Clone Name	rbags18j06
Clone Library Name	barley_pub

---

No.	Definition	Score (bits)	E Value
1	tpg|BK005644.1| TPA: TPA_inf: Triticum aestivum histidine-contai...	444	e-121
2	gb|AY109584.1| Zea mays CL2436_1 mRNA sequence	313	3e-82
3	gb|BT018238.1| Zea mays clone EL01N0563B05.c mRNA sequence	311	1e-81
4	gb|M77224.1|MZERFESPA Zea mays mitochondrial Rieske Fe-S protein...	311	1e-81
5	gb|BT017520.1| Zea mays clone EL01N0421A02.c mRNA sequence	291	1e-75
6	dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic D...	276	7e-71
7	dbj|AK059519.1| Oryza sativa (japonica cultivar-group) cDNA clon...	276	7e-71
8	emb|AL731591.3|OSJN00240 Oryza sativa genomic DNA, chromosome 4,...	276	7e-71
9	ref|XM_472343.1| Oryza sativa (japonica cultivar-group), predic...	264	3e-67
10	gb|AY105531.1| Zea mays PCO113958 mRNA sequence	228	1e-56
11	gb|BT014059.1| Lycopersicon esculentum clone 133157F, mRNA sequence	123	6e-25
12	ref|XM_466001.1| Oryza sativa (japonica cultivar-group), mRNA	119	1e-23
13	gb|DQ207870.1| Solanum tuberosum clone 087E11 rieske iron-sulfur...	119	1e-23
14	dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D...	119	1e-23
15	dbj|AP005842.3| Oryza sativa (japonica cultivar-group) genomic D...	119	1e-23
16	dbj|AP005749.3| Oryza sativa (japonica cultivar-group) genomic D...	119	1e-23
17	dbj|AK102815.1| Oryza sativa (japonica cultivar-group) cDNA clon...	119	1e-23
18	gb|L16813.1|TOBFESD Nicotiana tabacum clone 32.10 Rieske iron-su...	115	1e-22
19	emb|X79332.1|STFES1G S.tuberosum (Desiree) FeS1 mRNA for Rieske ...	111	2e-21
20	gb|M77225.1|TOBRFESP Nicotiana tabacum mitochondrial Rieske Fe-S...	109	9e-21
21	gb|L16812.1|TOBFESC Nicotiana tabacum clone 36.14 Rieske iron-su...	105	1e-19
22	gb|L16810.1|TOBFESA Nicotiana tabacum clone 17.12 Rieske iron-su...	105	1e-19
23	gb|AY085370.1| Arabidopsis thaliana clone 1482 mRNA, complete se...	105	1e-19
24	gb|L16811.1|TOBFESB Nicotiana tabacum clone 8.8 Rieske iron-sulf...	103	6e-19
25	ref|NM_121346.2| Arabidopsis thaliana oxidoreductase/ ubiquinol-...	101	2e-18
26	emb|AL163572.1|ATT22N19 Arabidopsis thaliana DNA chromosome 5, B...	101	2e-18
27	gb|AF375413.1| Arabidopsis thaliana AT5g13430/T22N19_80 mRNA, co...	101	2e-18
28	gb|AY066055.1| Arabidopsis thaliana AT5g13430/T22N19_80 mRNA, co...	101	2e-18
29	dbj|AK221169.1| Arabidopsis thaliana mRNA for ubiquinol--cytochr...	101	2e-18
30	emb|BX830387.1|CNS0A1JK Arabidopsis thaliana Full-length cDNA Co...	101	2e-18
31	emb|BX829878.1|CNS0A1B9 Arabidopsis thaliana Full-length cDNA Co...	101	2e-18
32	emb|BX831700.1|CNS0A14K Arabidopsis thaliana Full-length cDNA Co...	101	2e-18
33	ref|NM_121347.3| Arabidopsis thaliana oxidoreductase/ ubiquinol-...	98	4e-17
34	gb|AY081510.1| Arabidopsis thaliana ubiquinol--cytochrome-c redu...	98	4e-17
35	gb|AF370533.1|AF370533 Arabidopsis thaliana ubiquinol--cytochrom...	98	4e-17
36	emb|BX829960.1|CNS0A1KF Arabidopsis thaliana Full-length cDNA Co...	98	4e-17
37	emb|BX833733.1|CNS0A0BW Arabidopsis thaliana Full-length cDNA Co...	98	4e-17
38	gb|AY086148.1| Arabidopsis thaliana clone 21819 mRNA, complete s...	98	4e-17
39	dbj|D21116.1|RICSS126 Oryza sativa mRNA for Rieske Fe-S protein,...	92	2e-15
40	emb|BX829847.1|CNS0A1CH Arabidopsis thaliana Full-length cDNA Co...	90	9e-15
41	emb|BX829679.1|CNS0A1GR Arabidopsis thaliana Full-length cDNA Co...	82	2e-12
42	emb|AJ719669.1| Gallus gallus mRNA for hypothetical protein, clo...	72	2e-09
43	ref|NM_001005843.1| Gallus gallus ubiquinol-cytochrome c reducta...	72	2e-09
44	emb|AJ250370.1|CPA250370 Cyanophora paradoxa partial mRNA for ub...	70	8e-09
45	ref|XM_359684.1| Magnaporthe grisea 70-15 hypothetical protein (...	64	5e-07
46	ref|XM_499709.1| Yarrowia lipolytica CLIB122, YALI0A02915g predi...	62	2e-06
47	emb|X91795.1|CRUCCOR C.reinhardtii mRNa for ubiquinol-cytochrome...	62	2e-06
48	emb|AJ320239.1|CRE320239 Chlamydomonas reinhardtii risp gene for...	62	2e-06
49	emb|CR382127.1| Yarrowia lipolytica chromosome A of strain CLIB1...	62	2e-06
50	emb|BX830982.1|CNS0A0P7 Arabidopsis thaliana Full-length cDNA Co...	60	8e-06
51	gb|AE017345.1| Cryptococcus neoformans var. neoformans JEC21 chr...	58	3e-05
52	ref|XM_570926.1| Cryptococcus neoformans var. neoformans JEC21 u...	58	3e-05
53	dbj|AP007175.1| Aspergillus oryzae RIB40 genomic DNA, SC010	58	3e-05
54	gb|CP000081.1| Leishmania major chromosome 35, complete sequence	56	1e-04
55	ref|XM_460873.1| Debaryomyces hansenii CBS767 hypothetical prote...	56	1e-04
56	ref|XM_838166.1| Leishmania major strain Friedlin reiske iron-su...	56	1e-04
57	emb|CR382138.1| Debaryomyces hansenii chromosome F of strain CBS...	56	1e-04
58	dbj|AP007255.1| Magnetospirillum magneticum AMB-1 DNA, complete ...	56	1e-04
59	gb|AE016818.1| Ashbya gossypii (= Eremothecium gossypii) ATCC 10...	56	1e-04
60	ref|NM_210148.1| Eremothecium gossypii AEL067Wp (AEL067W), mRNA	56	1e-04
61	ref|XM_447387.1| Candida glabrata CBS138 hypothetical protein (C...	54	5e-04
62	emb|CR380955.1| Candida glabrata strain CBS138 chromosome I comp...	54	5e-04
63	dbj|BA000012.4| Mesorhizobium loti MAFF303099 DNA, complete genome	54	5e-04
64	gb|AE005720.1| Caulobacter crescentus CB15 section 46 of 359 of ...	52	0.002
65	gb|CP000031.1| Silicibacter pomeroyi DSS-3, complete genome	50	0.007
66	ref|XM_748490.1| Aspergillus fumigatus Af293 ubiquinol-cytochrom...	50	0.007
67	ref|XM_957255.1| Neurospora crassa OR74A hypothetical protein (N...	48	0.029
68	ref|XM_326460.1| Neurospora crassa OR74A hypothetical protein (N...	48	0.029
69	gb|AC110374.3| Mus musculus BAC clone RP23-293P18 from 15, compl...	48	0.029
70	emb|X02472.1|NCCYRFES Neurospora gene for mitochondrial ubiquino...	48	0.029
71	gb|BC019934.1| Mus musculus ubiquinol-cytochrome c reductase, Ri...	46	0.12
72	gb|BT010222.1| Drosophila melanogaster RH01528 full insert cDNA	46	0.12
73	gb|DQ445508.1| Graphocephala atropunctata isolate WHGA0169 Riesk...	46	0.12
74	emb|AL611944.10| Mouse DNA sequence from clone RP23-279E14 on ch...	46	0.12
75	gb|DQ122922.1| Chlamydomonas incerta mitochondrial ubiquinol-cyt...	46	0.12
76	ref|NM_164426.1| Drosophila melanogaster Rieske iron-sulfur prot...	46	0.12
77	ref|NM_080009.2| Drosophila melanogaster Rieske iron-sulfur prot...	46	0.12
78	dbj|AK152391.1| Mus musculus bone marrow macrophage cDNA, RIKEN ...	46	0.12
79	gb|AC104630.1| Drosophila melanogaster, chromosome 2L, region 22...	46	0.12
80	gb|CP000264.1| Jannaschia sp. CCS1, complete genome	46	0.12
81	dbj|AK153139.1| Mus musculus bone marrow macrophage cDNA, RIKEN ...	46	0.12
82	gb|AC092188.1|AC092188 Drosophila melanogaster, chromosome 2L, r...	46	0.12
83	dbj|AK012180.1| Mus musculus 10 days embryo whole body cDNA, RIK...	46	0.12
84	dbj|AK014470.1| Mus musculus 14 days embryo liver cDNA, RIKEN fu...	46	0.12
85	dbj|AK003966.1| Mus musculus 18-day embryo whole body cDNA, RIKE...	46	0.12
86	ref|NM_025710.1| Mus musculus ubiquinol-cytochrome c reductase, ...	46	0.12
87	dbj|AK217705.1| Mus musculus cDNA, clone:Y2G0142L01, strand:plus...	46	0.12
88	dbj|AK212564.1| Mus musculus cDNA, clone:Y2G0125G04, strand:plus...	46	0.12
89	dbj|AK210928.1| Mus musculus cDNA, clone:Y2G0120B13, strand:minu...	46	0.12
90	dbj|AK180820.1| Mus musculus cDNA, clone:Y0G0116A06, strand:minu...	46	0.12
91	gb|AE003585.5| Drosophila melanogaster chromosome 2L, section 6 ...	46	0.12
92	gb|AC004445.1|AC004445 Drosophila melanogaster DNA sequence (P1 ...	46	0.12
93	gb|BC047125.1| Mus musculus ubiquinol-cytochrome c reductase, Ri...	46	0.12
94	ref|XM_654818.1| Aspergillus nidulans FGSC A4 hypothetical prote...	44	0.45
95	gb|AY558341.1| Saccharomyces cerevisiae clone FLH111526.01X YEL0...	44	0.45
96	ref|XM_754879.1| Ustilago maydis 521 hypothetical protein (UM038...	44	0.45
97	ref|XM_385427.1| Gibberella zeae PH-1 chromosome 3 hypothetical ...	44	0.45
98	emb|AL022104.2|SPBC16H5 S.pombe chromosome II cosmid c16H5	44	0.45
99	dbj|AK221073.1| Arabidopsis thaliana mRNA for ubiquinol--cytochr...	44	0.45
100	ref|NM_001021849.1| Schizosaccharomyces pombe 972h- hypothetical...	44	0.45
101	emb|AL116266.1|CNS01D1U Botrytis cinerea strain T4 cDNA library	44	0.45
102	emb|AL114037.1|CNS01BBX Botrytis cinerea strain T4 cDNA library	44	0.45
103	emb|AL113155.1|CNS01ANF Botrytis cinerea strain T4 cDNA library	44	0.45
104	emb|AL111908.1|CNS019OS Botrytis cinerea strain T4 cDNA library	44	0.45
105	gb|U18530.1|SCE9871 Saccharomyces cerevisiae chromosome V cosmid...	44	0.45
106	gb|AE004857.1| Pseudomonas aeruginosa PAO1, section 418 of 529 o...	44	0.45
107	gb|U40480.1|SPU40480 Schizosaccharomyces pombe Rieske iron-sulfu...	44	0.45
108	gb|M24500.1|YSCRIP1A S.cerevisiae Rieske iron-sulfur protein (RI...	44	0.45
109	gb|M23316.1|YSCRIP1 Yeast (S.cerevisiae; DC5) Rieske iron-sulfur...	44	0.45
110	gb|DQ213880.1| Taeniopygia guttata clone 0058P0044G07 ubiquinol-...	42	1.8
111	gb|AE014291.4| Brucella suis 1330 chromosome I, complete sequence	42	1.8
112	emb|AL365215.23| Human DNA sequence from clone RP11-416D8 on chr...	42	1.8
113	emb|AL162455.14| Human DNA sequence from clone RP11-62D23 on chr...	42	1.8
114	emb|AL626770.9| Mouse DNA sequence from clone RP23-379J18 on chr...	42	1.8
115	gb|AC160031.8| Mus musculus 10 BAC RP24-395H7 (Roswell Park Canc...	42	1.8
116	gb|AE009490.1| Brucella melitensis 16M chromosome I, section 47 ...	42	1.8
117	gb|AF035964.1|AF035964 Brucella abortus tRNA/rRNA methyltransfer...	42	1.8
118	gb|AE017223.1| Brucella abortus biovar 1 str. 9-941 chromosome I...	42	1.8
119	emb|CT033644.1| Platynereis dumerilii EST IB0AAA16DC02EM1	42	1.8
120	emb|CT033533.1| Platynereis dumerilii EST IB0AAA18DC05EM1	42	1.8
121	emb|CT033153.1| Platynereis dumerilii EST IB0AAA25DC05EM1	42	1.8
122	emb|AM040264.1| Brucella melitensis biovar Abortus chromosome I,...	42	1.8
123	gb|AC005591.1| Homo sapiens chromosome 16, P1 clone 94-10H (LANL...	40	7.1
124	gb|BC020241.1| Homo sapiens cDNA clone IMAGE:4661475, with appar...	40	7.1
125	emb|CR769784.10| Zebrafish DNA sequence from clone DKEY-3N10 in ...	40	7.1
126	gb|AC092117.4| Homo sapiens chromosome 16 clone CTD-2270P14, com...	40	7.1
127	gb|AC141586.2| Homo sapiens chromosome 16 clone CTD-3126B10, com...	40	7.1
128	emb|CR752649.9| Zebrafish DNA sequence from clone DKEY-238J13, c...	40	7.1
129	emb|AL607026.11| Human DNA sequence from clone RP11-498G22 on ch...	40	7.1
130	emb|CR388002.6| Zebrafish DNA sequence from clone DKEY-75M8 in l...	40	7.1
131	gb|CP000087.1| Rickettsia bellii RML369-C, complete genome	40	7.1
132	emb|X05630.1|RCPETG Rhodopseudomonas capsulata petABC operon	40	7.1
133	emb|X05799.1|PDBC1 P. denitrificans bc1 gene for cytochrome bc1 ...	40	7.1
134	emb|X03476.1|RCFBC Rhodopseudomonas sphaeroides fbc operon (fbcF...	40	7.1
135	emb|AL645564.6| Mouse DNA sequence from clone RP23-35N22 on chro...	40	7.1
136	emb|BX511162.8| Zebrafish DNA sequence from clone DKEY-240B22 in...	40	7.1
137	emb|BX323017.6| Zebrafish DNA sequence from clone DKEYP-41F9, co...	40	7.1
138	emb|AJ785968.1| Homo sapiens mRNA for PDPK2 protein	40	7.1
139	gb|AC068308.12| Homo sapiens 3 BAC RP11-275H4 (Roswell Park Canc...	40	7.1
140	gb|AC068892.7| Homo sapiens chromosome 10 clone RP11-116D21, com...	40	7.1
141	ref|XM_496112.2| PREDICTED: Homo sapiens similar to 3-phosphoino...	40	7.1
142	ref|XM_935349.1| PREDICTED: Homo sapiens similar to 3-phosphoino...	40	7.1
143	ref|XM_935348.1| PREDICTED: Homo sapiens similar to 3-phosphoino...	40	7.1
144	gb|BC002659.1|BC002659 Homo sapiens, clone IMAGE:3609437, mRNA	40	7.1
145	ref|XM_394267.2| PREDICTED: Apis mellifera similar to ENSANGP000...	40	7.1
146	gb|AC092577.3| Homo sapiens BAC clone RP11-12E5 from 4, complete...	40	7.1
147	gb|AC093517.3| Homo sapiens chromosome 16 clone CTD-2593F12, com...	40	7.1
148	gb|AC093525.3| Homo sapiens chromosome 16 clone RP11-20I23, comp...	40	7.1
149	dbj|AK197173.1| Mus musculus cDNA, clone:Y1G0124E03, strand:minu...	40	7.1
150	dbj|AK191429.1| Mus musculus cDNA, clone:Y1G0105N20, strand:minu...	40	7.1
151	dbj|AP006850.2| Oryza sativa (japonica cultivar-group) genomic D...	40	7.1
152	dbj|AP005845.2| Oryza sativa (japonica cultivar-group) genomic D...	40	7.1
153	gb|AC150478.3| Monodelphis domestica clone VMRC6-508P4, complete...	40	7.1
154	gb|AC147872.3| Monodelphis domestica clone VMRC6-555H19, complet...	40	7.1
155	emb|BX323453.7| Zebrafish DNA sequence from clone CH211-212G2 in...	40	7.1
156	emb|AL138478.3|CNS01DWR Human chromosome 14 DNA sequence BAC R-6...	40	7.1
157	emb|CR812957.13| Zebrafish DNA sequence from clone DKEY-41L5 in ...	40	7.1
158	emb|AL954329.7| Zebrafish DNA sequence from clone CH211-226C11 i...	40	7.1
159	gb|DP000021.1| Monodelphis domestica target 1 genomic scaffold	40	7.1
160	emb|AL137785.6|CNS01DWN Human chromosome 14 DNA sequence BAC R-1...	40	7.1
161	gb|M17522.1|PDEBC1 P.denitrificans bc1 operon genes encoding thr...	40	7.1

---

>tpg|BK005644.1| TPA: TPA_inf: Triticum aestivum histidine-containing
           phosphotransfer protein 2 (HP) mRNA, complete cds
          Length = 1212

 Score =  444 bits (224), Expect = e-121
 Identities = 255/264 (96%), Gaps = 1/264 (0%)
 Strand = Plus / Plus

                                                                       
Query: 1   aaatcagtacaaagtaacttacaatccagtagcaacataggagaaacaattatttcgcac 60
           ||||||||| |||  |||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 88  aaatcagtataaaacaacttacaatccagtagcaacataggagaaacaattatttcgcac 147

                                                                       
Query: 61  tgcaaatgaacttcagtaggtaacagtggatcaccattgtgatagtcctgaaacaaaaac 120
           ||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||
Sbjct: 148 tgcaaatgaacttcagtaggtaacagtggatcaccgttgcgatagtcctgaaacaaaaac 207

                                                                       
Query: 121 tcctagccacattgagaacaaaataacagcgcaacaggaattcactcctgtggagaatat 180
           ||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||
Sbjct: 208 tcctagccacattgaaaacaaaataacagcgcaacaggaattcactcctgtcgagaatat 267

                                                                       
Query: 181 atgttggtaggtactggtctttaggctcttagcctatgagcatcttgttatcttccaaga 240
           |||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||
Sbjct: 268 atgtcggtaggtactggt-tttaggctcttagcctatgagcatcttgttatcttccaaga 326

                                   
Query: 241 aactgtaggtgggcacctcaaggt 264
           ||||||||||||||||||||||||
Sbjct: 327 aactgtaggtgggcacctcaaggt 350

---

>gb|AY109584.1| Zea mays CL2436_1 mRNA sequence
          Length = 1746

 Score =  313 bits (158), Expect = 3e-82
 Identities = 278/318 (87%)
 Strand = Plus / Minus

                                                                        
Query: 208  cttagcctatgagcatcttgttatcttccaagaaactgtaggtgggcacctcaaggttgt 267
            |||||||||||||||  ||||| || ||||||||||||||||| || ||||| |||||| 
Sbjct: 1439 cttagcctatgagcagtttgttctcctccaagaaactgtaggtagggacctcgaggttga 1380

                                                                        
Query: 268  acggggcagggcccttgcggattctgccagagatgtcgtagtgggagccatggcacgggc 327
            |||| ||||||||||||||||| || || || ||||| |||||||| |||||||| ||||
Sbjct: 1379 acggcgcagggcccttgcggatcctcccggaaatgtcatagtgggaaccatggcatgggc 1320

                                                                        
Query: 328  agaaccaaccaccaaagtctccagagttgggaagggggatgcaaccaagatgagtgcaga 387
            ||||||| || ||||||||||| |  || || || |||||||| || || || ||||| |
Sbjct: 1319 agaaccagccgccaaagtctccggcattaggtagtgggatgcagccgaggtgcgtgcaca 1260

                                                                        
Query: 388  caccaataaccaccagccactctgggttcttcacacgctcagcgtcttgctctgggtggc 447
            | ||||| |||||||||||||| ||||||||||||||||| || || |||||||||||||
Sbjct: 1259 cgccaatgaccaccagccactcagggttcttcacacgctctgcatcctgctctgggtggc 1200

                                                                        
Query: 448  gcagggatgcaacatccacgctgttggccagcttgatgtcatcgtctgtccgtcgcctga 507
            |||||||||| |||||||| |||||||| |||||||||||||| |||||||| |||||||
Sbjct: 1199 gcagggatgccacatccacactgttggcaagcttgatgtcatcctctgtccgacgcctga 1140

                              
Query: 508  tgaagactggctttccac 525
            ||||||||||||||||||
Sbjct: 1139 tgaagactggctttccac 1122

---

>gb|BT018238.1| Zea mays clone EL01N0563B05.c mRNA sequence
          Length = 971

 Score =  311 bits (157), Expect = 1e-81
 Identities = 280/321 (87%)
 Strand = Plus / Minus

                                                                       
Query: 205 gctcttagcctatgagcatcttgttatcttccaagaaactgtaggtgggcacctcaaggt 264
           ||||||| ||||||||||  ||||| || ||||||||||||||||| || ||||| ||||
Sbjct: 790 gctcttaacctatgagcagtttgttctcctccaagaaactgtaggtcgggacctcgaggt 731

                                                                       
Query: 265 tgtacggggcagggcccttgcggattctgccagagatgtcgtagtgggagccatggcacg 324
           || |||| ||||||||||||||||| || || || |||||||||||||| |||||||| |
Sbjct: 730 tgaacggcgcagggcccttgcggatcctcccggatatgtcgtagtgggaaccatggcatg 671

                                                                       
Query: 325 ggcagaaccaaccaccaaagtctccagagttgggaagggggatgcaaccaagatgagtgc 384
           |||||||||| || ||||||||||| | ||| || || |||||||| || || |||||||
Sbjct: 670 ggcagaaccagccgccaaagtctccggcgttcggtagtgggatgcagccgaggtgagtgc 611

                                                                       
Query: 385 agacaccaataaccaccagccactctgggttcttcacacgctcagcgtcttgctctgggt 444
           | || ||||| |||||||||||||| || |||||||||||||| || || ||||||||||
Sbjct: 610 acacgccaatgaccaccagccactcgggattcttcacacgctctgcatcctgctctgggt 551

                                                                       
Query: 445 ggcgcagggatgcaacatccacgctgttggccagcttgatgtcatcgtctgtccgtcgcc 504
           ||||||||||||| |||||||| |||||||| ||||||||||| ||||| ||||| || |
Sbjct: 550 ggcgcagggatgccacatccacactgttggcaagcttgatgtcgtcgtccgtccggcgtc 491

                                
Query: 505 tgatgaagactggctttccac 525
           |||||||||||||||||||||
Sbjct: 490 tgatgaagactggctttccac 470

---

>gb|M77224.1|MZERFESPA Zea mays mitochondrial Rieske Fe-S protein mRNA, complete cds
          Length = 1197

 Score =  311 bits (157), Expect = 1e-81
 Identities = 280/321 (87%)
 Strand = Plus / Minus

                                                                       
Query: 205 gctcttagcctatgagcatcttgttatcttccaagaaactgtaggtgggcacctcaaggt 264
           |||||||||||| |||||  ||||| || ||||||||||||||||| || ||||| ||||
Sbjct: 933 gctcttagcctacgagcagtttgttctcctccaagaaactgtaggtagggacctcgaggt 874

                                                                       
Query: 265 tgtacggggcagggcccttgcggattctgccagagatgtcgtagtgggagccatggcacg 324
           || |||| ||||||||||||||||| || || || ||||| |||||||| |||||||| |
Sbjct: 873 tgaacggcgcagggcccttgcggatcctcccggaaatgtcatagtgggaaccatggcatg 814

                                                                       
Query: 325 ggcagaaccaaccaccaaagtctccagagttgggaagggggatgcaaccaagatgagtgc 384
           |||||||||| || ||||||||||| |  || || || |||||||| || || || ||||
Sbjct: 813 ggcagaaccagccgccaaagtctccggcattaggtagtgggatgcagccgaggtgcgtgc 754

                                                                       
Query: 385 agacaccaataaccaccagccactctgggttcttcacacgctcagcgtcttgctctgggt 444
           | || ||||| |||||||||||||| ||||||||||||||||| || || ||||||||||
Sbjct: 753 acacgccaatgaccaccagccactcagggttcttcacacgctctgcatcctgctctgggt 694

                                                                       
Query: 445 ggcgcagggatgcaacatccacgctgttggccagcttgatgtcatcgtctgtccgtcgcc 504
           ||||||||||||| |||||||| |||||||| |||||||||||||| |||||||| ||||
Sbjct: 693 ggcgcagggatgccacatccacactgttggcaagcttgatgtcatcctctgtccgacgcc 634

                                
Query: 505 tgatgaagactggctttccac 525
           |||||||||||||||||||||
Sbjct: 633 tgatgaagactggctttccac 613

---

>gb|BT017520.1| Zea mays clone EL01N0421A02.c mRNA sequence
          Length = 1172

 Score =  291 bits (147), Expect = 1e-75
 Identities = 276/319 (86%)
 Strand = Plus / Minus

                                                                       
Query: 207 tcttagcctatgagcatcttgttatcttccaagaaactgtaggtgggcacctcaaggttg 266
           ||||| ||||||||||  ||||| || ||||||||||||||||| || ||||| ||||||
Sbjct: 900 tcttaacctatgagcagtttgttctcctccaagaaactgtaggtcgggacctcgaggttg 841

                                                                       
Query: 267 tacggggcagggcccttgcggattctgccagagatgtcgtagtgggagccatggcacggg 326
            |||||||||||||||||||||| || || || |||| ||||||||| |||||||| |||
Sbjct: 840 aacggggcagggcccttgcggatcctcccggatatgtagtagtgggaaccatggcatggg 781

                                                                       
Query: 327 cagaaccaaccaccaaagtctccagagttgggaagggggatgcaaccaagatgagtgcag 386
           |||||||| || ||||||||||| | ||| || || ||||||||||| || |||||||| 
Sbjct: 780 cagaaccagccgccaaagtctccggcgttcggtagtgggatgcaaccgaggtgagtgcac 721

                                                                       
Query: 387 acaccaataaccaccagccactctgggttcttcacacgctcagcgtcttgctctgggtgg 446
           || ||||| |||||||||||||| || |||||||||||||  || || ||||||||||||
Sbjct: 720 acgccaatgaccaccagccactcgggattcttcacacgctatgcatcctgctctgggtgg 661

                                                                       
Query: 447 cgcagggatgcaacatccacgctgttggccagcttgatgtcatcgtctgtccgtcgcctg 506
           ||||||||||| |||||||| |||||||| ||||||| ||  ||||| ||||| || |||
Sbjct: 660 cgcagggatgccacatccacactgttggcaagcttgaagtagtcgtccgtccggcgtctg 601

                              
Query: 507 atgaagactggctttccac 525
           |||||||||||||||||||
Sbjct: 600 atgaagactggctttccac 582

---

>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete
                sequence
          Length = 35498469

 Score =  276 bits (139), Expect = 7e-71
 Identities = 277/323 (85%)
 Strand = Plus / Minus

                                                                            
Query: 203      aggctcttagcctatgagcatcttgttatcttccaagaaactgtaggtgggcacctcaag 262
                |||||||||||||||||| | |||||| || ||||||||||||||||| || ||||| ||
Sbjct: 19696266 aggctcttagcctatgaggagcttgttctcctccaagaaactgtaggtagggacctccag 19696207

                                                                            
Query: 263      gttgtacggggcagggcccttgcggattctgccagagatgtcgtagtgggagccatggca 322
                |||| | || || ||||||||||| || ||||||||||||||||||||||||||||||||
Sbjct: 19696206 gttgaatggagcggggcccttgcgaatcctgccagagatgtcgtagtgggagccatggca 19696147

                                                                            
Query: 323      cgggcagaaccaaccaccaaagtctccagagttgggaagggggatgcaaccaagatgagt 382
                ||||||||||||||| || || |||||||  ||||| || || ||||||||||| || ||
Sbjct: 19696146 cgggcagaaccaacctccgaaatctccagcattggggagaggaatgcaaccaaggtgggt 19696087

                                                                            
Query: 383      gcagacaccaataaccaccagccactctgggttcttcacacgctcagcgtcttgctctgg 442
                |||||| ||||| ||||| |||||||||||||||||||||||||| ||||| ||||  ||
Sbjct: 19696086 gcagacgccaatgaccactagccactctgggttcttcacacgctctgcgtcctgctgggg 19696027

                                                                            
Query: 443      gtggcgcagggatgcaacatccacgctgttggccagcttgatgtcatcgtctgtccgtcg 502
                 |||||||||||  |||| |||||||| |||||||||   ||||| || |||||||  | 
Sbjct: 19696026 atggcgcagggacccaacgtccacgctattggccagcgctatgtcgtcctctgtcctcct 19695967

                                       
Query: 503      cctgatgaagactggctttccac 525
                 |||||||| |||||||| ||||
Sbjct: 19695966 tctgatgaaaactggcttcccac 19695944

---

>dbj|AK059519.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-029-C04, full
           insert sequence
          Length = 1242

 Score =  276 bits (139), Expect = 7e-71
 Identities = 277/323 (85%)
 Strand = Plus / Minus

                                                                       
Query: 203 aggctcttagcctatgagcatcttgttatcttccaagaaactgtaggtgggcacctcaag 262
           |||||||||||||||||| | |||||| || ||||||||||||||||| || ||||| ||
Sbjct: 972 aggctcttagcctatgaggagcttgttctcctccaagaaactgtaggtagggacctccag 913

                                                                       
Query: 263 gttgtacggggcagggcccttgcggattctgccagagatgtcgtagtgggagccatggca 322
           |||| | || || ||||||||||| || ||||||||||||||||||||||||||||||||
Sbjct: 912 gttgaatggagcggggcccttgcgaatcctgccagagatgtcgtagtgggagccatggca 853

                                                                       
Query: 323 cgggcagaaccaaccaccaaagtctccagagttgggaagggggatgcaaccaagatgagt 382
           ||||||||||||||| || || |||||||  ||||| || || ||||||||||| || ||
Sbjct: 852 cgggcagaaccaacctccgaaatctccagcattggggagaggaatgcaaccaaggtgggt 793

                                                                       
Query: 383 gcagacaccaataaccaccagccactctgggttcttcacacgctcagcgtcttgctctgg 442
           |||||| ||||| ||||| |||||||||||||||||||||||||| ||||| ||||  ||
Sbjct: 792 gcagacgccaatgaccactagccactctgggttcttcacacgctctgcgtcctgctgggg 733

                                                                       
Query: 443 gtggcgcagggatgcaacatccacgctgttggccagcttgatgtcatcgtctgtccgtcg 502
            |||||||||||  |||| |||||||| |||||||||   ||||| || |||||||  | 
Sbjct: 732 atggcgcagggacccaacgtccacgctattggccagcgctatgtcgtcctctgtcctcct 673

                                  
Query: 503 cctgatgaagactggctttccac 525
            |||||||| |||||||| ||||
Sbjct: 672 tctgatgaaaactggcttcccac 650

---

>emb|AL731591.3|OSJN00240 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0039C07,
              complete sequence
          Length = 166410

 Score =  276 bits (139), Expect = 7e-71
 Identities = 277/323 (85%)
 Strand = Plus / Minus

                                                                          
Query: 203    aggctcttagcctatgagcatcttgttatcttccaagaaactgtaggtgggcacctcaag 262
              |||||||||||||||||| | |||||| || ||||||||||||||||| || ||||| ||
Sbjct: 146992 aggctcttagcctatgaggagcttgttctcctccaagaaactgtaggtagggacctccag 146933

                                                                          
Query: 263    gttgtacggggcagggcccttgcggattctgccagagatgtcgtagtgggagccatggca 322
              |||| | || || ||||||||||| || ||||||||||||||||||||||||||||||||
Sbjct: 146932 gttgaatggagcggggcccttgcgaatcctgccagagatgtcgtagtgggagccatggca 146873

                                                                          
Query: 323    cgggcagaaccaaccaccaaagtctccagagttgggaagggggatgcaaccaagatgagt 382
              ||||||||||||||| || || |||||||  ||||| || || ||||||||||| || ||
Sbjct: 146872 cgggcagaaccaacctccgaaatctccagcattggggagaggaatgcaaccaaggtgggt 146813

                                                                          
Query: 383    gcagacaccaataaccaccagccactctgggttcttcacacgctcagcgtcttgctctgg 442
              |||||| ||||| ||||| |||||||||||||||||||||||||| ||||| ||||  ||
Sbjct: 146812 gcagacgccaatgaccactagccactctgggttcttcacacgctctgcgtcctgctgggg 146753

                                                                          
Query: 443    gtggcgcagggatgcaacatccacgctgttggccagcttgatgtcatcgtctgtccgtcg 502
               |||||||||||  |||| |||||||| |||||||||   ||||| || |||||||  | 
Sbjct: 146752 atggcgcagggacccaacgtccacgctattggccagcgctatgtcgtcctctgtcctcct 146693

                                     
Query: 503    cctgatgaagactggctttccac 525
               |||||||| |||||||| ||||
Sbjct: 146692 tctgatgaaaactggcttcccac 146670

---

>ref|XM_472343.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 837

 Score =  264 bits (133), Expect = 3e-67
 Identities = 271/317 (85%)
 Strand = Plus / Minus

                                                                       
Query: 209 ttagcctatgagcatcttgttatcttccaagaaactgtaggtgggcacctcaaggttgta 268
           |||||||||||| | |||||| || ||||||||||||||||| || ||||| |||||| |
Sbjct: 837 ttagcctatgaggagcttgttctcctccaagaaactgtaggtagggacctccaggttgaa 778

                                                                       
Query: 269 cggggcagggcccttgcggattctgccagagatgtcgtagtgggagccatggcacgggca 328
            || || ||||||||||| || ||||||||||||||||||||||||||||||||||||||
Sbjct: 777 tggagcggggcccttgcgaatcctgccagagatgtcgtagtgggagccatggcacgggca 718

                                                                       
Query: 329 gaaccaaccaccaaagtctccagagttgggaagggggatgcaaccaagatgagtgcagac 388
           ||||||||| || || |||||||  ||||| || || ||||||||||| || ||||||||
Sbjct: 717 gaaccaacctccgaaatctccagcattggggagaggaatgcaaccaaggtgggtgcagac 658

                                                                       
Query: 389 accaataaccaccagccactctgggttcttcacacgctcagcgtcttgctctgggtggcg 448
            ||||| ||||| |||||||||||||||||||||||||| ||||| ||||  || |||||
Sbjct: 657 gccaatgaccactagccactctgggttcttcacacgctctgcgtcctgctggggatggcg 598

                                                                       
Query: 449 cagggatgcaacatccacgctgttggccagcttgatgtcatcgtctgtccgtcgcctgat 508
           ||||||  |||| |||||||| |||||||||   ||||| || |||||||  |  |||||
Sbjct: 597 cagggacccaacgtccacgctattggccagcgctatgtcgtcctctgtcctccttctgat 538

                            
Query: 509 gaagactggctttccac 525
           ||| |||||||| ||||
Sbjct: 537 gaaaactggcttcccac 521

---

>gb|AY105531.1| Zea mays PCO113958 mRNA sequence
          Length = 1217

 Score =  228 bits (115), Expect = 1e-56
 Identities = 265/315 (84%)
 Strand = Plus / Minus

                                                                       
Query: 211 agcctatgagcatcttgttatcttccaagaaactgtaggtgggcacctcaaggttgtacg 270
           |||| ||||| | |||||| ||||||||||| ||||| || ||||| || |||||| | |
Sbjct: 960 agccgatgagaagcttgttctcttccaagaagctgtatgtcggcacttccaggttgaagg 901

                                                                       
Query: 271 gggcagggcccttgcggattctgccagagatgtcgtagtgggagccatggcacgggcaga 330
           | || |||||||||||||| || ||||| ||||||||||| ||||| |||||||||||||
Sbjct: 900 gtgccgggcccttgcggatcctaccagaaatgtcgtagtgcgagccgtggcacgggcaga 841

                                                                       
Query: 331 accaaccaccaaagtctccagagttgggaagggggatgcaaccaagatgagtgcagacac 390
           |||| |||||||||||||| |  || || || |||||||| || || ||||||||||| |
Sbjct: 840 accagccaccaaagtctcctgcattagggagcgggatgcagcccaggtgagtgcagaccc 781

                                                                       
Query: 391 caataaccaccagccactctgggttcttcacacgctcagcgtcttgctctgggtggcgca 450
           |||| || |||||||| || |||||||| || ||||| || ||||||||||||||||| |
Sbjct: 780 caatgacgaccagccattcggggttcttgacgcgctctgcatcttgctctgggtggcgga 721

                                                                       
Query: 451 gggatgcaacatccacgctgttggccagcttgatgtcatcgtctgtccgtcgcctgatga 510
           ||||||| || || || |||||||||| |||||| ||||| |||||||  ||||| ||||
Sbjct: 720 gggatgcgacgtcaacactgttggccaacttgatatcatcctctgtcctccgccttatga 661

                          
Query: 511 agactggctttccac 525
           |||| ||||| ||||
Sbjct: 660 agaccggcttgccac 646

---

>gb|BT014059.1| Lycopersicon esculentum clone 133157F, mRNA sequence
          Length = 1087

 Score =  123 bits (62), Expect = 6e-25
 Identities = 242/302 (80%)
 Strand = Plus / Minus

                                                                       
Query: 224 cttgttatcttccaagaaactgtaggtgggcacctcaaggttgtacggggcagggccctt 283
           |||||| |||||||||||||||||||| |||||||| || || ||||| || || || ||
Sbjct: 853 cttgttctcttccaagaaactgtaggtaggcacctccagattatacggtgcgggtccttt 794

                                                                       
Query: 284 gcggattctgccagagatgtcgtagtgggagccatggcacgggcagaaccaaccaccaaa 343
           ||| || || |||||||||||||| || ||||||||||| ||||| ||||||||||||||
Sbjct: 793 gcgaatcctaccagagatgtcgtaatgagagccatggcatgggcaaaaccaaccaccaaa 734

                                                                       
Query: 344 gtctccagagttgggaagggggatgcaaccaagatgagtgcagacaccaataaccaccag 403
            || ||||  || || |  || ||||| || |||||||| || || |||| |||||| ||
Sbjct: 733 atcaccagcatttggtaaaggaatgcaccctagatgagtacataccccaacaaccacaag 674

                                                                       
Query: 404 ccactctgggttcttcacacgctcagcgtcttgctctgggtggcgcagggatgcaacatc 463
           ||| ||||| || || || | |||||| ||||| |  ||||  || ||||   ||| |||
Sbjct: 673 ccattctggatttttgaccctctcagcatcttgttgcgggtcacgaagggtgccaagatc 614

                                                                       
Query: 464 cacgctgttggccagcttgatgtcatcgtctgtccgtcgcctgatgaagactggctttcc 523
            || ||||| |||| ||||||||||||||| || || || |||||||| || || |||||
Sbjct: 613 aacactgtttgccaacttgatgtcatcgtcagtgcggcgtctgatgaaaacaggttttcc 554

             
Query: 524 ac 525
           ||
Sbjct: 553 ac 552

---

>ref|XM_466001.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1157

 Score =  119 bits (60), Expect = 1e-23
 Identities = 210/260 (80%)
 Strand = Plus / Minus

                                                                       
Query: 261 aggttgtacggggcagggcccttgcggattctgccagagatgtcgtagtgggagccatgg 320
           |||||||| || ||||||||||| |||||||| || || || || || || || ||||||
Sbjct: 857 aggttgtatggtgcagggcccttacggattctacctgatatatcataatgtgatccatgg 798

                                                                       
Query: 321 cacgggcagaaccaaccaccaaagtctccagagttgggaagggggatgcaaccaagatga 380
           || || |||||||| ||||||||||| |||| ||||||||| || ||||| || ||||||
Sbjct: 797 catggacagaaccagccaccaaagtcaccagcgttgggaagtggaatgcagcccagatga 738

                                                                       
Query: 381 gtgcagacaccaataaccaccagccactctgggttcttcacacgctcagcgtcttgctct 440
           || || || ||||| || ||||||||||| |||||||| || || || || || |||| |
Sbjct: 737 gtacacaccccaatcacaaccagccactcagggttcttgactcgttccgcatcctgctgt 678

                                                                       
Query: 441 gggtggcgcagggatgcaacatccacgctgttggccagcttgatgtcatcgtctgtccgt 500
           ||||  || || ||| |||  || |||||||| ||||  |||||||| || |||||||  
Sbjct: 677 gggtcacgaagagatccaatgtcaacgctgttcgccaagttgatgtcttcctctgtcctg 618

                               
Query: 501 cgcctgatgaagactggctt 520
           |||||||| || ||||||||
Sbjct: 617 cgcctgataaaaactggctt 598

---

>gb|DQ207870.1| Solanum tuberosum clone 087E11 rieske iron-sulfur protein-like
           mRNA, complete cds
          Length = 1098

 Score =  119 bits (60), Expect = 1e-23
 Identities = 105/120 (87%)
 Strand = Plus / Minus

                                                                       
Query: 224 cttgttatcttccaagaaactgtaggtgggcacctcaaggttgtacggggcagggccctt 283
           |||||| |||||||||||||||||||| |||||||| || || ||||| || || || ||
Sbjct: 841 cttgttctcttccaagaaactgtaggtaggcacctccagattatacggtgcgggtccttt 782

                                                                       
Query: 284 gcggattctgccagagatgtcgtagtgggagccatggcacgggcagaaccaaccaccaaa 343
           ||| || || |||||||||||||| |||||||||||||| ||||| ||||||||||||||
Sbjct: 781 gcgaatcctaccagagatgtcgtaatgggagccatggcatgggcaaaaccaaccaccaaa 722



 Score = 44.1 bits (22), Expect = 0.45
 Identities = 40/46 (86%)
 Strand = Plus / Minus

                                                         
Query: 480 ttgatgtcatcgtctgtccgtcgcctgatgaagactggctttccac 525
           |||||||||||||| || || || |||||||| || ||||||||||
Sbjct: 585 ttgatgtcatcgtcagttcggcgtctgatgaaaacaggctttccac 540

---

>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
                sequence
          Length = 35954743

 Score =  119 bits (60), Expect = 1e-23
 Identities = 210/260 (80%)
 Strand = Plus / Plus

                                                                            
Query: 261      aggttgtacggggcagggcccttgcggattctgccagagatgtcgtagtgggagccatgg 320
                |||||||| || ||||||||||| |||||||| || || || || || || || ||||||
Sbjct: 19000643 aggttgtatggtgcagggcccttacggattctacctgatatatcataatgtgatccatgg 19000702

                                                                            
Query: 321      cacgggcagaaccaaccaccaaagtctccagagttgggaagggggatgcaaccaagatga 380
                || || |||||||| ||||||||||| |||| ||||||||| || ||||| || ||||||
Sbjct: 19000703 catggacagaaccagccaccaaagtcaccagcgttgggaagtggaatgcagcccagatga 19000762

                                                                            
Query: 381      gtgcagacaccaataaccaccagccactctgggttcttcacacgctcagcgtcttgctct 440
                || || || ||||| || ||||||||||| |||||||| || || || || || |||| |
Sbjct: 19000763 gtacacaccccaatcacaaccagccactcagggttcttgactcgttccgcatcctgctgt 19000822

                                                                            
Query: 441      gggtggcgcagggatgcaacatccacgctgttggccagcttgatgtcatcgtctgtccgt 500
                ||||  || || ||| |||  || |||||||| ||||  |||||||| || |||||||  
Sbjct: 19000823 gggtcacgaagagatccaatgtcaacgctgttcgccaagttgatgtcttcctctgtcctg 19000882

                                    
Query: 501      cgcctgatgaagactggctt 520
                |||||||| || ||||||||
Sbjct: 19000883 cgcctgataaaaactggctt 19000902



 Score = 40.1 bits (20), Expect = 7.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                        
Query: 2        aatcagtacaaagtaacttacaat 25
                ||||| ||||||||||||||||||
Sbjct: 18847869 aatcaatacaaagtaacttacaat 18847892

---

>dbj|AP005842.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OSJNBb0003H22
          Length = 68256

 Score =  119 bits (60), Expect = 1e-23
 Identities = 210/260 (80%)
 Strand = Plus / Plus

                                                                         
Query: 261   aggttgtacggggcagggcccttgcggattctgccagagatgtcgtagtgggagccatgg 320
             |||||||| || ||||||||||| |||||||| || || || || || || || ||||||
Sbjct: 55964 aggttgtatggtgcagggcccttacggattctacctgatatatcataatgtgatccatgg 56023

                                                                         
Query: 321   cacgggcagaaccaaccaccaaagtctccagagttgggaagggggatgcaaccaagatga 380
             || || |||||||| ||||||||||| |||| ||||||||| || ||||| || ||||||
Sbjct: 56024 catggacagaaccagccaccaaagtcaccagcgttgggaagtggaatgcagcccagatga 56083

                                                                         
Query: 381   gtgcagacaccaataaccaccagccactctgggttcttcacacgctcagcgtcttgctct 440
             || || || ||||| || ||||||||||| |||||||| || || || || || |||| |
Sbjct: 56084 gtacacaccccaatcacaaccagccactcagggttcttgactcgttccgcatcctgctgt 56143

                                                                         
Query: 441   gggtggcgcagggatgcaacatccacgctgttggccagcttgatgtcatcgtctgtccgt 500
             ||||  || || ||| |||  || |||||||| ||||  |||||||| || |||||||  
Sbjct: 56144 gggtcacgaagagatccaatgtcaacgctgttcgccaagttgatgtcttcctctgtcctg 56203

                                 
Query: 501   cgcctgatgaagactggctt 520
             |||||||| || ||||||||
Sbjct: 56204 cgcctgataaaaactggctt 56223

---

>dbj|AP005749.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
            clone:OSJNBa0047A17
          Length = 149142

 Score =  119 bits (60), Expect = 1e-23
 Identities = 210/260 (80%)
 Strand = Plus / Plus

                                                                        
Query: 261  aggttgtacggggcagggcccttgcggattctgccagagatgtcgtagtgggagccatgg 320
            |||||||| || ||||||||||| |||||||| || || || || || || || ||||||
Sbjct: 6164 aggttgtatggtgcagggcccttacggattctacctgatatatcataatgtgatccatgg 6223

                                                                        
Query: 321  cacgggcagaaccaaccaccaaagtctccagagttgggaagggggatgcaaccaagatga 380
            || || |||||||| ||||||||||| |||| ||||||||| || ||||| || ||||||
Sbjct: 6224 catggacagaaccagccaccaaagtcaccagcgttgggaagtggaatgcagcccagatga 6283

                                                                        
Query: 381  gtgcagacaccaataaccaccagccactctgggttcttcacacgctcagcgtcttgctct 440
            || || || ||||| || ||||||||||| |||||||| || || || || || |||| |
Sbjct: 6284 gtacacaccccaatcacaaccagccactcagggttcttgactcgttccgcatcctgctgt 6343

                                                                        
Query: 441  gggtggcgcagggatgcaacatccacgctgttggccagcttgatgtcatcgtctgtccgt 500
            ||||  || || ||| |||  || |||||||| ||||  |||||||| || |||||||  
Sbjct: 6344 gggtcacgaagagatccaatgtcaacgctgttcgccaagttgatgtcttcctctgtcctg 6403

                                
Query: 501  cgcctgatgaagactggctt 520
            |||||||| || ||||||||
Sbjct: 6404 cgcctgataaaaactggctt 6423

---

>dbj|AK102815.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033108M09, full
           insert sequence
          Length = 1157

 Score =  119 bits (60), Expect = 1e-23
 Identities = 210/260 (80%)
 Strand = Plus / Minus

                                                                       
Query: 261 aggttgtacggggcagggcccttgcggattctgccagagatgtcgtagtgggagccatgg 320
           |||||||| || ||||||||||| |||||||| || || || || || || || ||||||
Sbjct: 857 aggttgtatggtgcagggcccttacggattctacctgatatatcataatgtgatccatgg 798

                                                                       
Query: 321 cacgggcagaaccaaccaccaaagtctccagagttgggaagggggatgcaaccaagatga 380
           || || |||||||| ||||||||||| |||| ||||||||| || ||||| || ||||||
Sbjct: 797 catggacagaaccagccaccaaagtcaccagcgttgggaagtggaatgcagcccagatga 738

                                                                       
Query: 381 gtgcagacaccaataaccaccagccactctgggttcttcacacgctcagcgtcttgctct 440
           || || || ||||| || ||||||||||| |||||||| || || || || || |||| |
Sbjct: 737 gtacacaccccaatcacaaccagccactcagggttcttgactcgttccgcatcctgctgt 678

                                                                       
Query: 441 gggtggcgcagggatgcaacatccacgctgttggccagcttgatgtcatcgtctgtccgt 500
           ||||  || || ||| |||  || |||||||| ||||  |||||||| || |||||||  
Sbjct: 677 gggtcacgaagagatccaatgtcaacgctgttcgccaagttgatgtcttcctctgtcctg 618

                               
Query: 501 cgcctgatgaagactggctt 520
           |||||||| || ||||||||
Sbjct: 617 cgcctgataaaaactggctt 598

---

>gb|L16813.1|TOBFESD Nicotiana tabacum clone 32.10 Rieske iron-sulfur protein mRNA,
           complete cds; mitochondrial
          Length = 1121

 Score =  115 bits (58), Expect = 1e-22
 Identities = 241/302 (79%)
 Strand = Plus / Minus

                                                                       
Query: 224 cttgttatcttccaagaaactgtaggtgggcacctcaaggttgtacggggcagggccctt 283
           |||||| || |||| |||||||||||| |||||||| || || || || ||||| || ||
Sbjct: 891 cttgttctcctccatgaaactgtaggtaggcacctccagattatatggcgcaggtccttt 832

                                                                       
Query: 284 gcggattctgccagagatgtcgtagtgggagccatggcacgggcagaaccaaccaccaaa 343
           ||| || || ||||||||||| |||||||| |||||||| ||||| ||||||||||||||
Sbjct: 831 gcgaatcctaccagagatgtcatagtgggaaccatggcatgggcaaaaccaaccaccaaa 772

                                                                       
Query: 344 gtctccagagttgggaagggggatgcaaccaagatgagtgcagacaccaataaccaccag 403
            || ||||  || || |  || ||||| || ||||||||||| || || |||||||| ||
Sbjct: 771 atcaccagcatttggtaaaggtatgcaccctagatgagtgcataccccgataaccacaag 712

                                                                       
Query: 404 ccactctgggttcttcacacgctcagcgtcttgctctgggtggcgcagggatgcaacatc 463
           ||| ||||| || || || | |||||| ||||| |  |||| ||| |||||  ||| |||
Sbjct: 711 ccattctggattttttaccctctcagcatcttgttgcgggtcgcgaagggagccaagatc 652

                                                                       
Query: 464 cacgctgttggccagcttgatgtcatcgtctgtccgtcgcctgatgaagactggctttcc 523
            || ||||| ||||  |||||||| ||||| || || || |||||||| || ||||| ||
Sbjct: 651 aacactgttcgccaaattgatgtcttcgtcagtgcggcgtctgatgaaaacaggcttccc 592

             
Query: 524 ac 525
           ||
Sbjct: 591 ac 590

---

>emb|X79332.1|STFES1G S.tuberosum (Desiree) FeS1 mRNA for Rieske iron-sulfur protein
          Length = 993

 Score =  111 bits (56), Expect = 2e-21
 Identities = 104/120 (86%)
 Strand = Plus / Minus

                                                                       
Query: 224 cttgttatcttccaagaaactgtaggtgggcacctcaaggttgtacggggcagggccctt 283
           |||||| |||||||||||||| ||||| |||||||| || || ||||| || || || ||
Sbjct: 804 cttgttctcttccaagaaactataggtaggcacctccagattatacggtgcgggtccttt 745

                                                                       
Query: 284 gcggattctgccagagatgtcgtagtgggagccatggcacgggcagaaccaaccaccaaa 343
           ||| || || |||||||||||||| |||||||||||||| ||||| ||||||||||||||
Sbjct: 744 gcgaatcctaccagagatgtcgtaatgggagccatggcatgggcaaaaccaaccaccaaa 685

---

>gb|M77225.1|TOBRFESP Nicotiana tabacum mitochondrial Rieske Fe-S protein mRNA, complete
           cds
          Length = 956

 Score =  109 bits (55), Expect = 9e-21
 Identities = 160/195 (82%)
 Strand = Plus / Minus

                                                                       
Query: 224 cttgttatcttccaagaaactgtaggtgggcacctcaaggttgtacggggcagggccctt 283
           |||||| || |||| |||||| || || |||||||| || || || || ||||| |||||
Sbjct: 762 cttgttctcctccaggaaactataagtaggcacctccagattatatggtgcaggtccctt 703

                                                                       
Query: 284 gcggattctgccagagatgtcgtagtgggagccatggcacgggcagaaccaaccaccaaa 343
           |||||| || ||||||||||| || |||||||| ||||| ||||| ||||||||||||||
Sbjct: 702 gcggatcctaccagagatgtcataatgggagccgtggcaagggcaaaaccaaccaccaaa 643

                                                                       
Query: 344 gtctccagagttgggaagggggatgcaaccaagatgagtgcagacaccaataaccaccag 403
            || ||||  || || |  || ||||| |||||||| ||||| || ||||||||||| ||
Sbjct: 642 atcaccagcatttggcaaaggaatgcacccaagatgggtgcataccccaataaccacaag 583

                          
Query: 404 ccactctgggttctt 418
           ||| ||||| |||||
Sbjct: 582 ccattctggattctt 568

---

>gb|L16812.1|TOBFESC Nicotiana tabacum clone 36.14 Rieske iron-sulfur protein mRNA,
            complete cds; mitochondrial
          Length = 1286

 Score =  105 bits (53), Expect = 1e-19
 Identities = 155/189 (82%)
 Strand = Plus / Minus

                                                                        
Query: 224  cttgttatcttccaagaaactgtaggtgggcacctcaaggttgtacggggcagggccctt 283
            |||||| ||||||| |||||| || || |||||||| || || || || ||||| |||||
Sbjct: 1014 cttgttctcttccaggaaactataagtaggcacctccagattatatggtgcaggtccctt 955

                                                                        
Query: 284  gcggattctgccagagatgtcgtagtgggagccatggcacgggcagaaccaaccaccaaa 343
            |||||| || ||||||||||| || |||||||| ||||| ||||| ||||||||||||||
Sbjct: 954  gcggatcctaccagagatgtcataatgggagccgtggcaagggcaaaaccaaccaccaaa 895

                                                                        
Query: 344  gtctccagagttgggaagggggatgcaaccaagatgagtgcagacaccaataaccaccag 403
             || || |  || || |  || ||||| |||||||| ||||| || ||||||||||| ||
Sbjct: 894  atcaccggcatttggcaaaggaatgcacccaagatgggtgcataccccaataaccacaag 835

                     
Query: 404  ccactctgg 412
            ||| |||||
Sbjct: 834  ccattctgg 826

---

>gb|L16810.1|TOBFESA Nicotiana tabacum clone 17.12 Rieske iron-sulfur protein mRNA,
           complete cds; mitochondrial
          Length = 1210

 Score =  105 bits (53), Expect = 1e-19
 Identities = 155/189 (82%)
 Strand = Plus / Minus

                                                                       
Query: 224 cttgttatcttccaagaaactgtaggtgggcacctcaaggttgtacggggcagggccctt 283
           |||||| ||||||| |||||| || || |||||||| || || || || ||||| |||||
Sbjct: 954 cttgttctcttccaggaaactataagtaggcacctccagattatatggtgcaggtccctt 895

                                                                       
Query: 284 gcggattctgccagagatgtcgtagtgggagccatggcacgggcagaaccaaccaccaaa 343
           |||||| || ||||||||||| || |||||||| ||||| ||||| ||||||||||||||
Sbjct: 894 gcggatcctaccagagatgtcataatgggagccgtggcaagggcaaaaccaaccaccaaa 835

                                                                       
Query: 344 gtctccagagttgggaagggggatgcaaccaagatgagtgcagacaccaataaccaccag 403
            || || |  || || |  || ||||| |||||||| ||||| || ||||||||||| ||
Sbjct: 834 atcaccggcatttggcaaaggaatgcacccaagatgggtgcataccccaataaccacaag 775

                    
Query: 404 ccactctgg 412
           ||| |||||
Sbjct: 774 ccattctgg 766

---

>gb|AY085370.1| Arabidopsis thaliana clone 1482 mRNA, complete sequence
          Length = 1068

 Score =  105 bits (53), Expect = 1e-19
 Identities = 71/77 (92%)
 Strand = Plus / Minus

                                                                       
Query: 449 cagggatgcaacatccacgctgttggccagcttgatgtcatcgtctgtccgtcgcctgat 508
           ||||||| |||||||||| ||||||||||||||||||||||| ||||| | |||||||||
Sbjct: 684 cagggatccaacatccacactgttggccagcttgatgtcatcttctgttcttcgcctgat 625

                            
Query: 509 gaagactggctttccac 525
           |||||| ||||||||||
Sbjct: 624 gaagacgggctttccac 608

---

>gb|L16811.1|TOBFESB Nicotiana tabacum clone 8.8 Rieske iron-sulfur protein mRNA,
           complete cds; mitochondrial
          Length = 1202

 Score =  103 bits (52), Expect = 6e-19
 Identities = 103/120 (85%)
 Strand = Plus / Minus

                                                                       
Query: 224 cttgttatcttccaagaaactgtaggtgggcacctcaaggttgtacggggcagggccctt 283
           |||||| || |||| |||||||||||| |||||||| || || || || ||||| || ||
Sbjct: 907 cttgttctcctccatgaaactgtaggtaggcacctccagattatatggtgcaggtccttt 848

                                                                       
Query: 284 gcggattctgccagagatgtcgtagtgggagccatggcacgggcagaaccaaccaccaaa 343
           ||| || || ||||||||||| ||||||||||||||||| ||||| ||||||||||||||
Sbjct: 847 gcgaatcctaccagagatgtcatagtgggagccatggcatgggcaaaaccaaccaccaaa 788

---

>ref|NM_121346.2| Arabidopsis thaliana oxidoreductase/ ubiquinol-cytochrome-c
           reductase AT5G13430 mRNA, complete cds
          Length = 1222

 Score =  101 bits (51), Expect = 2e-18
 Identities = 234/295 (79%)
 Strand = Plus / Minus

                                                                       
Query: 231 tcttccaagaaactgtaggtgggcacctcaaggttgtacggggcagggcccttgcggatt 290
           ||||||| ||| |||||||| || || || |||||||| || ||||| || || |  |||
Sbjct: 911 tcttccaggaagctgtaggttggtacttccaggttgtatggtgcaggacctttcctaatt 852

                                                                       
Query: 291 ctgccagagatgtcgtagtgggagccatggcacgggcagaaccaaccaccaaagtctcca 350
           || ||||| || ||||| || || || || ||||| || |||||||||||| | || |||
Sbjct: 851 cttccagatatatcgtaatgtgatccgtgacacggacaaaaccaaccaccataatcacca 792

                                                                       
Query: 351 gagttgggaagggggatgcaaccaagatgagtgcagacaccaataaccaccagccactct 410
           |  || || | ||||||||| || | ||||||||| || |||| |||||| | ||| |||
Sbjct: 791 gcattaggcaaggggatgcaccccaaatgagtgcacactccaacaaccactaaccattct 732

                                                                       
Query: 411 gggttcttcacacgctcagcgtcttgctctgggtggcgcagggatgcaacatccacgctg 470
           || ||||| || |   | | |||||  | |||||  | ||||||| |||||||||| || 
Sbjct: 731 ggattcttgaccctaaccgagtcttcttgtgggtccctcagggatccaacatccacacta 672

                                                                  
Query: 471 ttggccagcttgatgtcatcgtctgtccgtcgcctgatgaagactggctttccac 525
           |||||||||||||||||||| ||||| | ||||||||||||||| ||||||||||
Sbjct: 671 ttggccagcttgatgtcatcttctgttcttcgcctgatgaagacgggctttccac 617

---

>emb|AL163572.1|ATT22N19 Arabidopsis thaliana DNA chromosome 5, BAC clone T22N19 (ESSA project)
          Length = 68948

 Score =  101 bits (51), Expect = 2e-18
 Identities = 234/295 (79%)
 Strand = Plus / Plus

                                                                         
Query: 231   tcttccaagaaactgtaggtgggcacctcaaggttgtacggggcagggcccttgcggatt 290
             ||||||| ||| |||||||| || || || |||||||| || ||||| || || |  |||
Sbjct: 48600 tcttccaggaagctgtaggttggtacttccaggttgtatggtgcaggacctttcctaatt 48659

                                                                         
Query: 291   ctgccagagatgtcgtagtgggagccatggcacgggcagaaccaaccaccaaagtctcca 350
             || ||||| || ||||| || || || || ||||| || |||||||||||| | || |||
Sbjct: 48660 cttccagatatatcgtaatgtgatccgtgacacggacaaaaccaaccaccataatcacca 48719

                                                                         
Query: 351   gagttgggaagggggatgcaaccaagatgagtgcagacaccaataaccaccagccactct 410
             |  || || | ||||||||| || | ||||||||| || |||| |||||| | ||| |||
Sbjct: 48720 gcattaggcaaggggatgcaccccaaatgagtgcacactccaacaaccactaaccattct 48779

                                                                         
Query: 411   gggttcttcacacgctcagcgtcttgctctgggtggcgcagggatgcaacatccacgctg 470
             || ||||| || |   | | |||||  | |||||  | ||||||| |||||||||| || 
Sbjct: 48780 ggattcttgaccctaaccgagtcttcttgtgggtccctcagggatccaacatccacacta 48839

                                                                    
Query: 471   ttggccagcttgatgtcatcgtctgtccgtcgcctgatgaagactggctttccac 525
             |||||||||||||||||||| ||||| | ||||||||||||||| ||||||||||
Sbjct: 48840 ttggccagcttgatgtcatcttctgttcttcgcctgatgaagacgggctttccac 48894



 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 70/77 (90%)
 Strand = Plus / Plus

                                                                         
Query: 449   cagggatgcaacatccacgctgttggccagcttgatgtcatcgtctgtccgtcgcctgat 508
             ||||||| |||||||||| || |||||||||||||||||||| ||||| | |||||||||
Sbjct: 51835 cagggatccaacatccacactattggccagcttgatgtcatcttctgttcttcgcctgat 51894

                              
Query: 509   gaagactggctttccac 525
             |||||| ||||||||||
Sbjct: 51895 gaagacgggctttccac 51911

---

>gb|AF375413.1| Arabidopsis thaliana AT5g13430/T22N19_80 mRNA, complete cds
          Length = 1067

 Score =  101 bits (51), Expect = 2e-18
 Identities = 234/295 (79%)
 Strand = Plus / Minus

                                                                       
Query: 231 tcttccaagaaactgtaggtgggcacctcaaggttgtacggggcagggcccttgcggatt 290
           ||||||| ||| |||||||| || || || |||||||| || ||||| || || |  |||
Sbjct: 877 tcttccaggaagctgtaggttggtacttccaggttgtatggtgcaggacctttcctaatt 818

                                                                       
Query: 291 ctgccagagatgtcgtagtgggagccatggcacgggcagaaccaaccaccaaagtctcca 350
           || ||||| || ||||| || || || || ||||| || |||||||||||| | || |||
Sbjct: 817 cttccagatatatcgtaatgtgatccgtgacacggacaaaaccaaccaccataatcacca 758

                                                                       
Query: 351 gagttgggaagggggatgcaaccaagatgagtgcagacaccaataaccaccagccactct 410
           |  || || | ||||||||| || | ||||||||| || |||| |||||| | ||| |||
Sbjct: 757 gcattaggcaaggggatgcaccccaaatgagtgcacactccaacaaccactaaccattct 698

                                                                       
Query: 411 gggttcttcacacgctcagcgtcttgctctgggtggcgcagggatgcaacatccacgctg 470
           || ||||| || |   | | |||||  | |||||  | ||||||| |||||||||| || 
Sbjct: 697 ggattcttgaccctaaccgagtcttcttgtgggtccctcagggatccaacatccacacta 638

                                                                  
Query: 471 ttggccagcttgatgtcatcgtctgtccgtcgcctgatgaagactggctttccac 525
           |||||||||||||||||||| ||||| | ||||||||||||||| ||||||||||
Sbjct: 637 ttggccagcttgatgtcatcttctgttcttcgcctgatgaagacgggctttccac 583

---

>gb|AY066055.1| Arabidopsis thaliana AT5g13430/T22N19_80 mRNA, complete cds
          Length = 819

 Score =  101 bits (51), Expect = 2e-18
 Identities = 234/295 (79%)
 Strand = Plus / Minus

                                                                       
Query: 231 tcttccaagaaactgtaggtgggcacctcaaggttgtacggggcagggcccttgcggatt 290
           ||||||| ||| |||||||| || || || |||||||| || ||||| || || |  |||
Sbjct: 797 tcttccaggaagctgtaggttggtacttccaggttgtatggtgcaggacctttcctaatt 738

                                                                       
Query: 291 ctgccagagatgtcgtagtgggagccatggcacgggcagaaccaaccaccaaagtctcca 350
           || ||||| || ||||| || || || || ||||| || |||||||||||| | || |||
Sbjct: 737 cttccagatatatcgtaatgtgatccgtgacacggacaaaaccaaccaccataatcacca 678

                                                                       
Query: 351 gagttgggaagggggatgcaaccaagatgagtgcagacaccaataaccaccagccactct 410
           |  || || | ||||||||| || | ||||||||| || |||| |||||| | ||| |||
Sbjct: 677 gcattaggcaaggggatgcaccccaaatgagtgcacactccaacaaccactaaccattct 618

                                                                       
Query: 411 gggttcttcacacgctcagcgtcttgctctgggtggcgcagggatgcaacatccacgctg 470
           || ||||| || |   | | |||||  | |||||  | ||||||| |||||||||| || 
Sbjct: 617 ggattcttgaccctaaccgagtcttcttgtgggtccctcagggatccaacatccacacta 558

                                                                  
Query: 471 ttggccagcttgatgtcatcgtctgtccgtcgcctgatgaagactggctttccac 525
           |||||||||||||||||||| ||||| | ||||||||||||||| ||||||||||
Sbjct: 557 ttggccagcttgatgtcatcttctgttcttcgcctgatgaagacgggctttccac 503

---

>dbj|AK221169.1| Arabidopsis thaliana mRNA for ubiquinol--cytochrome-c reductase
           -like protein, partial cds, clone: RAFL22-96-P11
          Length = 800

 Score =  101 bits (51), Expect = 2e-18
 Identities = 234/295 (79%)
 Strand = Plus / Minus

                                                                       
Query: 231 tcttccaagaaactgtaggtgggcacctcaaggttgtacggggcagggcccttgcggatt 290
           ||||||||||| |||||||| || || || |||||||| || ||||| || || |  |||
Sbjct: 521 tcttccaagaagctgtaggtcggtacttccaggttgtatggtgcaggacctttcctaatt 462

                                                                       
Query: 291 ctgccagagatgtcgtagtgggagccatggcacgggcagaaccaaccaccaaagtctcca 350
           || ||||| || ||||| || || || || ||||| || |||||||||||| | || |||
Sbjct: 461 cttccagatatatcgtaatgtgatccgtgacacggacaaaaccaaccaccataatcacca 402

                                                                       
Query: 351 gagttgggaagggggatgcaaccaagatgagtgcagacaccaataaccaccagccactct 410
           |  || || | ||||||||| || | ||||||||| || ||||  || | || |||||||
Sbjct: 401 gcattaggcaaggggatgcaccccaaatgagtgcatactccaaccacgatcaaccactct 342

                                                                       
Query: 411 gggttcttcacacgctcagcgtcttgctctgggtggcgcagggatgcaacatccacgctg 470
           || ||||| || |   | | |||||  | |||||  | ||||||| |||||||||| || 
Sbjct: 341 ggattcttgactctaaccgagtcttcttgtgggtccctcagggatccaacatccacacta 282

                                                                  
Query: 471 ttggccagcttgatgtcatcgtctgtccgtcgcctgatgaagactggctttccac 525
           |||||||||||||||||||| ||||| | ||||||||||||||| ||||||||||
Sbjct: 281 ttggccagcttgatgtcatcttctgttcttcgcctgatgaagacgggctttccac 227

---

>emb|BX830387.1|CNS0A1JK Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB77ZD09 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 1011

 Score =  101 bits (51), Expect = 2e-18
 Identities = 234/295 (79%)
 Strand = Plus / Minus

                                                                       
Query: 231 tcttccaagaaactgtaggtgggcacctcaaggttgtacggggcagggcccttgcggatt 290
           ||||||| ||| |||||||| || || || |||||||| || ||||| || || |  |||
Sbjct: 829 tcttccaggaagctgtaggttggtacttccaggttgtatggtgcaggacctttcctaatt 770

                                                                       
Query: 291 ctgccagagatgtcgtagtgggagccatggcacgggcagaaccaaccaccaaagtctcca 350
           || ||||| || ||||| || || || || ||||| || |||||||||||| | || |||
Sbjct: 769 cttccagatatatcgtaatgtgatccgtgacacggacaaaaccaaccaccataatcacca 710

                                                                       
Query: 351 gagttgggaagggggatgcaaccaagatgagtgcagacaccaataaccaccagccactct 410
           |  || || | ||||||||| || | ||||||||| || |||| |||||| | ||| |||
Sbjct: 709 gcattaggcaaggggatgcaccccaaatgagtgcacactccaacaaccactaaccattct 650

                                                                       
Query: 411 gggttcttcacacgctcagcgtcttgctctgggtggcgcagggatgcaacatccacgctg 470
           || ||||| || |   | | |||||  | |||||  | ||||||| |||||||||| || 
Sbjct: 649 ggattcttgaccctaaccgagtcttcttgtgggtccctcagggatccaacatccacacta 590

                                                                  
Query: 471 ttggccagcttgatgtcatcgtctgtccgtcgcctgatgaagactggctttccac 525
           |||||||||||||||||||| ||||| | ||||||||||||||| ||||||||||
Sbjct: 589 ttggccagcttgatgtcatcttctgttcttcgcctgatgaagacgggctttccac 535

---

>emb|BX829878.1|CNS0A1B9 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB42ZG11 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 1031

 Score =  101 bits (51), Expect = 2e-18
 Identities = 234/295 (79%)
 Strand = Plus / Minus

                                                                       
Query: 231 tcttccaagaaactgtaggtgggcacctcaaggttgtacggggcagggcccttgcggatt 290
           ||||||| ||| |||||||| || || || |||||||| || ||||| || || |  |||
Sbjct: 866 tcttccaggaagctgtaggttggtacttccaggttgtatggtgcaggacctttcctaatt 807

                                                                       
Query: 291 ctgccagagatgtcgtagtgggagccatggcacgggcagaaccaaccaccaaagtctcca 350
           || ||||| || ||||| || || || || ||||| || |||||||||||| | || |||
Sbjct: 806 cttccagatatatcgtaatgtgatccgtgacacggacaaaaccaaccaccataatcacca 747

                                                                       
Query: 351 gagttgggaagggggatgcaaccaagatgagtgcagacaccaataaccaccagccactct 410
           |  || || | ||||||||| || | ||||||||| || |||| |||||| | ||| |||
Sbjct: 746 gcattaggcaaggggatgcaccccaaatgagtgcacactccaacaaccactaaccattct 687

                                                                       
Query: 411 gggttcttcacacgctcagcgtcttgctctgggtggcgcagggatgcaacatccacgctg 470
           || ||||| || |   | | |||||  | |||||  | ||||||| |||||||||| || 
Sbjct: 686 ggattcttgaccctaaccgagtcttcttgtgggtccctcagggatccaacatccacacta 627

                                                                  
Query: 471 ttggccagcttgatgtcatcgtctgtccgtcgcctgatgaagactggctttccac 525
           |||||||||||||||||||| ||||| | ||||||||||||||| ||||||||||
Sbjct: 626 ttggccagcttgatgtcatcttctgttcttcgcctgatgaagacgggctttccac 572

---

>emb|BX831700.1|CNS0A14K Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH24ZF01 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 542

 Score =  101 bits (51), Expect = 2e-18
 Identities = 234/295 (79%)
 Strand = Plus / Minus

                                                                       
Query: 231 tcttccaagaaactgtaggtgggcacctcaaggttgtacggggcagggcccttgcggatt 290
           ||||||| ||| |||||||| || || || |||||||| || ||||| || || |  |||
Sbjct: 322 tcttccaggaagctgtaggttggtacttccaggttgtatggtgcaggacctttcctaatt 263

                                                                       
Query: 291 ctgccagagatgtcgtagtgggagccatggcacgggcagaaccaaccaccaaagtctcca 350
           || ||||| || ||||| || || || || ||||| || |||||||||||| | || |||
Sbjct: 262 cttccagatatatcgtaatgtgatccgtgacacggacaaaaccaaccaccataatcacca 203

                                                                       
Query: 351 gagttgggaagggggatgcaaccaagatgagtgcagacaccaataaccaccagccactct 410
           |  || || | ||||||||| || | ||||||||| || |||| |||||| | ||| |||
Sbjct: 202 gcattaggcaaggggatgcaccccaaatgagtgcacactccaacaaccactaaccattct 143

                                                                       
Query: 411 gggttcttcacacgctcagcgtcttgctctgggtggcgcagggatgcaacatccacgctg 470
           || ||||| || |   | | |||||  | |||||  | ||||||| |||||||||| || 
Sbjct: 142 ggattcttgaccctaaccgagtcttcttgtgggtccctcagggatccaacatccacacta 83

                                                                  
Query: 471 ttggccagcttgatgtcatcgtctgtccgtcgcctgatgaagactggctttccac 525
           |||||||||||||||||||| ||||| | ||||||||||||||| ||||||||||
Sbjct: 82  ttggccagcttgatgtcatcttctgttcttcgcctgatgaagacgggctttccac 28

---

>ref|NM_121347.3| Arabidopsis thaliana oxidoreductase/ ubiquinol-cytochrome-c
           reductase AT5G13440 mRNA, complete cds
          Length = 1286

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 70/77 (90%)
 Strand = Plus / Minus

                                                                       
Query: 449 cagggatgcaacatccacgctgttggccagcttgatgtcatcgtctgtccgtcgcctgat 508
           ||||||| |||||||||| || |||||||||||||||||||| ||||| | |||||||||
Sbjct: 744 cagggatccaacatccacactattggccagcttgatgtcatcttctgttcttcgcctgat 685

                            
Query: 509 gaagactggctttccac 525
           |||||| ||||||||||
Sbjct: 684 gaagacgggctttccac 668

---

>gb|AY081510.1| Arabidopsis thaliana ubiquinol--cytochrome-c reductase-like protein
           (At5g13440) mRNA, complete cds
          Length = 932

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 70/77 (90%)
 Strand = Plus / Minus

                                                                       
Query: 449 cagggatgcaacatccacgctgttggccagcttgatgtcatcgtctgtccgtcgcctgat 508
           ||||||| |||||||||| || |||||||||||||||||||| ||||| | |||||||||
Sbjct: 585 cagggatccaacatccacactattggccagcttgatgtcatcttctgttcttcgcctgat 526

                            
Query: 509 gaagactggctttccac 525
           |||||| ||||||||||
Sbjct: 525 gaagacgggctttccac 509

---

>gb|AF370533.1|AF370533 Arabidopsis thaliana ubiquinol--cytochrome-c reductase-like protein
           (T22N19_90) mRNA, complete cds
          Length = 1080

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 70/77 (90%)
 Strand = Plus / Minus

                                                                       
Query: 449 cagggatgcaacatccacgctgttggccagcttgatgtcatcgtctgtccgtcgcctgat 508
           ||||||| |||||||||| || |||||||||||||||||||| ||||| | |||||||||
Sbjct: 641 cagggatccaacatccacactattggccagcttgatgtcatcttctgttcttcgcctgat 582

                            
Query: 509 gaagactggctttccac 525
           |||||| ||||||||||
Sbjct: 581 gaagacgggctttccac 565

---

>emb|BX829960.1|CNS0A1KF Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB49ZG05 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 1003

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 70/77 (90%)
 Strand = Plus / Minus

                                                                       
Query: 449 cagggatgcaacatccacgctgttggccagcttgatgtcatcgtctgtccgtcgcctgat 508
           ||||||| |||||||||| || |||||||||||||||||||| ||||| | |||||||||
Sbjct: 600 cagggatccaacatccacactattggccagcttgatgtcatcttctgttcttcgcctgat 541

                            
Query: 509 gaagactggctttccac 525
           |||||| ||||||||||
Sbjct: 540 gaagacgggctttccac 524

---

>emb|BX833733.1|CNS0A0BW Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL74ZC05 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 992

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 70/77 (90%)
 Strand = Plus / Minus

                                                                       
Query: 449 cagggatgcaacatccacgctgttggccagcttgatgtcatcgtctgtccgtcgcctgat 508
           ||||||| |||||||||| || |||||||||||||||||||| ||||| | |||||||||
Sbjct: 649 cagggatccaacatccacactattggccagcttgatgtcatcttctgttcttcgcctgat 590

                            
Query: 509 gaagactggctttccac 525
           |||||| ||||||||||
Sbjct: 589 gaagacgggctttccac 573

---

>gb|AY086148.1| Arabidopsis thaliana clone 21819 mRNA, complete sequence
          Length = 1226

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 70/77 (90%)
 Strand = Plus / Minus

                                                                       
Query: 449 cagggatgcaacatccacgctgttggccagcttgatgtcatcgtctgtccgtcgcctgat 508
           ||||||| |||||||||| || |||||||||||||||||||| ||||| | |||||||||
Sbjct: 745 cagggatccaacatccacactattggccagcttgatgtcatcttctgttcttcgcctgat 686

                            
Query: 509 gaagactggctttccac 525
           |||||| ||||||||||
Sbjct: 685 gaagacgggctttccac 669

---

>dbj|D21116.1|RICSS126 Oryza sativa mRNA for Rieske Fe-S protein, partial sequence
          Length = 299

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 112/135 (82%)
 Strand = Plus / Minus

                                                                       
Query: 345 tctccagagttgggaagggggatgcaaccaagatgagtgcagacaccaataaccaccagc 404
           |||||||  ||||| || || ||||||||||| || |||||||| | ||| ||||| |||
Sbjct: 296 tctccagcattggggagaggaatgcaaccaaggtgggtgcagacgcnaatgaccactagc 237

                                                                       
Query: 405 cactctgggttcttcacacgctcagcgtcttgctctgggtggcgcagggatgcaacatcc 464
           |||||||||||||| |||||||| ||||| ||||  |  |||||||||||   ||| |||
Sbjct: 236 cactctgggttcttnacacgctctgcgtcctgctgggaatggcgcagggaccnaacgtcc 177

                          
Query: 465 acgctgttggccagc 479
           ||||| |||||||||
Sbjct: 176 acgctattggccagc 162

---

>emb|BX829847.1|CNS0A1CH Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB40ZE04 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 1039

 Score = 89.7 bits (45), Expect = 9e-15
 Identities = 69/77 (89%)
 Strand = Plus / Minus

                                                                       
Query: 449 cagggatgcaacatccacgctgttggccagcttgatgtcatcgtctgtccgtcgcctgat 508
           ||||||| |||||||||| || |||||||||||||||||||| ||||| | |||||||||
Sbjct: 649 cagggatccaacatccacactattggccagcttgatgtcatcttctgttcttcgcctgat 590

                            
Query: 509 gaagactggctttccac 525
           |||||  ||||||||||
Sbjct: 589 gaagaggggctttccac 573

---

>emb|BX829679.1|CNS0A1GR Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB29ZG10 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 1095

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 68/77 (88%)
 Strand = Plus / Minus

                                                                       
Query: 449 cagggatgcaacatccacgctgttggccagcttgatgtcatcgtctgtccgtcgcctgat 508
           ||||||| |||||||||| || |||||||||||||||| ||| ||||| | |||||||| 
Sbjct: 649 cagggatccaacatccacactattggccagcttgatgttatcttctgttcttcgcctgaa 590

                            
Query: 509 gaagactggctttccac 525
           |||||| ||||||||||
Sbjct: 589 gaagacgggctttccac 573

---

>emb|AJ719669.1| Gallus gallus mRNA for hypothetical protein, clone 5b19
          Length = 1070

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 117/144 (81%)
 Strand = Plus / Minus

                                                                       
Query: 245 gtaggtgggcacctcaaggttgtacggggcagggcccttgcggattctgccagagatgtc 304
           |||||| || ||||| ||||| || |||||||| || || | |||||||||||||   ||
Sbjct: 845 gtaggttggaacctccaggttatagggggcaggacctttcctgattctgccagaggcatc 786

                                                                       
Query: 305 gtagtgggagccatggcacgggcagaaccaaccaccaaagtctccagagttgggaagggg 364
            || ||||| || |||||||||||| |  |||||||||| ||||||||||| | ||  ||
Sbjct: 785 ataatgggacccgtggcacgggcagtaataaccaccaaaatctccagagttagcaattgg 726

                                   
Query: 365 gatgcaaccaagatgagtgcagac 388
            |  ||||||||||||||||||||
Sbjct: 725 tacacaaccaagatgagtgcagac 702

---

>ref|NM_001005843.1| Gallus gallus ubiquinol-cytochrome c reductase, Rieske iron-sulfur
           polypeptide 1 (UQCRFS1), mRNA
          Length = 1070

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 117/144 (81%)
 Strand = Plus / Minus

                                                                       
Query: 245 gtaggtgggcacctcaaggttgtacggggcagggcccttgcggattctgccagagatgtc 304
           |||||| || ||||| ||||| || |||||||| || || | |||||||||||||   ||
Sbjct: 845 gtaggttggaacctccaggttatagggggcaggacctttcctgattctgccagaggcatc 786

                                                                       
Query: 305 gtagtgggagccatggcacgggcagaaccaaccaccaaagtctccagagttgggaagggg 364
            || ||||| || |||||||||||| |  |||||||||| ||||||||||| | ||  ||
Sbjct: 785 ataatgggacccgtggcacgggcagtaataaccaccaaaatctccagagttagcaattgg 726

                                   
Query: 365 gatgcaaccaagatgagtgcagac 388
            |  ||||||||||||||||||||
Sbjct: 725 tacacaaccaagatgagtgcagac 702

---

>emb|AJ250370.1|CPA250370 Cyanophora paradoxa partial mRNA for ubiquinol-cytochrome C
           reductase iron-sulfur subunit precursor (risp gene)
          Length = 836

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 71/83 (85%)
 Strand = Plus / Minus

                                                                       
Query: 252 ggcacctcaaggttgtacggggcagggcccttgcggattctgccagagatgtcgtagtgg 311
           |||||||| |||||   ||| ||||||||||| ||||| | ||| |||||||||||||||
Sbjct: 635 ggcacctccaggttaagcggcgcagggcccttccggatgcggccggagatgtcgtagtgg 576

                                  
Query: 312 gagccatggcacgggcagaacca 334
             ||| |||||||||||||||||
Sbjct: 575 ctgccgtggcacgggcagaacca 553

---

>ref|XM_359684.1| Magnaporthe grisea 70-15 hypothetical protein (MG05093.4) partial
           mRNA
          Length = 711

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 77/92 (83%)
 Strand = Plus / Minus

                                                                       
Query: 300 atgtcgtagtgggagccatggcacgggcagaaccaaccaccaaagtctccagagttggga 359
           ||||||||||| || || ||||| |||||||||||||| |||||||| ||||  | |  |
Sbjct: 620 atgtcgtagtgagatccgtggcaggggcagaaccaaccgccaaagtcgccagcctcgcca 561

                                           
Query: 360 agggggatgcaaccaagatgagtgcagacacc 391
           | |||||  ||||||||||| |||||||||||
Sbjct: 560 atggggacacaaccaagatgtgtgcagacacc 529

---

>ref|XM_499709.1| Yarrowia lipolytica CLIB122, YALI0A02915g predicted mRNA
          Length = 678

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 58/67 (86%)
 Strand = Plus / Minus

                                                                       
Query: 285 cggattctgccagagatgtcgtagtgggagccatggcacgggcagaaccaaccaccaaag 344
           ||||||| ||| || |||||||| ||||| || ||||| ||||||||||| || ||||||
Sbjct: 602 cggattcggccggaaatgtcgtaatgggatccgtggcaggggcagaaccagccgccaaag 543

                  
Query: 345 tctccag 351
           |||||||
Sbjct: 542 tctccag 536

---

>emb|X91795.1|CRUCCOR C.reinhardtii mRNa for ubiquinol-cytochrome c oxidoreductase
          Length = 1447

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 70/83 (84%)
 Strand = Plus / Minus

                                                                       
Query: 252 ggcacctcaaggttgtacggggcagggcccttgcggattctgccagagatgtcgtagtgg 311
           |||||||| |||||||| ||||| |||||||  |  || | ||| |||||||||||||||
Sbjct: 869 ggcacctccaggttgtatggggcggggccctccctaatgcggcccgagatgtcgtagtgg 810

                                  
Query: 312 gagccatggcacgggcagaacca 334
             ||| |||||||||||||||||
Sbjct: 809 ctgccgtggcacgggcagaacca 787

---

>emb|AJ320239.1|CRE320239 Chlamydomonas reinhardtii risp gene for ubiquinol-cytochrome c
            reductase, exons 1-5
          Length = 2847

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 70/83 (84%)
 Strand = Plus / Minus

                                                                        
Query: 252  ggcacctcaaggttgtacggggcagggcccttgcggattctgccagagatgtcgtagtgg 311
            |||||||| |||||||| ||||| |||||||  |  || | ||| |||||||||||||||
Sbjct: 2208 ggcacctccaggttgtatggggcggggccctccctaatgcggcccgagatgtcgtagtgg 2149

                                   
Query: 312  gagccatggcacgggcagaacca 334
              ||| |||||||||||||||||
Sbjct: 2148 ctgccgtggcacgggcagaacca 2126

---

>emb|CR382127.1| Yarrowia lipolytica chromosome A of strain CLIB122 of Yarrowia lipolytica
          Length = 2303261

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 58/67 (86%)
 Strand = Plus / Minus

                                                                          
Query: 285    cggattctgccagagatgtcgtagtgggagccatggcacgggcagaaccaaccaccaaag 344
              ||||||| ||| || |||||||| ||||| || ||||| ||||||||||| || ||||||
Sbjct: 346295 cggattcggccggaaatgtcgtaatgggatccgtggcaggggcagaaccagccgccaaag 346236

                     
Query: 345    tctccag 351
              |||||||
Sbjct: 346235 tctccag 346229

---

>emb|BX830982.1|CNS0A0P7 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS45ZG07 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1231

 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 45/50 (90%)
 Strand = Plus / Minus

                                                             
Query: 457 caacatccacgctgttggccagcttgatgtcatcgtctgtccgtcgcctg 506
           |||||||||| || |||||||||||||||||||| ||||| | |||||||
Sbjct: 681 caacatccacactattggccagcttgatgtcatcttctgttcttcgcctg 632



 Score = 46.1 bits (23), Expect = 0.12
 Identities = 89/111 (80%)
 Strand = Plus / Minus

                                                                       
Query: 231 tcttccaagaaactgtaggtgggcacctcaaggttgtacggggcagggcccttgcggatt 290
           ||||||||||| |||||||| || || || |||||||| || ||||| || || |  |||
Sbjct: 907 tcttccaagaagctgtaggtcggtacttccaggttgtatggtgcaggacctttcctaatt 848

                                                              
Query: 291 ctgccagagatgtcgtagtgggagccatggcacgggcagaaccaaccacca 341
           || ||||| || ||||| || || || || ||||| || ||||||||||||
Sbjct: 847 cttccagatatatcgtaatgtgatccgtgacacggacaaaaccaaccacca 797

---

>gb|AE017345.1| Cryptococcus neoformans var. neoformans JEC21 chromosome 5, complete
              sequence
          Length = 1507550

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 47/53 (88%)
 Strand = Plus / Plus

                                                                   
Query: 285    cggattctgccagagatgtcgtagtgggagccatggcacgggcagaaccaacc 337
              ||||||| |||||| |||||||||||||| || ||||| || |||||||||||
Sbjct: 627810 cggattcggccagaaatgtcgtagtgggaaccgtggcaaggacagaaccaacc 627862



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 369    caaccaagatgagtgcagacaccaa 393
              ||||||||||| |||||||||||||
Sbjct: 627953 caaccaagatgtgtgcagacaccaa 627977

---

>ref|XM_570926.1| Cryptococcus neoformans var. neoformans JEC21 ubiquinol-cytochrome
           c reductase iron-sulfur subunit, mitochondrial precursor
           (CNE02310) partial mRNA
          Length = 840

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                
Query: 285 cggattctgccagagatgtcgtagtgggagccatggcacgggcagaaccaacc 337
           ||||||| |||||| |||||||||||||| || ||||| || |||||||||||
Sbjct: 761 cggattcggccagaaatgtcgtagtgggaaccgtggcaaggacagaaccaacc 709



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 369 caaccaagatgagtgcagacaccaa 393
           ||||||||||| |||||||||||||
Sbjct: 677 caaccaagatgtgtgcagacaccaa 653

---

>dbj|AP007175.1| Aspergillus oryzae RIB40 genomic DNA, SC010
          Length = 2039961

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 65/77 (84%)
 Strand = Plus / Minus

                                                                           
Query: 270     ggggcagggcccttgcggattctgccagagatgtcgtagtgggagccatggcacgggcag 329
               |||||||| ||||| | ||| | ||| |||||||||||||| || || ||||| ||||||
Sbjct: 1276830 ggggcaggacccttcctgatacggccggagatgtcgtagtgagaaccgtggcaggggcag 1276771

                                
Query: 330     aaccaaccaccaaagtc 346
               ||||| || ||||||||
Sbjct: 1276770 aaccagccgccaaagtc 1276754

---

>gb|CP000081.1| Leishmania major chromosome 35, complete sequence
          Length = 2090491

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 67/80 (83%)
 Strand = Plus / Plus

                                                                          
Query: 252    ggcacctcaaggttgtacggggcagggcccttgcggattctgccagagatgtcgtagtgg 311
              ||||||||||||||   |||||||||||| | |||||| | ||| |||  ||||||||||
Sbjct: 666939 ggcacctcaaggttcagcggggcagggccttggcggatacggccggaggggtcgtagtgg 666998

                                  
Query: 312    gagccatggcacgggcagaa 331
                ||| ||||||||||||||
Sbjct: 666999 ctgccgtggcacgggcagaa 667018

---

>ref|XM_460873.1| Debaryomyces hansenii CBS767 hypothetical protein (DEHA0F12771g)
           partial mRNA
          Length = 477

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                   
Query: 288 attctgccagagatgtcgtagtgggagccatggcacgggcagaaccaaccaccaaa 343
           ||||| |||||||| |||||||| || ||||| || || |||||||||||||||||
Sbjct: 398 attctaccagagatatcgtagtgagaaccatgacaaggacagaaccaaccaccaaa 343

---

>ref|XM_838166.1| Leishmania major strain Friedlin reiske iron-sulfur protein
           precursor (LMJ_1083) partial mRNA
          Length = 894

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 67/80 (83%)
 Strand = Plus / Minus

                                                                       
Query: 252 ggcacctcaaggttgtacggggcagggcccttgcggattctgccagagatgtcgtagtgg 311
           ||||||||||||||   |||||||||||| | |||||| | ||| |||  ||||||||||
Sbjct: 845 ggcacctcaaggttcagcggggcagggccttggcggatacggccggaggggtcgtagtgg 786

                               
Query: 312 gagccatggcacgggcagaa 331
             ||| ||||||||||||||
Sbjct: 785 ctgccgtggcacgggcagaa 766

---

>emb|CR382138.1| Debaryomyces hansenii chromosome F of strain CBS767 of Debaryomyces
               hansenii
          Length = 2336804

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                       
Query: 288     attctgccagagatgtcgtagtgggagccatggcacgggcagaaccaaccaccaaa 343
               ||||| |||||||| |||||||| || ||||| || || |||||||||||||||||
Sbjct: 1023322 attctaccagagatatcgtagtgagaaccatgacaaggacagaaccaaccaccaaa 1023267

---

>dbj|AP007255.1| Magnetospirillum magneticum AMB-1 DNA, complete genome
          Length = 4967148

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                       
Query: 279     cccttgcggattctgccagagatgtcgtagtgggagccatggcacgggcagaacca 334
               ||||||||||| | ||| ||| | |||||||| || ||||||||||||||||||||
Sbjct: 4489680 cccttgcggatgcggccggaggtatcgtagtgcgatccatggcacgggcagaacca 4489625

---

>gb|AE016818.1| Ashbya gossypii (= Eremothecium gossypii) ATCC 10895 chromosome V,
              complete sequence
          Length = 1519138

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 40/44 (90%)
 Strand = Plus / Minus

                                                          
Query: 303    tcgtagtgggagccatggcacgggcagaaccaaccaccaaagtc 346
              ||||||||||| || ||||| ||||||||||| |||||||||||
Sbjct: 508718 tcgtagtgggaaccgtggcatgggcagaaccagccaccaaagtc 508675

---

>ref|NM_210148.1| Eremothecium gossypii AEL067Wp (AEL067W), mRNA
          Length = 639

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 40/44 (90%)
 Strand = Plus / Minus

                                                       
Query: 303 tcgtagtgggagccatggcacgggcagaaccaaccaccaaagtc 346
           ||||||||||| || ||||| ||||||||||| |||||||||||
Sbjct: 548 tcgtagtgggaaccgtggcatgggcagaaccagccaccaaagtc 505

---

>ref|XM_447387.1| Candida glabrata CBS138 hypothetical protein (CAGL0I03190g) partial
           mRNA
          Length = 642

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 51/59 (86%)
 Strand = Plus / Minus

                                                                      
Query: 288 attctgccagagatgtcgtagtgggagccatggcacgggcagaaccaaccaccaaagtc 346
           ||||| |||||||| |||||||| || || || || ||||||||||||||||| |||||
Sbjct: 566 attctaccagagatatcgtagtgagaaccgtgacaagggcagaaccaaccaccgaagtc 508

---

>emb|CR380955.1| Candida glabrata strain CBS138 chromosome I complete sequence
          Length = 1089401

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                         
Query: 288    attctgccagagatgtcgtagtgggagccatggcacgggcagaaccaaccaccaaagtc 346
              ||||| |||||||| |||||||| || || || || ||||||||||||||||| |||||
Sbjct: 274057 attctaccagagatatcgtagtgagaaccgtgacaagggcagaaccaaccaccgaagtc 274115

---

>dbj|BA000012.4| Mesorhizobium loti MAFF303099 DNA, complete genome
          Length = 7036071

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                          
Query: 276     gggcccttgcggattctgccagagatgtcgtagtgggagccatggcacgggcagaacca 334
               ||||| |||||||| | ||| | | ||||||| || |||||||||||||||||||||||
Sbjct: 2177333 gggcctttgcggatgcggccggcggtgtcgtactgcgagccatggcacgggcagaacca 2177391

---

>gb|AE005720.1| Caulobacter crescentus CB15 section 46 of 359 of the complete genome
          Length = 11816

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 53/62 (85%)
 Strand = Plus / Minus

                                                                        
Query: 273  gcagggcccttgcggattctgccagagatgtcgtagtgggagccatggcacgggcagaac 332
            ||||||||||| ||||| |  || ||| |||||||||| ||||| ||||| |||||||||
Sbjct: 5564 gcagggcccttacggatacgacccgaggtgtcgtagtgcgagccgtggcaggggcagaac 5505

              
Query: 333  ca 334
            ||
Sbjct: 5504 ca 5503

---

>gb|CP000031.1| Silicibacter pomeroyi DSS-3, complete genome
          Length = 4109442

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 46/53 (86%)
 Strand = Plus / Minus

                                                                   
Query: 282    ttgcggattctgccagagatgtcgtagtgggagccatggcacgggcagaacca 334
              |||||||| | ||||||| | |||||||| ||||| ||||| |||||||||||
Sbjct: 288687 ttgcggatccggccagaggtatcgtagtgcgagccgtggcaggggcagaacca 288635

---

>ref|XM_748490.1| Aspergillus fumigatus Af293 ubiquinol-cytochrome c reductase
           iron-sulfur subunit precursor (Afu5g10610) partial mRNA
          Length = 897

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 55/65 (84%)
 Strand = Plus / Minus

                                                                       
Query: 270 ggggcagggcccttgcggattctgccagagatgtcgtagtgggagccatggcacgggcag 329
           |||||||| ||||| ||||| | ||| ||||| || |||||||| || ||||| ||||||
Sbjct: 836 ggggcaggacccttccggatacggccggagatatcatagtgggaaccgtggcaggggcag 777

                
Query: 330 aacca 334
           |||||
Sbjct: 776 aacca 772

---

>ref|XM_957255.1| Neurospora crassa OR74A hypothetical protein (NCU06606.1) partial
           mRNA
          Length = 696

 Score = 48.1 bits (24), Expect = 0.029
 Identities = 42/48 (87%)
 Strand = Plus / Minus

                                                           
Query: 293 gccagagatgtcgtagtgggagccatggcacgggcagaaccaaccacc 340
           ||||||||| |||||||| || || ||||| ||||||||||| |||||
Sbjct: 612 gccagagatatcgtagtgagaaccgtggcaagggcagaaccagccacc 565

---

>ref|XM_326460.1| Neurospora crassa OR74A hypothetical protein (NCU06606.1) partial
           mRNA
          Length = 696

 Score = 48.1 bits (24), Expect = 0.029
 Identities = 42/48 (87%)
 Strand = Plus / Minus

                                                           
Query: 293 gccagagatgtcgtagtgggagccatggcacgggcagaaccaaccacc 340
           ||||||||| |||||||| || || ||||| ||||||||||| |||||
Sbjct: 612 gccagagatatcgtagtgagaaccgtggcaagggcagaaccagccacc 565

---

>gb|AC110374.3| Mus musculus BAC clone RP23-293P18 from 15, complete sequence
          Length = 199869

 Score = 48.1 bits (24), Expect = 0.029
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                      
Query: 174    agaatatatgttggtaggtactgg 197
              ||||||||||||||||||||||||
Sbjct: 143079 agaatatatgttggtaggtactgg 143056

---

>emb|X02472.1|NCCYRFES Neurospora gene for mitochondrial ubiquinol-cytochrome c reductase
            iron-sulfur subunit
          Length = 1790

 Score = 48.1 bits (24), Expect = 0.029
 Identities = 42/48 (87%)
 Strand = Plus / Minus

                                                            
Query: 293  gccagagatgtcgtagtgggagccatggcacgggcagaaccaaccacc 340
            ||||||||| |||||||| || || ||||| ||||||||||| |||||
Sbjct: 1401 gccagagatatcgtagtgagaaccgtggcaagggcagaaccagccacc 1354

---

>gb|BC019934.1| Mus musculus ubiquinol-cytochrome c reductase, Rieske iron-sulfur
           polypeptide 1, mRNA (cDNA clone MGC:30985
           IMAGE:5249225), complete cds
          Length = 1194

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 95/119 (79%)
 Strand = Plus / Minus

                                                                       
Query: 273 gcagggcccttgcggattctgccagagatgtcgtagtgggagccatggcacgggcagaac 332
           ||||||||||| | ||| |||||||||  ||| ||||| || |||||||| |||||  | 
Sbjct: 837 gcagggcccttcctgatcctgccagaggcgtcatagtgtgacccatggcaggggcaataa 778

                                                                      
Query: 333 caaccaccaaagtctccagagttgggaagggggatgcaaccaagatgagtgcagacacc 391
            | |||||||| ||||| | ||| | || ||| |  |||||||||||||| ||||||||
Sbjct: 777 tagccaccaaaatctcctgcgtttgcaatgggtacacaaccaagatgagtacagacacc 719

---

>gb|BT010222.1| Drosophila melanogaster RH01528 full insert cDNA
          Length = 931

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 44/51 (86%)
 Strand = Plus / Minus

                                                              
Query: 279 cccttgcggattctgccagagatgtcgtagtgggagccatggcacgggcag 329
           ||||||||||| || || |||  ||||||||||||||| ||||| ||||||
Sbjct: 767 cccttgcggatccttccggaggcgtcgtagtgggagccgtggcaggggcag 717

---

>gb|DQ445508.1| Graphocephala atropunctata isolate WHGA0169 Rieske iron-sulfur
           protein 1 mRNA, complete cds
          Length = 819

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 65/79 (82%)
 Strand = Plus / Minus

                                                                       
Query: 273 gcagggcccttgcggattctgccagagatgtcgtagtgggagccatggcacgggcagaac 332
           ||||| |||||||||||||  |||||    |||||||||||||||||||| || ||| | 
Sbjct: 755 gcaggtcccttgcggattcgaccagaagcatcgtagtgggagccatggcaaggacagtaa 696

                              
Query: 333 caaccaccaaagtctccag 351
            | ||||||||||| ||||
Sbjct: 695 tatccaccaaagtcaccag 677

---

>emb|AL611944.10| Mouse DNA sequence from clone RP23-279E14 on chromosome 13 Contains the
             gene for the ortholog of rat and human
             ubiquinol-cytochrome c reductase, Rieske iron-sulfur
             polypeptide 1 UQCRFS1, a novel gene and a CpG island,
             complete sequence
          Length = 194065

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 95/119 (79%)
 Strand = Plus / Plus

                                                                         
Query: 273   gcagggcccttgcggattctgccagagatgtcgtagtgggagccatggcacgggcagaac 332
             ||||||||||| | ||| |||||||||  ||| ||||| || |||||||| |||||  | 
Sbjct: 77295 gcagggcccttcctgatcctgccagaggcgtcatagtgtgacccatggcaggggcaataa 77354

                                                                        
Query: 333   caaccaccaaagtctccagagttgggaagggggatgcaaccaagatgagtgcagacacc 391
              | |||||||| ||||| | ||| | || ||| |  |||||||||||||| ||||||||
Sbjct: 77355 tagccaccaaaatctcctgcgtttgcaatgggtacacaaccaagatgagtacagacacc 77413

---

>gb|DQ122922.1| Chlamydomonas incerta mitochondrial ubiquinol-cytochrome c
           oxidoreductase (RisP) mRNA, partial cds; nuclear gene
           for mitochondrial product
          Length = 921

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 68/83 (81%)
 Strand = Plus / Minus

                                                                       
Query: 252 ggcacctcaaggttgtacggggcagggcccttgcggattctgccagagatgtcgtagtgg 311
           ||||| || |||||||| ||||| |||||||  || || | ||| || ||||||||||||
Sbjct: 593 ggcacttccaggttgtagggggcggggccctcccgaatgcggcccgaaatgtcgtagtgg 534

                                  
Query: 312 gagccatggcacgggcagaacca 334
             ||| ||||| |||||||||||
Sbjct: 533 ctgccgtggcaggggcagaacca 511

---

>ref|NM_164426.1| Drosophila melanogaster Rieske iron-sulfur protein CG7361-RB,
           transcript variant B (RFeSP), mRNA
          Length = 883

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 44/51 (86%)
 Strand = Plus / Minus

                                                              
Query: 279 cccttgcggattctgccagagatgtcgtagtgggagccatggcacgggcag 329
           ||||||||||| || || |||  ||||||||||||||| ||||| ||||||
Sbjct: 729 cccttgcggatccttccggaggcgtcgtagtgggagccgtggcaggggcag 679

---

>ref|NM_080009.2| Drosophila melanogaster Rieske iron-sulfur protein CG7361-RA,
           transcript variant A (RFeSP), mRNA
          Length = 938

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 44/51 (86%)
 Strand = Plus / Minus

                                                              
Query: 279 cccttgcggattctgccagagatgtcgtagtgggagccatggcacgggcag 329
           ||||||||||| || || |||  ||||||||||||||| ||||| ||||||
Sbjct: 784 cccttgcggatccttccggaggcgtcgtagtgggagccgtggcaggggcag 734

---

>dbj|AK152391.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length
           enriched library, clone:I830067N02
           product:ubiquinol-cytochrome c reductase, Rieske
           iron-sulfur polypeptide 1, full insert sequence
          Length = 1200

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 95/119 (79%)
 Strand = Plus / Minus

                                                                       
Query: 273 gcagggcccttgcggattctgccagagatgtcgtagtgggagccatggcacgggcagaac 332
           ||||||||||| | ||| |||||||||  ||| ||||| || |||||||| |||||  | 
Sbjct: 842 gcagggcccttcctgatcctgccagaggcgtcatagtgtgacccatggcaggggcaataa 783

                                                                      
Query: 333 caaccaccaaagtctccagagttgggaagggggatgcaaccaagatgagtgcagacacc 391
            | |||||||| ||||| | ||| | || ||| |  |||||||||||||| ||||||||
Sbjct: 782 tagccaccaaaatctcctgcgtttgcaatgggtacacaaccaagatgagtacagacacc 724

---

>gb|AC104630.1| Drosophila melanogaster, chromosome 2L, region 22B-22C, BAC clone
              BACR19B15, complete sequence
          Length = 180088

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 44/51 (86%)
 Strand = Plus / Minus

                                                                 
Query: 279    cccttgcggattctgccagagatgtcgtagtgggagccatggcacgggcag 329
              ||||||||||| || || |||  ||||||||||||||| ||||| ||||||
Sbjct: 142560 cccttgcggatccttccggaggcgtcgtagtgggagccgtggcaggggcag 142510

---

>gb|CP000264.1| Jannaschia sp. CCS1, complete genome
          Length = 4317977

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 44/51 (86%)
 Strand = Plus / Minus

                                                                 
Query: 301    tgtcgtagtgggagccatggcacgggcagaaccaaccaccaaagtctccag 351
              |||| ||||| ||||| ||||| ||||||||||| ||||| ||||| ||||
Sbjct: 331091 tgtcatagtgagagccgtggcaggggcagaaccagccaccgaagtcaccag 331041

---

>dbj|AK153139.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length
           enriched library, clone:I830124H22
           product:ubiquinol-cytochrome c reductase, Rieske
           iron-sulfur polypeptide 1, full insert sequence
          Length = 1084

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 95/119 (79%)
 Strand = Plus / Minus

                                                                       
Query: 273 gcagggcccttgcggattctgccagagatgtcgtagtgggagccatggcacgggcagaac 332
           ||||||||||| | ||| |||||||||  ||| ||||| || |||||||| |||||  | 
Sbjct: 817 gcagggcccttcctgatcctgccagaggcgtcatagtgtgacccatggcaggggcaataa 758

                                                                      
Query: 333 caaccaccaaagtctccagagttgggaagggggatgcaaccaagatgagtgcagacacc 391
            | |||||||| ||||| | ||| | || ||| |  |||||||||||||| ||||||||
Sbjct: 757 tagccaccaaaatctcctgcgtttgcaatgggtacacaaccaagatgagtacagacacc 699

---

>gb|AC092188.1|AC092188 Drosophila melanogaster, chromosome 2L, region 22B-22C, BAC clone
             BACR28O09, complete sequence
          Length = 177326

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 44/51 (86%)
 Strand = Plus / Minus

                                                                
Query: 279   cccttgcggattctgccagagatgtcgtagtgggagccatggcacgggcag 329
             ||||||||||| || || |||  ||||||||||||||| ||||| ||||||
Sbjct: 32613 cccttgcggatccttccggaggcgtcgtagtgggagccgtggcaggggcag 32563

---

>dbj|AK012180.1| Mus musculus 10 days embryo whole body cDNA, RIKEN full-length
           enriched library, clone:2610528M22
           product:UBIQUINOL-CYTOCHROME C REDUCTASE IRON-SULFUR
           SUBUNIT, MITOCHONDRIAL PRECURSOR (EC 1.10.2.2) (RIESKE
           IRON-SULFUR PROTEIN) (RISP) [CONTAINS:
           UBIQUINOL-CYTOCHROME C REDUCTASE 8 KDA PROTEIN (COMPLEX
           III SUBUNIT IX)] homolog [Bos taurus], full insert
           sequence
          Length = 1048

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 95/119 (79%)
 Strand = Plus / Minus

                                                                       
Query: 273 gcagggcccttgcggattctgccagagatgtcgtagtgggagccatggcacgggcagaac 332
           ||||||||||| | ||| |||||||||  ||| ||||| || |||||||| |||||  | 
Sbjct: 781 gcagggcccttcctgatcctgccagaggcgtcatagtgtgacccatggcaggggcaataa 722

                                                                      
Query: 333 caaccaccaaagtctccagagttgggaagggggatgcaaccaagatgagtgcagacacc 391
            | |||||||| ||||| | ||| | || ||| |  |||||||||||||| ||||||||
Sbjct: 721 tagccaccaaaatctcctgcgtttgcaatgggtacacaaccaagatgagtacagacacc 663

---

>dbj|AK014470.1| Mus musculus 14 days embryo liver cDNA, RIKEN full-length enriched
           library, clone:4430402G14 product:UBIQUINOL-CYTOCHROME C
           REDUCTASE IRON-SULFUR SUBUNIT, MITOCHONDRIAL PRECURSOR
           (EC 1.10.2.2) (RIESKE IRON-SULFUR PROTEIN) (RISP)
           [CONTAINS: UBIQUINOL-CYTOCHROME C REDUCTASE 8 KDA
           PROTEIN (COMPLEX III SUBUNIT IX)] homolog [Bos taurus],
           full insert sequence
          Length = 1316

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 95/119 (79%)
 Strand = Plus / Minus

                                                                       
Query: 273 gcagggcccttgcggattctgccagagatgtcgtagtgggagccatggcacgggcagaac 332
           ||||||||||| | ||| |||||||||  ||| ||||| || |||||||| |||||  | 
Sbjct: 833 gcagggcccttcctgatcctgccagaggcgtcatagtgtgacccatggcaggggcaataa 774

                                                                      
Query: 333 caaccaccaaagtctccagagttgggaagggggatgcaaccaagatgagtgcagacacc 391
            | |||||||| ||||| | ||| | || ||| |  |||||||||||||| ||||||||
Sbjct: 773 tagccaccaaaatctcctgcgtttgcaatgggtacacaaccaagatgagtacagacacc 715

---

>dbj|AK003966.1| Mus musculus 18-day embryo whole body cDNA, RIKEN full-length
           enriched library, clone:1110030B05
           product:ubiquinol-cytochrome c reductase, Rieske
           iron-sulfur polypeptide 1, full insert sequence
          Length = 1060

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 95/119 (79%)
 Strand = Plus / Minus

                                                                       
Query: 273 gcagggcccttgcggattctgccagagatgtcgtagtgggagccatggcacgggcagaac 332
           ||||||||||| | ||| |||||||||  ||| ||||| || |||||||| |||||  | 
Sbjct: 793 gcagggcccttcctgatcctgccagaggcgtcatagtgtgacccatggcaggggcaataa 734

                                                                      
Query: 333 caaccaccaaagtctccagagttgggaagggggatgcaaccaagatgagtgcagacacc 391
            | |||||||| ||||| | ||| | || ||| |  |||||||||||||| ||||||||
Sbjct: 733 tagccaccaaaatctcctgcgtttgcaatgggtacacaaccaagatgagtacagacacc 675

---

>ref|NM_025710.1| Mus musculus ubiquinol-cytochrome c reductase, Rieske iron-sulfur
           polypeptide 1 (Uqcrfs1), mRNA
          Length = 1316

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 95/119 (79%)
 Strand = Plus / Minus

                                                                       
Query: 273 gcagggcccttgcggattctgccagagatgtcgtagtgggagccatggcacgggcagaac 332
           ||||||||||| | ||| |||||||||  ||| ||||| || |||||||| |||||  | 
Sbjct: 833 gcagggcccttcctgatcctgccagaggcgtcatagtgtgacccatggcaggggcaataa 774

                                                                      
Query: 333 caaccaccaaagtctccagagttgggaagggggatgcaaccaagatgagtgcagacacc 391
            | |||||||| ||||| | ||| | || ||| |  |||||||||||||| ||||||||
Sbjct: 773 tagccaccaaaatctcctgcgtttgcaatgggtacacaaccaagatgagtacagacacc 715

---

>dbj|AK217705.1| Mus musculus cDNA, clone:Y2G0142L01, strand:plus,
           reference:ENSEMBL:Mouse-Transcript-
           ENST:ENSMUST00000042834, based on BLAT search
          Length = 378

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 95/119 (79%)
 Strand = Plus / Minus

                                                                       
Query: 273 gcagggcccttgcggattctgccagagatgtcgtagtgggagccatggcacgggcagaac 332
           ||||||||||| | ||| |||||||||  ||| ||||| || |||||||| |||||  | 
Sbjct: 327 gcagggcccttcctgatcctgccagaggcgtcatagtgtgacccatggcaggggcaataa 268

                                                                      
Query: 333 caaccaccaaagtctccagagttgggaagggggatgcaaccaagatgagtgcagacacc 391
            | |||||||| ||||| | ||| | || ||| |  |||||||||||||| ||||||||
Sbjct: 267 tagccaccaaaatctcctgcgtttgcaatgggtacacaaccaagatgagtacagacacc 209

---

>dbj|AK212564.1| Mus musculus cDNA, clone:Y2G0125G04, strand:plus,
           reference:ENSEMBL:Mouse-Transcript-
           ENST:ENSMUST00000042834, based on BLAT search
          Length = 336

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 95/119 (79%)
 Strand = Plus / Minus

                                                                       
Query: 273 gcagggcccttgcggattctgccagagatgtcgtagtgggagccatggcacgggcagaac 332
           ||||||||||| | ||| |||||||||  ||| ||||| || |||||||| |||||  | 
Sbjct: 327 gcagggcccttcctgatcctgccagaggcgtcatagtgtgacccatggcaggggcaataa 268

                                                                      
Query: 333 caaccaccaaagtctccagagttgggaagggggatgcaaccaagatgagtgcagacacc 391
            | |||||||| ||||| | ||| | || ||| |  |||||||||||||| ||||||||
Sbjct: 267 tagccaccaaaatctcctgcgtttgcaatgggtacacaaccaagatgagtacagacacc 209

---

>dbj|AK210928.1| Mus musculus cDNA, clone:Y2G0120B13, strand:minus,
           reference:ENSEMBL:Mouse-Transcript-
           ENST:ENSMUST00000042834, based on BLAT search
          Length = 384

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 95/119 (79%)
 Strand = Plus / Minus

                                                                       
Query: 273 gcagggcccttgcggattctgccagagatgtcgtagtgggagccatggcacgggcagaac 332
           ||||||||||| | ||| |||||||||  ||| ||||| || |||||||| |||||  | 
Sbjct: 315 gcagggcccttcctgatcctgccagaggcgtcatagtgtgacccatggcaggggcaataa 256

                                                                      
Query: 333 caaccaccaaagtctccagagttgggaagggggatgcaaccaagatgagtgcagacacc 391
            | |||||||| ||||| | ||| | || ||| |  |||||||||||||| ||||||||
Sbjct: 255 tagccaccaaaatctcctgcgtttgcaatgggtacacaaccaagatgagtacagacacc 197

---

>dbj|AK180820.1| Mus musculus cDNA, clone:Y0G0116A06, strand:minus,
           reference:ENSEMBL:Mouse-Transcript-
           ENST:ENSMUST00000042834, based on BLAT search
          Length = 435

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 95/119 (79%)
 Strand = Plus / Minus

                                                                       
Query: 273 gcagggcccttgcggattctgccagagatgtcgtagtgggagccatggcacgggcagaac 332
           ||||||||||| | ||| |||||||||  ||| ||||| || |||||||| |||||  | 
Sbjct: 366 gcagggcccttcctgatcctgccagaggcgtcatagtgtgacccatggcaggggcaataa 307

                                                                      
Query: 333 caaccaccaaagtctccagagttgggaagggggatgcaaccaagatgagtgcagacacc 391
            | |||||||| ||||| | ||| | || ||| |  |||||||||||||| ||||||||
Sbjct: 306 tagccaccaaaatctcctgcgtttgcaatgggtacacaaccaagatgagtacagacacc 248

---

>gb|AE003585.5| Drosophila melanogaster chromosome 2L, section 6 of 83 of the complete
             sequence
          Length = 343161

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 44/51 (86%)
 Strand = Plus / Plus

                                                                
Query: 279   cccttgcggattctgccagagatgtcgtagtgggagccatggcacgggcag 329
             ||||||||||| || || |||  ||||||||||||||| ||||| ||||||
Sbjct: 71472 cccttgcggatccttccggaggcgtcgtagtgggagccgtggcaggggcag 71522

---

>gb|AC004445.1|AC004445 Drosophila melanogaster DNA sequence (P1 DS00445 (D93)), complete
             sequence
          Length = 61852

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 44/51 (86%)
 Strand = Plus / Plus

                                                                
Query: 279   cccttgcggattctgccagagatgtcgtagtgggagccatggcacgggcag 329
             ||||||||||| || || |||  ||||||||||||||| ||||| ||||||
Sbjct: 27766 cccttgcggatccttccggaggcgtcgtagtgggagccgtggcaggggcag 27816

---

>gb|BC047125.1| Mus musculus ubiquinol-cytochrome c reductase, Rieske iron-sulfur
           polypeptide 1, mRNA (cDNA clone IMAGE:5009388)
          Length = 1194

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 95/119 (79%)
 Strand = Plus / Minus

                                                                       
Query: 273 gcagggcccttgcggattctgccagagatgtcgtagtgggagccatggcacgggcagaac 332
           ||||||||||| | ||| |||||||||  ||| ||||| || |||||||| |||||  | 
Sbjct: 837 gcagggcccttcctgatcctgccagaggcgtcatagtgtgacccatggcaggggcaataa 778

                                                                      
Query: 333 caaccaccaaagtctccagagttgggaagggggatgcaaccaagatgagtgcagacacc 391
            | |||||||| ||||| | ||| | || ||| |  |||||||||||||| ||||||||
Sbjct: 777 tagccaccaaaatctcctgcgtttgcaatgggtacacaaccaagatgagtacagacacc 719

---

>ref|XM_654818.1| Aspergillus nidulans FGSC A4 hypothetical protein (AN2306.2), mRNA
          Length = 717

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 297 gagatgtcgtagtgggagccatggcacgggcagaacca 334
           ||||| |||||||| || |||||||| |||||||||||
Sbjct: 629 gagatatcgtagtgcgaaccatggcaggggcagaacca 592

---

>gb|AY558341.1| Saccharomyces cerevisiae clone FLH111526.01X YEL024W gene, complete
           cds
          Length = 648

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 61/74 (82%)
 Strand = Plus / Minus

                                                                       
Query: 270 ggggcagggcccttgcggattctgccagagatgtcgtagtgggagccatggcacgggcag 329
           |||||||| ||||| | |||||| || || || || || || || |||||||| || |||
Sbjct: 590 ggggcaggtccctttctgattctaccggaaatatcataatgtgaaccatggcaaggacag 531

                         
Query: 330 aaccaaccaccaaa 343
           ||||||||||||||
Sbjct: 530 aaccaaccaccaaa 517

---

>ref|XM_754879.1| Ustilago maydis 521 hypothetical protein (UM03825.1) partial mRNA
          Length = 1236

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                              
Query: 297  gagatgtcgtagtgggagccatggcacgggcagaaccaaccaccaaagtc 346
            |||||||||||||| || || ||||| |||||| |||| || ||||||||
Sbjct: 1145 gagatgtcgtagtgcgaaccgtggcaagggcagtaccagccgccaaagtc 1096

---

>ref|XM_385427.1| Gibberella zeae PH-1 chromosome 3 hypothetical protein (FG05251.1)
           partial mRNA
          Length = 708

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                             
Query: 288 attctgccagagatgtcgtagtgggagccatggcacgggcagaaccaacc 337
           |||| ||| ||||| |||||||| || || ||||| ||||||||||||||
Sbjct: 629 attcggccggagatatcgtagtgagaaccgtggcaagggcagaaccaacc 580

---

>emb|AL022104.2|SPBC16H5 S.pombe chromosome II cosmid c16H5
          Length = 35660

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 369   caaccaagatgagtgcagacaccaat 394
             |||||||||||||| |||||||||||
Sbjct: 20415 caaccaagatgagtacagacaccaat 20440

---

>dbj|AK221073.1| Arabidopsis thaliana mRNA for ubiquinol--cytochrome-c reductase
           -like protein, partial cds, clone: RAFL22-79-D17
          Length = 414

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 133/170 (78%)
 Strand = Plus / Minus

                                                                       
Query: 231 tcttccaagaaactgtaggtgggcacctcaaggttgtacggggcagggcccttgcggatt 290
           ||||||| ||| |||||||| || || || |||||||| || ||||| || || |  |||
Sbjct: 217 tcttccaggaagctgtaggttggtacttccaggttgtatggtgcaggacctttcctaatt 158

                                                                       
Query: 291 ctgccagagatgtcgtagtgggagccatggcacgggcagaaccaaccaccaaagtctcca 350
           || ||||| || ||||| || || || || ||||| || |||||||||||| | || |||
Sbjct: 157 cttccagatatatcgtaatgtgatccgtgacacggacaaaaccaaccaccataatcacca 98

                                                             
Query: 351 gagttgggaagggggatgcaaccaagatgagtgcagacaccaataaccac 400
           |  || || | ||||||||| || | ||||||||| || |||| ||||||
Sbjct: 97  gcattaggcaaggggatgcaccccaaatgagtgcacactccaacaaccac 48

---

>ref|NM_001021849.1| Schizosaccharomyces pombe 972h- hypothetical protein (SPBC16H5.06),
           partial mRNA
          Length = 687

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 369 caaccaagatgagtgcagacaccaat 394
           |||||||||||||| |||||||||||
Sbjct: 530 caaccaagatgagtacagacaccaat 505

---

>emb|AL116266.1|CNS01D1U Botrytis cinerea strain T4 cDNA library
          Length = 720

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 52/62 (83%)
 Strand = Plus / Minus

                                                                       
Query: 372 ccaagatgagtgcagacaccaataaccaccagccactctgggttcttcacacgctcagcg 431
           |||||||| |||||||||||||  |  |||| ||| ||||| ||||| ||||| ||||||
Sbjct: 260 ccaagatgtgtgcagacaccaaccatgaccaaccattctggcttcttaacacggtcagcg 201

             
Query: 432 tc 433
           ||
Sbjct: 200 tc 199

---

>emb|AL114037.1|CNS01BBX Botrytis cinerea strain T4 cDNA library
          Length = 480

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 52/62 (83%)
 Strand = Plus / Minus

                                                                       
Query: 372 ccaagatgagtgcagacaccaataaccaccagccactctgggttcttcacacgctcagcg 431
           |||||||| |||||||||||||  |  |||| ||| ||||| ||||| ||||| ||||||
Sbjct: 164 ccaagatgtgtgcagacaccaaccatgaccaaccattctggcttcttaacacggtcagcg 105

             
Query: 432 tc 433
           ||
Sbjct: 104 tc 103

---

>emb|AL113155.1|CNS01ANF Botrytis cinerea strain T4 cDNA library
          Length = 780

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 52/62 (83%)
 Strand = Plus / Minus

                                                                       
Query: 372 ccaagatgagtgcagacaccaataaccaccagccactctgggttcttcacacgctcagcg 431
           |||||||| |||||||||||||  |  |||| ||| ||||| ||||| ||||| ||||||
Sbjct: 273 ccaagatgtgtgcagacaccaaccatgaccaaccattctggcttcttaacacggtcagcg 214

             
Query: 432 tc 433
           ||
Sbjct: 213 tc 212

---

>emb|AL111908.1|CNS019OS Botrytis cinerea strain T4 cDNA library
          Length = 480

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 52/62 (83%)
 Strand = Plus / Minus

                                                                       
Query: 372 ccaagatgagtgcagacaccaataaccaccagccactctgggttcttcacacgctcagcg 431
           |||||||| |||||||||||||  |  |||| ||| ||||| ||||| ||||| ||||||
Sbjct: 151 ccaagatgtgtgcagacaccaaccatgaccaaccattctggcttcttaacacggtcagcg 92

             
Query: 432 tc 433
           ||
Sbjct: 91  tc 90

---

>gb|U18530.1|SCE9871 Saccharomyces cerevisiae chromosome V cosmids 9871, 8199, 9867, 9495
             and lambda clones 6693 and 5898
          Length = 62643

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 61/74 (82%)
 Strand = Plus / Minus

                                                                         
Query: 270   ggggcagggcccttgcggattctgccagagatgtcgtagtgggagccatggcacgggcag 329
             |||||||| ||||| | |||||| || || || || || || || |||||||| || |||
Sbjct: 18255 ggggcaggtccctttctgattctaccggaaatatcataatgtgaaccatggcaaggacag 18196

                           
Query: 330   aaccaaccaccaaa 343
             ||||||||||||||
Sbjct: 18195 aaccaaccaccaaa 18182

---

>gb|AE004857.1| Pseudomonas aeruginosa PAO1, section 418 of 529 of the complete
            genome
          Length = 10948

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                          
Query: 302  gtcgtagtgggagccatggcacgggcagaa 331
            ||||||||||||||| ||||| ||||||||
Sbjct: 8029 gtcgtagtgggagccgtggcaagggcagaa 8058

---

>gb|U40480.1|SPU40480 Schizosaccharomyces pombe Rieske iron-sulfur protein (Rip1) mRNA,
           complete cds
          Length = 746

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 369 caaccaagatgagtgcagacaccaat 394
           |||||||||||||| |||||||||||
Sbjct: 584 caaccaagatgagtacagacaccaat 559

---

>gb|M24500.1|YSCRIP1A S.cerevisiae Rieske iron-sulfur protein (RIP1) gene, complete cds
          Length = 1238

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 61/74 (82%)
 Strand = Plus / Minus

                                                                       
Query: 270 ggggcagggcccttgcggattctgccagagatgtcgtagtgggagccatggcacgggcag 329
           |||||||| ||||| | |||||| || || || || || || || |||||||| || |||
Sbjct: 912 ggggcaggtccctttctgattctaccggaaatatcataatgtgaaccatggcaaggacag 853

                         
Query: 330 aaccaaccaccaaa 343
           ||||||||||||||
Sbjct: 852 aaccaaccaccaaa 839

---

>gb|M23316.1|YSCRIP1 Yeast (S.cerevisiae; DC5) Rieske iron-sulfur protein gene, complete
           cds
          Length = 1238

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 61/74 (82%)
 Strand = Plus / Minus

                                                                       
Query: 270 ggggcagggcccttgcggattctgccagagatgtcgtagtgggagccatggcacgggcag 329
           |||||||| ||||| | |||||| || || || || || || || |||||||| || |||
Sbjct: 912 ggggcaggtccctttctgattctaccggaaatatcataatgtgaaccatggcaaggacag 853

                         
Query: 330 aaccaaccaccaaa 343
           ||||||||||||||
Sbjct: 852 aaccaaccaccaaa 839

---

>gb|DQ213880.1| Taeniopygia guttata clone 0058P0044G07 ubiquinol-cytochrome c
           reductase variant 2-like mRNA, complete sequence
          Length = 1028

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 48/57 (84%)
 Strand = Plus / Minus

                                                                    
Query: 273 gcagggcccttgcggattctgccagagatgtcgtagtgggagccatggcacgggcag 329
           |||||||| || | ||| |||||||||  ||| ||||||||||| ||||| ||||||
Sbjct: 776 gcagggcctttcctgatcctgccagaggcgtcatagtgggagccgtggcaggggcag 720

---

>gb|AE014291.4| Brucella suis 1330 chromosome I, complete sequence
          Length = 2107794

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                                
Query: 312     gagccatggcacgggcagaaccaaccaccaaag 344
               ||||||||||| ||||||||||| || ||||||
Sbjct: 1492402 gagccatggcaagggcagaaccagccgccaaag 1492434

---

>emb|AL365215.23| Human DNA sequence from clone RP11-416D8 on chromosome 10 Contains
            the 5' end of the RSU1 gene for Ras suppressor protein 1,
            the 3' end of the CUBN gene for cubilin (intrinsic
            factor-cobalamin receptor) and a CpG island, complete
            sequence
          Length = 184703

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 101  gatagtcctgaaacaaaaact 121
            |||||||||||||||||||||
Sbjct: 8605 gatagtcctgaaacaaaaact 8625

---

>emb|AL162455.14| Human DNA sequence from clone RP11-62D23 on chromosome 13 Contains part
             of the GPC6 gene for glypican 6 and a novel gene, complete
             sequence
          Length = 173736

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 228   ttatcttccaagaaactgtag 248
             |||||||||||||||||||||
Sbjct: 64421 ttatcttccaagaaactgtag 64401

---

>emb|AL626770.9| Mouse DNA sequence from clone RP23-379J18 on chromosome 11 Contains a
             novel gene and a serine/arginine repetitive matrix 1
             (Srrm1) pseudogene, complete sequence
          Length = 188854

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 154   acaggaattcactcctgtgga 174
             |||||||||||||||||||||
Sbjct: 42009 acaggaattcactcctgtgga 42029

---

>gb|AC160031.8| Mus musculus 10 BAC RP24-395H7 (Roswell Park Cancer Institute (C57BL/6J
              Male) Mouse BAC Library) complete sequence
          Length = 191028

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 155    caggaattcactcctgtggag 175
              |||||||||||||||||||||
Sbjct: 129345 caggaattcactcctgtggag 129325

---

>gb|AE009490.1| Brucella melitensis 16M chromosome I, section 47 of 195 of the
           complete sequence
          Length = 11036

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                            
Query: 312 gagccatggcacgggcagaaccaaccaccaaag 344
           ||||||||||| ||||||||||| || ||||||
Sbjct: 626 gagccatggcaagggcagaaccagccgccaaag 594

---

>gb|AF035964.1|AF035964 Brucella abortus tRNA/rRNA methyltransferase (yibK), ATP-binding
            protein A (bapA), ATP-binding protein B (bapB), and
            Rieske Fe-S protein genes, complete cds; and cytochrome b
            gene, partial cds
          Length = 5692

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                             
Query: 312  gagccatggcacgggcagaaccaaccaccaaag 344
            ||||||||||| ||||||||||| || ||||||
Sbjct: 5224 gagccatggcaagggcagaaccagccgccaaag 5192

---

>gb|AE017223.1| Brucella abortus biovar 1 str. 9-941 chromosome I, complete sequence
          Length = 2124241

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                                
Query: 312     gagccatggcacgggcagaaccaaccaccaaag 344
               ||||||||||| ||||||||||| || ||||||
Sbjct: 1510465 gagccatggcaagggcagaaccagccgccaaag 1510497

---

>emb|CT033644.1| Platynereis dumerilii EST IB0AAA16DC02EM1
          Length = 957

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 270 ggggcagggcccttgcggattctgccaga 298
           ||||| || ||||||||||||||||||||
Sbjct: 804 ggggcgggtcccttgcggattctgccaga 776

---

>emb|CT033533.1| Platynereis dumerilii EST IB0AAA18DC05EM1
          Length = 864

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 270 ggggcagggcccttgcggattctgccaga 298
           ||||| || ||||||||||||||||||||
Sbjct: 826 ggggcgggtcccttgcggattctgccaga 798

---

>emb|CT033153.1| Platynereis dumerilii EST IB0AAA25DC05EM1
          Length = 915

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 270 ggggcagggcccttgcggattctgccaga 298
           ||||| || ||||||||||||||||||||
Sbjct: 793 ggggcgggtcccttgcggattctgccaga 765

---

>emb|AM040264.1| Brucella melitensis biovar Abortus chromosome I, complete sequence, strain
               2308
          Length = 2121359

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                                
Query: 312     gagccatggcacgggcagaaccaaccaccaaag 344
               ||||||||||| ||||||||||| || ||||||
Sbjct: 1507619 gagccatggcaagggcagaaccagccgccaaag 1507651

---

>gb|AC005591.1| Homo sapiens chromosome 16, P1 clone 94-10H (LANL), complete sequence
          Length = 78941

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 310   gggagccatggcacgggcag 329
             ||||||||||||||||||||
Sbjct: 11633 gggagccatggcacgggcag 11652

---

>gb|BC020241.1| Homo sapiens cDNA clone IMAGE:4661475, with apparent retained
           intron
          Length = 1928

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 310 gggagccatggcacgggcag 329
           ||||||||||||||||||||
Sbjct: 770 gggagccatggcacgggcag 751

---

>emb|CR769784.10| Zebrafish DNA sequence from clone DKEY-3N10 in linkage group 1, complete
              sequence
          Length = 230420

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 33     caacataggagaaacaatta 52
              ||||||||||||||||||||
Sbjct: 131528 caacataggagaaacaatta 131547

---

>gb|AC092117.4| Homo sapiens chromosome 16 clone CTD-2270P14, complete sequence
          Length = 211606

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 310   gggagccatggcacgggcag 329
             ||||||||||||||||||||
Sbjct: 33751 gggagccatggcacgggcag 33732

---

>gb|AC141586.2| Homo sapiens chromosome 16 clone CTD-3126B10, complete sequence
          Length = 127397

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 310    gggagccatggcacgggcag 329
              ||||||||||||||||||||
Sbjct: 108203 gggagccatggcacgggcag 108184



 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 310   gggagccatggcacgggcag 329
             ||||||||||||||||||||
Sbjct: 23035 gggagccatggcacgggcag 23054

---

>emb|CR752649.9| Zebrafish DNA sequence from clone DKEY-238J13, complete sequence
          Length = 164233

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 228   ttatcttccaagaaactgta 247
             ||||||||||||||||||||
Sbjct: 25582 ttatcttccaagaaactgta 25601

---

>emb|AL607026.11| Human DNA sequence from clone RP11-498G22 on chromosome 10, complete
              sequence
          Length = 172911

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 27/28 (96%), Gaps = 1/28 (3%)
 Strand = Plus / Minus

                                          
Query: 113    acaaaaactcctagccacattgagaaca 140
              |||||||||||||| |||||||||||||
Sbjct: 165704 acaaaaactcctag-cacattgagaaca 165678

---

>emb|CR388002.6| Zebrafish DNA sequence from clone DKEY-75M8 in linkage group 1, complete
              sequence
          Length = 228120

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 33     caacataggagaaacaatta 52
              ||||||||||||||||||||
Sbjct: 162277 caacataggagaaacaatta 162258

---

>gb|CP000087.1| Rickettsia bellii RML369-C, complete genome
          Length = 1522076

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 315    ccatggcacgggcagaacca 334
              ||||||||||||||||||||
Sbjct: 913996 ccatggcacgggcagaacca 913977

---

>emb|X05630.1|RCPETG Rhodopseudomonas capsulata petABC operon
          Length = 4007

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                            
Query: 303  tcgtagtgggagccatggcacgggcagaacca 334
            |||||||| ||||| ||||| |||||||||||
Sbjct: 1213 tcgtagtgcgagccgtggcaggggcagaacca 1182

---

>emb|X05799.1|PDBC1 P. denitrificans bc1 gene for cytochrome bc1 complex (EC 1.10.2.2)
          Length = 3840

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 44/52 (84%)
 Strand = Plus / Minus

                                                               
Query: 283 tgcggattctgccagagatgtcgtagtgggagccatggcacgggcagaacca 334
           ||||||| | ||| ||| ||||||| || || || |||||||||||||||||
Sbjct: 746 tgcggatgcggcccgaggtgtcgtaatgcgacccgtggcacgggcagaacca 695

---

>emb|X03476.1|RCFBC Rhodopseudomonas sphaeroides fbc operon (fbcF, fbcB, fbcC genes)
          Length = 3874

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                            
Query: 303  tcgtagtgggagccatggcacgggcagaacca 334
            |||||||| ||||| ||||| |||||||||||
Sbjct: 1324 tcgtagtgcgagccgtggcaggggcagaacca 1293

---

>emb|AL645564.6| Mouse DNA sequence from clone RP23-35N22 on chromosome 11 Contains part
              of a novel gene and two CpG islands, complete sequence
          Length = 205101

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 325    ggcagaaccaaccaccaaag 344
              ||||||||||||||||||||
Sbjct: 157990 ggcagaaccaaccaccaaag 157971

---

>emb|BX511162.8| Zebrafish DNA sequence from clone DKEY-240B22 in linkage group 1,
             complete sequence
          Length = 119612

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 33    caacataggagaaacaatta 52
             ||||||||||||||||||||
Sbjct: 16850 caacataggagaaacaatta 16869

---

>emb|BX323017.6| Zebrafish DNA sequence from clone DKEYP-41F9, complete sequence
          Length = 141192

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 33    caacataggagaaacaatta 52
             ||||||||||||||||||||
Sbjct: 33822 caacataggagaaacaatta 33841

---

>emb|AJ785968.1| Homo sapiens mRNA for PDPK2 protein
          Length = 2387

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 310 gggagccatggcacgggcag 329
           ||||||||||||||||||||
Sbjct: 617 gggagccatggcacgggcag 636

---

>gb|AC068308.12| Homo sapiens 3 BAC RP11-275H4 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 154495

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 16    aacttacaatccagtagcaacata 39
             ||||||||||||||||||| ||||
Sbjct: 38798 aacttacaatccagtagcaccata 38775

---

>gb|AC068892.7| Homo sapiens chromosome 10 clone RP11-116D21, complete sequence
          Length = 161178

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 27/28 (96%), Gaps = 1/28 (3%)
 Strand = Plus / Plus

                                          
Query: 113    acaaaaactcctagccacattgagaaca 140
              |||||||||||||| |||||||||||||
Sbjct: 131607 acaaaaactcctag-cacattgagaaca 131633

---

>ref|XM_496112.2| PREDICTED: Homo sapiens similar to 3-phosphoinositide dependent
           protein kinase 1 (hPDK1), transcript variant 1
           (LOC653650), mRNA
          Length = 2396

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 310 gggagccatggcacgggcag 329
           ||||||||||||||||||||
Sbjct: 632 gggagccatggcacgggcag 651

---

>ref|XM_935349.1| PREDICTED: Homo sapiens similar to 3-phosphoinositide dependent
           protein kinase 1 (hPDK1), transcript variant 5
           (LOC653650), mRNA
          Length = 2595

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 310 gggagccatggcacgggcag 329
           ||||||||||||||||||||
Sbjct: 632 gggagccatggcacgggcag 651

---

>ref|XM_935348.1| PREDICTED: Homo sapiens similar to 3-phosphoinositide dependent
           protein kinase 1 (hPDK1), transcript variant 4
           (LOC653650), mRNA
          Length = 1786

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 310 gggagccatggcacgggcag 329
           ||||||||||||||||||||
Sbjct: 632 gggagccatggcacgggcag 651

---

>gb|BC002659.1|BC002659 Homo sapiens, clone IMAGE:3609437, mRNA
          Length = 1254

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 310 gggagccatggcacgggcag 329
           ||||||||||||||||||||
Sbjct: 81  gggagccatggcacgggcag 62

---

>ref|XM_394267.2| PREDICTED: Apis mellifera similar to ENSANGP00000026211 (LOC410791),
            mRNA
          Length = 2127

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 138  acaaaataacagcgcaacag 157
            ||||||||||||||||||||
Sbjct: 2088 acaaaataacagcgcaacag 2069

---

>gb|AC092577.3| Homo sapiens BAC clone RP11-12E5 from 4, complete sequence
          Length = 73928

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 10    caaagtaacttacaatccagtagc 33
             |||||||||||| |||||||||||
Sbjct: 11132 caaagtaacttataatccagtagc 11109

---

>gb|AC093517.3| Homo sapiens chromosome 16 clone CTD-2593F12, complete sequence
          Length = 160606

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 310   gggagccatggcacgggcag 329
             ||||||||||||||||||||
Sbjct: 27171 gggagccatggcacgggcag 27152

---

>gb|AC093525.3| Homo sapiens chromosome 16 clone RP11-20I23, complete sequence
          Length = 157518

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 310   gggagccatggcacgggcag 329
             ||||||||||||||||||||
Sbjct: 35728 gggagccatggcacgggcag 35709

---

>dbj|AK197173.1| Mus musculus cDNA, clone:Y1G0124E03, strand:minus,
           reference:ENSEMBL:Mouse-Transcript-
           ENST:ENSMUST00000042834, based on BLAT search
          Length = 382

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 47/56 (83%)
 Strand = Plus / Minus

                                                                   
Query: 273 gcagggcccttgcggattctgccagagatgtcgtagtgggagccatggcacgggca 328
           ||||||||||| | ||| |||||||||  ||| ||||| || |||||||| |||||
Sbjct: 313 gcagggcccttcctgatcctgccagaggcgtcatagtgtgacccatggcaggggca 258

---

>dbj|AK191429.1| Mus musculus cDNA, clone:Y1G0105N20, strand:minus,
           reference:ENSEMBL:Mouse-Transcript-
           ENST:ENSMUST00000042834, based on BLAT search
          Length = 408

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 47/56 (83%)
 Strand = Plus / Minus

                                                                   
Query: 273 gcagggcccttgcggattctgccagagatgtcgtagtgggagccatggcacgggca 328
           ||||||||||| | ||| |||||||||  ||| ||||| || |||||||| |||||
Sbjct: 339 gcagggcccttcctgatcctgccagaggcgtcatagtgtgacccatggcaggggca 284

---

>dbj|AP006850.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2,
             fosmid clone:OSJNOa257A21
          Length = 34833

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 2     aatcagtacaaagtaacttacaat 25
             ||||| ||||||||||||||||||
Sbjct: 32111 aatcaatacaaagtaacttacaat 32134

---

>dbj|AP005845.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC
             clone:P0461D06
          Length = 112895

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 2     aatcagtacaaagtaacttacaat 25
             ||||| ||||||||||||||||||
Sbjct: 11402 aatcaatacaaagtaacttacaat 11425

---

>gb|AC150478.3| Monodelphis domestica clone VMRC6-508P4, complete sequence
          Length = 81497

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 334   aaccaccaaagtctccagag 353
             ||||||||||||||||||||
Sbjct: 13995 aaccaccaaagtctccagag 13976

---

>gb|AC147872.3| Monodelphis domestica clone VMRC6-555H19, complete sequence
          Length = 139145

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 334    aaccaccaaagtctccagag 353
              ||||||||||||||||||||
Sbjct: 130009 aaccaccaaagtctccagag 129990

---

>emb|BX323453.7| Zebrafish DNA sequence from clone CH211-212G2 in linkage group 22,
              complete sequence
          Length = 212160

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 33     caacataggagaaacaatta 52
              ||||||||||||||||||||
Sbjct: 153279 caacataggagaaacaatta 153298

---

>emb|AL138478.3|CNS01DWR Human chromosome 14 DNA sequence BAC R-681H18 of library RPCI-11 from
              chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 188717

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 345    tctccagagttgggaagggg 364
              ||||||||||||||||||||
Sbjct: 152301 tctccagagttgggaagggg 152320

---

>emb|CR812957.13| Zebrafish DNA sequence from clone DKEY-41L5 in linkage group 1, complete
              sequence
          Length = 220462

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 33     caacataggagaaacaatta 52
              ||||||||||||||||||||
Sbjct: 170932 caacataggagaaacaatta 170913

---

>emb|AL954329.7| Zebrafish DNA sequence from clone CH211-226C11 in linkage group 23,
             complete sequence
          Length = 194284

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 33    caacataggagaaacaatta 52
             ||||||||||||||||||||
Sbjct: 11111 caacataggagaaacaatta 11092

---

>gb|DP000021.1| Monodelphis domestica target 1 genomic scaffold
          Length = 1833844

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 334     aaccaccaaagtctccagag 353
               ||||||||||||||||||||
Sbjct: 1766342 aaccaccaaagtctccagag 1766323

---

>emb|AL137785.6|CNS01DWN Human chromosome 14 DNA sequence BAC R-151G14 of library RPCI-11 from
             chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 155729

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 345   tctccagagttgggaagggg 364
             ||||||||||||||||||||
Sbjct: 77128 tctccagagttgggaagggg 77109

---

>gb|M17522.1|PDEBC1 P.denitrificans bc1 operon genes encoding three subunits (FeS, b
           and c1) of the cytochrome bc1 complex, complete cds
          Length = 3840

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 44/52 (84%)
 Strand = Plus / Minus

                                                               
Query: 283 tgcggattctgccagagatgtcgtagtgggagccatggcacgggcagaacca 334
           ||||||| | ||| ||| ||||||| || || || |||||||||||||||||
Sbjct: 746 tgcggatgcggcccgaggtgtcgtaatgcgacccgtggcacgggcagaacca 695


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,631,775
Number of Sequences: 3902068
Number of extensions: 4631775
Number of successful extensions: 78904
Number of sequences better than 10.0: 161
Number of HSP's better than 10.0 without gapping: 155
Number of HSP's successfully gapped in prelim test: 6
Number of HSP's that attempted gapping in prelim test: 78433
Number of HSP's gapped (non-prelim): 470
length of query: 525
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 502
effective length of database: 17,143,297,704
effective search space: 8605935447408
effective search space used: 8605935447408
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)

---