ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbags17i22
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1dbj|AK111856.1| Oryza sativa (japonica cultivar-group) cDNA clon... 216 6e-53
2gb|AC132491.2| Oryza sativa (japonica cultivar-group) chromosome... 121 3e-24
3gb|AC130611.2| Oryza sativa (japonica cultivar-group) chromosome... 121 3e-24
4dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic D... 121 3e-24
5gb|BC030093.1| Homo sapiens cDNA clone IMAGE:4794937 44 0.54
6ref|NM_001025100.1| Homo sapiens myelin basic protein (MBP), tra... 44 0.54
7dbj|AK093588.1| Homo sapiens cDNA FLJ36269 fis, clone THYMU2003012 44 0.54
8gb|AC093330.25| Homo sapiens chromosome 18, clone RP11-862L9, co... 44 0.54
9dbj|AK098513.1| Homo sapiens cDNA FLJ25647 fis, clone SYN00310 44 0.54
10dbj|AK074315.1| Homo sapiens cDNA FLJ23735 fis, clone HEP14813 44 0.54
11ref|XM_518777.1| PREDICTED: Pan troglodytes similar to fucosidas... 42 2.1
12gb|BC051268.1| Homo sapiens fucosidase, alpha-L- 2, plasma, mRNA... 42 2.1
13gb|AY358551.1| Homo sapiens clone DNA33470 RPQE227 (UNQ227) mRNA... 42 2.1
14emb|AL031320.6|HS20N2 Human DNA sequence from clone RP1-20N2 on ... 42 2.1
15gb|AE008769.1| Salmonella typhimurium LT2, section 73 of 220 of ... 42 2.1
16emb|AL627270.1| Salmonella enterica serovar Typhi (Salmonella ty... 42 2.1
17emb|CR857171.1| Pongo pygmaeus mRNA; cDNA DKFZp469D0832 (from cl... 42 2.1
18emb|CR619981.1| full-length cDNA clone CS0DI022YG11 of Placenta ... 42 2.1
19emb|CR616303.1| full-length cDNA clone CS0DI010YP12 of Placenta ... 42 2.1
20emb|CR605098.1| full-length cDNA clone CS0DC013YA21 of Neuroblas... 42 2.1
21emb|CR604858.1| full-length cDNA clone CS0DI061YK01 of Placenta ... 42 2.1
22emb|CR604354.1| full-length cDNA clone CL0BA010ZF05 of Placenta ... 42 2.1
23emb|CR604319.1| full-length cDNA clone CS0DE013YB14 of Placenta ... 42 2.1
24dbj|AK075458.1| Homo sapiens cDNA PSEC0151 fis, clone PLACE10078... 42 2.1
25emb|CR597899.1| full-length cDNA clone CS0DI057YI15 of Placenta ... 42 2.1
26emb|CR597696.1| full-length cDNA clone CS0DC006YN18 of Neuroblas... 42 2.1
27emb|CR597166.1| full-length cDNA clone CS0DI060YL01 of Placenta ... 42 2.1
28emb|CR596039.1| full-length cDNA clone CS0DM002YF07 of Fetal liv... 42 2.1
29emb|CR594942.1| full-length cDNA clone CS0DE014YC08 of Placenta ... 42 2.1
30emb|CR594725.1| full-length cDNA clone CS0DI070YJ24 of Placenta ... 42 2.1
31emb|CR592398.1| full-length cDNA clone CS0DI086YF08 of Placenta ... 42 2.1
32emb|CR591818.1| full-length cDNA clone CS0DI002YE06 of Placenta ... 42 2.1
33ref|NM_032020.3| Homo sapiens fucosidase, alpha-L- 2, plasma (FU... 42 2.1
34gb|CP000026.1| Salmonella enterica subsp. enterica serovar Parat... 42 2.1
35gb|AE014613.1| Salmonella enterica subsp. enterica serovar Typhi... 42 2.1
36gb|AE017220.1| Salmonella enterica subsp. enterica serovar Chole... 42 2.1
37gb|BC003060.2| Homo sapiens fucosidase, alpha-L- 2, plasma, mRNA... 42 2.1
38gb|AC109272.20| Mus musculus chromosome 7, clone RP23-354L18, co... 40 8.4
39gb|BC070852.1| Xenopus laevis hypothetical protein MGC84592, mRN... 40 8.4
40gb|DP000008.1| Bos taurus target 1 genomic scaffold 40 8.4
41gb|BC060438.1| Xenopus laevis cDNA clone IMAGE:4174467, partial cds 40 8.4
42emb|CR717099.2|CNS0GG9G Tetraodon nigroviridis full-length cDNA 40 8.4
43gb|AC107715.5| Mus musculus chromosome 10, clone RP24-376I19, co... 40 8.4
44emb|Z95151.1|MLCB5 Mycobacterium leprae cosmid B5 40 8.4
45gb|AC162287.4| Mus musculus chromosome 7, clone RP24-243J4, comp... 40 8.4
46emb|CR555306.1| Azoarcus sp. EbN1 complete genome 40 8.4
47emb|AL583924.1|MLEPRTN8 Mycobacterium leprae strain TN complete ... 40 8.4
48gb|AC156367.3| Bos taurus clone RP42-394P24, complete sequence 40 8.4 
>dbj|AK111856.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033022A22, full
            insert sequence
          Length = 3046

 Score =  216 bits (109), Expect = 6e-53
 Identities = 244/289 (84%)
 Strand = Plus / Minus

                                                                        
Query: 326  gtcccagcagagctcagatatttgagcatgtactcgttggaggaacaagtgtccgccaga 385
            ||||||| ||||| |||||| || | ||||||||| || || ||||||||||| |||| |
Sbjct: 2657 gtcccagaagagcacagatacttcaacatgtactcattagaagaacaagtgtcggccaaa 2598

                                                                        
Query: 386  tcctggtgtagttttgttatagacttctgcaacgacttgagagcaggaagcaaagtcctc 445
            ||||| || | | |||||||||||||||| |||||||| |||||||||||||| |  || 
Sbjct: 2597 tcctgatgaattcttgttatagacttctgaaacgacttcagagcaggaagcaaggctctg 2538

                                                                        
Query: 446  gaattttgctggatgtagcttccatcaaccttgcatagctcctgagaccacagaaggatg 505
            || ||||| || || ||| |||| | || ||||||||||||||||||||| || || || 
Sbjct: 2537 gagttttgttgaatatagtttccgtgaatcttgcatagctcctgagaccagaggagaata 2478

                                                                        
Query: 506  aattccagatggggacagctttccaggaggtcagcgaatgcatcgatcaatctctgaaga 565
            ||||| ||||||||||| |||||||  |||||||  ||||| ||||| ||||||||||||
Sbjct: 2477 aattcaagatggggacaactttccaaaaggtcagaaaatgcttcgattaatctctgaaga 2418

                                                             
Query: 566  tacttaaagggtactgatgagcagattgctcgtacattggatggatcca 614
            ||||| ||||||  |||||| || |||||||||||||||||||||||||
Sbjct: 2417 tacttcaagggtgttgatgaacaaattgctcgtacattggatggatcca 2369
to top
>gb|AC132491.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone P0599F04,
              complete sequence
          Length = 169073

 Score =  121 bits (61), Expect = 3e-24
 Identities = 112/129 (86%)
 Strand = Plus / Plus

                                                                          
Query: 486    cctgagaccacagaaggatgaattccagatggggacagctttccaggaggtcagcgaatg 545
              |||||||||| || || || ||||| ||||||||||| |||||||  |||||||  ||||
Sbjct: 105675 cctgagaccagaggagaataaattcaagatggggacaactttccaaaaggtcagaaaatg 105734

                                                                          
Query: 546    catcgatcaatctctgaagatacttaaagggtactgatgagcagattgctcgtacattgg 605
              | ||||| ||||||||||||||||| ||||||  |||||| || ||||||||||||||||
Sbjct: 105735 cttcgattaatctctgaagatacttcaagggtgttgatgaacaaattgctcgtacattgg 105794

                       
Query: 606    atggatcca 614
              |||||||||
Sbjct: 105795 atggatcca 105803



 Score =  103 bits (52), Expect = 7e-19
 Identities = 136/164 (82%)
 Strand = Plus / Plus

                                                                          
Query: 326    gtcccagcagagctcagatatttgagcatgtactcgttggaggaacaagtgtccgccaga 385
              ||||||| ||||| |||||| || | ||||||||| || || ||||||||||| |||| |
Sbjct: 105428 gtcccagaagagcacagatacttcaacatgtactcattagaagaacaagtgtcggccaaa 105487

                                                                          
Query: 386    tcctggtgtagttttgttatagacttctgcaacgacttgagagcaggaagcaaagtcctc 445
              ||||| || | | |||||||||||||||| |||||||| |||||||||||||| |  || 
Sbjct: 105488 tcctgatgaattcttgttatagacttctgaaacgacttcagagcaggaagcaaggctctg 105547

                                                          
Query: 446    gaattttgctggatgtagcttccatcaaccttgcatagctcctg 489
              || ||||| || || ||| |||| | || |||||||||||||||
Sbjct: 105548 gagttttgttgaatatagtttccgtgaatcttgcatagctcctg 105591
to top
>gb|AC130611.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone P0483D07,
            complete sequence
          Length = 147122

 Score =  121 bits (61), Expect = 3e-24
 Identities = 112/129 (86%)
 Strand = Plus / Plus

                                                                        
Query: 486  cctgagaccacagaaggatgaattccagatggggacagctttccaggaggtcagcgaatg 545
            |||||||||| || || || ||||| ||||||||||| |||||||  |||||||  ||||
Sbjct: 1637 cctgagaccagaggagaataaattcaagatggggacaactttccaaaaggtcagaaaatg 1696

                                                                        
Query: 546  catcgatcaatctctgaagatacttaaagggtactgatgagcagattgctcgtacattgg 605
            | ||||| ||||||||||||||||| ||||||  |||||| || ||||||||||||||||
Sbjct: 1697 cttcgattaatctctgaagatacttcaagggtgttgatgaacaaattgctcgtacattgg 1756

                     
Query: 606  atggatcca 614
            |||||||||
Sbjct: 1757 atggatcca 1765



 Score =  103 bits (52), Expect = 7e-19
 Identities = 136/164 (82%)
 Strand = Plus / Plus

                                                                        
Query: 326  gtcccagcagagctcagatatttgagcatgtactcgttggaggaacaagtgtccgccaga 385
            ||||||| ||||| |||||| || | ||||||||| || || ||||||||||| |||| |
Sbjct: 1390 gtcccagaagagcacagatacttcaacatgtactcattagaagaacaagtgtcggccaaa 1449

                                                                        
Query: 386  tcctggtgtagttttgttatagacttctgcaacgacttgagagcaggaagcaaagtcctc 445
            ||||| || | | |||||||||||||||| |||||||| |||||||||||||| |  || 
Sbjct: 1450 tcctgatgaattcttgttatagacttctgaaacgacttcagagcaggaagcaaggctctg 1509

                                                        
Query: 446  gaattttgctggatgtagcttccatcaaccttgcatagctcctg 489
            || ||||| || || ||| |||| | || |||||||||||||||
Sbjct: 1510 gagttttgttgaatatagtttccgtgaatcttgcatagctcctg 1553
to top
>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete
                sequence
          Length = 29737217

 Score =  121 bits (61), Expect = 3e-24
 Identities = 112/129 (86%)
 Strand = Plus / Plus

                                                                            
Query: 486      cctgagaccacagaaggatgaattccagatggggacagctttccaggaggtcagcgaatg 545
                |||||||||| || || || ||||| ||||||||||| |||||||  |||||||  ||||
Sbjct: 25589268 cctgagaccagaggagaataaattcaagatggggacaactttccaaaaggtcagaaaatg 25589327

                                                                            
Query: 546      catcgatcaatctctgaagatacttaaagggtactgatgagcagattgctcgtacattgg 605
                | ||||| ||||||||||||||||| ||||||  |||||| || ||||||||||||||||
Sbjct: 25589328 cttcgattaatctctgaagatacttcaagggtgttgatgaacaaattgctcgtacattgg 25589387

                         
Query: 606      atggatcca 614
                |||||||||
Sbjct: 25589388 atggatcca 25589396



 Score =  103 bits (52), Expect = 7e-19
 Identities = 136/164 (82%)
 Strand = Plus / Plus

                                                                            
Query: 326      gtcccagcagagctcagatatttgagcatgtactcgttggaggaacaagtgtccgccaga 385
                ||||||| ||||| |||||| || | ||||||||| || || ||||||||||| |||| |
Sbjct: 25589021 gtcccagaagagcacagatacttcaacatgtactcattagaagaacaagtgtcggccaaa 25589080

                                                                            
Query: 386      tcctggtgtagttttgttatagacttctgcaacgacttgagagcaggaagcaaagtcctc 445
                ||||| || | | |||||||||||||||| |||||||| |||||||||||||| |  || 
Sbjct: 25589081 tcctgatgaattcttgttatagacttctgaaacgacttcagagcaggaagcaaggctctg 25589140

                                                            
Query: 446      gaattttgctggatgtagcttccatcaaccttgcatagctcctg 489
                || ||||| || || ||| |||| | || |||||||||||||||
Sbjct: 25589141 gagttttgttgaatatagtttccgtgaatcttgcatagctcctg 25589184
to top
>gb|BC030093.1| Homo sapiens cDNA clone IMAGE:4794937
          Length = 1010

 Score = 44.1 bits (22), Expect = 0.54
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 482 agctcctgagaccacagaagga 503
           ||||||||||||||||||||||
Sbjct: 762 agctcctgagaccacagaagga 741
to top
>ref|NM_001025100.1| Homo sapiens myelin basic protein (MBP), transcript variant 8, mRNA
          Length = 4889

 Score = 44.1 bits (22), Expect = 0.54
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 482  agctcctgagaccacagaagga 503
            ||||||||||||||||||||||
Sbjct: 4649 agctcctgagaccacagaagga 4628
to top
>dbj|AK093588.1| Homo sapiens cDNA FLJ36269 fis, clone THYMU2003012
          Length = 2464

 Score = 44.1 bits (22), Expect = 0.54
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 482  agctcctgagaccacagaagga 503
            ||||||||||||||||||||||
Sbjct: 2233 agctcctgagaccacagaagga 2212
to top
>gb|AC093330.25| Homo sapiens chromosome 18, clone RP11-862L9, complete sequence
          Length = 198182

 Score = 44.1 bits (22), Expect = 0.54
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 482    agctcctgagaccacagaagga 503
              ||||||||||||||||||||||
Sbjct: 129864 agctcctgagaccacagaagga 129885
to top
>dbj|AK098513.1| Homo sapiens cDNA FLJ25647 fis, clone SYN00310
          Length = 1929

 Score = 44.1 bits (22), Expect = 0.54
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 482  agctcctgagaccacagaagga 503
            ||||||||||||||||||||||
Sbjct: 1701 agctcctgagaccacagaagga 1680
to top
>dbj|AK074315.1| Homo sapiens cDNA FLJ23735 fis, clone HEP14813
          Length = 3949

 Score = 44.1 bits (22), Expect = 0.54
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 482  agctcctgagaccacagaagga 503
            ||||||||||||||||||||||
Sbjct: 3702 agctcctgagaccacagaagga 3681
to top
>ref|XM_518777.1| PREDICTED: Pan troglodytes similar to fucosidase, alpha-L- 2,
           plasma (LOC463039), mRNA
          Length = 1609

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 223 cactggttggcattaaaaaat 243
           |||||||||||||||||||||
Sbjct: 164 cactggttggcattaaaaaat 144
to top
>gb|BC051268.1| Homo sapiens fucosidase, alpha-L- 2, plasma, mRNA (cDNA clone
           MGC:59715 IMAGE:4855296), complete cds
          Length = 1732

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 223 cactggttggcattaaaaaat 243
           |||||||||||||||||||||
Sbjct: 434 cactggttggcattaaaaaat 414
to top
>gb|AY358551.1| Homo sapiens clone DNA33470 RPQE227 (UNQ227) mRNA, complete cds
          Length = 2362

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 223 cactggttggcattaaaaaat 243
           |||||||||||||||||||||
Sbjct: 416 cactggttggcattaaaaaat 396
to top
>emb|AL031320.6|HS20N2 Human DNA sequence from clone RP1-20N2 on chromosome 6q24 Contains the
              gene for a novel protein similar to yeast and bacterial
              cytosine deaminase, a novel protein similar to tubulin beta
              polypeptide 4 member Q (TUBB4Q) (probably a pseudogene),
              the PEX3 gene for peroxisomal biogenesis factor 3 (peroxin
              3), a VDAC1 (voltage-dependent anion channel 1
              (Plasmalemmal porin)) pseudogene, the gene for a novel
              protein similar to tissue fucosidase alpha-L-1, a novel
              gene and two CpG islands, complete sequence
          Length = 133574

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 223    cactggttggcattaaaaaat 243
              |||||||||||||||||||||
Sbjct: 126926 cactggttggcattaaaaaat 126946
to top
>gb|AE008769.1| Salmonella typhimurium LT2, section 73 of 220 of the complete genome
          Length = 20665

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 340  cagatatttgagcatgtactc 360
            |||||||||||||||||||||
Sbjct: 6578 cagatatttgagcatgtactc 6558
to top
>emb|AL627270.1| Salmonella enterica serovar Typhi (Salmonella typhi) strain CT18,
              complete chromosome; segment 6/20
          Length = 266050

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 340    cagatatttgagcatgtactc 360
              |||||||||||||||||||||
Sbjct: 135672 cagatatttgagcatgtactc 135692
to top
>emb|CR857171.1| Pongo pygmaeus mRNA; cDNA DKFZp469D0832 (from clone DKFZp469D0832)
          Length = 1737

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 223 cactggttggcattaaaaaat 243
           |||||||||||||||||||||
Sbjct: 436 cactggttggcattaaaaaat 416
to top
>emb|CR619981.1| full-length cDNA clone CS0DI022YG11 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1680

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 223 cactggttggcattaaaaaat 243
           |||||||||||||||||||||
Sbjct: 414 cactggttggcattaaaaaat 394
to top
>emb|CR616303.1| full-length cDNA clone CS0DI010YP12 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1661

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 223 cactggttggcattaaaaaat 243
           |||||||||||||||||||||
Sbjct: 428 cactggttggcattaaaaaat 408
to top
>emb|CR605098.1| full-length cDNA clone CS0DC013YA21 of Neuroblastoma Cot
           25-normalized of Homo sapiens (human)
          Length = 1686

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 223 cactggttggcattaaaaaat 243
           |||||||||||||||||||||
Sbjct: 427 cactggttggcattaaaaaat 407
to top
>emb|CR604858.1| full-length cDNA clone CS0DI061YK01 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1681

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 223 cactggttggcattaaaaaat 243
           |||||||||||||||||||||
Sbjct: 440 cactggttggcattaaaaaat 420
to top
>emb|CR604354.1| full-length cDNA clone CL0BA010ZF05 of Placenta of Homo sapiens
           (human)
          Length = 1683

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 223 cactggttggcattaaaaaat 243
           |||||||||||||||||||||
Sbjct: 409 cactggttggcattaaaaaat 389
to top
>emb|CR604319.1| full-length cDNA clone CS0DE013YB14 of Placenta of Homo sapiens
           (human)
          Length = 1648

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 223 cactggttggcattaaaaaat 243
           |||||||||||||||||||||
Sbjct: 416 cactggttggcattaaaaaat 396
to top
>dbj|AK075458.1| Homo sapiens cDNA PSEC0151 fis, clone PLACE1007878, highly similar
           to Fucosidase, alpha-L- 2, plasma
          Length = 1688

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 223 cactggttggcattaaaaaat 243
           |||||||||||||||||||||
Sbjct: 405 cactggttggcattaaaaaat 385
to top
>emb|CR597899.1| full-length cDNA clone CS0DI057YI15 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1621

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 223 cactggttggcattaaaaaat 243
           |||||||||||||||||||||
Sbjct: 403 cactggttggcattaaaaaat 383
to top
>emb|CR597696.1| full-length cDNA clone CS0DC006YN18 of Neuroblastoma Cot
           25-normalized of Homo sapiens (human)
          Length = 1658

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 223 cactggttggcattaaaaaat 243
           |||||||||||||||||||||
Sbjct: 416 cactggttggcattaaaaaat 396
to top
>emb|CR597166.1| full-length cDNA clone CS0DI060YL01 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1679

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 223 cactggttggcattaaaaaat 243
           |||||||||||||||||||||
Sbjct: 444 cactggttggcattaaaaaat 424
to top
>emb|CR596039.1| full-length cDNA clone CS0DM002YF07 of Fetal liver of Homo sapiens
           (human)
          Length = 1692

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 223 cactggttggcattaaaaaat 243
           |||||||||||||||||||||
Sbjct: 409 cactggttggcattaaaaaat 389
to top
>emb|CR594942.1| full-length cDNA clone CS0DE014YC08 of Placenta of Homo sapiens
           (human)
          Length = 1718

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 223 cactggttggcattaaaaaat 243
           |||||||||||||||||||||
Sbjct: 448 cactggttggcattaaaaaat 428
to top
>emb|CR594725.1| full-length cDNA clone CS0DI070YJ24 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1662

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 223 cactggttggcattaaaaaat 243
           |||||||||||||||||||||
Sbjct: 427 cactggttggcattaaaaaat 407
to top
>emb|CR592398.1| full-length cDNA clone CS0DI086YF08 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1693

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 223 cactggttggcattaaaaaat 243
           |||||||||||||||||||||
Sbjct: 448 cactggttggcattaaaaaat 428
to top
>emb|CR591818.1| full-length cDNA clone CS0DI002YE06 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1632

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 223 cactggttggcattaaaaaat 243
           |||||||||||||||||||||
Sbjct: 413 cactggttggcattaaaaaat 393
to top
>ref|NM_032020.3| Homo sapiens fucosidase, alpha-L- 2, plasma (FUCA2), mRNA
          Length = 2098

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 223 cactggttggcattaaaaaat 243
           |||||||||||||||||||||
Sbjct: 442 cactggttggcattaaaaaat 422
to top
>gb|CP000026.1| Salmonella enterica subsp. enterica serovar Paratyphi A str. ATCC 9150
          Length = 4585229

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 340     cagatatttgagcatgtactc 360
               |||||||||||||||||||||
Sbjct: 1367332 cagatatttgagcatgtactc 1367352
to top
>gb|AE014613.1| Salmonella enterica subsp. enterica serovar Typhi Ty2, complete genome
          Length = 4791961

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 340     cagatatttgagcatgtactc 360
               |||||||||||||||||||||
Sbjct: 1539253 cagatatttgagcatgtactc 1539233
to top
>gb|AE017220.1| Salmonella enterica subsp. enterica serovar Choleraesuis str. SC-B67,
               complete genome
          Length = 4755700

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 340     cagatatttgagcatgtactc 360
               |||||||||||||||||||||
Sbjct: 1676699 cagatatttgagcatgtactc 1676679
to top
>gb|BC003060.2| Homo sapiens fucosidase, alpha-L- 2, plasma, mRNA (cDNA clone
           MGC:1314 IMAGE:3505533), complete cds
          Length = 1696

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 223 cactggttggcattaaaaaat 243
           |||||||||||||||||||||
Sbjct: 380 cactggttggcattaaaaaat 360
to top
>gb|AC109272.20| Mus musculus chromosome 7, clone RP23-354L18, complete sequence
          Length = 202993

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 167    tacagccactgcccatgtgg 186
              ||||||||||||||||||||
Sbjct: 182799 tacagccactgcccatgtgg 182818
to top
>gb|BC070852.1| Xenopus laevis hypothetical protein MGC84592, mRNA (cDNA clone
            MGC:84592 IMAGE:6640288), complete cds
          Length = 5962

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 324  ttgtcccagcagagctcaga 343
            ||||||||||||||||||||
Sbjct: 1369 ttgtcccagcagagctcaga 1388
to top
>gb|DP000008.1| Bos taurus target 1 genomic scaffold
          Length = 2072671

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 254     tgctcatgtgctcagtcatc 273
               ||||||||||||||||||||
Sbjct: 1854475 tgctcatgtgctcagtcatc 1854494
to top
>gb|BC060438.1| Xenopus laevis cDNA clone IMAGE:4174467, partial cds
          Length = 1686

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 324  ttgtcccagcagagctcaga 343
            ||||||||||||||||||||
Sbjct: 1476 ttgtcccagcagagctcaga 1495
to top
>emb|CR717099.2|CNS0GG9G Tetraodon nigroviridis full-length cDNA
          Length = 969

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 317 taactctttgtcccagcaga 336
           ||||||||||||||||||||
Sbjct: 432 taactctttgtcccagcaga 451
to top
>gb|AC107715.5| Mus musculus chromosome 10, clone RP24-376I19, complete sequence
          Length = 156153

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 233   cattaaaaaatgatactcag 252
             ||||||||||||||||||||
Sbjct: 87951 cattaaaaaatgatactcag 87932
to top
>emb|Z95151.1|MLCB5 Mycobacterium leprae cosmid B5
          Length = 38109

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 430   aggaagcaaagtcctcgaat 449
             ||||||||||||||||||||
Sbjct: 22853 aggaagcaaagtcctcgaat 22872
to top
>gb|AC162287.4| Mus musculus chromosome 7, clone RP24-243J4, complete sequence
          Length = 152934

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 167    tacagccactgcccatgtgg 186
              ||||||||||||||||||||
Sbjct: 128761 tacagccactgcccatgtgg 128742
to top
>emb|CR555306.1| Azoarcus sp. EbN1 complete genome
          Length = 4296230

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 534     ggtcagcgaatgcatcgatc 553
               ||||||||||||||||||||
Sbjct: 2049691 ggtcagcgaatgcatcgatc 2049672
to top
>emb|AL583924.1|MLEPRTN8 Mycobacterium leprae strain TN complete genome; segment 8/10
          Length = 342300

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 430    aggaagcaaagtcctcgaat 449
              ||||||||||||||||||||
Sbjct: 287989 aggaagcaaagtcctcgaat 287970
to top
>gb|AC156367.3| Bos taurus clone RP42-394P24, complete sequence
          Length = 78774

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 254   tgctcatgtgctcagtcatc 273
             ||||||||||||||||||||
Sbjct: 28491 tgctcatgtgctcagtcatc 28510


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 5,998,653
Number of Sequences: 3902068
Number of extensions: 5998653
Number of successful extensions: 92417
Number of sequences better than 10.0: 48
Number of HSP's better than 10.0 without gapping: 48
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 92248
Number of HSP's gapped (non-prelim): 165
length of query: 614
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 591
effective length of database: 17,143,297,704
effective search space: 10131688943064
effective search space used: 10131688943064
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top