| Clone Name | rbags17m17 |
|---|---|
| Clone Library Name | barley_pub |
>gb|AC159548.5| Mus musculus 6 BAC RP23-77B7 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 207770 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 237 ctctaaatccagagccatatg 257 ||||||||||||||||||||| Sbjct: 105140 ctctaaatccagagccatatg 105120
>gb|AC153992.7| Mus musculus 6 BAC RP24-116E17 (Roswell Park Cancer Institute (C57BL/6J Male) Mouse BAC Library) complete sequence Length = 195972 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 237 ctctaaatccagagccatatg 257 ||||||||||||||||||||| Sbjct: 174606 ctctaaatccagagccatatg 174586
>gb|AC118021.13| Mus musculus chromosome 7, clone RP23-459P15, complete sequence Length = 196441 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aagaacgttaatatctaacc 178 |||||||||||||||||||| Sbjct: 149577 aagaacgttaatatctaacc 149596
>gb|CP000117.1| Anabaena variabilis ATCC 29413 chromosome, complete sequence Length = 6365727 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 483 ctggtggtgctaaaccagga 502 |||||||||||||||||||| Sbjct: 3518751 ctggtggtgctaaaccagga 3518732
>gb|AC116179.6| Mus musculus BAC clone RP23-272C6 from 10, complete sequence Length = 195123 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 264 tgccaggtggtcgagtctgg 283 |||||||||||||||||||| Sbjct: 91496 tgccaggtggtcgagtctgg 91515
>emb|CR407586.6| Zebrafish DNA sequence from clone CH211-283G6 in linkage group 18, complete sequence Length = 134596 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 97 cagcagagcactttactaga 116 |||||||||||||||||||| Sbjct: 73230 cagcagagcactttactaga 73249
>gb|AC019170.7| Homo sapiens BAC clone RP11-162G9 from 4, complete sequence Length = 185281 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 4 tgctgacataataatactac 23 |||||||||||||||||||| Sbjct: 4545 tgctgacataataatactac 4564
>gb|AF291866.1|AF291866 Meleagrid herpesvirus 1 strain FC126, complete genome Length = 159160 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 467 tgcactcgcggttgcactgg 486 |||||||||||||||||||| Sbjct: 53615 tgcactcgcggttgcactgg 53634
>gb|AC153792.4| Mus musculus BAC clone RP23-435D23 from 7, complete sequence Length = 224041 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 592 agcagcaggtgctaggccag 611 |||||||||||||||||||| Sbjct: 74252 agcagcaggtgctaggccag 74271
>emb|BX908722.4| Zebrafish DNA sequence from clone CH211-165A16 in linkage group 18, complete sequence Length = 166917 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 97 cagcagagcactttactaga 116 |||||||||||||||||||| Sbjct: 31282 cagcagagcactttactaga 31301
>gb|M62659.1|EIAENVAE Equine infectious anemia virus envelope and rev genes, partial cds Length = 444 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 11 ataataatactactacatta 30 |||||||||||||||||||| Sbjct: 415 ataataatactactacatta 434 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 4,405,927 Number of Sequences: 3902068 Number of extensions: 4405927 Number of successful extensions: 75267 Number of sequences better than 10.0: 11 Number of HSP's better than 10.0 without gapping: 11 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 75231 Number of HSP's gapped (non-prelim): 36 length of query: 639 length of database: 17,233,045,268 effective HSP length: 23 effective length of query: 616 effective length of database: 17,143,297,704 effective search space: 10560271385664 effective search space used: 10560271385664 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)