ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbags17m17
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AC159548.5| Mus musculus 6 BAC RP23-77B7 (Roswell Park Cancer... 42 2.2
2gb|AC153992.7| Mus musculus 6 BAC RP24-116E17 (Roswell Park Canc... 42 2.2
3gb|AC118021.13| Mus musculus chromosome 7, clone RP23-459P15, co... 40 8.7
4gb|CP000117.1| Anabaena variabilis ATCC 29413 chromosome, comple... 40 8.7
5gb|AC116179.6| Mus musculus BAC clone RP23-272C6 from 10, comple... 40 8.7
6emb|CR407586.6| Zebrafish DNA sequence from clone CH211-283G6 in... 40 8.7
7gb|AC019170.7| Homo sapiens BAC clone RP11-162G9 from 4, complet... 40 8.7
8gb|AF291866.1|AF291866 Meleagrid herpesvirus 1 strain FC126, com... 40 8.7
9gb|AC153792.4| Mus musculus BAC clone RP23-435D23 from 7, comple... 40 8.7
10emb|BX908722.4| Zebrafish DNA sequence from clone CH211-165A16 i... 40 8.7
11gb|M62659.1|EIAENVAE Equine infectious anemia virus envelope and... 40 8.7

>gb|AC159548.5| Mus musculus 6 BAC RP23-77B7 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 207770

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 237    ctctaaatccagagccatatg 257
              |||||||||||||||||||||
Sbjct: 105140 ctctaaatccagagccatatg 105120



to top

>gb|AC153992.7| Mus musculus 6 BAC RP24-116E17 (Roswell Park Cancer Institute (C57BL/6J
              Male) Mouse BAC Library) complete sequence
          Length = 195972

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 237    ctctaaatccagagccatatg 257
              |||||||||||||||||||||
Sbjct: 174606 ctctaaatccagagccatatg 174586



to top

>gb|AC118021.13| Mus musculus chromosome 7, clone RP23-459P15, complete sequence
          Length = 196441

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 159    aagaacgttaatatctaacc 178
              ||||||||||||||||||||
Sbjct: 149577 aagaacgttaatatctaacc 149596



to top

>gb|CP000117.1| Anabaena variabilis ATCC 29413 chromosome, complete sequence
          Length = 6365727

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 483     ctggtggtgctaaaccagga 502
               ||||||||||||||||||||
Sbjct: 3518751 ctggtggtgctaaaccagga 3518732



to top

>gb|AC116179.6| Mus musculus BAC clone RP23-272C6 from 10, complete sequence
          Length = 195123

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 264   tgccaggtggtcgagtctgg 283
             ||||||||||||||||||||
Sbjct: 91496 tgccaggtggtcgagtctgg 91515



to top

>emb|CR407586.6| Zebrafish DNA sequence from clone CH211-283G6 in linkage group 18,
             complete sequence
          Length = 134596

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 97    cagcagagcactttactaga 116
             ||||||||||||||||||||
Sbjct: 73230 cagcagagcactttactaga 73249



to top

>gb|AC019170.7| Homo sapiens BAC clone RP11-162G9 from 4, complete sequence
          Length = 185281

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 4    tgctgacataataatactac 23
            ||||||||||||||||||||
Sbjct: 4545 tgctgacataataatactac 4564



to top

>gb|AF291866.1|AF291866 Meleagrid herpesvirus 1 strain FC126, complete genome
          Length = 159160

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 467   tgcactcgcggttgcactgg 486
             ||||||||||||||||||||
Sbjct: 53615 tgcactcgcggttgcactgg 53634



to top

>gb|AC153792.4| Mus musculus BAC clone RP23-435D23 from 7, complete sequence
          Length = 224041

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 592   agcagcaggtgctaggccag 611
             ||||||||||||||||||||
Sbjct: 74252 agcagcaggtgctaggccag 74271



to top

>emb|BX908722.4| Zebrafish DNA sequence from clone CH211-165A16 in linkage group 18,
             complete sequence
          Length = 166917

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 97    cagcagagcactttactaga 116
             ||||||||||||||||||||
Sbjct: 31282 cagcagagcactttactaga 31301



to top

>gb|M62659.1|EIAENVAE Equine infectious anemia virus envelope and rev genes, partial cds
          Length = 444

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 11  ataataatactactacatta 30
           ||||||||||||||||||||
Sbjct: 415 ataataatactactacatta 434


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,405,927
Number of Sequences: 3902068
Number of extensions: 4405927
Number of successful extensions: 75267
Number of sequences better than 10.0: 11
Number of HSP's better than 10.0 without gapping: 11
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 75231
Number of HSP's gapped (non-prelim): 36
length of query: 639
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 616
effective length of database: 17,143,297,704
effective search space: 10560271385664
effective search space used: 10560271385664
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top