ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbags18d19
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1ref|NM_194798.1| Oryza sativa (japonica cultivar-group) putative... 167 5e-38
2dbj|AK069822.1| Oryza sativa (japonica cultivar-group) cDNA clon... 167 5e-38
3gb|AC112513.1| Oryza sativa chromosome 10 clone OSJNAa0029P06, c... 62 2e-06
4gb|AC090873.4| Oryza sativa chromosome 10 clone OSJNBa0029P06, c... 62 2e-06
5dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic D... 62 2e-06
6gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome... 62 2e-06
7gb|AC008259.4|AC008259 Drosophila melanogaster, chromosome 2R, r... 44 0.53
8gb|AC008258.4|AC008258 Drosophila melanogaster, chromosome 2R, r... 44 0.53
9gb|AE003840.3| Drosophila melanogaster chromosome 2R, section 10... 44 0.53
10gb|AC005641.1|AC005641 Drosophila melanogaster, chromosome 2R, r... 44 0.53
11emb|CR713940.2|CNS0GDTS Tetraodon nigroviridis full-length cDNA 42 2.1
12gb|AC148217.15| Medicago truncatula clone mth2-20c19, complete s... 42 2.1
13emb|AL390863.9| Human DNA sequence from clone RP11-239J11 on chr... 42 2.1
14dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 42 2.1
15dbj|AP003415.4| Oryza sativa (japonica cultivar-group) genomic D... 42 2.1
16dbj|AP003289.3| Oryza sativa (japonica cultivar-group) genomic D... 42 2.1
17gb|AC024770.1| Caenorhabditis elegans cosmid Y39H10A, complete s... 40 8.3
18gb|BC074491.1| Xenopus laevis hypothetical protein LOC443717, mR... 40 8.3
19gb|AC145724.1| Pan troglodytes BAC clone RP43-22E12 from 7, comp... 40 8.3
20gb|AC119411.16| Medicago truncatula clone mth2-23c14, complete s... 40 8.3
21emb|AL732374.14| Human DNA sequence from clone RP13-444K19 on ch... 40 8.3
22gb|AE016795.2| Vibrio vulnificus CMCP6 chromosome I complete seq... 40 8.3
23emb|AL139814.13| Human DNA sequence from clone RP11-211E5 on chr... 40 8.3
24emb|AL929358.1|PFA929358 Plasmodium falciparum strain 3D7, chrom... 40 8.3
25emb|CR376769.6| Zebrafish DNA sequence from clone CH211-120K3 in... 40 8.3
26gb|AC023751.3| Drosophila melanogaster 3L BAC RP98-31C17 (Roswel... 40 8.3
27dbj|AK095707.1| Homo sapiens cDNA FLJ38388 fis, clone FEBRA2004485 40 8.3
28gb|AC010665.6| Drosophila melanogaster 3L BAC RP98-23H9 (Roswell... 40 8.3
29gb|AC091736.2| Homo sapiens chromosome 7 clone RP11-644N4, compl... 40 8.3
30gb|AC074194.6| Homo sapiens BAC clone RP11-739P1 from 4, complet... 40 8.3
31gb|DQ366280.1| Boletellus shichianus isolate AFTOL-ID 532 RNA po... 40 8.3
32gb|DQ366279.1| Aureoboletus thibetanus isolate AFTOL-ID 450 RNA ... 40 8.3
33gb|AY513737.1| Oreochromis mossambicus Na-K-Cl cotransporter (NK... 40 8.3
34gb|AC092139.5| Homo sapiens chromosome 16 clone RP11-391L3, comp... 40 8.3
35gb|AC009148.11| Homo sapiens chromosome 16 clone RP11-55K13, com... 40 8.3
36emb|AL954697.15| Zebrafish DNA sequence from clone CH211-286K11 ... 40 8.3
37gb|AE003482.4| Drosophila melanogaster chromosome 3L, section 16... 40 8.3
38gb|AC173470.3| Dasypus novemcinctus clone VMRC5-164N1, complete ... 40 8.3

>ref|NM_194798.1| Oryza sativa (japonica cultivar-group) putative alpha-mannosidase
            (OSJNBa0029P06.16), mRNA
          Length = 1317

 Score =  167 bits (84), Expect = 5e-38
 Identities = 189/224 (84%)
 Strand = Plus / Minus

                                                                        
Query: 251  ctccacttgagcttcctcatcgctgacttcttttggttggcggacaggttagtttcagtc 310
            ||||| ||||||||| ||||| |||||||||||||||| || || ||| |||| ||||||
Sbjct: 1199 ctccaattgagcttcttcatctctgacttcttttggtttgcagataggctagtctcagtc 1140

                                                                        
Query: 311  aattccttgatagttctctttccaaacaattttttcagttcaacttttgccatcactgaa 370
            || || |||||  | |||||||||||||  ||| ||| |||||| |||||||| ||||||
Sbjct: 1139 aaatctttgattatcctctttccaaacagctttctcaattcaacctttgccattactgaa 1080

                                                                        
Query: 371  tattgtgggtcttctgcagcctgaaacaaatgtcccaagcggagaagtgtggtcccatca 430
            ||||||| ||| |||  ||||||||| | |||  |||| || || |||||||| ||||||
Sbjct: 1079 tattgtgtgtcctcttgagcctgaaaaagatgcgccaatcgaaggagtgtggtgccatca 1020

                                                        
Query: 431  tcgagattctgcaaggtgatgatcgcgacattatcaggaagact 474
            || ||| |||||||||||||||| || |||||||||||||||||
Sbjct: 1019 tcaagactctgcaaggtgatgattgcaacattatcaggaagact 976



to top

>dbj|AK069822.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023027F12, full
            insert sequence
          Length = 3416

 Score =  167 bits (84), Expect = 5e-38
 Identities = 189/224 (84%)
 Strand = Plus / Minus

                                                                        
Query: 251  ctccacttgagcttcctcatcgctgacttcttttggttggcggacaggttagtttcagtc 310
            ||||| ||||||||| ||||| |||||||||||||||| || || ||| |||| ||||||
Sbjct: 3129 ctccaattgagcttcttcatctctgacttcttttggtttgcagataggctagtctcagtc 3070

                                                                        
Query: 311  aattccttgatagttctctttccaaacaattttttcagttcaacttttgccatcactgaa 370
            || || |||||  | |||||||||||||  ||| ||| |||||| |||||||| ||||||
Sbjct: 3069 aaatctttgattatcctctttccaaacagctttctcaattcaacctttgccattactgaa 3010

                                                                        
Query: 371  tattgtgggtcttctgcagcctgaaacaaatgtcccaagcggagaagtgtggtcccatca 430
            ||||||| ||| |||  ||||||||| | |||  |||| || || |||||||| ||||||
Sbjct: 3009 tattgtgtgtcctcttgagcctgaaaaagatgcgccaatcgaaggagtgtggtgccatca 2950

                                                        
Query: 431  tcgagattctgcaaggtgatgatcgcgacattatcaggaagact 474
            || ||| |||||||||||||||| || |||||||||||||||||
Sbjct: 2949 tcaagactctgcaaggtgatgattgcaacattatcaggaagact 2906



to top

>gb|AC112513.1| Oryza sativa chromosome 10 clone OSJNAa0029P06, complete sequence
          Length = 122319

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 61/71 (85%)
 Strand = Plus / Minus

                                                                         
Query: 251   ctccacttgagcttcctcatcgctgacttcttttggttggcggacaggttagtttcagtc 310
             ||||| ||||||||| ||||| |||||||||||||||| || || ||| |||| ||||||
Sbjct: 33662 ctccaattgagcttcttcatctctgacttcttttggtttgcagataggctagtctcagtc 33603

                        
Query: 311   aattccttgat 321
             || || |||||
Sbjct: 33602 aaatctttgat 33592



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 46/52 (88%)
 Strand = Plus / Minus

                                                                 
Query: 326   ctctttccaaacaattttttcagttcaacttttgccatcactgaatattgtg 377
             |||||||||||||  ||| ||| |||||| |||||||| |||||||||||||
Sbjct: 33453 ctctttccaaacagctttctcaattcaacctttgccattactgaatattgtg 33402



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                                 
Query: 439   ctgcaaggtgatgatcgcgacattatcaggaagact 474
             ||||||||||||||| || |||||||||||||||||
Sbjct: 33179 ctgcaaggtgatgattgcaacattatcaggaagact 33144



to top

>gb|AC090873.4| Oryza sativa chromosome 10 clone OSJNBa0029P06, complete sequence
          Length = 151533

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 61/71 (85%)
 Strand = Plus / Minus

                                                                          
Query: 251    ctccacttgagcttcctcatcgctgacttcttttggttggcggacaggttagtttcagtc 310
              ||||| ||||||||| ||||| |||||||||||||||| || || ||| |||| ||||||
Sbjct: 125195 ctccaattgagcttcttcatctctgacttcttttggtttgcagataggctagtctcagtc 125136

                         
Query: 311    aattccttgat 321
              || || |||||
Sbjct: 125135 aaatctttgat 125125



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 46/52 (88%)
 Strand = Plus / Minus

                                                                  
Query: 326    ctctttccaaacaattttttcagttcaacttttgccatcactgaatattgtg 377
              |||||||||||||  ||| ||| |||||| |||||||| |||||||||||||
Sbjct: 124986 ctctttccaaacagctttctcaattcaacctttgccattactgaatattgtg 124935



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                                  
Query: 439    ctgcaaggtgatgatcgcgacattatcaggaagact 474
              ||||||||||||||| || |||||||||||||||||
Sbjct: 124712 ctgcaaggtgatgattgcaacattatcaggaagact 124677



to top

>dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 10, complete
               sequence
          Length = 22685906

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 61/71 (85%)
 Strand = Plus / Minus

                                                                           
Query: 251     ctccacttgagcttcctcatcgctgacttcttttggttggcggacaggttagtttcagtc 310
               ||||| ||||||||| ||||| |||||||||||||||| || || ||| |||| ||||||
Sbjct: 2468463 ctccaattgagcttcttcatctctgacttcttttggtttgcagataggctagtctcagtc 2468404

                          
Query: 311     aattccttgat 321
               || || |||||
Sbjct: 2468403 aaatctttgat 2468393



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 46/52 (88%)
 Strand = Plus / Minus

                                                                   
Query: 326     ctctttccaaacaattttttcagttcaacttttgccatcactgaatattgtg 377
               |||||||||||||  ||| ||| |||||| |||||||| |||||||||||||
Sbjct: 2468254 ctctttccaaacagctttctcaattcaacctttgccattactgaatattgtg 2468203



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                                   
Query: 439     ctgcaaggtgatgatcgcgacattatcaggaagact 474
               ||||||||||||||| || |||||||||||||||||
Sbjct: 2467980 ctgcaaggtgatgattgcaacattatcaggaagact 2467945



to top

>gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence
          Length = 22698374

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 61/71 (85%)
 Strand = Plus / Minus

                                                                           
Query: 251     ctccacttgagcttcctcatcgctgacttcttttggttggcggacaggttagtttcagtc 310
               ||||| ||||||||| ||||| |||||||||||||||| || || ||| |||| ||||||
Sbjct: 2468414 ctccaattgagcttcttcatctctgacttcttttggtttgcagataggctagtctcagtc 2468355

                          
Query: 311     aattccttgat 321
               || || |||||
Sbjct: 2468354 aaatctttgat 2468344



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 46/52 (88%)
 Strand = Plus / Minus

                                                                   
Query: 326     ctctttccaaacaattttttcagttcaacttttgccatcactgaatattgtg 377
               |||||||||||||  ||| ||| |||||| |||||||| |||||||||||||
Sbjct: 2468205 ctctttccaaacagctttctcaattcaacctttgccattactgaatattgtg 2468154



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                                   
Query: 439     ctgcaaggtgatgatcgcgacattatcaggaagact 474
               ||||||||||||||| || |||||||||||||||||
Sbjct: 2467931 ctgcaaggtgatgattgcaacattatcaggaagact 2467896



to top

>gb|AC008259.4|AC008259 Drosophila melanogaster, chromosome 2R, region 43D-43D, BAC clone
             BACR04H12, complete sequence
          Length = 175285

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 337   caattttttcagttcaactttt 358
             ||||||||||||||||||||||
Sbjct: 34384 caattttttcagttcaactttt 34363



to top

>gb|AC008258.4|AC008258 Drosophila melanogaster, chromosome 2R, region 43C-43C, BAC clone
              BACR04G20, complete sequence
          Length = 184079

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 337    caattttttcagttcaactttt 358
              ||||||||||||||||||||||
Sbjct: 134891 caattttttcagttcaactttt 134870



to top

>gb|AE003840.3| Drosophila melanogaster chromosome 2R, section 10 of 73 of the complete
             sequence
          Length = 272100

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 337   caattttttcagttcaactttt 358
             ||||||||||||||||||||||
Sbjct: 24788 caattttttcagttcaactttt 24767



to top

>gb|AC005641.1|AC005641 Drosophila melanogaster, chromosome 2R, region 43D1-43D7, P1 clone
             DS03454, complete sequence
          Length = 50089

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 337   caattttttcagttcaactttt 358
             ||||||||||||||||||||||
Sbjct: 21984 caattttttcagttcaactttt 21963



to top

>emb|CR713940.2|CNS0GDTS Tetraodon nigroviridis full-length cDNA
          Length = 778

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 212 gtaactggggcgtgactactttcag 236
           |||||||||| ||||||||||||||
Sbjct: 1   gtaactggggagtgactactttcag 25



to top

>gb|AC148217.15| Medicago truncatula clone mth2-20c19, complete sequence
          Length = 113210

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 333   caaacaattttttcagttcaacttt 357
             ||||||| |||||||||||||||||
Sbjct: 65025 caaacaactttttcagttcaacttt 65001



to top

>emb|AL390863.9| Human DNA sequence from clone RP11-239J11 on chromosome 1 Contains the
             5' end of the HRPT2 gene for hyperparathyroidism 2 (with
             jaw tumor), the B3GAL2 gene for UDP-Gal:betaGlcNAc beta
             1,3-galactosyltransferase polypeptide 2 and a CpG island,
             complete sequence
          Length = 122864

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 91    aacatgcatggaattacataa 111
             |||||||||||||||||||||
Sbjct: 19611 aacatgcatggaattacataa 19591



to top

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                     
Query: 380      tcttctgcagcctgaaacaaa 400
                |||||||||||||||||||||
Sbjct: 37017826 tcttctgcagcctgaaacaaa 37017846



to top

>dbj|AP003415.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC
              clone:OJ1402_H07
          Length = 140620

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 380    tcttctgcagcctgaaacaaa 400
              |||||||||||||||||||||
Sbjct: 108130 tcttctgcagcctgaaacaaa 108150



to top

>dbj|AP003289.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0683F02
          Length = 153388

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 380   tcttctgcagcctgaaacaaa 400
             |||||||||||||||||||||
Sbjct: 18967 tcttctgcagcctgaaacaaa 18987



to top

>gb|AC024770.1| Caenorhabditis elegans cosmid Y39H10A, complete sequence
          Length = 36751

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 339   attttttcagttcaactttt 358
             ||||||||||||||||||||
Sbjct: 16740 attttttcagttcaactttt 16721



to top

>gb|BC074491.1| Xenopus laevis hypothetical protein LOC443717, mRNA (cDNA clone
            IMAGE:6953116), partial cds
          Length = 2561

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 330  ttccaaacaattttttcagttcaa 353
            ||||||||| ||||||||||||||
Sbjct: 1067 ttccaaacacttttttcagttcaa 1090



to top

>gb|AC145724.1| Pan troglodytes BAC clone RP43-22E12 from 7, complete sequence
          Length = 152426

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 323   gttctctttccaaacaattt 342
             ||||||||||||||||||||
Sbjct: 82152 gttctctttccaaacaattt 82171



to top

>gb|AC119411.16| Medicago truncatula clone mth2-23c14, complete sequence
          Length = 106790

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 340   ttttttcagttcaacttttg 359
             ||||||||||||||||||||
Sbjct: 79395 ttttttcagttcaacttttg 79376



to top

>emb|AL732374.14| Human DNA sequence from clone RP13-444K19 on chromosome X Contains a
             mitochondrial ribosomal protein S18C (MRPS18C) pseudogene,
             the 3' end of the gene for a novel protein similar to PHD
             finger protein 2 PHF2 and a CpG island, complete sequence
          Length = 224187

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 3     tgactgagacacatttattt 22
             ||||||||||||||||||||
Sbjct: 58660 tgactgagacacatttattt 58679



to top

>gb|AE016795.2| Vibrio vulnificus CMCP6 chromosome I complete sequence
          Length = 3281944

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                           
Query: 141     tcaccaagaatgttcttatctccatggg 168
               ||||||| ||||||| ||||||||||||
Sbjct: 2719031 tcaccaacaatgttcgtatctccatggg 2719058



to top

>emb|AL139814.13| Human DNA sequence from clone RP11-211E5 on chromosome 10p12.1-12.33
             Contains part of the CACNB2 gene for calcium channel
             voltage-dependent beta 2 subunit, complete sequence
          Length = 119884

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 550   aagaagaaagggtgaataaa 569
             ||||||||||||||||||||
Sbjct: 89403 aagaagaaagggtgaataaa 89422



to top

>emb|AL929358.1|PFA929358 Plasmodium falciparum strain 3D7, chromosome 9; segment 4/5
          Length = 254050

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 565    ataaactttttgtccttgtg 584
              ||||||||||||||||||||
Sbjct: 140521 ataaactttttgtccttgtg 140540



to top

>emb|CR376769.6| Zebrafish DNA sequence from clone CH211-120K3 in linkage group 24,
             complete sequence
          Length = 56040

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 340   ttttttcagttcaacttttg 359
             ||||||||||||||||||||
Sbjct: 49339 ttttttcagttcaacttttg 49358



to top

>gb|AC023751.3| Drosophila melanogaster 3L BAC RP98-31C17 (Roswell Park Cancer
             Institute Drosophila BAC Library) complete sequence
          Length = 187437

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 343   tttcagttcaacttttgcca 362
             ||||||||||||||||||||
Sbjct: 27803 tttcagttcaacttttgcca 27822



to top

>dbj|AK095707.1| Homo sapiens cDNA FLJ38388 fis, clone FEBRA2004485
          Length = 2984

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 313  ttccttgatagttctctttc 332
            ||||||||||||||||||||
Sbjct: 1875 ttccttgatagttctctttc 1856



to top

>gb|AC010665.6| Drosophila melanogaster 3L BAC RP98-23H9 (Roswell Park Cancer Institute
              Drosophila BAC Library) complete sequence
          Length = 156526

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 343    tttcagttcaacttttgcca 362
              ||||||||||||||||||||
Sbjct: 153959 tttcagttcaacttttgcca 153978



to top

>gb|AC091736.2| Homo sapiens chromosome 7 clone RP11-644N4, complete sequence
          Length = 156539

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 323   gttctctttccaaacaattt 342
             ||||||||||||||||||||
Sbjct: 99423 gttctctttccaaacaattt 99404



to top

>gb|AC074194.6| Homo sapiens BAC clone RP11-739P1 from 4, complete sequence
          Length = 177273

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 57    ctcacaggaaatgaaaggcacaat 80
             ||||||||||| ||||||||||||
Sbjct: 65912 ctcacaggaaaggaaaggcacaat 65889



to top

>gb|DQ366280.1| Boletellus shichianus isolate AFTOL-ID 532 RNA polymerase II second
           largest subunit (RPB2) gene, partial cds
          Length = 1066

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 204 ggctaccggtaactggggcg 223
           ||||||||||||||||||||
Sbjct: 197 ggctaccggtaactggggcg 216



to top

>gb|DQ366279.1| Aureoboletus thibetanus isolate AFTOL-ID 450 RNA polymerase II
           second largest subunit (RPB2) gene, partial cds
          Length = 2174

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 204 ggctaccggtaactggggcg 223
           ||||||||||||||||||||
Sbjct: 215 ggctaccggtaactggggcg 234



to top

>gb|AY513737.1| Oreochromis mossambicus Na-K-Cl cotransporter (NKCC1alpha) mRNA,
            complete cds
          Length = 3954

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 134  cacagtttcaccaagaatgt 153
            ||||||||||||||||||||
Sbjct: 2390 cacagtttcaccaagaatgt 2409



to top

>gb|AC092139.5| Homo sapiens chromosome 16 clone RP11-391L3, complete sequence
          Length = 191731

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 313    ttccttgatagttctctttc 332
              ||||||||||||||||||||
Sbjct: 153295 ttccttgatagttctctttc 153314



to top

>gb|AC009148.11| Homo sapiens chromosome 16 clone RP11-55K13, complete sequence
          Length = 157518

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 313   ttccttgatagttctctttc 332
             ||||||||||||||||||||
Sbjct: 52414 ttccttgatagttctctttc 52433



to top

>emb|AL954697.15| Zebrafish DNA sequence from clone CH211-286K11 in linkage group 25,
              complete sequence
          Length = 134798

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 330    ttccaaacaattttttcagt 349
              ||||||||||||||||||||
Sbjct: 132122 ttccaaacaattttttcagt 132141



to top

>gb|AE003482.4| Drosophila melanogaster chromosome 3L, section 16 of 83 of the complete
              sequence
          Length = 302417

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 343    tttcagttcaacttttgcca 362
              ||||||||||||||||||||
Sbjct: 100813 tttcagttcaacttttgcca 100832



to top

>gb|AC173470.3| Dasypus novemcinctus clone VMRC5-164N1, complete sequence
          Length = 75140

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 63    ggaaatgaaaggcacaataa 82
             ||||||||||||||||||||
Sbjct: 34344 ggaaatgaaaggcacaataa 34325


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 6,629,174
Number of Sequences: 3902068
Number of extensions: 6629174
Number of successful extensions: 128678
Number of sequences better than 10.0: 38
Number of HSP's better than 10.0 without gapping: 38
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 128447
Number of HSP's gapped (non-prelim): 231
length of query: 609
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 586
effective length of database: 17,143,297,704
effective search space: 10045972454544
effective search space used: 10045972454544
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top