| Clone Name | rbags17o12 |
|---|---|
| Clone Library Name | barley_pub |
| No. | Definition | Score (bits) |
E Value |
1 | gb|AC087565.5| Homo sapiens chromosome 16 clone RP11-53L24, comp... | 38 | 3.3 | 2 | gb|AC110300.3| Homo sapiens BAC clone RP11-541A12 from 2, comple... | 38 | 3.3 | 3 | gb|AC007006.3| Homo sapiens BAC clone RP11-548P6 from 2, complet... | 38 | 3.3 | 4 | gb|AE016877.1| Bacillus cereus ATCC 14579, complete genome | 38 | 3.3 |
|---|
>gb|AC087565.5| Homo sapiens chromosome 16 clone RP11-53L24, complete sequence Length = 192937 Score = 38.2 bits (19), Expect = 3.3 Identities = 19/19 (100%) Strand = Plus / Minus Query: 55 ttgccactttaaatggcat 73 ||||||||||||||||||| Sbjct: 26393 ttgccactttaaatggcat 26375
>gb|AC110300.3| Homo sapiens BAC clone RP11-541A12 from 2, complete sequence Length = 93795 Score = 38.2 bits (19), Expect = 3.3 Identities = 21/22 (95%) Strand = Plus / Plus Query: 35 ttaaaaattaangtatatgctt 56 ||||||||||| |||||||||| Sbjct: 8264 ttaaaaattaaagtatatgctt 8285
>gb|AC007006.3| Homo sapiens BAC clone RP11-548P6 from 2, complete sequence Length = 112027 Score = 38.2 bits (19), Expect = 3.3 Identities = 19/19 (100%) Strand = Plus / Minus Query: 47 gtatatgcttgccacttta 65 ||||||||||||||||||| Sbjct: 10241 gtatatgcttgccacttta 10223
>gb|AE016877.1| Bacillus cereus ATCC 14579, complete genome Length = 5411809 Score = 38.2 bits (19), Expect = 3.3 Identities = 22/23 (95%) Strand = Plus / Plus Query: 48 tatatgcttgccactttaaatgg 70 |||||||||||| |||||||||| Sbjct: 2622155 tatatgcttgcccctttaaatgg 2622177 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 547,358 Number of Sequences: 3902068 Number of extensions: 547358 Number of successful extensions: 33646 Number of sequences better than 10.0: 4 Number of HSP's better than 10.0 without gapping: 4 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 33630 Number of HSP's gapped (non-prelim): 16 length of query: 80 length of database: 17,233,045,268 effective HSP length: 21 effective length of query: 59 effective length of database: 17,151,101,840 effective search space: 1011915008560 effective search space used: 1011915008560 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 19 (38.2 bits)