcaggacctttcctgattctgccagaggcatc 786 Query: 305 gtagtgggagccatggcacgggcagaaccaaccaccaaagtctccagagttgggaagggg 364 || ||||| || |||||||||||| | |||||||||| ||||||||||| | || || Sbjct: 785 ataatgggacccgtggcacgggcagtaataaccaccaaaatctccagagttagcaattgg 726 Query: 365 gatgcaaccaagatgagtgcagac 388 | |||||||||||||||||||| Sbjct: 725 tacacaaccaagatgagtgcagac 702
>ref|NM_001005843.1| Gallus gallus ubiquinol-cytochrome c reductase, Rieske iron-sulfur polypeptide 1 (UQCRFS1), mRNA Length = 1070 Score = 71.9 bits (36), Expect = 2e-09 Identities = 117/144 (81%) Strand = Plus / Minus Query: 245 gtaggtgggcacctcaaggttgtacggggcagggcccttgcggattctgccagagatgtc 304 |||||| || ||||| ||||| || |||||||| || || | ||||||||||||| || Sbjct: 845 gtaggttggaacctccaggttatagggggcaggacctttcctgattctgccagaggcatc 786 Query: 305 gtagtgggagccatggcacgggcagaaccaaccaccaaagtctccagagttgggaagggg 364 || ||||| || |||||||||||| | |||||||||| ||||||||||| | || || Sbjct: 785 ataatgggacccgtggcacgggcagtaataaccaccaaaatctccagagttagcaattgg 726 Query: 365 gatgcaaccaagatgagtgcagac 388 | |||||||||||||||||||| Sbjct: 725 tacacaaccaagatgagtgcagac 702
>emb|AJ250370.1|CPA250370 Cyanophora paradoxa partial mRNA for ubiquinol-cytochrome C reductase iron-sulfur subunit precursor (risp gene) Length = 836 Score = 69.9 bits (35), Expect = 8e-09 Identities = 71/83 (85%) Strand = Plus / Minus Query: 252 ggcacctcaaggttgtacggggcagggcccttgcggattctgccagagatgtcgtagtgg 311 |||||||| ||||| ||| ||||||||||| ||||| | ||| ||||||||||||||| Sbjct: 635 ggcacctccaggttaagcggcgcagggcccttccggatgcggccggagatgtcgtagtgg 576 Query: 312 gagccatggcacgggcagaacca 334 ||| ||||||||||||||||| Sbjct: 575 ctgccgtggcacgggcagaacca 553
>ref|XM_359684.1| Magnaporthe grisea 70-15 hypothetical protein (MG05093.4) partial mRNA Length = 711 Score = 63.9 bits (32), Expect = 5e-07 Identities = 77/92 (83%) Strand = Plus / Minus Query: 300 atgtcgtagtgggagccatggcacgggcagaaccaaccaccaaagtctccagagttggga 359 ||||||||||| || || ||||| |||||||||||||| |||||||| |||| | | | Sbjct: 620 atgtcgtagtgagatccgtggcaggggcagaaccaaccgccaaagtcgccagcctcgcca 561 Query: 360 agggggatgcaaccaagatgagtgcagacacc 391 | ||||| ||||||||||| ||||||||||| Sbjct: 560 atggggacacaaccaagatgtgtgcagacacc 529
>ref|XM_499709.1| Yarrowia lipolytica CLIB122, YALI0A02915g predicted mRNA Length = 678 Score = 61.9 bits (31), Expect = 2e-06 Identities = 58/67 (86%) Strand = Plus / Minus Query: 285 cggattctgccagagatgtcgtagtgggagccatggcacgggcagaaccaaccaccaaag 344 ||||||| ||| || |||||||| ||||| || ||||| ||||||||||| || |||||| Sbjct: 602 cggattcggccggaaatgtcgtaatgggatccgtggcaggggcagaaccagccgccaaag 543 Query: 345 tctccag 351 ||||||| Sbjct: 542 tctccag 536
>emb|X91795.1|CRUCCOR C.reinhardtii mRNa for ubiquinol-cytochrome c oxidoreductase Length = 1447 Score = 61.9 bits (31), Expect = 2e-06 Identities = 70/83 (84%) Strand = Plus / Minus Query: 252 ggcacctcaaggttgtacggggcagggcccttgcggattctgccagagatgtcgtagtgg 311 |||||||| |||||||| ||||| ||||||| | || | ||| ||||||||||||||| Sbjct: 869 ggcacctccaggttgtatggggcggggccctccctaatgcggcccgagatgtcgtagtgg 810 Query: 312 gagccatggcacgggcagaacca 334 ||| ||||||||||||||||| Sbjct: 809 ctgccgtggcacgggcagaacca 787
>emb|AJ320239.1|CRE320239 Chlamydomonas reinhardtii risp gene for ubiquinol-cytochrome c reductase, exons 1-5 Length = 2847 Score = 61.9 bits (31), Expect = 2e-06 Identities = 70/83 (84%) Strand = Plus / Minus Query: 252 ggcacctcaaggttgtacggggcagggcccttgcggattctgccagagatgtcgtagtgg 311 |||||||| |||||||| ||||| ||||||| | || | ||| ||||||||||||||| Sbjct: 2208 ggcacctccaggttgtatggggcggggccctccctaatgcggcccgagatgtcgtagtgg 2149 Query: 312 gagccatggcacgggcagaacca 334 ||| ||||||||||||||||| Sbjct: 2148 ctgccgtggcacgggcagaacca 2126
>emb|CR382127.1| Yarrowia lipolytica chromosome A of strain CLIB122 of Yarrowia lipolytica Length = 2303261 Score = 61.9 bits (31), Expect = 2e-06 Identities = 58/67 (86%) Strand = Plus / Minus Query: 285 cggattctgccagagatgtcgtagtgggagccatggcacgggcagaaccaaccaccaaag 344 ||||||| ||| || |||||||| ||||| || ||||| ||||||||||| || |||||| Sbjct: 346295 cggattcggccggaaatgtcgtaatgggatccgtggcaggggcagaaccagccgccaaag 346236 Query: 345 tctccag 351 ||||||| Sbjct: 346235 tctccag 346229
>emb|BX830982.1|CNS0A0P7 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS45ZG07 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1231 Score = 60.0 bits (30), Expect = 8e-06 Identities = 45/50 (90%) Strand = Plus / Minus Query: 457 caacatccacgctgttggccagcttgatgtcatcgtctgtccgtcgcctg 506 |||||||||| || |||||||||||||||||||| ||||| | ||||||| Sbjct: 681 caacatccacactattggccagcttgatgtcatcttctgttcttcgcctg 632 Score = 46.1 bits (23), Expect = 0.12 Identities = 89/111 (80%) Strand = Plus / Minus Query: 231 tcttccaagaaactgtaggtgggcacctcaaggttgtacggggcagggcccttgcggatt 290 ||||||||||| |||||||| || || || |||||||| || ||||| || || | ||| Sbjct: 907 tcttccaagaagctgtaggtcggtacttccaggttgtatggtgcaggacctttcctaatt 848 Query: 291 ctgccagagatgtcgtagtgggagccatggcacgggcagaaccaaccacca 341 || ||||| || ||||| || || || || ||||| || |||||||||||| Sbjct: 847 cttccagatatatcgtaatgtgatccgtgacacggacaaaaccaaccacca 797
>gb|AE017345.1| Cryptococcus neoformans var. neoformans JEC21 chromosome 5, complete sequence Length = 1507550 Score = 58.0 bits (29), Expect = 3e-05 Identities = 47/53 (88%) Strand = Plus / Plus Query: 285 cggattctgccagagatgtcgtagtgggagccatggcacgggcagaaccaacc 337 ||||||| |||||| |||||||||||||| || ||||| || ||||||||||| Sbjct: 627810 cggattcggccagaaatgtcgtagtgggaaccgtggcaaggacagaaccaacc 627862 Score = 42.1 bits (21), Expect = 1.8 Identities = 24/25 (96%) Strand = Plus / Plus Query: 369 caaccaagatgagtgcagacaccaa 393 ||||||||||| ||||||||||||| Sbjct: 627953 caaccaagatgtgtgcagacaccaa 627977
>ref|XM_570926.1| Cryptococcus neoformans var. neoformans JEC21 ubiquinol-cytochrome c reductase iron-sulfur subunit, mitochondrial precursor (CNE02310) partial mRNA Length = 840 Score = 58.0 bits (29), Expect = 3e-05 Identities = 47/53 (88%) Strand = Plus / Minus Query: 285 cggattctgccagagatgtcgtagtgggagccatggcacgggcagaaccaacc 337 ||||||| |||||| |||||||||||||| || ||||| || ||||||||||| Sbjct: 761 cggattcggccagaaatgtcgtagtgggaaccgtggcaaggacagaaccaacc 709 Score = 42.1 bits (21), Expect = 1.8 Identities = 24/25 (96%) Strand = Plus / Minus Query: 369 caaccaagatgagtgcagacaccaa 393 ||||||||||| ||||||||||||| Sbjct: 677 caaccaagatgtgtgcagacaccaa 653
>dbj|AP007175.1| Aspergillus oryzae RIB40 genomic DNA, SC010 Length = 2039961 Score = 58.0 bits (29), Expect = 3e-05 Identities = 65/77 (84%) Strand = Plus / Minus Query: 270 ggggcagggcccttgcggattctgccagagatgtcgtagtgggagccatggcacgggcag 329 |||||||| ||||| | ||| | ||| |||||||||||||| || || ||||| |||||| Sbjct: 1276830 ggggcaggacccttcctgatacggccggagatgtcgtagtgagaaccgtggcaggggcag 1276771 Query: 330 aaccaaccaccaaagtc 346 ||||| || |||||||| Sbjct: 1276770 aaccagccgccaaagtc 1276754
>gb|CP000081.1| Leishmania major chromosome 35, complete sequence Length = 2090491 Score = 56.0 bits (28), Expect = 1e-04 Identities = 67/80 (83%) Strand = Plus / Plus Query: 252 ggcacctcaaggttgtacggggcagggcccttgcggattctgccagagatgtcgtagtgg 311 |||||||||||||| |||||||||||| | |||||| | ||| ||| |||||||||| Sbjct: 666939 ggcacctcaaggttcagcggggcagggccttggcggatacggccggaggggtcgtagtgg 666998 Query: 312 gagccatggcacgggcagaa 331 ||| |||||||||||||| Sbjct: 666999 ctgccgtggcacgggcagaa 667018
>ref|XM_460873.1| Debaryomyces hansenii CBS767 hypothetical protein (DEHA0F12771g) partial mRNA Length = 477 Score = 56.0 bits (28), Expect = 1e-04 Identities = 49/56 (87%) Strand = Plus / Minus Query: 288 attctgccagagatgtcgtagtgggagccatggcacgggcagaaccaaccaccaaa 343 ||||| |||||||| |||||||| || ||||| || || ||||||||||||||||| Sbjct: 398 attctaccagagatatcgtagtgagaaccatgacaaggacagaaccaaccaccaaa 343
>ref|XM_838166.1| Leishmania major strain Friedlin reiske iron-sulfur protein precursor (LMJ_1083) partial mRNA Length = 894 Score = 56.0 bits (28), Expect = 1e-04 Identities = 67/80 (83%) Strand = Plus / Minus Query: 252 ggcacctcaaggttgtacggggcagggcccttgcggattctgccagagatgtcgtagtgg 311 |||||||||||||| |||||||||||| | |||||| | ||| ||| |||||||||| Sbjct: 845 ggcacctcaaggttcagcggggcagggccttggcggatacggccggaggggtcgtagtgg 786 Query: 312 gagccatggcacgggcagaa 331 ||| |||||||||||||| Sbjct: 785 ctgccgtggcacgggcagaa 766
>emb|CR382138.1| Debaryomyces hansenii chromosome F of strain CBS767 of Debaryomyces hansenii Length = 2336804 Score = 56.0 bits (28), Expect = 1e-04 Identities = 49/56 (87%) Strand = Plus / Minus Query: 288 attctgccagagatgtcgtagtgggagccatggcacgggcagaaccaaccaccaaa 343 ||||| |||||||| |||||||| || ||||| || || ||||||||||||||||| Sbjct: 1023322 attctaccagagatatcgtagtgagaaccatgacaaggacagaaccaaccaccaaa 1023267
>dbj|AP007255.1| Magnetospirillum magneticum AMB-1 DNA, complete genome Length = 4967148 Score = 56.0 bits (28), Expect = 1e-04 Identities = 49/56 (87%) Strand = Plus / Minus Query: 279 cccttgcggattctgccagagatgtcgtagtgggagccatggcacgggcagaacca 334 ||||||||||| | ||| ||| | |||||||| || |||||||||||||||||||| Sbjct: 4489680 cccttgcggatgcggccggaggtatcgtagtgcgatccatggcacgggcagaacca 4489625
>gb|AE016818.1| Ashbya gossypii (= Eremothecium gossypii) ATCC 10895 chromosome V, complete sequence Length = 1519138 Score = 56.0 bits (28), Expect = 1e-04 Identities = 40/44 (90%) Strand = Plus / Minus Query: 303 tcgtagtgggagccatggcacgggcagaaccaaccaccaaagtc 346 ||||||||||| || ||||| ||||||||||| ||||||||||| Sbjct: 508718 tcgtagtgggaaccgtggcatgggcagaaccagccaccaaagtc 508675
>ref|NM_210148.1| Eremothecium gossypii AEL067Wp (AEL067W), mRNA Length = 639 Score = 56.0 bits (28), Expect = 1e-04 Identities = 40/44 (90%) Strand = Plus / Minus Query: 303 tcgtagtgggagccatggcacgggcagaaccaaccaccaaagtc 346 ||||||||||| || ||||| ||||||||||| ||||||||||| Sbjct: 548 tcgtagtgggaaccgtggcatgggcagaaccagccaccaaagtc 505
>ref|XM_447387.1| Candida glabrata CBS138 hypothetical protein (CAGL0I03190g) partial mRNA Length = 642 Score = 54.0 bits (27), Expect = 5e-04 Identities = 51/59 (86%) Strand = Plus / Minus Query: 288 attctgccagagatgtcgtagtgggagccatggcacgggcagaaccaaccaccaaagtc 346 ||||| |||||||| |||||||| || || || || ||||||||||||||||| ||||| Sbjct: 566 attctaccagagatatcgtagtgagaaccgtgacaagggcagaaccaaccaccgaagtc 508
>emb|CR380955.1| Candida glabrata strain CBS138 chromosome I complete sequence Length = 1089401 Score = 54.0 bits (27), Expect = 5e-04 Identities = 51/59 (86%) Strand = Plus / Plus Query: 288 attctgccagagatgtcgtagtgggagccatggcacgggcagaaccaaccaccaaagtc 346 ||||| |||||||| |||||||| || || || || ||||||||||||||||| ||||| Sbjct: 274057 attctaccagagatatcgtagtgagaaccgtgacaagggcagaaccaaccaccgaagtc 274115
>dbj|BA000012.4| Mesorhizobium loti MAFF303099 DNA, complete genome Length = 7036071 Score = 54.0 bits (27), Expect = 5e-04 Identities = 51/59 (86%) Strand = Plus / Plus Query: 276 gggcccttgcggattctgccagagatgtcgtagtgggagccatggcacgggcagaacca 334 ||||| |||||||| | ||| | | ||||||| || ||||||||||||||||||||||| Sbjct: 2177333 gggcctttgcggatgcggccggcggtgtcgtactgcgagccatggcacgggcagaacca 2177391
>gb|AE005720.1| Caulobacter crescentus CB15 section 46 of 359 of the complete genome Length = 11816 Score = 52.0 bits (26), Expect = 0.002 Identities = 53/62 (85%) Strand = Plus / Minus Query: 273 gcagggcccttgcggattctgccagagatgtcgtagtgggagccatggcacgggcagaac 332 ||||||||||| ||||| | || ||| |||||||||| ||||| ||||| ||||||||| Sbjct: 5564 gcagggcccttacggatacgacccgaggtgtcgtagtgcgagccgtggcaggggcagaac 5505 Query: 333 ca 334 || Sbjct: 5504 ca 5503
>gb|CP000031.1| Silicibacter pomeroyi DSS-3, complete genome Length = 4109442 Score = 50.1 bits (25), Expect = 0.007 Identities = 46/53 (86%) Strand = Plus / Minus Query: 282 ttgcggattctgccagagatgtcgtagtgggagccatggcacgggcagaacca 334 |||||||| | ||||||| | |||||||| ||||| ||||| ||||||||||| Sbjct: 288687 ttgcggatccggccagaggtatcgtagtgcgagccgtggcaggggcagaacca 288635
>ref|XM_748490.1| Aspergillus fumigatus Af293 ubiquinol-cytochrome c reductase iron-sulfur subunit precursor (Afu5g10610) partial mRNA Length = 897 Score = 50.1 bits (25), Expect = 0.007 Identities = 55/65 (84%) Strand = Plus / Minus Query: 270 ggggcagggcccttgcggattctgccagagatgtcgtagtgggagccatggcacgggcag 329 |||||||| ||||| ||||| | ||| ||||| || |||||||| || ||||| |||||| Sbjct: 836 ggggcaggacccttccggatacggccggagatatcatagtgggaaccgtggcaggggcag 777 Query: 330 aacca 334 ||||| Sbjct: 776 aacca 772
>ref|XM_957255.1| Neurospora crassa OR74A hypothetical protein (NCU06606.1) partial mRNA Length = 696 Score = 48.1 bits (24), Expect = 0.029 Identities = 42/48 (87%) Strand = Plus / Minus Query: 293 gccagagatgtcgtagtgggagccatggcacgggcagaaccaaccacc 340 ||||||||| |||||||| || || ||||| ||||||||||| ||||| Sbjct: 612 gccagagatatcgtagtgagaaccgtggcaagggcagaaccagccacc 565
>ref|XM_326460.1| Neurospora crassa OR74A hypothetical protein (NCU06606.1) partial mRNA Length = 696 Score = 48.1 bits (24), Expect = 0.029 Identities = 42/48 (87%) Strand = Plus / Minus Query: 293 gccagagatgtcgtagtgggagccatggcacgggcagaaccaaccacc 340 ||||||||| |||||||| || || ||||| ||||||||||| ||||| Sbjct: 612 gccagagatatcgtagtgagaaccgtggcaagggcagaaccagccacc 565
>gb|AC110374.3| Mus musculus BAC clone RP23-293P18 from 15, complete sequence Length = 199869 Score = 48.1 bits (24), Expect = 0.029 Identities = 24/24 (100%) Strand = Plus / Minus Query: 174 agaatatatgttggtaggtactgg 197 |||||||||||||||||||||||| Sbjct: 143079 agaatatatgttggtaggtactgg 143056
>emb|X02472.1|NCCYRFES Neurospora gene for mitochondrial ubiquinol-cytochrome c reductase iron-sulfur subunit Length = 1790 Score = 48.1 bits (24), Expect = 0.029 Identities = 42/48 (87%) Strand = Plus / Minus Query: 293 gccagagatgtcgtagtgggagccatggcacgggcagaaccaaccacc 340 ||||||||| |||||||| || || ||||| ||||||||||| ||||| Sbjct: 1401 gccagagatatcgtagtgagaaccgtggcaagggcagaaccagccacc 1354
>gb|BC019934.1| Mus musculus ubiquinol-cytochrome c reductase, Rieske iron-sulfur polypeptide 1, mRNA (cDNA clone MGC:30985 IMAGE:5249225), complete cds Length = 1194 Score = 46.1 bits (23), Expect = 0.12 Identities = 95/119 (79%) Strand = Plus / Minus Query: 273 gcagggcccttgcggattctgccagagatgtcgtagtgggagccatggcacgggcagaac 332 ||||||||||| | ||| ||||||||| ||| ||||| || |||||||| ||||| | Sbjct: 837 gcagggcccttcctgatcctgccagaggcgtcatagtgtgacccatggcaggggcaataa 778 Query: 333 caaccaccaaagtctccagagttgggaagggggatgcaaccaagatgagtgcagacacc 391 | |||||||| ||||| | ||| | || ||| | |||||||||||||| |||||||| Sbjct: 777 tagccaccaaaatctcctgcgtttgcaatgggtacacaaccaagatgagtacagacacc 719
>gb|BT010222.1| Drosophila melanogaster RH01528 full insert cDNA Length = 931 Score = 46.1 bits (23), Expect = 0.12 Identities = 44/51 (86%) Strand = Plus / Minus Query: 279 cccttgcggattctgccagagatgtcgtagtgggagccatggcacgggcag 329 ||||||||||| || || ||| ||||||||||||||| ||||| |||||| Sbjct: 767 cccttgcggatccttccggaggcgtcgtagtgggagccgtggcaggggcag 717
>gb|DQ445508.1| Graphocephala atropunctata isolate WHGA0169 Rieske iron-sulfur protein 1 mRNA, complete cds Length = 819 Score = 46.1 bits (23), Expect = 0.12 Identities = 65/79 (82%) Strand = Plus / Minus Query: 273 gcagggcccttgcggattctgccagagatgtcgtagtgggagccatggcacgggcagaac 332 ||||| ||||||||||||| ||||| |||||||||||||||||||| || ||| | Sbjct: 755 gcaggtcccttgcggattcgaccagaagcatcgtagtgggagccatggcaaggacagtaa 696 Query: 333 caaccaccaaagtctccag 351 | ||||||||||| |||| Sbjct: 695 tatccaccaaagtcaccag 677
>emb|AL611944.10| Mouse DNA sequence from clone RP23-279E14 on chromosome 13 Contains the gene for the ortholog of rat and human ubiquinol-cytochrome c reductase, Rieske iron-sulfur polypeptide 1 UQCRFS1, a novel gene and a CpG island, complete sequence Length = 194065 Score = 46.1 bits (23), Expect = 0.12 Identities = 95/119 (79%) Strand = Plus / Plus Query: 273 gcagggcccttgcggattctgccagagatgtcgtagtgggagccatggcacgggcagaac 332 ||||||||||| | ||| ||||||||| ||| ||||| || |||||||| ||||| | Sbjct: 77295 gcagggcccttcctgatcctgccagaggcgtcatagtgtgacccatggcaggggcaataa 77354 Query: 333 caaccaccaaagtctccagagttgggaagggggatgcaaccaagatgagtgcagacacc 391 | |||||||| ||||| | ||| | || ||| | |||||||||||||| |||||||| Sbjct: 77355 tagccaccaaaatctcctgcgtttgcaatgggtacacaaccaagatgagtacagacacc 77413
>gb|DQ122922.1| Chlamydomonas incerta mitochondrial ubiquinol-cytochrome c oxidoreductase (RisP) mRNA, partial cds; nuclear gene for mitochondrial product Length = 921 Score = 46.1 bits (23), Expect = 0.12 Identities = 68/83 (81%) Strand = Plus / Minus Query: 252 ggcacctcaaggttgtacggggcagggcccttgcggattctgccagagatgtcgtagtgg 311 ||||| || |||||||| ||||| ||||||| || || | ||| || |||||||||||| Sbjct: 593 ggcacttccaggttgtagggggcggggccctcccgaatgcggcccgaaatgtcgtagtgg 534 Query: 312 gagccatggcacgggcagaacca 334 ||| ||||| ||||||||||| Sbjct: 533 ctgccgtggcaggggcagaacca 511
>ref|NM_164426.1| Drosophila melanogaster Rieske iron-sulfur protein CG7361-RB, transcript variant B (RFeSP), mRNA Length = 883 Score = 46.1 bits (23), Expect = 0.12 Identities = 44/51 (86%) Strand = Plus / Minus Query: 279 cccttgcggattctgccagagatgtcgtagtgggagccatggcacgggcag 329 ||||||||||| || || ||| ||||||||||||||| ||||| |||||| Sbjct: 729 cccttgcggatccttccggaggcgtcgtagtgggagccgtggcaggggcag 679
>ref|NM_080009.2| Drosophila melanogaster Rieske iron-sulfur protein CG7361-RA, transcript variant A (RFeSP), mRNA Length = 938 Score = 46.1 bits (23), Expect = 0.12 Identities = 44/51 (86%) Strand = Plus / Minus Query: 279 cccttgcggattctgccagagatgtcgtagtgggagccatggcacgggcag 329 ||||||||||| || || ||| ||||||||||||||| ||||| |||||| Sbjct: 784 cccttgcggatccttccggaggcgtcgtagtgggagccgtggcaggggcag 734
>dbj|AK152391.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length enriched library, clone:I830067N02 product:ubiquinol-cytochrome c reductase, Rieske iron-sulfur polypeptide 1, full insert sequence Length = 1200 Score = 46.1 bits (23), Expect = 0.12 Identities = 95/119 (79%) Strand = Plus / Minus Query: 273 gcagggcccttgcggattctgccagagatgtcgtagtgggagccatggcacgggcagaac 332 ||||||||||| | ||| ||||||||| ||| ||||| || |||||||| ||||| | Sbjct: 842 gcagggcccttcctgatcctgccagaggcgtcatagtgtgacccatggcaggggcaataa 783 Query: 333 caaccaccaaagtctccagagttgggaagggggatgcaaccaagatgagtgcagacacc 391 | |||||||| ||||| | ||| | || ||| | |||||||||||||| |||||||| Sbjct: 782 tagccaccaaaatctcctgcgtttgcaatgggtacacaaccaagatgagtacagacacc 724
>gb|AC104630.1| Drosophila melanogaster, chromosome 2L, region 22B-22C, BAC clone BACR19B15, complete sequence Length = 180088 Score = 46.1 bits (23), Expect = 0.12 Identities = 44/51 (86%) Strand = Plus / Minus Query: 279 cccttgcggattctgccagagatgtcgtagtgggagccatggcacgggcag 329 ||||||||||| || || ||| ||||||||||||||| ||||| |||||| Sbjct: 142560 cccttgcggatccttccggaggcgtcgtagtgggagccgtggcaggggcag 142510
>gb|CP000264.1| Jannaschia sp. CCS1, complete genome Length = 4317977 Score = 46.1 bits (23), Expect = 0.12 Identities = 44/51 (86%) Strand = Plus / Minus Query: 301 tgtcgtagtgggagccatggcacgggcagaaccaaccaccaaagtctccag 351 |||| ||||| ||||| ||||| ||||||||||| ||||| ||||| |||| Sbjct: 331091 tgtcatagtgagagccgtggcaggggcagaaccagccaccgaagtcaccag 331041
>dbj|AK153139.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length enriched library, clone:I830124H22 product:ubiquinol-cytochrome c reductase, Rieske iron-sulfur polypeptide 1, full insert sequence Length = 1084 Score = 46.1 bits (23), Expect = 0.12 Identities = 95/119 (79%) Strand = Plus / Minus Query: 273 gcagggcccttgcggattctgccagagatgtcgtagtgggagccatggcacgggcagaac 332 ||||||||||| | ||| ||||||||| ||| ||||| || |||||||| ||||| | Sbjct: 817 gcagggcccttcctgatcctgccagaggcgtcatagtgtgacccatggcaggggcaataa 758 Query: 333 caaccaccaaagtctccagagttgggaagggggatgcaaccaagatgagtgcagacacc 391 | |||||||| ||||| | ||| | || ||| | |||||||||||||| |||||||| Sbjct: 757 tagccaccaaaatctcctgcgtttgcaatgggtacacaaccaagatgagtacagacacc 699
>gb|AC092188.1|AC092188 Drosophila melanogaster, chromosome 2L, region 22B-22C, BAC clone BACR28O09, complete sequence Length = 177326 Score = 46.1 bits (23), Expect = 0.12 Identities = 44/51 (86%) Strand = Plus / Minus Query: 279 cccttgcggattctgccagagatgtcgtagtgggagccatggcacgggcag 329 ||||||||||| || || ||| ||||||||||||||| ||||| |||||| Sbjct: 32613 cccttgcggatccttccggaggcgtcgtagtgggagccgtggcaggggcag 32563
>dbj|AK012180.1| Mus musculus 10 days embryo whole body cDNA, RIKEN full-length enriched library, clone:2610528M22 product:UBIQUINOL-CYTOCHROME C REDUCTASE IRON-SULFUR SUBUNIT, MITOCHONDRIAL PRECURSOR (EC 1.10.2.2) (RIESKE IRON-SULFUR PROTEIN) (RISP) [CONTAINS: UBIQUINOL-CYTOCHROME C REDUCTASE 8 KDA PROTEIN (COMPLEX III SUBUNIT IX)] homolog [Bos taurus], full insert sequence Length = 1048 Score = 46.1 bits (23), Expect = 0.12 Identities = 95/119 (79%) Strand = Plus / Minus Query: 273 gcagggcccttgcggattctgccagagatgtcgtagtgggagccatggcacgggcagaac 332 ||||||||||| | ||| ||||||||| ||| ||||| || |||||||| ||||| | Sbjct: 781 gcagggcccttcctgatcctgccagaggcgtcatagtgtgacccatggcaggggcaataa 722 Query: 333 caaccaccaaagtctccagagttgggaagggggatgcaaccaagatgagtgcagacacc 391 | |||||||| ||||| | ||| | || ||| | |||||||||||||| |||||||| Sbjct: 721 tagccaccaaaatctcctgcgtttgcaatgggtacacaaccaagatgagtacagacacc 663
>dbj|AK014470.1| Mus musculus 14 days embryo liver cDNA, RIKEN full-length enriched library, clone:4430402G14 product:UBIQUINOL-CYTOCHROME C REDUCTASE IRON-SULFUR SUBUNIT, MITOCHONDRIAL PRECURSOR (EC 1.10.2.2) (RIESKE IRON-SULFUR PROTEIN) (RISP) [CONTAINS: UBIQUINOL-CYTOCHROME C REDUCTASE 8 KDA PROTEIN (COMPLEX III SUBUNIT IX)] homolog [Bos taurus], full insert sequence Length = 1316 Score = 46.1 bits (23), Expect = 0.12 Identities = 95/119 (79%) Strand = Plus / Minus Query: 273 gcagggcccttgcggattctgccagagatgtcgtagtgggagccatggcacgggcagaac 332 ||||||||||| | ||| ||||||||| ||| ||||| || |||||||| ||||| | Sbjct: 833 gcagggcccttcctgatcctgccagaggcgtcatagtgtgacccatggcaggggcaataa 774 Query: 333 caaccaccaaagtctccagagttgggaagggggatgcaaccaagatgagtgcagacacc 391 | |||||||| ||||| | ||| | || ||| | |||||||||||||| |||||||| Sbjct: 773 tagccaccaaaatctcctgcgtttgcaatgggtacacaaccaagatgagtacagacacc 715
>dbj|AK003966.1| Mus musculus 18-day embryo whole body cDNA, RIKEN full-length enriched library, clone:1110030B05 product:ubiquinol-cytochrome c reductase, Rieske iron-sulfur polypeptide 1, full insert sequence Length = 1060 Score = 46.1 bits (23), Expect = 0.12 Identities = 95/119 (79%) Strand = Plus / Minus Query: 273 gcagggcccttgcggattctgccagagatgtcgtagtgggagccatggcacgggcagaac 332 ||||||||||| | ||| ||||||||| ||| ||||| || |||||||| ||||| | Sbjct: 793 gcagggcccttcctgatcctgccagaggcgtcatagtgtgacccatggcaggggcaataa 734 Query: 333 caaccaccaaagtctccagagttgggaagggggatgcaaccaagatgagtgcagacacc 391 | |||||||| ||||| | ||| | || ||| | |||||||||||||| |||||||| Sbjct: 733 tagccaccaaaatctcctgcgtttgcaatgggtacacaaccaagatgagtacagacacc 675
>ref|NM_025710.1| Mus musculus ubiquinol-cytochrome c reductase, Rieske iron-sulfur polypeptide 1 (Uqcrfs1), mRNA Length = 1316 Score = 46.1 bits (23), Expect = 0.12 Identities = 95/119 (79%) Strand = Plus / Minus Query: 273 gcagggcccttgcggattctgccagagatgtcgtagtgggagccatggcacgggcagaac 332 ||||||||||| | ||| ||||||||| ||| ||||| || |||||||| ||||| | Sbjct: 833 gcagggcccttcctgatcctgccagaggcgtcatagtgtgacccatggcaggggcaataa 774 Query: 333 caaccaccaaagtctccagagttgggaagggggatgcaaccaagatgagtgcagacacc 391 | |||||||| ||||| | ||| | || ||| | |||||||||||||| |||||||| Sbjct: 773 tagccaccaaaatctcctgcgtttgcaatgggtacacaaccaagatgagtacagacacc 715
>dbj|AK217705.1| Mus musculus cDNA, clone:Y2G0142L01, strand:plus, reference:ENSEMBL:Mouse-Transcript- ENST:ENSMUST00000042834, based on BLAT search Length = 378 Score = 46.1 bits (23), Expect = 0.12 Identities = 95/119 (79%) Strand = Plus / Minus Query: 273 gcagggcccttgcggattctgccagagatgtcgtagtgggagccatggcacgggcagaac 332 ||||||||||| | ||| ||||||||| ||| ||||| || |||||||| ||||| | Sbjct: 327 gcagggcccttcctgatcctgccagaggcgtcatagtgtgacccatggcaggggcaataa 268 Query: 333 caaccaccaaagtctccagagttgggaagggggatgcaaccaagatgagtgcagacacc 391 | |||||||| ||||| | ||| | || ||| | |||||||||||||| |||||||| Sbjct: 267 tagccaccaaaatctcctgcgtttgcaatgggtacacaaccaagatgagtacagacacc 209
>dbj|AK212564.1| Mus musculus cDNA, clone:Y2G0125G04, strand:plus, reference:ENSEMBL:Mouse-Transcript- ENST:ENSMUST00000042834, based on BLAT search Length = 336 Score = 46.1 bits (23), Expect = 0.12 Identities = 95/119 (79%) Strand = Plus / Minus Query: 273 gcagggcccttgcggattctgccagagatgtcgtagtgggagccatggcacgggcagaac 332 ||||||||||| | ||| ||||||||| ||| ||||| || |||||||| ||||| | Sbjct: 327 gcagggcccttcctgatcctgccagaggcgtcatagtgtgacccatggcaggggcaataa 268 Query: 333 caaccaccaaagtctccagagttgggaagggggatgcaaccaagatgagtgcagacacc 391 | |||||||| ||||| | ||| | || ||| | |||||||||||||| |||||||| Sbjct: 267 tagccaccaaaatctcctgcgtttgcaatgggtacacaaccaagatgagtacagacacc 209
>dbj|AK210928.1| Mus musculus cDNA, clone:Y2G0120B13, strand:minus, reference:ENSEMBL:Mouse-Transcript- ENST:ENSMUST00000042834, based on BLAT search Length = 384 Score = 46.1 bits (23), Expect = 0.12 Identities = 95/119 (79%) Strand = Plus / Minus Query: 273 gcagggcccttgcggattctgccagagatgtcgtagtgggagccatggcacgggcagaac 332 ||||||||||| | ||| ||||||||| ||| ||||| || |||||||| ||||| | Sbjct: 315 gcagggcccttcctgatcctgccagaggcgtcatagtgtgacccatggcaggggcaataa 256 Query: 333 caaccaccaaagtctccagagttgggaagggggatgcaaccaagatgagtgcagacacc 391 | |||||||| ||||| | ||| | || ||| | |||||||||||||| |||||||| Sbjct: 255 tagccaccaaaatctcctgcgtttgcaatgggtacacaaccaagatgagtacagacacc 197
>dbj|AK180820.1| Mus musculus cDNA, clone:Y0G0116A06, strand:minus, reference:ENSEMBL:Mouse-Transcript- ENST:ENSMUST00000042834, based on BLAT search Length = 435 Score = 46.1 bits (23), Expect = 0.12 Identities = 95/119 (79%) Strand = Plus / Minus Query: 273 gcagggcccttgcggattctgccagagatgtcgtagtgggagccatggcacgggcagaac 332 ||||||||||| | ||| ||||||||| ||| ||||| || |||||||| ||||| | Sbjct: 366 gcagggcccttcctgatcctgccagaggcgtcatagtgtgacccatggcaggggcaataa 307 Query: 333 caaccaccaaagtctccagagttgggaagggggatgcaaccaagatgagtgcagacacc 391 | |||||||| ||||| | ||| | || ||| | |||||||||||||| |||||||| Sbjct: 306 tagccaccaaaatctcctgcgtttgcaatgggtacacaaccaagatgagtacagacacc 248
>gb|AE003585.5| Drosophila melanogaster chromosome 2L, section 6 of 83 of the complete sequence Length = 343161 Score = 46.1 bits (23), Expect = 0.12 Identities = 44/51 (86%) Strand = Plus / Plus Query: 279 cccttgcggattctgccagagatgtcgtagtgggagccatggcacgggcag 329 ||||||||||| || || ||| ||||||||||||||| ||||| |||||| Sbjct: 71472 cccttgcggatccttccggaggcgtcgtagtgggagccgtggcaggggcag 71522
>gb|AC004445.1|AC004445 Drosophila melanogaster DNA sequence (P1 DS00445 (D93)), complete sequence Length = 61852 Score = 46.1 bits (23), Expect = 0.12 Identities = 44/51 (86%) Strand = Plus / Plus Query: 279 cccttgcggattctgccagagatgtcgtagtgggagccatggcacgggcag 329 ||||||||||| || || ||| ||||||||||||||| ||||| |||||| Sbjct: 27766 cccttgcggatccttccggaggcgtcgtagtgggagccgtggcaggggcag 27816
>gb|BC047125.1| Mus musculus ubiquinol-cytochrome c reductase, Rieske iron-sulfur polypeptide 1, mRNA (cDNA clone IMAGE:5009388) Length = 1194 Score = 46.1 bits (23), Expect = 0.12 Identities = 95/119 (79%) Strand = Plus / Minus Query: 273 gcagggcccttgcggattctgccagagatgtcgtagtgggagccatggcacgggcagaac 332 ||||||||||| | ||| ||||||||| ||| ||||| || |||||||| ||||| | Sbjct: 837 gcagggcccttcctgatcctgccagaggcgtcatagtgtgacccatggcaggggcaataa 778 Query: 333 caaccaccaaagtctccagagttgggaagggggatgcaaccaagatgagtgcagacacc 391 | |||||||| ||||| | ||| | || ||| | |||||||||||||| |||||||| Sbjct: 777 tagccaccaaaatctcctgcgtttgcaatgggtacacaaccaagatgagtacagacacc 719
>ref|XM_654818.1| Aspergillus nidulans FGSC A4 hypothetical protein (AN2306.2), mRNA Length = 717 Score = 44.1 bits (22), Expect = 0.45 Identities = 34/38 (89%) Strand = Plus / Minus Query: 297 gagatgtcgtagtgggagccatggcacgggcagaacca 334 ||||| |||||||| || |||||||| ||||||||||| Sbjct: 629 gagatatcgtagtgcgaaccatggcaggggcagaacca 592
>gb|AY558341.1| Saccharomyces cerevisiae clone FLH111526.01X YEL024W gene, complete cds Length = 648 Score = 44.1 bits (22), Expect = 0.45 Identities = 61/74 (82%) Strand = Plus / Minus Query: 270 ggggcagggcccttgcggattctgccagagatgtcgtagtgggagccatggcacgggcag 329 |||||||| ||||| | |||||| || || || || || || || |||||||| || ||| Sbjct: 590 ggggcaggtccctttctgattctaccggaaatatcataatgtgaaccatggcaaggacag 531 Query: 330 aaccaaccaccaaa 343 |||||||||||||| Sbjct: 530 aaccaaccaccaaa 517
>ref|XM_754879.1| Ustilago maydis 521 hypothetical protein (UM03825.1) partial mRNA Length = 1236 Score = 44.1 bits (22), Expect = 0.45 Identities = 43/50 (86%) Strand = Plus / Minus Query: 297 gagatgtcgtagtgggagccatggcacgggcagaaccaaccaccaaagtc 346 |||||||||||||| || || ||||| |||||| |||| || |||||||| Sbjct: 1145 gagatgtcgtagtgcgaaccgtggcaagggcagtaccagccgccaaagtc 1096
>ref|XM_385427.1| Gibberella zeae PH-1 chromosome 3 hypothetical protein (FG05251.1) partial mRNA Length = 708 Score = 44.1 bits (22), Expect = 0.45 Identities = 43/50 (86%) Strand = Plus / Minus Query: 288 attctgccagagatgtcgtagtgggagccatggcacgggcagaaccaacc 337 |||| ||| ||||| |||||||| || || ||||| |||||||||||||| Sbjct: 629 attcggccggagatatcgtagtgagaaccgtggcaagggcagaaccaacc 580
>emb|AL022104.2|SPBC16H5 S.pombe chromosome II cosmid c16H5 Length = 35660 Score = 44.1 bits (22), Expect = 0.45 Identities = 25/26 (96%) Strand = Plus / Plus Query: 369 caaccaagatgagtgcagacaccaat 394 |||||||||||||| ||||||||||| Sbjct: 20415 caaccaagatgagtacagacaccaat 20440
>dbj|AK221073.1| Arabidopsis thaliana mRNA for ubiquinol--cytochrome-c reductase -like protein, partial cds, clone: RAFL22-79-D17 Length = 414 Score = 44.1 bits (22), Expect = 0.45 Identities = 133/170 (78%) Strand = Plus / Minus Query: 231 tcttccaagaaactgtaggtgggcacctcaaggttgtacggggcagggcccttgcggatt 290 ||||||| ||| |||||||| || || || |||||||| || ||||| || || | ||| Sbjct: 217 tcttccaggaagctgtaggttggtacttccaggttgtatggtgcaggacctttcctaatt 158 Query: 291 ctgccagagatgtcgtagtgggagccatggcacgggcagaaccaaccaccaaagtctcca 350 || ||||| || ||||| || || || || ||||| || |||||||||||| | || ||| Sbjct: 157 cttccagatatatcgtaatgtgatccgtgacacggacaaaaccaaccaccataatcacca 98 Query: 351 gagttgggaagggggatgcaaccaagatgagtgcagacaccaataaccac 400 | || || | ||||||||| || | ||||||||| || |||| |||||| Sbjct: 97 gcattaggcaaggggatgcaccccaaatgagtgcacactccaacaaccac 48
>ref|NM_001021849.1| Schizosaccharomyces pombe 972h- hypothetical protein (SPBC16H5.06), partial mRNA Length = 687 Score = 44.1 bits (22), Expect = 0.45 Identities = 25/26 (96%) Strand = Plus / Minus Query: 369 caaccaagatgagtgcagacaccaat 394 |||||||||||||| ||||||||||| Sbjct: 530 caaccaagatgagtacagacaccaat 505
>emb|AL116266.1|CNS01D1U Botrytis cinerea strain T4 cDNA library Length = 720 Score = 44.1 bits (22), Expect = 0.45 Identities = 52/62 (83%) Strand = Plus / Minus Query: 372 ccaagatgagtgcagacaccaataaccaccagccactctgggttcttcacacgctcagcg 431 |||||||| ||||||||||||| | |||| ||| ||||| ||||| ||||| |||||| Sbjct: 260 ccaagatgtgtgcagacaccaaccatgaccaaccattctggcttcttaacacggtcagcg 201 Query: 432 tc 433 || Sbjct: 200 tc 199
>emb|AL114037.1|CNS01BBX Botrytis cinerea strain T4 cDNA library Length = 480 Score = 44.1 bits (22), Expect = 0.45 Identities = 52/62 (83%) Strand = Plus / Minus Query: 372 ccaagatgagtgcagacaccaataaccaccagccactctgggttcttcacacgctcagcg 431 |||||||| ||||||||||||| | |||| ||| ||||| ||||| ||||| |||||| Sbjct: 164 ccaagatgtgtgcagacaccaaccatgaccaaccattctggcttcttaacacggtcagcg 105 Query: 432 tc 433 || Sbjct: 104 tc 103
>emb|AL113155.1|CNS01ANF Botrytis cinerea strain T4 cDNA library Length = 780 Score = 44.1 bits (22), Expect = 0.45 Identities = 52/62 (83%) Strand = Plus / Minus Query: 372 ccaagatgagtgcagacaccaataaccaccagccactctgggttcttcacacgctcagcg 431 |||||||| ||||||||||||| | |||| ||| ||||| ||||| ||||| |||||| Sbjct: 273 ccaagatgtgtgcagacaccaaccatgaccaaccattctggcttcttaacacggtcagcg 214 Query: 432 tc 433 || Sbjct: 213 tc 212
>emb|AL111908.1|CNS019OS Botrytis cinerea strain T4 cDNA library Length = 480 Score = 44.1 bits (22), Expect = 0.45 Identities = 52/62 (83%) Strand = Plus / Minus Query: 372 ccaagatgagtgcagacaccaataaccaccagccactctgggttcttcacacgctcagcg 431 |||||||| ||||||||||||| | |||| ||| ||||| ||||| ||||| |||||| Sbjct: 151 ccaagatgtgtgcagacaccaaccatgaccaaccattctggcttcttaacacggtcagcg 92 Query: 432 tc 433 || Sbjct: 91 tc 90
>gb|U18530.1|SCE9871 Saccharomyces cerevisiae chromosome V cosmids 9871, 8199, 9867, 9495 and lambda clones 6693 and 5898 Length = 62643 Score = 44.1 bits (22), Expect = 0.45 Identities = 61/74 (82%) Strand = Plus / Minus Query: 270 ggggcagggcccttgcggattctgccagagatgtcgtagtgggagccatggcacgggcag 329 |||||||| ||||| | |||||| || || || || || || || |||||||| || ||| Sbjct: 18255 ggggcaggtccctttctgattctaccggaaatatcataatgtgaaccatggcaaggacag 18196 Query: 330 aaccaaccaccaaa 343 |||||||||||||| Sbjct: 18195 aaccaaccaccaaa 18182
>gb|AE004857.1| Pseudomonas aeruginosa PAO1, section 418 of 529 of the complete genome Length = 10948 Score = 44.1 bits (22), Expect = 0.45 Identities = 28/30 (93%) Strand = Plus / Plus Query: 302 gtcgtagtgggagccatggcacgggcagaa 331 ||||||||||||||| ||||| |||||||| Sbjct: 8029 gtcgtagtgggagccgtggcaagggcagaa 8058
>gb|U40480.1|SPU40480 Schizosaccharomyces pombe Rieske iron-sulfur protein (Rip1) mRNA, complete cds Length = 746 Score = 44.1 bits (22), Expect = 0.45 Identities = 25/26 (96%) Strand = Plus / Minus Query: 369 caaccaagatgagtgcagacaccaat 394 |||||||||||||| ||||||||||| Sbjct: 584 caaccaagatgagtacagacaccaat 559
>gb|M24500.1|YSCRIP1A S.cerevisiae Rieske iron-sulfur protein (RIP1) gene, complete cds Length = 1238 Score = 44.1 bits (22), Expect = 0.45 Identities = 61/74 (82%) Strand = Plus / Minus Query: 270 ggggcagggcccttgcggattctgccagagatgtcgtagtgggagccatggcacgggcag 329 |||||||| ||||| | |||||| || || || || || || || |||||||| || ||| Sbjct: 912 ggggcaggtccctttctgattctaccggaaatatcataatgtgaaccatggcaaggacag 853 Query: 330 aaccaaccaccaaa 343 |||||||||||||| Sbjct: 852 aaccaaccaccaaa 839
>gb|M23316.1|YSCRIP1 Yeast (S.cerevisiae; DC5) Rieske iron-sulfur protein gene, complete cds Length = 1238 Score = 44.1 bits (22), Expect = 0.45 Identities = 61/74 (82%) Strand = Plus / Minus Query: 270 ggggcagggcccttgcggattctgccagagatgtcgtagtgggagccatggcacgggcag 329 |||||||| ||||| | |||||| || || || || || || || |||||||| || ||| Sbjct: 912 ggggcaggtccctttctgattctaccggaaatatcataatgtgaaccatggcaaggacag 853 Query: 330 aaccaaccaccaaa 343 |||||||||||||| Sbjct: 852 aaccaaccaccaaa 839
>gb|DQ213880.1| Taeniopygia guttata clone 0058P0044G07 ubiquinol-cytochrome c reductase variant 2-like mRNA, complete sequence Length = 1028 Score = 42.1 bits (21), Expect = 1.8 Identities = 48/57 (84%) Strand = Plus / Minus Query: 273 gcagggcccttgcggattctgccagagatgtcgtagtgggagccatggcacgggcag 329 |||||||| || | ||| ||||||||| ||| ||||||||||| ||||| |||||| Sbjct: 776 gcagggcctttcctgatcctgccagaggcgtcatagtgggagccgtggcaggggcag 720
>gb|AE014291.4| Brucella suis 1330 chromosome I, complete sequence Length = 2107794 Score = 42.1 bits (21), Expect = 1.8 Identities = 30/33 (90%) Strand = Plus / Plus Query: 312 gagccatggcacgggcagaaccaaccaccaaag 344 ||||||||||| ||||||||||| || |||||| Sbjct: 1492402 gagccatggcaagggcagaaccagccgccaaag 1492434
>emb|AL365215.23| Human DNA sequence from clone RP11-416D8 on chromosome 10 Contains the 5' end of the RSU1 gene for Ras suppressor protein 1, the 3' end of the CUBN gene for cubilin (intrinsic factor-cobalamin receptor) and a CpG island, complete sequence Length = 184703 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 101 gatagtcctgaaacaaaaact 121 ||||||||||||||||||||| Sbjct: 8605 gatagtcctgaaacaaaaact 8625
>emb|AL162455.14| Human DNA sequence from clone RP11-62D23 on chromosome 13 Contains part of the GPC6 gene for glypican 6 and a novel gene, complete sequence Length = 173736 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 228 ttatcttccaagaaactgtag 248 ||||||||||||||||||||| Sbjct: 64421 ttatcttccaagaaactgtag 64401
>emb|AL626770.9| Mouse DNA sequence from clone RP23-379J18 on chromosome 11 Contains a novel gene and a serine/arginine repetitive matrix 1 (Srrm1) pseudogene, complete sequence Length = 188854 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 154 acaggaattcactcctgtgga 174 ||||||||||||||||||||| Sbjct: 42009 acaggaattcactcctgtgga 42029
>gb|AC160031.8| Mus musculus 10 BAC RP24-395H7 (Roswell Park Cancer Institute (C57BL/6J Male) Mouse BAC Library) complete sequence Length = 191028 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 155 caggaattcactcctgtggag 175 ||||||||||||||||||||| Sbjct: 129345 caggaattcactcctgtggag 129325
>gb|AE009490.1| Brucella melitensis 16M chromosome I, section 47 of 195 of the complete sequence Length = 11036 Score = 42.1 bits (21), Expect = 1.8 Identities = 30/33 (90%) Strand = Plus / Minus Query: 312 gagccatggcacgggcagaaccaaccaccaaag 344 ||||||||||| ||||||||||| || |||||| Sbjct: 626 gagccatggcaagggcagaaccagccgccaaag 594
>gb|AF035964.1|AF035964 Brucella abortus tRNA/rRNA methyltransferase (yibK), ATP-binding protein A (bapA), ATP-binding protein B (bapB), and Rieske Fe-S protein genes, complete cds; and cytochrome b gene, partial cds Length = 5692 Score = 42.1 bits (21), Expect = 1.8 Identities = 30/33 (90%) Strand = Plus / Minus Query: 312 gagccatggcacgggcagaaccaaccaccaaag 344 ||||||||||| ||||||||||| || |||||| Sbjct: 5224 gagccatggcaagggcagaaccagccgccaaag 5192
>gb|AE017223.1| Brucella abortus biovar 1 str. 9-941 chromosome I, complete sequence Length = 2124241 Score = 42.1 bits (21), Expect = 1.8 Identities = 30/33 (90%) Strand = Plus / Plus Query: 312 gagccatggcacgggcagaaccaaccaccaaag 344 ||||||||||| ||||||||||| || |||||| Sbjct: 1510465 gagccatggcaagggcagaaccagccgccaaag 1510497
>emb|CT033644.1| Platynereis dumerilii EST IB0AAA16DC02EM1 Length = 957 Score = 42.1 bits (21), Expect = 1.8 Identities = 27/29 (93%) Strand = Plus / Minus Query: 270 ggggcagggcccttgcggattctgccaga 298 ||||| || |||||||||||||||||||| Sbjct: 804 ggggcgggtcccttgcggattctgccaga 776
>emb|CT033533.1| Platynereis dumerilii EST IB0AAA18DC05EM1 Length = 864 Score = 42.1 bits (21), Expect = 1.8 Identities = 27/29 (93%) Strand = Plus / Minus Query: 270 ggggcagggcccttgcggattctgccaga 298 ||||| || |||||||||||||||||||| Sbjct: 826 ggggcgggtcccttgcggattctgccaga 798
>emb|CT033153.1| Platynereis dumerilii EST IB0AAA25DC05EM1 Length = 915 Score = 42.1 bits (21), Expect = 1.8 Identities = 27/29 (93%) Strand = Plus / Minus Query: 270 ggggcagggcccttgcggattctgccaga 298 ||||| || |||||||||||||||||||| Sbjct: 793 ggggcgggtcccttgcggattctgccaga 765
>emb|AM040264.1| Brucella melitensis biovar Abortus chromosome I, complete sequence, strain 2308 Length = 2121359 Score = 42.1 bits (21), Expect = 1.8 Identities = 30/33 (90%) Strand = Plus / Plus Query: 312 gagccatggcacgggcagaaccaaccaccaaag 344 ||||||||||| ||||||||||| || |||||| Sbjct: 1507619 gagccatggcaagggcagaaccagccgccaaag 1507651
>gb|AC005591.1| Homo sapiens chromosome 16, P1 clone 94-10H (LANL), complete sequence Length = 78941 Score = 40.1 bits (20), Expect = 7.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 310 gggagccatggcacgggcag 329 |||||||||||||||||||| Sbjct: 11633 gggagccatggcacgggcag 11652
>gb|BC020241.1| Homo sapiens cDNA clone IMAGE:4661475, with apparent retained intron Length = 1928 Score = 40.1 bits (20), Expect = 7.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 310 gggagccatggcacgggcag 329 |||||||||||||||||||| Sbjct: 770 gggagccatggcacgggcag 751
>emb|CR769784.10| Zebrafish DNA sequence from clone DKEY-3N10 in linkage group 1, complete sequence Length = 230420 Score = 40.1 bits (20), Expect = 7.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 33 caacataggagaaacaatta 52 |||||||||||||||||||| Sbjct: 131528 caacataggagaaacaatta 131547
>gb|AC092117.4| Homo sapiens chromosome 16 clone CTD-2270P14, complete sequence Length = 211606 Score = 40.1 bits (20), Expect = 7.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 310 gggagccatggcacgggcag 329 |||||||||||||||||||| Sbjct: 33751 gggagccatggcacgggcag 33732
>gb|AC141586.2| Homo sapiens chromosome 16 clone CTD-3126B10, complete sequence Length = 127397 Score = 40.1 bits (20), Expect = 7.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 310 gggagccatggcacgggcag 329 |||||||||||||||||||| Sbjct: 108203 gggagccatggcacgggcag 108184 Score = 40.1 bits (20), Expect = 7.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 310 gggagccatggcacgggcag 329 |||||||||||||||||||| Sbjct: 23035 gggagccatggcacgggcag 23054
>emb|CR752649.9| Zebrafish DNA sequence from clone DKEY-238J13, complete sequence Length = 164233 Score = 40.1 bits (20), Expect = 7.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 228 ttatcttccaagaaactgta 247 |||||||||||||||||||| Sbjct: 25582 ttatcttccaagaaactgta 25601
>emb|AL607026.11| Human DNA sequence from clone RP11-498G22 on chromosome 10, complete sequence Length = 172911 Score = 40.1 bits (20), Expect = 7.1 Identities = 27/28 (96%), Gaps = 1/28 (3%) Strand = Plus / Minus Query: 113 acaaaaactcctagccacattgagaaca 140 |||||||||||||| ||||||||||||| Sbjct: 165704 acaaaaactcctag-cacattgagaaca 165678
>emb|CR388002.6| Zebrafish DNA sequence from clone DKEY-75M8 in linkage group 1, complete sequence Length = 228120 Score = 40.1 bits (20), Expect = 7.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 33 caacataggagaaacaatta 52 |||||||||||||||||||| Sbjct: 162277 caacataggagaaacaatta 162258
>gb|CP000087.1| Rickettsia bellii RML369-C, complete genome Length = 1522076 Score = 40.1 bits (20), Expect = 7.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 315 ccatggcacgggcagaacca 334 |||||||||||||||||||| Sbjct: 913996 ccatggcacgggcagaacca 913977
>emb|X05630.1|RCPETG Rhodopseudomonas capsulata petABC operon Length = 4007 Score = 40.1 bits (20), Expect = 7.1 Identities = 29/32 (90%) Strand = Plus / Minus Query: 303 tcgtagtgggagccatggcacgggcagaacca 334 |||||||| ||||| ||||| ||||||||||| Sbjct: 1213 tcgtagtgcgagccgtggcaggggcagaacca 1182
>emb|X05799.1|PDBC1 P. denitrificans bc1 gene for cytochrome bc1 complex (EC 1.10.2.2) Length = 3840 Score = 40.1 bits (20), Expect = 7.1 Identities = 44/52 (84%) Strand = Plus / Minus Query: 283 tgcggattctgccagagatgtcgtagtgggagccatggcacgggcagaacca 334 ||||||| | ||| ||| ||||||| || || || ||||||||||||||||| Sbjct: 746 tgcggatgcggcccgaggtgtcgtaatgcgacccgtggcacgggcagaacca 695
>emb|X03476.1|RCFBC Rhodopseudomonas sphaeroides fbc operon (fbcF, fbcB, fbcC genes) Length = 3874 Score = 40.1 bits (20), Expect = 7.1 Identities = 29/32 (90%) Strand = Plus / Minus Query: 303 tcgtagtgggagccatggcacgggcagaacca 334 |||||||| ||||| ||||| ||||||||||| Sbjct: 1324 tcgtagtgcgagccgtggcaggggcagaacca 1293
>emb|AL645564.6| Mouse DNA sequence from clone RP23-35N22 on chromosome 11 Contains part of a novel gene and two CpG islands, complete sequence Length = 205101 Score = 40.1 bits (20), Expect = 7.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 325 ggcagaaccaaccaccaaag 344 |||||||||||||||||||| Sbjct: 157990 ggcagaaccaaccaccaaag 157971
>emb|BX511162.8| Zebrafish DNA sequence from clone DKEY-240B22 in linkage group 1, complete sequence Length = 119612 Score = 40.1 bits (20), Expect = 7.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 33 caacataggagaaacaatta 52 |||||||||||||||||||| Sbjct: 16850 caacataggagaaacaatta 16869
>emb|BX323017.6| Zebrafish DNA sequence from clone DKEYP-41F9, complete sequence Length = 141192 Score = 40.1 bits (20), Expect = 7.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 33 caacataggagaaacaatta 52 |||||||||||||||||||| Sbjct: 33822 caacataggagaaacaatta 33841
>emb|AJ785968.1| Homo sapiens mRNA for PDPK2 protein Length = 2387 Score = 40.1 bits (20), Expect = 7.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 310 gggagccatggcacgggcag 329 |||||||||||||||||||| Sbjct: 617 gggagccatggcacgggcag 636
>gb|AC068308.12| Homo sapiens 3 BAC RP11-275H4 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 154495 Score = 40.1 bits (20), Expect = 7.1 Identities = 23/24 (95%) Strand = Plus / Minus Query: 16 aacttacaatccagtagcaacata 39 ||||||||||||||||||| |||| Sbjct: 38798 aacttacaatccagtagcaccata 38775
>gb|AC068892.7| Homo sapiens chromosome 10 clone RP11-116D21, complete sequence Length = 161178 Score = 40.1 bits (20), Expect = 7.1 Identities = 27/28 (96%), Gaps = 1/28 (3%) Strand = Plus / Plus Query: 113 acaaaaactcctagccacattgagaaca 140 |||||||||||||| ||||||||||||| Sbjct: 131607 acaaaaactcctag-cacattgagaaca 131633
>ref|XM_496112.2| PREDICTED: Homo sapiens similar to 3-phosphoinositide dependent protein kinase 1 (hPDK1), transcript variant 1 (LOC653650), mRNA Length = 2396 Score = 40.1 bits (20), Expect = 7.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 310 gggagccatggcacgggcag 329 |||||||||||||||||||| Sbjct: 632 gggagccatggcacgggcag 651
>ref|XM_935349.1| PREDICTED: Homo sapiens similar to 3-phosphoinositide dependent protein kinase 1 (hPDK1), transcript variant 5 (LOC653650), mRNA Length = 2595 Score = 40.1 bits (20), Expect = 7.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 310 gggagccatggcacgggcag 329 |||||||||||||||||||| Sbjct: 632 gggagccatggcacgggcag 651
>ref|XM_935348.1| PREDICTED: Homo sapiens similar to 3-phosphoinositide dependent protein kinase 1 (hPDK1), transcript variant 4 (LOC653650), mRNA Length = 1786 Score = 40.1 bits (20), Expect = 7.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 310 gggagccatggcacgggcag 329 |||||||||||||||||||| Sbjct: 632 gggagccatggcacgggcag 651
>gb|BC002659.1|BC002659 Homo sapiens, clone IMAGE:3609437, mRNA Length = 1254 Score = 40.1 bits (20), Expect = 7.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 310 gggagccatggcacgggcag 329 |||||||||||||||||||| Sbjct: 81 gggagccatggcacgggcag 62
>ref|XM_394267.2| PREDICTED: Apis mellifera similar to ENSANGP00000026211 (LOC410791), mRNA Length = 2127 Score = 40.1 bits (20), Expect = 7.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 138 acaaaataacagcgcaacag 157 |||||||||||||||||||| Sbjct: 2088 acaaaataacagcgcaacag 2069
>gb|AC092577.3| Homo sapiens BAC clone RP11-12E5 from 4, complete sequence Length = 73928 Score = 40.1 bits (20), Expect = 7.1 Identities = 23/24 (95%) Strand = Plus / Minus Query: 10 caaagtaacttacaatccagtagc 33 |||||||||||| ||||||||||| Sbjct: 11132 caaagtaacttataatccagtagc 11109
>gb|AC093517.3| Homo sapiens chromosome 16 clone CTD-2593F12, complete sequence Length = 160606 Score = 40.1 bits (20), Expect = 7.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 310 gggagccatggcacgggcag 329 |||||||||||||||||||| Sbjct: 27171 gggagccatggcacgggcag 27152
>gb|AC093525.3| Homo sapiens chromosome 16 clone RP11-20I23, complete sequence Length = 157518 Score = 40.1 bits (20), Expect = 7.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 310 gggagccatggcacgggcag 329 |||||||||||||||||||| Sbjct: 35728 gggagccatggcacgggcag 35709
>dbj|AK197173.1| Mus musculus cDNA, clone:Y1G0124E03, strand:minus, reference:ENSEMBL:Mouse-Transcript- ENST:ENSMUST00000042834, based on BLAT search Length = 382 Score = 40.1 bits (20), Expect = 7.1 Identities = 47/56 (83%) Strand = Plus / Minus Query: 273 gcagggcccttgcggattctgccagagatgtcgtagtgggagccatggcacgggca 328 ||||||||||| | ||| ||||||||| ||| ||||| || |||||||| ||||| Sbjct: 313 gcagggcccttcctgatcctgccagaggcgtcatagtgtgacccatggcaggggca 258
>dbj|AK191429.1| Mus musculus cDNA, clone:Y1G0105N20, strand:minus, reference:ENSEMBL:Mouse-Transcript- ENST:ENSMUST00000042834, based on BLAT search Length = 408 Score = 40.1 bits (20), Expect = 7.1 Identities = 47/56 (83%) Strand = Plus / Minus Query: 273 gcagggcccttgcggattctgccagagatgtcgtagtgggagccatggcacgggca 328 ||||||||||| | ||| ||||||||| ||| ||||| || |||||||| ||||| Sbjct: 339 gcagggcccttcctgatcctgccagaggcgtcatagtgtgacccatggcaggggca 284
>dbj|AP006850.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, fosmid clone:OSJNOa257A21 Length = 34833 Score = 40.1 bits (20), Expect = 7.1 Identities = 23/24 (95%) Strand = Plus / Plus Query: 2 aatcagtacaaagtaacttacaat 25 ||||| |||||||||||||||||| Sbjct: 32111 aatcaatacaaagtaacttacaat 32134
>dbj|AP005845.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P0461D06 Length = 112895 Score = 40.1 bits (20), Expect = 7.1 Identities = 23/24 (95%) Strand = Plus / Plus Query: 2 aatcagtacaaagtaacttacaat 25 ||||| |||||||||||||||||| Sbjct: 11402 aatcaatacaaagtaacttacaat 11425
>gb|AC150478.3| Monodelphis domestica clone VMRC6-508P4, complete sequence Length = 81497 Score = 40.1 bits (20), Expect = 7.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 334 aaccaccaaagtctccagag 353 |||||||||||||||||||| Sbjct: 13995 aaccaccaaagtctccagag 13976
>gb|AC147872.3| Monodelphis domestica clone VMRC6-555H19, complete sequence Length = 139145 Score = 40.1 bits (20), Expect = 7.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 334 aaccaccaaagtctccagag 353 |||||||||||||||||||| Sbjct: 130009 aaccaccaaagtctccagag 129990
>emb|BX323453.7| Zebrafish DNA sequence from clone CH211-212G2 in linkage group 22, complete sequence Length = 212160 Score = 40.1 bits (20), Expect = 7.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 33 caacataggagaaacaatta 52 |||||||||||||||||||| Sbjct: 153279 caacataggagaaacaatta 153298
>emb|AL138478.3|CNS01DWR Human chromosome 14 DNA sequence BAC R-681H18 of library RPCI-11 from chromosome 14 of Homo sapiens (Human), complete sequence Length = 188717 Score = 40.1 bits (20), Expect = 7.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 345 tctccagagttgggaagggg 364 |||||||||||||||||||| Sbjct: 152301 tctccagagttgggaagggg 152320
>emb|CR812957.13| Zebrafish DNA sequence from clone DKEY-41L5 in linkage group 1, complete sequence Length = 220462 Score = 40.1 bits (20), Expect = 7.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 33 caacataggagaaacaatta 52 |||||||||||||||||||| Sbjct: 170932 caacataggagaaacaatta 170913
>emb|AL954329.7| Zebrafish DNA sequence from clone CH211-226C11 in linkage group 23, complete sequence Length = 194284 Score = 40.1 bits (20), Expect = 7.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 33 caacataggagaaacaatta 52 |||||||||||||||||||| Sbjct: 11111 caacataggagaaacaatta 11092
>gb|DP000021.1| Monodelphis domestica target 1 genomic scaffold Length = 1833844 Score = 40.1 bits (20), Expect = 7.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 334 aaccaccaaagtctccagag 353 |||||||||||||||||||| Sbjct: 1766342 aaccaccaaagtctccagag 1766323
>emb|AL137785.6|CNS01DWN Human chromosome 14 DNA sequence BAC R-151G14 of library RPCI-11 from chromosome 14 of Homo sapiens (Human), complete sequence Length = 155729 Score = 40.1 bits (20), Expect = 7.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 345 tctccagagttgggaagggg 364 |||||||||||||||||||| Sbjct: 77128 tctccagagttgggaagggg 77109
>gb|M17522.1|PDEBC1 P.denitrificans bc1 operon genes encoding three subunits (FeS, b and c1) of the cytochrome bc1 complex, complete cds Length = 3840 Score = 40.1 bits (20), Expect = 7.1 Identities = 44/52 (84%) Strand = Plus / Minus Query: 283 tgcggattctgccagagatgtcgtagtgggagccatggcacgggcagaacca 334 ||||||| | ||| ||| ||||||| || || || ||||||||||||||||| Sbjct: 746 tgcggatgcggcccgaggtgtcgtaatgcgacccgtggcacgggcagaacca 695 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 4,631,775 Number of Sequences: 3902068 Number of extensions: 4631775 Number of successful extensions: 78904 Number of sequences better than 10.0: 161 Number of HSP's better than 10.0 without gapping: 155 Number of HSP's successfully gapped in prelim test: 6 Number of HSP's that attempted gapping in prelim test: 78433 Number of HSP's gapped (non-prelim): 470 length of query: 525 length of database: 17,233,045,268 effective HSP length: 23 effective length of query: 502 effective length of database: 17,143,297,704 effective search space: 8605935447408 effective search space used: 8605935447408 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)