ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | rbags18g22 |
|---|---|
| Clone Library Name | barley_pub |
>gb|AY103621.1| Zea mays PCO154872 mRNA sequence Length = 805 Score = 569 bits (287), Expect = e-159 Identities = 392/427 (91%) Strand = Plus / Minus Query: 233 ggtacaccagcgggaacttgatcttcgagttgtggaactgcttcgtgttgtccctcttgc 292 ||||||| |||||||||||||||| ||||||||||||||||| |||||||||||||||| Sbjct: 533 ggtacacaagcgggaacttgatctcggagttgtggaactgcttggtgttgtccctcttgc 474 Query: 293 acagcttgaagtccaccgtcgcagtcttgatgatctggatgcacggggaacgcacgcggt 352 |||||||||||| |||||||| |||||||||||||| ||||| ||||| | |||||||| Sbjct: 473 acagcttgaagtggaccgtcgctgtcttgatgatctgtatgcagggggacctcacgcggt 414 Query: 353 gccgcgacgccatctccgtgtacatctgctccacaccgccgttcagagtcgtgtcgcggt 412 | || || |||||||| |||||||||||||||| |||||||||| || |||||||||| Sbjct: 413 ggcgggaggccatctcgttgtacatctgctccactgcgccgttcagggtggtgtcgcggt 354 Query: 413 actccttgtacatgttgtggtaaccggtcctgctctggtagcgcagccagatgccgtagt 472 ||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||| Sbjct: 353 actccttgtacatgttgtggtaaccagtcctgctctggtagcgcagccagatgccatagt 294 Query: 473 tcttgatggtggtcgggttcttctcaaagatctcgttgatggcgagcatctggccgttgg 532 ||||||||||||||||||| ||||||||||||||||||||| ||||||||||| ||| Sbjct: 293 tcttgatggtggtcgggttgcgctcaaagatctcgttgatggcaagcatctggccattgc 234 Query: 533 ccttcttcaccttcttgagcttcctcaggaagtaccagaacttggacttggcgcggacct 592 ||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||| Sbjct: 233 tcttcttcaccttcttgagctttctcaggaagtaccagaacttggacttggcgcgaacct 174 Query: 593 cgttggtggcccagagcttcatgcggtagatcttgggctgctcatcgcccggggtcggca 652 ||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||| Sbjct: 173 cgttggtggcccagagcttcatgcggtagatcttggggtgctcatcggttggggtcggca 114 Query: 653 gcgcgcg 659 ||||||| Sbjct: 113 gcgcgcg 107
>dbj|AK102673.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033102C12, full insert sequence Length = 966 Score = 513 bits (259), Expect = e-142 Identities = 385/427 (90%) Strand = Plus / Minus Query: 233 ggtacaccagcgggaacttgatcttcgagttgtggaactgcttcgtgttgtccctcttgc 292 ||||||| |||||||||||||| |||||||||||||||||||| |||||||||||||||| Sbjct: 531 ggtacacgagcgggaacttgatattcgagttgtggaactgcttagtgttgtccctcttgc 472 Query: 293 acagcttgaagtccaccgtcgcagtcttgatgatctggatgcacggggaacgcacgcggt 352 | |||||||||| || || || |||||||||||||| ||||| ||| | | ||| |||| Sbjct: 471 agagcttgaagtgaactgttgcggtcttgatgatctgaatgcaggggaacctcacacggt 412 Query: 353 gccgcgacgccatctccgtgtacatctgctccacaccgccgttcagagtcgtgtcgcggt 412 | || || |||||||| |||||||||||||||||| | || |||||||| ||||| |||| Sbjct: 411 gacgagaggccatctcggtgtacatctgctccacagcaccattcagagtagtgtcacggt 352 Query: 413 actccttgtacatgttgtggtaaccggtcctgctctggtagcgcagccagatgccgtagt 472 | ||||||||||||||||||||||| || ||||||||||| ||||||||||||||||||| Sbjct: 351 attccttgtacatgttgtggtaacctgttctgctctggtaacgcagccagatgccgtagt 292 Query: 473 tcttgatggtggtcgggttcttctcaaagatctcgttgatggcgagcatctggccgttgg 532 ||||||| || || ||||| |||||||||||||||||||||||||||||| || ||| Sbjct: 291 tcttgatcgttgtagggttacgctcaaagatctcgttgatggcgagcatctgtccattgc 232 Query: 533 ccttcttcaccttcttgagcttcctcaggaagtaccagaacttggacttggcgcggacct 592 ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| Sbjct: 231 tcttcttcaccttcttcagcttcctcaggaagtaccagaacttggacttggcgcggacct 172 Query: 593 cgttggtggcccagagcttcatgcggtagatcttgggctgctcatcgcccggggtcggca 652 ||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||| | Sbjct: 171 cgttggtggcccagagcttcatgcggtagatcttggggtgctcatcgccgggggtcggga 112 Query: 653 gcgcgcg 659 ||||||| Sbjct: 111 gcgcgcg 105
>gb|BT017327.1| Zea mays clone EL01N0320F05.c mRNA sequence Length = 791 Score = 505 bits (255), Expect = e-140 Identities = 378/419 (90%) Strand = Plus / Minus Query: 241 agcgggaacttgatcttcgagttgtggaactgcttcgtgttgtccctcttgcacagcttg 300 |||||||||||||||| ||||||||||||||| ||||||||||||||||| |||||| Sbjct: 503 agcgggaacttgatctcactgttgtggaactgcttagtgttgtccctcttgcagagcttg 444 Query: 301 aagtccaccgtcgcagtcttgatgatctggatgcacggggaacgcacgcggtgccgcgac 360 |||| |||||||||||||||||||||||||||||| ||||| | ||||||||| || || Sbjct: 443 aagtgcaccgtcgcagtcttgatgatctggatgcagggggacctcacgcggtggcgagag 384 Query: 361 gccatctccgtgtacatctgctccacaccgccgttcagagtcgtgtcgcggtactccttg 420 |||||||| ||||||||||||||||| |||| ||||| || |||||||||||||||||| Sbjct: 383 gccatctcgttgtacatctgctccacagcgccattcagggttgtgtcgcggtactccttg 324 Query: 421 tacatgttgtggtaaccggtcctgctctggtagcgcagccagatgccgtagttcttgatg 480 |||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||| Sbjct: 323 tacatgttgtggtagccggttctgctctggtagcgcagccagatgccgtagttcttgatt 264 Query: 481 gtggtcgggttcttctcaaagatctcgttgatggcgagcatctggccgttggccttcttc 540 || |||||||| ||||||||||||||||||||| || | |||||||||| |||||| Sbjct: 263 gtcgtcgggttacgctcaaagatctcgttgatggccaggacctggccgttgctcttctta 204 Query: 541 accttcttgagcttcctcaggaagtaccagaacttggacttggcgcggacctcgttggtg 600 |||||||| | |||||||| |||||||||||||||| |||||||||||||||||||||| Sbjct: 203 accttcttcaacttcctcaagaagtaccagaacttgctcttggcgcggacctcgttggtg 144 Query: 601 gcccagagcttcatgcggtagatcttgggctgctcatcgcccggggtcggcagcgcgcg 659 |||||||||||||||||||||||||||| ||||||||||| || |||||||||||||| Sbjct: 143 gcccagagcttcatgcggtagatcttggagtgctcatcgccgggcgtcggcagcgcgcg 85
>gb|AY103768.1| Zea mays PCO155588 mRNA sequence Length = 818 Score = 490 bits (247), Expect = e-135 Identities = 382/427 (89%) Strand = Plus / Minus Query: 233 ggtacaccagcgggaacttgatcttcgagttgtggaactgcttcgtgttgtccctcttgc 292 ||||||| || ||||||||||||| ||||||||||||||| |||||||||||||||| Sbjct: 529 ggtacacgagtgggaacttgatctcactgttgtggaactgcttagtgttgtccctcttgc 470 Query: 293 acagcttgaagtccaccgtcgcagtcttgatgatctggatgcacggggaacgcacgcggt 352 | |||||||||| |||||||||||||||||||||||||||||| ||||| | |||||||| Sbjct: 469 agagcttgaagtgcaccgtcgcagtcttgatgatctggatgcagggggacctcacgcggt 410 Query: 353 gccgcgacgccatctccgtgtacatctgctccacaccgccgttcagagtcgtgtcgcggt 412 | || || |||||||| ||||||||||||||||| |||| ||||| || |||||||||| Sbjct: 409 ggcgagaagccatctcgttgtacatctgctccacagcgccattcagggttgtgtcgcggt 350 Query: 413 actccttgtacatgttgtggtaaccggtcctgctctggtagcgcagccagatgccgtagt 472 |||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||| Sbjct: 349 actccttgtacatgttgtggtagccggttctgctctggtagcgcagccagatgccgtagt 290 Query: 473 tcttgatggtggtcgggttcttctcaaagatctcgttgatggcgagcatctggccgttgg 532 ||||||| || |||||||| ||| ||||||||||||||||| || | ||| |||||| Sbjct: 289 tcttgatcgtcgtcgggttacgctcgaagatctcgttgatggccaggacctgaccgttgc 230 Query: 533 ccttcttcaccttcttgagcttcctcaggaagtaccagaacttggacttggcgcggacct 592 |||||| |||||||| | ||||||||||||||||||||||||| |||||||||||| | Sbjct: 229 tcttcttaaccttcttcaacttcctcaggaagtaccagaacttgctcttggcgcggactt 170 Query: 593 cgttggtggcccagagcttcatgcggtagatcttgggctgctcatcgcccggggtcggca 652 ||||||||||||||||||||||||||||||||||||| ||||| ||||| || ||||||| Sbjct: 169 cgttggtggcccagagcttcatgcggtagatcttggggtgctcgtcgccgggcgtcggca 110 Query: 653 gcgcgcg 659 ||||||| Sbjct: 109 gcgcgcg 103
>gb|BT016199.1| Zea mays clone Contig32 mRNA sequence Length = 732 Score = 466 bits (235), Expect = e-128 Identities = 379/427 (88%) Strand = Plus / Minus Query: 233 ggtacaccagcgggaacttgatcttcgagttgtggaactgcttcgtgttgtccctcttgc 292 ||||||| || ||||||||||||| |||||| |||||||| |||||||||||||||| Sbjct: 536 ggtacacgagtgggaacttgatctcactgttgtgaaactgcttggtgttgtccctcttgc 477 Query: 293 acagcttgaagtccaccgtcgcagtcttgatgatctggatgcacggggaacgcacgcggt 352 |||||||||||| ||| || || |||||||||||||||||||| ||||| | |||||||| Sbjct: 476 acagcttgaagtgcactgtggcggtcttgatgatctggatgcatggggacctcacgcggt 417 Query: 353 gccgcgacgccatctccgtgtacatctgctccacaccgccgttcagagtcgtgtcgcggt 412 | || || |||||||| ||||||||||||| ||| |||||||||| || |||||||||| Sbjct: 416 ggcgagaagccatctcattgtacatctgctctacagcgccgttcagggttgtgtcgcggt 357 Query: 413 actccttgtacatgttgtggtaaccggtcctgctctggtagcgcagccagatgccgtagt 472 |||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||| Sbjct: 356 actccttgtacatgttgtggtagccggttctgctctggtagcgcagccagatgccgtagt 297 Query: 473 tcttgatggtggtcgggttcttctcaaagatctcgttgatggcgagcatctggccgttgg 532 ||||||| || |||||||| ||| ||||||||||||||||| || | ||| |||||| Sbjct: 296 tcttgatcgtcgtcgggttacgctcgaagatctcgttgatggccaggacctgaccgttgc 237 Query: 533 ccttcttcaccttcttgagcttcctcaggaagtaccagaacttggacttggcgcggacct 592 |||||| |||||||| | ||||||||||||||||||||||||| |||||||||||| | Sbjct: 236 tcttcttaaccttcttcaacttcctcaggaagtaccagaacttgctcttggcgcggactt 177 Query: 593 cgttggtggcccagagcttcatgcggtagatcttgggctgctcatcgcccggggtcggca 652 ||||||||||||||||||||||||||||||||||||| ||||| ||||| || ||||||| Sbjct: 176 cgttggtggcccagagcttcatgcggtagatcttggggtgctcgtcgccgggcgtcggca 117 Query: 653 gcgcgcg 659 ||||||| Sbjct: 116 gcgcgcg 110
>gb|BT017504.1| Zea mays clone EL01N0414H05.c mRNA sequence Length = 834 Score = 428 bits (216), Expect = e-116 Identities = 336/376 (89%) Strand = Plus / Minus Query: 284 ccctcttgcacagcttgaagtccaccgtcgcagtcttgatgatctggatgcacggggaac 343 ||||||||||||||||||||| ||| || || |||||||||||||||||||| ||||| | Sbjct: 465 ccctcttgcacagcttgaagtgcactgtggcggtcttgatgatctggatgcatggggacc 406 Query: 344 gcacgcggtgccgcgacgccatctccgtgtacatctgctccacaccgccgttcagagtcg 403 ||||||||| || || |||||||| ||||||||||||| ||| |||||||||| || | Sbjct: 405 tcacgcggtggcgagaagccatctcattgtacatctgctctacagcgccgttcagggttg 346 Query: 404 tgtcgcggtactccttgtacatgttgtggtaaccggtcctgctctggtagcgcagccaga 463 ||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||| Sbjct: 345 tgtcgcggtactccttgtacatgttgtggtagccggttctgctctggtagcgcagccaga 286 Query: 464 tgccgtagttcttgatggtggtcgggttcttctcaaagatctcgttgatggcgagcatct 523 |||||||||||||||| || |||||||| ||| ||||||||||||||||| || | || Sbjct: 285 tgccgtagttcttgatcgtcgtcgggttacgctcgaagatctcgttgatggccaggacct 226 Query: 524 ggccgttggccttcttcaccttcttgagcttcctcaggaagtaccagaacttggacttgg 583 | |||||| |||||| |||||||| | ||||||||||||||||||||||||| ||||| Sbjct: 225 gaccgttgctcttcttaaccttcttcaacttcctcaggaagtaccagaacttgctcttgg 166 Query: 584 cgcggacctcgttggtggcccagagcttcatgcggtagatcttgggctgctcatcgcccg 643 ||||||| |||||||||||||||||||||||||||||||||||||| ||||| ||||| | Sbjct: 165 cgcggacttcgttggtggcccagagcttcatgcggtagatcttggggtgctcgtcgccgg 106 Query: 644 gggtcggcagcgcgcg 659 | |||||||||||||| Sbjct: 105 gcgtcggcagcgcgcg 90
>ref|NM_191253.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 537 Score = 357 bits (180), Expect = 3e-95 Identities = 360/420 (85%) Strand = Plus / Minus Query: 234 gtacaccagcgggaacttgatcttcgagttgtggaactgcttcgtgttgtccctcttgca 293 ||||||||| ||||||||||| | || |||||||||||||| |||||||| | |||||| Sbjct: 465 gtacaccagtgggaacttgatatctgacttgtggaactgcttagtgttgtcacgcttgca 406 Query: 294 cagcttgaagtccaccgtcgcagtcttgatgatctggatgcacggggaacgcacgcggtg 353 || || |||| || || ||||||||||||||||| ||||| ||| | | || ||||| Sbjct: 405 gagtttaaagtggacagtagcagtcttgatgatctgaatgcaagggaatctgacacggtg 346 Query: 354 ccgcgacgccatctccgtgtacatctgctccacaccgccgttcagagtcgtgtcgcggta 413 || || |||||||| |||||||||||||| || | || || || || || || ||||| Sbjct: 345 gcgggaagccatctcagtgtacatctgctcaacggcaccattgagggtggtatcacggta 286 Query: 414 ctccttgtacatgttgtggtaaccggtcctgctctggtagcgcagccagatgccgtagtt 473 ||||||||||||||||||||| || ||||| |||||||| |||||||||||||| ||||| Sbjct: 285 ctccttgtacatgttgtggtagccagtcctactctggtaacgcagccagatgccatagtt 226 Query: 474 cttgatggtggtcgggttcttctcaaagatctcgttgatggcgagcatctggccgttggc 533 |||||| || || |||||||||||||| |||||||||||||| || ||||| |||||| Sbjct: 225 cttgatagttgttgggttcttctcaaaaatctcgttgatggcaaggatctgcccgttgct 166 Query: 534 cttcttcaccttcttgagcttcctcaggaagtaccagaacttggacttggcgcggacctc 593 ||||||||||||||| ||||| | ||||||||||||||||||||||||||||||||||| Sbjct: 165 cttcttcaccttcttcagcttgcggaggaagtaccagaacttggacttggcgcggacctc 106 Query: 594 gttggtggcccagagcttcatgcggtagatcttgggctgctcatcgcccggggtcggcag 653 |||||| ||||||||||||||||||||||||||||| ||||| ||| ||| |||||||| Sbjct: 105 gttggtagcccagagcttcatgcggtagatcttggggtgctcgtcggtcggcgtcggcag 46
>dbj|AK121755.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033088C04, full insert sequence Length = 910 Score = 353 bits (178), Expect = 5e-94 Identities = 346/402 (86%) Strand = Plus / Minus Query: 234 gtacaccagcgggaacttgatcttcgagttgtggaactgcttcgtgttgtccctcttgca 293 ||||||||| ||||||||||| | || |||||||||||||| |||||||| | |||||| Sbjct: 582 gtacaccagtgggaacttgatatctgacttgtggaactgcttagtgttgtcacgcttgca 523 Query: 294 cagcttgaagtccaccgtcgcagtcttgatgatctggatgcacggggaacgcacgcggtg 353 || || |||| || || ||||||||||||||||| ||||| ||| | | || ||||| Sbjct: 522 gagtttaaagtggacagtagcagtcttgatgatctgaatgcaagggaatctgacacggtg 463 Query: 354 ccgcgacgccatctccgtgtacatctgctccacaccgccgttcagagtcgtgtcgcggta 413 || || |||||||| |||||||||||||| || | || || || || || || ||||| Sbjct: 462 gcgggaagccatctcagtgtacatctgctcaacggcaccattgagggtggtatcacggta 403 Query: 414 ctccttgtacatgttgtggtaaccggtcctgctctggtagcgcagccagatgccgtagtt 473 ||||||||||||||||||||| || ||||| |||||||| |||||||||||||| ||||| Sbjct: 402 ctccttgtacatgttgtggtagccagtcctactctggtaacgcagccagatgccatagtt 343 Query: 474 cttgatggtggtcgggttcttctcaaagatctcgttgatggcgagcatctggccgttggc 533 |||||| || || |||||||||||||| |||||||||||||| || ||||| |||||| Sbjct: 342 cttgatagttgttgggttcttctcaaaaatctcgttgatggcaaggatctgcccgttgct 283 Query: 534 cttcttcaccttcttgagcttcctcaggaagtaccagaacttggacttggcgcggacctc 593 ||||||||||||||| ||||| | ||||||||||||||||||||||||||||||||||| Sbjct: 282 cttcttcaccttcttcagcttgcggaggaagtaccagaacttggacttggcgcggacctc 223 Query: 594 gttggtggcccagagcttcatgcggtagatcttgggctgctc 635 |||||| ||||||||||||||||||||||||||||| ||||| Sbjct: 222 gttggtagcccagagcttcatgcggtagatcttggggtgctc 181
>ref|NM_191921.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 588 Score = 325 bits (164), Expect = 1e-85 Identities = 293/336 (87%) Strand = Plus / Minus Query: 233 ggtacaccagcgggaacttgatcttcgagttgtggaactgcttcgtgttgtccctcttgc 292 ||||||| || ||||||||||| || ||||||||||||||| |||||||||||||||| Sbjct: 517 ggtacacaagggggaacttgatgctcccgttgtggaactgcttggtgttgtccctcttgc 458 Query: 293 acagcttgaagtccaccgtcgcagtcttgatgatctggatgcacggggaacgcacgcggt 352 | |||||||||| || || || |||||||||||||||||||| ||| | | ||| |||| Sbjct: 457 agagcttgaagtggacagtggcggtcttgatgatctggatgcaagggaatctcacacggt 398 Query: 353 gccgcgacgccatctccgtgtacatctgctccacaccgccgttcagagtcgtgtcgcggt 412 | || || |||||||| ||||||||||| ||||| | || |||| || ||||| |||| Sbjct: 397 ggcgagaagccatctcggtgtacatctgttccacggcaccattcaatgtagtgtcacggt 338 Query: 413 actccttgtacatgttgtggtaaccggtcctgctctggtagcgcagccagatgccgtagt 472 |||||||||||||||||||||||||||| ||||||||||| |||||||||||||| |||| Sbjct: 337 actccttgtacatgttgtggtaaccggttctgctctggtaacgcagccagatgccatagt 278 Query: 473 tcttgatggtggtcgggttcttctcaaagatctcgttgatggcgagcatctggccgttgg 532 ||||||| ||||| ||||| ||| ||||||||||||||||||||||||||||||||| Sbjct: 277 tcttgatcgtggttgggttgcgctcgaagatctcgttgatggcgagcatctggccgttgc 218 Query: 533 ccttcttcaccttcttgagcttcctcaggaagtacc 568 ||||||||||||||| ||||||||||||||||||| Sbjct: 217 tcttcttcaccttcttcagcttcctcaggaagtacc 182 Score = 135 bits (68), Expect = 2e-28 Identities = 86/92 (93%) Strand = Plus / Minus Query: 568 cagaacttggacttggcgcggacctcgttggtggcccagagcttcatgcggtagatcttg 627 ||||||||| ||||||||||||||| |||||||||||||||||||| |||||||||||| Sbjct: 131 cagaacttgctcttggcgcggacctcattggtggcccagagcttcatccggtagatcttg 72 Query: 628 ggctgctcatcgcccggggtcggcagcgcgcg 659 || ||||||||||| ||||||||||||||||| Sbjct: 71 gggtgctcatcgccgggggtcggcagcgcgcg 40
>gb|DQ175860.1| Hordeum vulgare clone DsC33 Ds insertion site flanking region genomic sequence Length = 556 Score = 285 bits (144), Expect = 9e-74 Identities = 144/144 (100%) Strand = Plus / Plus Query: 11 ttactaatacgaaacaaagtcaagagttgcatcaacgcagcagcatcctcagtgccaact 70 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 6 ttactaatacgaaacaaagtcaagagttgcatcaacgcagcagcatcctcagtgccaact 65 Query: 71 gaaaacattctcaaagtgcataaccaaaacttccacatgcaaaacattcaaactcttaca 130 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 66 gaaaacattctcaaagtgcataaccaaaacttccacatgcaaaacattcaaactcttaca 125 Query: 131 cacgctaaaacagtaggcagtggg 154 |||||||||||||||||||||||| Sbjct: 126 cacgctaaaacagtaggcagtggg 149 Score = 145 bits (73), Expect = 2e-31 Identities = 84/87 (96%), Gaps = 3/87 (3%) Strand = Plus / Plus Query: 487 gggttcttctcaaagatctcgttgatggcgagcatctggccgttggccttcttcaccttc 546 ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| Sbjct: 472 gggttcttctcaaagatctcgttgatggcgagcatctgg---ttggccttcttcaccttc 528 Query: 547 ttgagcttcctcaggaagtaccagaac 573 ||||||||||||||||||||||||||| Sbjct: 529 ttgagcttcctcaggaagtaccagaac 555
>ref|NM_129000.2| Arabidopsis thaliana structural constituent of ribosome AT2G34480 mRNA, complete cds Length = 785 Score = 276 bits (139), Expect = 9e-71 Identities = 331/395 (83%) Strand = Plus / Minus Query: 244 gggaacttgatcttcgagttgtggaactgcttcgtgttgtccctcttgcacagcttgaag 303 |||||||||||||| |||||||||||| || ||| | || ||||||||||||||| Sbjct: 495 gggaacttgatcttgctgttgtggaactgtttagtgctctctctcttgcacagcttggct 436 Query: 304 tccaccgtcgcagtcttgatgatctggatgcacggggaacgcacgcggtgccgcgacgcc 363 || || || |||||||||||||| ||||| ||| | | || ||||| || || ||| Sbjct: 435 gggacagtggctgtcttgatgatctgaatgcaagggaatctgacacggtgacgggatgcc 376 Query: 364 atctccgtgtacatctgctccacaccgccgttcagagtcgtgtcgcggtactccttgtac 423 ||||| |||||||||||||| ||| | ||||| ||||| ||||| ||||||||||||||| Sbjct: 375 atctcagtgtacatctgctcaacagctccgttaagagtggtgtcacggtactccttgtac 316 Query: 424 atgttgtggtaaccggtcctgctctggtagcgcagccagatgccgtagttcttgatggtg 483 ||||||||||| || || || |||||||| | || ||| || ||| |||||||||| || Sbjct: 315 atgttgtggtacccagttctactctggtacctcaaccaaataccgaagttcttgatcgtt 256 Query: 484 gtcgggttcttctcaaagatctcgttgatggcgagcatctggccgttggccttcttcacc 543 || |||||||||||| ||||||||||||||||||||||||| || || |||||||||| Sbjct: 255 gttgggttcttctcatagatctcgttgatggcgagcatctgtccattactcttcttcacc 196 Query: 544 ttcttgagcttcctcaggaagtaccagaacttggacttggcgcggacctcgttggtggcc 603 |||||||||||||||| ||| |||||||||||||||||||| || |||||||| || ||| Sbjct: 195 ttcttgagcttcctcaagaaataccagaacttggacttggcacgaacctcgttcgtagcc 136 Query: 604 cagagcttcatgcggtagatcttgggctgctcatc 638 ||||||||||| | ||| ||||| |||||| |||| Sbjct: 135 cagagcttcatcctgtaaatcttaggctgcacatc 101
>gb|BT000076.1| Arabidopsis thaliana 60S ribosomal protein L18A (At2g34480) mRNA, complete cds Length = 672 Score = 276 bits (139), Expect = 9e-71 Identities = 331/395 (83%) Strand = Plus / Minus Query: 244 gggaacttgatcttcgagttgtggaactgcttcgtgttgtccctcttgcacagcttgaag 303 |||||||||||||| |||||||||||| || ||| | || ||||||||||||||| Sbjct: 455 gggaacttgatcttgctgttgtggaactgtttagtgctctctctcttgcacagcttggct 396 Query: 304 tccaccgtcgcagtcttgatgatctggatgcacggggaacgcacgcggtgccgcgacgcc 363 || || || |||||||||||||| ||||| ||| | | || ||||| || || ||| Sbjct: 395 gggacagtggctgtcttgatgatctgaatgcaagggaatctgacacggtgacgggatgcc 336 Query: 364 atctccgtgtacatctgctccacaccgccgttcagagtcgtgtcgcggtactccttgtac 423 ||||| |||||||||||||| ||| | ||||| ||||| ||||| ||||||||||||||| Sbjct: 335 atctcagtgtacatctgctcaacagctccgttaagagtggtgtcacggtactccttgtac 276 Query: 424 atgttgtggtaaccggtcctgctctggtagcgcagccagatgccgtagttcttgatggtg 483 ||||||||||| || || || |||||||| | || ||| || ||| |||||||||| || Sbjct: 275 atgttgtggtacccagttctactctggtacctcaaccaaataccgaagttcttgatcgtt 216 Query: 484 gtcgggttcttctcaaagatctcgttgatggcgagcatctggccgttggccttcttcacc 543 || |||||||||||| ||||||||||||||||||||||||| || || |||||||||| Sbjct: 215 gttgggttcttctcatagatctcgttgatggcgagcatctgtccattactcttcttcacc 156 Query: 544 ttcttgagcttcctcaggaagtaccagaacttggacttggcgcggacctcgttggtggcc 603 |||||||||||||||| ||| |||||||||||||||||||| || |||||||| || ||| Sbjct: 155 ttcttgagcttcctcaagaaataccagaacttggacttggcacgaacctcgttcgtagcc 96 Query: 604 cagagcttcatgcggtagatcttgggctgctcatc 638 ||||||||||| | ||| ||||| |||||| |||| Sbjct: 95 cagagcttcatcctgtaaatcttaggctgcacatc 61
>gb|AY120778.1| Arabidopsis thaliana 60S ribosomal protein L18A (At2g34480) mRNA, complete cds Length = 734 Score = 276 bits (139), Expect = 9e-71 Identities = 331/395 (83%) Strand = Plus / Minus Query: 244 gggaacttgatcttcgagttgtggaactgcttcgtgttgtccctcttgcacagcttgaag 303 |||||||||||||| |||||||||||| || ||| | || ||||||||||||||| Sbjct: 490 gggaacttgatcttgctgttgtggaactgtttagtgctctctctcttgcacagcttggct 431 Query: 304 tccaccgtcgcagtcttgatgatctggatgcacggggaacgcacgcggtgccgcgacgcc 363 || || || |||||||||||||| ||||| ||| | | || ||||| || || ||| Sbjct: 430 gggacagtggctgtcttgatgatctgaatgcaagggaatctgacacggtgacgggatgcc 371 Query: 364 atctccgtgtacatctgctccacaccgccgttcagagtcgtgtcgcggtactccttgtac 423 ||||| |||||||||||||| ||| | ||||| ||||| ||||| ||||||||||||||| Sbjct: 370 atctcagtgtacatctgctcaacagctccgttaagagtggtgtcacggtactccttgtac 311 Query: 424 atgttgtggtaaccggtcctgctctggtagcgcagccagatgccgtagttcttgatggtg 483 ||||||||||| || || || |||||||| | || ||| || ||| |||||||||| || Sbjct: 310 atgttgtggtacccagttctactctggtacctcaaccaaataccgaagttcttgatcgtt 251 Query: 484 gtcgggttcttctcaaagatctcgttgatggcgagcatctggccgttggccttcttcacc 543 || |||||||||||| ||||||||||||||||||||||||| || || |||||||||| Sbjct: 250 gttgggttcttctcatagatctcgttgatggcgagcatctgtccattactcttcttcacc 191 Query: 544 ttcttgagcttcctcaggaagtaccagaacttggacttggcgcggacctcgttggtggcc 603 |||||||||||||||| ||| |||||||||||||||||||| || |||||||| || ||| Sbjct: 190 ttcttgagcttcctcaagaaataccagaacttggacttggcacgaacctcgttcgtagcc 131 Query: 604 cagagcttcatgcggtagatcttgggctgctcatc 638 ||||||||||| | ||| ||||| |||||| |||| Sbjct: 130 cagagcttcatcctgtaaatcttaggctgcacatc 96
>emb|BX818972.1|CNS0A9U8 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB32ZE10 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 752 Score = 276 bits (139), Expect = 9e-71 Identities = 331/395 (83%) Strand = Plus / Minus Query: 244 gggaacttgatcttcgagttgtggaactgcttcgtgttgtccctcttgcacagcttgaag 303 |||||||||||||| |||||||||||| || ||| | || ||||||||||||||| Sbjct: 489 gggaacttgatcttgctgttgtggaactgtttagtgctctctctcttgcacagcttggct 430 Query: 304 tccaccgtcgcagtcttgatgatctggatgcacggggaacgcacgcggtgccgcgacgcc 363 || || || |||||||||||||| ||||| ||| | | || ||||| || || ||| Sbjct: 429 gggacagtggctgtcttgatgatctgaatgcaagggaatctgacacggtgacgggatgcc 370 Query: 364 atctccgtgtacatctgctccacaccgccgttcagagtcgtgtcgcggtactccttgtac 423 ||||| |||||||||||||| ||| | ||||| ||||| ||||| ||||||||||||||| Sbjct: 369 atctcagtgtacatctgctcaacagctccgttaagagtggtgtcacggtactccttgtac 310 Query: 424 atgttgtggtaaccggtcctgctctggtagcgcagccagatgccgtagttcttgatggtg 483 ||||||||||| || || || |||||||| | || ||| || ||| |||||||||| || Sbjct: 309 atgttgtggtacccagttctactctggtacctcaaccaaataccgaagttcttgatcgtt 250 Query: 484 gtcgggttcttctcaaagatctcgttgatggcgagcatctggccgttggccttcttcacc 543 || |||||||||||| ||||||||||||||||||||||||| || || |||||||||| Sbjct: 249 gttgggttcttctcatagatctcgttgatggcgagcatctgtccattactcttcttcacc 190 Query: 544 ttcttgagcttcctcaggaagtaccagaacttggacttggcgcggacctcgttggtggcc 603 |||||||||||||||| ||| |||||||||||||||||||| || |||||||| || ||| Sbjct: 189 ttcttgagcttcctcaagaaataccagaacttggacttggcacgaacctcgttcgtagcc 130 Query: 604 cagagcttcatgcggtagatcttgggctgctcatc 638 ||||||||||| | ||| ||||| |||||| |||| Sbjct: 129 cagagcttcatcctgtaaatcttaggctgcacatc 95
>emb|BX818907.1|CNS0A9RI Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB25ZH03 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 704 Score = 276 bits (139), Expect = 9e-71 Identities = 331/395 (83%) Strand = Plus / Minus Query: 244 gggaacttgatcttcgagttgtggaactgcttcgtgttgtccctcttgcacagcttgaag 303 |||||||||||||| |||||||||||| || ||| | || ||||||||||||||| Sbjct: 441 gggaacttgatcttgctgttgtggaactgtttagtgctctctctcttgcacagcttggct 382 Query: 304 tccaccgtcgcagtcttgatgatctggatgcacggggaacgcacgcggtgccgcgacgcc 363 || || || |||||||||||||| ||||| ||| | | || ||||| || || ||| Sbjct: 381 gggacagtggctgtcttgatgatctgaatgcaagggaatctgacacggtgacgggatgcc 322 Query: 364 atctccgtgtacatctgctccacaccgccgttcagagtcgtgtcgcggtactccttgtac 423 ||||| |||||||||||||| ||| | ||||| ||||| ||||| ||||||||||||||| Sbjct: 321 atctcagtgtacatctgctcaacagctccgttaagagtggtgtcacggtactccttgtac 262 Query: 424 atgttgtggtaaccggtcctgctctggtagcgcagccagatgccgtagttcttgatggtg 483 ||||||||||| || || || |||||||| | || ||| || ||| |||||||||| || Sbjct: 261 atgttgtggtacccagttctactctggtacctcaaccaaataccgaagttcttgatcgtt 202 Query: 484 gtcgggttcttctcaaagatctcgttgatggcgagcatctggccgttggccttcttcacc 543 || |||||||||||| ||||||||||||||||||||||||| || || |||||||||| Sbjct: 201 gttgggttcttctcatagatctcgttgatggcgagcatctgtccattactcttcttcacc 142 Query: 544 ttcttgagcttcctcaggaagtaccagaacttggacttggcgcggacctcgttggtggcc 603 |||||||||||||||| ||| |||||||||||||||||||| || |||||||| || ||| Sbjct: 141 ttcttgagcttcctcaagaaataccagaacttggacttggcacgaacctcgttcgtagcc 82 Query: 604 cagagcttcatgcggtagatcttgggctgctcatc 638 ||||||||||| | ||| ||||| |||||| |||| Sbjct: 81 cagagcttcatcctgtaaatcttaggctgcacatc 47
>gb|AC124143.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBb0053D02, complete sequence Length = 157106 Score = 272 bits (137), Expect = 1e-69 Identities = 239/273 (87%) Strand = Plus / Minus Query: 233 ggtacaccagcgggaacttgatcttcgagttgtggaactgcttcgtgttgtccctcttgc 292 ||||||| |||||||||||||| |||||||||||||||||||| |||||||||||||||| Sbjct: 130137 ggtacacgagcgggaacttgatattcgagttgtggaactgcttagtgttgtccctcttgc 130078 Query: 293 acagcttgaagtccaccgtcgcagtcttgatgatctggatgcacggggaacgcacgcggt 352 | |||||||||| || || || |||||||||||||| ||||| ||| | | ||| |||| Sbjct: 130077 agagcttgaagtgaactgttgcggtcttgatgatctgaatgcaggggaacctcacacggt 130018 Query: 353 gccgcgacgccatctccgtgtacatctgctccacaccgccgttcagagtcgtgtcgcggt 412 | || || |||||||| |||||||||||||||||| | || |||||||| ||||| |||| Sbjct: 130017 gacgagaggccatctcggtgtacatctgctccacagcaccattcagagtagtgtcacggt 129958 Query: 413 actccttgtacatgttgtggtaaccggtcctgctctggtagcgcagccagatgccgtagt 472 | ||||||||||||||||||||||| || ||||||||||| ||||||||||||||||||| Sbjct: 129957 attccttgtacatgttgtggtaacctgttctgctctggtaacgcagccagatgccgtagt 129898 Query: 473 tcttgatggtggtcgggttcttctcaaagatct 505 ||||||| || || ||||| ||||||||||| Sbjct: 129897 tcttgatcgttgtagggttacgctcaaagatct 129865 Score = 163 bits (82), Expect = 9e-37 Identities = 91/94 (96%) Strand = Plus / Minus Query: 566 accagaacttggacttggcgcggacctcgttggtggcccagagcttcatgcggtagatct 625 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 128693 accagaacttggacttggcgcggacctcgttggtggcccagagcttcatgcggtagatct 128634 Query: 626 tgggctgctcatcgcccggggtcggcagcgcgcg 659 |||| ||||||||||| |||||||| |||||||| Sbjct: 128633 tggggtgctcatcgccgggggtcgggagcgcgcg 128600 Score = 89.7 bits (45), Expect = 1e-14 Identities = 60/65 (92%) Strand = Plus / Minus Query: 504 ctcgttgatggcgagcatctggccgttggccttcttcaccttcttgagcttcctcaggaa 563 ||||||||||||||||||||| || ||| ||||||||||||||| |||||||||||||| Sbjct: 128841 ctcgttgatggcgagcatctgtccattgctcttcttcaccttcttcagcttcctcaggaa 128782 Query: 564 gtacc 568 ||||| Sbjct: 128781 gtacc 128777
>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete sequence Length = 29737217 Score = 272 bits (137), Expect = 1e-69 Identities = 239/273 (87%) Strand = Plus / Minus Query: 233 ggtacaccagcgggaacttgatcttcgagttgtggaactgcttcgtgttgtccctcttgc 292 ||||||| |||||||||||||| |||||||||||||||||||| |||||||||||||||| Sbjct: 27899720 ggtacacgagcgggaacttgatattcgagttgtggaactgcttagtgttgtccctcttgc 27899661 Query: 293 acagcttgaagtccaccgtcgcagtcttgatgatctggatgcacggggaacgcacgcggt 352 | |||||||||| || || || |||||||||||||| ||||| ||| | | ||| |||| Sbjct: 27899660 agagcttgaagtgaactgttgcggtcttgatgatctgaatgcaggggaacctcacacggt 27899601 Query: 353 gccgcgacgccatctccgtgtacatctgctccacaccgccgttcagagtcgtgtcgcggt 412 | || || |||||||| |||||||||||||||||| | || |||||||| ||||| |||| Sbjct: 27899600 gacgagaggccatctcggtgtacatctgctccacagcaccattcagagtagtgtcacggt 27899541 Query: 413 actccttgtacatgttgtggtaaccggtcctgctctggtagcgcagccagatgccgtagt 472 | ||||||||||||||||||||||| || ||||||||||| ||||||||||||||||||| Sbjct: 27899540 attccttgtacatgttgtggtaacctgttctgctctggtaacgcagccagatgccgtagt 27899481 Query: 473 tcttgatggtggtcgggttcttctcaaagatct 505 ||||||| || || ||||| ||||||||||| Sbjct: 27899480 tcttgatcgttgtagggttacgctcaaagatct 27899448 Score = 163 bits (82), Expect = 9e-37 Identities = 91/94 (96%) Strand = Plus / Minus Query: 566 accagaacttggacttggcgcggacctcgttggtggcccagagcttcatgcggtagatct 625 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 27898276 accagaacttggacttggcgcggacctcgttggtggcccagagcttcatgcggtagatct 27898217 Query: 626 tgggctgctcatcgcccggggtcggcagcgcgcg 659 |||| ||||||||||| |||||||| |||||||| Sbjct: 27898216 tggggtgctcatcgccgggggtcgggagcgcgcg 27898183 Score = 89.7 bits (45), Expect = 1e-14 Identities = 60/65 (92%) Strand = Plus / Minus Query: 504 ctcgttgatggcgagcatctggccgttggccttcttcaccttcttgagcttcctcaggaa 563 ||||||||||||||||||||| || ||| ||||||||||||||| |||||||||||||| Sbjct: 27898424 ctcgttgatggcgagcatctgtccattgctcttcttcaccttcttcagcttcctcaggaa 27898365 Query: 564 gtacc 568 ||||| Sbjct: 27898364 gtacc 27898360
>gb|BT006559.1| Arabidopsis thaliana At2g34480 gene, complete cds Length = 537 Score = 268 bits (135), Expect = 2e-68 Identities = 312/371 (84%) Strand = Plus / Minus Query: 244 gggaacttgatcttcgagttgtggaactgcttcgtgttgtccctcttgcacagcttgaag 303 |||||||||||||| |||||||||||| || ||| | || ||||||||||||||| Sbjct: 455 gggaacttgatcttgctgttgtggaactgtttagtgctctctctcttgcacagcttggct 396 Query: 304 tccaccgtcgcagtcttgatgatctggatgcacggggaacgcacgcggtgccgcgacgcc 363 || || || |||||||||||||| ||||| ||| | | || ||||| || || ||| Sbjct: 395 gggacagtggctgtcttgatgatctgaatgcaagggaatctgacacggtgacgggatgcc 336 Query: 364 atctccgtgtacatctgctccacaccgccgttcagagtcgtgtcgcggtactccttgtac 423 ||||| |||||||||||||| ||| | ||||| ||||| ||||| ||||||||||||||| Sbjct: 335 atctcagtgtacatctgctcaacagctccgttaagagtggtgtcacggtactccttgtac 276 Query: 424 atgttgtggtaaccggtcctgctctggtagcgcagccagatgccgtagttcttgatggtg 483 ||||||||||| || || || |||||||| | || ||| || ||| |||||||||| || Sbjct: 275 atgttgtggtacccagttctactctggtacctcaaccaaataccgaagttcttgatcgtt 216 Query: 484 gtcgggttcttctcaaagatctcgttgatggcgagcatctggccgttggccttcttcacc 543 || |||||||||||| ||||||||||||||||||||||||| || || |||||||||| Sbjct: 215 gttgggttcttctcatagatctcgttgatggcgagcatctgtccattactcttcttcacc 156 Query: 544 ttcttgagcttcctcaggaagtaccagaacttggacttggcgcggacctcgttggtggcc 603 |||||||||||||||| ||| |||||||||||||||||||| || |||||||| || ||| Sbjct: 155 ttcttgagcttcctcaagaaataccagaacttggacttggcacgaacctcgttcgtagcc 96 Query: 604 cagagcttcat 614 ||||||||||| Sbjct: 95 cagagcttcat 85
>gb|AY042803.1| Arabidopsis thaliana Unknown protein mRNA, complete cds Length = 755 Score = 268 bits (135), Expect = 2e-68 Identities = 312/371 (84%) Strand = Plus / Minus Query: 244 gggaacttgatcttcgagttgtggaactgcttcgtgttgtccctcttgcacagcttgaag 303 |||||||||||||| |||||||||||| || ||| | || ||||||||||||||| Sbjct: 490 gggaacttgatcttgctgttgtggaactgtttagtgctctctctcttgcacagcttggct 431 Query: 304 tccaccgtcgcagtcttgatgatctggatgcacggggaacgcacgcggtgccgcgacgcc 363 || || || |||||||||||||| ||||| ||| | | || ||||| || || ||| Sbjct: 430 gggacagtggctgtcttgatgatctgaatgcaagggaatctgacacggtgacgggatgcc 371 Query: 364 atctccgtgtacatctgctccacaccgccgttcagagtcgtgtcgcggtactccttgtac 423 ||||| |||||||||||||| ||| | ||||| ||||| ||||| ||||||||||||||| Sbjct: 370 atctcagtgtacatctgctcaacagctccgttaagagtggtgtcacggtactccttgtac 311 Query: 424 atgttgtggtaaccggtcctgctctggtagcgcagccagatgccgtagttcttgatggtg 483 ||||||||||| || || || |||||||| | || ||| || ||| |||||||||| || Sbjct: 310 atgttgtggtacccagttctactctggtacctcaaccaaataccgaagttcttgatcgtt 251 Query: 484 gtcgggttcttctcaaagatctcgttgatggcgagcatctggccgttggccttcttcacc 543 || |||||||||||| ||||||||||||||||||||||||| || || |||||||||| Sbjct: 250 gttgggttcttctcatagatctcgttgatggcgagcatctgtccattactcttcttcacc 191 Query: 544 ttcttgagcttcctcaggaagtaccagaacttggacttggcgcggacctcgttggtggcc 603 |||||||||||||||| ||| |||||||||||||||||||| || |||||||| || ||| Sbjct: 190 ttcttgagcttcctcaagaaataccagaacttggacttggcacgaacctcgttcgtagcc 131 Query: 604 cagagcttcat 614 ||||||||||| Sbjct: 130 cagagcttcat 120
>dbj|D21301.1|RICSS128 Oryza sativa SS128 mRNA for ribosomal protein L18a, partial sequence Length = 380 Score = 262 bits (132), Expect = 1e-66 Identities = 218/247 (88%) Strand = Plus / Minus Query: 233 ggtacaccagcgggaacttgatcttcgagttgtggaactgcttcgtgttgtccctcttgc 292 ||||||| |||||||||||||| |||||||||||||||||||| |||||||||||||||| Sbjct: 262 ggtacacgagcgggaacttgatattcgagttgtggaactgcttagtgttgtccctcttgc 203 Query: 293 acagcttgaagtccaccgtcgcagtcttgatgatctggatgcacggggaacgcacgcggt 352 | |||||||||| || || || |||||||||||||| ||||| ||| | | ||| |||| Sbjct: 202 agagcttgaagtgaactgttgcggtcttgatgatctgaatgcaggggaacctcacacggt 143 Query: 353 gccgcgacgccatctccgtgtacatctgctccacaccgccgttcagagtcgtgtcgcggt 412 | || || |||||||| |||||||||||||||||| | || |||||||| ||||| |||| Sbjct: 142 gacgagaggccatctcggtgtacatctgctccacagcaccattcagagtagtgtcacggt 83 Query: 413 actccttgtacatgttgtggtaaccggtcctgctctggtagcgcagccagatgccgtagt 472 | ||||||||||||||||||||||| || ||||||||||| |||| |||||||||||||| Sbjct: 82 attccttgtacatgttgtggtaacctgttctgctctggtaacgcanccagatgccgtagt 23 Query: 473 tcttgat 479 ||||||| Sbjct: 22 tcttgat 16
>ref|NM_112321.2| Arabidopsis thaliana structural constituent of ribosome AT3G14600 mRNA, complete cds Length = 853 Score = 256 bits (129), Expect = 8e-65 Identities = 332/397 (83%), Gaps = 2/397 (0%) Strand = Plus / Minus Query: 244 gggaacttgatcttcgagttgtggaactgcttcgtgttgtccctcttgcacagctt-gaa 302 |||||||||||||||||||| ||||||||||| ||| | || |||||||| ||||| | | Sbjct: 531 gggaacttgatcttcgagttatggaactgcttggtgatctctctcttgcaaagctttgca 472 Query: 303 gtccaccgtcgcagtcttgatgatctggatgcacggggaacgcacgcggtgccgcgacgc 362 | || |||||||||||||||||||| ||||| ||| | | ||| | || || || || Sbjct: 471 ggg-acagtcgcagtcttgatgatctgaatgcaagggaacctcactctatgacgagaagc 413 Query: 363 catctccgtgtacatctgctccacaccgccgttcagagtcgtgtcgcggtactccttgta 422 |||||| ||||||||||||||||| || || || || || ||||| |||||||||||||| Sbjct: 412 catctcagtgtacatctgctccactccaccattgagtgttgtgtcacggtactccttgta 353 Query: 423 catgttgtggtaaccggtcctgctctggtagcgcagccagatgccgtagttcttgatggt 482 |||||||||||| || || | |||||| || |||| |||||| ||||||||||||||||| Sbjct: 352 catgttgtggtacccagttcggctctgataacgcaaccagatcccgtagttcttgatggt 293 Query: 483 ggtcgggttcttctcaaagatctcgttgatggcgagcatctggccgttggccttcttcac 542 || ||||||||||| || ||||| |||||||| |||||||| |||||| |||||||| Sbjct: 292 cgttgggttcttctcgaaaatctcattgatggcaagcatctgtccgttgcttttcttcac 233 Query: 543 cttcttgagcttcctcaggaagtaccagaacttggacttggcgcggacctcgttggtggc 602 |||||| || ||||||| |||||||||||||||||||||||||| || || || | | Sbjct: 232 cttcttcagtttcctcatgaagtaccagaacttggacttggcgcatacttcatttctacc 173 Query: 603 ccagagcttcatgcggtagatcttgggctgctcatcg 639 ||| |||||||| | ||||||||| || ||||||||| Sbjct: 172 ccaaagcttcatcctgtagatcttagggtgctcatcg 136
>gb|AY097377.1| Arabidopsis thaliana AT3g14600/MIE1_10 mRNA, complete cds Length = 537 Score = 256 bits (129), Expect = 8e-65 Identities = 332/397 (83%), Gaps = 2/397 (0%) Strand = Plus / Minus Query: 244 gggaacttgatcttcgagttgtggaactgcttcgtgttgtccctcttgcacagctt-gaa 302 |||||||||||||||||||| ||||||||||| ||| | || |||||||| ||||| | | Sbjct: 455 gggaacttgatcttcgagttatggaactgcttggtgatctctctcttgcaaagctttgca 396 Query: 303 gtccaccgtcgcagtcttgatgatctggatgcacggggaacgcacgcggtgccgcgacgc 362 | || |||||||||||||||||||| ||||| ||| | | ||| | || || || || Sbjct: 395 ggg-acagtcgcagtcttgatgatctgaatgcaagggaacctcactctatgacgagaagc 337 Query: 363 catctccgtgtacatctgctccacaccgccgttcagagtcgtgtcgcggtactccttgta 422 |||||| ||||||||||||||||| || || || || || ||||| |||||||||||||| Sbjct: 336 catctcagtgtacatctgctccactccaccattgagtgttgtgtcacggtactccttgta 277 Query: 423 catgttgtggtaaccggtcctgctctggtagcgcagccagatgccgtagttcttgatggt 482 |||||||||||| || || | |||||| || |||| |||||| ||||||||||||||||| Sbjct: 276 catgttgtggtacccagttcggctctgataacgcaaccagatcccgtagttcttgatggt 217 Query: 483 ggtcgggttcttctcaaagatctcgttgatggcgagcatctggccgttggccttcttcac 542 || ||||||||||| || ||||| |||||||| |||||||| |||||| |||||||| Sbjct: 216 cgttgggttcttctcgaaaatctcattgatggcaagcatctgtccgttgcttttcttcac 157 Query: 543 cttcttgagcttcctcaggaagtaccagaacttggacttggcgcggacctcgttggtggc 602 |||||| || ||||||| |||||||||||||||||||||||||| || || || | | Sbjct: 156 cttcttcagtttcctcatgaagtaccagaacttggacttggcgcatacttcatttctacc 97 Query: 603 ccagagcttcatgcggtagatcttgggctgctcatcg 639 ||| |||||||| | ||||||||| || ||||||||| Sbjct: 96 ccaaagcttcatcctgtagatcttagggtgctcatcg 60
>gb|AY072540.1| Arabidopsis thaliana AT3g14600/MIE1_10 mRNA, complete cds Length = 829 Score = 256 bits (129), Expect = 8e-65 Identities = 332/397 (83%), Gaps = 2/397 (0%) Strand = Plus / Minus Query: 244 gggaacttgatcttcgagttgtggaactgcttcgtgttgtccctcttgcacagctt-gaa 302 |||||||||||||||||||| ||||||||||| ||| | || |||||||| ||||| | | Sbjct: 506 gggaacttgatcttcgagttatggaactgcttggtgatctctctcttgcaaagctttgca 447 Query: 303 gtccaccgtcgcagtcttgatgatctggatgcacggggaacgcacgcggtgccgcgacgc 362 | || |||||||||||||||||||| ||||| ||| | | ||| | || || || || Sbjct: 446 ggg-acagtcgcagtcttgatgatctgaatgcaagggaacctcactctatgacgagaagc 388 Query: 363 catctccgtgtacatctgctccacaccgccgttcagagtcgtgtcgcggtactccttgta 422 |||||| ||||||||||||||||| || || || || || ||||| |||||||||||||| Sbjct: 387 catctcagtgtacatctgctccactccaccattgagtgttgtgtcacggtactccttgta 328 Query: 423 catgttgtggtaaccggtcctgctctggtagcgcagccagatgccgtagttcttgatggt 482 |||||||||||| || || | |||||| || |||| |||||| ||||||||||||||||| Sbjct: 327 catgttgtggtacccagttcggctctgataacgcaaccagatcccgtagttcttgatggt 268 Query: 483 ggtcgggttcttctcaaagatctcgttgatggcgagcatctggccgttggccttcttcac 542 || ||||||||||| || ||||| |||||||| |||||||| |||||| |||||||| Sbjct: 267 cgttgggttcttctcgaaaatctcattgatggcaagcatctgtccgttgcttttcttcac 208 Query: 543 cttcttgagcttcctcaggaagtaccagaacttggacttggcgcggacctcgttggtggc 602 |||||| || ||||||| |||||||||||||||||||||||||| || || || | | Sbjct: 207 cttcttcagtttcctcatgaagtaccagaacttggacttggcgcatacttcatttctacc 148 Query: 603 ccagagcttcatgcggtagatcttgggctgctcatcg 639 ||| |||||||| | ||||||||| || ||||||||| Sbjct: 147 ccaaagcttcatcctgtagatcttagggtgctcatcg 111
>emb|BX819594.1|CNS0A9TR Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB92ZG02 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 711 Score = 242 bits (122), Expect = 1e-60 Identities = 326/394 (82%) Strand = Plus / Minus Query: 245 ggaacttgatcttcgagttgtggaactgcttcgtgttgtccctcttgcacagcttgaagt 304 ||||||||||||| |||||||||||| || ||| | || ||||||||||||||| Sbjct: 490 ggaacttgatcttgctgttgtggaactgtttagtgctctctctcttgcacagcttggctg 431 Query: 305 ccaccgtcgcagtcttgatgatctggatgcacggggaacgcacgcggtgccgcgacgcca 364 || || || |||||||||||||| ||||| ||| | | || |||| || || |||| Sbjct: 430 ggacagttgctgtcttgatgatctgaatgcaagggaatcttacaaggtgacgggatgcca 371 Query: 365 tctccgtgtacatctgctccacaccgccgttcagagtcgtgtcgcggtactccttgtaca 424 |||| || ||||||||||| ||| | ||||| ||||| |||| |||||||||||||||| Sbjct: 370 tctcagtatacatctgctcaacagcaccgttaagagtggtgtaacggtactccttgtaca 311 Query: 425 tgttgtggtaaccggtcctgctctggtagcgcagccagatgccgtagttcttgatggtgg 484 |||||||||| || || || |||||||| | || ||| || ||| |||||||||| || | Sbjct: 310 tgttgtggtacccagttctactctggtacctcaaccaaataccgaagttcttgatcgttg 251 Query: 485 tcgggttcttctcaaagatctcgttgatggcgagcatctggccgttggccttcttcacct 544 | |||||||||||| |||||||||||||||||||||||| || || ||||||||||| Sbjct: 250 ttgggttcttctcatagatctcgttgatggcgagcatctttccattactcttcttcacct 191 Query: 545 tcttgagcttcctcaggaagtaccagaacttggacttggcgcggacctcgttggtggccc 604 ||||||||||||||| ||| |||||||||||||||||||| || |||||||| || |||| Sbjct: 190 tcttgagcttcctcaagaaataccagaacttggacttggcacgaacctcgttcgtagccc 131 Query: 605 agagcttcatgcggtagatcttgggctgctcatc 638 |||||||||| | ||| ||||| |||||| |||| Sbjct: 130 agagcttcatcctgtaaatcttaggctgcacatc 97
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete sequence Length = 43261740 Score = 228 bits (115), Expect = 2e-56 Identities = 223/259 (86%) Strand = Plus / Plus Query: 233 ggtacaccagcgggaacttgatcttcgagttgtggaactgcttcgtgttgtccctcttgc 292 ||||||| || ||||||||||| || ||||||||||||||| |||||||||||||||| Sbjct: 27260170 ggtacacaagggggaacttgatgctcccgttgtggaactgcttggtgttgtccctcttgc 27260229 Query: 293 acagcttgaagtccaccgtcgcagtcttgatgatctggatgcacggggaacgcacgcggt 352 | |||||||||| || || || |||||||||||||||||||| ||| | | ||| |||| Sbjct: 27260230 agagcttgaagtggacagtggcggtcttgatgatctggatgcaagggaatctcacacggt 27260289 Query: 353 gccgcgacgccatctccgtgtacatctgctccacaccgccgttcagagtcgtgtcgcggt 412 | || || |||||||| ||||||||||| ||||| | || |||| || ||||| |||| Sbjct: 27260290 ggcgagaagccatctcggtgtacatctgttccacggcaccattcaatgtagtgtcacggt 27260349 Query: 413 actccttgtacatgttgtggtaaccggtcctgctctggtagcgcagccagatgccgtagt 472 |||||||||||||||||||||||||||| ||||||||||| |||||||||||||| |||| Sbjct: 27260350 actccttgtacatgttgtggtaaccggttctgctctggtaacgcagccagatgccatagt 27260409 Query: 473 tcttgatggtggtcgggtt 491 ||||||| ||||| ||||| Sbjct: 27260410 tcttgatcgtggttgggtt 27260428 Score = 182 bits (92), Expect = 1e-42 Identities = 227/272 (83%) Strand = Plus / Plus Query: 234 gtacaccagcgggaacttgatcttcgagttgtggaactgcttcgtgttgtccctcttgca 293 ||||||||| ||||||||||| | || |||||||||||||| |||||||| | |||||| Sbjct: 31552819 gtacaccagtgggaacttgatatctgacttgtggaactgcttagtgttgtcacgcttgca 31552878 Query: 294 cagcttgaagtccaccgtcgcagtcttgatgatctggatgcacggggaacgcacgcggtg 353 || || |||| || || ||||||||||||||||| ||||| ||| | | || ||||| Sbjct: 31552879 gagtttaaagtggacagtagcagtcttgatgatctgaatgcaagggaatctgacacggtg 31552938 Query: 354 ccgcgacgccatctccgtgtacatctgctccacaccgccgttcagagtcgtgtcgcggta 413 || || |||||||| |||||||||||||| || | || || || || || || ||||| Sbjct: 31552939 gcgggaagccatctcagtgtacatctgctcaacggcaccattgagggtggtatcacggta 31552998 Query: 414 ctccttgtacatgttgtggtaaccggtcctgctctggtagcgcagccagatgccgtagtt 473 ||||||||||||||||||||| || ||||| |||||||| |||||||||||||| ||||| Sbjct: 31552999 ctccttgtacatgttgtggtagccagtcctactctggtaacgcagccagatgccatagtt 31553058 Query: 474 cttgatggtggtcgggttcttctcaaagatct 505 |||||| || || |||||||||||||| |||| Sbjct: 31553059 cttgatagttgttgggttcttctcaaaaatct 31553090 Score = 139 bits (70), Expect = 1e-29 Identities = 88/94 (93%) Strand = Plus / Plus Query: 566 accagaacttggacttggcgcggacctcgttggtggcccagagcttcatgcggtagatct 625 ||||||||||| ||||||||||||||| |||||||||||||||||||| |||||||||| Sbjct: 27261401 accagaacttgctcttggcgcggacctcattggtggcccagagcttcatccggtagatct 27261460 Query: 626 tgggctgctcatcgcccggggtcggcagcgcgcg 659 |||| ||||||||||| ||||||||||||||||| Sbjct: 27261461 tggggtgctcatcgccgggggtcggcagcgcgcg 27261494 Score = 127 bits (64), Expect = 5e-26 Identities = 82/88 (93%) Strand = Plus / Plus Query: 566 accagaacttggacttggcgcggacctcgttggtggcccagagcttcatgcggtagatct 625 |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| Sbjct: 31553741 accagaacttggacttggcgcggacctcgttggtagcccagagcttcatgcggtagatct 31553800 Query: 626 tgggctgctcatcgcccggggtcggcag 653 |||| ||||| ||| ||| |||||||| Sbjct: 31553801 tggggtgctcgtcggtcggcgtcggcag 31553828 Score = 105 bits (53), Expect = 2e-19 Identities = 62/65 (95%) Strand = Plus / Plus Query: 504 ctcgttgatggcgagcatctggccgttggccttcttcaccttcttgagcttcctcaggaa 563 |||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||| Sbjct: 27261236 ctcgttgatggcgagcatctggccgttgctcttcttcaccttcttcagcttcctcaggaa 27261295 Query: 564 gtacc 568 ||||| Sbjct: 27261296 gtacc 27261300 Score = 58.0 bits (29), Expect = 4e-05 Identities = 56/65 (86%) Strand = Plus / Plus Query: 504 ctcgttgatggcgagcatctggccgttggccttcttcaccttcttgagcttcctcaggaa 563 |||||||||||| || ||||| |||||| ||||||||||||||| ||||| | ||||| Sbjct: 31553583 ctcgttgatggcaaggatctgcccgttgctcttcttcaccttcttcagcttgcggaggaa 31553642 Query: 564 gtacc 568 ||||| Sbjct: 31553643 gtacc 31553647
>dbj|AP003760.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC clone:OSJNBb0063G05 Length = 182681 Score = 228 bits (115), Expect = 2e-56 Identities = 223/259 (86%) Strand = Plus / Plus Query: 233 ggtacaccagcgggaacttgatcttcgagttgtggaactgcttcgtgttgtccctcttgc 292 ||||||| || ||||||||||| || ||||||||||||||| |||||||||||||||| Sbjct: 40687 ggtacacaagggggaacttgatgctcccgttgtggaactgcttggtgttgtccctcttgc 40746 Query: 293 acagcttgaagtccaccgtcgcagtcttgatgatctggatgcacggggaacgcacgcggt 352 | |||||||||| || || || |||||||||||||||||||| ||| | | ||| |||| Sbjct: 40747 agagcttgaagtggacagtggcggtcttgatgatctggatgcaagggaatctcacacggt 40806 Query: 353 gccgcgacgccatctccgtgtacatctgctccacaccgccgttcagagtcgtgtcgcggt 412 | || || |||||||| ||||||||||| ||||| | || |||| || ||||| |||| Sbjct: 40807 ggcgagaagccatctcggtgtacatctgttccacggcaccattcaatgtagtgtcacggt 40866 Query: 413 actccttgtacatgttgtggtaaccggtcctgctctggtagcgcagccagatgccgtagt 472 |||||||||||||||||||||||||||| ||||||||||| |||||||||||||| |||| Sbjct: 40867 actccttgtacatgttgtggtaaccggttctgctctggtaacgcagccagatgccatagt 40926 Query: 473 tcttgatggtggtcgggtt 491 ||||||| ||||| ||||| Sbjct: 40927 tcttgatcgtggttgggtt 40945 Score = 139 bits (70), Expect = 1e-29 Identities = 88/94 (93%) Strand = Plus / Plus Query: 566 accagaacttggacttggcgcggacctcgttggtggcccagagcttcatgcggtagatct 625 ||||||||||| ||||||||||||||| |||||||||||||||||||| |||||||||| Sbjct: 41918 accagaacttgctcttggcgcggacctcattggtggcccagagcttcatccggtagatct 41977 Query: 626 tgggctgctcatcgcccggggtcggcagcgcgcg 659 |||| ||||||||||| ||||||||||||||||| Sbjct: 41978 tggggtgctcatcgccgggggtcggcagcgcgcg 42011 Score = 105 bits (53), Expect = 2e-19 Identities = 62/65 (95%) Strand = Plus / Plus Query: 504 ctcgttgatggcgagcatctggccgttggccttcttcaccttcttgagcttcctcaggaa 563 |||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||| Sbjct: 41753 ctcgttgatggcgagcatctggccgttgctcttcttcaccttcttcagcttcctcaggaa 41812 Query: 564 gtacc 568 ||||| Sbjct: 41813 gtacc 41817
>gb|AY088351.1| Arabidopsis thaliana clone 5961 mRNA, complete sequence Length = 767 Score = 222 bits (112), Expect = 1e-54 Identities = 288/344 (83%), Gaps = 2/344 (0%) Strand = Plus / Minus Query: 244 gggaacttgatcttcgagttgtggaactgcttcgtgttgtccctcttgcacagctt-gaa 302 |||||||||||||||||||| ||||||||||| ||| | || |||||||| ||||| | | Sbjct: 531 gggaacttgatcttcgagttatggaactgcttggtgatctctctcttgcaaagctttgca 472 Query: 303 gtccaccgtcgcagtcttgatgatctggatgcacggggaacgcacgcggtgccgcgacgc 362 | || |||||||||||||||||||| ||||| ||| | | ||| | || || || || Sbjct: 471 ggg-acagtcgcagtcttgatgatctgaatgcaagggaacctcactctatgacgagaagc 413 Query: 363 catctccgtgtacatctgctccacaccgccgttcagagtcgtgtcgcggtactccttgta 422 ||||| ||||||||||||||||| || || || || || ||||| |||||||||||||| Sbjct: 412 aatctcagtgtacatctgctccactccaccattgagtgttgtgtcacggtactccttgta 353 Query: 423 catgttgtggtaaccggtcctgctctggtagcgcagccagatgccgtagttcttgatggt 482 |||||||||||| || || | |||||| || |||| |||||| ||||| |||||||| || Sbjct: 352 catgttgtggtacccagttcggctctgataacgcaaccagatcccgtaattcttgattgt 293 Query: 483 ggtcgggttcttctcaaagatctcgttgatggcgagcatctggccgttggccttcttcac 542 || ||||||||||| || ||||| |||||||| |||||||| |||||| |||||||| Sbjct: 292 cgttgggttcttctcgaaaatctcattgatggcaagcatctgcccgttgcttttcttcac 233 Query: 543 cttcttgagcttcctcaggaagtaccagaacttggacttggcgc 586 |||||| || || |||| |||||||||||||||||||||||||| Sbjct: 232 cttcttcagttttctcatgaagtaccagaacttggacttggcgc 189
>gb|AY389632.1| Hyacinthus orientalis ribosomal protein L18A (RPL18) mRNA, complete cds Length = 710 Score = 208 bits (105), Expect = 2e-50 Identities = 367/454 (80%), Gaps = 2/454 (0%) Strand = Plus / Minus Query: 187 gccttgtaggtggtcttgagcttgcgggtnnnnnnncgcaccttctggtacaccagcggg 246 |||||| |||||||||||||||| | ||| || ||||||| | |||| || ||| Sbjct: 518 gccttgaaggtggtcttgagcttcctggtgggcggccggaccttcttgaacacgaggggg 459 Query: 247 aacttgatcttcgagttgtggaactgcttcgtgttgtccctcttgcacagcttgaagtcc 306 || ||||||||||||| ||||||||||| ||| | || | |||||| |||||| | Sbjct: 458 aatttgatcttcgagtcatggaactgcttggtgctctcgcgcttgcagagcttggcgggg 399 Query: 307 accgtcgcagtcttgatgatctggatgcacggggaacgcacgcggtgccgcgacgccatc 366 | || || |||||||||||||||||||| ||| | | || | ||| || || ||||| Sbjct: 398 atggtggccgtcttgatgatctggatgcatgggaacctaaccctgtggcgtgatgccatt 339 Query: 367 tccgtgtacatctgctccacaccgccgttcagagtcgtgtcgcggtactccttgtacatg 426 || ||||||||||||||||| || || ||||| || ||||| | |||||||||||||||| Sbjct: 338 tcagtgtacatctgctccactcctccattcagggtggtgtccctgtactccttgtacatg 279 Query: 427 ttgtggtaaccggtcctgctctggtagcgcagccagatgccgtagttct-tgatggtggt 485 | || || ||||| ||||||||||| | |||||| ||||||||||||| | || |||| Sbjct: 278 ta-tgatagccggttctgctctggtacctcagccatatgccgtagttctattattttggt 220 Query: 486 cgggttcttctcaaagatctcgttgatggcgagcatctggccgttggccttcttcacctt 545 |||||||||||||| ||||||||||| || || | ||||| || ||||||||| || Sbjct: 219 ggggttcttctcaaatatctcgttgatagcaagaacttggccattactcttcttcacttt 160 Query: 546 cttgagcttcctcaggaagtaccagaacttggacttggcgcggacctcgttggtggccca 605 ||| |||||||||||||| ||||| |||||||||||||| || || |||||||| ||||| Sbjct: 159 cttcagcttcctcaggaaataccaaaacttggacttggcccgaacttcgttggttgccca 100 Query: 606 gagcttcatgcggtagatcttgggctgctcatcg 639 |||||||||||| ||||||| || ||||||||| Sbjct: 99 aagcttcatgcggaagatcttcgggtgctcatcg 66
>gb|DQ235171.1| Solanum tuberosum clone 155B02 unknown mRNA Length = 722 Score = 196 bits (99), Expect = 6e-47 Identities = 234/279 (83%) Strand = Plus / Minus Query: 361 gccatctccgtgtacatctgctccacaccgccgttcagagtcgtgtcgcggtactccttg 420 ||||| || ||||||||||| || ||||| || |||| || ||||| |||||||||||| Sbjct: 356 gccatttcagtgtacatctgttctacaccaccattcaatgtggtgtcacggtactccttg 297 Query: 421 tacatgttgtggtaaccggtcctgctctggtagcgcagccagatgccgtagttcttgatg 480 |||||||| || || || ||||| || ||||| |||||||| || || ||||||||||| Sbjct: 296 tacatgttatgatacccagtcctactttggtaacgcagccaaataccatagttcttgatt 237 Query: 481 gtggtcgggttcttctcaaagatctcgttgatggcgagcatctggccgttggccttcttc 540 | || |||| |||||||| ||||| ||||| || |||||||| || ||| ||||||| Sbjct: 236 tttgttgggtatttctcaaaaatctcattgatagctagcatctgaccattgctcttcttc 177 Query: 541 accttcttgagcttcctcaggaagtaccagaacttggacttggcgcggacctcgttggtg 600 |||||||| |||||||||| |||||||||||||||||||||||| |||||||| || || Sbjct: 176 accttctttagcttcctcaagaagtaccagaacttggacttggcacggacctcatttgta 117 Query: 601 gcccagagcttcatgcggtagatcttgggctgctcatcg 639 |||||||| ||||| ||||| ||||| || ||||||||| Sbjct: 116 gcccagagtttcatacggtaaatctttgggtgctcatcg 78 Score = 48.1 bits (24), Expect = 0.037 Identities = 54/64 (84%) Strand = Plus / Minus Query: 236 acaccagcgggaacttgatcttcgagttgtggaactgcttcgtgttgtccctcttgcaca 295 |||||| |||||||||||| || |||| ||||||||||| ||| | |||| |||||| | Sbjct: 481 acaccaacgggaacttgattttggagtcatggaactgctttgtgctctcccgcttgcaga 422 Query: 296 gctt 299 |||| Sbjct: 421 gctt 418
>gb|DQ200390.1| Solanum tuberosum clone 067G06 unknown mRNA Length = 779 Score = 186 bits (94), Expect = 6e-44 Identities = 232/278 (83%) Strand = Plus / Minus Query: 361 gccatctccgtgtacatctgctccacaccgccgttcagagtcgtgtcgcggtactccttg 420 |||||||| |||||||||||||||||||| || |||| || ||||| |||||||||||| Sbjct: 356 gccatctcagtgtacatctgctccacaccaccattcaatgtggtgtcacggtactccttg 297 Query: 421 tacatgttgtggtaaccggtcctgctctggtagcgcagccagatgccgtagttcttgatg 480 |||||||||||||| || || || || ||||| || ||||| || || || |||||||| Sbjct: 296 tacatgttgtggtatccagttctactttggtaacggagccaaataccataattcttgatt 237 Query: 481 gtggtcgggttcttctcaaagatctcgttgatggcgagcatctggccgttggccttcttc 540 || || ||||||||||| |||||||| || || || |||||||| |||||| ||||||| Sbjct: 236 gttgttgggttcttctcgaagatctcattaatagccagcatctgaccgttgctcttcttc 177 Query: 541 accttcttgagcttcctcaggaagtaccagaacttggacttggcgcggacctcgttggtg 600 |||||||| |||||||||| ||| |||||||| |||||||| || || || || || || Sbjct: 176 accttcttaagcttcctcaagaaataccagaatttggacttagcacgaacttcatttgta 117 Query: 601 gcccagagcttcatgcggtagatcttgggctgctcatc 638 ||||| | |||||| || || |||||||| |||||||| Sbjct: 116 gcccacaacttcatacgataaatcttgggatgctcatc 79 Score = 71.9 bits (36), Expect = 3e-09 Identities = 57/64 (89%) Strand = Plus / Minus Query: 236 acaccagcgggaacttgatcttcgagttgtggaactgcttcgtgttgtccctcttgcaca 295 |||||| ||||||||||||||| |||| ||||||||||| ||| | ||||||||||||| Sbjct: 481 acaccaacgggaacttgatcttggagtcatggaactgcttagtgctctccctcttgcaca 422 Query: 296 gctt 299 |||| Sbjct: 421 gctt 418
>dbj|AP003249.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0435B05 Length = 150997 Score = 182 bits (92), Expect = 1e-42 Identities = 227/272 (83%) Strand = Plus / Plus Query: 234 gtacaccagcgggaacttgatcttcgagttgtggaactgcttcgtgttgtccctcttgca 293 ||||||||| ||||||||||| | || |||||||||||||| |||||||| | |||||| Sbjct: 65842 gtacaccagtgggaacttgatatctgacttgtggaactgcttagtgttgtcacgcttgca 65901 Query: 294 cagcttgaagtccaccgtcgcagtcttgatgatctggatgcacggggaacgcacgcggtg 353 || || |||| || || ||||||||||||||||| ||||| ||| | | || ||||| Sbjct: 65902 gagtttaaagtggacagtagcagtcttgatgatctgaatgcaagggaatctgacacggtg 65961 Query: 354 ccgcgacgccatctccgtgtacatctgctccacaccgccgttcagagtcgtgtcgcggta 413 || || |||||||| |||||||||||||| || | || || || || || || ||||| Sbjct: 65962 gcgggaagccatctcagtgtacatctgctcaacggcaccattgagggtggtatcacggta 66021 Query: 414 ctccttgtacatgttgtggtaaccggtcctgctctggtagcgcagccagatgccgtagtt 473 ||||||||||||||||||||| || ||||| |||||||| |||||||||||||| ||||| Sbjct: 66022 ctccttgtacatgttgtggtagccagtcctactctggtaacgcagccagatgccatagtt 66081 Query: 474 cttgatggtggtcgggttcttctcaaagatct 505 |||||| || || |||||||||||||| |||| Sbjct: 66082 cttgatagttgttgggttcttctcaaaaatct 66113 Score = 127 bits (64), Expect = 5e-26 Identities = 82/88 (93%) Strand = Plus / Plus Query: 566 accagaacttggacttggcgcggacctcgttggtggcccagagcttcatgcggtagatct 625 |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| Sbjct: 66764 accagaacttggacttggcgcggacctcgttggtagcccagagcttcatgcggtagatct 66823 Query: 626 tgggctgctcatcgcccggggtcggcag 653 |||| ||||| ||| ||| |||||||| Sbjct: 66824 tggggtgctcgtcggtcggcgtcggcag 66851 Score = 58.0 bits (29), Expect = 4e-05 Identities = 56/65 (86%) Strand = Plus / Plus Query: 504 ctcgttgatggcgagcatctggccgttggccttcttcaccttcttgagcttcctcaggaa 563 |||||||||||| || ||||| |||||| ||||||||||||||| ||||| | ||||| Sbjct: 66606 ctcgttgatggcaaggatctgcccgttgctcttcttcaccttcttcagcttgcggaggaa 66665 Query: 564 gtacc 568 ||||| Sbjct: 66666 gtacc 66670
>dbj|AP003237.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0046E05 Length = 162776 Score = 182 bits (92), Expect = 1e-42 Identities = 227/272 (83%) Strand = Plus / Plus Query: 234 gtacaccagcgggaacttgatcttcgagttgtggaactgcttcgtgttgtccctcttgca 293 ||||||||| ||||||||||| | || |||||||||||||| |||||||| | |||||| Sbjct: 146883 gtacaccagtgggaacttgatatctgacttgtggaactgcttagtgttgtcacgcttgca 146942 Query: 294 cagcttgaagtccaccgtcgcagtcttgatgatctggatgcacggggaacgcacgcggtg 353 || || |||| || || ||||||||||||||||| ||||| ||| | | || ||||| Sbjct: 146943 gagtttaaagtggacagtagcagtcttgatgatctgaatgcaagggaatctgacacggtg 147002 Query: 354 ccgcgacgccatctccgtgtacatctgctccacaccgccgttcagagtcgtgtcgcggta 413 || || |||||||| |||||||||||||| || | || || || || || || ||||| Sbjct: 147003 gcgggaagccatctcagtgtacatctgctcaacggcaccattgagggtggtatcacggta 147062 Query: 414 ctccttgtacatgttgtggtaaccggtcctgctctggtagcgcagccagatgccgtagtt 473 ||||||||||||||||||||| || ||||| |||||||| |||||||||||||| ||||| Sbjct: 147063 ctccttgtacatgttgtggtagccagtcctactctggtaacgcagccagatgccatagtt 147122 Query: 474 cttgatggtggtcgggttcttctcaaagatct 505 |||||| || || |||||||||||||| |||| Sbjct: 147123 cttgatagttgttgggttcttctcaaaaatct 147154 Score = 127 bits (64), Expect = 5e-26 Identities = 82/88 (93%) Strand = Plus / Plus Query: 566 accagaacttggacttggcgcggacctcgttggtggcccagagcttcatgcggtagatct 625 |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| Sbjct: 147805 accagaacttggacttggcgcggacctcgttggtagcccagagcttcatgcggtagatct 147864 Query: 626 tgggctgctcatcgcccggggtcggcag 653 |||| ||||| ||| ||| |||||||| Sbjct: 147865 tggggtgctcgtcggtcggcgtcggcag 147892 Score = 58.0 bits (29), Expect = 4e-05 Identities = 56/65 (86%) Strand = Plus / Plus Query: 504 ctcgttgatggcgagcatctggccgttggccttcttcaccttcttgagcttcctcaggaa 563 |||||||||||| || ||||| |||||| ||||||||||||||| ||||| | ||||| Sbjct: 147647 ctcgttgatggcaaggatctgcccgttgctcttcttcaccttcttcagcttgcggaggaa 147706 Query: 564 gtacc 568 ||||| Sbjct: 147707 gtacc 147711
>gb|DQ235168.1| Solanum tuberosum clone 154B10 unknown mRNA Length = 904 Score = 180 bits (91), Expect = 4e-42 Identities = 232/279 (83%) Strand = Plus / Minus Query: 361 gccatctccgtgtacatctgctccacaccgccgttcagagtcgtgtcgcggtactccttg 420 |||||||| ||||||||||| || ||| | || |||| || || || |||||||||||| Sbjct: 383 gccatctctgtgtacatctgttctacagctccattcaatgtggtatcacggtactccttg 324 Query: 421 tacatgttgtggtaaccggtcctgctctggtagcgcagccagatgccgtagttcttgatg 480 |||||||||||||| || || | ||||| || |||| ||| ||||||||||||||||| Sbjct: 323 tacatgttgtggtacccagtgcgactctgataacgcaaccaaatgccgtagttcttgatt 264 Query: 481 gtggtcgggttcttctcaaagatctcgttgatggcgagcatctggccgttggccttcttc 540 | || |||| ||||||||||||||| || || || |||||||| |||||| |||||| Sbjct: 263 ttagtagggtacttctcaaagatctcattaatagcaagcatctgcccgttgctcttctta 204 Query: 541 accttcttgagcttcctcaggaagtaccagaacttggacttggcgcggacctcgttggtg 600 |||||||| |||||||||| ||||||||||||||||| || || |||||||| ||||| Sbjct: 203 accttcttcagcttcctcaaaaagtaccagaacttggatttcgcacggacctcattggta 144 Query: 601 gcccagagcttcatgcggtagatcttgggctgctcatcg 639 ||||| || |||||||| |||||||| || || |||||| Sbjct: 143 gcccaaagtttcatgcgatagatctttgggtgttcatcg 105 Score = 50.1 bits (25), Expect = 0.009 Identities = 46/53 (86%) Strand = Plus / Minus Query: 244 gggaacttgatcttcgagttgtggaactgcttcgtgttgtccctcttgcacag 296 ||||||||||| || |||| ||||||||||| ||| | |||||||||||||| Sbjct: 500 gggaacttgattttggagtcatggaactgcttggtgctctccctcttgcacag 448
>ref|NM_179398.1| Arabidopsis thaliana structural constituent of ribosome AT1G29965 mRNA, complete cds Length = 774 Score = 176 bits (89), Expect = 6e-41 Identities = 233/281 (82%) Strand = Plus / Minus Query: 358 gacgccatctccgtgtacatctgctccacaccgccgttcagagtcgtgtcgcggtactcc 417 ||||||||||| |||||||| |||||||| | || |||| ||| ||||| |||||||| Sbjct: 430 gacgccatctcagtgtacatttgctccactgctccattcaaagtagtgtcacggtactct 371 Query: 418 ttgtacatgttgtggtaaccggtcctgctctggtagcgcagccagatgccgtagttcttg 477 ||||||||||| |||||||| || | ||||||||| | || |||||| || | |||||| Sbjct: 370 ttgtacatgttatggtaacctgtacggctctggtatctcaaccagattccaaaattcttg 311 Query: 478 atggtggtcgggttcttctcaaagatctcgttgatggcgagcatctggccgttggccttc 537 || || || ||||||||||||||||||||||||||||| |||||||| || || |||| Sbjct: 310 atcgttgttgggttcttctcaaagatctcgttgatggctagcatctgtccattactcttc 251 Query: 538 ttcaccttcttgagcttcctcaggaagtaccagaacttggacttggcgcggacctcgttg 597 ||||||||||| || |||| | | |||||||||||||||| ||||| | |||||||| Sbjct: 250 ttcaccttcttttgcctccttaagtagtaccagaacttggatttggcaagaacctcgttc 191 Query: 598 gtggcccagagcttcatgcggtagatcttgggctgctcatc 638 || ||||| |||||||| | ||| ||||| || |||||||| Sbjct: 190 gttgcccatagcttcatcctgtaaatctttggttgctcatc 150 Score = 56.0 bits (28), Expect = 2e-04 Identities = 49/56 (87%) Strand = Plus / Minus Query: 238 accagcgggaacttgatcttcgagttgtggaactgcttcgtgttgtccctcttgca 293 |||| ||||||||||||||| |||||| |||||||||||| | ||||||||||| Sbjct: 550 accaacgggaacttgatcttgctgttgtgaaactgcttcgtgctttccctcttgca 495
>gb|BT000059.1| Arabidopsis thaliana 60S ribosomal protein L18A, putative (At1g29970) mRNA, complete cds Length = 633 Score = 176 bits (89), Expect = 6e-41 Identities = 233/281 (82%) Strand = Plus / Minus Query: 358 gacgccatctccgtgtacatctgctccacaccgccgttcagagtcgtgtcgcggtactcc 417 ||||||||||| |||||||| |||||||| | || |||| ||| ||||| |||||||| Sbjct: 341 gacgccatctcagtgtacatttgctccactgctccattcaaagtagtgtcacggtactct 282 Query: 418 ttgtacatgttgtggtaaccggtcctgctctggtagcgcagccagatgccgtagttcttg 477 ||||||||||| |||||||| || | ||||||||| | || |||||| || | |||||| Sbjct: 281 ttgtacatgttatggtaacctgtacggctctggtatctcaaccagattccaaaattcttg 222 Query: 478 atggtggtcgggttcttctcaaagatctcgttgatggcgagcatctggccgttggccttc 537 || || || ||||||||||||||||||||||||||||| |||||||| || || |||| Sbjct: 221 atcgttgttgggttcttctcaaagatctcgttgatggctagcatctgtccattactcttc 162 Query: 538 ttcaccttcttgagcttcctcaggaagtaccagaacttggacttggcgcggacctcgttg 597 ||||||||||| || |||| | | |||||||||||||||| ||||| | |||||||| Sbjct: 161 ttcaccttcttttgcctccttaagtagtaccagaacttggatttggcaagaacctcgttc 102 Query: 598 gtggcccagagcttcatgcggtagatcttgggctgctcatc 638 || ||||| |||||||| | ||| ||||| || |||||||| Sbjct: 101 gttgcccatagcttcatcctgtaaatctttggttgctcatc 61 Score = 56.0 bits (28), Expect = 2e-04 Identities = 49/56 (87%) Strand = Plus / Minus Query: 238 accagcgggaacttgatcttcgagttgtggaactgcttcgtgttgtccctcttgca 293 |||| ||||||||||||||| |||||| |||||||||||| | ||||||||||| Sbjct: 461 accaacgggaacttgatcttgctgttgtgaaactgcttcgtgctttccctcttgca 406
>gb|AY128411.1| Arabidopsis thaliana 60S ribosomal protein L18A, putative (At1g29970) mRNA, complete cds Length = 758 Score = 176 bits (89), Expect = 6e-41 Identities = 233/281 (82%) Strand = Plus / Minus Query: 358 gacgccatctccgtgtacatctgctccacaccgccgttcagagtcgtgtcgcggtactcc 417 ||||||||||| |||||||| |||||||| | || |||| ||| ||||| |||||||| Sbjct: 418 gacgccatctcagtgtacatttgctccactgctccattcaaagtagtgtcacggtactct 359 Query: 418 ttgtacatgttgtggtaaccggtcctgctctggtagcgcagccagatgccgtagttcttg 477 ||||||||||| |||||||| || | ||||||||| | || |||||| || | |||||| Sbjct: 358 ttgtacatgttatggtaacctgtacggctctggtatctcaaccagattccaaaattcttg 299 Query: 478 atggtggtcgggttcttctcaaagatctcgttgatggcgagcatctggccgttggccttc 537 || || || ||||||||||||||||||||||||||||| |||||||| || || |||| Sbjct: 298 atcgttgttgggttcttctcaaagatctcgttgatggctagcatctgtccattactcttc 239 Query: 538 ttcaccttcttgagcttcctcaggaagtaccagaacttggacttggcgcggacctcgttg 597 ||||||||||| || |||| | | |||||||||||||||| ||||| | |||||||| Sbjct: 238 ttcaccttcttttgcctccttaagtagtaccagaacttggatttggcaagaacctcgttc 179 Query: 598 gtggcccagagcttcatgcggtagatcttgggctgctcatc 638 || ||||| |||||||| | ||| ||||| || |||||||| Sbjct: 178 gttgcccatagcttcatcctgtaaatctttggttgctcatc 138 Score = 56.0 bits (28), Expect = 2e-04 Identities = 49/56 (87%) Strand = Plus / Minus Query: 238 accagcgggaacttgatcttcgagttgtggaactgcttcgtgttgtccctcttgca 293 |||| ||||||||||||||| |||||| |||||||||||| | ||||||||||| Sbjct: 538 accaacgggaacttgatcttgctgttgtgaaactgcttcgtgctttccctcttgca 483
>emb|BX816320.1|CNS0AD9L Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH40ZG05 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1162 Score = 176 bits (89), Expect = 6e-41 Identities = 233/281 (82%) Strand = Plus / Minus Query: 358 gacgccatctccgtgtacatctgctccacaccgccgttcagagtcgtgtcgcggtactcc 417 ||||||||||| |||||||| |||||||| | || |||| ||| ||||| |||||||| Sbjct: 859 gacgccatctcagtgtacatttgctccactgctccattcaaagtagtgtcacggtactct 800 Query: 418 ttgtacatgttgtggtaaccggtcctgctctggtagcgcagccagatgccgtagttcttg 477 ||||||||||| |||||||| || | ||||||||| | || |||||| || | |||||| Sbjct: 799 ttgtacatgttatggtaacctgtacggctctggtatctcaaccagattccaaaattcttg 740 Query: 478 atggtggtcgggttcttctcaaagatctcgttgatggcgagcatctggccgttggccttc 537 || || || ||||||||||||||||||||||||||||| |||||||| || || |||| Sbjct: 739 atcgttgttgggttcttctcaaagatctcgttgatggctagcatctgtccattactcttc 680 Query: 538 ttcaccttcttgagcttcctcaggaagtaccagaacttggacttggcgcggacctcgttg 597 ||||||||||| || |||| | | |||||||||||||||| ||||| | |||||||| Sbjct: 679 ttcaccttcttttgcctccttaagtagtaccagaacttggatttggcaagaacctcgttc 620 Query: 598 gtggcccagagcttcatgcggtagatcttgggctgctcatc 638 || ||||| |||||||| | ||| ||||| || |||||||| Sbjct: 619 gttgcccatagcttcatcctgtaaatctttggttgctcatc 579 Score = 56.0 bits (28), Expect = 2e-04 Identities = 49/56 (87%) Strand = Plus / Minus Query: 238 accagcgggaacttgatcttcgagttgtggaactgcttcgtgttgtccctcttgca 293 |||| ||||||||||||||| |||||| |||||||||||| | ||||||||||| Sbjct: 979 accaacgggaacttgatcttgctgttgtgaaactgcttcgtgctttccctcttgca 924
>gb|BT014521.1| Lycopersicon esculentum clone 133914F, mRNA sequence Length = 810 Score = 167 bits (84), Expect = 6e-38 Identities = 264/324 (81%) Strand = Plus / Minus Query: 316 gtcttgatgatctggatgcacggggaacgcacgcggtgccgcgacgccatctccgtgtac 375 |||||||||||||||||||| | ||| || | ||| || || ||||| || |||||| Sbjct: 419 gtcttgatgatctggatgcagtgatgacggaccctgtggcgagaagccatttcagtgtac 360 Query: 376 atctgctccacaccgccgttcagagtcgtgtcgcggtactccttgtacatgttgtggtaa 435 ||||| || ||||| || |||| || || || |||||||||||||||||||| || || Sbjct: 359 atctgttctacaccaccattcaatgttgtatcacggtactccttgtacatgttatgatac 300 Query: 436 ccggtcctgctctggtagcgcagccagatgccgtagttcttgatggtggtcgggttcttc 495 || ||||| || ||||| |||||||| || || ||||||||||| | || |||| ||| Sbjct: 299 ccagtcctactttggtaacgcagccaaataccatagttcttgatttttgttgggtatttc 240 Query: 496 tcaaagatctcgttgatggcgagcatctggccgttggccttcttcaccttcttgagcttc 555 ||||| ||||| || || || |||||||| || ||| ||||||||||||||| |||||| Sbjct: 239 tcaaaaatctcattaatagctagcatctgaccattgctcttcttcaccttctttagcttc 180 Query: 556 ctcaggaagtaccagaacttggacttggcgcggacctcgttggtggcccagagcttcatg 615 |||| ||||||||| ||||||||||| || |||||||| || || |||||||| ||||| Sbjct: 179 ctcaagaagtaccaaaacttggacttagcacggacctcattcgtagcccagagtttcata 120 Query: 616 cggtagatcttgggctgctcatcg 639 ||||| ||||| || ||||||||| Sbjct: 119 cggtaaatctttggatgctcatcg 96 Score = 56.0 bits (28), Expect = 2e-04 Identities = 55/64 (85%) Strand = Plus / Minus Query: 236 acaccagcgggaacttgatcttcgagttgtggaactgcttcgtgttgtccctcttgcaca 295 |||||| |||||||||||| || |||| |||||||||||| ||| | |||| |||||| | Sbjct: 499 acaccaacgggaacttgattttggagtcgtggaactgctttgtgctctcccgcttgcaga 440 Query: 296 gctt 299 |||| Sbjct: 439 gctt 436
>dbj|AB023038.1| Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MIE1 Length = 84462 Score = 165 bits (83), Expect = 2e-37 Identities = 214/255 (83%), Gaps = 2/255 (0%) Strand = Plus / Minus Query: 244 gggaacttgatcttcgagttgtggaactgcttcgtgttgtccctcttgcacagctt-gaa 302 |||||||||||||||||||| ||||||||||| ||| | || |||||||| ||||| | | Sbjct: 39811 gggaacttgatcttcgagttatggaactgcttggtgatctctctcttgcaaagctttgca 39752 Query: 303 gtccaccgtcgcagtcttgatgatctggatgcacggggaacgcacgcggtgccgcgacgc 362 | || |||||||||||||||||||| ||||| ||| | | ||| | || || || || Sbjct: 39751 ggg-acagtcgcagtcttgatgatctgaatgcaagggaacctcactctatgacgagaagc 39693 Query: 363 catctccgtgtacatctgctccacaccgccgttcagagtcgtgtcgcggtactccttgta 422 |||||| ||||||||||||||||| || || || || || ||||| |||||||||||||| Sbjct: 39692 catctcagtgtacatctgctccactccaccattgagtgttgtgtcacggtactccttgta 39633 Query: 423 catgttgtggtaaccggtcctgctctggtagcgcagccagatgccgtagttcttgatggt 482 |||||||||||| || || | |||||| || |||| |||||| ||||||||||||||||| Sbjct: 39632 catgttgtggtacccagttcggctctgataacgcaaccagatcccgtagttcttgatggt 39573 Query: 483 ggtcgggttcttctc 497 || ||||||||||| Sbjct: 39572 cgttgggttcttctc 39558 Score = 58.0 bits (29), Expect = 4e-05 Identities = 53/61 (86%) Strand = Plus / Minus Query: 508 ttgatggcgagcatctggccgttggccttcttcaccttcttgagcttcctcaggaagtac 567 |||||||| |||||||| |||||| |||||||||||||| || ||||||| ||||||| Sbjct: 39462 ttgatggcaagcatctgtccgttgcttttcttcaccttcttcagtttcctcatgaagtac 39403 Query: 568 c 568 | Sbjct: 39402 c 39402 Score = 44.1 bits (22), Expect = 0.58 Identities = 61/74 (82%) Strand = Plus / Minus Query: 566 accagaacttggacttggcgcggacctcgttggtggcccagagcttcatgcggtagatct 625 ||||||||||||||||||||| || || || | |||| |||||||| | |||||||| Sbjct: 39310 accagaacttggacttggcgcatacttcatttctaccccaaagcttcatcctgtagatct 39251 Query: 626 tgggctgctcatcg 639 | || ||||||||| Sbjct: 39250 tagggtgctcatcg 39237
>gb|AC004481.3| Arabidopsis thaliana chromosome 2 clone F13P17 map ve016, complete sequence Length = 112763 Score = 139 bits (70), Expect = 1e-29 Identities = 214/262 (81%) Strand = Plus / Plus Query: 244 gggaacttgatcttcgagttgtggaactgcttcgtgttgtccctcttgcacagcttgaag 303 |||||||||||||| |||||||||||| || ||| | || ||||||||||||||| Sbjct: 103485 gggaacttgatcttgctgttgtggaactgtttagtgctctctctcttgcacagcttggct 103544 Query: 304 tccaccgtcgcagtcttgatgatctggatgcacggggaacgcacgcggtgccgcgacgcc 363 || || || |||||||||||||| ||||| ||| | | || ||||| || || ||| Sbjct: 103545 gggacagtggctgtcttgatgatctgaatgcaagggaatctgacacggtgacgggatgcc 103604 Query: 364 atctccgtgtacatctgctccacaccgccgttcagagtcgtgtcgcggtactccttgtac 423 ||||| |||||||||||||| ||| | ||||| ||||| ||||| ||||||||||||||| Sbjct: 103605 atctcagtgtacatctgctcaacagctccgttaagagtggtgtcacggtactccttgtac 103664 Query: 424 atgttgtggtaaccggtcctgctctggtagcgcagccagatgccgtagttcttgatggtg 483 ||||||||||| || || || |||||||| | || ||| || ||| |||||||||| || Sbjct: 103665 atgttgtggtacccagttctactctggtacctcaaccaaataccgaagttcttgatcgtt 103724 Query: 484 gtcgggttcttctcaaagatct 505 || |||||||||||| |||||| Sbjct: 103725 gttgggttcttctcatagatct 103746 Score = 73.8 bits (37), Expect = 6e-10 Identities = 64/73 (87%) Strand = Plus / Plus Query: 566 accagaacttggacttggcgcggacctcgttggtggcccagagcttcatgcggtagatct 625 ||||||||||||||||||| || |||||||| || |||||||||||||| | ||| |||| Sbjct: 104408 accagaacttggacttggcacgaacctcgttcgtagcccagagcttcatcctgtaaatct 104467 Query: 626 tgggctgctcatc 638 | |||||| |||| Sbjct: 104468 taggctgcacatc 104480 Score = 73.8 bits (37), Expect = 6e-10 Identities = 58/65 (89%) Strand = Plus / Plus Query: 504 ctcgttgatggcgagcatctggccgttggccttcttcaccttcttgagcttcctcaggaa 563 ||||||||||||||||||||| || || |||||||||||||||||||||||||| ||| Sbjct: 104248 ctcgttgatggcgagcatctgtccattactcttcttcaccttcttgagcttcctcaagaa 104307 Query: 564 gtacc 568 |||| Sbjct: 104308 atacc 104312
>gb|AC004077.3| Arabidopsis thaliana chromosome 2 clone T31E10 map ve016, complete sequence Length = 93060 Score = 139 bits (70), Expect = 1e-29 Identities = 214/262 (81%) Strand = Plus / Minus Query: 244 gggaacttgatcttcgagttgtggaactgcttcgtgttgtccctcttgcacagcttgaag 303 |||||||||||||| |||||||||||| || ||| | || ||||||||||||||| Sbjct: 70717 gggaacttgatcttgctgttgtggaactgtttagtgctctctctcttgcacagcttggct 70658 Query: 304 tccaccgtcgcagtcttgatgatctggatgcacggggaacgcacgcggtgccgcgacgcc 363 || || || |||||||||||||| ||||| ||| | | || ||||| || || ||| Sbjct: 70657 gggacagtggctgtcttgatgatctgaatgcaagggaatctgacacggtgacgggatgcc 70598 Query: 364 atctccgtgtacatctgctccacaccgccgttcagagtcgtgtcgcggtactccttgtac 423 ||||| |||||||||||||| ||| | ||||| ||||| ||||| ||||||||||||||| Sbjct: 70597 atctcagtgtacatctgctcaacagctccgttaagagtggtgtcacggtactccttgtac 70538 Query: 424 atgttgtggtaaccggtcctgctctggtagcgcagccagatgccgtagttcttgatggtg 483 ||||||||||| || || || |||||||| | || ||| || ||| |||||||||| || Sbjct: 70537 atgttgtggtacccagttctactctggtacctcaaccaaataccgaagttcttgatcgtt 70478 Query: 484 gtcgggttcttctcaaagatct 505 || |||||||||||| |||||| Sbjct: 70477 gttgggttcttctcatagatct 70456 Score = 73.8 bits (37), Expect = 6e-10 Identities = 58/65 (89%) Strand = Plus / Minus Query: 504 ctcgttgatggcgagcatctggccgttggccttcttcaccttcttgagcttcctcaggaa 563 ||||||||||||||||||||| || || |||||||||||||||||||||||||| ||| Sbjct: 69954 ctcgttgatggcgagcatctgtccattactcttcttcaccttcttgagcttcctcaagaa 69895 Query: 564 gtacc 568 |||| Sbjct: 69894 atacc 69890 Score = 73.8 bits (37), Expect = 6e-10 Identities = 64/73 (87%) Strand = Plus / Minus Query: 566 accagaacttggacttggcgcggacctcgttggtggcccagagcttcatgcggtagatct 625 ||||||||||||||||||| || |||||||| || |||||||||||||| | ||| |||| Sbjct: 69794 accagaacttggacttggcacgaacctcgttcgtagcccagagcttcatcctgtaaatct 69735 Query: 626 tgggctgctcatc 638 | |||||| |||| Sbjct: 69734 taggctgcacatc 69722
>gb|DQ226673.1| Boechera divaricarpa isolate SLW-348-443-C10 mRNA sequence Length = 312 Score = 137 bits (69), Expect = 5e-29 Identities = 180/217 (82%) Strand = Plus / Plus Query: 422 acatgttgtggtaaccggtcctgctctggtagcgcagccagatgccgtagttcttgatgg 481 ||||||| ||||| || || | |||||| || ||||||||||| || || |||||||| | Sbjct: 1 acatgttatggtatccagttcggctctgataacgcagccagataccataattcttgattg 60 Query: 482 tggtcgggttcttctcaaagatctcgttgatggcgagcatctggccgttggccttcttca 541 | |||||||||||||| || ||||| |||||||| |||||||| || ||| ||||||| Sbjct: 61 tcgtcgggttcttctcgaaaatctcattgatggcaagcatctgcccattgcttttcttca 120 Query: 542 ccttcttgagcttcctcaggaagtaccagaacttggacttggcgcggacctcgttggtgg 601 ||||||| || ||||||| ||| ||||| |||||||||||||||| || || || ||| Sbjct: 121 ccttcttcagtttcctcatgaaataccaaaacttggacttggcgcatacttcatttgtgc 180 Query: 602 cccagagcttcatgcggtagatcttgggctgctcatc 638 |||| |||||||| | ||||||||| || |||||||| Sbjct: 181 cccatagcttcatcctgtagatcttagggtgctcatc 217
>dbj|AK110262.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-163-B05, full insert sequence Length = 885 Score = 125 bits (63), Expect = 2e-25 Identities = 186/227 (81%) Strand = Plus / Minus Query: 316 gtcttgatgatctggatgcacggggaacgcacgcggtgccgcgacgccatctccgtgtac 375 |||||||||||||||||||| ||| | ||||||||||| || || |||||||| ||||| Sbjct: 431 gtcttgatgatctggatgcaagggaagcgcacgcggtggcgtgatgccatctcgctgtac 372 Query: 376 atctgctccacaccgccgttcagagtcgtgtcgcggtactccttgtacatgttgtggtaa 435 ||||| ||||| | ||||| || || ||||| |||||||||||||||||||||||||| Sbjct: 371 atctggtccactgcaccgttgagggtggtgtcacggtactccttgtacatgttgtggtag 312 Query: 436 ccggtcctgctctggtagcgcagccagatgccgtagttcttgatggtggtcgggttcttc 495 || || | ||||||||||| ||||||||| ||||||| | || || || || | Sbjct: 311 cctgtgcgtgactggtagcgcacccagatgccaaagttcttcacagttgtgggcttgcgc 252 Query: 496 tcaaagatctcgttgatggcgagcatctggccgttggccttcttcac 542 ||||| |||||||| | |||| ||||||||||||||||||||||| Sbjct: 251 tcaaaaatctcgttcactgcgatgatctggccgttggccttcttcac 205
>gb|AF334839.1| Castanea sativa ribosomal protein L18a mRNA, complete cds Length = 775 Score = 109 bits (55), Expect = 1e-20 Identities = 223/279 (79%) Strand = Plus / Minus Query: 361 gccatctccgtgtacatctgctccacaccgccgttcagagtcgtgtcgcggtactccttg 420 |||||||| ||||||| || |||||| | || || ||||| ||||| || |||||||| Sbjct: 421 gccatctcaatgtacatttgttccacagcaccatttagagtggtgtctcgatactcctta 362 Query: 421 tacatgttgtggtaaccggtcctgctctggtagcgcagccagatgccgtagttcttgatg 480 ||||||||||| || || || | ||| || || ||||||||||| || || ||||| || Sbjct: 361 tacatgttgtgatacccagttcggctttgataccgcagccagataccataattcttaatc 302 Query: 481 gtggtcgggttcttctcaaagatctcgttgatggcgagcatctggccgttggccttcttc 540 | || || ||||||||||| ||||| ||||| || | |||||| || ||| |||||| Sbjct: 301 tttgtaggattcttctcaaaaatctcattgatagctaacatctgcccattgctcttctta 242 Query: 541 accttcttgagcttcctcaggaagtaccagaacttggacttggcgcggacctcgttggtg 600 || ||||| |||||||||| |||||||||||||| |||||||| |||||||| || || Sbjct: 241 actttcttcagcttcctcaaaaagtaccagaacttcgacttggcacggacctcatttgta 182 Query: 601 gcccagagcttcatgcggtagatcttgggctgctcatcg 639 ||||| || ||||| | || ||||| || ||||||||| Sbjct: 181 gcccaaagtttcatcctataaatctttggatgctcatcg 143 Score = 48.1 bits (24), Expect = 0.037 Identities = 48/56 (85%) Strand = Plus / Minus Query: 238 accagcgggaacttgatcttcgagttgtggaactgcttcgtgttgtccctcttgca 293 ||||| ||||||||||| || || |||||||||||||| | | | ||||||||||| Sbjct: 544 accagagggaacttgattttggaattgtggaactgcttagagctctccctcttgca 489
>gb|AC022455.5|AC022455 Arabidopsis thaliana chromosome 1 BAC T1P2 genomic sequence, complete sequence Length = 82053 Score = 103 bits (52), Expect = 7e-19 Identities = 124/148 (83%) Strand = Plus / Plus Query: 358 gacgccatctccgtgtacatctgctccacaccgccgttcagagtcgtgtcgcggtactcc 417 ||||||||||| |||||||| |||||||| | || |||| ||| ||||| |||||||| Sbjct: 20530 gacgccatctcagtgtacatttgctccactgctccattcaaagtagtgtcacggtactct 20589 Query: 418 ttgtacatgttgtggtaaccggtcctgctctggtagcgcagccagatgccgtagttcttg 477 ||||||||||| |||||||| || | ||||||||| | || |||||| || | |||||| Sbjct: 20590 ttgtacatgttatggtaacctgtacggctctggtatctcaaccagattccaaaattcttg 20649 Query: 478 atggtggtcgggttcttctcaaagatct 505 || || || ||||||||||||||||||| Sbjct: 20650 atcgttgttgggttcttctcaaagatct 20677 Score = 56.0 bits (28), Expect = 2e-04 Identities = 49/56 (87%) Strand = Plus / Plus Query: 238 accagcgggaacttgatcttcgagttgtggaactgcttcgtgttgtccctcttgca 293 |||| ||||||||||||||| |||||| |||||||||||| | ||||||||||| Sbjct: 20410 accaacgggaacttgatcttgctgttgtgaaactgcttcgtgctttccctcttgca 20465 Score = 50.1 bits (25), Expect = 0.009 Identities = 61/73 (83%) Strand = Plus / Plus Query: 566 accagaacttggacttggcgcggacctcgttggtggcccagagcttcatgcggtagatct 625 ||||||||||||| ||||| | |||||||| || ||||| |||||||| | ||| |||| Sbjct: 21003 accagaacttggatttggcaagaacctcgttcgttgcccatagcttcatcctgtaaatct 21062 Query: 626 tgggctgctcatc 638 | || |||||||| Sbjct: 21063 ttggttgctcatc 21075 Score = 42.1 bits (21), Expect = 2.3 Identities = 39/45 (86%) Strand = Plus / Plus Query: 504 ctcgttgatggcgagcatctggccgttggccttcttcaccttctt 548 |||||||||||| |||||||| || || ||||||||||||||| Sbjct: 20846 ctcgttgatggctagcatctgtccattactcttcttcaccttctt 20890
>emb|BX820914.1|CNS0A9IE Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH81ZB06 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress) Length = 705 Score = 87.7 bits (44), Expect = 4e-14 Identities = 99/116 (85%), Gaps = 1/116 (0%) Strand = Plus / Minus Query: 470 agttcttgatggtggtcgggttcttctcaaagatctcgttgatggcgagcatctggccgt 529 |||| ||||| || || |||||||||||| |||||| |||||||||||||||||| || | Sbjct: 216 agttattgatcgttgttgggttcttctcatagatcttgttgatggcgagcatctgtccat 157 Query: 530 tggcct-tcttcaccttcttgagcttcctcaggaagtaccagaacttggacttggc 584 | || |||||||||||||||| ||||||| ||| |||||||| ||||| ||||| Sbjct: 156 tactctgtcttcaccttcttgagtttcctcaagaaataccagaaattggatttggc 101 Score = 75.8 bits (38), Expect = 2e-10 Identities = 65/74 (87%) Strand = Plus / Minus Query: 361 gccatctccgtgtacatctgctccacaccgccgttcagagtcgtgtcgcggtactccttg 420 |||||||| ||||||||||| || ||| | | ||| ||||| ||||| |||||||||||| Sbjct: 325 gccatctcagtgtacatctgttcaacagctctgttaagagtggtgtcacggtactccttg 266 Query: 421 tacatgttgtggta 434 |||||||||||||| Sbjct: 265 tacatgttgtggta 252
>gb|BT016634.1| Zea mays clone Contig467 mRNA sequence Length = 859 Score = 85.7 bits (43), Expect = 2e-13 Identities = 103/123 (83%) Strand = Plus / Plus Query: 409 cggtactccttgtacatgttgtggtaaccggtcctgctctggtagcgcagccagatgccg 468 ||||||||||||| || || ||||||||| ||||||| |||||| | |||||||||||| Sbjct: 537 cggtactccttgtgcaggtcgtggtaacctgtcctgcactggtaacacagccagatgcca 596 Query: 469 tagttcttgatggtggtcgggttcttctcaaagatctcgttgatggcgagcatctggccg 528 |||||||||| || || ||||| |||||| ||||||| |||||||| ||||| ||| Sbjct: 597 cagttcttgattgttgtagggttacactcaaatatctcgtctatggcgagaatctgaccg 656 Query: 529 ttg 531 ||| Sbjct: 657 ttg 659 Score = 81.8 bits (41), Expect = 3e-12 Identities = 81/93 (87%), Gaps = 1/93 (1%) Strand = Plus / Plus Query: 546 cttgagcttcctcaggaagtaccagaacttggacttggcgcggacctcgttggtggccca 605 ||||||||||||||| ||||||||| ||||| |||| || |||||||||||| || || Sbjct: 679 cttgagcttcctcagatagtaccagagattggatttggagcagacctcgttggtagcgca 738 Query: 606 gagcttcatgcggtagatcttgggctgctcatc 638 |||| |||||||||||||||||| |||||||| Sbjct: 739 -agctccatgcggtagatcttggggtgctcatc 770 Score = 69.9 bits (35), Expect = 1e-08 Identities = 71/83 (85%) Strand = Plus / Plus Query: 247 aacttgatcttcgagttgtggaactgcttcgtgttgtccctcttgcacagcttgaagtcc 306 ||||||| ||| || |||||||||||||| ||||||||||||||||| ||||| |||| Sbjct: 377 aacttgaactttgaattgtggaactgcttggtgttgtccctcttgcaaagcttaaagttg 436 Query: 307 accgtcgcagtcttgatgatctg 329 | || || |||||||||||||| Sbjct: 437 attgttgccgtcttgatgatctg 459
>gb|AF548319.1| Branchiostoma belcheri ribosomal protein L18a mRNA, complete cds Length = 616 Score = 75.8 bits (38), Expect = 2e-10 Identities = 77/90 (85%) Strand = Plus / Minus Query: 405 gtcgcggtactccttgtacatgttgtggtaaccggtcctgctctggtagcgcagccagat 464 ||||||||||||| |||||||||||||| ||| | ||| | ||||||||||||||| Sbjct: 311 gtcgcggtactccctgtacatgttgtgggttccgcttctggagtcgtagcgcagccagat 252 Query: 465 gccgtagttcttgatggtggtcgggttctt 494 |||||||||||||||| | || |||||||| Sbjct: 251 gccgtagttcttgatgctcgtggggttctt 222
>gb|AC146330.33| Medicago truncatula clone mth2-7g7, complete sequence Length = 117139 Score = 67.9 bits (34), Expect = 4e-08 Identities = 64/74 (86%) Strand = Plus / Plus Query: 565 taccagaacttggacttggcgcggacctcgttggtggcccagagcttcatgcggtagatc 624 |||||||||||||| ||||| || ||||||||||| ||||| || |||||||| || ||| Sbjct: 20577 taccagaacttggatttggcacgaacctcgttggttgcccaaagtttcatgcgataaatc 20636 Query: 625 ttgggctgctcatc 638 ||||| || ||||| Sbjct: 20637 ttgggatgttcatc 20650 Score = 65.9 bits (33), Expect = 2e-07 Identities = 102/125 (81%) Strand = Plus / Plus Query: 381 ctccacaccgccgttcagagtcgtgtcgcggtactccttgtacatgttgtggtaaccggt 440 ||||||| | ||||| ||||| || || ||||| ||||||||||| ||||| ||||| || Sbjct: 19689 ctccacagcaccgtttagagtagtatcacggtattccttgtacatattgtgataaccagt 19748 Query: 441 cctgctctggtagcgcagccagatgccgtagttcttgatggtggtcgggttcttctcaaa 500 | ||||| || |||||||| || ||||||||||| || |||| || || |||||||| Sbjct: 19749 acgactctgataacgcagccaaattccgtagttcttaatcttggtaggatttttctcaaa 19808 Query: 501 gatct 505 ||||| Sbjct: 19809 gatct 19813 Score = 58.0 bits (29), Expect = 4e-05 Identities = 59/69 (85%) Strand = Plus / Plus Query: 228 cttctggtacaccagcgggaacttgatcttcgagttgtggaactgcttcgtgttgtccct 287 ||||| |||||||| ||||||||||| || || |||||||||||||| ||| | ||||| Sbjct: 19536 cttcttgtacaccaaggggaacttgattttggaattgtggaactgcttagtgctctccct 19595 Query: 288 cttgcacag 296 |||||||| Sbjct: 19596 tttgcacag 19604
>emb|AJ718289.1| Nicotiana tabacum cDNA-AFLP-fragment BSTT4-43-380, cultivar Bright Yellow 2 Length = 320 Score = 65.9 bits (33), Expect = 2e-07 Identities = 60/69 (86%) Strand = Plus / Minus Query: 361 gccatctccgtgtacatctgctccacaccgccgttcagagtcgtgtcgcggtactccttg 420 |||||||| ||||||||||| |||||| | || |||| ||| || || |||||||||||| Sbjct: 109 gccatctcagtgtacatctgttccacagctccattcaaagtggtatctcggtactccttg 50 Query: 421 tacatgttg 429 ||||||||| Sbjct: 49 tacatgttg 41 Score = 40.1 bits (20), Expect = 9.0 Identities = 47/56 (83%) Strand = Plus / Minus Query: 244 gggaacttgatcttcgagttgtggaactgcttcgtgttgtccctcttgcacagctt 299 ||||||||||| || |||| ||||||||||| ||| | |||||||| || ||||| Sbjct: 226 gggaacttgattttggagtcatggaactgcttggtgctctccctcttacatagctt 171
>ref|XM_505817.1| Yarrowia lipolytica CLIB122, YALI0F24123g predicted mRNA Length = 519 Score = 60.0 bits (30), Expect = 1e-05 Identities = 93/114 (81%) Strand = Plus / Minus Query: 459 ccagatgccgtagttcttgatggtggtcgggttcttctcaaagatctcgttgatggcgag 518 |||||||||| ||||||||| | || ||| ||||||| |||||| ||||||||| | Sbjct: 234 ccagatgccgaagttcttgaccttagtgggggtcttctcggagatcttgttgatggcaac 175 Query: 519 catctggccgttggccttcttcaccttcttgagcttcctcaggaagtaccagaa 572 |||| ||| ||| |||||| ||||||||||||| |||||||||||||||| Sbjct: 174 aatctcaccggtggacttcttgaccttcttgagctgggtcaggaagtaccagaa 121 Score = 46.1 bits (23), Expect = 0.15 Identities = 23/23 (100%) Strand = Plus / Minus Query: 409 cggtactccttgtacatgttgtg 431 ||||||||||||||||||||||| Sbjct: 284 cggtactccttgtacatgttgtg 262
>emb|CR382132.1| Yarrowia lipolytica chromosome F of strain CLIB122 of Yarrowia lipolytica Length = 4003362 Score = 60.0 bits (30), Expect = 1e-05 Identities = 93/114 (81%) Strand = Plus / Plus Query: 459 ccagatgccgtagttcttgatggtggtcgggttcttctcaaagatctcgttgatggcgag 518 |||||||||| ||||||||| | || ||| ||||||| |||||| ||||||||| | Sbjct: 3153790 ccagatgccgaagttcttgaccttagtgggggtcttctcggagatcttgttgatggcaac 3153849 Query: 519 catctggccgttggccttcttcaccttcttgagcttcctcaggaagtaccagaa 572 |||| ||| ||| |||||| ||||||||||||| |||||||||||||||| Sbjct: 3153850 aatctcaccggtggacttcttgaccttcttgagctgggtcaggaagtaccagaa 3153903 Score = 46.1 bits (23), Expect = 0.15 Identities = 23/23 (100%) Strand = Plus / Plus Query: 409 cggtactccttgtacatgttgtg 431 ||||||||||||||||||||||| Sbjct: 3153740 cggtactccttgtacatgttgtg 3153762
>gb|AY961480.1| Phytophthora infestans clone MY-22-C-06 ribosomal protein L18 mRNA, complete cds Length = 682 Score = 58.0 bits (29), Expect = 4e-05 Identities = 53/61 (86%) Strand = Plus / Minus Query: 372 gtacatctgctccacaccgccgttcagagtcgtgtcgcggtactccttgtacatgttgtg 431 |||||||||||||||| ||| | |||||| ||| ||||||||||||||||||||||| Sbjct: 335 gtacatctgctccacagcgctgcagagagtcaagtcacggtactccttgtacatgttgtg 276 Query: 432 g 432 | Sbjct: 275 g 275
>ref|XM_524153.1| PREDICTED: Pan troglodytes similar to ribosomal protein L18a; 60S ribosomal protein L18a (LOC468766), mRNA Length = 390 Score = 56.0 bits (28), Expect = 2e-04 Identities = 34/36 (94%) Strand = Plus / Minus Query: 240 cagcgggaacttgatcttcgagttgtggaactgctt 275 |||||||||||||||||| |||| |||||||||||| Sbjct: 321 cagcgggaacttgatcttggagtcgtggaactgctt 286
>ref|NM_000980.2| Homo sapiens ribosomal protein L18a (RPL18A), mRNA Length = 618 Score = 56.0 bits (28), Expect = 2e-04 Identities = 34/36 (94%) Strand = Plus / Minus Query: 240 cagcgggaacttgatcttcgagttgtggaactgctt 275 |||||||||||||||||| |||| |||||||||||| Sbjct: 497 cagcgggaacttgatcttggagtcgtggaactgctt 462
>gb|U52111.3| Homo sapiens chromosome X clone Qc-7G6, QLL-F1720, QLL-C1335, Qc-8B7, Qc-11H12, Qc-7F6, QLL-E153, Qc-10E8, Qc-10B7 map q28, complete sequence Length = 247592 Score = 56.0 bits (28), Expect = 2e-04 Identities = 34/36 (94%) Strand = Plus / Minus Query: 240 cagcgggaacttgatcttcgagttgtggaactgctt 275 |||||||||||||||||| |||| |||||||||||| Sbjct: 45832 cagcgggaacttgatcttggagtcgtggaactgctt 45797 Score = 44.1 bits (22), Expect = 0.58 Identities = 25/26 (96%) Strand = Plus / Minus Query: 451 tagcgcagccagatgccgtagttctt 476 |||||||||||||||||| ||||||| Sbjct: 45621 tagcgcagccagatgccgaagttctt 45596
>gb|AC089983.23| Homo sapiens 12 BAC RP11-818F20 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 204505 Score = 56.0 bits (28), Expect = 2e-04 Identities = 34/36 (94%) Strand = Plus / Minus Query: 240 cagcgggaacttgatcttcgagttgtggaactgctt 275 |||||||||||||||||| |||| |||||||||||| Sbjct: 168555 cagcgggaacttgatcttggagtcgtggaactgctt 168520
>gb|BC098413.1| Homo sapiens cDNA clone IMAGE:6208834, **** WARNING: chimeric clone **** Length = 1360 Score = 56.0 bits (28), Expect = 2e-04 Identities = 34/36 (94%) Strand = Plus / Minus Query: 240 cagcgggaacttgatcttcgagttgtggaactgctt 275 |||||||||||||||||| |||| |||||||||||| Sbjct: 1166 cagcgggaacttgatcttggagtcgtggaactgctt 1131
>gb|BC062307.1| Homo sapiens cDNA clone IMAGE:3504574, **** WARNING: chimeric clone **** Length = 1785 Score = 56.0 bits (28), Expect = 2e-04 Identities = 34/36 (94%) Strand = Plus / Minus Query: 240 cagcgggaacttgatcttcgagttgtggaactgctt 275 |||||||||||||||||| |||| |||||||||||| Sbjct: 1608 cagcgggaacttgatcttggagtcgtggaactgctt 1573
>gb|BC071836.1| Homo sapiens cDNA clone IMAGE:6210072, **** WARNING: chimeric clone **** Length = 1360 Score = 56.0 bits (28), Expect = 2e-04 Identities = 34/36 (94%) Strand = Plus / Minus Query: 240 cagcgggaacttgatcttcgagttgtggaactgctt 275 |||||||||||||||||| |||| |||||||||||| Sbjct: 1166 cagcgggaacttgatcttggagtcgtggaactgctt 1131
>gb|BC066319.1| Homo sapiens ribosomal protein L18a, mRNA (cDNA clone MGC:87208 IMAGE:5286436), complete cds Length = 632 Score = 56.0 bits (28), Expect = 2e-04 Identities = 34/36 (94%) Strand = Plus / Minus Query: 240 cagcgggaacttgatcttcgagttgtggaactgctt 275 |||||||||||||||||| |||| |||||||||||| Sbjct: 501 cagcgggaacttgatcttggagtcgtggaactgctt 466
>gb|BC007512.2| Homo sapiens ribosomal protein L18a, mRNA (cDNA clone MGC:4476 IMAGE:2961519), complete cds Length = 616 Score = 56.0 bits (28), Expect = 2e-04 Identities = 34/36 (94%) Strand = Plus / Minus Query: 240 cagcgggaacttgatcttcgagttgtggaactgctt 275 |||||||||||||||||| |||| |||||||||||| Sbjct: 481 cagcgggaacttgatcttggagtcgtggaactgctt 446
>emb|CR615832.1| full-length cDNA clone CS0DL001YB06 of B cells (Ramos cell line) Cot 25-normalized of Homo sapiens (human) Length = 602 Score = 56.0 bits (28), Expect = 2e-04 Identities = 34/36 (94%) Strand = Plus / Minus Query: 240 cagcgggaacttgatcttcgagttgtggaactgctt 275 |||||||||||||||||| |||| |||||||||||| Sbjct: 481 cagcgggaacttgatcttggagtcgtggaactgctt 446
>emb|CR624588.1| full-length cDNA clone CS0DI021YD01 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 612 Score = 56.0 bits (28), Expect = 2e-04 Identities = 34/36 (94%) Strand = Plus / Minus Query: 240 cagcgggaacttgatcttcgagttgtggaactgctt 275 |||||||||||||||||| |||| |||||||||||| Sbjct: 491 cagcgggaacttgatcttggagtcgtggaactgctt 456
>emb|CR619918.1| full-length cDNA clone CS0DM013YP23 of Fetal liver of Homo sapiens (human) Length = 1921 Score = 56.0 bits (28), Expect = 2e-04 Identities = 34/36 (94%) Strand = Plus / Minus Query: 240 cagcgggaacttgatcttcgagttgtggaactgctt 275 |||||||||||||||||| |||| |||||||||||| Sbjct: 1802 cagcgggaacttgatcttggagtcgtggaactgctt 1767
>emb|CR619120.1| full-length cDNA clone CS0DI077YH09 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 1912 Score = 56.0 bits (28), Expect = 2e-04 Identities = 34/36 (94%) Strand = Plus / Minus Query: 240 cagcgggaacttgatcttcgagttgtggaactgctt 275 |||||||||||||||||| |||| |||||||||||| Sbjct: 1802 cagcgggaacttgatcttggagtcgtggaactgctt 1767
>emb|CR617184.1| full-length cDNA clone CS0DJ005YO06 of T cells (Jurkat cell line) Cot 10-normalized of Homo sapiens (human) Length = 606 Score = 56.0 bits (28), Expect = 2e-04 Identities = 34/36 (94%) Strand = Plus / Minus Query: 240 cagcgggaacttgatcttcgagttgtggaactgctt 275 |||||||||||||||||| |||| |||||||||||| Sbjct: 484 cagcgggaacttgatcttggagtcgtggaactgctt 449
>emb|CR606905.1| full-length cDNA clone CS0DC025YL04 of Neuroblastoma Cot 25-normalized of Homo sapiens (human) Length = 604 Score = 56.0 bits (28), Expect = 2e-04 Identities = 34/36 (94%) Strand = Plus / Minus Query: 240 cagcgggaacttgatcttcgagttgtggaactgctt 275 |||||||||||||||||| |||| |||||||||||| Sbjct: 483 cagcgggaacttgatcttggagtcgtggaactgctt 448
>emb|CR603612.1| full-length cDNA clone CS0DB009YJ04 of Neuroblastoma Cot 10-normalized of Homo sapiens (human) Length = 612 Score = 56.0 bits (28), Expect = 2e-04 Identities = 34/36 (94%) Strand = Plus / Minus Query: 240 cagcgggaacttgatcttcgagttgtggaactgctt 275 |||||||||||||||||| |||| |||||||||||| Sbjct: 491 cagcgggaacttgatcttggagtcgtggaactgctt 456
>emb|CR600519.1| full-length cDNA clone CS0DC003YF24 of Neuroblastoma Cot 25-normalized of Homo sapiens (human) Length = 605 Score = 56.0 bits (28), Expect = 2e-04 Identities = 34/36 (94%) Strand = Plus / Minus Query: 240 cagcgggaacttgatcttcgagttgtggaactgctt 275 |||||||||||||||||| |||| |||||||||||| Sbjct: 484 cagcgggaacttgatcttggagtcgtggaactgctt 449
>emb|CR600845.1| full-length cDNA clone CS0DA007YA19 of Neuroblastoma of Homo sapiens (human) Length = 605 Score = 56.0 bits (28), Expect = 2e-04 Identities = 34/36 (94%) Strand = Plus / Minus Query: 240 cagcgggaacttgatcttcgagttgtggaactgctt 275 |||||||||||||||||| |||| |||||||||||| Sbjct: 484 cagcgggaacttgatcttggagtcgtggaactgctt 449
>emb|CR594005.1| full-length cDNA clone CL0BB004ZF10 of Neuroblastoma of Homo sapiens (human) Length = 603 Score = 56.0 bits (28), Expect = 2e-04 Identities = 34/36 (94%) Strand = Plus / Minus Query: 240 cagcgggaacttgatcttcgagttgtggaactgctt 275 |||||||||||||||||| |||| |||||||||||| Sbjct: 483 cagcgggaacttgatcttggagtcgtggaactgctt 448
>emb|CR592115.1| full-length cDNA clone CS0DI063YB22 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 601 Score = 56.0 bits (28), Expect = 2e-04 Identities = 34/36 (94%) Strand = Plus / Minus Query: 240 cagcgggaacttgatcttcgagttgtggaactgctt 275 |||||||||||||||||| |||| |||||||||||| Sbjct: 482 cagcgggaacttgatcttggagtcgtggaactgctt 447
>ref|NR_001593.1| Homo sapiens similar to ribosomal protein L18a; 60S ribosomal protein L18a (LOC390354) on chromosome 12 Length = 616 Score = 56.0 bits (28), Expect = 2e-04 Identities = 34/36 (94%) Strand = Plus / Minus Query: 240 cagcgggaacttgatcttcgagttgtggaactgctt 275 |||||||||||||||||| |||| |||||||||||| Sbjct: 501 cagcgggaacttgatcttggagtcgtggaactgctt 466
>ref|XM_938382.1| PREDICTED: Homo sapiens similar to ribosomal protein L18a (LOC347544), mRNA Length = 574 Score = 56.0 bits (28), Expect = 2e-04 Identities = 34/36 (94%) Strand = Plus / Minus Query: 240 cagcgggaacttgatcttcgagttgtggaactgctt 275 |||||||||||||||||| |||| |||||||||||| Sbjct: 462 cagcgggaacttgatcttggagtcgtggaactgctt 427 Score = 44.1 bits (22), Expect = 0.58 Identities = 25/26 (96%) Strand = Plus / Minus Query: 451 tagcgcagccagatgccgtagttctt 476 |||||||||||||||||| ||||||| Sbjct: 251 tagcgcagccagatgccgaagttctt 226
>ref|XM_293412.3| PREDICTED: Homo sapiens similar to ribosomal protein L18a (LOC347544), mRNA Length = 574 Score = 56.0 bits (28), Expect = 2e-04 Identities = 34/36 (94%) Strand = Plus / Minus Query: 240 cagcgggaacttgatcttcgagttgtggaactgctt 275 |||||||||||||||||| |||| |||||||||||| Sbjct: 462 cagcgggaacttgatcttggagtcgtggaactgctt 427 Score = 44.1 bits (22), Expect = 0.58 Identities = 25/26 (96%) Strand = Plus / Minus Query: 451 tagcgcagccagatgccgtagttctt 476 |||||||||||||||||| ||||||| Sbjct: 251 tagcgcagccagatgccgaagttctt 226
>ref|XM_945469.1| PREDICTED: Homo sapiens similar to ribosomal protein L18a, transcript variant 6 (LOC285053), mRNA Length = 588 Score = 56.0 bits (28), Expect = 2e-04 Identities = 34/36 (94%) Strand = Plus / Minus Query: 240 cagcgggaacttgatcttcgagttgtggaactgctt 275 |||||||||||||||||| |||| |||||||||||| Sbjct: 465 cagcgggaacttgatcttggagtcgtggaactgctt 430
>ref|XM_945465.1| PREDICTED: Homo sapiens similar to ribosomal protein L18a, transcript variant 5 (LOC285053), mRNA Length = 557 Score = 56.0 bits (28), Expect = 2e-04 Identities = 34/36 (94%) Strand = Plus / Minus Query: 240 cagcgggaacttgatcttcgagttgtggaactgctt 275 |||||||||||||||||| |||| |||||||||||| Sbjct: 434 cagcgggaacttgatcttggagtcgtggaactgctt 399
>ref|XM_941835.1| PREDICTED: Homo sapiens similar to ribosomal protein L18a, transcript variant 4 (LOC285053), mRNA Length = 659 Score = 56.0 bits (28), Expect = 2e-04 Identities = 34/36 (94%) Strand = Plus / Minus Query: 240 cagcgggaacttgatcttcgagttgtggaactgctt 275 |||||||||||||||||| |||| |||||||||||| Sbjct: 511 cagcgggaacttgatcttggagtcgtggaactgctt 476
>ref|XM_934020.1| PREDICTED: Homo sapiens similar to ribosomal protein L18a, transcript variant 3 (LOC285053), mRNA Length = 588 Score = 56.0 bits (28), Expect = 2e-04 Identities = 34/36 (94%) Strand = Plus / Minus Query: 240 cagcgggaacttgatcttcgagttgtggaactgctt 275 |||||||||||||||||| |||| |||||||||||| Sbjct: 465 cagcgggaacttgatcttggagtcgtggaactgctt 430
>ref|XM_934018.1| PREDICTED: Homo sapiens similar to ribosomal protein L18a, transcript variant 2 (LOC285053), mRNA Length = 557 Score = 56.0 bits (28), Expect = 2e-04 Identities = 34/36 (94%) Strand = Plus / Minus Query: 240 cagcgggaacttgatcttcgagttgtggaactgctt 275 |||||||||||||||||| |||| |||||||||||| Sbjct: 434 cagcgggaacttgatcttggagtcgtggaactgctt 399
>ref|XM_208281.6| PREDICTED: Homo sapiens similar to ribosomal protein L18a, transcript variant 1 (LOC285053), mRNA Length = 659 Score = 56.0 bits (28), Expect = 2e-04 Identities = 34/36 (94%) Strand = Plus / Minus Query: 240 cagcgggaacttgatcttcgagttgtggaactgctt 275 |||||||||||||||||| |||| |||||||||||| Sbjct: 511 cagcgggaacttgatcttggagtcgtggaactgctt 476
>dbj|AK222647.1| Homo sapiens mRNA for ribosomal protein L18a variant, clone: CBL08590 Length = 594 Score = 56.0 bits (28), Expect = 2e-04 Identities = 34/36 (94%) Strand = Plus / Minus Query: 240 cagcgggaacttgatcttcgagttgtggaactgctt 275 |||||||||||||||||| |||| |||||||||||| Sbjct: 497 cagcgggaacttgatcttggagtcgtggaactgctt 462
>gb|AC079250.7| Homo sapiens BAC clone RP11-62I18 from 2, complete sequence Length = 82938 Score = 56.0 bits (28), Expect = 2e-04 Identities = 34/36 (94%) Strand = Plus / Plus Query: 240 cagcgggaacttgatcttcgagttgtggaactgctt 275 |||||||||||||||||| |||| |||||||||||| Sbjct: 78637 cagcgggaacttgatcttggagtcgtggaactgctt 78672
>gb|L05093.1|HUMRIBPROD Homo sapiens ribosomal protein L18a mRNA, complete cds Length = 602 Score = 56.0 bits (28), Expect = 2e-04 Identities = 34/36 (94%) Strand = Plus / Minus Query: 240 cagcgggaacttgatcttcgagttgtggaactgctt 275 |||||||||||||||||| |||| |||||||||||| Sbjct: 481 cagcgggaacttgatcttggagtcgtggaactgctt 446
>dbj|AB180445.1| Plutella xylostella mRNA for Ribosomal protein L18A, complete cds Length = 564 Score = 56.0 bits (28), Expect = 2e-04 Identities = 43/48 (89%) Strand = Plus / Minus Query: 450 gtagcgcagccagatgccgtagttcttgatggtggtcgggttcttctc 497 ||||||||||||||||||| |||||||||| || ||||| ||||||| Sbjct: 257 gtagcgcagccagatgccgaagttcttgatcttgatcgggctcttctc 210
>gb|BC071920.1| Homo sapiens ribosomal protein L18a, mRNA (cDNA clone MGC:88602 IMAGE:6293838), complete cds Length = 622 Score = 56.0 bits (28), Expect = 2e-04 Identities = 34/36 (94%) Strand = Plus / Minus Query: 240 cagcgggaacttgatcttcgagttgtggaactgctt 275 |||||||||||||||||| |||| |||||||||||| Sbjct: 481 cagcgggaacttgatcttggagtcgtggaactgctt 446
>gb|AF045188.1|AF045188 Salmo salar ribosomal protein L18a mRNA, complete cds Length = 607 Score = 56.0 bits (28), Expect = 2e-04 Identities = 31/32 (96%) Strand = Plus / Minus Query: 244 gggaacttgatcttcgagttgtggaactgctt 275 ||||||||||||||||||| |||||||||||| Sbjct: 474 gggaacttgatcttcgagtcgtggaactgctt 443
>emb|X80822.1|HSPLORF H.sapiens mRNA for ORF Length = 657 Score = 56.0 bits (28), Expect = 2e-04 Identities = 34/36 (94%) Strand = Plus / Minus Query: 240 cagcgggaacttgatcttcgagttgtggaactgctt 275 |||||||||||||||||| |||| |||||||||||| Sbjct: 487 cagcgggaacttgatcttggagtcgtggaactgctt 452
>gb|AY232187.1| Drosophila yakuba clone yak-ad_RpL18A mRNA sequence Length = 240 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 238 accagcgggaacttgatcttcgagttgtggaactgcttc 276 ||||| ||||||||||||||||| | ||||||||||||| Sbjct: 173 accagagggaacttgatcttcgaatcgtggaactgcttc 135
>gb|AY231805.1| Drosophila yakuba clone yak-em_RpL18A mRNA sequence Length = 528 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 238 accagcgggaacttgatcttcgagttgtggaactgcttc 276 ||||| |||||||||||||| |||| ||||||||||||| Sbjct: 461 accagagggaacttgatcttggagtcgtggaactgcttc 423 Score = 44.1 bits (22), Expect = 0.58 Identities = 25/26 (96%) Strand = Plus / Minus Query: 454 cgcagccagatgccgtagttcttgat 479 ||||||||||||||| |||||||||| Sbjct: 245 cgcagccagatgccgaagttcttgat 220
>gb|AY048752.1| Blastocystis hominis RAPD fragment Length = 1132 Score = 54.0 bits (27), Expect = 6e-04 Identities = 33/35 (94%) Strand = Plus / Plus Query: 397 agagtcgtgtcgcggtactccttgtacatgttgtg 431 |||| |||||| ||||||||||||||||||||||| Sbjct: 356 agagccgtgtcacggtactccttgtacatgttgtg 390
>emb|BX053393.1|CNS09DD1 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC31AB07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 165 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 237 caccagcgggaacttgatcttcgagttgtggaactgctt 275 |||||||||||| |||||||||||||||||||||||| Sbjct: 111 caccagcgggaatcggatcttcgagttgtggaactgctt 149
>emb|BX072011.1|CNS09RQ7 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC9DB04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 702 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 237 caccagcgggaacttgatcttcgagttgtggaactgctt 275 |||||||||||| |||||||||||||||||||||||| Sbjct: 434 caccagcgggaatcggatcttcgagttgtggaactgctt 472
>emb|BX072010.1|CNS09RQ6 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC9DB04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 773 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 237 caccagcgggaacttgatcttcgagttgtggaactgctt 275 |||||||||||| |||||||||||||||||||||||| Sbjct: 506 caccagcgggaatcggatcttcgagttgtggaactgctt 468
>emb|BX071935.1|CNS09RO3 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC9CF11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 940 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 237 caccagcgggaacttgatcttcgagttgtggaactgctt 275 |||||||||||| |||||||||||||||||||||||| Sbjct: 414 caccagcgggaatcggatcttcgagttgtggaactgctt 452
>emb|BX071934.1|CNS09RO2 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC9CF11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 964 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 237 caccagcgggaacttgatcttcgagttgtggaactgctt 275 |||||||||||| |||||||||||||||||||||||| Sbjct: 492 caccagcgggaatcggatcttcgagttgtggaactgctt 454
>emb|BX071198.1|CNS09R3M Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC8CE08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 951 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 237 caccagcgggaacttgatcttcgagttgtggaactgctt 275 |||||||||||| |||||||||||||||||||||||| Sbjct: 407 caccagcgggaatcggatcttcgagttgtggaactgctt 445
>emb|BX071197.1|CNS09R3L Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC8CE08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 946 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 237 caccagcgggaacttgatcttcgagttgtggaactgctt 275 |||||||||||| |||||||||||||||||||||||| Sbjct: 482 caccagcgggaatcggatcttcgagttgtggaactgctt 444
>emb|BX071326.1|CNS09R76 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC8DC06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 946 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 237 caccagcgggaacttgatcttcgagttgtggaactgctt 275 |||||||||||| |||||||||||||||||||||||| Sbjct: 482 caccagcgggaatcggatcttcgagttgtggaactgctt 444
>emb|BX071022.1|CNS09QYQ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC8BE12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 909 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 237 caccagcgggaacttgatcttcgagttgtggaactgctt 275 |||||||||||| |||||||||||||||||||||||| Sbjct: 422 caccagcgggaatcggatcttcgagttgtggaactgctt 460
>emb|BX071021.1|CNS09QYP Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC8BE12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 885 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 237 caccagcgggaacttgatcttcgagttgtggaactgctt 275 |||||||||||| |||||||||||||||||||||||| Sbjct: 497 caccagcgggaatcggatcttcgagttgtggaactgctt 459
>emb|BX070958.1|CNS09QWY Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC8BC04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 931 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 237 caccagcgggaacttgatcttcgagttgtggaactgctt 275 |||||||||||| |||||||||||||||||||||||| Sbjct: 420 caccagcgggaatcggatcttcgagttgtggaactgctt 458
>emb|BX070094.1|CNS09Q8Y Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC7AA12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 684 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 237 caccagcgggaacttgatcttcgagttgtggaactgctt 275 |||||||||||| |||||||||||||||||||||||| Sbjct: 479 caccagcgggaatcggatcttcgagttgtggaactgctt 441
>emb|BX069977.1|CNS09Q5P Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC6DD10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 934 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 237 caccagcgggaacttgatcttcgagttgtggaactgctt 275 |||||||||||| |||||||||||||||||||||||| Sbjct: 489 caccagcgggaatcggatcttcgagttgtggaactgctt 451
>emb|BX069941.1|CNS09Q4P Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC6DC01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 694 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 237 caccagcgggaacttgatcttcgagttgtggaactgctt 275 |||||||||||| |||||||||||||||||||||||| Sbjct: 413 caccagcgggaatcggatcttcgagttgtggaactgctt 451
>emb|BX069940.1|CNS09Q4O Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC6DC01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 932 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 237 caccagcgggaacttgatcttcgagttgtggaactgctt 275 |||||||||||| |||||||||||||||||||||||| Sbjct: 467 caccagcgggaatcggatcttcgagttgtggaactgctt 429
>emb|BX069703.1|CNS09PY3 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC6BH09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 950 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 237 caccagcgggaacttgatcttcgagttgtggaactgctt 275 |||||||||||| |||||||||||||||||||||||| Sbjct: 392 caccagcgggaatcggatcttcgagttgtggaactgctt 430
>emb|BX069702.1|CNS09PY2 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC6BH09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 940 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 237 caccagcgggaacttgatcttcgagttgtggaactgctt 275 |||||||||||| |||||||||||||||||||||||| Sbjct: 476 caccagcgggaatcggatcttcgagttgtggaactgctt 438
>emb|BX060940.1|CNS09J6O Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC41CB03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 392 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 237 caccagcgggaacttgatcttcgagttgtggaactgctt 275 |||||||||||| |||||||||||||||||||||||| Sbjct: 348 caccagcgggaatcggatcttcgagttgtggaactgctt 386
>emb|BX060939.1|CNS09J6N Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC41CB03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 944 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 237 caccagcgggaacttgatcttcgagttgtggaactgctt 275 |||||||||||| |||||||||||||||||||||||| Sbjct: 476 caccagcgggaatcggatcttcgagttgtggaactgctt 438
>emb|BX069369.1|CNS09POT Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC6AA09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 577 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 237 caccagcgggaacttgatcttcgagttgtggaactgctt 275 |||||||||||| |||||||||||||||||||||||| Sbjct: 437 caccagcgggaatcggatcttcgagttgtggaactgctt 475
>emb|BX069368.1|CNS09POS Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC6AA09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 976 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 237 caccagcgggaacttgatcttcgagttgtggaactgctt 275 |||||||||||| |||||||||||||||||||||||| Sbjct: 503 caccagcgggaatcggatcttcgagttgtggaactgctt 465
>emb|BX069214.1|CNS09PKI Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC53DB06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 981 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 237 caccagcgggaacttgatcttcgagttgtggaactgctt 275 |||||||||||| |||||||||||||||||||||||| Sbjct: 441 caccagcgggaatcggatcttcgagttgtggaactgctt 479
>emb|BX069213.1|CNS09PKH Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC53DB06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 972 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 237 caccagcgggaacttgatcttcgagttgtggaactgctt 275 |||||||||||| |||||||||||||||||||||||| Sbjct: 493 caccagcgggaatcggatcttcgagttgtggaactgctt 455
>emb|BX068918.1|CNS09PCA Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC53BE04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 975 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 237 caccagcgggaacttgatcttcgagttgtggaactgctt 275 |||||||||||| |||||||||||||||||||||||| Sbjct: 443 caccagcgggaatcggatcttcgagttgtggaactgctt 481
>emb|BX068917.1|CNS09PC9 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC53BE04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 990 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 237 caccagcgggaacttgatcttcgagttgtggaactgctt 275 |||||||||||| |||||||||||||||||||||||| Sbjct: 516 caccagcgggaatcggatcttcgagttgtggaactgctt 478
>emb|BX068781.1|CNS09P8H Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC53AG06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 514 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 237 caccagcgggaacttgatcttcgagttgtggaactgctt 275 |||||||||||| |||||||||||||||||||||||| Sbjct: 447 caccagcgggaatcggatcttcgagttgtggaactgctt 485
>emb|BX068780.1|CNS09P8G Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC53AG06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 974 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 237 caccagcgggaacttgatcttcgagttgtggaactgctt 275 |||||||||||| |||||||||||||||||||||||| Sbjct: 501 caccagcgggaatcggatcttcgagttgtggaactgctt 463
>emb|BX068699.1|CNS09P67 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC53AC09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 896 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 237 caccagcgggaacttgatcttcgagttgtggaactgctt 275 |||||||||||| |||||||||||||||||||||||| Sbjct: 435 caccagcgggaatcggatcttcgagttgtggaactgctt 473
>emb|BX068698.1|CNS09P66 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC53AC09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 966 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 237 caccagcgggaacttgatcttcgagttgtggaactgctt 275 |||||||||||| |||||||||||||||||||||||| Sbjct: 486 caccagcgggaatcggatcttcgagttgtggaactgctt 448
>emb|BX068685.1|CNS09P5T Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC53AC01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 796 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 237 caccagcgggaacttgatcttcgagttgtggaactgctt 275 |||||||||||| |||||||||||||||||||||||| Sbjct: 271 caccagcgggaatcggatcttcgagttgtggaactgctt 309
>emb|BX068632.1|CNS09P4C Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC52DH10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 469 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 237 caccagcgggaacttgatcttcgagttgtggaactgctt 275 |||||||||||| |||||||||||||||||||||||| Sbjct: 401 caccagcgggaatcggatcttcgagttgtggaactgctt 439
>emb|BX068631.1|CNS09P4B Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC52DH10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 962 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 237 caccagcgggaacttgatcttcgagttgtggaactgctt 275 |||||||||||| |||||||||||||||||||||||| Sbjct: 494 caccagcgggaatcggatcttcgagttgtggaactgctt 456
>emb|BX068389.1|CNS09OXL Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC52CD01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 968 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 237 caccagcgggaacttgatcttcgagttgtggaactgctt 275 |||||||||||| |||||||||||||||||||||||| Sbjct: 494 caccagcgggaatcggatcttcgagttgtggaactgctt 456
>emb|BX068343.1|CNS09OWB Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC52BH12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 894 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 237 caccagcgggaacttgatcttcgagttgtggaactgctt 275 |||||||||||| |||||||||||||||||||||||| Sbjct: 387 caccagcgggaatcggatcttcgagttgtggaactgctt 425
>emb|BX068342.1|CNS09OWA Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC52BH12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 858 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 237 caccagcgggaacttgatcttcgagttgtggaactgctt 275 |||||||||||| |||||||||||||||||||||||| Sbjct: 471 caccagcgggaatcggatcttcgagttgtggaactgctt 433
>emb|BX068334.1|CNS09OW2 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC52BH08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 954 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 237 caccagcgggaacttgatcttcgagttgtggaactgctt 275 |||||||||||| |||||||||||||||||||||||| Sbjct: 488 caccagcgggaatcggatcttcgagttgtggaactgctt 450
>emb|BX068304.1|CNS09OV8 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC52BG05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 978 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 237 caccagcgggaacttgatcttcgagttgtggaactgctt 275 |||||||||||| |||||||||||||||||||||||| Sbjct: 500 caccagcgggaatcggatcttcgagttgtggaactgctt 462
>emb|BX068271.1|CNS09OUB Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC52BE12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 538 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 237 caccagcgggaacttgatcttcgagttgtggaactgctt 275 |||||||||||| |||||||||||||||||||||||| Sbjct: 347 caccagcgggaatcggatcttcgagttgtggaactgctt 385
>emb|BX068270.1|CNS09OUA Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC52BE12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 910 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 237 caccagcgggaacttgatcttcgagttgtggaactgctt 275 |||||||||||| |||||||||||||||||||||||| Sbjct: 483 caccagcgggaatcggatcttcgagttgtggaactgctt 445
>emb|BX068265.1|CNS09OU5 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC52BE08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 790 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 237 caccagcgggaacttgatcttcgagttgtggaactgctt 275 |||||||||||| |||||||||||||||||||||||| Sbjct: 411 caccagcgggaatcggatcttcgagttgtggaactgctt 449
>emb|BX068264.1|CNS09OU4 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC52BE08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 741 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 237 caccagcgggaacttgatcttcgagttgtggaactgctt 275 |||||||||||| |||||||||||||||||||||||| Sbjct: 490 caccagcgggaatcggatcttcgagttgtggaactgctt 452
>emb|BX068004.1|CNS09OMW Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC52AA10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 832 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 237 caccagcgggaacttgatcttcgagttgtggaactgctt 275 |||||||||||| |||||||||||||||||||||||| Sbjct: 400 caccagcgggaatcggatcttcgagttgtggaactgctt 438
>emb|BX068003.1|CNS09OMV Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC52AA10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 822 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 237 caccagcgggaacttgatcttcgagttgtggaactgctt 275 |||||||||||| |||||||||||||||||||||||| Sbjct: 470 caccagcgggaatcggatcttcgagttgtggaactgctt 432
>emb|BX067731.1|CNS09OFB Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC51CB11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 887 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 237 caccagcgggaacttgatcttcgagttgtggaactgctt 275 |||||||||||| |||||||||||||||||||||||| Sbjct: 422 caccagcgggaatcggatcttcgagttgtggaactgctt 460
>emb|BX067730.1|CNS09OFA Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC51CB11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 977 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 237 caccagcgggaacttgatcttcgagttgtggaactgctt 275 |||||||||||| |||||||||||||||||||||||| Sbjct: 492 caccagcgggaatcggatcttcgagttgtggaactgctt 454
>emb|BX067102.1|CNS09NXU Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC50CE12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 564 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 237 caccagcgggaacttgatcttcgagttgtggaactgctt 275 |||||||||||| |||||||||||||||||||||||| Sbjct: 438 caccagcgggaatcggatcttcgagttgtggaactgctt 476
>emb|BX067101.1|CNS09NXT Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC50CE12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 801 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 237 caccagcgggaacttgatcttcgagttgtggaactgctt 275 |||||||||||| |||||||||||||||||||||||| Sbjct: 500 caccagcgggaatcggatcttcgagttgtggaactgctt 462
>emb|BX066999.1|CNS09NUZ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC50CA07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 755 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 237 caccagcgggaacttgatcttcgagttgtggaactgctt 275 |||||||||||| |||||||||||||||||||||||| Sbjct: 430 caccagcgggaatcggatcttcgagttgtggaactgctt 468
>emb|BX066998.1|CNS09NUY Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC50CA07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 869 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 237 caccagcgggaacttgatcttcgagttgtggaactgctt 275 |||||||||||| |||||||||||||||||||||||| Sbjct: 494 caccagcgggaatcggatcttcgagttgtggaactgctt 456
>emb|BX066931.1|CNS09NT3 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC50BF07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 968 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 237 caccagcgggaacttgatcttcgagttgtggaactgctt 275 |||||||||||| |||||||||||||||||||||||| Sbjct: 491 caccagcgggaatcggatcttcgagttgtggaactgctt 453
>emb|BX066843.1|CNS09NQN Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC50BB10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 804 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 237 caccagcgggaacttgatcttcgagttgtggaactgctt 275 |||||||||||| |||||||||||||||||||||||| Sbjct: 429 caccagcgggaatcggatcttcgagttgtggaactgctt 467
>emb|BX066842.1|CNS09NQM Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC50BB10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 964 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 237 caccagcgggaacttgatcttcgagttgtggaactgctt 275 |||||||||||| |||||||||||||||||||||||| Sbjct: 499 caccagcgggaatcggatcttcgagttgtggaactgctt 461
>emb|BX066697.1|CNS09NML Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC50AD07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 613 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 237 caccagcgggaacttgatcttcgagttgtggaactgctt 275 |||||||||||| |||||||||||||||||||||||| Sbjct: 495 caccagcgggaatcggatcttcgagttgtggaactgctt 457
>emb|BX066444.1|CNS09NFK Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC5DA10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 815 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 237 caccagcgggaacttgatcttcgagttgtggaactgctt 275 |||||||||||| |||||||||||||||||||||||| Sbjct: 486 caccagcgggaatcggatcttcgagttgtggaactgctt 448
>emb|BX065769.1|CNS09MWT Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC49DB09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 648 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 237 caccagcgggaacttgatcttcgagttgtggaactgctt 275 |||||||||||| |||||||||||||||||||||||| Sbjct: 419 caccagcgggaatcggatcttcgagttgtggaactgctt 457
>emb|BX065768.1|CNS09MWS Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC49DB09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 873 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 237 caccagcgggaacttgatcttcgagttgtggaactgctt 275 |||||||||||| |||||||||||||||||||||||| Sbjct: 497 caccagcgggaatcggatcttcgagttgtggaactgctt 459
>emb|BX065563.1|CNS09MR3 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC49CA10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 853 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 237 caccagcgggaacttgatcttcgagttgtggaactgctt 275 |||||||||||| |||||||||||||||||||||||| Sbjct: 401 caccagcgggaatcggatcttcgagttgtggaactgctt 439
>emb|BX065562.1|CNS09MR2 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC49CA10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 913 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 237 caccagcgggaacttgatcttcgagttgtggaactgctt 275 |||||||||||| |||||||||||||||||||||||| Sbjct: 522 caccagcgggaatcggatcttcgagttgtggaactgctt 484
>emb|BX065379.1|CNS09MLZ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC49BA08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 955 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 237 caccagcgggaacttgatcttcgagttgtggaactgctt 275 |||||||||||| |||||||||||||||||||||||| Sbjct: 425 caccagcgggaatcggatcttcgagttgtggaactgctt 463
>emb|BX065287.1|CNS09MJF Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC49AD12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 779 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 237 caccagcgggaacttgatcttcgagttgtggaactgctt 275 |||||||||||| |||||||||||||||||||||||| Sbjct: 410 caccagcgggaatcggatcttcgagttgtggaactgctt 448
>emb|BX065286.1|CNS09MJE Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC49AD12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 854 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 237 caccagcgggaacttgatcttcgagttgtggaactgctt 275 |||||||||||| |||||||||||||||||||||||| Sbjct: 480 caccagcgggaatcggatcttcgagttgtggaactgctt 442
>emb|BX065104.1|CNS09MEC Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC48DD07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 814 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 237 caccagcgggaacttgatcttcgagttgtggaactgctt 275 |||||||||||| |||||||||||||||||||||||| Sbjct: 407 caccagcgggaatcggatcttcgagttgtggaactgctt 445
>emb|BX065103.1|CNS09MEB Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC48DD07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 943 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 237 caccagcgggaacttgatcttcgagttgtggaactgctt 275 |||||||||||| |||||||||||||||||||||||| Sbjct: 479 caccagcgggaatcggatcttcgagttgtggaactgctt 441
>emb|BX065085.1|CNS09MDT Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC48DC10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 681 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 237 caccagcgggaacttgatcttcgagttgtggaactgctt 275 |||||||||||| |||||||||||||||||||||||| Sbjct: 311 caccagcgggaatcggatcttcgagttgtggaactgctt 273
>emb|BX065080.1|CNS09MDO Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC48DC07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 895 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 237 caccagcgggaacttgatcttcgagttgtggaactgctt 275 |||||||||||| |||||||||||||||||||||||| Sbjct: 402 caccagcgggaatcggatcttcgagttgtggaactgctt 440
>emb|BX065079.1|CNS09MDN Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC48DC07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 928 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 237 caccagcgggaacttgatcttcgagttgtggaactgctt 275 |||||||||||| |||||||||||||||||||||||| Sbjct: 481 caccagcgggaatcggatcttcgagttgtggaactgctt 443
>emb|BX065033.1|CNS09MCD Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC48DA05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 824 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 237 caccagcgggaacttgatcttcgagttgtggaactgctt 275 |||||||||||| |||||||||||||||||||||||| Sbjct: 402 caccagcgggaatcggatcttcgagttgtggaactgctt 440
>emb|BX065032.1|CNS09MCC Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC48DA05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 919 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 237 caccagcgggaacttgatcttcgagttgtggaactgctt 275 |||||||||||| |||||||||||||||||||||||| Sbjct: 471 caccagcgggaatcggatcttcgagttgtggaactgctt 433
>emb|BX064042.1|CNS09LKU Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC46AF09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 463 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 237 caccagcgggaacttgatcttcgagttgtggaactgctt 275 |||||||||||| |||||||||||||||||||||||| Sbjct: 27 caccagcgggaatcggatcttcgagttgtggaactgctt 65
>emb|BX064041.1|CNS09LKT Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC46AF09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 964 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 237 caccagcgggaacttgatcttcgagttgtggaactgctt 275 |||||||||||| |||||||||||||||||||||||| Sbjct: 497 caccagcgggaatcggatcttcgagttgtggaactgctt 459
>emb|BX063680.1|CNS09LAS Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC45CF09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 824 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 237 caccagcgggaacttgatcttcgagttgtggaactgctt 275 |||||||||||| |||||||||||||||||||||||| Sbjct: 361 caccagcgggaatcggatcttcgagttgtggaactgctt 323
>emb|BX063679.1|CNS09LAR Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC45CF08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 951 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 237 caccagcgggaacttgatcttcgagttgtggaactgctt 275 |||||||||||| |||||||||||||||||||||||| Sbjct: 412 caccagcgggaatcggatcttcgagttgtggaactgctt 450
>emb|BX063678.1|CNS09LAQ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC45CF08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 922 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 237 caccagcgggaacttgatcttcgagttgtggaactgctt 275 |||||||||||| |||||||||||||||||||||||| Sbjct: 476 caccagcgggaatcggatcttcgagttgtggaactgctt 438
>emb|BX063630.1|CNS09L9E Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC45CC12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 555 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 237 caccagcgggaacttgatcttcgagttgtggaactgctt 275 |||||||||||| |||||||||||||||||||||||| Sbjct: 424 caccagcgggaatcggatcttcgagttgtggaactgctt 462
>emb|BX063629.1|CNS09L9D Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC45CC12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 552 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 237 caccagcgggaacttgatcttcgagttgtggaactgctt 275 |||||||||||| |||||||||||||||||||||||| Sbjct: 489 caccagcgggaatcggatcttcgagttgtggaactgctt 451
>emb|BX063028.1|CNS09KSO Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC44CE06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 851 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 237 caccagcgggaacttgatcttcgagttgtggaactgctt 275 |||||||||||| |||||||||||||||||||||||| Sbjct: 413 caccagcgggaatcggatcttcgagttgtggaactgctt 451
>emb|BX063027.1|CNS09KSN Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC44CE06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 904 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 237 caccagcgggaacttgatcttcgagttgtggaactgctt 275 |||||||||||| |||||||||||||||||||||||| Sbjct: 610 caccagcgggaatcggatcttcgagttgtggaactgctt 572
>emb|BX062931.1|CNS09KPZ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC44BG11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 485 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 237 caccagcgggaacttgatcttcgagttgtggaactgctt 275 |||||||||||| |||||||||||||||||||||||| Sbjct: 422 caccagcgggaatcggatcttcgagttgtggaactgctt 460
>emb|BX062913.1|CNS09KPH Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC44BG01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 858 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 237 caccagcgggaacttgatcttcgagttgtggaactgctt 275 |||||||||||| |||||||||||||||||||||||| Sbjct: 411 caccagcgggaatcggatcttcgagttgtggaactgctt 449
>emb|BX062912.1|CNS09KPG Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC44BG01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 860 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 237 caccagcgggaacttgatcttcgagttgtggaactgctt 275 |||||||||||| |||||||||||||||||||||||| Sbjct: 484 caccagcgggaatcggatcttcgagttgtggaactgctt 446
>emb|BX062805.1|CNS09KMH Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC44BB01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 953 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 237 caccagcgggaacttgatcttcgagttgtggaactgctt 275 |||||||||||| |||||||||||||||||||||||| Sbjct: 489 caccagcgggaatcggatcttcgagttgtggaactgctt 451
>emb|BX062755.1|CNS09KL3 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC44AG07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 695 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 237 caccagcgggaacttgatcttcgagttgtggaactgctt 275 |||||||||||| |||||||||||||||||||||||| Sbjct: 350 caccagcgggaatcggatcttcgagttgtggaactgctt 312
>emb|BX062625.1|CNS09KHH Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC44AA02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 884 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 237 caccagcgggaacttgatcttcgagttgtggaactgctt 275 |||||||||||| |||||||||||||||||||||||| Sbjct: 405 caccagcgggaatcggatcttcgagttgtggaactgctt 443
>emb|BX062624.1|CNS09KHG Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC44AA02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 890 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 237 caccagcgggaacttgatcttcgagttgtggaactgctt 275 |||||||||||| |||||||||||||||||||||||| Sbjct: 480 caccagcgggaatcggatcttcgagttgtggaactgctt 442
>emb|BX062166.1|CNS09K4Q Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC43BC10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 865 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 237 caccagcgggaacttgatcttcgagttgtggaactgctt 275 |||||||||||| |||||||||||||||||||||||| Sbjct: 417 caccagcgggaatcggatcttcgagttgtggaactgctt 455
>emb|BX062165.1|CNS09K4P Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC43BC10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 816 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 237 caccagcgggaacttgatcttcgagttgtggaactgctt 275 |||||||||||| |||||||||||||||||||||||| Sbjct: 490 caccagcgggaatcggatcttcgagttgtggaactgctt 452
>emb|BX062118.1|CNS09K3E Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC43BA07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 914 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 237 caccagcgggaacttgatcttcgagttgtggaactgctt 275 |||||||||||| |||||||||||||||||||||||| Sbjct: 486 caccagcgggaatcggatcttcgagttgtggaactgctt 448
>emb|BX062090.1|CNS09K2M Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC43AH04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 921 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 237 caccagcgggaacttgatcttcgagttgtggaactgctt 275 |||||||||||| |||||||||||||||||||||||| Sbjct: 455 caccagcgggaatcggatcttcgagttgtggaactgctt 417
>emb|BX061845.1|CNS09JVT Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC42DD06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 800 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 237 caccagcgggaacttgatcttcgagttgtggaactgctt 275 |||||||||||| |||||||||||||||||||||||| Sbjct: 435 caccagcgggaatcggatcttcgagttgtggaactgctt 473
>emb|BX061844.1|CNS09JVS Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC42DD06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 681 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 237 caccagcgggaacttgatcttcgagttgtggaactgctt 275 |||||||||||| |||||||||||||||||||||||| Sbjct: 475 caccagcgggaatcggatcttcgagttgtggaactgctt 437
>emb|BX061453.1|CNS09JKX Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC42BB07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 862 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 237 caccagcgggaacttgatcttcgagttgtggaactgctt 275 |||||||||||| |||||||||||||||||||||||| Sbjct: 305 caccagcgggaatcggatcttcgagttgtggaactgctt 343
>emb|BX061452.1|CNS09JKW Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC42BB07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 846 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 237 caccagcgggaacttgatcttcgagttgtggaactgctt 275 |||||||||||| |||||||||||||||||||||||| Sbjct: 392 caccagcgggaatcggatcttcgagttgtggaactgctt 354
>emb|BX061383.1|CNS09JIZ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC42AF09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 931 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 237 caccagcgggaacttgatcttcgagttgtggaactgctt 275 |||||||||||| |||||||||||||||||||||||| Sbjct: 473 caccagcgggaatcggatcttcgagttgtggaactgctt 435
>emb|BX061292.1|CNS09JGG Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC42AA11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 916 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 237 caccagcgggaacttgatcttcgagttgtggaactgctt 275 |||||||||||| |||||||||||||||||||||||| Sbjct: 416 caccagcgggaatcggatcttcgagttgtggaactgctt 454
>emb|BX061291.1|CNS09JGF Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC42AA11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 916 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 237 caccagcgggaacttgatcttcgagttgtggaactgctt 275 |||||||||||| |||||||||||||||||||||||| Sbjct: 480 caccagcgggaatcggatcttcgagttgtggaactgctt 442
>emb|BX061184.1|CNS09JDG Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC41DD11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 947 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 237 caccagcgggaacttgatcttcgagttgtggaactgctt 275 |||||||||||| |||||||||||||||||||||||| Sbjct: 480 caccagcgggaatcggatcttcgagttgtggaactgctt 442
>emb|BX060474.1|CNS09ITQ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC40DD11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 892 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 237 caccagcgggaacttgatcttcgagttgtggaactgctt 275 |||||||||||| |||||||||||||||||||||||| Sbjct: 501 caccagcgggaatcggatcttcgagttgtggaactgctt 463
>emb|BX060315.1|CNS09IPB Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC40CE08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 801 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 237 caccagcgggaacttgatcttcgagttgtggaactgctt 275 |||||||||||| |||||||||||||||||||||||| Sbjct: 353 caccagcgggaatcggatcttcgagttgtggaactgctt 391
>emb|BX060314.1|CNS09IPA Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC40CE08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 596 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 237 caccagcgggaacttgatcttcgagttgtggaactgctt 275 |||||||||||| |||||||||||||||||||||||| Sbjct: 489 caccagcgggaatcggatcttcgagttgtggaactgctt 451
>emb|BX060072.1|CNS09IIK Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC40BC02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1043 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 237 caccagcgggaacttgatcttcgagttgtggaactgctt 275 |||||||||||| |||||||||||||||||||||||| Sbjct: 736 caccagcgggaatcggatcttcgagttgtggaactgctt 698
>emb|BX059980.1|CNS09IG0 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC40AF10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 947 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 237 caccagcgggaacttgatcttcgagttgtggaactgctt 275 |||||||||||| |||||||||||||||||||||||| Sbjct: 426 caccagcgggaatcggatcttcgagttgtggaactgctt 464
>emb|BX059979.1|CNS09IFZ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC40AF10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 755 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 237 caccagcgggaacttgatcttcgagttgtggaactgctt 275 |||||||||||| |||||||||||||||||||||||| Sbjct: 494 caccagcgggaatcggatcttcgagttgtggaactgctt 456
>emb|BX059598.1|CNS09I5E Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC4CB01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 901 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 237 caccagcgggaacttgatcttcgagttgtggaactgctt 275 |||||||||||| |||||||||||||||||||||||| Sbjct: 412 caccagcgggaatcggatcttcgagttgtggaactgctt 450
>emb|BX059597.1|CNS09I5D Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC4CB01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 945 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 237 caccagcgggaacttgatcttcgagttgtggaactgctt 275 |||||||||||| |||||||||||||||||||||||| Sbjct: 492 caccagcgggaatcggatcttcgagttgtggaactgctt 454
>emb|BX059276.1|CNS09HWG Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC4AB09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 949 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 237 caccagcgggaacttgatcttcgagttgtggaactgctt 275 |||||||||||| |||||||||||||||||||||||| Sbjct: 474 caccagcgggaatcggatcttcgagttgtggaactgctt 436
>emb|BX059262.1|CNS09HW2 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC4AA12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 949 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 237 caccagcgggaacttgatcttcgagttgtggaactgctt 275 |||||||||||| |||||||||||||||||||||||| Sbjct: 499 caccagcgggaatcggatcttcgagttgtggaactgctt 461
>emb|BX059231.1|CNS09HV7 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC39DH06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 437 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 237 caccagcgggaacttgatcttcgagttgtggaactgctt 275 |||||||||||| |||||||||||||||||||||||| Sbjct: 19 caccagcgggaatcggatcttcgagttgtggaactgctt 57
>emb|BX059230.1|CNS09HV6 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC39DH06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 954 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 237 caccagcgggaacttgatcttcgagttgtggaactgctt 275 |||||||||||| |||||||||||||||||||||||| Sbjct: 480 caccagcgggaatcggatcttcgagttgtggaactgctt 442
>emb|BX058872.1|CNS09HL8 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC39BH10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 938 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 237 caccagcgggaacttgatcttcgagttgtggaactgctt 275 |||||||||||| |||||||||||||||||||||||| Sbjct: 384 caccagcgggaatcggatcttcgagttgtggaactgctt 422
>emb|BX058871.1|CNS09HL7 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC39BH10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 928 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 237 caccagcgggaacttgatcttcgagttgtggaactgctt 275 |||||||||||| |||||||||||||||||||||||| Sbjct: 463 caccagcgggaatcggatcttcgagttgtggaactgctt 425
>emb|BX058808.1|CNS09HJG Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC39BE12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 905 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 237 caccagcgggaacttgatcttcgagttgtggaactgctt 275 |||||||||||| |||||||||||||||||||||||| Sbjct: 396 caccagcgggaatcggatcttcgagttgtggaactgctt 434
>emb|BX058807.1|CNS09HJF Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC39BE12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 932 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 237 caccagcgggaacttgatcttcgagttgtggaactgctt 275 |||||||||||| |||||||||||||||||||||||| Sbjct: 462 caccagcgggaatcggatcttcgagttgtggaactgctt 424
>emb|BX058560.1|CNS09HCK Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC39AB03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 955 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 237 caccagcgggaacttgatcttcgagttgtggaactgctt 275 |||||||||||| |||||||||||||||||||||||| Sbjct: 401 caccagcgggaatcggatcttcgagttgtggaactgctt 439
>emb|BX058559.1|CNS09HCJ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC39AB03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 690 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 237 caccagcgggaacttgatcttcgagttgtggaactgctt 275 |||||||||||| |||||||||||||||||||||||| Sbjct: 478 caccagcgggaatcggatcttcgagttgtggaactgctt 440
>emb|BX058281.1|CNS09H4T Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC38CD07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 976 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 237 caccagcgggaacttgatcttcgagttgtggaactgctt 275 |||||||||||| |||||||||||||||||||||||| Sbjct: 420 caccagcgggaatcggatcttcgagttgtggaactgctt 458
>emb|BX058280.1|CNS09H4S Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC38CD07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 958 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 237 caccagcgggaacttgatcttcgagttgtggaactgctt 275 |||||||||||| |||||||||||||||||||||||| Sbjct: 497 caccagcgggaatcggatcttcgagttgtggaactgctt 459
>emb|BX058269.1|CNS09H4H Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC38CC09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 738 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 237 caccagcgggaacttgatcttcgagttgtggaactgctt 275 |||||||||||| |||||||||||||||||||||||| Sbjct: 426 caccagcgggaatcggatcttcgagttgtggaactgctt 388
>emb|BX056753.1|CNS09FYD Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC36BC04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 559 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 237 caccagcgggaacttgatcttcgagttgtggaactgctt 275 |||||||||||| |||||||||||||||||||||||| Sbjct: 417 caccagcgggaatcggatcttcgagttgtggaactgctt 455
>emb|BX056602.1|CNS09FU6 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC36AB01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 575 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 237 caccagcgggaacttgatcttcgagttgtggaactgctt 275 |||||||||||| |||||||||||||||||||||||| Sbjct: 27 caccagcgggaatcggatcttcgagttgtggaactgctt 65
>emb|BX056601.1|CNS09FU5 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC36AB01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 925 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 237 caccagcgggaacttgatcttcgagttgtggaactgctt 275 |||||||||||| |||||||||||||||||||||||| Sbjct: 457 caccagcgggaatcggatcttcgagttgtggaactgctt 419
>emb|BX057958.1|CNS09GVU Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC38AE09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 942 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 237 caccagcgggaacttgatcttcgagttgtggaactgctt 275 |||||||||||| |||||||||||||||||||||||| Sbjct: 470 caccagcgggaatcggatcttcgagttgtggaactgctt 432
>emb|BX056891.1|CNS09G27 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC36CC03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 779 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 237 caccagcgggaacttgatcttcgagttgtggaactgctt 275 |||||||||||| |||||||||||||||||||||||| Sbjct: 491 caccagcgggaatcggatcttcgagttgtggaactgctt 453
>emb|BX056571.1|CNS09FTB Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC35DH08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 896 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 237 caccagcgggaacttgatcttcgagttgtggaactgctt 275 |||||||||||| |||||||||||||||||||||||| Sbjct: 424 caccagcgggaatcggatcttcgagttgtggaactgctt 386
>emb|BX056553.1|CNS09FST Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC35DG07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 847 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 237 caccagcgggaacttgatcttcgagttgtggaactgctt 275 |||||||||||| |||||||||||||||||||||||| Sbjct: 410 caccagcgggaatcggatcttcgagttgtggaactgctt 448
>emb|BX056552.1|CNS09FSS Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC35DG07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 739 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 237 caccagcgggaacttgatcttcgagttgtggaactgctt 275 |||||||||||| |||||||||||||||||||||||| Sbjct: 460 caccagcgggaatcggatcttcgagttgtggaactgctt 422
>emb|BX056479.1|CNS09FQR Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC35DB10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 833 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 237 caccagcgggaacttgatcttcgagttgtggaactgctt 275 |||||||||||| |||||||||||||||||||||||| Sbjct: 406 caccagcgggaatcggatcttcgagttgtggaactgctt 444
>emb|BX056478.1|CNS09FQQ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC35DB10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 861 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 237 caccagcgggaacttgatcttcgagttgtggaactgctt 275 |||||||||||| |||||||||||||||||||||||| Sbjct: 470 caccagcgggaatcggatcttcgagttgtggaactgctt 432
>emb|BX056309.1|CNS09FM1 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC35CB09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 927 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 237 caccagcgggaacttgatcttcgagttgtggaactgctt 275 |||||||||||| |||||||||||||||||||||||| Sbjct: 469 caccagcgggaatcggatcttcgagttgtggaactgctt 431
>emb|BX056040.1|CNS09FEK Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC34DG03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 651 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 237 caccagcgggaacttgatcttcgagttgtggaactgctt 275 |||||||||||| |||||||||||||||||||||||| Sbjct: 415 caccagcgggaatcggatcttcgagttgtggaactgctt 453
>emb|BX056039.1|CNS09FEJ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC34DG03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 844 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 237 caccagcgggaacttgatcttcgagttgtggaactgctt 275 |||||||||||| |||||||||||||||||||||||| Sbjct: 488 caccagcgggaatcggatcttcgagttgtggaactgctt 450
>emb|BX055724.1|CNS09F5S Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC34BH02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 983 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 237 caccagcgggaacttgatcttcgagttgtggaactgctt 275 |||||||||||| |||||||||||||||||||||||| Sbjct: 435 caccagcgggaatcggatcttcgagttgtggaactgctt 473
>emb|BX055723.1|CNS09F5R Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC34BH02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 934 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 237 caccagcgggaacttgatcttcgagttgtggaactgctt 275 |||||||||||| |||||||||||||||||||||||| Sbjct: 468 caccagcgggaatcggatcttcgagttgtggaactgctt 430
>emb|BX055717.1|CNS09F5L Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC34BG10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 544 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 237 caccagcgggaacttgatcttcgagttgtggaactgctt 275 |||||||||||| |||||||||||||||||||||||| Sbjct: 433 caccagcgggaatcggatcttcgagttgtggaactgctt 471
>emb|BX055643.1|CNS09F3J Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC34BD03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 911 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 237 caccagcgggaacttgatcttcgagttgtggaactgctt 275 |||||||||||| |||||||||||||||||||||||| Sbjct: 436 caccagcgggaatcggatcttcgagttgtggaactgctt 474
>emb|BX055642.1|CNS09F3I Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC34BD03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 942 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 237 caccagcgggaacttgatcttcgagttgtggaactgctt 275 |||||||||||| |||||||||||||||||||||||| Sbjct: 486 caccagcgggaatcggatcttcgagttgtggaactgctt 448
>emb|BX055566.1|CNS09F1E Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC34AH11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 474 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 237 caccagcgggaacttgatcttcgagttgtggaactgctt 275 |||||||||||| |||||||||||||||||||||||| Sbjct: 407 caccagcgggaatcggatcttcgagttgtggaactgctt 445
>emb|BX055565.1|CNS09F1D Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC34AH11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 957 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 237 caccagcgggaacttgatcttcgagttgtggaactgctt 275 |||||||||||| |||||||||||||||||||||||| Sbjct: 508 caccagcgggaatcggatcttcgagttgtggaactgctt 470
>emb|BX055542.1|CNS09F0Q Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC34AG11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 892 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 237 caccagcgggaacttgatcttcgagttgtggaactgctt 275 |||||||||||| |||||||||||||||||||||||| Sbjct: 415 caccagcgggaatcggatcttcgagttgtggaactgctt 453
>emb|BX055541.1|CNS09F0P Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC34AG11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 944 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 237 caccagcgggaacttgatcttcgagttgtggaactgctt 275 |||||||||||| |||||||||||||||||||||||| Sbjct: 494 caccagcgggaatcggatcttcgagttgtggaactgctt 456
>emb|BX055478.1|CNS09EYY Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC34AE01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 942 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 237 caccagcgggaacttgatcttcgagttgtggaactgctt 275 |||||||||||| |||||||||||||||||||||||| Sbjct: 396 caccagcgggaatcggatcttcgagttgtggaactgctt 434
>emb|BX055405.1|CNS09EWX Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC34AA11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 432 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 237 caccagcgggaacttgatcttcgagttgtggaactgctt 275 |||||||||||| |||||||||||||||||||||||| Sbjct: 303 caccagcgggaatcggatcttcgagttgtggaactgctt 341
>emb|BX055404.1|CNS09EWW Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC34AA11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 858 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 237 caccagcgggaacttgatcttcgagttgtggaactgctt 275 |||||||||||| |||||||||||||||||||||||| Sbjct: 498 caccagcgggaatcggatcttcgagttgtggaactgctt 460
>emb|BX055221.1|CNS09ERT Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC33DA11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 947 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 237 caccagcgggaacttgatcttcgagttgtggaactgctt 275 |||||||||||| |||||||||||||||||||||||| Sbjct: 484 caccagcgggaatcggatcttcgagttgtggaactgctt 446
>emb|BX053165.1|CNS09D6P Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC30CG12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 891 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 237 caccagcgggaacttgatcttcgagttgtggaactgctt 275 |||||||||||| |||||||||||||||||||||||| Sbjct: 450 caccagcgggaatcggatcttcgagttgtggaactgctt 412
>emb|BX055118.1|CNS09EOY Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC33CD12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 692 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 237 caccagcgggaacttgatcttcgagttgtggaactgctt 275 |||||||||||| |||||||||||||||||||||||| Sbjct: 437 caccagcgggaatcggatcttcgagttgtggaactgctt 399
>emb|BX054551.1|CNS09E97 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC32DA08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 565 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 237 caccagcgggaacttgatcttcgagttgtggaactgctt 275 |||||||||||| |||||||||||||||||||||||| Sbjct: 399 caccagcgggaatcggatcttcgagttgtggaactgctt 437
>emb|BX054550.1|CNS09E96 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC32DA08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 752 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 237 caccagcgggaacttgatcttcgagttgtggaactgctt 275 |||||||||||| |||||||||||||||||||||||| Sbjct: 476 caccagcgggaatcggatcttcgagttgtggaactgctt 438
>emb|BX054490.1|CNS09E7I Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC32CF11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 726 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 237 caccagcgggaacttgatcttcgagttgtggaactgctt 275 |||||||||||| |||||||||||||||||||||||| Sbjct: 405 caccagcgggaatcggatcttcgagttgtggaactgctt 443
>emb|BX054489.1|CNS09E7H Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC32CF11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 775 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 237 caccagcgggaacttgatcttcgagttgtggaactgctt 275 |||||||||||| |||||||||||||||||||||||| Sbjct: 491 caccagcgggaatcggatcttcgagttgtggaactgctt 453
>emb|BX054096.1|CNS09DWK Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC32AE04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 512 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 237 caccagcgggaacttgatcttcgagttgtggaactgctt 275 |||||||||||| |||||||||||||||||||||||| Sbjct: 435 caccagcgggaatcggatcttcgagttgtggaactgctt 473
>emb|BX054095.1|CNS09DWJ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC32AE04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 737 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 237 caccagcgggaacttgatcttcgagttgtggaactgctt 275 |||||||||||| |||||||||||||||||||||||| Sbjct: 490 caccagcgggaatcggatcttcgagttgtggaactgctt 452
>emb|BX053786.1|CNS09DNY Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC31CF10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 716 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 237 caccagcgggaacttgatcttcgagttgtggaactgctt 275 |||||||||||| |||||||||||||||||||||||| Sbjct: 338 caccagcgggaatcggatcttcgagttgtggaactgctt 300
>emb|BX052786.1|CNS09CW6 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC30AD05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 891 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 237 caccagcgggaacttgatcttcgagttgtggaactgctt 275 |||||||||||| |||||||||||||||||||||||| Sbjct: 424 caccagcgggaatcggatcttcgagttgtggaactgctt 462
>emb|BX052785.1|CNS09CW5 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC30AD05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 909 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 237 caccagcgggaacttgatcttcgagttgtggaactgctt 275 |||||||||||| |||||||||||||||||||||||| Sbjct: 493 caccagcgggaatcggatcttcgagttgtggaactgctt 455
>emb|BX052679.1|CNS09CT7 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC3DF03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 948 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 237 caccagcgggaacttgatcttcgagttgtggaactgctt 275 |||||||||||| |||||||||||||||||||||||| Sbjct: 410 caccagcgggaatcggatcttcgagttgtggaactgctt 448
>emb|BX052678.1|CNS09CT6 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC3DF03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 734 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 237 caccagcgggaacttgatcttcgagttgtggaactgctt 275 |||||||||||| |||||||||||||||||||||||| Sbjct: 328 caccagcgggaatcggatcttcgagttgtggaactgctt 290
>emb|BX052629.1|CNS09CRT Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC3DC03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 824 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 237 caccagcgggaacttgatcttcgagttgtggaactgctt 275 |||||||||||| |||||||||||||||||||||||| Sbjct: 406 caccagcgggaatcggatcttcgagttgtggaactgctt 444
>emb|BX052628.1|CNS09CRS Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC3DC03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 698 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 237 caccagcgggaacttgatcttcgagttgtggaactgctt 275 |||||||||||| |||||||||||||||||||||||| Sbjct: 330 caccagcgggaatcggatcttcgagttgtggaactgctt 292 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 4,679,505 Number of Sequences: 3902068 Number of extensions: 4679505 Number of successful extensions: 92994 Number of sequences better than 10.0: 664 Number of HSP's better than 10.0 without gapping: 664 Number of HSP's successfully gapped in prelim test: 1 Number of HSP's that attempted gapping in prelim test: 90983 Number of HSP's gapped (non-prelim): 1982 length of query: 659 length of database: 17,233,045,268 effective HSP length: 23 effective length of query: 636 effective length of database: 17,143,297,704 effective search space: 10903137339744 effective search space used: 10903137339744 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)
