| Clone Name | rbags18a16 |
|---|---|
| Clone Library Name | barley_pub |
| No. | Definition | Score (bits) |
E Value |
1 | emb|AL731692.8| Mouse DNA sequence from clone RP23-245M18 on chr... | 44 | 0.078 | 2 | gb|AC092484.1|AC092484 Homo sapiens clone RP11-114K22, complete ... | 38 | 4.8 | 3 | gb|L42023.1| Haemophilus influenzae Rd KW20, complete genome | 38 | 4.8 |
|---|
>emb|AL731692.8| Mouse DNA sequence from clone RP23-245M18 on chromosome X, complete sequence Length = 169309 Score = 44.1 bits (22), Expect = 0.078 Identities = 22/22 (100%) Strand = Plus / Minus Query: 86 ctggtatatgtgtttttgcaag 107 |||||||||||||||||||||| Sbjct: 39611 ctggtatatgtgtttttgcaag 39590
>gb|AC092484.1|AC092484 Homo sapiens clone RP11-114K22, complete sequence Length = 73900 Score = 38.2 bits (19), Expect = 4.8 Identities = 21/22 (95%) Strand = Plus / Plus Query: 38 tgtnctcctgaactgggcttaa 59 ||| |||||||||||||||||| Sbjct: 26975 tgttctcctgaactgggcttaa 26996
>gb|L42023.1| Haemophilus influenzae Rd KW20, complete genome Length = 1830138 Score = 38.2 bits (19), Expect = 4.8 Identities = 19/19 (100%) Strand = Plus / Plus Query: 58 aatggcagcagaacgttta 76 ||||||||||||||||||| Sbjct: 1583352 aatggcagcagaacgttta 1583370 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 504,699 Number of Sequences: 3902068 Number of extensions: 504699 Number of successful extensions: 31647 Number of sequences better than 10.0: 3 Number of HSP's better than 10.0 without gapping: 3 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 31633 Number of HSP's gapped (non-prelim): 14 length of query: 107 length of database: 17,233,045,268 effective HSP length: 21 effective length of query: 86 effective length of database: 17,151,101,840 effective search space: 1474994758240 effective search space used: 1474994758240 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 19 (38.2 bits)