ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbags16p07
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|BT016516.1| Zea mays clone Contig349 mRNA sequence 537 e-149
2dbj|AK103918.1| Oryza sativa (japonica cultivar-group) cDNA clon... 531 e-147
3dbj|AK059823.1| Oryza sativa (japonica cultivar-group) cDNA clon... 531 e-147
4dbj|AK059558.1| Oryza sativa (japonica cultivar-group) cDNA clon... 531 e-147
5gb|BT016445.1| Zea mays clone Contig278 mRNA sequence 529 e-147
6gb|AY103625.1| Zea mays PCO091587 mRNA sequence 529 e-147
7ref|NM_183433.2| Oryza sativa (japonica cultivar-group), mRNA 505 e-140
8dbj|AK121523.1| Oryza sativa (japonica cultivar-group) cDNA clon... 505 e-140
9dbj|AK059844.1| Oryza sativa (japonica cultivar-group) cDNA clon... 505 e-140
10gb|BT016589.1| Zea mays clone Contig422 mRNA sequence 498 e-137
11dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 258 2e-65
12dbj|AP003727.3| Oryza sativa (japonica cultivar-group) genomic D... 258 2e-65
13dbj|AP008219.1| Oryza sativa (japonica cultivar-group) genomic D... 258 2e-65
14dbj|AP003610.2| Oryza sativa (japonica cultivar-group) genomic D... 258 2e-65
15gb|AC114011.5| Oryza sativa (japonica cultivar-group) chromosome... 236 8e-59
16dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic D... 236 8e-59
17gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome... 236 8e-59
18ref|NM_112027.2| Arabidopsis thaliana ATRPS5A (RIBOSOMAL PROTEIN... 180 4e-42
19ref|NM_180233.1| Arabidopsis thaliana ATRPS5A (RIBOSOMAL PROTEIN... 180 4e-42
20gb|AY091376.1| Arabidopsis thaliana putative 40S ribosomal prote... 180 4e-42
21gb|AY045846.1| Arabidopsis thaliana putative 40S ribosomal prote... 180 4e-42
22emb|BX822599.1|CNS0A75J Arabidopsis thaliana Full-length cDNA Co... 180 4e-42
23emb|BX824143.1|CNS0A6QW Arabidopsis thaliana Full-length cDNA Co... 180 4e-42
24gb|AY086938.1| Arabidopsis thaliana clone 29782 mRNA, complete s... 180 4e-42
25emb|AM167929.1| Chlamydomonas sp. ICE-L mRNA for 40S ribosomal p... 168 2e-38
26gb|AY674223.1| Ixodes pacificus clone IP_7_60_92_100_CLU 40S rib... 165 2e-37
27gb|AY547734.1| Ornithodoros moubata 40S ribosomal protein S5 mRN... 163 1e-36
28dbj|D29726.1|RICYK40 Oryza sativa mRNA, partial homologous to ri... 155 2e-34
29gb|DQ066208.1| Ixodes scapularis isolate ISUFL41 40S ribosomal p... 149 1e-32
30emb|BX822969.1|CNS0A70I Arabidopsis thaliana Full-length cDNA Co... 149 1e-32
31dbj|AK110655.1| Oryza sativa (japonica cultivar-group) cDNA clon... 149 1e-32
32emb|CR523515.1| Gallus gallus finished cDNA, clone ChEST17m15 143 9e-31
33ref|XM_958137.1| Neurospora crassa OR74A 40S RIBOSOMAL PROTEIN S... 141 4e-30
34ref|XM_329833.1| Neurospora crassa OR74A 40S RIBOSOMAL PROTEIN S... 141 4e-30
35emb|BX842597.1| Neurospora crassa DNA linkage group II BAC clone... 141 4e-30
36emb|BX842596.1| Neurospora crassa DNA linkage group II BAC clone... 141 4e-30
37emb|AJ439528.1|PSP439528 Polytomella sp. 'Pringsheim 198.80' mRN... 139 1e-29
38gb|AY785292.1| Callinectes sapidus receptor guanylyl cyclase (GC... 137 6e-29
39ref|XM_653355.1| Aspergillus nidulans FGSC A4 40S ribosomal prot... 127 5e-26
40gb|AY498744.1| Capsicum annuum 40S ribosomal protein S5 (RpS5) m... 125 2e-25
41gb|AY130451.1| Petromyzon marinus ribosomal protein S5 mRNA, par... 125 2e-25
42ref|NM_001015531.1| Bos taurus ribosomal protein S5 (RPS5), mRNA 121 3e-24
43gb|BC102374.1| Bos taurus ribosomal protein S5, mRNA (cDNA clone... 121 3e-24
44gb|BT021032.1| Bos taurus ribosomal protein S5 (RPS5), mRNA, com... 121 3e-24
45emb|BX824064.1|CNS0A6PV Arabidopsis thaliana Full-length cDNA Co... 119 1e-23
46ref|XM_747778.1| Aspergillus fumigatus Af293 40S ribosomal prote... 117 5e-23
47gb|AY241965.1| Dermacentor variabilis 40S ribosomal protein S5 m... 117 5e-23
48emb|Z99168.1|SPAC8C9 S.pombe chromosome I cosmid c8C9 111 3e-21
49emb|AL360054.1|SPAC328 S.pombe chromosome I cosmid c328 111 3e-21
50ref|NM_078658.2| Drosophila melanogaster Ribosomal protein S5a C... 111 3e-21
51gb|AY075368.1| Drosophila melanogaster GM13047 full length cDNA 111 3e-21
52ref|NM_001019702.1| Schizosaccharomyces pombe 972h- hypothetical... 111 3e-21
53ref|NM_001019635.1| Schizosaccharomyces pombe 972h- hypothetical... 111 3e-21
54emb|BX822925.1|CNS0A746 Arabidopsis thaliana Full-length cDNA Co... 111 3e-21
55gb|U48394.1|DMU48394 Drosophila melanogaster ribosomal protein S... 111 3e-21
56gb|AY837869.1| Trichoplusia ni ribosomal protein S5 mRNA, comple... 109 1e-20
57ref|XM_386195.1| Gibberella zeae PH-1 chromosome 3 RS5_CICAR 40S... 107 5e-20
58ref|XM_512950.1| PREDICTED: Pan troglodytes similar to ribosomal... 105 2e-19
59gb|BC015405.1| Homo sapiens ribosomal protein S5, mRNA (cDNA clo... 105 2e-19
60gb|BC004392.1| Homo sapiens cDNA clone IMAGE:3635299, **** WARNI... 105 2e-19
61gb|BC015589.2| Homo sapiens cDNA clone IMAGE:4643450, partial cds 105 2e-19
62gb|BC011718.1| Homo sapiens cDNA clone IMAGE:4099312, **** WARNI... 105 2e-19
63ref|NM_001009.3| Homo sapiens ribosomal protein S5 (RPS5), mRNA 105 2e-19
64emb|CR625375.1| full-length cDNA clone CS0DI026YC20 of Placenta ... 105 2e-19
65emb|CR619033.1| full-length cDNA clone CS0DK007YN14 of HeLa cell... 105 2e-19
66emb|CR614318.1| full-length cDNA clone CS0DI033YI16 of Placenta ... 105 2e-19
67emb|CR605125.1| full-length cDNA clone CS0DM009YE02 of Fetal liv... 105 2e-19
68emb|CR606098.1| full-length cDNA clone CS0DK012YE07 of HeLa cell... 105 2e-19
69emb|CR593754.1| full-length cDNA clone CS0DI002YN03 of Placenta ... 105 2e-19
70gb|AY891473.1| Synthetic construct Homo sapiens clone FLH027247.... 105 2e-19
71gb|AY888836.1| Synthetic construct Homo sapiens clone FLH027250.... 105 2e-19
72gb|BC018151.1| Homo sapiens ribosomal protein S5, mRNA (cDNA clo... 105 2e-19
73gb|BC035830.1| Homo sapiens ribosomal protein S5, mRNA (cDNA clo... 105 2e-19
74gb|BC018828.2| Homo sapiens ribosomal protein S5, mRNA (cDNA clo... 105 2e-19
75gb|U14970.1|HSU14970 Human ribosomal protein S5 mRNA, complete cds 105 2e-19
76ref|NM_129283.2| Arabidopsis thaliana ATRPS5B (RIBOSOMAL PROTEIN... 103 8e-19
77ref|NM_001036425.1| Arabidopsis thaliana ATRPS5B (RIBOSOMAL PROT... 103 8e-19
78dbj|AP007151.1| Aspergillus oryzae RIB40 genomic DNA, SC005 103 8e-19
79gb|AY081669.1| Arabidopsis thaliana 40S ribosomal protein S5 (At... 103 8e-19
80gb|AY059849.1| Arabidopsis thaliana 40S ribosomal protein S5 (At... 103 8e-19
81gb|AY088613.1| Arabidopsis thaliana clone 8397 mRNA, complete se... 103 8e-19
82ref|XM_792179.1| PREDICTED: Strongylocentrotus purpuratus simila... 101 3e-18
83emb|Y08860.1|NP40SRS5 N.plumbaginifolia mRNA for 40S ribosomal p... 101 3e-18
84emb|CR382132.1| Yarrowia lipolytica chromosome F of strain CLIB1... 101 3e-18
85ref|XM_505167.1| Yarrowia lipolytica CLIB122, YALI0F08569g predi... 100 1e-17
86gb|AY190724.1| Pagrus major 40S ribosomal protein S5 mRNA, parti... 98 5e-17
87dbj|AK223106.1| Homo sapiens mRNA for ribosomal protein S5 varia... 98 5e-17
88gb|AC084495.1|CBRG10C24 Caenorhabditis briggsae cosmid G10C24, c... 98 5e-17
89gb|BC059443.1| Danio rerio ribosomal protein S5, mRNA (cDNA clon... 96 2e-16
90gb|AC016795.6|ATAC016795 Arabidopsis thaliana chromosome III BAC... 96 2e-16
91emb|AJ005346.1|CAA005346 Cicer arietinum mRNA for 40S ribosomal ... 96 2e-16
92ref|XM_341788.2| PREDICTED: Rattus norvegicus ribosomal protein ... 96 2e-16
93ref|XM_528175.1| PREDICTED: Pan troglodytes similar to ribosomal... 94 8e-16
94emb|BX820728.1|CNS0A81J Arabidopsis thaliana Full-length cDNA Co... 94 8e-16
95emb|Z68751.1|CET05E11 Caenorhabditis elegans Cosmid T05E11, comp... 92 3e-15
96ref|NM_069676.2| Caenorhabditis elegans Ribosomal Protein, Small... 92 3e-15
97ref|XM_856770.1| PREDICTED: Canis familiaris similar to ribosoma... 90 1e-14
98ref|XM_856740.1| PREDICTED: Canis familiaris similar to ribosoma... 90 1e-14
99ref|XM_856714.1| PREDICTED: Canis familiaris similar to ribosoma... 90 1e-14
100ref|XM_856685.1| PREDICTED: Canis familiaris similar to ribosoma... 90 1e-14
101ref|XM_533568.2| PREDICTED: Canis familiaris similar to ribosoma... 90 1e-14
102emb|AL050331.11|HSDJ486I3 Human DNA sequence from clone RP3-486I... 90 1e-14
103ref|NG_000896.1| Homo sapiens ribosomal protein S5 pseudogene 1 ... 90 1e-14
104gb|AY909418.1| Siniperca chuatsi clone C137 40S ribosomal protei... 90 1e-14
105gb|AY650305.1| Macaca fascicularis ribosomal protein S5 mRNA, pa... 88 5e-14
106ref|XM_518704.1| PREDICTED: Pan troglodytes similar to KIAA0721 ... 88 5e-14
107gb|BC058690.1| Mus musculus ribosomal protein S5, mRNA (cDNA clo... 88 5e-14
108ref|NM_173232.1| Danio rerio ribosomal protein S5 (rps5), mRNA 88 5e-14
109emb|Y12431.1|MMRPS5 M.musculus mRNA for ribosomal protein S5 88 5e-14
110gb|AF506223.1| Danio rerio 40S ribosomal protein S5 (rps5) mRNA,... 88 5e-14
111dbj|AK152449.1| Mus musculus bone marrow macrophage cDNA, RIKEN ... 88 5e-14
112dbj|AK167533.1| Mus musculus 14 days embryo liver cDNA, RIKEN fu... 88 5e-14
113dbj|AK164079.1| Mus musculus 12 days embryo spinal cord cDNA, RI... 88 5e-14
114dbj|AK160552.1| Mus musculus ES cells cDNA, RIKEN full-length en... 88 5e-14
115dbj|AK168106.1| Mus musculus TIB-55 BB88 cDNA, RIKEN full-length... 88 5e-14
116dbj|AK168044.1| Mus musculus CRL-1722 L5178Y-R cDNA, RIKEN full-... 88 5e-14
117dbj|AK169016.1| Mus musculus 17 days embryo kidney cDNA, RIKEN f... 88 5e-14
118dbj|AK172446.1| Mus musculus activated spleen cDNA, RIKEN full-l... 88 5e-14
119dbj|AK020477.1| Mus musculus 12 days embryo embryonic body betwe... 88 5e-14
120dbj|AK010681.1| Mus musculus ES cells cDNA, RIKEN full-length en... 88 5e-14
121dbj|AK009663.1| Mus musculus adult male tongue cDNA, RIKEN full-... 88 5e-14
122dbj|AK050622.1| Mus musculus 2 days neonate thymus thymic cells ... 88 5e-14
123dbj|AK050611.1| Mus musculus 2 days neonate thymus thymic cells ... 88 5e-14
124dbj|AK012481.1| Mus musculus 11 days embryo whole body cDNA, RIK... 88 5e-14
125dbj|AK012424.1| Mus musculus 11 days embryo whole body cDNA, RIK... 88 5e-14
126dbj|AK002235.1| Mus musculus adult male kidney cDNA, RIKEN full-... 88 5e-14
127dbj|AK020754.1| Mus musculus 0 day neonate thymus cDNA, RIKEN fu... 88 5e-14
128gb|BC020401.1| Mus musculus ribosomal protein S5, mRNA (cDNA clo... 88 5e-14
129gb|AY194365.1| Vitis vinifera putative 40S ribosomal protein S5 ... 86 2e-13
130gb|AF517858.1| Griffithsia japonica isolate Gj431 40S ribosome p... 86 2e-13
131gb|AY857462.1| Suberites domuncula S5 mRNA, complete cds 86 2e-13
132ref|XM_370161.1| Magnaporthe grisea 70-15 chromosome II hypothet... 84 7e-13
133ref|XM_751645.1| Ustilago maydis 521 hypothetical protein (UM005... 84 7e-13
134emb|CR640277.2|CNS0ET0B Tetraodon nigroviridis full-length cDNA 84 7e-13
135ref|NM_142150.2| Drosophila melanogaster Ribosomal protein S5b C... 84 7e-13
136gb|AY071138.1| Drosophila melanogaster RE17836 full length cDNA 84 7e-13
137gb|AC008136.4|AC008136 Drosophila melanogaster, chromosome 3R, r... 84 7e-13
138gb|AC005721.3|AC005721 Drosophila melanogaster, chromosome 3R, r... 84 7e-13
139gb|AE003706.5| Drosophila melanogaster chromosome 3R, section 44... 84 7e-13
140emb|BX070858.1|CNS09QU6 Single read from an extremity of a full-... 82 3e-12
141emb|BX070857.1|CNS09QU5 Single read from an extremity of a full-... 82 3e-12
142emb|BX060985.1|CNS09J7X Single read from an extremity of a full-... 82 3e-12
143emb|BX069208.1|CNS09PKC Single read from an extremity of a full-... 82 3e-12
144emb|BX069149.1|CNS09PIP Single read from an extremity of a full-... 82 3e-12
145emb|BX067805.1|CNS09OHD Single read from an extremity of a full-... 82 3e-12
146emb|BX067167.1|CNS09NZN Single read from an extremity of a full-... 82 3e-12
147emb|BX066872.1|CNS09NRG Single read from an extremity of a full-... 82 3e-12
148emb|BX066614.1|CNS09NKA Single read from an extremity of a full-... 82 3e-12
149emb|BX066613.1|CNS09NK9 Single read from an extremity of a full-... 82 3e-12
150emb|BX066320.1|CNS09NC4 Single read from an extremity of a full-... 82 3e-12
151emb|BX066319.1|CNS09NC3 Single read from an extremity of a full-... 82 3e-12
152emb|BX065223.1|CNS09MHN Single read from an extremity of a full-... 82 3e-12
153emb|BX064990.1|CNS09MB6 Single read from an extremity of a full-... 82 3e-12
154emb|BX064714.1|CNS09M3I Single read from an extremity of a full-... 82 3e-12
155emb|BX064166.1|CNS09LOA Single read from an extremity of a full-... 82 3e-12
156emb|BX062350.1|CNS09K9U Single read from an extremity of a full-... 82 3e-12
157emb|BX061779.1|CNS09JTZ Single read from an extremity of a full-... 82 3e-12
158emb|BX060577.1|CNS09IWL Single read from an extremity of a full-... 82 3e-12
159emb|BX060576.1|CNS09IWK Single read from an extremity of a full-... 82 3e-12
160emb|BX060097.1|CNS09IJ9 Single read from an extremity of a full-... 82 3e-12
161emb|BX059264.1|CNS09HW4 Single read from an extremity of a full-... 82 3e-12
162emb|BX055956.1|CNS09FC8 Single read from an extremity of a full-... 82 3e-12
163emb|BX055954.1|CNS09FC6 Single read from an extremity of a full-... 82 3e-12
164emb|BX056005.1|CNS09FDL Single read from an extremity of a full-... 82 3e-12
165emb|BX055289.1|CNS09ETP Single read from an extremity of a full-... 82 3e-12
166emb|BX054593.1|CNS09EAD Single read from an extremity of a full-... 82 3e-12
167emb|BX054146.1|CNS09DXY Single read from an extremity of a full-... 82 3e-12
168emb|BX050132.1|CNS09AUG Single read from an extremity of a full-... 82 3e-12
169emb|BX050939.1|CNS09BGV Single read from an extremity of a full-... 82 3e-12
170emb|BX050490.1|CNS09B4E Single read from an extremity of a full-... 82 3e-12
171emb|BX050054.1|CNS09ASA Single read from an extremity of a full-... 82 3e-12
172emb|BX049760.1|CNS09AK4 Single read from an extremity of a full-... 82 3e-12
173emb|BX030899.1|CNS08W07 Single read from an extremity of a full-... 82 3e-12
174emb|BX048650.1|CNS099PA Single read from an extremity of a full-... 82 3e-12
175emb|BX047888.1|CNS09944 Single read from an extremity of a full-... 82 3e-12
176emb|BX047653.1|CNS098XL Single read from an extremity of a full-... 82 3e-12
177emb|BX047407.1|CNS098QR Single read from an extremity of a full-... 82 3e-12
178emb|BX047406.1|CNS098QQ Single read from an extremity of a full-... 82 3e-12
179emb|BX047180.1|CNS098KG Single read from an extremity of a full-... 82 3e-12
180emb|BX046292.1|CNS097VS Single read from an extremity of a full-... 82 3e-12
181emb|BX045879.1|CNS097KB Single read from an extremity of a full-... 82 3e-12
182emb|BX042957.1|CNS095B5 Single read from an extremity of a full-... 82 3e-12
183emb|BX042956.1|CNS095B4 Single read from an extremity of a full-... 82 3e-12
184emb|BX043656.1|CNS095UK Single read from an extremity of a full-... 82 3e-12
185emb|BX043116.1|CNS095FK Single read from an extremity of a full-... 82 3e-12
186emb|BX041675.1|CNS094BJ Single read from an extremity of a full-... 82 3e-12
187emb|BX041950.1|CNS094J6 Single read from an extremity of a full-... 82 3e-12
188emb|BX041256.1|CNS093ZW Single read from an extremity of a full-... 82 3e-12
189emb|BX040008.1|CNS09318 Single read from an extremity of a full-... 82 3e-12
190emb|BX040007.1|CNS09317 Single read from an extremity of a full-... 82 3e-12
191emb|BX039701.1|CNS092SP Single read from an extremity of a full-... 82 3e-12
192emb|BX037484.1|CNS09134 Single read from an extremity of a full-... 82 3e-12
193emb|BX037483.1|CNS09133 Single read from an extremity of a full-... 82 3e-12
194emb|BX037292.1|CNS090XS Single read from an extremity of a full-... 82 3e-12
195emb|BX037168.1|CNS090UC Single read from an extremity of a full-... 82 3e-12
196emb|BX037167.1|CNS090UB Single read from an extremity of a full-... 82 3e-12
197emb|BX036321.1|CNS0906T Single read from an extremity of a full-... 82 3e-12
198emb|BX036320.1|CNS0906S Single read from an extremity of a full-... 82 3e-12
199emb|BX036088.1|CNS0900C Single read from an extremity of a full-... 82 3e-12
200emb|BX035877.1|CNS08ZUH Single read from an extremity of a full-... 82 3e-12
201emb|BX035876.1|CNS08ZUG Single read from an extremity of a full-... 82 3e-12
202emb|BX035842.1|CNS08ZTI Single read from an extremity of a full-... 82 3e-12
203emb|BX034797.1|CNS08Z0H Single read from an extremity of a full-... 82 3e-12
204emb|BX034367.1|CNS08YOJ Single read from an extremity of a full-... 82 3e-12
205emb|BX034366.1|CNS08YOI Single read from an extremity of a full-... 82 3e-12
206emb|BX034032.1|CNS08YF8 Single read from an extremity of a full-... 82 3e-12
207emb|BX033399.1|CNS08XXN Single read from an extremity of a full-... 82 3e-12
208emb|BX032903.1|CNS08XJV Single read from an extremity of a full-... 82 3e-12
209emb|BX032460.1|CNS08X7K Single read from an extremity of a full-... 82 3e-12
210emb|BX031884.1|CNS08WRK Single read from an extremity of a full-... 82 3e-12
211emb|BX031739.1|CNS08WNJ Single read from an extremity of a full-... 82 3e-12
212emb|BX031420.1|CNS08WEO Single read from an extremity of a full-... 82 3e-12
213emb|BX031299.1|CNS08WBB Single read from an extremity of a full-... 82 3e-12
214emb|BX031111.1|CNS08W63 Single read from an extremity of a full-... 82 3e-12
215emb|BX031110.1|CNS08W62 Single read from an extremity of a full-... 82 3e-12
216emb|BX030434.1|CNS08VNA Single read from an extremity of a full-... 82 3e-12
217emb|BX030022.1|CNS08VBU Single read from an extremity of a full-... 82 3e-12
218emb|BX030006.1|CNS08VBE Single read from an extremity of a full-... 82 3e-12
219emb|BX030005.1|CNS08VBD Single read from an extremity of a full-... 82 3e-12
220emb|BX029809.1|CNS08V5X Single read from an extremity of a full-... 82 3e-12
221emb|BX029671.1|CNS08V23 Single read from an extremity of a full-... 82 3e-12
222emb|BX029068.1|CNS08ULC Single read from an extremity of a full-... 82 3e-12
223emb|BX028774.1|CNS08UD6 Single read from an extremity of a full-... 82 3e-12
224emb|BX028773.1|CNS08UD5 Single read from an extremity of a full-... 82 3e-12
225emb|BX028667.1|CNS08UA7 Single read from an extremity of a full-... 82 3e-12
226emb|BX028422.1|CNS08U3E Single read from an extremity of a full-... 82 3e-12
227emb|BX028421.1|CNS08U3D Single read from an extremity of a full-... 82 3e-12
228emb|BX028363.1|CNS08U1R Single read from an extremity of a full-... 82 3e-12
229emb|BX028362.1|CNS08U1Q Single read from an extremity of a full-... 82 3e-12
230emb|BX027498.1|CNS08TDQ Single read from an extremity of a full-... 82 3e-12
231emb|BX027480.1|CNS08TD8 Single read from an extremity of a full-... 82 3e-12
232emb|BX025592.1|CNS08RWS Single read from an extremity of a full-... 82 3e-12
233emb|BX022854.1|CNS08PSQ Single read from an extremity of a full-... 82 3e-12
234emb|BX024680.1|CNS08R7G Single read from an extremity of a full-... 82 3e-12
235emb|BX024182.1|CNS08QTM Single read from an extremity of a full-... 82 3e-12
236emb|BX023855.1|CNS08QKJ Single read from an extremity of a full-... 82 3e-12
237emb|BX023607.1|CNS08QDN Single read from an extremity of a full-... 82 3e-12
238emb|BX023606.1|CNS08QDM Single read from an extremity of a full-... 82 3e-12
239emb|BX023496.1|CNS08QAK Single read from an extremity of a full-... 82 3e-12
240emb|BX023083.1|CNS08PZ3 Single read from an extremity of a full-... 82 3e-12
241emb|BX022243.1|CNS08PBR Single read from an extremity of a full-... 82 3e-12
242emb|BX022242.1|CNS08PBQ Single read from an extremity of a full-... 82 3e-12
243emb|BX022047.1|CNS08P6B Single read from an extremity of a full-... 82 3e-12
244emb|BX021562.1|CNS08OSU Single read from an extremity of a full-... 82 3e-12
245emb|BX021278.1|CNS08OKY Single read from an extremity of a full-... 82 3e-12
246emb|BX020767.1|CNS08O6R Single read from an extremity of a full-... 82 3e-12
247emb|BX018908.1|CNS08MR4 Single read from an extremity of a full-... 82 3e-12
248emb|BX018907.1|CNS08MR3 Single read from an extremity of a full-... 82 3e-12
249emb|BX018088.1|CNS08M4C Single read from an extremity of a full-... 82 3e-12
250emb|BX017024.1|CNS08LAS Single read from an extremity of a full-... 82 3e-12
251emb|BX016310.1|CNS08KQY Single read from an extremity of a full-... 82 3e-12
252emb|BX015921.1|CNS08KG5 Single read from an extremity of a full-... 82 3e-12
253emb|BX015406.1|CNS08K1U Single read from an extremity of a full-... 82 3e-12
254emb|BX015043.1|CNS08JRR Single read from an extremity of a full-... 82 3e-12
255emb|BX014758.1|CNS08JJU Single read from an extremity of a full-... 82 3e-12
256emb|BX013915.1|CNS08IWF Single read from an extremity of a full-... 82 3e-12
257emb|BX013914.1|CNS08IWE Single read from an extremity of a full-... 82 3e-12
258emb|BX012966.1|CNS08I62 Single read from an extremity of a full-... 82 3e-12
259emb|BX012868.1|CNS08I3C Single read from an extremity of a full-... 82 3e-12
260emb|BX012234.1|CNS08HLQ Single read from an extremity of a full-... 82 3e-12
261emb|BX012218.1|CNS08HLA Single read from an extremity of a full-... 82 3e-12
262emb|BX012118.1|CNS08HII Single read from an extremity of a full-... 82 3e-12
263emb|BX010779.1|CNS08GHB Single read from an extremity of a full-... 82 3e-12
264emb|BX010285.1|CNS08G3L Single read from an extremity of a full-... 82 3e-12
265emb|BX010284.1|CNS08G3K Single read from an extremity of a full-... 82 3e-12
266emb|BX009579.1|CNS08FJZ Single read from an extremity of a full-... 82 3e-12
267emb|BX008809.1|CNS08EYL Single read from an extremity of a full-... 82 3e-12
268emb|BX008262.1|CNS08EJE Single read from an extremity of a full-... 82 3e-12
269emb|BX007419.1|CNS08DVZ Single read from an extremity of a full-... 82 3e-12
270emb|BX007418.1|CNS08DVY Single read from an extremity of a full-... 82 3e-12
271emb|BX006934.1|CNS08DII Single read from an extremity of a full-... 82 3e-12
272emb|BX006492.1|CNS08D68 Single read from an extremity of a full-... 82 3e-12
273emb|BX006287.1|CNS08D0J Single read from an extremity of a full-... 82 3e-12
274emb|BX006100.1|CNS08CVC Single read from an extremity of a full-... 82 3e-12
275ref|XM_555129.2| Anopheles gambiae str. PEST ENSANGP00000028274 ... 82 3e-12
276ref|XM_317132.2| Anopheles gambiae str. PEST ENSANGP00000025326 ... 82 3e-12
277emb|BX059487.1|CNS09I2B Single read from an extremity of a full-... 80 1e-11
278emb|BX041676.1|CNS094BK Single read from an extremity of a full-... 80 1e-11
279emb|BX025593.1|CNS08RWT Single read from an extremity of a full-... 80 1e-11
280emb|BX006873.1|CNS08DGT Single read from an extremity of a full-... 80 1e-11
281ref|NM_009095.1| Mus musculus ribosomal protein S5 (Rps5), mRNA 80 1e-11
282emb|X58465.1|RNRPS5 Rat mRNA for ribosomal protein S5 80 1e-11
283gb|U78085.1|MMU78085 Mus musculus ribosomal protein S5 mRNA, com... 80 1e-11
284gb|AE017351.1| Cryptococcus neoformans var. neoformans JEC21 chr... 78 4e-11
285ref|XM_567915.1| Cryptococcus neoformans var. neoformans JEC21 4... 78 4e-11
286gb|AC104212.3| Homo sapiens chromosome 8, clone RP11-941H19, com... 78 4e-11
287dbj|AB199894.1| Crassostrea gigas mRNA for ribosomal protein S5,... 78 4e-11
288gb|AC012313.7| Homo sapiens chromosome 19 clone CTD-2619J13, com... 78 4e-11
289dbj|AB061853.2| Homo sapiens RPS5 gene for ribosomal protein S5,... 78 4e-11
290gb|AY130371.1| Scyliorhinus canicula ribosomal protein S5-like m... 78 4e-11
291gb|AY130369.1| Branchiostoma lanceolatum ribosomal protein S5 mR... 78 4e-11
292dbj|AK108544.1| Oryza sativa (japonica cultivar-group) cDNA clon... 78 4e-11
293gb|DQ440005.1| Aedes aegypti clone AE-198A ribosomal protein S5 ... 76 2e-10
294emb|CR734964.2|CNS0GTVN Tetraodon nigroviridis full-length cDNA 76 2e-10
295emb|CR652721.2|CNS0F2LZ Tetraodon nigroviridis full-length cDNA 76 2e-10
296emb|CR734045.2|CNS0GT64 Tetraodon nigroviridis full-length cDNA 76 2e-10
297emb|CR733991.2|CNS0GT4M Tetraodon nigroviridis full-length cDNA 76 2e-10
298emb|CR733728.3|CNS0GSXB Tetraodon nigroviridis full-length cDNA 76 2e-10
299emb|CR732380.2|CNS0GS1T Tetraodon nigroviridis full-length cDNA 76 2e-10
300emb|CR712156.2|CNS0GCG8 Tetraodon nigroviridis full-length cDNA 76 2e-10
301emb|CR730643.2|CNS0GQPK Tetraodon nigroviridis full-length cDNA 76 2e-10
302emb|CR729694.2|CNS0GPZ8 Tetraodon nigroviridis full-length cDNA 76 2e-10
303emb|CR711620.2|CNS0GC1C Tetraodon nigroviridis full-length cDNA 76 2e-10
304emb|CR727521.2|CNS0GOAV Tetraodon nigroviridis full-length cDNA 76 2e-10
305emb|CR726983.2|CNS0GNVX Tetraodon nigroviridis full-length cDNA 76 2e-10
306emb|CR726796.2|CNS0GNQQ Tetraodon nigroviridis full-length cDNA 76 2e-10
307emb|CR725824.2|CNS0GMZQ Tetraodon nigroviridis full-length cDNA 76 2e-10
308emb|CR720232.2|CNS0GIOE Tetraodon nigroviridis full-length cDNA 76 2e-10
309emb|CR722433.2|CNS0GKDJ Tetraodon nigroviridis full-length cDNA 76 2e-10
310emb|CR722392.2|CNS0GKCE Tetraodon nigroviridis full-length cDNA 76 2e-10
311emb|CR722116.2|CNS0GK4Q Tetraodon nigroviridis full-length cDNA 76 2e-10
312emb|CR721637.2|CNS0GJRF Tetraodon nigroviridis full-length cDNA 76 2e-10
313emb|CR721312.2|CNS0GJIE Tetraodon nigroviridis full-length cDNA 76 2e-10
314emb|CR721188.2|CNS0GJEY Tetraodon nigroviridis full-length cDNA 76 2e-10
315emb|CR720718.2|CNS0GJ1W Tetraodon nigroviridis full-length cDNA 76 2e-10
316emb|CR720567.2|CNS0GIXP Tetraodon nigroviridis full-length cDNA 76 2e-10
317emb|CR719847.2|CNS0GIDP Tetraodon nigroviridis full-length cDNA 76 2e-10
318emb|CR719243.2|CNS0GHWX Tetraodon nigroviridis full-length cDNA 76 2e-10
319emb|CR718316.2|CNS0GH76 Tetraodon nigroviridis full-length cDNA 76 2e-10
320emb|CR718135.2|CNS0GH25 Tetraodon nigroviridis full-length cDNA 76 2e-10
321emb|CR717477.2|CNS0GGJV Tetraodon nigroviridis full-length cDNA 76 2e-10
322emb|CR715776.2|CNS0GF8S Tetraodon nigroviridis full-length cDNA 76 2e-10
323emb|CR715242.2|CNS0GETY Tetraodon nigroviridis full-length cDNA 76 2e-10
324emb|CR715195.2|CNS0GESN Tetraodon nigroviridis full-length cDNA 76 2e-10
325emb|CR715164.2|CNS0GERS Tetraodon nigroviridis full-length cDNA 76 2e-10
326emb|CR714696.2|CNS0GEES Tetraodon nigroviridis full-length cDNA 76 2e-10
327emb|CR715056.2|CNS0GEOS Tetraodon nigroviridis full-length cDNA 76 2e-10
328emb|CR714229.2|CNS0GE1T Tetraodon nigroviridis full-length cDNA 76 2e-10
329emb|CR711212.2|CNS0GBQ0 Tetraodon nigroviridis full-length cDNA 76 2e-10
330emb|CR710469.2|CNS0GB5D Tetraodon nigroviridis full-length cDNA 76 2e-10
331emb|CR710441.2|CNS0GB4L Tetraodon nigroviridis full-length cDNA 76 2e-10
332emb|CR708703.2|CNS0G9SB Tetraodon nigroviridis full-length cDNA 76 2e-10
333emb|CR706045.2|CNS0G7QH Tetraodon nigroviridis full-length cDNA 76 2e-10
334emb|CR707022.2|CNS0G8HM Tetraodon nigroviridis full-length cDNA 76 2e-10
335emb|CR706847.2|CNS0G8CR Tetraodon nigroviridis full-length cDNA 76 2e-10
336emb|CR705350.2|CNS0G776 Tetraodon nigroviridis full-length cDNA 76 2e-10
337emb|CR704432.2|CNS0G6HO Tetraodon nigroviridis full-length cDNA 76 2e-10
338emb|CR704048.2|CNS0G670 Tetraodon nigroviridis full-length cDNA 76 2e-10
339emb|CR703564.2|CNS0G5TK Tetraodon nigroviridis full-length cDNA 76 2e-10
340emb|CR702233.2|CNS0G4SL Tetraodon nigroviridis full-length cDNA 76 2e-10
341emb|CR702106.2|CNS0G4P2 Tetraodon nigroviridis full-length cDNA 76 2e-10
342emb|CR701918.2|CNS0G4JU Tetraodon nigroviridis full-length cDNA 76 2e-10
343emb|CR700708.2|CNS0G3M8 Tetraodon nigroviridis full-length cDNA 76 2e-10
344emb|CR700561.2|CNS0G3I5 Tetraodon nigroviridis full-length cDNA 76 2e-10
345emb|CR699428.2|CNS0G2MO Tetraodon nigroviridis full-length cDNA 76 2e-10
346emb|CR698800.2|CNS0G258 Tetraodon nigroviridis full-length cDNA 76 2e-10
347emb|CR698346.2|CNS0G1SM Tetraodon nigroviridis full-length cDNA 76 2e-10
348emb|CR696508.2|CNS0G0DK Tetraodon nigroviridis full-length cDNA 76 2e-10
349emb|CR695411.2|CNS0FZJ3 Tetraodon nigroviridis full-length cDNA 76 2e-10
350emb|CR692115.2|CNS0FWZJ Tetraodon nigroviridis full-length cDNA 76 2e-10
351emb|CR694565.2|CNS0FYVL Tetraodon nigroviridis full-length cDNA 76 2e-10
352emb|CR694555.2|CNS0FYVB Tetraodon nigroviridis full-length cDNA 76 2e-10
353emb|CR694052.2|CNS0FYHC Tetraodon nigroviridis full-length cDNA 76 2e-10
354emb|CR693832.2|CNS0FYB8 Tetraodon nigroviridis full-length cDNA 76 2e-10
355emb|CR692464.2|CNS0FX98 Tetraodon nigroviridis full-length cDNA 76 2e-10
356emb|CR691897.2|CNS0FWTH Tetraodon nigroviridis full-length cDNA 76 2e-10
357emb|CR691534.2|CNS0FWJE Tetraodon nigroviridis full-length cDNA 76 2e-10
358emb|CR690540.2|CNS0FVRS Tetraodon nigroviridis full-length cDNA 76 2e-10
359emb|CR690344.2|CNS0FVMC Tetraodon nigroviridis full-length cDNA 76 2e-10
360emb|CR689850.2|CNS0FV8M Tetraodon nigroviridis full-length cDNA 76 2e-10
361emb|CR689811.2|CNS0FV7J Tetraodon nigroviridis full-length cDNA 76 2e-10
362emb|CR689596.2|CNS0FV1K Tetraodon nigroviridis full-length cDNA 76 2e-10
363emb|CR689465.2|CNS0FUXX Tetraodon nigroviridis full-length cDNA 76 2e-10
364emb|CR687759.2|CNS0FTMJ Tetraodon nigroviridis full-length cDNA 76 2e-10
365emb|CR687391.2|CNS0FTCB Tetraodon nigroviridis full-length cDNA 76 2e-10
366emb|CR687023.2|CNS0FT23 Tetraodon nigroviridis full-length cDNA 76 2e-10
367emb|CR686963.2|CNS0FT0F Tetraodon nigroviridis full-length cDNA 76 2e-10
368emb|CR686684.2|CNS0FSSO Tetraodon nigroviridis full-length cDNA 76 2e-10
369emb|CR686092.2|CNS0FSC8 Tetraodon nigroviridis full-length cDNA 76 2e-10
370emb|CR685313.2|CNS0FRQL Tetraodon nigroviridis full-length cDNA 76 2e-10
371emb|CR684285.2|CNS0FQY1 Tetraodon nigroviridis full-length cDNA 76 2e-10
372emb|CR683107.2|CNS0FQ1B Tetraodon nigroviridis full-length cDNA 76 2e-10
373emb|CR682579.2|CNS0FPMN Tetraodon nigroviridis full-length cDNA 76 2e-10
374emb|CR682549.2|CNS0FPLT Tetraodon nigroviridis full-length cDNA 76 2e-10
375emb|CR681674.2|CNS0FOXI Tetraodon nigroviridis full-length cDNA 76 2e-10
376emb|CR681638.2|CNS0FOWI Tetraodon nigroviridis full-length cDNA 76 2e-10
377emb|CR681193.2|CNS0FOK5 Tetraodon nigroviridis full-length cDNA 76 2e-10
378emb|CR680997.2|CNS0FOEP Tetraodon nigroviridis full-length cDNA 76 2e-10
379emb|CR680682.2|CNS0FO5Y Tetraodon nigroviridis full-length cDNA 76 2e-10
380emb|CR680395.2|CNS0FNXZ Tetraodon nigroviridis full-length cDNA 76 2e-10
381emb|CR680060.2|CNS0FNOO Tetraodon nigroviridis full-length cDNA 76 2e-10
382emb|CR679784.2|CNS0FNH0 Tetraodon nigroviridis full-length cDNA 76 2e-10
383emb|CR678797.2|CNS0FMPL Tetraodon nigroviridis full-length cDNA 76 2e-10
384emb|CR677559.2|CNS0FLRM Tetraodon nigroviridis full-length cDNA 76 2e-10
385emb|CR677792.2|CNS0FLY0 Tetraodon nigroviridis full-length cDNA 76 2e-10
386emb|CR677185.2|CNS0FLH9 Tetraodon nigroviridis full-length cDNA 76 2e-10
387emb|CR677130.2|CNS0FLFQ Tetraodon nigroviridis full-length cDNA 76 2e-10
388emb|CR677070.2|CNS0FLE2 Tetraodon nigroviridis full-length cDNA 76 2e-10
389emb|CR677024.2|CNS0FLCS Tetraodon nigroviridis full-length cDNA 76 2e-10
390emb|CR676925.2|CNS0FLA1 Tetraodon nigroviridis full-length cDNA 76 2e-10
391emb|CR676280.2|CNS0FKS4 Tetraodon nigroviridis full-length cDNA 76 2e-10
392emb|CR676187.2|CNS0FKPJ Tetraodon nigroviridis full-length cDNA 76 2e-10
393emb|CR675605.2|CNS0FK9N Tetraodon nigroviridis full-length cDNA 76 2e-10
394emb|CR675034.2|CNS0FJTS Tetraodon nigroviridis full-length cDNA 76 2e-10
395emb|CR674649.2|CNS0FJJ3 Tetraodon nigroviridis full-length cDNA 76 2e-10
396emb|CR674543.2|CNS0FJG5 Tetraodon nigroviridis full-length cDNA 76 2e-10
397emb|CR673916.2|CNS0FIYQ Tetraodon nigroviridis full-length cDNA 76 2e-10
398emb|CR673603.2|CNS0FIQ1 Tetraodon nigroviridis full-length cDNA 76 2e-10
399emb|CR673402.2|CNS0FIKG Tetraodon nigroviridis full-length cDNA 76 2e-10
400emb|CR673210.2|CNS0FIF4 Tetraodon nigroviridis full-length cDNA 76 2e-10
401emb|CR673124.2|CNS0FICQ Tetraodon nigroviridis full-length cDNA 76 2e-10
402emb|CR672745.2|CNS0FI27 Tetraodon nigroviridis full-length cDNA 76 2e-10
403emb|CR672880.2|CNS0FI5Y Tetraodon nigroviridis full-length cDNA 76 2e-10
404emb|CR672038.2|CNS0FHIK Tetraodon nigroviridis full-length cDNA 76 2e-10
405emb|CR672264.2|CNS0FHOU Tetraodon nigroviridis full-length cDNA 76 2e-10
406emb|CR672258.2|CNS0FHOO Tetraodon nigroviridis full-length cDNA 76 2e-10
407emb|CR670990.2|CNS0FGPG Tetraodon nigroviridis full-length cDNA 76 2e-10
408emb|CR671513.2|CNS0FH3Z Tetraodon nigroviridis full-length cDNA 76 2e-10
409emb|CR671510.2|CNS0FH3W Tetraodon nigroviridis full-length cDNA 76 2e-10
410emb|CR670923.2|CNS0FGNL Tetraodon nigroviridis full-length cDNA 76 2e-10
411emb|CR670774.2|CNS0FGJG Tetraodon nigroviridis full-length cDNA 76 2e-10
412emb|CR669917.2|CNS0FFVN Tetraodon nigroviridis full-length cDNA 76 2e-10
413emb|CR669841.2|CNS0FFTJ Tetraodon nigroviridis full-length cDNA 76 2e-10
414emb|CR669821.2|CNS0FFSZ Tetraodon nigroviridis full-length cDNA 76 2e-10
415emb|CR669034.2|CNS0FF74 Tetraodon nigroviridis full-length cDNA 76 2e-10
416emb|CR668930.2|CNS0FF48 Tetraodon nigroviridis full-length cDNA 76 2e-10
417emb|CR668839.2|CNS0FF1P Tetraodon nigroviridis full-length cDNA 76 2e-10
418emb|CR668791.2|CNS0FF0D Tetraodon nigroviridis full-length cDNA 76 2e-10
419emb|CR667932.2|CNS0FECI Tetraodon nigroviridis full-length cDNA 76 2e-10
420emb|CR667793.2|CNS0FE8N Tetraodon nigroviridis full-length cDNA 76 2e-10
421emb|CR666966.2|CNS0FDLO Tetraodon nigroviridis full-length cDNA 76 2e-10
422emb|CR666866.2|CNS0FDIW Tetraodon nigroviridis full-length cDNA 76 2e-10
423emb|CR665964.2|CNS0FCTU Tetraodon nigroviridis full-length cDNA 76 2e-10
424emb|CR665583.2|CNS0FCJ9 Tetraodon nigroviridis full-length cDNA 76 2e-10
425emb|CR665261.2|CNS0FCAB Tetraodon nigroviridis full-length cDNA 76 2e-10
426emb|CR665193.2|CNS0FC8F Tetraodon nigroviridis full-length cDNA 76 2e-10
427emb|CR664499.2|CNS0FBP5 Tetraodon nigroviridis full-length cDNA 76 2e-10
428emb|CR665083.2|CNS0FC5D Tetraodon nigroviridis full-length cDNA 76 2e-10
429emb|CR663297.2|CNS0FARR Tetraodon nigroviridis full-length cDNA 76 2e-10
430emb|CR663139.2|CNS0FAND Tetraodon nigroviridis full-length cDNA 76 2e-10
431emb|CR662470.2|CNS0FA4S Tetraodon nigroviridis full-length cDNA 76 2e-10
432emb|CR662455.2|CNS0FA4D Tetraodon nigroviridis full-length cDNA 76 2e-10
433emb|CR662423.2|CNS0FA3H Tetraodon nigroviridis full-length cDNA 76 2e-10
434emb|CR662356.2|CNS0FA1M Tetraodon nigroviridis full-length cDNA 76 2e-10
435emb|CR661579.2|CNS0F9G1 Tetraodon nigroviridis full-length cDNA 76 2e-10
436emb|CR661537.2|CNS0F9EV Tetraodon nigroviridis full-length cDNA 76 2e-10
437emb|CR661351.2|CNS0F99P Tetraodon nigroviridis full-length cDNA 76 2e-10
438emb|CR660973.2|CNS0F8Z7 Tetraodon nigroviridis full-length cDNA 76 2e-10
439emb|CR660416.2|CNS0F8JQ Tetraodon nigroviridis full-length cDNA 76 2e-10
440emb|CR660126.2|CNS0F8BO Tetraodon nigroviridis full-length cDNA 76 2e-10
441emb|CR659815.2|CNS0F831 Tetraodon nigroviridis full-length cDNA 76 2e-10
442emb|CR659136.2|CNS0F7K6 Tetraodon nigroviridis full-length cDNA 76 2e-10
443emb|CR659680.2|CNS0F7ZA Tetraodon nigroviridis full-length cDNA 76 2e-10
444emb|CR658586.2|CNS0F74W Tetraodon nigroviridis full-length cDNA 76 2e-10
445emb|CR656233.2|CNS0F5BJ Tetraodon nigroviridis full-length cDNA 76 2e-10
446emb|CR656034.2|CNS0F560 Tetraodon nigroviridis full-length cDNA 76 2e-10
447emb|CR655953.2|CNS0F53R Tetraodon nigroviridis full-length cDNA 76 2e-10
448emb|CR655949.2|CNS0F53N Tetraodon nigroviridis full-length cDNA 76 2e-10
449emb|CR655867.2|CNS0F51D Tetraodon nigroviridis full-length cDNA 76 2e-10
450emb|CR655796.2|CNS0F4ZE Tetraodon nigroviridis full-length cDNA 76 2e-10
451emb|CR653158.2|CNS0F2Y4 Tetraodon nigroviridis full-length cDNA 76 2e-10
452emb|CR654855.2|CNS0F499 Tetraodon nigroviridis full-length cDNA 76 2e-10
453emb|CR654468.2|CNS0F3YI Tetraodon nigroviridis full-length cDNA 76 2e-10
454emb|CR654443.2|CNS0F3XT Tetraodon nigroviridis full-length cDNA 76 2e-10
455emb|CR653862.2|CNS0F3HO Tetraodon nigroviridis full-length cDNA 76 2e-10
456emb|CR653737.2|CNS0F3E7 Tetraodon nigroviridis full-length cDNA 76 2e-10
457emb|CR652872.2|CNS0F2Q6 Tetraodon nigroviridis full-length cDNA 76 2e-10
458emb|CR652600.2|CNS0F2IM Tetraodon nigroviridis full-length cDNA 76 2e-10
459emb|CR652073.2|CNS0F23Z Tetraodon nigroviridis full-length cDNA 76 2e-10
460emb|CR651100.2|CNS0F1CY Tetraodon nigroviridis full-length cDNA 76 2e-10
461emb|CR650572.2|CNS0F0YA Tetraodon nigroviridis full-length cDNA 76 2e-10
462emb|CR650484.2|CNS0F0VU Tetraodon nigroviridis full-length cDNA 76 2e-10
463emb|CR649993.2|CNS0F0I7 Tetraodon nigroviridis full-length cDNA 76 2e-10
464emb|CR649974.2|CNS0F0HO Tetraodon nigroviridis full-length cDNA 76 2e-10
465emb|CR649237.2|CNS0EZX7 Tetraodon nigroviridis full-length cDNA 76 2e-10
466emb|CR649136.2|CNS0EZUE Tetraodon nigroviridis full-length cDNA 76 2e-10
467emb|CR649112.2|CNS0EZTQ Tetraodon nigroviridis full-length cDNA 76 2e-10
468emb|CR649034.2|CNS0EZRK Tetraodon nigroviridis full-length cDNA 76 2e-10
469emb|CR648683.2|CNS0EZHT Tetraodon nigroviridis full-length cDNA 76 2e-10
470emb|CR647693.2|CNS0EYQB Tetraodon nigroviridis full-length cDNA 76 2e-10
471emb|CR647625.2|CNS0EYOF Tetraodon nigroviridis full-length cDNA 76 2e-10
472emb|CR646960.2|CNS0EY5Y Tetraodon nigroviridis full-length cDNA 76 2e-10
473emb|CR646911.2|CNS0EY4L Tetraodon nigroviridis full-length cDNA 76 2e-10
474emb|CR646779.2|CNS0EY0X Tetraodon nigroviridis full-length cDNA 76 2e-10
475emb|CR643274.2|CNS0EVBK Tetraodon nigroviridis full-length cDNA 76 2e-10
476emb|CR643244.2|CNS0EVAQ Tetraodon nigroviridis full-length cDNA 76 2e-10
477emb|CR643083.2|CNS0EV69 Tetraodon nigroviridis full-length cDNA 76 2e-10
478emb|CR646238.2|CNS0EXLW Tetraodon nigroviridis full-length cDNA 76 2e-10
479emb|CR646098.2|CNS0EXI0 Tetraodon nigroviridis full-length cDNA 76 2e-10
480emb|CR645752.2|CNS0EX8E Tetraodon nigroviridis full-length cDNA 76 2e-10
481emb|CR645486.2|CNS0EX10 Tetraodon nigroviridis full-length cDNA 76 2e-10
482emb|CR644596.2|CNS0EWCA Tetraodon nigroviridis full-length cDNA 76 2e-10
483emb|CR644907.2|CNS0EWKX Tetraodon nigroviridis full-length cDNA 76 2e-10
484emb|CR644905.2|CNS0EWKV Tetraodon nigroviridis full-length cDNA 76 2e-10
485emb|CR644897.2|CNS0EWKN Tetraodon nigroviridis full-length cDNA 76 2e-10
486emb|CR644330.2|CNS0EW4W Tetraodon nigroviridis full-length cDNA 76 2e-10
487emb|CR644203.2|CNS0EW1D Tetraodon nigroviridis full-length cDNA 76 2e-10
488emb|CR644195.2|CNS0EW15 Tetraodon nigroviridis full-length cDNA 76 2e-10
489emb|CR643970.2|CNS0EVUW Tetraodon nigroviridis full-length cDNA 76 2e-10
490emb|CR643930.2|CNS0EVTS Tetraodon nigroviridis full-length cDNA 76 2e-10
491emb|CR642522.2|CNS0EUQO Tetraodon nigroviridis full-length cDNA 76 2e-10
492emb|CR642481.2|CNS0EUPJ Tetraodon nigroviridis full-length cDNA 76 2e-10
493emb|CR642139.2|CNS0EUG1 Tetraodon nigroviridis full-length cDNA 76 2e-10
494emb|CR642015.2|CNS0EUCL Tetraodon nigroviridis full-length cDNA 76 2e-10
495emb|CR641956.2|CNS0EUAY Tetraodon nigroviridis full-length cDNA 76 2e-10
496emb|CR641791.2|CNS0EU6D Tetraodon nigroviridis full-length cDNA 76 2e-10
497emb|CR641303.2|CNS0ETST Tetraodon nigroviridis full-length cDNA 76 2e-10
498emb|CR641228.2|CNS0ETQQ Tetraodon nigroviridis full-length cDNA 76 2e-10
499emb|CR641180.2|CNS0ETPE Tetraodon nigroviridis full-length cDNA 76 2e-10
500emb|CR641173.2|CNS0ETP7 Tetraodon nigroviridis full-length cDNA 76 2e-10

>gb|BT016516.1| Zea mays clone Contig349 mRNA sequence
          Length = 818

 Score =  537 bits (271), Expect = e-149
 Identities = 401/442 (90%), Gaps = 3/442 (0%)
 Strand = Plus / Minus

                                                                       
Query: 187 aacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgttgg 246
           ||||||| ||||||||||||||||| |||||||||||||||||||||||||| |||||||
Sbjct: 657 aacggttggccttggcaacacgctcaatctcgtccttcttcttgatggcgtagctgttgg 598

                                                                       
Query: 247 atgagcccttggcagcattgatcagctcatcagcaaggcactcagcaatggtcttgacat 306
           | |||||||||||||| ||||||| |||||| |||||||||||||||||||| ||||  |
Sbjct: 597 aagagcccttggcagcgttgatcaactcatctgcaaggcactcagcaatggttttgatgt 538

                                                                       
Query: 307 tacggaaagcgctctccctggcaccagtggtcagaaggtagatggcctggttcaccctcc 366
           | | ||||||||||||||||||||||||||| || ||||||||||||||||||||||| |
Sbjct: 537 tcctgaaagcgctctccctggcaccagtggtgaggaggtagatggcctggttcacccttc 478

                                                                       
Query: 367 tgaggggggagatatccacagcctgtctcctcacaacaccagctgacccaatacgggtag 426
           | ||||| ||||||||||||||||| || ||||||||||||||||| ||||||||||| |
Sbjct: 477 tcaggggtgagatatccacagcctgccttctcacaacaccagctgaaccaatacgggtgg 418

                                                                       
Query: 427 catcctcacgtggcccactgttgatgatggcgtcgacgatgatctggatggggttggccg 486
           ||||||||||||| ||||||||||| |||||||| ||||  | ||||||||| |||| ||
Sbjct: 417 catcctcacgtggtccactgttgataatggcgtccacgaccacctggatgggattgg-cg 359

                                                                       
Query: 487 tcggtgaggaggtggatgatctccatggtgtgcttgatgatgcggacggccatgatcttc 546
           || ||||| |||||||||||||||| ||||||||| ||||||||||||||||||| ||||
Sbjct: 358 tcagtgagcaggtggatgatctccagggtgtgcttcatgatgcggacggccatgaccttc 299

                                                                       
Query: 547 tttgcccgttgttgcgcccgtgcatcatgagggagttggtgaggcgctcgatgatggggc 606
           ||   |||||||||||||||||||||||||| ||||||||||||||||||| ||||| ||
Sbjct: 298 tt--gccgttgttgcgcccgtgcatcatgagcgagttggtgaggcgctcgacgatggcgc 241

                                 
Query: 607 actgcgccttgcggaagcgctt 628
           |||||||||||||||| |||||
Sbjct: 240 actgcgccttgcggaaccgctt 219



to top

>dbj|AK103918.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-013-A08, full
           insert sequence
          Length = 884

 Score =  531 bits (268), Expect = e-147
 Identities = 407/451 (90%), Gaps = 3/451 (0%)
 Strand = Plus / Minus

                                                                       
Query: 187 aacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgttgg 246
           ||||||| ||||||||||||||||||||||| ||||||||||||||||| || |||||||
Sbjct: 707 aacggttggccttggcaacacgctcgatctcatccttcttcttgatggcatagctgttgg 648

                                                                       
Query: 247 atgagcccttggcagcattgatcagctcatcagcaaggcactcagcaatggtcttgacat 306
           ||||||||||||| ||||| || ||||| ||||||||||||||||||||||||||||  |
Sbjct: 647 atgagcccttggcggcattaataagctcgtcagcaaggcactcagcaatggtcttgatgt 588

                                                                       
Query: 307 tacggaaagcgctctccctggcaccagtggtcagaaggtagatggcctggttcaccctcc 366
           | | ||| ||||||||||||||||||||||| || |||||||| |||||||| |||||||
Sbjct: 587 tcctgaaggcgctctccctggcaccagtggtgaggaggtagattgcctggttgaccctcc 528

                                                                       
Query: 367 tgaggggggagatatccacagcctgtctcctcacaacaccagctgacccaatacgggtag 426
           | | ||| ||||||||||||||||| ||||||||| |||| || |||||||||||||| |
Sbjct: 527 tcaagggagagatatccacagcctgcctcctcacagcacccgcagacccaatacgggtcg 468

                                                                       
Query: 427 catcctcacgtggcccactgttgatgatggcgtcgacgatgatctggatggggttggccg 486
           |||||||||| || |||||||||||||||||||||||||||| ||| |||||||||| ||
Sbjct: 467 catcctcacgagggccactgttgatgatggcgtcgacgatgacctgaatggggttgg-cg 409

                                                                       
Query: 487 tcggtgaggaggtggatgatctccatggtgtgcttgatgatgcggacggccatgatcttc 546
           |||||||||||||||||||||||||||| |||||||| |||||| |||||||||||||||
Sbjct: 408 tcggtgaggaggtggatgatctccatggcgtgcttgacgatgcgcacggccatgatcttc 349

                                                                       
Query: 547 tttgcccgttgttgcgcccgtgcatcatgagggagttggtgaggcgctcgatgatggggc 606
           ||  |||||||||||| |||||||||||||| |||||||| |||||||| | ||||||||
Sbjct: 348 tt--cccgttgttgcggccgtgcatcatgagcgagttggtcaggcgctccacgatggggc 291

                                          
Query: 607 actgcgccttgcggaagcgcttggccgagta 637
           |||||||||| ||||| | ||| ||||||||
Sbjct: 290 actgcgccttccggaacctcttcgccgagta 260



to top

>dbj|AK059823.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-205-E03, full
           insert sequence
          Length = 1022

 Score =  531 bits (268), Expect = e-147
 Identities = 407/451 (90%), Gaps = 3/451 (0%)
 Strand = Plus / Minus

                                                                       
Query: 187 aacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgttgg 246
           ||||||| ||||||||||||||||||||||| ||||||||||||||||| || |||||||
Sbjct: 819 aacggttggccttggcaacacgctcgatctcatccttcttcttgatggcatagctgttgg 760

                                                                       
Query: 247 atgagcccttggcagcattgatcagctcatcagcaaggcactcagcaatggtcttgacat 306
           ||||||||||||| ||||| || ||||| ||||||||||||||||||||||||||||  |
Sbjct: 759 atgagcccttggcggcattaataagctcgtcagcaaggcactcagcaatggtcttgatgt 700

                                                                       
Query: 307 tacggaaagcgctctccctggcaccagtggtcagaaggtagatggcctggttcaccctcc 366
           | | ||| ||||||||||||||||||||||| || |||||||| |||||||| |||||||
Sbjct: 699 tcctgaaggcgctctccctggcaccagtggtgaggaggtagattgcctggttgaccctcc 640

                                                                       
Query: 367 tgaggggggagatatccacagcctgtctcctcacaacaccagctgacccaatacgggtag 426
           | | ||| ||||||||||||||||| ||||||||| |||| || |||||||||||||| |
Sbjct: 639 tcaagggagagatatccacagcctgcctcctcacagcacccgcagacccaatacgggtcg 580

                                                                       
Query: 427 catcctcacgtggcccactgttgatgatggcgtcgacgatgatctggatggggttggccg 486
           |||||||||| || |||||||||||||||||||||||||||| ||| |||||||||| ||
Sbjct: 579 catcctcacgagggccactgttgatgatggcgtcgacgatgacctgaatggggttgg-cg 521

                                                                       
Query: 487 tcggtgaggaggtggatgatctccatggtgtgcttgatgatgcggacggccatgatcttc 546
           |||||||||||||||||||||||||||| |||||||| |||||| |||||||||||||||
Sbjct: 520 tcggtgaggaggtggatgatctccatggcgtgcttgacgatgcgcacggccatgatcttc 461

                                                                       
Query: 547 tttgcccgttgttgcgcccgtgcatcatgagggagttggtgaggcgctcgatgatggggc 606
           ||  |||||||||||| |||||||||||||| |||||||| |||||||| | ||||||||
Sbjct: 460 tt--cccgttgttgcggccgtgcatcatgagcgagttggtcaggcgctccacgatggggc 403

                                          
Query: 607 actgcgccttgcggaagcgcttggccgagta 637
           |||||||||| ||||| | ||| ||||||||
Sbjct: 402 actgcgccttccggaacctcttcgccgagta 372



to top

>dbj|AK059558.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-029-G10, full
           insert sequence
          Length = 1012

 Score =  531 bits (268), Expect = e-147
 Identities = 407/451 (90%), Gaps = 3/451 (0%)
 Strand = Plus / Minus

                                                                       
Query: 187 aacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgttgg 246
           ||||||| ||||||||||||||||||||||| ||||||||||||||||| || |||||||
Sbjct: 703 aacggttggccttggcaacacgctcgatctcatccttcttcttgatggcatagctgttgg 644

                                                                       
Query: 247 atgagcccttggcagcattgatcagctcatcagcaaggcactcagcaatggtcttgacat 306
           ||||||||||||| ||||| || ||||| ||||||||||||||||||||||||||||  |
Sbjct: 643 atgagcccttggcggcattaataagctcgtcagcaaggcactcagcaatggtcttgatgt 584

                                                                       
Query: 307 tacggaaagcgctctccctggcaccagtggtcagaaggtagatggcctggttcaccctcc 366
           | | ||| ||||||||||||||||||||||| || |||||||| |||||||| |||||||
Sbjct: 583 tcctgaaggcgctctccctggcaccagtggtgaggaggtagattgcctggttgaccctcc 524

                                                                       
Query: 367 tgaggggggagatatccacagcctgtctcctcacaacaccagctgacccaatacgggtag 426
           | | ||| ||||||||||||||||| ||||||||| |||| || |||||||||||||| |
Sbjct: 523 tcaagggagagatatccacagcctgcctcctcacagcacccgcagacccaatacgggtcg 464

                                                                       
Query: 427 catcctcacgtggcccactgttgatgatggcgtcgacgatgatctggatggggttggccg 486
           |||||||||| || |||||||||||||||||||||||||||| ||| |||||||||| ||
Sbjct: 463 catcctcacgagggccactgttgatgatggcgtcgacgatgacctgaatggggttgg-cg 405

                                                                       
Query: 487 tcggtgaggaggtggatgatctccatggtgtgcttgatgatgcggacggccatgatcttc 546
           |||||||||||||||||||||||||||| |||||||| |||||| |||||||||||||||
Sbjct: 404 tcggtgaggaggtggatgatctccatggcgtgcttgacgatgcgcacggccatgatcttc 345

                                                                       
Query: 547 tttgcccgttgttgcgcccgtgcatcatgagggagttggtgaggcgctcgatgatggggc 606
           ||  |||||||||||| |||||||||||||| |||||||| |||||||| | ||||||||
Sbjct: 344 tt--cccgttgttgcggccgtgcatcatgagcgagttggtcaggcgctccacgatggggc 287

                                          
Query: 607 actgcgccttgcggaagcgcttggccgagta 637
           |||||||||| ||||| | ||| ||||||||
Sbjct: 286 actgcgccttccggaacctcttcgccgagta 256



to top

>gb|BT016445.1| Zea mays clone Contig278 mRNA sequence
          Length = 1018

 Score =  529 bits (267), Expect = e-147
 Identities = 400/442 (90%), Gaps = 3/442 (0%)
 Strand = Plus / Minus

                                                                       
Query: 187 aacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgttgg 246
           ||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||
Sbjct: 699 aacggttggccttggcaacacgctcaatctcgtccttcttcttgatggcgtaactgttgg 640

                                                                       
Query: 247 atgagcccttggcagcattgatcagctcatcagcaaggcactcagcaatggtcttgacat 306
           |||||||||||||||| |||||||||||||| ||||||||||| |||||||| ||||  |
Sbjct: 639 atgagcccttggcagcgttgatcagctcatctgcaaggcactcggcaatggttttgatgt 580

                                                                       
Query: 307 tacggaaagcgctctccctggcaccagtggtcagaaggtagatggcctggttcaccctcc 366
           | |||||||| |||||||||||||||||||| || |||||||||||||||||||||||||
Sbjct: 579 tccggaaagcactctccctggcaccagtggtgaggaggtagatggcctggttcaccctcc 520

                                                                       
Query: 367 tgaggggggagatatccacagcctgtctcctcacaacaccagctgacccaatacgggtag 426
           | ||||| ||||||||||| ||||| || |||||||||||||| || ||||||||||| |
Sbjct: 519 tcaggggtgagatatccacggcctgccttctcacaacaccagcggaaccaatacgggtgg 460

                                                                       
Query: 427 catcctcacgtggcccactgttgatgatggcgtcgacgatgatctggatggggttggccg 486
           |||||||||| || |||||||||||||| |||||||||| || |||||||||||||| | 
Sbjct: 459 catcctcacgggggccactgttgatgatcgcgtcgacgacgacctggatggggttgg-ca 401

                                                                       
Query: 487 tcggtgaggaggtggatgatctccatggtgtgcttgatgatgcggacggccatgatcttc 546
           |||||||| ||||| |||||||||| ||| ||||||||||||||||| ||||||| ||||
Sbjct: 400 tcggtgagcaggtgaatgatctccagggtatgcttgatgatgcggacagccatgaccttc 341

                                                                       
Query: 547 tttgcccgttgttgcgcccgtgcatcatgagggagttggtgaggcgctcgatgatggggc 606
           ||   |||||||||||||||||||||||||||||||| || |||||||| | ||| ||||
Sbjct: 340 tt--gccgttgttgcgcccgtgcatcatgagggagtttgtaaggcgctcaacgatcgggc 283

                                 
Query: 607 actgcgccttgcggaagcgctt 628
           |||||||||||||||| |||||
Sbjct: 282 actgcgccttgcggaaccgctt 261



to top

>gb|AY103625.1| Zea mays PCO091587 mRNA sequence
          Length = 1085

 Score =  529 bits (267), Expect = e-147
 Identities = 400/442 (90%), Gaps = 3/442 (0%)
 Strand = Plus / Minus

                                                                       
Query: 187 aacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgttgg 246
           ||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||
Sbjct: 750 aacggttggccttggcaacacgctcaatctcgtccttcttcttgatggcgtaactgttgg 691

                                                                       
Query: 247 atgagcccttggcagcattgatcagctcatcagcaaggcactcagcaatggtcttgacat 306
           |||||||||||||||| |||||||||||||| ||||||||||| |||||||| ||||  |
Sbjct: 690 atgagcccttggcagcgttgatcagctcatctgcaaggcactcggcaatggttttgatgt 631

                                                                       
Query: 307 tacggaaagcgctctccctggcaccagtggtcagaaggtagatggcctggttcaccctcc 366
           | |||||||| |||||||||||||||||||| || |||||||||||||||||||||||||
Sbjct: 630 tccggaaagcactctccctggcaccagtggtgaggaggtagatggcctggttcaccctcc 571

                                                                       
Query: 367 tgaggggggagatatccacagcctgtctcctcacaacaccagctgacccaatacgggtag 426
           | ||||| ||||||||||| ||||| || |||||||||||||| || ||||||||||| |
Sbjct: 570 tcaggggtgagatatccacggcctgccttctcacaacaccagcggaaccaatacgggtgg 511

                                                                       
Query: 427 catcctcacgtggcccactgttgatgatggcgtcgacgatgatctggatggggttggccg 486
           |||||||||| || |||||||||||||| |||||||||| || |||||||||||||| | 
Sbjct: 510 catcctcacgggggccactgttgatgatcgcgtcgacgacgacctggatggggttgg-ca 452

                                                                       
Query: 487 tcggtgaggaggtggatgatctccatggtgtgcttgatgatgcggacggccatgatcttc 546
           |||||||| ||||| |||||||||| ||| ||||||||||||||||| ||||||| ||||
Sbjct: 451 tcggtgagcaggtgaatgatctccagggtatgcttgatgatgcggacagccatgaccttc 392

                                                                       
Query: 547 tttgcccgttgttgcgcccgtgcatcatgagggagttggtgaggcgctcgatgatggggc 606
           ||   |||||||||||||||||||||||||||||||| || |||||||| | ||| ||||
Sbjct: 391 tt--gccgttgttgcgcccgtgcatcatgagggagtttgtaaggcgctcaacgatcgggc 334

                                 
Query: 607 actgcgccttgcggaagcgctt 628
           |||||||||||||||| |||||
Sbjct: 333 actgcgccttgcggaaccgctt 312



to top

>ref|NM_183433.2| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 864

 Score =  505 bits (255), Expect = e-140
 Identities = 406/454 (89%), Gaps = 3/454 (0%)
 Strand = Plus / Minus

                                                                       
Query: 187 aacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgttgg 246
           ||||||| ||||||||||||||||| ||||| ||||||||||||||||| || |||||||
Sbjct: 679 aacggttcgccttggcaacacgctcaatctcatccttcttcttgatggcatagctgttgg 620

                                                                       
Query: 247 atgagcccttggcagcattgatcagctcatcagcaaggcactcagcaatggtcttgacat 306
           ||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||  |
Sbjct: 619 atgagcccttggcggcattgatgagctcatcagcaaggcactcagcaatggtcttgatgt 560

                                                                       
Query: 307 tacggaaagcgctctccctggcaccagtggtcagaaggtagatggcctggttcaccctcc 366
           | |  || || ||||||||||| |||||||| || |||||||| |||||||| |||||||
Sbjct: 559 tcctaaaggcactctccctggcgccagtggtgaggaggtagattgcctggttgaccctcc 500

                                                                       
Query: 367 tgaggggggagatatccacagcctgtctcctcacaacaccagctgacccaatacgggtag 426
           | | ||| ||||||||||||||||| ||||||||| | ||||| || || |||||||| |
Sbjct: 499 tcaagggagagatatccacagcctgcctcctcacagcgccagcagagccgatacgggttg 440

                                                                       
Query: 427 catcctcacgtggcccactgttgatgatggcgtcgacgatgatctggatggggttggccg 486
           | |||||||| || || |||||||||||||| || ||||||| |||||||||||||| ||
Sbjct: 439 cgtcctcacgcgggccgctgttgatgatggcatctacgatgacctggatggggttgg-cg 381

                                                                       
Query: 487 tcggtgaggaggtggatgatctccatggtgtgcttgatgatgcggacggccatgatcttc 546
           |||||||||||||||||||||||||||| |||||||| ||||||||| ||||||||||||
Sbjct: 380 tcggtgaggaggtggatgatctccatggcgtgcttgacgatgcggacagccatgatcttc 321

                                                                       
Query: 547 tttgcccgttgttgcgcccgtgcatcatgagggagttggtgaggcgctcgatgatggggc 606
           ||   ||||||||||| |||||||||||||||||||||||||||||||| | || |||||
Sbjct: 320 tt--gccgttgttgcggccgtgcatcatgagggagttggtgaggcgctccacgagggggc 263

                                             
Query: 607 actgcgccttgcggaagcgcttggccgagtagcg 640
           |||||||||||||||||||||| |||||||||||
Sbjct: 262 actgcgccttgcggaagcgcttcgccgagtagcg 229



to top

>dbj|AK121523.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033028P14, full
           insert sequence
          Length = 916

 Score =  505 bits (255), Expect = e-140
 Identities = 406/454 (89%), Gaps = 3/454 (0%)
 Strand = Plus / Minus

                                                                       
Query: 187 aacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgttgg 246
           ||||||| ||||||||||||||||| ||||| ||||||||||||||||| || |||||||
Sbjct: 689 aacggttcgccttggcaacacgctcaatctcatccttcttcttgatggcatagctgttgg 630

                                                                       
Query: 247 atgagcccttggcagcattgatcagctcatcagcaaggcactcagcaatggtcttgacat 306
           ||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||  |
Sbjct: 629 atgagcccttggcggcattgatgagctcatcagcaaggcactcagcaatggtcttgatgt 570

                                                                       
Query: 307 tacggaaagcgctctccctggcaccagtggtcagaaggtagatggcctggttcaccctcc 366
           | |  || || ||||||||||| |||||||| || |||||||| |||||||| |||||||
Sbjct: 569 tcctaaaggcactctccctggcgccagtggtgaggaggtagattgcctggttgaccctcc 510

                                                                       
Query: 367 tgaggggggagatatccacagcctgtctcctcacaacaccagctgacccaatacgggtag 426
           | | ||| ||||||||||||||||| ||||||||| | ||||| || || |||||||| |
Sbjct: 509 tcaagggagagatatccacagcctgcctcctcacagcgccagcagagccgatacgggttg 450

                                                                       
Query: 427 catcctcacgtggcccactgttgatgatggcgtcgacgatgatctggatggggttggccg 486
           | |||||||| || || |||||||||||||| || ||||||| |||||||||||||| ||
Sbjct: 449 cgtcctcacgcgggccgctgttgatgatggcatctacgatgacctggatggggttgg-cg 391

                                                                       
Query: 487 tcggtgaggaggtggatgatctccatggtgtgcttgatgatgcggacggccatgatcttc 546
           |||||||||||||||||||||||||||| |||||||| ||||||||| ||||||||||||
Sbjct: 390 tcggtgaggaggtggatgatctccatggcgtgcttgacgatgcggacagccatgatcttc 331

                                                                       
Query: 547 tttgcccgttgttgcgcccgtgcatcatgagggagttggtgaggcgctcgatgatggggc 606
           ||   ||||||||||| |||||||||||||||||||||||||||||||| | || |||||
Sbjct: 330 tt--gccgttgttgcggccgtgcatcatgagggagttggtgaggcgctccacgagggggc 273

                                             
Query: 607 actgcgccttgcggaagcgcttggccgagtagcg 640
           |||||||||||||||||||||| |||||||||||
Sbjct: 272 actgcgccttgcggaagcgcttcgccgagtagcg 239



to top

>dbj|AK059844.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-206-E02, full
           insert sequence
          Length = 864

 Score =  505 bits (255), Expect = e-140
 Identities = 406/454 (89%), Gaps = 3/454 (0%)
 Strand = Plus / Minus

                                                                       
Query: 187 aacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgttgg 246
           ||||||| ||||||||||||||||| ||||| ||||||||||||||||| || |||||||
Sbjct: 679 aacggttcgccttggcaacacgctcaatctcatccttcttcttgatggcatagctgttgg 620

                                                                       
Query: 247 atgagcccttggcagcattgatcagctcatcagcaaggcactcagcaatggtcttgacat 306
           ||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||  |
Sbjct: 619 atgagcccttggcggcattgatgagctcatcagcaaggcactcagcaatggtcttgatgt 560

                                                                       
Query: 307 tacggaaagcgctctccctggcaccagtggtcagaaggtagatggcctggttcaccctcc 366
           | |  || || ||||||||||| |||||||| || |||||||| |||||||| |||||||
Sbjct: 559 tcctaaaggcactctccctggcgccagtggtgaggaggtagattgcctggttgaccctcc 500

                                                                       
Query: 367 tgaggggggagatatccacagcctgtctcctcacaacaccagctgacccaatacgggtag 426
           | | ||| ||||||||||||||||| ||||||||| | ||||| || || |||||||| |
Sbjct: 499 tcaagggagagatatccacagcctgcctcctcacagcgccagcagagccgatacgggttg 440

                                                                       
Query: 427 catcctcacgtggcccactgttgatgatggcgtcgacgatgatctggatggggttggccg 486
           | |||||||| || || |||||||||||||| || ||||||| |||||||||||||| ||
Sbjct: 439 cgtcctcacgcgggccgctgttgatgatggcatctacgatgacctggatggggttgg-cg 381

                                                                       
Query: 487 tcggtgaggaggtggatgatctccatggtgtgcttgatgatgcggacggccatgatcttc 546
           |||||||||||||||||||||||||||| |||||||| ||||||||| ||||||||||||
Sbjct: 380 tcggtgaggaggtggatgatctccatggcgtgcttgacgatgcggacagccatgatcttc 321

                                                                       
Query: 547 tttgcccgttgttgcgcccgtgcatcatgagggagttggtgaggcgctcgatgatggggc 606
           ||   ||||||||||| |||||||||||||||||||||||||||||||| | || |||||
Sbjct: 320 tt--gccgttgttgcggccgtgcatcatgagggagttggtgaggcgctccacgagggggc 263

                                             
Query: 607 actgcgccttgcggaagcgcttggccgagtagcg 640
           |||||||||||||||||||||| |||||||||||
Sbjct: 262 actgcgccttgcggaagcgcttcgccgagtagcg 229



to top

>gb|BT016589.1| Zea mays clone Contig422 mRNA sequence
          Length = 899

 Score =  498 bits (251), Expect = e-137
 Identities = 390/434 (89%), Gaps = 3/434 (0%)
 Strand = Plus / Minus

                                                                       
Query: 195 gccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgttggatgagccc 254
           ||||||| ||||||||| ||||||||||| ||||||||||||||||||||||||||||||
Sbjct: 676 gccttggaaacacgctcaatctcgtcctttttcttgatggcgtaactgttggatgagccc 617

                                                                       
Query: 255 ttggcagcattgatcagctcatcagcaaggcactcagcaatggtcttgacattacggaaa 314
           |||||||| |||||||||||||| ||||||||||| |||||||| ||||  ||  |||||
Sbjct: 616 ttggcagcgttgatcagctcatctgcaaggcactcggcaatggttttgatgttcaggaaa 557

                                                                       
Query: 315 gcgctctccctggcaccagtggtcagaaggtagatggcctggttcaccctcctgaggggg 374
           || |||||||||||||||||||| || |||||||||||||||||||||||||| ||||| 
Sbjct: 556 gcactctccctggcaccagtggtgaggaggtagatggcctggttcaccctcctcaggggt 497

                                                                       
Query: 375 gagatatccacagcctgtctcctcacaacaccagctgacccaatacgggtagcatcctca 434
           ||||||||||| ||||| || |||||||||||||| || ||||||||||| |||||||||
Sbjct: 496 gagatatccacggcctgccttctcacaacaccagcggaaccaatacgggtggcatcctca 437

                                                                       
Query: 435 cgtggcccactgttgatgatggcgtcgacgatgatctggatggggttggccgtcggtgag 494
           || || |||||||||||||| |||||||||| || |||||||||||||| | ||||||||
Sbjct: 436 cgggggccactgttgatgatcgcgtcgacgacgacctggatggggttgg-catcggtgag 378

                                                                       
Query: 495 gaggtggatgatctccatggtgtgcttgatgatgcggacggccatgatcttctttgcccg 554
            ||||| |||||||||| ||| ||||||||||||||||| ||||||| ||||||   |||
Sbjct: 377 caggtgaatgatctccagggtatgcttgatgatgcggacagccatgaccttctt--gccg 320

                                                                       
Query: 555 ttgttgcgcccgtgcatcatgagggagttggtgaggcgctcgatgatggggcactgcgcc 614
           ||||||||||||||||||||||||||||| || |||||||| | ||| ||||||||||||
Sbjct: 319 ttgttgcgcccgtgcatcatgagggagtttgtaaggcgctcaacgatcgggcactgcgcc 260

                         
Query: 615 ttgcggaagcgctt 628
           |||||||| |||||
Sbjct: 259 ttgcggaaccgctt 246



to top

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1,
             complete sequence
          Length = 43261740

 Score =  258 bits (130), Expect = 2e-65
 Identities = 182/197 (92%), Gaps = 3/197 (1%)
 Strand = Plus / Minus

                                                                         
Query: 444   ctgttgatgatggcgtcgacgatgatctggatggggttggccgtcggtgaggaggtggat 503
             |||||||||||||| || ||||||| ||||||||||||||| ||||||||||||||||||
Sbjct: 26641 ctgttgatgatggcatctacgatgacctggatggggttggc-gtcggtgaggaggtggat 26583

                                                                         
Query: 504   gatctccatggtgtgcttgatgatgcggacggccatgatcttctttgcccgttgttgcgc 563
             ||||||||||| |||||||| ||||||||| ||||||||||||||   ||||||||||| 
Sbjct: 26582 gatctccatggcgtgcttgacgatgcggacagccatgatcttcttg--ccgttgttgcgg 26525

                                                                         
Query: 564   ccgtgcatcatgagggagttggtgaggcgctcgatgatggggcactgcgccttgcggaag 623
             |||||||||||||||||||||||||||||||| | || ||||||||||||||||||||||
Sbjct: 26524 ccgtgcatcatgagggagttggtgaggcgctccacgagggggcactgcgccttgcggaag 26465

                              
Query: 624   cgcttggccgagtagcg 640
             ||||| |||||||||||
Sbjct: 26464 cgcttcgccgagtagcg 26448



 Score =  192 bits (97), Expect = 1e-45
 Identities = 172/197 (87%)
 Strand = Plus / Minus

                                                                         
Query: 240   ctgttggatgagcccttggcagcattgatcagctcatcagcaaggcactcagcaatggtc 299
             |||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||
Sbjct: 27293 ctgttggatgagcccttggcggcattgatgagctcatcagcaaggcactcagcaatggtc 27234

                                                                         
Query: 300   ttgacattacggaaagcgctctccctggcaccagtggtcagaaggtagatggcctggttc 359
             ||||  || |  || || ||||||||||| |||||||| || |||||||| |||||||| 
Sbjct: 27233 ttgatgttcctaaaggcactctccctggcgccagtggtgaggaggtagattgcctggttg 27174

                                                                         
Query: 360   accctcctgaggggggagatatccacagcctgtctcctcacaacaccagctgacccaata 419
             |||||||| | ||| ||||||||||||||||| ||||||||| | ||||| || || |||
Sbjct: 27173 accctcctcaagggagagatatccacagcctgcctcctcacagcgccagcagagccgata 27114

                              
Query: 420   cgggtagcatcctcacg 436
             ||||| || ||||||||
Sbjct: 27113 cgggttgcgtcctcacg 27097



 Score = 73.8 bits (37), Expect = 7e-10
 Identities = 46/49 (93%)
 Strand = Plus / Minus

                                                              
Query: 187   aacggttagccttggcaacacgctcgatctcgtccttcttcttgatggc 235
             ||||||| ||||||||||||||||| ||||| |||||||||||||||||
Sbjct: 27417 aacggttcgccttggcaacacgctcaatctcatccttcttcttgatggc 27369



to top

>dbj|AP003727.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0672D08
          Length = 173729

 Score =  258 bits (130), Expect = 2e-65
 Identities = 182/197 (92%), Gaps = 3/197 (1%)
 Strand = Plus / Minus

                                                                         
Query: 444   ctgttgatgatggcgtcgacgatgatctggatggggttggccgtcggtgaggaggtggat 503
             |||||||||||||| || ||||||| ||||||||||||||| ||||||||||||||||||
Sbjct: 24443 ctgttgatgatggcatctacgatgacctggatggggttggc-gtcggtgaggaggtggat 24385

                                                                         
Query: 504   gatctccatggtgtgcttgatgatgcggacggccatgatcttctttgcccgttgttgcgc 563
             ||||||||||| |||||||| ||||||||| ||||||||||||||   ||||||||||| 
Sbjct: 24384 gatctccatggcgtgcttgacgatgcggacagccatgatcttcttg--ccgttgttgcgg 24327

                                                                         
Query: 564   ccgtgcatcatgagggagttggtgaggcgctcgatgatggggcactgcgccttgcggaag 623
             |||||||||||||||||||||||||||||||| | || ||||||||||||||||||||||
Sbjct: 24326 ccgtgcatcatgagggagttggtgaggcgctccacgagggggcactgcgccttgcggaag 24267

                              
Query: 624   cgcttggccgagtagcg 640
             ||||| |||||||||||
Sbjct: 24266 cgcttcgccgagtagcg 24250



 Score =  192 bits (97), Expect = 1e-45
 Identities = 172/197 (87%)
 Strand = Plus / Minus

                                                                         
Query: 240   ctgttggatgagcccttggcagcattgatcagctcatcagcaaggcactcagcaatggtc 299
             |||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||
Sbjct: 25095 ctgttggatgagcccttggcggcattgatgagctcatcagcaaggcactcagcaatggtc 25036

                                                                         
Query: 300   ttgacattacggaaagcgctctccctggcaccagtggtcagaaggtagatggcctggttc 359
             ||||  || |  || || ||||||||||| |||||||| || |||||||| |||||||| 
Sbjct: 25035 ttgatgttcctaaaggcactctccctggcgccagtggtgaggaggtagattgcctggttg 24976

                                                                         
Query: 360   accctcctgaggggggagatatccacagcctgtctcctcacaacaccagctgacccaata 419
             |||||||| | ||| ||||||||||||||||| ||||||||| | ||||| || || |||
Sbjct: 24975 accctcctcaagggagagatatccacagcctgcctcctcacagcgccagcagagccgata 24916

                              
Query: 420   cgggtagcatcctcacg 436
             ||||| || ||||||||
Sbjct: 24915 cgggttgcgtcctcacg 24899



 Score = 73.8 bits (37), Expect = 7e-10
 Identities = 46/49 (93%)
 Strand = Plus / Minus

                                                              
Query: 187   aacggttagccttggcaacacgctcgatctcgtccttcttcttgatggc 235
             ||||||| ||||||||||||||||| ||||| |||||||||||||||||
Sbjct: 25219 aacggttcgccttggcaacacgctcaatctcatccttcttcttgatggc 25171



to top

>dbj|AP008219.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1,
             fosmid clone:OSJNOa264G09
          Length = 31687

 Score =  258 bits (130), Expect = 2e-65
 Identities = 182/197 (92%), Gaps = 3/197 (1%)
 Strand = Plus / Minus

                                                                         
Query: 444   ctgttgatgatggcgtcgacgatgatctggatggggttggccgtcggtgaggaggtggat 503
             |||||||||||||| || ||||||| ||||||||||||||| ||||||||||||||||||
Sbjct: 26641 ctgttgatgatggcatctacgatgacctggatggggttggc-gtcggtgaggaggtggat 26583

                                                                         
Query: 504   gatctccatggtgtgcttgatgatgcggacggccatgatcttctttgcccgttgttgcgc 563
             ||||||||||| |||||||| ||||||||| ||||||||||||||   ||||||||||| 
Sbjct: 26582 gatctccatggcgtgcttgacgatgcggacagccatgatcttcttg--ccgttgttgcgg 26525

                                                                         
Query: 564   ccgtgcatcatgagggagttggtgaggcgctcgatgatggggcactgcgccttgcggaag 623
             |||||||||||||||||||||||||||||||| | || ||||||||||||||||||||||
Sbjct: 26524 ccgtgcatcatgagggagttggtgaggcgctccacgagggggcactgcgccttgcggaag 26465

                              
Query: 624   cgcttggccgagtagcg 640
             ||||| |||||||||||
Sbjct: 26464 cgcttcgccgagtagcg 26448



 Score =  192 bits (97), Expect = 1e-45
 Identities = 172/197 (87%)
 Strand = Plus / Minus

                                                                         
Query: 240   ctgttggatgagcccttggcagcattgatcagctcatcagcaaggcactcagcaatggtc 299
             |||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||
Sbjct: 27293 ctgttggatgagcccttggcggcattgatgagctcatcagcaaggcactcagcaatggtc 27234

                                                                         
Query: 300   ttgacattacggaaagcgctctccctggcaccagtggtcagaaggtagatggcctggttc 359
             ||||  || |  || || ||||||||||| |||||||| || |||||||| |||||||| 
Sbjct: 27233 ttgatgttcctaaaggcactctccctggcgccagtggtgaggaggtagattgcctggttg 27174

                                                                         
Query: 360   accctcctgaggggggagatatccacagcctgtctcctcacaacaccagctgacccaata 419
             |||||||| | ||| ||||||||||||||||| ||||||||| | ||||| || || |||
Sbjct: 27173 accctcctcaagggagagatatccacagcctgcctcctcacagcgccagcagagccgata 27114

                              
Query: 420   cgggtagcatcctcacg 436
             ||||| || ||||||||
Sbjct: 27113 cgggttgcgtcctcacg 27097



 Score = 73.8 bits (37), Expect = 7e-10
 Identities = 46/49 (93%)
 Strand = Plus / Minus

                                                              
Query: 187   aacggttagccttggcaacacgctcgatctcgtccttcttcttgatggc 235
             ||||||| ||||||||||||||||| ||||| |||||||||||||||||
Sbjct: 27417 aacggttcgccttggcaacacgctcaatctcatccttcttcttgatggc 27369



to top

>dbj|AP003610.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0402A09
          Length = 141966

 Score =  258 bits (130), Expect = 2e-65
 Identities = 182/197 (92%), Gaps = 3/197 (1%)
 Strand = Plus / Minus

                                                                         
Query: 444   ctgttgatgatggcgtcgacgatgatctggatggggttggccgtcggtgaggaggtggat 503
             |||||||||||||| || ||||||| ||||||||||||||| ||||||||||||||||||
Sbjct: 11571 ctgttgatgatggcatctacgatgacctggatggggttggc-gtcggtgaggaggtggat 11513

                                                                         
Query: 504   gatctccatggtgtgcttgatgatgcggacggccatgatcttctttgcccgttgttgcgc 563
             ||||||||||| |||||||| ||||||||| ||||||||||||||   ||||||||||| 
Sbjct: 11512 gatctccatggcgtgcttgacgatgcggacagccatgatcttcttg--ccgttgttgcgg 11455

                                                                         
Query: 564   ccgtgcatcatgagggagttggtgaggcgctcgatgatggggcactgcgccttgcggaag 623
             |||||||||||||||||||||||||||||||| | || ||||||||||||||||||||||
Sbjct: 11454 ccgtgcatcatgagggagttggtgaggcgctccacgagggggcactgcgccttgcggaag 11395

                              
Query: 624   cgcttggccgagtagcg 640
             ||||| |||||||||||
Sbjct: 11394 cgcttcgccgagtagcg 11378



 Score =  192 bits (97), Expect = 1e-45
 Identities = 172/197 (87%)
 Strand = Plus / Minus

                                                                         
Query: 240   ctgttggatgagcccttggcagcattgatcagctcatcagcaaggcactcagcaatggtc 299
             |||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||
Sbjct: 12223 ctgttggatgagcccttggcggcattgatgagctcatcagcaaggcactcagcaatggtc 12164

                                                                         
Query: 300   ttgacattacggaaagcgctctccctggcaccagtggtcagaaggtagatggcctggttc 359
             ||||  || |  || || ||||||||||| |||||||| || |||||||| |||||||| 
Sbjct: 12163 ttgatgttcctaaaggcactctccctggcgccagtggtgaggaggtagattgcctggttg 12104

                                                                         
Query: 360   accctcctgaggggggagatatccacagcctgtctcctcacaacaccagctgacccaata 419
             |||||||| | ||| ||||||||||||||||| ||||||||| | ||||| || || |||
Sbjct: 12103 accctcctcaagggagagatatccacagcctgcctcctcacagcgccagcagagccgata 12044

                              
Query: 420   cgggtagcatcctcacg 436
             ||||| || ||||||||
Sbjct: 12043 cgggttgcgtcctcacg 12027



 Score = 73.8 bits (37), Expect = 7e-10
 Identities = 46/49 (93%)
 Strand = Plus / Minus

                                                              
Query: 187   aacggttagccttggcaacacgctcgatctcgtccttcttcttgatggc 235
             ||||||| ||||||||||||||||| ||||| |||||||||||||||||
Sbjct: 12347 aacggttcgccttggcaacacgctcaatctcatccttcttcttgatggc 12299



to top

>gb|AC114011.5| Oryza sativa (japonica cultivar-group) chromosome 11 clone
             OSJNBa0078f20, complete sequence
          Length = 151042

 Score =  236 bits (119), Expect = 8e-59
 Identities = 177/194 (91%), Gaps = 3/194 (1%)
 Strand = Plus / Plus

                                                                         
Query: 444   ctgttgatgatggcgtcgacgatgatctggatggggttggccgtcggtgaggaggtggat 503
             ||||||||||||||||||||||||| ||| ||||||||||| ||||||||||||||||||
Sbjct: 70229 ctgttgatgatggcgtcgacgatgacctgaatggggttggc-gtcggtgaggaggtggat 70287

                                                                         
Query: 504   gatctccatggtgtgcttgatgatgcggacggccatgatcttctttgcccgttgttgcgc 563
             ||||||||||| |||||||| |||||| |||||||||||||||||  |||||||||||| 
Sbjct: 70288 gatctccatggcgtgcttgacgatgcgcacggccatgatcttctt--cccgttgttgcgg 70345

                                                                         
Query: 564   ccgtgcatcatgagggagttggtgaggcgctcgatgatggggcactgcgccttgcggaag 623
             |||||||||||||| |||||||| |||||||| | |||||||||||||||||| ||||| 
Sbjct: 70346 ccgtgcatcatgagcgagttggtcaggcgctccacgatggggcactgcgccttccggaac 70405

                           
Query: 624   cgcttggccgagta 637
             | ||| ||||||||
Sbjct: 70406 ctcttcgccgagta 70419



 Score =  228 bits (115), Expect = 2e-56
 Identities = 184/207 (88%)
 Strand = Plus / Plus

                                                                         
Query: 240   ctgttggatgagcccttggcagcattgatcagctcatcagcaaggcactcagcaatggtc 299
             |||||||||||||||||||| ||||| || ||||| ||||||||||||||||||||||||
Sbjct: 69133 ctgttggatgagcccttggcggcattaataagctcgtcagcaaggcactcagcaatggtc 69192

                                                                         
Query: 300   ttgacattacggaaagcgctctccctggcaccagtggtcagaaggtagatggcctggttc 359
             ||||  || | ||| ||||||||||||||||||||||| || |||||||| |||||||| 
Sbjct: 69193 ttgatgttcctgaaggcgctctccctggcaccagtggtgaggaggtagattgcctggttg 69252

                                                                         
Query: 360   accctcctgaggggggagatatccacagcctgtctcctcacaacaccagctgacccaata 419
             |||||||| | ||| ||||||||||||||||| ||||||||| |||| || |||||||||
Sbjct: 69253 accctcctcaagggagagatatccacagcctgcctcctcacagcacccgcagacccaata 69312

                                        
Query: 420   cgggtagcatcctcacgtggcccactg 446
             ||||| ||||||||||| || ||||||
Sbjct: 69313 cgggtcgcatcctcacgagggccactg 69339



 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 47/49 (95%)
 Strand = Plus / Plus

                                                              
Query: 187   aacggttagccttggcaacacgctcgatctcgtccttcttcttgatggc 235
             ||||||| ||||||||||||||||||||||| |||||||||||||||||
Sbjct: 68995 aacggttggccttggcaacacgctcgatctcatccttcttcttgatggc 69043



to top

>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11, complete
                sequence
          Length = 28386948

 Score =  236 bits (119), Expect = 8e-59
 Identities = 177/194 (91%), Gaps = 3/194 (1%)
 Strand = Plus / Plus

                                                                            
Query: 444      ctgttgatgatggcgtcgacgatgatctggatggggttggccgtcggtgaggaggtggat 503
                ||||||||||||||||||||||||| ||| ||||||||||| ||||||||||||||||||
Sbjct: 16329794 ctgttgatgatggcgtcgacgatgacctgaatggggttggc-gtcggtgaggaggtggat 16329852

                                                                            
Query: 504      gatctccatggtgtgcttgatgatgcggacggccatgatcttctttgcccgttgttgcgc 563
                ||||||||||| |||||||| |||||| |||||||||||||||||  |||||||||||| 
Sbjct: 16329853 gatctccatggcgtgcttgacgatgcgcacggccatgatcttctt--cccgttgttgcgg 16329910

                                                                            
Query: 564      ccgtgcatcatgagggagttggtgaggcgctcgatgatggggcactgcgccttgcggaag 623
                |||||||||||||| |||||||| |||||||| | |||||||||||||||||| ||||| 
Sbjct: 16329911 ccgtgcatcatgagcgagttggtcaggcgctccacgatggggcactgcgccttccggaac 16329970

                              
Query: 624      cgcttggccgagta 637
                | ||| ||||||||
Sbjct: 16329971 ctcttcgccgagta 16329984



 Score =  228 bits (115), Expect = 2e-56
 Identities = 184/207 (88%)
 Strand = Plus / Plus

                                                                            
Query: 240      ctgttggatgagcccttggcagcattgatcagctcatcagcaaggcactcagcaatggtc 299
                |||||||||||||||||||| ||||| || ||||| ||||||||||||||||||||||||
Sbjct: 16328698 ctgttggatgagcccttggcggcattaataagctcgtcagcaaggcactcagcaatggtc 16328757

                                                                            
Query: 300      ttgacattacggaaagcgctctccctggcaccagtggtcagaaggtagatggcctggttc 359
                ||||  || | ||| ||||||||||||||||||||||| || |||||||| |||||||| 
Sbjct: 16328758 ttgatgttcctgaaggcgctctccctggcaccagtggtgaggaggtagattgcctggttg 16328817

                                                                            
Query: 360      accctcctgaggggggagatatccacagcctgtctcctcacaacaccagctgacccaata 419
                |||||||| | ||| ||||||||||||||||| ||||||||| |||| || |||||||||
Sbjct: 16328818 accctcctcaagggagagatatccacagcctgcctcctcacagcacccgcagacccaata 16328877

                                           
Query: 420      cgggtagcatcctcacgtggcccactg 446
                ||||| ||||||||||| || ||||||
Sbjct: 16328878 cgggtcgcatcctcacgagggccactg 16328904



 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 47/49 (95%)
 Strand = Plus / Plus

                                                                 
Query: 187      aacggttagccttggcaacacgctcgatctcgtccttcttcttgatggc 235
                ||||||| ||||||||||||||||||||||| |||||||||||||||||
Sbjct: 16328560 aacggttggccttggcaacacgctcgatctcatccttcttcttgatggc 16328608



to top

>gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome 11, complete sequence
          Length = 28369397

 Score =  236 bits (119), Expect = 8e-59
 Identities = 177/194 (91%), Gaps = 3/194 (1%)
 Strand = Plus / Plus

                                                                            
Query: 444      ctgttgatgatggcgtcgacgatgatctggatggggttggccgtcggtgaggaggtggat 503
                ||||||||||||||||||||||||| ||| ||||||||||| ||||||||||||||||||
Sbjct: 16419773 ctgttgatgatggcgtcgacgatgacctgaatggggttggc-gtcggtgaggaggtggat 16419831

                                                                            
Query: 504      gatctccatggtgtgcttgatgatgcggacggccatgatcttctttgcccgttgttgcgc 563
                ||||||||||| |||||||| |||||| |||||||||||||||||  |||||||||||| 
Sbjct: 16419832 gatctccatggcgtgcttgacgatgcgcacggccatgatcttctt--cccgttgttgcgg 16419889

                                                                            
Query: 564      ccgtgcatcatgagggagttggtgaggcgctcgatgatggggcactgcgccttgcggaag 623
                |||||||||||||| |||||||| |||||||| | |||||||||||||||||| ||||| 
Sbjct: 16419890 ccgtgcatcatgagcgagttggtcaggcgctccacgatggggcactgcgccttccggaac 16419949

                              
Query: 624      cgcttggccgagta 637
                | ||| ||||||||
Sbjct: 16419950 ctcttcgccgagta 16419963



 Score =  228 bits (115), Expect = 2e-56
 Identities = 184/207 (88%)
 Strand = Plus / Plus

                                                                            
Query: 240      ctgttggatgagcccttggcagcattgatcagctcatcagcaaggcactcagcaatggtc 299
                |||||||||||||||||||| ||||| || ||||| ||||||||||||||||||||||||
Sbjct: 16418677 ctgttggatgagcccttggcggcattaataagctcgtcagcaaggcactcagcaatggtc 16418736

                                                                            
Query: 300      ttgacattacggaaagcgctctccctggcaccagtggtcagaaggtagatggcctggttc 359
                ||||  || | ||| ||||||||||||||||||||||| || |||||||| |||||||| 
Sbjct: 16418737 ttgatgttcctgaaggcgctctccctggcaccagtggtgaggaggtagattgcctggttg 16418796

                                                                            
Query: 360      accctcctgaggggggagatatccacagcctgtctcctcacaacaccagctgacccaata 419
                |||||||| | ||| ||||||||||||||||| ||||||||| |||| || |||||||||
Sbjct: 16418797 accctcctcaagggagagatatccacagcctgcctcctcacagcacccgcagacccaata 16418856

                                           
Query: 420      cgggtagcatcctcacgtggcccactg 446
                ||||| ||||||||||| || ||||||
Sbjct: 16418857 cgggtcgcatcctcacgagggccactg 16418883



 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 47/49 (95%)
 Strand = Plus / Plus

                                                                 
Query: 187      aacggttagccttggcaacacgctcgatctcgtccttcttcttgatggc 235
                ||||||| ||||||||||||||||||||||| |||||||||||||||||
Sbjct: 16418539 aacggttggccttggcaacacgctcgatctcatccttcttcttgatggc 16418587



to top

>ref|NM_112027.2| Arabidopsis thaliana ATRPS5A (RIBOSOMAL PROTEIN 5A); structural
           constituent of ribosome AT3G11940 (ATRPS5A) transcript
           variant AT3G11940.1 mRNA, complete cds
          Length = 1017

 Score =  180 bits (91), Expect = 4e-42
 Identities = 352/434 (81%), Gaps = 5/434 (1%)
 Strand = Plus / Minus

                                                                       
Query: 184 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 243
           ||||||| |||||||||||||| |  || ||||| ||||||||||||||||| || ||||
Sbjct: 738 cttaacgattagccttggcaactctttcaatctcatccttcttcttgatggcatagctgt 679

                                                                       
Query: 244 tggatgagcccttggcagcattgatcagctcatcagcaaggcactcagcaatggtcttga 303
           |||| ||||||||||| || |||||||  |||||||||||||||||||| || |||||||
Sbjct: 678 tggaagagcccttggctgcgttgatcaattcatcagcaaggcactcagctatagtcttga 619

                                                                       
Query: 304 cattacggaaagc-gctctccctggcaccagtggtcagaaggtagatggcctggttcacc 362
             || | |||||| ||| || |  ||||||||||| |  | | |||| |||||||| || 
Sbjct: 618 tgtttctgaaagcagct-tcacgagcaccagtggtaatcaagaagatagcctggttaaca 560

                                                                       
Query: 363 ctcctgaggggggagatatccacagcctgtctcctcacaacaccagctgacccaatacgg 422
           |  || || || |||||||| ||||| |||||||| ||||||||||| || ||||| | |
Sbjct: 559 cgtcttagaggagagatatcaacagcttgtctcctaacaacaccagcagatccaattctg 500

                                                                       
Query: 423 gtagcatcctcacgtggcccactgttgatgatggcgtcgacgatgatctggatggggttg 482
           |||||||| |||||||| ||||||||||  |||||||| | ||||| ||| || ||||| 
Sbjct: 499 gtagcatcttcacgtggaccactgttgacaatggcgtcaatgatgacctgaattgggtt- 441

                                                                       
Query: 483 gccgtcggtgaggaggtggatgatctccatggtgtgcttgatgatgcggacggccatgat 542
              ||| |  | ||||||||| |||||||||| |||||||| ||| | ||| ||||| | 
Sbjct: 440 caagtcagacaagaggtggataatctccatggcgtgcttgacgatcctgacagccatcaa 381

                                                                       
Query: 543 cttctttgcccgttgttgcgcccgtgcatcatgagggagttggtgaggcgctcgatgatg 602
            |||||   |||||||| | ||||||||||||||| ||||||||||| | ||| |  |||
Sbjct: 380 tttctt--accgttgttcctcccgtgcatcatgagagagttggtgagcctctcaacaatg 323

                         
Query: 603 gggcactgcgcctt 616
           |||||||| |||||
Sbjct: 322 gggcactgagcctt 309



to top

>ref|NM_180233.1| Arabidopsis thaliana ATRPS5A (RIBOSOMAL PROTEIN 5A); structural
           constituent of ribosome AT3G11940 (ATRPS5A) transcript
           variant AT3G11940.2 mRNA, complete cds
          Length = 968

 Score =  180 bits (91), Expect = 4e-42
 Identities = 352/434 (81%), Gaps = 5/434 (1%)
 Strand = Plus / Minus

                                                                       
Query: 184 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 243
           ||||||| |||||||||||||| |  || ||||| ||||||||||||||||| || ||||
Sbjct: 689 cttaacgattagccttggcaactctttcaatctcatccttcttcttgatggcatagctgt 630

                                                                       
Query: 244 tggatgagcccttggcagcattgatcagctcatcagcaaggcactcagcaatggtcttga 303
           |||| ||||||||||| || |||||||  |||||||||||||||||||| || |||||||
Sbjct: 629 tggaagagcccttggctgcgttgatcaattcatcagcaaggcactcagctatagtcttga 570

                                                                       
Query: 304 cattacggaaagc-gctctccctggcaccagtggtcagaaggtagatggcctggttcacc 362
             || | |||||| ||| || |  ||||||||||| |  | | |||| |||||||| || 
Sbjct: 569 tgtttctgaaagcagct-tcacgagcaccagtggtaatcaagaagatagcctggttaaca 511

                                                                       
Query: 363 ctcctgaggggggagatatccacagcctgtctcctcacaacaccagctgacccaatacgg 422
           |  || || || |||||||| ||||| |||||||| ||||||||||| || ||||| | |
Sbjct: 510 cgtcttagaggagagatatcaacagcttgtctcctaacaacaccagcagatccaattctg 451

                                                                       
Query: 423 gtagcatcctcacgtggcccactgttgatgatggcgtcgacgatgatctggatggggttg 482
           |||||||| |||||||| ||||||||||  |||||||| | ||||| ||| || ||||| 
Sbjct: 450 gtagcatcttcacgtggaccactgttgacaatggcgtcaatgatgacctgaattgggtt- 392

                                                                       
Query: 483 gccgtcggtgaggaggtggatgatctccatggtgtgcttgatgatgcggacggccatgat 542
              ||| |  | ||||||||| |||||||||| |||||||| ||| | ||| ||||| | 
Sbjct: 391 caagtcagacaagaggtggataatctccatggcgtgcttgacgatcctgacagccatcaa 332

                                                                       
Query: 543 cttctttgcccgttgttgcgcccgtgcatcatgagggagttggtgaggcgctcgatgatg 602
            |||||   |||||||| | ||||||||||||||| ||||||||||| | ||| |  |||
Sbjct: 331 tttctt--accgttgttcctcccgtgcatcatgagagagttggtgagcctctcaacaatg 274

                         
Query: 603 gggcactgcgcctt 616
           |||||||| |||||
Sbjct: 273 gggcactgagcctt 260



to top

>gb|AY091376.1| Arabidopsis thaliana putative 40S ribosomal protein S5 (At3g11940)
           mRNA, complete cds
          Length = 655

 Score =  180 bits (91), Expect = 4e-42
 Identities = 352/434 (81%), Gaps = 5/434 (1%)
 Strand = Plus / Minus

                                                                       
Query: 184 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 243
           ||||||| |||||||||||||| |  || ||||| ||||||||||||||||| || ||||
Sbjct: 625 cttaacgattagccttggcaactctttcaatctcatccttcttcttgatggcatagctgt 566

                                                                       
Query: 244 tggatgagcccttggcagcattgatcagctcatcagcaaggcactcagcaatggtcttga 303
           |||| ||||||||||| || |||||||  |||||||||||||||||||| || |||||||
Sbjct: 565 tggaagagcccttggctgcgttgatcaattcatcagcaaggcactcagctatagtcttga 506

                                                                       
Query: 304 cattacggaaagc-gctctccctggcaccagtggtcagaaggtagatggcctggttcacc 362
             || | |||||| ||| || |  ||||||||||| |  | | |||| |||||||| || 
Sbjct: 505 tgtttctgaaagcagct-tcacgagcaccagtggtaatcaagaagatagcctggttaaca 447

                                                                       
Query: 363 ctcctgaggggggagatatccacagcctgtctcctcacaacaccagctgacccaatacgg 422
           |  || || || |||||||| ||||| |||||||| ||||||||||| || ||||| | |
Sbjct: 446 cgtcttagaggagagatatcaacagcttgtctcctaacaacaccagcagatccaattctg 387

                                                                       
Query: 423 gtagcatcctcacgtggcccactgttgatgatggcgtcgacgatgatctggatggggttg 482
           |||||||| |||||||| ||||||||||  |||||||| | ||||| ||| || ||||| 
Sbjct: 386 gtagcatcttcacgtggaccactgttgacaatggcgtcaatgatgacctgaattgggtt- 328

                                                                       
Query: 483 gccgtcggtgaggaggtggatgatctccatggtgtgcttgatgatgcggacggccatgat 542
              ||| |  | ||||||||| |||||||||| |||||||| ||| | ||| ||||| | 
Sbjct: 327 caagtcagacaagaggtggataatctccatggcgtgcttgacgatcctgacagccatcaa 268

                                                                       
Query: 543 cttctttgcccgttgttgcgcccgtgcatcatgagggagttggtgaggcgctcgatgatg 602
            |||||   |||||||| | ||||||||||||||| ||||||||||| | ||| |  |||
Sbjct: 267 tttctt--accgttgttcctcccgtgcatcatgagagagttggtgagcctctcaacaatg 210

                         
Query: 603 gggcactgcgcctt 616
           |||||||| |||||
Sbjct: 209 gggcactgagcctt 196



to top

>gb|AY045846.1| Arabidopsis thaliana putative 40S ribosomal protein S5 (At3g11940)
           mRNA, complete cds
          Length = 931

 Score =  180 bits (91), Expect = 4e-42
 Identities = 352/434 (81%), Gaps = 5/434 (1%)
 Strand = Plus / Minus

                                                                       
Query: 184 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 243
           ||||||| |||||||||||||| |  || ||||| ||||||||||||||||| || ||||
Sbjct: 689 cttaacgattagccttggcaactctttcaatctcatccttcttcttgatggcatagctgt 630

                                                                       
Query: 244 tggatgagcccttggcagcattgatcagctcatcagcaaggcactcagcaatggtcttga 303
           |||| ||||||||||| || |||||||  |||||||||||||||||||| || |||||||
Sbjct: 629 tggaagagcccttggctgcgttgatcaattcatcagcaaggcactcagctatagtcttga 570

                                                                       
Query: 304 cattacggaaagc-gctctccctggcaccagtggtcagaaggtagatggcctggttcacc 362
             || | |||||| ||| || |  ||||||||||| |  | | |||| |||||||| || 
Sbjct: 569 tgtttctgaaagcagct-tcacgagcaccagtggtaatcaagaagatagcctggttaaca 511

                                                                       
Query: 363 ctcctgaggggggagatatccacagcctgtctcctcacaacaccagctgacccaatacgg 422
           |  || || || |||||||| ||||| |||||||| ||||||||||| || ||||| | |
Sbjct: 510 cgtcttagaggagagatatcaacagcttgtctcctaacaacaccagcagatccaattctg 451

                                                                       
Query: 423 gtagcatcctcacgtggcccactgttgatgatggcgtcgacgatgatctggatggggttg 482
           |||||||| |||||||| ||||||||||  |||||||| | ||||| ||| || ||||| 
Sbjct: 450 gtagcatcttcacgtggaccactgttgacaatggcgtcaatgatgacctgaattgggtt- 392

                                                                       
Query: 483 gccgtcggtgaggaggtggatgatctccatggtgtgcttgatgatgcggacggccatgat 542
              ||| |  | ||||||||| |||||||||| |||||||| ||| | ||| ||||| | 
Sbjct: 391 caagtcagacaagaggtggataatctccatggcgtgcttgacgatcctgacagccatcaa 332

                                                                       
Query: 543 cttctttgcccgttgttgcgcccgtgcatcatgagggagttggtgaggcgctcgatgatg 602
            |||||   |||||||| | ||||||||||||||| ||||||||||| | ||| |  |||
Sbjct: 331 tttctt--accgttgttcctcccgtgcatcatgagagagttggtgagcctctcaacaatg 274

                         
Query: 603 gggcactgcgcctt 616
           |||||||| |||||
Sbjct: 273 gggcactgagcctt 260



to top

>emb|BX822599.1|CNS0A75J Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB51ZF06 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 894

 Score =  180 bits (91), Expect = 4e-42
 Identities = 352/434 (81%), Gaps = 5/434 (1%)
 Strand = Plus / Minus

                                                                       
Query: 184 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 243
           ||||||| |||||||||||||| |  || ||||| ||||||||||||||||| || ||||
Sbjct: 675 cttaacgattagccttggcaactctttcaatctcatccttcttcttgatggcatagctgt 616

                                                                       
Query: 244 tggatgagcccttggcagcattgatcagctcatcagcaaggcactcagcaatggtcttga 303
           |||| ||||||||||| || |||||||  |||||||||||||||||||| || |||||||
Sbjct: 615 tggaagagcccttggctgcgttgatcaattcatcagcaaggcactcagctatagtcttga 556

                                                                       
Query: 304 cattacggaaagc-gctctccctggcaccagtggtcagaaggtagatggcctggttcacc 362
             || | |||||| ||| || |  ||||||||||| |  | | |||| |||||||| || 
Sbjct: 555 tgtttctgaaagcagct-tcacgagcaccagtggtaatcaagaagatagcctggttaaca 497

                                                                       
Query: 363 ctcctgaggggggagatatccacagcctgtctcctcacaacaccagctgacccaatacgg 422
           |  || || || |||||||| ||||| |||||||| ||||||||||| || ||||| | |
Sbjct: 496 cgtcttagaggagagatatcaacagcttgtctcctaacaacaccagcagatccaattctg 437

                                                                       
Query: 423 gtagcatcctcacgtggcccactgttgatgatggcgtcgacgatgatctggatggggttg 482
           |||||||| |||||||| ||||||||||  |||||||| | ||||| ||| || ||||| 
Sbjct: 436 gtagcatcttcacgtggaccactgttgaaaatggcgtcaatgatgacctgaattgggtt- 378

                                                                       
Query: 483 gccgtcggtgaggaggtggatgatctccatggtgtgcttgatgatgcggacggccatgat 542
              ||| |  | ||||||||| |||||||||| |||||||| ||| | ||| ||||| | 
Sbjct: 377 caagtcagacaagaggtggataatctccatggcgtgcttgacgatcctgacagccatcaa 318

                                                                       
Query: 543 cttctttgcccgttgttgcgcccgtgcatcatgagggagttggtgaggcgctcgatgatg 602
            |||||   |||||||| | ||||||||||||||| ||||||||||| | ||| |  |||
Sbjct: 317 tttctt--accgttgttcctcccgtgcatcatgagagagttggtgagcctctcaacaatg 260

                         
Query: 603 gggcactgcgcctt 616
           |||||||| |||||
Sbjct: 259 gggcactgagcctt 246



to top

>emb|BX824143.1|CNS0A6QW Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH25ZG01 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 800

 Score =  180 bits (91), Expect = 4e-42
 Identities = 352/434 (81%), Gaps = 5/434 (1%)
 Strand = Plus / Minus

                                                                       
Query: 184 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 243
           ||||||| |||||||||||||| |  || ||||| ||||||||||||||||| || ||||
Sbjct: 688 cttaacgattagccttggcaactctttcaatctcatccttcttcttgatggcatagctgt 629

                                                                       
Query: 244 tggatgagcccttggcagcattgatcagctcatcagcaaggcactcagcaatggtcttga 303
           |||| ||||||||||| || |||||||  |||||||||||||||||||| || |||||||
Sbjct: 628 tggaagagcccttggctgcgttgatcaattcatcagcaaggcactcagctatagtcttga 569

                                                                       
Query: 304 cattacggaaagc-gctctccctggcaccagtggtcagaaggtagatggcctggttcacc 362
             || | |||||| ||| || |  ||||||||||| |  | | |||| |||||||| || 
Sbjct: 568 tgtttctgaaagcagct-tcacgagcaccagtggtaatcaagaagatagcctggttaaca 510

                                                                       
Query: 363 ctcctgaggggggagatatccacagcctgtctcctcacaacaccagctgacccaatacgg 422
           |  || || || |||||||| ||||| |||||||| ||||||||||| || ||||| | |
Sbjct: 509 cgtcttagaggagagatatcaacagcttgtctcctaacaacaccagcagatccaattctg 450

                                                                       
Query: 423 gtagcatcctcacgtggcccactgttgatgatggcgtcgacgatgatctggatggggttg 482
           |||||||| |||||||| ||||||||||  |||||||| | ||||| ||| || ||||| 
Sbjct: 449 gtagcatcttcacgtggaccactgttgacaatggcgtcaatgatgacctgaattgggtt- 391

                                                                       
Query: 483 gccgtcggtgaggaggtggatgatctccatggtgtgcttgatgatgcggacggccatgat 542
              ||| |  | ||||||||| |||||||||| |||||||| ||| | ||| ||||| | 
Sbjct: 390 caagtcagacaagaggtggataatctccatggcgtgcttgacgatcctgacagccatcaa 331

                                                                       
Query: 543 cttctttgcccgttgttgcgcccgtgcatcatgagggagttggtgaggcgctcgatgatg 602
            |||||   |||||||| | ||||||||||||||| ||||||||||| | ||| |  |||
Sbjct: 330 tttctt--accgttgttcctcccgtgcatcatgagagagttggtgagcctctcaacaatg 273

                         
Query: 603 gggcactgcgcctt 616
           |||||||| |||||
Sbjct: 272 gggcactgagcctt 259



to top

>gb|AY086938.1| Arabidopsis thaliana clone 29782 mRNA, complete sequence
          Length = 860

 Score =  180 bits (91), Expect = 4e-42
 Identities = 352/434 (81%), Gaps = 5/434 (1%)
 Strand = Plus / Minus

                                                                       
Query: 184 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 243
           ||||||| |||||||||||||| |  || ||||| ||||||||||||||||| || ||||
Sbjct: 738 cttaacgattagccttggcaactctttcaatctcatccttcttcttgatggcatagctgt 679

                                                                       
Query: 244 tggatgagcccttggcagcattgatcagctcatcagcaaggcactcagcaatggtcttga 303
           |||| ||||||||||| || |||||||  |||||||||||||||||||| || |||||||
Sbjct: 678 tggaagagcccttggctgcgttgatcaattcatcagcaaggcactcagctatagtcttga 619

                                                                       
Query: 304 cattacggaaagc-gctctccctggcaccagtggtcagaaggtagatggcctggttcacc 362
             || | |||||| ||| || |  ||||||||||| |  | | |||| |||||||| || 
Sbjct: 618 tgtttctgaaagcagct-tcacgagcaccagtggtaatcaagaagatagcctggttaaca 560

                                                                       
Query: 363 ctcctgaggggggagatatccacagcctgtctcctcacaacaccagctgacccaatacgg 422
           |  || || || |||||||| ||||| |||||||| ||||||||||| || ||||| | |
Sbjct: 559 cgtcttagaggagagatatcaacagcttgtctcctaacaacaccagcagatccaattctg 500

                                                                       
Query: 423 gtagcatcctcacgtggcccactgttgatgatggcgtcgacgatgatctggatggggttg 482
           |||||||| |||||||| ||||||||||  |||||||| | ||||| ||| || ||||| 
Sbjct: 499 gtagcatcttcacgtggaccactgttgacaatggcgtcaatgatgacctgaattgggtt- 441

                                                                       
Query: 483 gccgtcggtgaggaggtggatgatctccatggtgtgcttgatgatgcggacggccatgat 542
              ||| |  | ||||||||| |||||||||| |||||||| ||| | ||| ||||| | 
Sbjct: 440 caagtcagacaagaggtggataatctccatggcgtgcttgacgatcctgacagccatcaa 381

                                                                       
Query: 543 cttctttgcccgttgttgcgcccgtgcatcatgagggagttggtgaggcgctcgatgatg 602
            |||||   |||||||| | ||||||||||||||| ||||||||||| | ||| |  |||
Sbjct: 380 tttctt--accgttgttcctcccgtgcatcatgagagagttggtgagcctctcaacaatg 323

                         
Query: 603 gggcactgcgcctt 616
           |||||||| |||||
Sbjct: 322 gggcactgagcctt 309



to top

>emb|AM167929.1| Chlamydomonas sp. ICE-L mRNA for 40S ribosomal protein S5 (RPS5
           gene)
          Length = 747

 Score =  168 bits (85), Expect = 2e-38
 Identities = 356/444 (80%), Gaps = 3/444 (0%)
 Strand = Plus / Minus

                                                                       
Query: 185 ttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgtt 244
           ||||||||| ||||||||||||||||| | ||||||||||||||| || |||||||||||
Sbjct: 616 ttaacggttggccttggcaacacgctccagctcgtccttcttcttaatagcgtaactgtt 557

                                                                       
Query: 245 ggatgagcccttggcagcattgatcagctcatcagcaaggcactcagcaatggtcttgac 304
           ||| || ||||| || || |||| || ||| ||||| | |||||||||||  ||||||| 
Sbjct: 556 ggaagatcccttagcggcgttgaccaactcgtcagccaagcactcagcaacagtcttgat 497

                                                                       
Query: 305 attacggaaagcgctctccctggcaccagtggtcagaaggtagatggcctggttcaccct 364
             | ||||| ||   ||| | |||||||||||| |  ||| |||| |||||||| || | 
Sbjct: 496 gctgcggaatgcagcctcacgggcaccagtggtgatcaggaagatagcctggttgacacg 437

                                                                       
Query: 365 cctgaggggggagatatccacagcctgtctcctcacaacaccagctgacccaatacgggt 424
            |  ||||||||||||||||||||||| |  |  |||||||| || || |||||||||||
Sbjct: 436 gcgcaggggggagatatccacagcctggcggcggacaacaccggcggagccaatacgggt 377

                                                                       
Query: 425 agcatcctcacgtggcccactgttgatgatggcgtcgacgatgatctggatggggttggc 484
            ||||||||||| || ||||||||||||||||| || ||||  | ||||||||||||   
Sbjct: 376 ggcatcctcacggggtccactgttgatgatggcatcaacgacaacctggatggggtt-ct 318

                                                                       
Query: 485 cgtcggtgaggaggtggatgatctccatggtgtgcttgatgatgcggacggccatgatct 544
            |||||| || |||| ||||||||| |  |  ||||| |  |||||||| ||||  | ||
Sbjct: 317 ggtcggtcagcaggttgatgatctcaaacgcatgcttcacaatgcggacagccaacagct 258

                                                                       
Query: 545 tctttgcccgttgttgcgcccgtgcatcatgagggagttggtgaggcgctcgatgatggg 604
           |||||  ||||||||||| ||||||||||| ||||||  || ||| | ||| | ||||||
Sbjct: 257 tcttt--ccgttgttgcggccgtgcatcatcagggagacggcgagcctctcaacgatggg 200

                                   
Query: 605 gcactgcgccttgcggaagcgctt 628
           |||| | ||||| ||||| |||||
Sbjct: 199 gcacagggcctttcggaatcgctt 176



to top

>gb|AY674223.1| Ixodes pacificus clone IP_7_60_92_100_CLU 40S ribosomal protein S5
           mRNA, complete cds
          Length = 630

 Score =  165 bits (83), Expect = 2e-37
 Identities = 155/179 (86%)
 Strand = Plus / Minus

                                                                       
Query: 185 ttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgtt 244
           ||||||||| | |||||| |||||||| | |||||||||||||||||||||||| |||||
Sbjct: 630 ttaacggttggacttggcgacacgctccagctcgtccttcttcttgatggcgtagctgtt 571

                                                                       
Query: 245 ggatgagcccttggcagcattgatcagctcatcagcaaggcactcagcaatggtcttgac 304
           ||| ||||||||||| |||||||| ||||| || || |||||||| ||||||||||||| 
Sbjct: 570 ggaagagcccttggcggcattgatgagctcgtccgccaggcactctgcaatggtcttgat 511

                                                                      
Query: 305 attacggaaagcgctctccctggcaccagtggtcagaaggtagatggcctggttcaccc 363
            |||||||| ||||||||||  ||||| |||  ||| ||  ||||||||||||||||||
Sbjct: 510 gttacggaaggcgctctcccgtgcacccgtgcacagcagccagatggcctggttcaccc 452



 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 83/97 (85%)
 Strand = Plus / Minus

                                                                       
Query: 552 ccgttgttgcgcccgtgcatcatgagggagttggtgaggcgctcgatgatggggcactgc 611
           |||||||| || ||||||||||| |  ||||| || || ||||| | |||||||||||||
Sbjct: 266 ccgttgtttcggccgtgcatcatcatagagtttgtcagacgctccacgatggggcactgc 207

                                                
Query: 612 gccttgcggaagcgcttggccgagtagcgcccggccg 648
           |||||||||||||||||||  |  |||||||||||||
Sbjct: 206 gccttgcggaagcgcttggaagcatagcgcccggccg 170



to top

>gb|AY547734.1| Ornithodoros moubata 40S ribosomal protein S5 mRNA, complete cds
          Length = 739

 Score =  163 bits (82), Expect = 1e-36
 Identities = 178/210 (84%)
 Strand = Plus / Minus

                                                                       
Query: 185 ttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgtt 244
           ||||||||| | |||||| |||||||| |  ||||| |||||||||||||| || |||||
Sbjct: 658 ttaacggtttgacttggccacacgctccaattcgtctttcttcttgatggcatagctgtt 599

                                                                       
Query: 245 ggatgagcccttggcagcattgatcagctcatcagcaaggcactcagcaatggtcttgac 304
           |||||||||||| ||||||||||| || || ||||| | |||||||||||||||||||| 
Sbjct: 598 ggatgagcccttagcagcattgatgagttcgtcagccaagcactcagcaatggtcttgat 539

                                                                       
Query: 305 attacggaaagcgctctccctggcaccagtggtcagaaggtagatggcctggttcaccct 364
            || ||||| || ||||| | ||||||||| |  |||||  |||||||||||||||||||
Sbjct: 538 gttgcggaaggcactctcgcgggcaccagtagaaagaagccagatggcctggttcaccct 479

                                         
Query: 365 cctgaggggggagatatccacagcctgtct 394
           ||  || ||||| | |||||||||||||||
Sbjct: 478 ccgcagcggggatacatccacagcctgtct 449



 Score = 46.1 bits (23), Expect = 0.16
 Identities = 62/75 (82%)
 Strand = Plus / Minus

                                                                       
Query: 555 ttgttgcgcccgtgcatcatgagggagttggtgaggcgctcgatgatggggcactgcgcc 614
           |||||||| ||||||||||| | ||| || || || ||||| |  |||||||| || || 
Sbjct: 291 ttgttgcgaccgtgcatcatcatggaatttgtcagacgctccacaatggggcattgagct 232

                          
Query: 615 ttgcggaagcgcttg 629
           |||||||||||||||
Sbjct: 231 ttgcggaagcgcttg 217



to top

>dbj|D29726.1|RICYK40 Oryza sativa mRNA, partial homologous to ribosomal protein S5 gene
          Length = 305

 Score =  155 bits (78), Expect = 2e-34
 Identities = 106/116 (91%)
 Strand = Plus / Minus

                                                                       
Query: 187 aacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgttgg 246
           ||||||| |||||||||||| | |||||||| ||||||||||||||||| || |||||||
Sbjct: 124 aacggttggccttggcaacangntcgatctcatccttcttcttgatggcatagctgttgg 65

                                                                   
Query: 247 atgagcccttggcagcattgatcagctcatcagcaaggcactcagcaatggtcttg 302
           ||||||||||||| ||||| || ||||| |||||||||||||||||||||||||||
Sbjct: 64  atgagcccttggcggcattaataagctcgtcagcaaggcactcagcaatggtcttg 9



to top

>gb|DQ066208.1| Ixodes scapularis isolate ISUFL41 40S ribosomal protein S5 mRNA,
           complete cds
          Length = 630

 Score =  149 bits (75), Expect = 1e-32
 Identities = 153/179 (85%)
 Strand = Plus / Minus

                                                                       
Query: 185 ttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgtt 244
           ||||||||| | |||||| |||||||| | ||||||||||||||||||||| || |||||
Sbjct: 630 ttaacggttggacttggcgacacgctccagctcgtccttcttcttgatggcatagctgtt 571

                                                                       
Query: 245 ggatgagcccttggcagcattgatcagctcatcagcaaggcactcagcaatggtcttgac 304
           ||| ||||||||||| |||||||| ||||| || || |||||||||||||||||||||| 
Sbjct: 570 ggaagagcccttggcggcattgatgagctcgtccgccaggcactcagcaatggtcttgat 511

                                                                      
Query: 305 attacggaaagcgctctccctggcaccagtggtcagaaggtagatggcctggttcaccc 363
            |||||||| |||||||| |  || || |||  ||| ||  ||||||||||||||||||
Sbjct: 510 gttacggaaggcgctctcgcgtgcgcccgtgcacagcagccagatggcctggttcaccc 452



 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 83/97 (85%)
 Strand = Plus / Minus

                                                                       
Query: 552 ccgttgttgcgcccgtgcatcatgagggagttggtgaggcgctcgatgatggggcactgc 611
           |||||||| || ||||||||||| |  ||||| || || ||||| | |||||||||||||
Sbjct: 266 ccgttgttccggccgtgcatcatcatagagtttgtaagacgctccacgatggggcactgc 207

                                                
Query: 612 gccttgcggaagcgcttggccgagtagcgcccggccg 648
           |||||||||||||||||||  |  |||||||||||||
Sbjct: 206 gccttgcggaagcgcttggaagcatagcgcccggccg 170



to top

>emb|BX822969.1|CNS0A70I Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB77ZF12 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 807

 Score =  149 bits (75), Expect = 1e-32
 Identities = 348/434 (80%), Gaps = 5/434 (1%)
 Strand = Plus / Minus

                                                                       
Query: 184 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 243
           ||||||| |||||||||||||| |  || ||||| ||||||||||||||||| || ||||
Sbjct: 653 cttaacgattagccttggcaactctttcaatctcatccttcttcttgatggcatagctgt 594

                                                                       
Query: 244 tggatgagcccttggcagcattgatcagctcatcagcaaggcactcagcaatggtcttga 303
           |||| ||||||||||| || |||||||  |||||||||||||||||||| || |||||||
Sbjct: 593 tggaagagcccttggctgcgttgatcaattcatcagcaaggcactcagctatagtcttga 534

                                                                       
Query: 304 cattacggaaagc-gctctccctggcaccagtggtcagaaggtagatggcctggttcacc 362
             || | |||||| ||| || |  ||||||||||| |  | | |||| |||||||| || 
Sbjct: 533 tgtttctgaaagcagct-tcacgagcaccagtggtaatcaagaagatagcctggttaaca 475

                                                                       
Query: 363 ctcctgaggggggagatatccacagcctgtctcctcacaacaccagctgacccaatacgg 422
           |  || || || |||| ||| ||||| |||||||| ||||||||||| || ||||| | |
Sbjct: 474 cgtcttagaggagagaaatcaacagcttgtctcctaacaacaccagcagatccaattctg 415

                                                                       
Query: 423 gtagcatcctcacgtggcccactgttgatgatggcgtcgacgatgatctggatggggttg 482
           |||||||| | |||||| ||||||| ||  |||||||| | ||||| ||| || ||||| 
Sbjct: 414 gtagcatctttacgtggaccactgtagacaatggcgtcaatgatgacctgaattgggtt- 356

                                                                       
Query: 483 gccgtcggtgaggaggtggatgatctccatggtgtgcttgatgatgcggacggccatgat 542
              ||| |  | ||||||||| |||||||||| |||||||| ||| |  || ||||| | 
Sbjct: 355 caagtcagacaagaggtggataatctccatggcgtgcttgacgatccttacagccatcaa 296

                                                                       
Query: 543 cttctttgcccgttgttgcgcccgtgcatcatgagggagttggtgaggcgctcgatgatg 602
            |||||   |||||||| | ||||||||||||||| ||||||||||| | ||| |  |||
Sbjct: 295 tttctt--accgttgttcctcccgtgcatcatgagagagttggtgagcctctcaacaatg 238

                         
Query: 603 gggcactgcgcctt 616
           |||||||| |||||
Sbjct: 237 gggcactgagcctt 224



to top

>dbj|AK110655.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-169-E07, full
           insert sequence
          Length = 1159

 Score =  149 bits (75), Expect = 1e-32
 Identities = 172/202 (85%), Gaps = 3/202 (1%)
 Strand = Plus / Minus

                                                                       
Query: 404 accagctgacccaatacgggtagcatcctcacgtggcccactgttgatgatggcgtcgac 463
           |||||| || || |||||||| |  |||||||| || ||| |||||||||||||||||||
Sbjct: 496 accagccgagccgatacgggtcgagtcctcacggggaccagtgttgatgatggcgtcgac 437

                                                                       
Query: 464 gatgatctggatggggttggccgtcggtgaggaggtggatgatctccatggtgtgcttga 523
           || ||||||||||||||||| |||||||||| |||| ||||||||| | || |||   ||
Sbjct: 436 gaggatctggatggggttgg-cgtcggtgagcaggttgatgatctcaaaggcgtgggcga 378

                                                                       
Query: 524 tgatgcggacggccatgatcttctttgcccgttgttgcgcccgtgcatcatgagggagtt 583
            ||||||||||||||||| ||||||   ||||||||||| |||||||||||||| |||||
Sbjct: 377 cgatgcggacggccatgagcttctt--gccgttgttgcggccgtgcatcatgagcgagtt 320

                                 
Query: 584 ggtgaggcgctcgatgatgggg 605
           |   |||||||||| |||||||
Sbjct: 319 gaccaggcgctcgacgatgggg 298



 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 76/90 (84%)
 Strand = Plus / Minus

                                                                       
Query: 200 ggcaacacgctcgatctcgtccttcttcttgatggcgtaactgttggatgagcccttggc 259
           |||||||||||| ||||||||   |||||||||||||||   |||||| || ||||||||
Sbjct: 700 ggcaacacgctccatctcgtcacgcttcttgatggcgtacgagttggacgaacccttggc 641

                                         
Query: 260 agcattgatcagctcatcagcaaggcactc 289
            || ||||||||||| || || ||||||||
Sbjct: 640 ggcgttgatcagctcgtcggcgaggcactc 611



to top

>emb|CR523515.1| Gallus gallus finished cDNA, clone ChEST17m15
          Length = 898

 Score =  143 bits (72), Expect = 9e-31
 Identities = 138/159 (86%), Gaps = 2/159 (1%)
 Strand = Plus / Minus

                                                                       
Query: 488 cggtgaggaggtggatgatctccatggtgtgcttgatgatgcggacggccatgatcttct 547
           ||||||| || ||||||||||| | || |||||||| |||||| |||| ||||| |||||
Sbjct: 291 cggtgagcagatggatgatctcgaaggcgtgcttgacgatgcgcacggtcatgagcttct 232

                                                                       
Query: 548 ttgcccgttgttgcgcccgtgcatcatgagggagttggtgaggcgctcgatgatggggca 607
           |   ||||||||||| ||||||||||| | |||||||||||||||||| | |||||||||
Sbjct: 231 tg--ccgttgttgcggccgtgcatcatcatggagttggtgaggcgctccacgatggggca 174

                                                  
Query: 608 ctgcgccttgcggaagcgcttggccgagtagcgcccggc 646
           ||||||||| |||||||| ||||||| ||| ||||||||
Sbjct: 173 ctgcgccttccggaagcgtttggccgcgtaccgcccggc 135



 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 60/71 (84%)
 Strand = Plus / Minus

                                                                       
Query: 198 ttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgttggatgagcccttg 257
           |||||||| ||||| |  |||||||||||||| ||||||||   |||||| |||||||||
Sbjct: 580 ttggcaacgcgctccaattcgtccttcttcttaatggcgtaggagttggaggagcccttg 521

                      
Query: 258 gcagcattgat 268
           || || |||||
Sbjct: 520 gcggcgttgat 510



to top

>ref|XM_958137.1| Neurospora crassa OR74A 40S RIBOSOMAL PROTEIN S5 (NCU09475.1)
           partial mRNA
          Length = 582

 Score =  141 bits (71), Expect = 4e-30
 Identities = 116/131 (88%)
 Strand = Plus / Minus

                                                                       
Query: 185 ttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgtt 244
           ||||||||| | ||||||||||||||||| ||| ||||||||||||||||||||   |||
Sbjct: 582 ttaacggttggacttggcaacacgctcgagctcatccttcttcttgatggcgtacgagtt 523

                                                                       
Query: 245 ggatgagcccttggcagcattgatcagctcatcagcaaggcactcagcaatggtcttgac 304
           ||| ||||||||||| || ||||||||||| |||||||||||||| ||||||| ||||||
Sbjct: 522 ggaggagcccttggcggcgttgatcagctcctcagcaaggcactcggcaatggacttgac 463

                      
Query: 305 attacggaaag 315
            || |||||||
Sbjct: 462 gttgcggaaag 452



 Score =  117 bits (59), Expect = 5e-23
 Identities = 156/186 (83%), Gaps = 3/186 (1%)
 Strand = Plus / Minus

                                                                       
Query: 446 gttgatgatggcgtcgacgatgatctggatggggttggccgtcggtgaggaggtggatga 505
           ||||| |||||| ||||||  |||||||||||||||    |||||| | |||||||||||
Sbjct: 321 gttgacgatggcatcgacggcgatctggatggggttctg-gtcggtcatgaggtggatga 263

                                                                       
Query: 506 tctccatggtgtgcttgatgatgcggacggccatgatcttctttgcccgttgttgcgccc 565
           |||| | || |||   ||  |||||||| ||||||| ||||||   ||||||||||| ||
Sbjct: 262 tctcgaaggcgtgagcgacaatgcggacagccatgagcttcttg--ccgttgttgcgacc 205

                                                                       
Query: 566 gtgcatcatgagggagttggtgaggcgctcgatgatggggcactgcgccttgcggaagcg 625
           |||||||||||||||||||||||| ||||| ||||||||||| |  ||||||||||| ||
Sbjct: 204 gtgcatcatgagggagttggtgagacgctcaatgatggggcagttggccttgcggaaacg 145

                 
Query: 626 cttggc 631
           ||||||
Sbjct: 144 cttggc 139



to top

>ref|XM_329833.1| Neurospora crassa OR74A 40S RIBOSOMAL PROTEIN S5 (NCU09475.1)
           partial mRNA
          Length = 582

 Score =  141 bits (71), Expect = 4e-30
 Identities = 116/131 (88%)
 Strand = Plus / Minus

                                                                       
Query: 185 ttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgtt 244
           ||||||||| | ||||||||||||||||| ||| ||||||||||||||||||||   |||
Sbjct: 582 ttaacggttggacttggcaacacgctcgagctcatccttcttcttgatggcgtacgagtt 523

                                                                       
Query: 245 ggatgagcccttggcagcattgatcagctcatcagcaaggcactcagcaatggtcttgac 304
           ||| ||||||||||| || ||||||||||| |||||||||||||| ||||||| ||||||
Sbjct: 522 ggaggagcccttggcggcgttgatcagctcctcagcaaggcactcggcaatggacttgac 463

                      
Query: 305 attacggaaag 315
            || |||||||
Sbjct: 462 gttgcggaaag 452



 Score =  117 bits (59), Expect = 5e-23
 Identities = 156/186 (83%), Gaps = 3/186 (1%)
 Strand = Plus / Minus

                                                                       
Query: 446 gttgatgatggcgtcgacgatgatctggatggggttggccgtcggtgaggaggtggatga 505
           ||||| |||||| ||||||  |||||||||||||||    |||||| | |||||||||||
Sbjct: 321 gttgacgatggcatcgacggcgatctggatggggttctg-gtcggtcatgaggtggatga 263

                                                                       
Query: 506 tctccatggtgtgcttgatgatgcggacggccatgatcttctttgcccgttgttgcgccc 565
           |||| | || |||   ||  |||||||| ||||||| ||||||   ||||||||||| ||
Sbjct: 262 tctcgaaggcgtgagcgacaatgcggacagccatgagcttcttg--ccgttgttgcgacc 205

                                                                       
Query: 566 gtgcatcatgagggagttggtgaggcgctcgatgatggggcactgcgccttgcggaagcg 625
           |||||||||||||||||||||||| ||||| ||||||||||| |  ||||||||||| ||
Sbjct: 204 gtgcatcatgagggagttggtgagacgctcaatgatggggcagttggccttgcggaaacg 145

                 
Query: 626 cttggc 631
           ||||||
Sbjct: 144 cttggc 139



to top

>emb|BX842597.1| Neurospora crassa DNA linkage group II BAC clone B22K18
          Length = 75214

 Score =  141 bits (71), Expect = 4e-30
 Identities = 116/131 (88%)
 Strand = Plus / Minus

                                                                         
Query: 185   ttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgtt 244
             ||||||||| | ||||||||||||||||| ||| ||||||||||||||||||||   |||
Sbjct: 73211 ttaacggttggacttggcaacacgctcgagctcatccttcttcttgatggcgtacgagtt 73152

                                                                         
Query: 245   ggatgagcccttggcagcattgatcagctcatcagcaaggcactcagcaatggtcttgac 304
             ||| ||||||||||| || ||||||||||| |||||||||||||| ||||||| ||||||
Sbjct: 73151 ggaggagcccttggcggcgttgatcagctcctcagcaaggcactcggcaatggacttgac 73092

                        
Query: 305   attacggaaag 315
              || |||||||
Sbjct: 73091 gttgcggaaag 73081



 Score =  109 bits (55), Expect = 1e-20
 Identities = 94/106 (88%), Gaps = 2/106 (1%)
 Strand = Plus / Minus

                                                                         
Query: 526   atgcggacggccatgatcttctttgcccgttgttgcgcccgtgcatcatgagggagttgg 585
             |||||||| ||||||| ||||||   ||||||||||| ||||||||||||||||||||||
Sbjct: 72796 atgcggacagccatgagcttcttg--ccgttgttgcgaccgtgcatcatgagggagttgg 72739

                                                           
Query: 586   tgaggcgctcgatgatggggcactgcgccttgcggaagcgcttggc 631
             |||| ||||| ||||||||||| |  ||||||||||| ||||||||
Sbjct: 72738 tgagacgctcaatgatggggcagttggccttgcggaaacgcttggc 72693



 Score = 40.1 bits (20), Expect = 9.7
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                                 
Query: 446   gttgatgatggcgtcgacgatgatctggatggggtt 481
             ||||| |||||| ||||||  |||||||||||||||
Sbjct: 72950 gttgacgatggcatcgacggcgatctggatggggtt 72915



to top

>emb|BX842596.1| Neurospora crassa DNA linkage group II BAC clone B10K17
          Length = 77292

 Score =  141 bits (71), Expect = 4e-30
 Identities = 116/131 (88%)
 Strand = Plus / Plus

                                                                         
Query: 185   ttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgtt 244
             ||||||||| | ||||||||||||||||| ||| ||||||||||||||||||||   |||
Sbjct: 44634 ttaacggttggacttggcaacacgctcgagctcatccttcttcttgatggcgtacgagtt 44693

                                                                         
Query: 245   ggatgagcccttggcagcattgatcagctcatcagcaaggcactcagcaatggtcttgac 304
             ||| ||||||||||| || ||||||||||| |||||||||||||| ||||||| ||||||
Sbjct: 44694 ggaggagcccttggcggcgttgatcagctcctcagcaaggcactcggcaatggacttgac 44753

                        
Query: 305   attacggaaag 315
              || |||||||
Sbjct: 44754 gttgcggaaag 44764



 Score =  109 bits (55), Expect = 1e-20
 Identities = 94/106 (88%), Gaps = 2/106 (1%)
 Strand = Plus / Plus

                                                                         
Query: 526   atgcggacggccatgatcttctttgcccgttgttgcgcccgtgcatcatgagggagttgg 585
             |||||||| ||||||| ||||||   ||||||||||| ||||||||||||||||||||||
Sbjct: 45049 atgcggacagccatgagcttcttg--ccgttgttgcgaccgtgcatcatgagggagttgg 45106

                                                           
Query: 586   tgaggcgctcgatgatggggcactgcgccttgcggaagcgcttggc 631
             |||| ||||| ||||||||||| |  ||||||||||| ||||||||
Sbjct: 45107 tgagacgctcaatgatggggcagttggccttgcggaaacgcttggc 45152



 Score = 40.1 bits (20), Expect = 9.7
 Identities = 32/36 (88%)
 Strand = Plus / Plus

                                                 
Query: 446   gttgatgatggcgtcgacgatgatctggatggggtt 481
             ||||| |||||| ||||||  |||||||||||||||
Sbjct: 44895 gttgacgatggcatcgacggcgatctggatggggtt 44930



to top

>emb|AJ439528.1|PSP439528 Polytomella sp. 'Pringsheim 198.80' mRNA for 40S ribosomal protein
           s5 (rs5 gene)
          Length = 885

 Score =  139 bits (70), Expect = 1e-29
 Identities = 112/126 (88%)
 Strand = Plus / Minus

                                                                       
Query: 191 gttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgttggatga 250
           ||||||||||||||| ||||||||||| ||||||||||| ||||| || |||||||| ||
Sbjct: 588 gttagccttggcaacgcgctcgatctcatccttcttcttaatggcatagctgttggagga 529

                                                                       
Query: 251 gcccttggcagcattgatcagctcatcagcaaggcactcagcaatggtcttgacattacg 310
            |||||||| ||||| || ||||||||||| | ||||||||||||||||||||  |||||
Sbjct: 528 acccttggcggcattcatgagctcatcagccaagcactcagcaatggtcttgatgttacg 469

                 
Query: 311 gaaagc 316
           ||||||
Sbjct: 468 gaaagc 463



 Score = 71.9 bits (36), Expect = 3e-09
 Identities = 81/95 (85%), Gaps = 2/95 (2%)
 Strand = Plus / Minus

                                                                       
Query: 495 gaggtggatgatctccatggtgtgcttgatgatgcggacggccatgatcttctttgcccg 554
           |||||||||||| || | || ||||||||  |||||||| ||||| | |||||||  |||
Sbjct: 285 gaggtggatgatgtcaaaggcgtgcttgacaatgcggacagccataagcttcttt--ccg 228

                                              
Query: 555 ttgttgcgcccgtgcatcatgagggagttggtgag 589
           |||||||| || ||||||||||||||| |||||||
Sbjct: 227 ttgttgcggccatgcatcatgagggaggtggtgag 193



to top

>gb|AY785292.1| Callinectes sapidus receptor guanylyl cyclase (GC-YO1) mRNA, complete
            cds
          Length = 4010

 Score =  137 bits (69), Expect = 6e-29
 Identities = 174/209 (83%)
 Strand = Plus / Minus

                                                                        
Query: 183  tcttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactg 242
            ||||||||||| | ||| || || ||||| | |||||||||||||||||||||||| |||
Sbjct: 3943 tcttaacggttggactttgccacgcgctccagctcgtccttcttcttgatggcgtagctg 3884

                                                                        
Query: 243  ttggatgagcccttggcagcattgatcagctcatcagcaaggcactcagcaatggtcttg 302
            ||||| |||||| |||  || ||||| ||||||||||| |  |||||||| |||||||||
Sbjct: 3883 ttggaggagcccctggatgcgttgatgagctcatcagccaaacactcagcgatggtcttg 3824

                                                                        
Query: 303  acattacggaaagcgctctccctggcaccagtggtcagaaggtagatggcctggttcacc 362
            |  |||||||| ||   ||| |  ||||| |||||||| ||  ||||||||||||| |||
Sbjct: 3823 atgttacggaaggcagcctcgcgagcaccggtggtcagcagccagatggcctggttgacc 3764

                                         
Query: 363  ctcctgaggggggagatatccacagcctg 391
            ||||||||||| || | ||||||||||||
Sbjct: 3763 ctcctgaggggcgacacatccacagcctg 3735



to top

>ref|XM_653355.1| Aspergillus nidulans FGSC A4 40S ribosomal protein S5 (AN0843.2),
           mRNA
          Length = 570

 Score =  127 bits (64), Expect = 5e-26
 Identities = 103/115 (89%), Gaps = 2/115 (1%)
 Strand = Plus / Minus

                                                                       
Query: 526 atgcggacggccatgatcttctttgcccgttgttgcgcccgtgcatcatgagggagttgg 585
           ||||| || ||||||| |||||||  ||||||||||| |||| ||||||||  |||||||
Sbjct: 230 atgcgaacagccatgagcttcttt--ccgttgttgcggccgttcatcatgatagagttgg 173

                                                                  
Query: 586 tgaggcgctcgatgatggggcactgcgccttgcggaagcgcttggccgagtagcg 640
           ||||||||||||||||||||||||| |||||||||||||||||||| | ||||||
Sbjct: 172 tgaggcgctcgatgatggggcactgagccttgcggaagcgcttggcggcgtagcg 118



 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 85/100 (85%)
 Strand = Plus / Minus

                                                                       
Query: 204 acacgctcgatctcgtccttcttcttgatggcgtaactgttggatgagcccttggcagca 263
           |||||||| | |||||||||||||||||| |||||   ||||||   ||||||||| || 
Sbjct: 551 acacgctcaagctcgtccttcttcttgatagcgtaggagttggagctgcccttggcggcg 492

                                                   
Query: 264 ttgatcagctcatcagcaaggcactcagcaatggtcttga 303
           ||||| ||||| ||||||||||||||||| ||| ||||||
Sbjct: 491 ttgataagctcctcagcaaggcactcagcgatgctcttga 452



to top

>gb|AY498744.1| Capsicum annuum 40S ribosomal protein S5 (RpS5) mRNA, complete cds
          Length = 853

 Score =  125 bits (63), Expect = 2e-25
 Identities = 195/239 (81%)
 Strand = Plus / Minus

                                                                       
Query: 213 atctcgtccttcttcttgatggcgtaactgttggatgagcccttggcagcattgatcagc 272
           ||||| ||||||||||| ||||| || || || || || || || ||||||||||| || 
Sbjct: 649 atctcatccttcttcttaatggcatagctatttgaagaacctttagcagcattgatgagt 590

                                                                       
Query: 273 tcatcagcaaggcactcagcaatggtcttgacattacggaaagcgctctccctggcacca 332
           |||||||||||||| ||||||||||||||||  || | |||||| ||||| |  ||||||
Sbjct: 589 tcatcagcaaggcattcagcaatggtcttgatgttcctgaaagcactctcacgagcacca 530

                                                                       
Query: 333 gtggtcagaaggtagatggcctggttcaccctcctgaggggggagatatccacagcctgt 392
           || ||||| |  ||||| |||||||| || |  |  ||||| || ||||||||||| || 
Sbjct: 529 gttgtcagcaaatagattgcctggttaacacggcgaaggggagaaatatccacagcttga 470

                                                                      
Query: 393 ctcctcacaacaccagctgacccaatacgggtagcatcctcacgtggcccactgttgat 451
           |  || |||||||||||||| |||||||| |||||||| || | |||||||||||||||
Sbjct: 469 cgtctgacaacaccagctgaaccaatacgagtagcatcttcccttggcccactgttgat 411



 Score = 40.1 bits (20), Expect = 9.7
 Identities = 104/131 (79%), Gaps = 2/131 (1%)
 Strand = Plus / Minus

                                                                       
Query: 502 atgatctccatggtgtgcttgatgatgcggacggccatgatcttctttgcccgttgttgc 561
           ||||||||||| |  ||||| || ||||| || ||||| | ||||||  ||||||||| |
Sbjct: 361 atgatctccattgcatgcttaataatgcgaacagccatcagcttctt--cccgttgttcc 304

                                                                       
Query: 562 gcccgtgcatcatgagggagttggtgaggcgctcgatgatggggcactgcgccttgcgga 621
             || ||||||||||| || |||||||| | ||| |  || |||||||| ||||| | ||
Sbjct: 303 taccatgcatcatgagagaattggtgagcctctcaacaattgggcactgagccttcctga 244

                      
Query: 622 agcgcttggcc 632
           | |||||||||
Sbjct: 243 aacgcttggcc 233



to top

>gb|AY130451.1| Petromyzon marinus ribosomal protein S5 mRNA, partial cds
          Length = 555

 Score =  125 bits (63), Expect = 2e-25
 Identities = 135/158 (85%), Gaps = 2/158 (1%)
 Strand = Plus / Minus

                                                                       
Query: 488 cggtgaggaggtggatgatctccatggtgtgcttgatgatgcggacggccatgatcttct 547
           |||||||||||||||||||||| | || |||||||| ||| || |||| ||| | |||||
Sbjct: 265 cggtgaggaggtggatgatctcgaaggcgtgcttgacgatacgcacggtcatcagcttct 206

                                                                       
Query: 548 ttgcccgttgttgcgcccgtgcatcatgagggagttggtgaggcgctcgatgatggggca 607
           |   ||||||||||| ||||||||||| | |||||||||||||||||| | |||||||||
Sbjct: 205 tg--ccgttgttgcgtccgtgcatcatcatggagttggtgaggcgctccacgatggggca 148

                                                 
Query: 608 ctgcgccttgcggaagcgcttggccgagtagcgcccgg 645
            || ||||||||||| |||||||| | |||||| ||||
Sbjct: 147 ttgtgccttgcggaaccgcttggcggcgtagcggccgg 110



 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 74/86 (86%)
 Strand = Plus / Minus

                                                                       
Query: 204 acacgctcgatctcgtccttcttcttgatggcgtaactgttggatgagcccttggcagca 263
           |||||||| | ||| || |||||| ||||||||||   |||||| |||||||||||||| 
Sbjct: 548 acacgctccagctcatctttcttcctgatggcgtacgagttggaagagcccttggcagcg 489

                                     
Query: 264 ttgatcagctcatcagcaaggcactc 289
           ||||| ||||||||||| ||||||||
Sbjct: 488 ttgatgagctcatcagcgaggcactc 463



to top

>ref|NM_001015531.1| Bos taurus ribosomal protein S5 (RPS5), mRNA
          Length = 714

 Score =  121 bits (61), Expect = 3e-24
 Identities = 124/144 (86%), Gaps = 2/144 (1%)
 Strand = Plus / Minus

                                                                       
Query: 490 gtgaggaggtggatgatctccatggtgtgcttgatgatgcggacggccatgatcttcttt 549
           ||||| || ||||||||||| | || |||||||| |||||| |||| ||||| |||||| 
Sbjct: 368 gtgagcagatggatgatctcaaaggcgtgcttgacgatgcgcacggtcatgagcttcttg 309

                                                                       
Query: 550 gcccgttgttgcgcccgtgcatcatgagggagttggtgaggcgctcgatgatggggcact 609
             || |||||||| || |||||||| | |||||||||||||||||| | |||||||||||
Sbjct: 308 --ccattgttgcggccatgcatcatcatggagttggtgaggcgctccacgatggggcact 251

                                   
Query: 610 gcgccttgcggaagcgcttggccg 633
           | ||||||||||||||||||||||
Sbjct: 250 gtgccttgcggaagcgcttggccg 227



 Score = 85.7 bits (43), Expect = 2e-13
 Identities = 97/115 (84%)
 Strand = Plus / Minus

                                                                       
Query: 189 cggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgttggat 248
           ||||||| |||||| || ||||| | ||||||||||||||||||||||||    ||||| 
Sbjct: 668 cggttagacttggccacgcgctccagctcgtccttcttcttgatggcgtaggaattggag 609

                                                                  
Query: 249 gagcccttggcagcattgatcagctcatcagcaaggcactcagcaatggtcttga 303
           |||||||| || || ||||| || ||||| || |||||||| |||||||||||||
Sbjct: 608 gagcccttagctgcgttgattagttcatccgccaggcactcggcaatggtcttga 554



to top

>gb|BC102374.1| Bos taurus ribosomal protein S5, mRNA (cDNA clone MGC:127574
           IMAGE:7951084), complete cds
          Length = 746

 Score =  121 bits (61), Expect = 3e-24
 Identities = 124/144 (86%), Gaps = 2/144 (1%)
 Strand = Plus / Minus

                                                                       
Query: 490 gtgaggaggtggatgatctccatggtgtgcttgatgatgcggacggccatgatcttcttt 549
           ||||| || ||||||||||| | || |||||||| |||||| |||| ||||| |||||| 
Sbjct: 385 gtgagcagatggatgatctcaaaggcgtgcttgacgatgcgcacggtcatgagcttcttg 326

                                                                       
Query: 550 gcccgttgttgcgcccgtgcatcatgagggagttggtgaggcgctcgatgatggggcact 609
             || |||||||| || |||||||| | |||||||||||||||||| | |||||||||||
Sbjct: 325 --ccattgttgcggccatgcatcatcatggagttggtgaggcgctccacgatggggcact 268

                                   
Query: 610 gcgccttgcggaagcgcttggccg 633
           | ||||||||||||||||||||||
Sbjct: 267 gtgccttgcggaagcgcttggccg 244



 Score = 85.7 bits (43), Expect = 2e-13
 Identities = 97/115 (84%)
 Strand = Plus / Minus

                                                                       
Query: 189 cggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgttggat 248
           ||||||| |||||| || ||||| | ||||||||||||||||||||||||    ||||| 
Sbjct: 685 cggttagacttggccacgcgctccagctcgtccttcttcttgatggcgtaggaattggag 626

                                                                  
Query: 249 gagcccttggcagcattgatcagctcatcagcaaggcactcagcaatggtcttga 303
           |||||||| || || ||||| || ||||| || |||||||| |||||||||||||
Sbjct: 625 gagcccttagctgcgttgattagttcatccgccaggcactcggcaatggtcttga 571



to top

>gb|BT021032.1| Bos taurus ribosomal protein S5 (RPS5), mRNA, complete cds
          Length = 714

 Score =  121 bits (61), Expect = 3e-24
 Identities = 124/144 (86%), Gaps = 2/144 (1%)
 Strand = Plus / Minus

                                                                       
Query: 490 gtgaggaggtggatgatctccatggtgtgcttgatgatgcggacggccatgatcttcttt 549
           ||||| || ||||||||||| | || |||||||| |||||| |||| ||||| |||||| 
Sbjct: 368 gtgagcagatggatgatctcaaaggcgtgcttgacgatgcgcacggtcatgagcttcttg 309

                                                                       
Query: 550 gcccgttgttgcgcccgtgcatcatgagggagttggtgaggcgctcgatgatggggcact 609
             || |||||||| || |||||||| | |||||||||||||||||| | |||||||||||
Sbjct: 308 --ccattgttgcggccatgcatcatcatggagttggtgaggcgctccacgatggggcact 251

                                   
Query: 610 gcgccttgcggaagcgcttggccg 633
           | ||||||||||||||||||||||
Sbjct: 250 gtgccttgcggaagcgcttggccg 227



 Score = 85.7 bits (43), Expect = 2e-13
 Identities = 97/115 (84%)
 Strand = Plus / Minus

                                                                       
Query: 189 cggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgttggat 248
           ||||||| |||||| || ||||| | ||||||||||||||||||||||||    ||||| 
Sbjct: 668 cggttagacttggccacgcgctccagctcgtccttcttcttgatggcgtaggaattggag 609

                                                                  
Query: 249 gagcccttggcagcattgatcagctcatcagcaaggcactcagcaatggtcttga 303
           |||||||| || || ||||| || ||||| || |||||||| |||||||||||||
Sbjct: 608 gagcccttagctgcgttgattagttcatccgccaggcactcggcaatggtcttga 554



to top

>emb|BX824064.1|CNS0A6PV Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH19ZG11 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 802

 Score =  119 bits (60), Expect = 1e-23
 Identities = 105/120 (87%)
 Strand = Plus / Minus

                                                                       
Query: 184 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 243
           ||||||| |||||||||||||| |  || ||||| ||||||||||||||||| || ||||
Sbjct: 682 cttaacgattagccttggcaactctttcaatctcatccttcttcttgatggcatagctgt 623

                                                                       
Query: 244 tggatgagcccttggcagcattgatcagctcatcagcaaggcactcagcaatggtcttga 303
           |||| ||||||||||| || |||||||  |||||||||||||||||||| || |||||||
Sbjct: 622 tggaagagcccttggctgcgttgatcaattcatcagcaaggcactcagctatagtcttga 563



 Score =  109 bits (55), Expect = 1e-20
 Identities = 197/242 (81%), Gaps = 3/242 (1%)
 Strand = Plus / Minus

                                                                       
Query: 375 gagatatccacagcctgtctcctcacaacaccagctgacccaatacgggtagcatcctca 434
           |||||||| ||||| |||||||| ||||||||||| || ||||| | ||||||||| |||
Sbjct: 491 gagatatcaacagcttgtctcctaacaacaccagcagatccaattctggtagcatcttca 432

                                                                       
Query: 435 cgtggcccactgttgatgatggcgtcgacgatgatctggatggggttggccgtcggtgag 494
           ||||| ||||||||||  |||||||| | ||||| ||| || |||||    ||| |  | 
Sbjct: 431 cgtggaccactgttgacaatggcgtcaatgatgacctgaattgggtt-caagtcagacaa 373

                                                                       
Query: 495 gaggtggatgatctccatggtgtgcttgatgatgcggacggccatgatcttctttgcccg 554
           ||||||||| |||||||||| |||||||| ||| | ||| ||||| |  |||||   |||
Sbjct: 372 gaggtggataatctccatggcgtgcttgacgatcctgacagccatcaatttctt--accg 315

                                                                       
Query: 555 ttgttgcgcccgtgcatcatgagggagttggtgaggcgctcgatgatggggcactgcgcc 614
           ||||| | ||||||||||||||| ||||||||||| | ||| |  ||||||||||| |||
Sbjct: 314 ttgttcctcccgtgcatcatgagagagttggtgagcctctcaacaatggggcactgagcc 255

             
Query: 615 tt 616
           ||
Sbjct: 254 tt 253



to top

>ref|XM_747778.1| Aspergillus fumigatus Af293 40S ribosomal protein S5 (Afu1g15020)
           partial mRNA
          Length = 696

 Score =  117 bits (59), Expect = 5e-23
 Identities = 104/119 (87%)
 Strand = Plus / Minus

                                                                       
Query: 197 cttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgttggatgagccctt 256
           ||||||||||||||||| |||||||||||||||||||||||||  ||||||    |||||
Sbjct: 684 cttggcaacacgctcgagctcgtccttcttcttgatggcgtaagagttggagcttccctt 625

                                                                      
Query: 257 ggcagcattgatcagctcatcagcaaggcactcagcaatggtcttgacattacggaaag 315
           |||||| ||||| ||||| ||||| |||||||| |||||| ||||||  ||||||||||
Sbjct: 624 ggcagcgttgatgagctcttcagccaggcactcggcaatgctcttgatgttacggaaag 566



 Score =  105 bits (53), Expect = 2e-19
 Identities = 92/104 (88%), Gaps = 2/104 (1%)
 Strand = Plus / Minus

                                                                       
Query: 525 gatgcggacggccatgatcttctttgcccgttgttgcgcccgtgcatcatgagggagttg 584
           ||||||||| ||||||| ||||||   ||||||||||| |||| ||||||||| ||||||
Sbjct: 357 gatgcggacagccatgagcttcttg--ccgttgttgcgaccgttcatcatgagagagttg 300

                                                       
Query: 585 gtgaggcgctcgatgatggggcactgcgccttgcggaagcgctt 628
           || |||||||| |||||||||||||| ||||||||||| |||||
Sbjct: 299 gtcaggcgctcaatgatggggcactgagccttgcggaaacgctt 256



to top

>gb|AY241965.1| Dermacentor variabilis 40S ribosomal protein S5 mRNA, complete cds
          Length = 756

 Score =  117 bits (59), Expect = 5e-23
 Identities = 104/119 (87%)
 Strand = Plus / Minus

                                                                       
Query: 185 ttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgtt 244
           ||||||||| | |||||| |||||||||| |||||||||||||||||| || || |||||
Sbjct: 679 ttaacggttggacttggccacacgctcgagctcgtccttcttcttgatcgcatagctgtt 620

                                                                      
Query: 245 ggatgagcccttggcagcattgatcagctcatcagcaaggcactcagcaatggtcttga 303
            ||||| |||||||| |||||||| ||||||||||| | |||||| |||||||| ||||
Sbjct: 619 cgatgaacccttggctgcattgatgagctcatcagccaagcactcggcaatggttttga 561



 Score = 63.9 bits (32), Expect = 7e-07
 Identities = 59/68 (86%)
 Strand = Plus / Minus

                                                                       
Query: 555 ttgttgcgcccgtgcatcatgagggagttggtgaggcgctcgatgatggggcactgcgcc 614
           |||||||| ||||||||||| | ||||||||| || ||||| |  ||||||||||| |||
Sbjct: 312 ttgttgcggccgtgcatcatcatggagttggtcagacgctccacaatggggcactgggcc 253

                   
Query: 615 ttgcggaa 622
           ||||||||
Sbjct: 252 ttgcggaa 245



 Score = 40.1 bits (20), Expect = 9.7
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 432 tcacgtggcccactgttgatgatggcgt 459
           |||||||| |||||||||||||| ||||
Sbjct: 432 tcacgtggtccactgttgatgatagcgt 405



to top

>emb|Z99168.1|SPAC8C9 S.pombe chromosome I cosmid c8C9
          Length = 36310

 Score =  111 bits (56), Expect = 3e-21
 Identities = 113/132 (85%)
 Strand = Plus / Minus

                                                                         
Query: 185   ttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgtt 244
             ||||||||||  ||||||||||||||| | ||| |||||||||||||||||||||  |||
Sbjct: 14883 ttaacggttactcttggcaacacgctcaagctcatccttcttcttgatggcgtaagagtt 14824

                                                                         
Query: 245   ggatgagcccttggcagcattgatcagctcatcagcaaggcactcagcaatggtcttgac 304
             ||| |||||||| ||||||||||| |  || ||||| | ||| |||| ||||| ||||||
Sbjct: 14823 ggaagagcccttagcagcattgatgatttcttcagccaagcattcagaaatggacttgac 14764

                         
Query: 305   attacggaaagc 316
              |||||||||||
Sbjct: 14763 gttacggaaagc 14752



to top

>emb|AL360054.1|SPAC328 S.pombe chromosome I cosmid c328
          Length = 25985

 Score =  111 bits (56), Expect = 3e-21
 Identities = 113/132 (85%)
 Strand = Plus / Plus

                                                                         
Query: 185   ttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgtt 244
             ||||||||||  ||||||||||||||| | ||| |||||||||||||||||||||  |||
Sbjct: 24717 ttaacggttactcttggcaacacgctcaagctcatccttcttcttgatggcgtaagagtt 24776

                                                                         
Query: 245   ggatgagcccttggcagcattgatcagctcatcagcaaggcactcagcaatggtcttgac 304
             ||| |||||||| ||||||||||| |  || ||||| | ||| |||| ||||| ||||||
Sbjct: 24777 ggaagagcccttagcagcattgatgatttcttcagccaagcattcagaaatggacttgac 24836

                         
Query: 305   attacggaaagc 316
              |||||||||||
Sbjct: 24837 gttacggaaagc 24848



to top

>ref|NM_078658.2| Drosophila melanogaster Ribosomal protein S5a CG8922-RA (RpS5a),
           mRNA
          Length = 855

 Score =  111 bits (56), Expect = 3e-21
 Identities = 104/120 (86%)
 Strand = Plus / Minus

                                                                       
Query: 184 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 243
           |||||||||| | |||||| |||||||| | ||| ||||||||||||||||||||   ||
Sbjct: 740 cttaacggttggacttggcgacacgctccaactcatccttcttcttgatggcgtacgagt 681

                                                                       
Query: 244 tggatgagcccttggcagcattgatcagctcatcagcaaggcactcagcaatggtcttga 303
           |||| || ||||| ||||| ||||||||||||||||| |||||||| || ||||||||||
Sbjct: 680 tggaagatcccttagcagcgttgatcagctcatcagccaggcactcggcgatggtcttga 621



 Score = 50.1 bits (25), Expect = 0.010
 Identities = 94/116 (81%), Gaps = 2/116 (1%)
 Strand = Plus / Minus

                                                                       
Query: 516 gtgcttgatgatgcggacggccatgatcttctttgcccgttgttgcgcccgtgcatcatg 575
           |||||||| |||||||  |||||| | ||||||   ||||||||||| || | |||||| 
Sbjct: 409 gtgcttgacgatgcggcaggccatcagcttcttg--ccgttgttgcgacccttcatcatc 352

                                                                   
Query: 576 agggagttggtgaggcgctcgatgatggggcactgcgccttgcggaagcgcttggc 631
           ||||||  ||| |  ||||| |  ||||||||||| ||||||||||| ||||||||
Sbjct: 351 agggagcaggtcaaacgctccacaatggggcactgggccttgcggaaacgcttggc 296



to top

>gb|AY075368.1| Drosophila melanogaster GM13047 full length cDNA
          Length = 873

 Score =  111 bits (56), Expect = 3e-21
 Identities = 104/120 (86%)
 Strand = Plus / Minus

                                                                       
Query: 184 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 243
           |||||||||| | |||||| |||||||| | ||| ||||||||||||||||||||   ||
Sbjct: 740 cttaacggttggacttggcgacacgctccaactcatccttcttcttgatggcgtacgagt 681

                                                                       
Query: 244 tggatgagcccttggcagcattgatcagctcatcagcaaggcactcagcaatggtcttga 303
           |||| || ||||| ||||| ||||||||||||||||| |||||||| || ||||||||||
Sbjct: 680 tggaagatcccttagcagcgttgatcagctcatcagccaggcactcggcgatggtcttga 621



 Score = 50.1 bits (25), Expect = 0.010
 Identities = 94/116 (81%), Gaps = 2/116 (1%)
 Strand = Plus / Minus

                                                                       
Query: 516 gtgcttgatgatgcggacggccatgatcttctttgcccgttgttgcgcccgtgcatcatg 575
           |||||||| |||||||  |||||| | ||||||   ||||||||||| || | |||||| 
Sbjct: 409 gtgcttgacgatgcggcaggccatcagcttcttg--ccgttgttgcgacccttcatcatc 352

                                                                   
Query: 576 agggagttggtgaggcgctcgatgatggggcactgcgccttgcggaagcgcttggc 631
           ||||||  ||| |  ||||| |  ||||||||||| ||||||||||| ||||||||
Sbjct: 351 agggagcaggtcaaacgctccacaatggggcactgggccttgcggaaacgcttggc 296



to top

>ref|NM_001019702.1| Schizosaccharomyces pombe 972h- hypothetical protein (SPAC8C9.08),
           partial mRNA
          Length = 612

 Score =  111 bits (56), Expect = 3e-21
 Identities = 113/132 (85%)
 Strand = Plus / Minus

                                                                       
Query: 185 ttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgtt 244
           ||||||||||  ||||||||||||||| | ||| |||||||||||||||||||||  |||
Sbjct: 612 ttaacggttactcttggcaacacgctcaagctcatccttcttcttgatggcgtaagagtt 553

                                                                       
Query: 245 ggatgagcccttggcagcattgatcagctcatcagcaaggcactcagcaatggtcttgac 304
           ||| |||||||| ||||||||||| |  || ||||| | ||| |||| ||||| ||||||
Sbjct: 552 ggaagagcccttagcagcattgatgatttcttcagccaagcattcagaaatggacttgac 493

                       
Query: 305 attacggaaagc 316
            |||||||||||
Sbjct: 492 gttacggaaagc 481



to top

>ref|NM_001019635.1| Schizosaccharomyces pombe 972h- hypothetical protein (SPAC328.10c),
           partial mRNA
          Length = 612

 Score =  111 bits (56), Expect = 3e-21
 Identities = 113/132 (85%)
 Strand = Plus / Minus

                                                                       
Query: 185 ttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgtt 244
           ||||||||||  ||||||||||||||| | ||| |||||||||||||||||||||  |||
Sbjct: 612 ttaacggttactcttggcaacacgctcaagctcatccttcttcttgatggcgtaagagtt 553

                                                                       
Query: 245 ggatgagcccttggcagcattgatcagctcatcagcaaggcactcagcaatggtcttgac 304
           ||| |||||||| ||||||||||| |  || ||||| | ||| |||| ||||| ||||||
Sbjct: 552 ggaagagcccttagcagcattgatgatttcttcagccaagcattcagaaatggacttgac 493

                       
Query: 305 attacggaaagc 316
            |||||||||||
Sbjct: 492 gttacggaaagc 481



to top

>emb|BX822925.1|CNS0A746 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB73ZD08 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 752

 Score =  111 bits (56), Expect = 3e-21
 Identities = 104/120 (86%)
 Strand = Plus / Minus

                                                                       
Query: 184 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 243
           ||||||| |||||||||||||| |  || ||||| ||||||||||||||||| || ||||
Sbjct: 630 cttaacgattagccttggcaactctttcaatctcatccttcttcttgatggcatagctgt 571

                                                                       
Query: 244 tggatgagcccttggcagcattgatcagctcatcagcaaggcactcagcaatggtcttga 303
           |||| ||||||||||| || |||||||  |||||||| ||||||||||| || |||||||
Sbjct: 570 tggaagagcccttggctgcgttgatcaattcatcagcgaggcactcagctatagtcttga 511



 Score = 91.7 bits (46), Expect = 3e-15
 Identities = 188/233 (80%), Gaps = 3/233 (1%)
 Strand = Plus / Minus

                                                                       
Query: 384 acagcctgtctcctcacaacaccagctgacccaatacgggtagcatcctcacgtggccca 443
           ||||| |||||||| ||||||||||| || ||||| | ||||||||| |||||||| |||
Sbjct: 430 acagcttgtctcctaacaacaccagcagatccaattctggtagcatcttcacgtggacca 371

                                                                       
Query: 444 ctgttgatgatggcgtcgacgatgatctggatggggttggccgtcggtgaggaggtggat 503
           |||||||  |||||||| | ||||| ||| || |||||    ||| |  | |||||||||
Sbjct: 370 ctgttgaaaatggcgtcaatgatgacctgaattgggtt-caagtcagacaagaggtggat 312

                                                                       
Query: 504 gatctccatggtgtgcttgatgatgcggacggccatgatcttctttgcccgttgttgcgc 563
            |||||||||| |||||||| ||| |  || ||||| |  |||||   |||||||| | |
Sbjct: 311 aatctccatggcgtgcttgacgatcctcacagccatcaatttctt--accgttgttcctc 254

                                                                
Query: 564 ccgtgcatcatgagggagttggtgaggcgctcgatgatggggcactgcgcctt 616
           |||||||||||||| ||||||||||| | ||| |  ||||||||||| |||||
Sbjct: 253 ccgtgcatcatgagagagttggtgagcctctcaacaatggggcactgagcctt 201



to top

>gb|U48394.1|DMU48394 Drosophila melanogaster ribosomal protein S5 homolog (M(1)15D)
           mRNA, complete cds
          Length = 860

 Score =  111 bits (56), Expect = 3e-21
 Identities = 104/120 (86%)
 Strand = Plus / Minus

                                                                       
Query: 184 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 243
           |||||||||| | |||||| |||||||| | ||| ||||||||||||||||||||   ||
Sbjct: 744 cttaacggttggacttggcgacacgctccaactcatccttcttcttgatggcgtacgagt 685

                                                                       
Query: 244 tggatgagcccttggcagcattgatcagctcatcagcaaggcactcagcaatggtcttga 303
           |||| || ||||| ||||| ||||||||||||||||| |||||||| || ||||||||||
Sbjct: 684 tggaagatcccttagcagcgttgatcagctcatcagccaggcactcggcgatggtcttga 625



 Score = 50.1 bits (25), Expect = 0.010
 Identities = 94/116 (81%), Gaps = 2/116 (1%)
 Strand = Plus / Minus

                                                                       
Query: 516 gtgcttgatgatgcggacggccatgatcttctttgcccgttgttgcgcccgtgcatcatg 575
           |||||||| |||||||  |||||| | ||||||   ||||||||||| || | |||||| 
Sbjct: 413 gtgcttgacgatgcggcaggccatcagcttcttg--ccgttgttgcgacccttcatcatc 356

                                                                   
Query: 576 agggagttggtgaggcgctcgatgatggggcactgcgccttgcggaagcgcttggc 631
           ||||||  ||| |  ||||| |  ||||||||||| ||||||||||| ||||||||
Sbjct: 355 agggagcaggtcaaacgctccacaatggggcactgggccttgcggaaacgcttggc 300



to top

>gb|AY837869.1| Trichoplusia ni ribosomal protein S5 mRNA, complete cds
          Length = 782

 Score =  109 bits (55), Expect = 1e-20
 Identities = 103/119 (86%)
 Strand = Plus / Minus

                                                                       
Query: 185 ttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgtt 244
           ||||||||| | ||| ||||||||||| | ||| |||||||||||||||||||||  |||
Sbjct: 696 ttaacggttggacttagcaacacgctccaactcatccttcttcttgatggcgtaagagtt 637

                                                                      
Query: 245 ggatgagcccttggcagcattgatcagctcatcagcaaggcactcagcaatggtcttga 303
            ||||| ||||| ||||| ||||| ||||| |||||||  |||||||||||||||||||
Sbjct: 636 tgatgaacccttagcagcgttgatgagctcgtcagcaacacactcagcaatggtcttga 578



 Score = 52.0 bits (26), Expect = 0.003
 Identities = 65/78 (83%)
 Strand = Plus / Minus

                                                                       
Query: 552 ccgttgttgcgcccgtgcatcatgagggagttggtgaggcgctcgatgatggggcactgc 611
           |||||||| || ||||||||||| || ||||| || | |||||| |  ||||||||||| 
Sbjct: 332 ccgttgttacgtccgtgcatcatcagagagtttgtcaagcgctcaacaatggggcactgg 273

                             
Query: 612 gccttgcggaagcgcttg 629
           ||||| ||||| ||||||
Sbjct: 272 gcctttcggaaacgcttg 255



to top

>ref|XM_386195.1| Gibberella zeae PH-1 chromosome 3 RS5_CICAR 40S RIBOSOMAL PROTEIN
           S5 (FG06019.1) partial mRNA
          Length = 546

 Score =  107 bits (54), Expect = 5e-20
 Identities = 135/162 (83%)
 Strand = Plus / Minus

                                                                       
Query: 197 cttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgttggatgagccctt 256
           |||||| |||||||| | ||| |||||||||||||| ||||||  ||||   || |||||
Sbjct: 534 cttggccacacgctccaactcatccttcttcttgatagcgtaagagttgctggaaccctt 475

                                                                       
Query: 257 ggcagcattgatcagctcatcagcaaggcactcagcaatggtcttgacattacggaaagc 316
           |||||| ||||| ||||| |||||||||||||| ||||||| ||||||||| ||||||| 
Sbjct: 474 ggcagcgttgataagctcctcagcaaggcactcggcaatggacttgacattgcggaaaga 415

                                                     
Query: 317 gctctccctggcaccagtggtcagaaggtagatggcctggtt 358
           |  ||| | |||||||||||| || ||  |||| ||||||||
Sbjct: 414 ggcctcgcgggcaccagtggtgaggagagagatagcctggtt 373



 Score = 46.1 bits (23), Expect = 0.16
 Identities = 83/102 (81%), Gaps = 2/102 (1%)
 Strand = Plus / Minus

                                                                       
Query: 529 cggacggccatgatcttctttgcccgttgttgcgcccgtgcatcatgagggagttggtga 588
           ||||| ||||||| |||||||  ||||||||||| |||||   ||| || |||||||| |
Sbjct: 203 cggacagccatgagcttcttt--ccgttgttgcggccgtggtgcatcagagagttggtca 146

                                                     
Query: 589 ggcgctcgatgatggggcactgcgccttgcggaagcgcttgg 630
             ||||| ||||| ||||| |  ||||||||||| |||||||
Sbjct: 145 atcgctcaatgatagggcagttggccttgcggaatcgcttgg 104



to top

>ref|XM_512950.1| PREDICTED: Pan troglodytes similar to ribosomal protein S5; 40S
           ribosomal protein S5 (LOC456347), mRNA
          Length = 678

 Score =  105 bits (53), Expect = 2e-19
 Identities = 92/105 (87%)
 Strand = Plus / Minus

                                                                       
Query: 197 cttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgttggatgagccctt 256
           |||||| |||||||| | ||||||||||||||| ||||| ||   ||| || ||||||||
Sbjct: 614 cttggccacacgctccagctcgtccttcttcttaatggcataggagttcgaggagccctt 555

                                                        
Query: 257 ggcagcattgatcagctcatcagcaaggcactcagcaatggtctt 301
           |||||||||||| |||||||| || ||||||||||||||||||||
Sbjct: 554 ggcagcattgatgagctcatctgccaggcactcagcaatggtctt 510



 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 117/142 (82%), Gaps = 2/142 (1%)
 Strand = Plus / Minus

                                                                       
Query: 490 gtgaggaggtggatgatctccatggtgtgcttgatgatgcggacggccatgatcttcttt 549
           ||||| ||||| |||||||| | ||  ||||||| |||||| || | ||||| |||||| 
Sbjct: 334 gtgagcaggtgtatgatctcgaaggcatgcttgacgatgcgcacagtcatgagcttcttg 275

                                                                       
Query: 550 gcccgttgttgcgcccgtgcatcatgagggagttggtgaggcgctcgatgatggggcact 609
             ||||||||||| ||||||||||| | |||||| ||||||||||| |  ||||| ||||
Sbjct: 274 --ccgttgttgcggccgtgcatcatcatggagttagtgaggcgctccacaatgggacact 217

                                 
Query: 610 gcgccttgcggaagcgcttggc 631
           | || ||||||||||| |||||
Sbjct: 216 gagctttgcggaagcgtttggc 195



 Score = 40.1 bits (20), Expect = 9.7
 Identities = 41/48 (85%)
 Strand = Plus / Minus

                                                           
Query: 346 agatggcctggttcaccctcctgaggggggagatatccacagcctgtc 393
           |||||||||||||||| |  |  |||||||| | ||||||||||||||
Sbjct: 465 agatggcctggttcacacggcgcaggggggacacatccacagcctgtc 418



to top

>gb|BC015405.1| Homo sapiens ribosomal protein S5, mRNA (cDNA clone MGC:21949
           IMAGE:4390892), complete cds
          Length = 743

 Score =  105 bits (53), Expect = 2e-19
 Identities = 92/105 (87%)
 Strand = Plus / Minus

                                                                       
Query: 197 cttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgttggatgagccctt 256
           |||||| |||||||| | ||||||||||||||| ||||| ||   ||| || ||||||||
Sbjct: 663 cttggccacacgctccagctcgtccttcttcttaatggcataggagttcgaggagccctt 604

                                                        
Query: 257 ggcagcattgatcagctcatcagcaaggcactcagcaatggtctt 301
           |||||||||||| |||||||| || ||||||||||||||||||||
Sbjct: 603 ggcagcattgatgagctcatctgccaggcactcagcaatggtctt 559



 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 117/142 (82%), Gaps = 2/142 (1%)
 Strand = Plus / Minus

                                                                       
Query: 490 gtgaggaggtggatgatctccatggtgtgcttgatgatgcggacggccatgatcttcttt 549
           ||||| ||||| |||||||| | ||  ||||||| |||||| || | ||||| |||||| 
Sbjct: 371 gtgagcaggtgtatgatctcgaaggcatgcttgacgatgcgcacagtcatgagcttcttg 312

                                                                       
Query: 550 gcccgttgttgcgcccgtgcatcatgagggagttggtgaggcgctcgatgatggggcact 609
             ||||||||||| ||||||||||| | |||||| ||||||||||| |  ||||| ||||
Sbjct: 311 --ccgttgttgcggccgtgcatcatcatggagttagtgaggcgctccacaatgggacact 254

                                 
Query: 610 gcgccttgcggaagcgcttggc 631
           | || ||||||||||| |||||
Sbjct: 253 gagctttgcggaagcgtttggc 232



 Score = 40.1 bits (20), Expect = 9.7
 Identities = 41/48 (85%)
 Strand = Plus / Minus

                                                           
Query: 346 agatggcctggttcaccctcctgaggggggagatatccacagcctgtc 393
           |||||||||||||||| |  |  |||||||| | ||||||||||||||
Sbjct: 514 agatggcctggttcacacggcgcaggggggacacatccacagcctgtc 467



to top

>gb|BC004392.1| Homo sapiens cDNA clone IMAGE:3635299, **** WARNING: chimeric clone
            ****
          Length = 4791

 Score =  105 bits (53), Expect = 2e-19
 Identities = 92/105 (87%)
 Strand = Plus / Plus

                                                                        
Query: 197  cttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgttggatgagccctt 256
            |||||| |||||||| | ||||||||||||||| ||||| ||   ||| || ||||||||
Sbjct: 1811 cttggccacacgctccagctcgtccttcttcttaatggcataggagttcgaggagccctt 1870

                                                         
Query: 257  ggcagcattgatcagctcatcagcaaggcactcagcaatggtctt 301
            |||||||||||| |||||||| || ||||||||||||||||||||
Sbjct: 1871 ggcagcattgatgagctcatctgccaggcactcagcaatggtctt 1915



 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 117/142 (82%), Gaps = 2/142 (1%)
 Strand = Plus / Plus

                                                                        
Query: 490  gtgaggaggtggatgatctccatggtgtgcttgatgatgcggacggccatgatcttcttt 549
            ||||| ||||| |||||||| | ||  ||||||| |||||| || | ||||| |||||| 
Sbjct: 2103 gtgagcaggtgtatgatctcgaaggcatgcttgacgatgcgcacagtcatgagcttcttg 2162

                                                                        
Query: 550  gcccgttgttgcgcccgtgcatcatgagggagttggtgaggcgctcgatgatggggcact 609
              ||||||||||| ||||||||||| | |||||| ||||||||||| |  ||||| ||||
Sbjct: 2163 --ccgttgttgcggccgtgcatcatcatggagttagtgaggcgctccacaatgggacact 2220

                                  
Query: 610  gcgccttgcggaagcgcttggc 631
            | || ||||||||||| |||||
Sbjct: 2221 gagctttgcggaagcgtttggc 2242



 Score = 40.1 bits (20), Expect = 9.7
 Identities = 41/48 (85%)
 Strand = Plus / Plus

                                                            
Query: 346  agatggcctggttcaccctcctgaggggggagatatccacagcctgtc 393
            |||||||||||||||| |  |  |||||||| | ||||||||||||||
Sbjct: 1960 agatggcctggttcacacggcgcaggggggacacatccacagcctgtc 2007



to top

>gb|BC015589.2| Homo sapiens cDNA clone IMAGE:4643450, partial cds
          Length = 1512

 Score =  105 bits (53), Expect = 2e-19
 Identities = 92/105 (87%)
 Strand = Plus / Plus

                                                                       
Query: 197 cttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgttggatgagccctt 256
           |||||| |||||||| | ||||||||||||||| ||||| ||   ||| || ||||||||
Sbjct: 108 cttggccacacgctccagctcgtccttcttcttaatggcataggagttcgaggagccctt 167

                                                        
Query: 257 ggcagcattgatcagctcatcagcaaggcactcagcaatggtctt 301
           |||||||||||| |||||||| || ||||||||||||||||||||
Sbjct: 168 ggcagcattgatgagctcatctgccaggcactcagcaatggtctt 212



 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 117/142 (82%), Gaps = 2/142 (1%)
 Strand = Plus / Plus

                                                                       
Query: 490 gtgaggaggtggatgatctccatggtgtgcttgatgatgcggacggccatgatcttcttt 549
           ||||| ||||| |||||||| | ||  ||||||| |||||| || | ||||| |||||| 
Sbjct: 400 gtgagcaggtgtatgatctcgaaggcatgcttgacgatgcgcacagtcatgagcttcttg 459

                                                                       
Query: 550 gcccgttgttgcgcccgtgcatcatgagggagttggtgaggcgctcgatgatggggcact 609
             ||||||||||| ||||||||||| | |||||| ||||||||||| |  ||||| ||||
Sbjct: 460 --ccgttgttgcggccgtgcatcatcatggagttagtgaggcgctccacaatgggacact 517

                                 
Query: 610 gcgccttgcggaagcgcttggc 631
           | || ||||||||||| |||||
Sbjct: 518 gagctttgcggaagcgtttggc 539



 Score = 40.1 bits (20), Expect = 9.7
 Identities = 41/48 (85%)
 Strand = Plus / Plus

                                                           
Query: 346 agatggcctggttcaccctcctgaggggggagatatccacagcctgtc 393
           |||||||||||||||| |  |  |||||||| | ||||||||||||||
Sbjct: 257 agatggcctggttcacacggcgcaggggggacacatccacagcctgtc 304



to top

>gb|BC011718.1| Homo sapiens cDNA clone IMAGE:4099312, **** WARNING: chimeric clone
            ****
          Length = 3787

 Score =  105 bits (53), Expect = 2e-19
 Identities = 92/105 (87%)
 Strand = Plus / Plus

                                                                        
Query: 197  cttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgttggatgagccctt 256
            |||||| |||||||| | ||||||||||||||| ||||| ||   ||| || ||||||||
Sbjct: 1688 cttggccacacgctccagctcgtccttcttcttaatggcataggagttcgaggagccctt 1747

                                                         
Query: 257  ggcagcattgatcagctcatcagcaaggcactcagcaatggtctt 301
            |||||||||||| |||||||| || ||||||||||||||||||||
Sbjct: 1748 ggcagcattgatgagctcatctgccaggcactcagcaatggtctt 1792



 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 117/142 (82%), Gaps = 2/142 (1%)
 Strand = Plus / Plus

                                                                        
Query: 490  gtgaggaggtggatgatctccatggtgtgcttgatgatgcggacggccatgatcttcttt 549
            ||||| ||||| |||||||| | ||  ||||||| |||||| || | ||||| |||||| 
Sbjct: 1980 gtgagcaggtgtatgatctcgaaggcatgcttgacgatgcgcacagtcatgagcttcttg 2039

                                                                        
Query: 550  gcccgttgttgcgcccgtgcatcatgagggagttggtgaggcgctcgatgatggggcact 609
              ||||||||||| ||||||||||| | |||||| ||||||||||| |  ||||| ||||
Sbjct: 2040 --ccgttgttgcggccgtgcatcatcatggagttagtgaggcgctccacaatgggacact 2097

                                  
Query: 610  gcgccttgcggaagcgcttggc 631
            | || ||||||||||| |||||
Sbjct: 2098 gagctttgcggaagcgtttggc 2119



 Score = 40.1 bits (20), Expect = 9.7
 Identities = 41/48 (85%)
 Strand = Plus / Plus

                                                            
Query: 346  agatggcctggttcaccctcctgaggggggagatatccacagcctgtc 393
            |||||||||||||||| |  |  |||||||| | ||||||||||||||
Sbjct: 1837 agatggcctggttcacacggcgcaggggggacacatccacagcctgtc 1884



to top

>ref|NM_001009.3| Homo sapiens ribosomal protein S5 (RPS5), mRNA
          Length = 755

 Score =  105 bits (53), Expect = 2e-19
 Identities = 92/105 (87%)
 Strand = Plus / Minus

                                                                       
Query: 197 cttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgttggatgagccctt 256
           |||||| |||||||| | ||||||||||||||| ||||| ||   ||| || ||||||||
Sbjct: 675 cttggccacacgctccagctcgtccttcttcttaatggcataggagttcgaggagccctt 616

                                                        
Query: 257 ggcagcattgatcagctcatcagcaaggcactcagcaatggtctt 301
           |||||||||||| |||||||| || ||||||||||||||||||||
Sbjct: 615 ggcagcattgatgagctcatctgccaggcactcagcaatggtctt 571



 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 117/142 (82%), Gaps = 2/142 (1%)
 Strand = Plus / Minus

                                                                       
Query: 490 gtgaggaggtggatgatctccatggtgtgcttgatgatgcggacggccatgatcttcttt 549
           ||||| ||||| |||||||| | ||  ||||||| |||||| || | ||||| |||||| 
Sbjct: 383 gtgagcaggtgtatgatctcgaaggcatgcttgacgatgcgcacagtcatgagcttcttg 324

                                                                       
Query: 550 gcccgttgttgcgcccgtgcatcatgagggagttggtgaggcgctcgatgatggggcact 609
             ||||||||||| ||||||||||| | |||||| ||||||||||| |  ||||| ||||
Sbjct: 323 --ccgttgttgcggccgtgcatcatcatggagttagtgaggcgctccacaatgggacact 266

                                 
Query: 610 gcgccttgcggaagcgcttggc 631
           | || ||||||||||| |||||
Sbjct: 265 gagctttgcggaagcgtttggc 244



 Score = 40.1 bits (20), Expect = 9.7
 Identities = 41/48 (85%)
 Strand = Plus / Minus

                                                           
Query: 346 agatggcctggttcaccctcctgaggggggagatatccacagcctgtc 393
           |||||||||||||||| |  |  |||||||| | ||||||||||||||
Sbjct: 526 agatggcctggttcacacggcgcaggggggacacatccacagcctgtc 479



to top

>emb|CR625375.1| full-length cDNA clone CS0DI026YC20 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 714

 Score =  105 bits (53), Expect = 2e-19
 Identities = 92/105 (87%)
 Strand = Plus / Minus

                                                                       
Query: 197 cttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgttggatgagccctt 256
           |||||| |||||||| | ||||||||||||||| ||||| ||   ||| || ||||||||
Sbjct: 650 cttggccacacgctccagctcgtccttcttcttaatggcataggagttcgaggagccctt 591

                                                        
Query: 257 ggcagcattgatcagctcatcagcaaggcactcagcaatggtctt 301
           |||||||||||| |||||||| || ||||||||||||||||||||
Sbjct: 590 ggcagcattgatgagctcatctgccaggcactcagcaatggtctt 546



 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 117/142 (82%), Gaps = 2/142 (1%)
 Strand = Plus / Minus

                                                                       
Query: 490 gtgaggaggtggatgatctccatggtgtgcttgatgatgcggacggccatgatcttcttt 549
           ||||| ||||| |||||||| | ||  ||||||| |||||| || | ||||| |||||| 
Sbjct: 358 gtgagcaggtgtatgatctcgaaggcatgcttgacgatgcgcacagtcatgagcttcttg 299

                                                                       
Query: 550 gcccgttgttgcgcccgtgcatcatgagggagttggtgaggcgctcgatgatggggcact 609
             ||||||||||| ||||||||||| | |||||| ||||||||||| |  ||||| ||||
Sbjct: 298 --ccgttgttgcggccgtgcatcatcatggagttagtgaggcgctccacaatgggacact 241

                                 
Query: 610 gcgccttgcggaagcgcttggc 631
           | || ||||||||||| |||||
Sbjct: 240 gagctttgcggaagcgtttggc 219



 Score = 40.1 bits (20), Expect = 9.7
 Identities = 41/48 (85%)
 Strand = Plus / Minus

                                                           
Query: 346 agatggcctggttcaccctcctgaggggggagatatccacagcctgtc 393
           |||||||||||||||| |  |  |||||||| | ||||||||||||||
Sbjct: 501 agatggcctggttcacacggcgcaggggggacacatccacagcctgtc 454



to top

>emb|CR619033.1| full-length cDNA clone CS0DK007YN14 of HeLa cells Cot 25-normalized
           of Homo sapiens (human)
          Length = 537

 Score =  105 bits (53), Expect = 2e-19
 Identities = 92/105 (87%)
 Strand = Plus / Minus

                                                                       
Query: 197 cttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgttggatgagccctt 256
           |||||| |||||||| | ||||||||||||||| ||||| ||   ||| || ||||||||
Sbjct: 471 cttggccacacgctccagctcgtccttcttcttaatggcataggagttcgaggagccctt 412

                                                        
Query: 257 ggcagcattgatcagctcatcagcaaggcactcagcaatggtctt 301
           |||||||||||| |||||||| || ||||||||||||||||||||
Sbjct: 411 ggcagcattgatgagctcatctgccaggcactcagcaatggtctt 367



 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 117/142 (82%), Gaps = 2/142 (1%)
 Strand = Plus / Minus

                                                                       
Query: 490 gtgaggaggtggatgatctccatggtgtgcttgatgatgcggacggccatgatcttcttt 549
           ||||| ||||| |||||||| | ||  ||||||| |||||| || | ||||| |||||| 
Sbjct: 179 gtgagcaggtgtatgatctcgaaggcatgcttgacgatgcgcacagtcatgagcttcttg 120

                                                                       
Query: 550 gcccgttgttgcgcccgtgcatcatgagggagttggtgaggcgctcgatgatggggcact 609
             ||||||||||| ||||||||||| | |||||| ||||||||||| |  ||||| ||||
Sbjct: 119 --ccgttgttgcggccgtgcatcatcatggagttagtgaggcgctccacaatgggacact 62

                                 
Query: 610 gcgccttgcggaagcgcttggc 631
           | || ||||||||||| |||||
Sbjct: 61  gagctttgcggaagcgtttggc 40



 Score = 40.1 bits (20), Expect = 9.7
 Identities = 41/48 (85%)
 Strand = Plus / Minus

                                                           
Query: 346 agatggcctggttcaccctcctgaggggggagatatccacagcctgtc 393
           |||||||||||||||| |  |  |||||||| | ||||||||||||||
Sbjct: 322 agatggcctggttcacacggcgcaggggggacacatccacagcctgtc 275



to top

>emb|CR614318.1| full-length cDNA clone CS0DI033YI16 of Placenta Cot 25-normalized of
            Homo sapiens (human)
          Length = 1520

 Score =  105 bits (53), Expect = 2e-19
 Identities = 92/105 (87%)
 Strand = Plus / Minus

                                                                        
Query: 197  cttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgttggatgagccctt 256
            |||||| |||||||| | ||||||||||||||| ||||| ||   ||| || ||||||||
Sbjct: 1452 cttggccacacgctccagctcgtccttcttcttaatggcataggagttcgaggagccctt 1393

                                                         
Query: 257  ggcagcattgatcagctcatcagcaaggcactcagcaatggtctt 301
            |||||||||||| |||||||| || ||||||||||||||||||||
Sbjct: 1392 ggcagcattgatgagctcatctgccaggcactcagcaatggtctt 1348



 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 117/142 (82%), Gaps = 2/142 (1%)
 Strand = Plus / Minus

                                                                        
Query: 490  gtgaggaggtggatgatctccatggtgtgcttgatgatgcggacggccatgatcttcttt 549
            ||||| ||||| |||||||| | ||  ||||||| |||||| || | ||||| |||||| 
Sbjct: 1160 gtgagcaggtgtatgatctcgaaggcatgcttgacgatgcgcacagtcatgagcttcttg 1101

                                                                        
Query: 550  gcccgttgttgcgcccgtgcatcatgagggagttggtgaggcgctcgatgatggggcact 609
              ||||||||||| ||||||||||| | |||||| ||||||||||| |  ||||| ||||
Sbjct: 1100 --ccgttgttgcggccgtgcatcatcatggagttagtgaggcgctccacaatgggacact 1043

                                  
Query: 610  gcgccttgcggaagcgcttggc 631
            | || ||||||||||| |||||
Sbjct: 1042 gagctttgcggaagcgtttggc 1021



 Score = 40.1 bits (20), Expect = 9.7
 Identities = 41/48 (85%)
 Strand = Plus / Minus

                                                            
Query: 346  agatggcctggttcaccctcctgaggggggagatatccacagcctgtc 393
            |||||||||||||||| |  |  |||||||| | ||||||||||||||
Sbjct: 1303 agatggcctggttcacacggcgcaggggggacacatccacagcctgtc 1256



to top

>emb|CR605125.1| full-length cDNA clone CS0DM009YE02 of Fetal liver of Homo sapiens
           (human)
          Length = 720

 Score =  105 bits (53), Expect = 2e-19
 Identities = 92/105 (87%)
 Strand = Plus / Minus

                                                                       
Query: 197 cttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgttggatgagccctt 256
           |||||| |||||||| | ||||||||||||||| ||||| ||   ||| || ||||||||
Sbjct: 656 cttggccacacgctccagctcgtccttcttcttaatggcataggagttcgaggagccctt 597

                                                        
Query: 257 ggcagcattgatcagctcatcagcaaggcactcagcaatggtctt 301
           |||||||||||| |||||||| || ||||||||||||||||||||
Sbjct: 596 ggcagcattgatgagctcatctgccaggcactcagcaatggtctt 552



 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 117/142 (82%), Gaps = 2/142 (1%)
 Strand = Plus / Minus

                                                                       
Query: 490 gtgaggaggtggatgatctccatggtgtgcttgatgatgcggacggccatgatcttcttt 549
           ||||| ||||| |||||||| | ||  ||||||| |||||| || | ||||| |||||| 
Sbjct: 364 gtgagcaggtgtatgatctcgaaggcatgcttgacgatgcgcacagtcatgagcttcttg 305

                                                                       
Query: 550 gcccgttgttgcgcccgtgcatcatgagggagttggtgaggcgctcgatgatggggcact 609
             ||||||||||| ||||||||||| | |||||| ||||||||||| |  ||||| ||||
Sbjct: 304 --ccgttgttgcggccgtgcatcatcatggagttagtgaggcgctccacaatgggacact 247

                                 
Query: 610 gcgccttgcggaagcgcttggc 631
           | || ||||||||||| |||||
Sbjct: 246 gagctttgcggaagcgtttggc 225



 Score = 40.1 bits (20), Expect = 9.7
 Identities = 41/48 (85%)
 Strand = Plus / Minus

                                                           
Query: 346 agatggcctggttcaccctcctgaggggggagatatccacagcctgtc 393
           |||||||||||||||| |  |  |||||||| | ||||||||||||||
Sbjct: 507 agatggcctggttcacacggcgcaggggggacacatccacagcctgtc 460



to top

>emb|CR606098.1| full-length cDNA clone CS0DK012YE07 of HeLa cells Cot 25-normalized
           of Homo sapiens (human)
          Length = 716

 Score =  105 bits (53), Expect = 2e-19
 Identities = 92/105 (87%)
 Strand = Plus / Minus

                                                                       
Query: 197 cttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgttggatgagccctt 256
           |||||| |||||||| | ||||||||||||||| ||||| ||   ||| || ||||||||
Sbjct: 654 cttggccacacgctccagctcgtccttcttcttaatggcataggagttcgaggagccctt 595

                                                        
Query: 257 ggcagcattgatcagctcatcagcaaggcactcagcaatggtctt 301
           |||||||||||| |||||||| || ||||||||||||||||||||
Sbjct: 594 ggcagcattgatgagctcatctgccaggcactcagcaatggtctt 550



 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 117/142 (82%), Gaps = 2/142 (1%)
 Strand = Plus / Minus

                                                                       
Query: 490 gtgaggaggtggatgatctccatggtgtgcttgatgatgcggacggccatgatcttcttt 549
           ||||| ||||| |||||||| | ||  ||||||| |||||| || | ||||| |||||| 
Sbjct: 362 gtgagcaggtgtatgatctcgaaggcatgcttgacgatgcgcacagtcatgagcttcttg 303

                                                                       
Query: 550 gcccgttgttgcgcccgtgcatcatgagggagttggtgaggcgctcgatgatggggcact 609
             ||||||||||| ||||||||||| | |||||| ||||||||||| |  ||||| ||||
Sbjct: 302 --ccgttgttgcggccgtgcatcatcatggagttagtgaggcgctccacaatgggacact 245

                                 
Query: 610 gcgccttgcggaagcgcttggc 631
           | || ||||||||||| |||||
Sbjct: 244 gagctttgcggaagcgtttggc 223



 Score = 40.1 bits (20), Expect = 9.7
 Identities = 41/48 (85%)
 Strand = Plus / Minus

                                                           
Query: 346 agatggcctggttcaccctcctgaggggggagatatccacagcctgtc 393
           |||||||||||||||| |  |  |||||||| | ||||||||||||||
Sbjct: 505 agatggcctggttcacacggcgcaggggggacacatccacagcctgtc 458



to top

>emb|CR593754.1| full-length cDNA clone CS0DI002YN03 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 354

 Score =  105 bits (53), Expect = 2e-19
 Identities = 92/105 (87%)
 Strand = Plus / Minus

                                                                       
Query: 197 cttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgttggatgagccctt 256
           |||||| |||||||| | ||||||||||||||| ||||| ||   ||| || ||||||||
Sbjct: 290 cttggccacacgctccagctcgtccttcttcttaatggcataggagttcgaggagccctt 231

                                                        
Query: 257 ggcagcattgatcagctcatcagcaaggcactcagcaatggtctt 301
           |||||||||||| |||||||| || ||||||||||||||||||||
Sbjct: 230 ggcagcattgatgagctcatctgccaggcactcagcaatggtctt 186



 Score = 40.1 bits (20), Expect = 9.7
 Identities = 41/48 (85%)
 Strand = Plus / Minus

                                                           
Query: 346 agatggcctggttcaccctcctgaggggggagatatccacagcctgtc 393
           |||||||||||||||| |  |  |||||||| | ||||||||||||||
Sbjct: 141 agatggcctggttcacacggcgcaggggggacacatccacagcctgtc 94



to top

>gb|AY891473.1| Synthetic construct Homo sapiens clone FLH027247.01L ribosomal
           protein S5 (RPS5) mRNA, partial cds
          Length = 615

 Score =  105 bits (53), Expect = 2e-19
 Identities = 92/105 (87%)
 Strand = Plus / Minus

                                                                       
Query: 197 cttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgttggatgagccctt 256
           |||||| |||||||| | ||||||||||||||| ||||| ||   ||| || ||||||||
Sbjct: 603 cttggccacacgctccagctcgtccttcttcttaatggcataggagttcgaggagccctt 544

                                                        
Query: 257 ggcagcattgatcagctcatcagcaaggcactcagcaatggtctt 301
           |||||||||||| |||||||| || ||||||||||||||||||||
Sbjct: 543 ggcagcattgatgagctcatctgccaggcactcagcaatggtctt 499



 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 117/142 (82%), Gaps = 2/142 (1%)
 Strand = Plus / Minus

                                                                       
Query: 490 gtgaggaggtggatgatctccatggtgtgcttgatgatgcggacggccatgatcttcttt 549
           ||||| ||||| |||||||| | ||  ||||||| |||||| || | ||||| |||||| 
Sbjct: 311 gtgagcaggtgtatgatctcgaaggcatgcttgacgatgcgcacagtcatgagcttcttg 252

                                                                       
Query: 550 gcccgttgttgcgcccgtgcatcatgagggagttggtgaggcgctcgatgatggggcact 609
             ||||||||||| ||||||||||| | |||||| ||||||||||| |  ||||| ||||
Sbjct: 251 --ccgttgttgcggccgtgcatcatcatggagttagtgaggcgctccacaatgggacact 194

                                 
Query: 610 gcgccttgcggaagcgcttggc 631
           | || ||||||||||| |||||
Sbjct: 193 gagctttgcggaagcgtttggc 172



 Score = 40.1 bits (20), Expect = 9.7
 Identities = 41/48 (85%)
 Strand = Plus / Minus

                                                           
Query: 346 agatggcctggttcaccctcctgaggggggagatatccacagcctgtc 393
           |||||||||||||||| |  |  |||||||| | ||||||||||||||
Sbjct: 454 agatggcctggttcacacggcgcaggggggacacatccacagcctgtc 407



to top

>gb|AY888836.1| Synthetic construct Homo sapiens clone FLH027250.01X ribosomal
           protein S5 (RPS5) mRNA, complete cds
          Length = 615

 Score =  105 bits (53), Expect = 2e-19
 Identities = 92/105 (87%)
 Strand = Plus / Minus

                                                                       
Query: 197 cttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgttggatgagccctt 256
           |||||| |||||||| | ||||||||||||||| ||||| ||   ||| || ||||||||
Sbjct: 603 cttggccacacgctccagctcgtccttcttcttaatggcataggagttcgaggagccctt 544

                                                        
Query: 257 ggcagcattgatcagctcatcagcaaggcactcagcaatggtctt 301
           |||||||||||| |||||||| || ||||||||||||||||||||
Sbjct: 543 ggcagcattgatgagctcatctgccaggcactcagcaatggtctt 499



 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 117/142 (82%), Gaps = 2/142 (1%)
 Strand = Plus / Minus

                                                                       
Query: 490 gtgaggaggtggatgatctccatggtgtgcttgatgatgcggacggccatgatcttcttt 549
           ||||| ||||| |||||||| | ||  ||||||| |||||| || | ||||| |||||| 
Sbjct: 311 gtgagcaggtgtatgatctcgaaggcatgcttgacgatgcgcacagtcatgagcttcttg 252

                                                                       
Query: 550 gcccgttgttgcgcccgtgcatcatgagggagttggtgaggcgctcgatgatggggcact 609
             ||||||||||| ||||||||||| | |||||| ||||||||||| |  ||||| ||||
Sbjct: 251 --ccgttgttgcggccgtgcatcatcatggagttagtgaggcgctccacaatgggacact 194

                                 
Query: 610 gcgccttgcggaagcgcttggc 631
           | || ||||||||||| |||||
Sbjct: 193 gagctttgcggaagcgtttggc 172



 Score = 40.1 bits (20), Expect = 9.7
 Identities = 41/48 (85%)
 Strand = Plus / Minus

                                                           
Query: 346 agatggcctggttcaccctcctgaggggggagatatccacagcctgtc 393
           |||||||||||||||| |  |  |||||||| | ||||||||||||||
Sbjct: 454 agatggcctggttcacacggcgcaggggggacacatccacagcctgtc 407



to top

>gb|BC018151.1| Homo sapiens ribosomal protein S5, mRNA (cDNA clone MGC:9774
           IMAGE:3856663), complete cds
          Length = 797

 Score =  105 bits (53), Expect = 2e-19
 Identities = 92/105 (87%)
 Strand = Plus / Minus

                                                                       
Query: 197 cttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgttggatgagccctt 256
           |||||| |||||||| | ||||||||||||||| ||||| ||   ||| || ||||||||
Sbjct: 650 cttggccacacgctccagctcgtccttcttcttaatggcataggagttcgaggagccctt 591

                                                        
Query: 257 ggcagcattgatcagctcatcagcaaggcactcagcaatggtctt 301
           |||||||||||| |||||||| || ||||||||||||||||||||
Sbjct: 590 ggcagcattgatgagctcatctgccaggcactcagcaatggtctt 546



 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 117/142 (82%), Gaps = 2/142 (1%)
 Strand = Plus / Minus

                                                                       
Query: 490 gtgaggaggtggatgatctccatggtgtgcttgatgatgcggacggccatgatcttcttt 549
           ||||| ||||| |||||||| | ||  ||||||| |||||| || | ||||| |||||| 
Sbjct: 358 gtgagcaggtgtatgatctcgaaggcatgcttgacgatgcgcacagtcatgagcttcttg 299

                                                                       
Query: 550 gcccgttgttgcgcccgtgcatcatgagggagttggtgaggcgctcgatgatggggcact 609
             ||||||||||| ||||||||||| | |||||| ||||||||||| |  ||||| ||||
Sbjct: 298 --ccgttgttgcggccgtgcatcatcatggagttagtgaggcgctccacaatgggacact 241

                                 
Query: 610 gcgccttgcggaagcgcttggc 631
           | || ||||||||||| |||||
Sbjct: 240 gagctttgcggaagcgtttggc 219



 Score = 40.1 bits (20), Expect = 9.7
 Identities = 41/48 (85%)
 Strand = Plus / Minus

                                                           
Query: 346 agatggcctggttcaccctcctgaggggggagatatccacagcctgtc 393
           |||||||||||||||| |  |  |||||||| | ||||||||||||||
Sbjct: 501 agatggcctggttcacacggcgcaggggggacacatccacagcctgtc 454



to top

>gb|BC035830.1| Homo sapiens ribosomal protein S5, mRNA (cDNA clone IMAGE:5581961)
          Length = 740

 Score =  105 bits (53), Expect = 2e-19
 Identities = 92/105 (87%)
 Strand = Plus / Minus

                                                                       
Query: 197 cttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgttggatgagccctt 256
           |||||| |||||||| | ||||||||||||||| ||||| ||   ||| || ||||||||
Sbjct: 663 cttggccacacgctccagctcgtccttcttcttaatggcataggagttcgaggagccctt 604

                                                        
Query: 257 ggcagcattgatcagctcatcagcaaggcactcagcaatggtctt 301
           |||||||||||| |||||||| || ||||||||||||||||||||
Sbjct: 603 ggcagcattgatgagctcatctgccaggcactcagcaatggtctt 559



 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 117/142 (82%), Gaps = 2/142 (1%)
 Strand = Plus / Minus

                                                                       
Query: 490 gtgaggaggtggatgatctccatggtgtgcttgatgatgcggacggccatgatcttcttt 549
           ||||| ||||| |||||||| | ||  ||||||| |||||| || | ||||| |||||| 
Sbjct: 371 gtgagcaggtgtatgatctcgaaggcatgcttgacgatgcgcacagtcatgagcttcttg 312

                                                                       
Query: 550 gcccgttgttgcgcccgtgcatcatgagggagttggtgaggcgctcgatgatggggcact 609
             ||||||||||| ||||||||||| | |||||| ||||||||||| |  ||||| ||||
Sbjct: 311 --ccgttgttgcggccgtgcatcatcatggagttagtgaggcgctccacaatgggacact 254

                                 
Query: 610 gcgccttgcggaagcgcttggc 631
           | || ||||||||||| |||||
Sbjct: 253 gagctttgcggaagcgtttggc 232



 Score = 40.1 bits (20), Expect = 9.7
 Identities = 41/48 (85%)
 Strand = Plus / Minus

                                                           
Query: 346 agatggcctggttcaccctcctgaggggggagatatccacagcctgtc 393
           |||||||||||||||| |  |  |||||||| | ||||||||||||||
Sbjct: 514 agatggcctggttcacacggcgcaggggggacacatccacagcctgtc 467



to top

>gb|BC018828.2| Homo sapiens ribosomal protein S5, mRNA (cDNA clone IMAGE:3343539)
          Length = 764

 Score =  105 bits (53), Expect = 2e-19
 Identities = 92/105 (87%)
 Strand = Plus / Minus

                                                                       
Query: 197 cttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgttggatgagccctt 256
           |||||| |||||||| | ||||||||||||||| ||||| ||   ||| || ||||||||
Sbjct: 661 cttggccacacgctccagctcgtccttcttcttaatggcataggagttcgaggagccctt 602

                                                        
Query: 257 ggcagcattgatcagctcatcagcaaggcactcagcaatggtctt 301
           |||||||||||| |||||||| || ||||||||||||||||||||
Sbjct: 601 ggcagcattgatgagctcatctgccaggcactcagcaatggtctt 557



 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 117/142 (82%), Gaps = 2/142 (1%)
 Strand = Plus / Minus

                                                                       
Query: 490 gtgaggaggtggatgatctccatggtgtgcttgatgatgcggacggccatgatcttcttt 549
           ||||| ||||| |||||||| | ||  ||||||| |||||| || | ||||| |||||| 
Sbjct: 369 gtgagcaggtgtatgatctcgaaggcatgcttgacgatgcgcacagtcatgagcttcttg 310

                                                                       
Query: 550 gcccgttgttgcgcccgtgcatcatgagggagttggtgaggcgctcgatgatggggcact 609
             ||||||||||| ||||||||||| | |||||| ||||||||||| |  ||||| ||||
Sbjct: 309 --ccgttgttgcggccgtgcatcatcatggagttagtgaggcgctccacaatgggacact 252

                                 
Query: 610 gcgccttgcggaagcgcttggc 631
           | || ||||||||||| |||||
Sbjct: 251 gagctttgcggaagcgtttggc 230



 Score = 40.1 bits (20), Expect = 9.7
 Identities = 41/48 (85%)
 Strand = Plus / Minus

                                                           
Query: 346 agatggcctggttcaccctcctgaggggggagatatccacagcctgtc 393
           |||||||||||||||| |  |  |||||||| | ||||||||||||||
Sbjct: 512 agatggcctggttcacacggcgcaggggggacacatccacagcctgtc 465



to top

>gb|U14970.1|HSU14970 Human ribosomal protein S5 mRNA, complete cds
          Length = 705

 Score =  105 bits (53), Expect = 2e-19
 Identities = 92/105 (87%)
 Strand = Plus / Minus

                                                                       
Query: 197 cttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgttggatgagccctt 256
           |||||| |||||||| | ||||||||||||||| ||||| ||   ||| || ||||||||
Sbjct: 640 cttggccacacgctccagctcgtccttcttcttaatggcataggagttcgaggagccctt 581

                                                        
Query: 257 ggcagcattgatcagctcatcagcaaggcactcagcaatggtctt 301
           |||||||||||| |||||||| || ||||||||||||||||||||
Sbjct: 580 ggcagcattgatgagctcatctgccaggcactcagcaatggtctt 536



 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 109/133 (81%), Gaps = 2/133 (1%)
 Strand = Plus / Minus

                                                                       
Query: 490 gtgaggaggtggatgatctccatggtgtgcttgatgatgcggacggccatgatcttcttt 549
           ||||| ||||| |||||||| | ||  ||||||| |||||| || | ||||| |||||| 
Sbjct: 348 gtgagcaggtgtatgatctcgaaggcatgcttgacgatgcgcacagtcatgagcttcttg 289

                                                                       
Query: 550 gcccgttgttgcgcccgtgcatcatgagggagttggtgaggcgctcgatgatggggcact 609
             ||||||||||| ||||||||||| | |||||| ||||||||||| |  ||||| ||||
Sbjct: 288 --ccgttgttgcggccgtgcatcatcatggagttagtgaggcgctccacaatgggacact 231

                        
Query: 610 gcgccttgcggaa 622
           | || ||||||||
Sbjct: 230 gagctttgcggaa 218



 Score = 40.1 bits (20), Expect = 9.7
 Identities = 41/48 (85%)
 Strand = Plus / Minus

                                                           
Query: 346 agatggcctggttcaccctcctgaggggggagatatccacagcctgtc 393
           |||||||||||||||| |  |  |||||||| | ||||||||||||||
Sbjct: 491 agatggcctggttcacacggcgcaggggggacacatccacagcctgtc 444



to top

>ref|NM_129283.2| Arabidopsis thaliana ATRPS5B (RIBOSOMAL PROTEIN 5B); structural
           constituent of ribosome AT2G37270 (ATRPS5B) transcript
           variant AT2G37270.1 mRNA, complete cds
          Length = 910

 Score =  103 bits (52), Expect = 8e-19
 Identities = 103/120 (85%)
 Strand = Plus / Minus

                                                                       
Query: 184 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 243
           ||||||| || ||||| ||||| | ||| ||||| || |||||||||||||| || ||||
Sbjct: 725 cttaacgattggccttagcaactctctcaatctcatctttcttcttgatggcatagctgt 666

                                                                       
Query: 244 tggatgagcccttggcagcattgatcagctcatcagcaaggcactcagcaatggtcttga 303
           |||| || ||||| ||||||||||| || |||||||||||||||||||| || |||||||
Sbjct: 665 tggaagatccctttgcagcattgatgagttcatcagcaaggcactcagcgattgtcttga 606



 Score = 46.1 bits (23), Expect = 0.16
 Identities = 98/122 (80%), Gaps = 2/122 (1%)
 Strand = Plus / Minus

                                                                       
Query: 495 gaggtggatgatctccatggtgtgcttgatgatgcggacggccatgatcttctttgcccg 554
           ||||||||| ||||||||||  ||||||| ||| | ||| ||||| | ||||||   || 
Sbjct: 415 gaggtggataatctccatggcatgcttgacgatcctgacagccatcaacttctta--cca 358

                                                                       
Query: 555 ttgttgcgcccgtgcatcatgagggagttggtgaggcgctcgatgatggggcactgcgcc 614
           ||||| |  |||||||||||||| ||||| ||||| | ||| |  || ||||||||||||
Sbjct: 357 ttgtttcttccgtgcatcatgagagagttagtgagcctctcaacaattgggcactgcgcc 298

             
Query: 615 tt 616
           ||
Sbjct: 297 tt 296



to top

>ref|NM_001036425.1| Arabidopsis thaliana ATRPS5B (RIBOSOMAL PROTEIN 5B); structural
           constituent of ribosome AT2G37270 (ATRPS5B) transcript
           variant AT2G37270.2 mRNA, complete cds
          Length = 991

 Score =  103 bits (52), Expect = 8e-19
 Identities = 103/120 (85%)
 Strand = Plus / Minus

                                                                       
Query: 184 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 243
           ||||||| || ||||| ||||| | ||| ||||| || |||||||||||||| || ||||
Sbjct: 786 cttaacgattggccttagcaactctctcaatctcatctttcttcttgatggcatagctgt 727

                                                                       
Query: 244 tggatgagcccttggcagcattgatcagctcatcagcaaggcactcagcaatggtcttga 303
           |||| || ||||| ||||||||||| || |||||||||||||||||||| || |||||||
Sbjct: 726 tggaagatccctttgcagcattgatgagttcatcagcaaggcactcagcgattgtcttga 667



 Score = 46.1 bits (23), Expect = 0.16
 Identities = 98/122 (80%), Gaps = 2/122 (1%)
 Strand = Plus / Minus

                                                                       
Query: 495 gaggtggatgatctccatggtgtgcttgatgatgcggacggccatgatcttctttgcccg 554
           ||||||||| ||||||||||  ||||||| ||| | ||| ||||| | ||||||   || 
Sbjct: 476 gaggtggataatctccatggcatgcttgacgatcctgacagccatcaacttctta--cca 419

                                                                       
Query: 555 ttgttgcgcccgtgcatcatgagggagttggtgaggcgctcgatgatggggcactgcgcc 614
           ||||| |  |||||||||||||| ||||| ||||| | ||| |  || ||||||||||||
Sbjct: 418 ttgtttcttccgtgcatcatgagagagttagtgagcctctcaacaattgggcactgcgcc 359

             
Query: 615 tt 616
           ||
Sbjct: 358 tt 357



to top

>dbj|AP007151.1| Aspergillus oryzae RIB40 genomic DNA, SC005
          Length = 4429080

 Score =  103 bits (52), Expect = 8e-19
 Identities = 73/80 (91%)
 Strand = Plus / Plus

                                                                           
Query: 552     ccgttgttgcgcccgtgcatcatgagggagttggtgaggcgctcgatgatggggcactgc 611
               ||||||||||| |||| ||||||||| |||||||| |||||||| |||||||||||||| 
Sbjct: 3246450 ccgttgttgcggccgttcatcatgagcgagttggtcaggcgctcaatgatggggcactga 3246509

                                   
Query: 612     gccttgcggaagcgcttggc 631
               ||||||||||| ||||||||
Sbjct: 3246510 gccttgcggaaacgcttggc 3246529



 Score = 93.7 bits (47), Expect = 8e-16
 Identities = 101/119 (84%)
 Strand = Plus / Plus

                                                                           
Query: 197     cttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgttggatgagccctt 256
               ||||||||||||||| | ||||||||||||||||||||| ||   ||| ||    |||||
Sbjct: 3246033 cttggcaacacgctcaagctcgtccttcttcttgatggcataggagttcgagcttccctt 3246092

                                                                          
Query: 257     ggcagcattgatcagctcatcagcaaggcactcagcaatggtcttgacattacggaaag 315
               |||||| ||||| ||||| ||||| ||||||||||||||| ||||||  ||||||||||
Sbjct: 3246093 ggcagcgttgataagctcttcagcgaggcactcagcaatgctcttgatgttacggaaag 3246151



to top

>gb|AY081669.1| Arabidopsis thaliana 40S ribosomal protein S5 (At2g37270) mRNA,
           complete cds
          Length = 691

 Score =  103 bits (52), Expect = 8e-19
 Identities = 103/120 (85%)
 Strand = Plus / Minus

                                                                       
Query: 184 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 243
           ||||||| || ||||| ||||| | ||| ||||| || |||||||||||||| || ||||
Sbjct: 625 cttaacgattggccttagcaactctctcaatctcatctttcttcttgatggcatagctgt 566

                                                                       
Query: 244 tggatgagcccttggcagcattgatcagctcatcagcaaggcactcagcaatggtcttga 303
           |||| || ||||| ||||||||||| || |||||||||||||||||||| || |||||||
Sbjct: 565 tggaagatccctttgcagcattgatgagttcatcagcaaggcactcagcgattgtcttga 506



 Score = 46.1 bits (23), Expect = 0.16
 Identities = 98/122 (80%), Gaps = 2/122 (1%)
 Strand = Plus / Minus

                                                                       
Query: 495 gaggtggatgatctccatggtgtgcttgatgatgcggacggccatgatcttctttgcccg 554
           ||||||||| ||||||||||  ||||||| ||| | ||| ||||| | ||||||   || 
Sbjct: 315 gaggtggataatctccatggcatgcttgacgatcctgacagccatcaacttctta--cca 258

                                                                       
Query: 555 ttgttgcgcccgtgcatcatgagggagttggtgaggcgctcgatgatggggcactgcgcc 614
           ||||| |  |||||||||||||| ||||| ||||| | ||| |  || ||||||||||||
Sbjct: 257 ttgtttcttccgtgcatcatgagagagttagtgagcctctcaacaattgggcactgcgcc 198

             
Query: 615 tt 616
           ||
Sbjct: 197 tt 196



to top

>gb|AY059849.1| Arabidopsis thaliana 40S ribosomal protein S5 (At2g37270; F3G5.6)
           mRNA, complete cds
          Length = 856

 Score =  103 bits (52), Expect = 8e-19
 Identities = 103/120 (85%)
 Strand = Plus / Minus

                                                                       
Query: 184 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 243
           ||||||| || ||||| ||||| | ||| ||||| || |||||||||||||| || ||||
Sbjct: 722 cttaacgattggccttagcaactctctcaatctcatctttcttcttgatggcatagctgt 663

                                                                       
Query: 244 tggatgagcccttggcagcattgatcagctcatcagcaaggcactcagcaatggtcttga 303
           |||| || ||||| ||||||||||| || |||||||||||||||||||| || |||||||
Sbjct: 662 tggaagatccctttgcagcattgatgagttcatcagcaaggcactcagcgattgtcttga 603



 Score = 46.1 bits (23), Expect = 0.16
 Identities = 98/122 (80%), Gaps = 2/122 (1%)
 Strand = Plus / Minus

                                                                       
Query: 495 gaggtggatgatctccatggtgtgcttgatgatgcggacggccatgatcttctttgcccg 554
           ||||||||| ||||||||||  ||||||| ||| | ||| ||||| | ||||||   || 
Sbjct: 412 gaggtggataatctccatggcatgcttgacgatcctgacagccatcaacttctta--cca 355

                                                                       
Query: 555 ttgttgcgcccgtgcatcatgagggagttggtgaggcgctcgatgatggggcactgcgcc 614
           ||||| |  |||||||||||||| ||||| ||||| | ||| |  || ||||||||||||
Sbjct: 354 ttgtttcttccgtgcatcatgagagagttagtgagcctctcaacaattgggcactgcgcc 295

             
Query: 615 tt 616
           ||
Sbjct: 294 tt 293



to top

>gb|AY088613.1| Arabidopsis thaliana clone 8397 mRNA, complete sequence
          Length = 839

 Score =  103 bits (52), Expect = 8e-19
 Identities = 103/120 (85%)
 Strand = Plus / Minus

                                                                       
Query: 184 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 243
           ||||||| || ||||| ||||| | ||| ||||| || |||||||||||||| || ||||
Sbjct: 725 cttaacgattggccttagcaactctctcaatctcatctttcttcttgatggcatagctgt 666

                                                                       
Query: 244 tggatgagcccttggcagcattgatcagctcatcagcaaggcactcagcaatggtcttga 303
           |||| || ||||| ||||||||||| || |||||||||||||||||||| || |||||||
Sbjct: 665 tggaagatccctttgcagcattgatgagttcatcagcaaggcactcagcgattgtcttga 606



 Score = 46.1 bits (23), Expect = 0.16
 Identities = 98/122 (80%), Gaps = 2/122 (1%)
 Strand = Plus / Minus

                                                                       
Query: 495 gaggtggatgatctccatggtgtgcttgatgatgcggacggccatgatcttctttgcccg 554
           ||||||||| ||||||||||  ||||||| ||| | ||| ||||| | ||||||   || 
Sbjct: 415 gaggtggataatctccatggcatgcttgacgatcctgacagccatcaacttctta--cca 358

                                                                       
Query: 555 ttgttgcgcccgtgcatcatgagggagttggtgaggcgctcgatgatggggcactgcgcc 614
           ||||| |  |||||||||||||| ||||| ||||| | ||| |  || ||||||||||||
Sbjct: 357 ttgtttcttccgtgcatcatgagagagttagtgagcctctcaacaattgggcactgcgcc 298

             
Query: 615 tt 616
           ||
Sbjct: 297 tt 296



to top

>ref|XM_792179.1| PREDICTED: Strongylocentrotus purpuratus similar to ribosomal
           protein S5 (LOC592668), mRNA
          Length = 663

 Score =  101 bits (51), Expect = 3e-18
 Identities = 90/103 (87%)
 Strand = Plus / Minus

                                                                       
Query: 201 gcaacacgctcgatctcgtccttcttcttgatggcgtaactgttggatgagcccttggca 260
           ||||||||||||| |||||||||||||||||| |||||   |||||| || |||||||| 
Sbjct: 647 gcaacacgctcgagctcgtccttcttcttgattgcgtacgagttggaggatcccttggcg 588

                                                      
Query: 261 gcattgatcagctcatcagcaaggcactcagcaatggtcttga 303
           |||||||| || |||||||| | ||||||||| ||||||||||
Sbjct: 587 gcattgatgagttcatcagccaagcactcagcgatggtcttga 545



 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 53/59 (89%)
 Strand = Plus / Minus

                                                                      
Query: 564 ccgtgcatcatgagggagttggtgaggcgctcgatgatggggcactgcgccttgcggaa 622
           ||||||||||| | ||||||||||| |||||| | |||||||||||| |||||||||||
Sbjct: 287 ccgtgcatcatcatggagttggtgatgcgctccacgatggggcactgggccttgcggaa 229



 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 39/43 (90%)
 Strand = Plus / Minus

                                                      
Query: 417 atacgggtagcatcctcacgtggcccactgttgatgatggcgt 459
           ||||||||||  |||||||| || |||||||||||||||||||
Sbjct: 431 atacgggtagagtcctcacgaggtccactgttgatgatggcgt 389



 Score = 48.1 bits (24), Expect = 0.040
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 488 cggtgaggaggtggatgatctccatggtgtgcttgatgat 527
           ||||||| |||||||||||||| | || ||||||||||||
Sbjct: 361 cggtgagcaggtggatgatctcaaaggcgtgcttgatgat 322



to top

>emb|Y08860.1|NP40SRS5 N.plumbaginifolia mRNA for 40S ribosomal protein S5
          Length = 653

 Score =  101 bits (51), Expect = 3e-18
 Identities = 213/267 (79%)
 Strand = Plus / Minus

                                                                       
Query: 185 ttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgtt 244
           |||||| || ||||||||||| | ||| ||||| |||||||||||||| || || |||||
Sbjct: 466 ttaacgattggccttggcaaccctctcaatctcatccttcttcttgatagcatagctgtt 407

                                                                       
Query: 245 ggatgagcccttggcagcattgatcagctcatcagcaaggcactcagcaatggtcttgac 304
            || || ||||||||||||||||| || ||||| |||||||| || ||||||||||||| 
Sbjct: 406 agaagatcccttggcagcattgatgagttcatctgcaaggcattctgcaatggtcttgat 347

                                                                       
Query: 305 attacggaaagcgctctccctggcaccagtggtcagaaggtagatggcctggttcaccct 364
            || | |||||| ||||| |  |||||||| || || || || || |||||| | || | 
Sbjct: 346 gtttctgaaagcactctcacgtgcaccagttgtgaggagatatattgcctggctaacacg 287

                                                                       
Query: 365 cctgaggggggagatatccacagcctgtctcctcacaacaccagctgacccaatacgggt 424
            |  || || || ||||| |||||||| | ||||||||| || || || |||||||| ||
Sbjct: 286 acgaagtggagaaatatcaacagcctgacgcctcacaactccggcagaaccaatacgagt 227

                                      
Query: 425 agcatcctcacgtggcccactgttgat 451
            ||||| || | ||| |||||||||||
Sbjct: 226 tgcatcttctcttggtccactgttgat 200



to top

>emb|CR382132.1| Yarrowia lipolytica chromosome F of strain CLIB122 of Yarrowia lipolytica
          Length = 4003362

 Score =  101 bits (51), Expect = 3e-18
 Identities = 144/175 (82%)
 Strand = Plus / Minus

                                                                           
Query: 184     cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 243
               |||| ||||||| |||||| || ||||| | |||||||||||||||||| ||||||  ||
Sbjct: 1193522 cttatcggttagacttggcgactcgctcaagctcgtccttcttcttgatagcgtaagagt 1193463

                                                                           
Query: 244     tggatgagcccttggcagcattgatcagctcatcagcaaggcactcagcaatggtcttga 303
               |||| || |||||  | || ||||| ||||| |||||||| |||||||||||||||||||
Sbjct: 1193462 tggaagaaccctttccggcgttgatgagctcctcagcaagacactcagcaatggtcttga 1193403

                                                                      
Query: 304     cattacggaaagcgctctccctggcaccagtggtcagaaggtagatggcctggtt 358
                 || |||||||||  ||| | ||||||  |||| || ||  |||||||||||||
Sbjct: 1193402 tgtttcggaaagcggcctctcgggcaccgatggtgagcagagagatggcctggtt 1193348



 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 119/144 (82%), Gaps = 2/144 (1%)
 Strand = Plus / Minus

                                                                           
Query: 486     gtcggtgaggaggtggatgatctccatggtgtgcttgatgatgcggacggccatgatctt 545
               ||||||||| ||||||||||||||||  | ||||| || ||| ||||| ||| ||| |||
Sbjct: 1193221 gtcggtgagcaggtggatgatctccagagcgtgctcgacgattcggacagccttgagctt 1193162

                                                                           
Query: 546     ctttgcccgttgttgcgcccgtgcatcatgagggagttggtgaggcgctcgatgatgggg 605
               |||   |||||||| || |||| |||||| || | ||||||||| |||||||  ||||||
Sbjct: 1193161 ctta--ccgttgtttcggccgttcatcatcagagcgttggtgagtcgctcgacaatgggg 1193104

                                       
Query: 606     cactgcgccttgcggaagcgcttg 629
               ||||| ||||| ||||| ||||||
Sbjct: 1193103 cactgggcctttcggaaacgcttg 1193080



to top

>ref|XM_505167.1| Yarrowia lipolytica CLIB122, YALI0F08569g predicted mRNA
          Length = 633

 Score = 99.6 bits (50), Expect = 1e-17
 Identities = 140/170 (82%)
 Strand = Plus / Minus

                                                                       
Query: 189 cggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgttggat 248
           ||||||| |||||| || ||||| | |||||||||||||||||| ||||||  |||||| 
Sbjct: 629 cggttagacttggcgactcgctcaagctcgtccttcttcttgatagcgtaagagttggaa 570

                                                                       
Query: 249 gagcccttggcagcattgatcagctcatcagcaaggcactcagcaatggtcttgacatta 308
           || |||||  | || ||||| ||||| |||||||| |||||||||||||||||||  || 
Sbjct: 569 gaaccctttccggcgttgatgagctcctcagcaagacactcagcaatggtcttgatgttt 510

                                                             
Query: 309 cggaaagcgctctccctggcaccagtggtcagaaggtagatggcctggtt 358
           |||||||||  ||| | ||||||  |||| || ||  |||||||||||||
Sbjct: 509 cggaaagcggcctctcgggcaccgatggtgagcagagagatggcctggtt 460



 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 119/144 (82%), Gaps = 2/144 (1%)
 Strand = Plus / Minus

                                                                       
Query: 486 gtcggtgaggaggtggatgatctccatggtgtgcttgatgatgcggacggccatgatctt 545
           ||||||||| ||||||||||||||||  | ||||| || ||| ||||| ||| ||| |||
Sbjct: 333 gtcggtgagcaggtggatgatctccagagcgtgctcgacgattcggacagccttgagctt 274

                                                                       
Query: 546 ctttgcccgttgttgcgcccgtgcatcatgagggagttggtgaggcgctcgatgatgggg 605
           |||   |||||||| || |||| |||||| || | ||||||||| |||||||  ||||||
Sbjct: 273 ctta--ccgttgtttcggccgttcatcatcagagcgttggtgagtcgctcgacaatgggg 216

                                   
Query: 606 cactgcgccttgcggaagcgcttg 629
           ||||| ||||| ||||| ||||||
Sbjct: 215 cactgggcctttcggaaacgcttg 192



to top

>gb|AY190724.1| Pagrus major 40S ribosomal protein S5 mRNA, partial cds
          Length = 633

 Score = 97.6 bits (49), Expect = 5e-17
 Identities = 79/89 (88%)
 Strand = Plus / Minus

                                                                       
Query: 215 ctcgtccttcttcttgatggcgtaactgttggatgagcccttggcagcattgatcagctc 274
           |||||| |||||||||||||||||   ||| ||||| ||||| || ||||||||||||||
Sbjct: 622 ctcgtctttcttcttgatggcgtaggagttagatgaacccttagctgcattgatcagctc 563

                                        
Query: 275 atcagcaaggcactcagcaatggtcttga 303
           |||||| ||||||||||| ||||||||||
Sbjct: 562 atcagccaggcactcagcgatggtcttga 534



 Score = 97.6 bits (49), Expect = 5e-17
 Identities = 115/136 (84%), Gaps = 2/136 (1%)
 Strand = Plus / Minus

                                                                       
Query: 496 aggtggatgatctccatggtgtgcttgatgatgcggacggccatgatcttctttgcccgt 555
           |||||||||||||| | || |||||||| |||||| |||| ||| | ||||||   ||||
Sbjct: 342 aggtggatgatctcgaaggcgtgcttgacgatgcgcacggtcatcagcttcttg--ccgt 285

                                                                       
Query: 556 tgttgcgcccgtgcatcatgagggagttggtgaggcgctcgatgatggggcactgcgcct 615
           ||||||| ||||||||||| | ||||||||| || ||||| | |||||||||||| ||||
Sbjct: 284 tgttgcggccgtgcatcatcatggagttggtcagacgctccacgatggggcactgggcct 225

                           
Query: 616 tgcggaagcgcttggc 631
           | ||||| ||||||||
Sbjct: 224 tacggaaacgcttggc 209



to top

>dbj|AK223106.1| Homo sapiens mRNA for ribosomal protein S5 variant, clone: KAT05451
          Length = 820

 Score = 97.6 bits (49), Expect = 5e-17
 Identities = 91/105 (86%)
 Strand = Plus / Minus

                                                                       
Query: 197 cttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgttggatgagccctt 256
           |||||| |||||||| | ||||||| ||||||| ||||| ||   ||| || ||||||||
Sbjct: 675 cttggccacacgctccagctcgtccctcttcttaatggcatagaagttcgaggagccctt 616

                                                        
Query: 257 ggcagcattgatcagctcatcagcaaggcactcagcaatggtctt 301
           |||||||||||| |||||||| || ||||||||||||||||||||
Sbjct: 615 ggcagcattgatgagctcatctgccaggcactcagcaatggtctt 571



 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 117/142 (82%), Gaps = 2/142 (1%)
 Strand = Plus / Minus

                                                                       
Query: 490 gtgaggaggtggatgatctccatggtgtgcttgatgatgcggacggccatgatcttcttt 549
           ||||| ||||| |||||||| | ||  ||||||| |||||| || | ||||| |||||| 
Sbjct: 383 gtgagcaggtgtatgatctcgaaggcatgcttgacgatgcgcacagtcatgagcttcttg 324

                                                                       
Query: 550 gcccgttgttgcgcccgtgcatcatgagggagttggtgaggcgctcgatgatggggcact 609
             ||||||||||| ||||||||||| | |||||| ||||||||||| |  ||||| ||||
Sbjct: 323 --ccgttgttgcggccgtgcatcatcatggagttagtgaggcgctccacaatgggacact 266

                                 
Query: 610 gcgccttgcggaagcgcttggc 631
           | || ||||||||||| |||||
Sbjct: 265 gagctttgcggaagcgtttggc 244



 Score = 40.1 bits (20), Expect = 9.7
 Identities = 41/48 (85%)
 Strand = Plus / Minus

                                                           
Query: 346 agatggcctggttcaccctcctgaggggggagatatccacagcctgtc 393
           |||||||||||||||| |  |  |||||||| | ||||||||||||||
Sbjct: 526 agatggcctggttcacacggcgcaggggggacacatccacagcctgtc 479



to top

>gb|AC084495.1|CBRG10C24 Caenorhabditis briggsae cosmid G10C24, complete sequence
          Length = 21608

 Score = 97.6 bits (49), Expect = 5e-17
 Identities = 103/121 (85%)
 Strand = Plus / Minus

                                                                        
Query: 184  cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 243
            |||| ||||| | |||||| |||||||||| |||||||||||||||||||||||| ||||
Sbjct: 8241 cttatcggttggacttggcgacacgctcgagctcgtccttcttcttgatggcgtagctgt 8182

                                                                        
Query: 244  tggatgagcccttggcagcattgatcagctcatcagcaaggcactcagcaatggtcttga 303
            |||| || ||||| || || ||||| || || ||||| | ||| ||||| ||||||||||
Sbjct: 8181 tggaggatcccttagcggcgttgatgagttcgtcagccaagcattcagcgatggtcttga 8122

             
Query: 304  c 304
            |
Sbjct: 8121 c 8121



 Score = 40.1 bits (20), Expect = 9.7
 Identities = 50/59 (84%), Gaps = 2/59 (3%)
 Strand = Plus / Minus

                                                                       
Query: 516  gtgcttgatgatgcggacggccatgatcttctttgcccgttgttgcgcccgtgcatcat 574
            |||||||| ||| | ||| | ||||| |||||||  ||||||||||| |||||||||||
Sbjct: 7813 gtgcttgacgattctgacagtcatgagcttcttt--ccgttgttgcgtccgtgcatcat 7757



to top

>gb|BC059443.1| Danio rerio ribosomal protein S5, mRNA (cDNA clone MGC:73068
           IMAGE:4145464), complete cds
          Length = 742

 Score = 95.6 bits (48), Expect = 2e-16
 Identities = 218/272 (80%), Gaps = 2/272 (0%)
 Strand = Plus / Minus

                                                                       
Query: 189 cggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgttggat 248
           ||||||| |||||| || | ||| | ||| || ||||||||||||||||||  |||||| 
Sbjct: 637 cggttagacttggccactctctccagctcatctttcttcttgatggcgtaagagttggag 578

                                                                       
Query: 249 gagcccttggcagcattgatcagctcatcagcaaggcactcagcaatggtcttgacatta 308
           || ||||||||||| ||||| ||||| |||||||| ||||| || ||||||||||  || 
Sbjct: 577 gaacccttggcagcgttgatgagctcgtcagcaagacactctgcgatggtcttgatgttc 518

                                                                       
Query: 309 cggaaagc-gctctccctggcaccagtggtcagaaggtagatggcctggttcaccctcct 367
           | |||||| ||| || || |||||||||   || ||  ||||||||||||| || || | 
Sbjct: 517 ctgaaagcagct-tctcttgcaccagtgcagagcagccagatggcctggttgactctgcg 459

                                                                       
Query: 368 gaggggggagatatccacagcctgtctcctcacaacaccagctgacccaatacgggtagc 427
            |||||||| | ||| |||||||||||||||||    |||||    || |||||||| | 
Sbjct: 458 caggggggacacatcaacagcctgtctcctcacggttccagcacgtccgatacgggtgga 399

                                           
Query: 428 atcctcacgtggcccactgttgatgatggcgt 459
            |||||||| || |||||||||||||||||||
Sbjct: 398 gtcctcacgagggccactgttgatgatggcgt 367



 Score = 63.9 bits (32), Expect = 7e-07
 Identities = 68/80 (85%)
 Strand = Plus / Minus

                                                                       
Query: 552 ccgttgttgcgcccgtgcatcatgagggagttggtgaggcgctcgatgatggggcactgc 611
           ||||||||||| ||||||||||| | |||||| |||| |||||| |  ||||| ||||| 
Sbjct: 277 ccgttgttgcgtccgtgcatcatcatggagttagtgacgcgctccacaatgggacactga 218

                               
Query: 612 gccttgcggaagcgcttggc 631
           ||||| ||||| ||||||||
Sbjct: 217 gccttacggaaacgcttggc 198



to top

>gb|AC016795.6|ATAC016795 Arabidopsis thaliana chromosome III BAC F26K24 genomic sequence,
             complete sequence
          Length = 100835

 Score = 95.6 bits (48), Expect = 2e-16
 Identities = 170/208 (81%), Gaps = 2/208 (0%)
 Strand = Plus / Plus

                                                                         
Query: 240   ctgttggatgagcccttggcagcattgatcagctcatcagcaaggcactcagcaatggtc 299
             |||||||| ||||||||||| || |||||||  |||||||||||||||||||| || |||
Sbjct: 78840 ctgttggaagagcccttggctgcgttgatcaattcatcagcaaggcactcagctatagtc 78899

                                                                         
Query: 300   ttgacattacggaaagc-gctctccctggcaccagtggtcagaaggtagatggcctggtt 358
             ||||  || | |||||| ||| || |  ||||||||||| |  | | |||| ||||||||
Sbjct: 78900 ttgatgtttctgaaagcagct-tcacgagcaccagtggtaatcaagaagatagcctggtt 78958

                                                                         
Query: 359   caccctcctgaggggggagatatccacagcctgtctcctcacaacaccagctgacccaat 418
              || |  || || || |||||||| ||||| |||||||| ||||||||||| || |||||
Sbjct: 78959 aacacgtcttagaggagagatatcaacagcttgtctcctaacaacaccagcagatccaat 79018

                                         
Query: 419   acgggtagcatcctcacgtggcccactg 446
              | ||||||||| |||||||| ||||||
Sbjct: 79019 tctggtagcatcttcacgtggaccactg 79046



 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 101/122 (82%), Gaps = 2/122 (1%)
 Strand = Plus / Plus

                                                                         
Query: 495   gaggtggatgatctccatggtgtgcttgatgatgcggacggccatgatcttctttgcccg 554
             ||||||||| |||||||||| |||||||| ||| | ||| ||||| |  |||||   |||
Sbjct: 79183 gaggtggataatctccatggcgtgcttgacgatcctgacagccatcaatttctta--ccg 79240

                                                                         
Query: 555   ttgttgcgcccgtgcatcatgagggagttggtgaggcgctcgatgatggggcactgcgcc 614
             ||||| | ||||||||||||||| ||||||||||| | ||| |  ||||||||||| |||
Sbjct: 79241 ttgttcctcccgtgcatcatgagagagttggtgagcctctcaacaatggggcactgagcc 79300

               
Query: 615   tt 616
             ||
Sbjct: 79301 tt 79302



 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 46/52 (88%)
 Strand = Plus / Plus

                                                                 
Query: 184   cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggc 235
             ||||||| |||||||||||||| |  || ||||| |||||||||||||||||
Sbjct: 78704 cttaacgattagccttggcaactctttcaatctcatccttcttcttgatggc 78755



to top

>emb|AJ005346.1|CAA005346 Cicer arietinum mRNA for 40S ribosomal protein S5
          Length = 724

 Score = 95.6 bits (48), Expect = 2e-16
 Identities = 69/76 (90%)
 Strand = Plus / Minus

                                                                       
Query: 375 gagatatccacagcctgtctcctcacaacaccagctgacccaatacgggtagcatcctca 434
           ||||||||||||||||||||||| ||||| ||||| ||||||||||| |||||||| |||
Sbjct: 405 gagatatccacagcctgtctccttacaactccagcagacccaatacgagtagcatcttca 346

                           
Query: 435 cgtggcccactgttga 450
           || || ||||||||||
Sbjct: 345 cggggaccactgttga 330



 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 91/112 (81%)
 Strand = Plus / Minus

                                                                       
Query: 184 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 243
           ||||||| || ||||| ||||| | ||| || || || || |||||||| || |||||||
Sbjct: 596 cttaacgatttgccttagcaactctctcaatttcatcttttttcttgattgcataactgt 537

                                                               
Query: 244 tggatgagcccttggcagcattgatcagctcatcagcaaggcactcagcaat 295
           ||||||| || || || ||||| || || ||||||||||| || ||||||||
Sbjct: 536 tggatgaaccttttgctgcattaataagttcatcagcaagacattcagcaat 485



 Score = 44.1 bits (22), Expect = 0.62
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 564 ccgtgcatcatgagggagttggtgag 589
           |||||||||||||| |||||||||||
Sbjct: 219 ccgtgcatcatgagagagttggtgag 194



to top

>ref|XM_341788.2| PREDICTED: Rattus norvegicus ribosomal protein S5 (Rps5), mRNA
          Length = 722

 Score = 95.6 bits (48), Expect = 2e-16
 Identities = 108/128 (84%)
 Strand = Plus / Minus

                                                                       
Query: 189 cggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgttggat 248
           ||||||| |||||| |||||||| |  || || ||||||||||| || ||   |||||| 
Sbjct: 672 cggttagacttggccacacgctccagttcatctttcttcttgatagcataggagttggag 613

                                                                       
Query: 249 gagcccttggcagcattgatcagctcatcagcaaggcactcagcaatggtcttgacatta 308
           ||||||||||||||||| || |||||||| |||||||||||||| ||||||||||  || 
Sbjct: 612 gagcccttggcagcattaatgagctcatctgcaaggcactcagcgatggtcttgatgttc 553

                   
Query: 309 cggaaagc 316
           ||||||||
Sbjct: 552 cggaaagc 545



 Score = 63.9 bits (32), Expect = 7e-07
 Identities = 68/80 (85%)
 Strand = Plus / Minus

                                                                       
Query: 552 ccgttgttgcgcccgtgcatcatgagggagttggtgaggcgctcgatgatggggcactgc 611
           |||||||| || ||||||||||| | |||||| || |||||||| | |||||| ||||| 
Sbjct: 312 ccgttgttacgaccgtgcatcatcatggagttagtaaggcgctccacgatgggacactgt 253

                               
Query: 612 gccttgcggaagcgcttggc 631
           || |||||||| ||||||||
Sbjct: 252 gctttgcggaaacgcttggc 233



to top

>ref|XM_528175.1| PREDICTED: Pan troglodytes similar to ribosomal protein S5; 40S
           ribosomal protein S5 (LOC472803), mRNA
          Length = 534

 Score = 93.7 bits (47), Expect = 8e-16
 Identities = 92/107 (85%)
 Strand = Plus / Minus

                                                                       
Query: 197 cttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgttggatgagccctt 256
           |||||| |||| ||| | |||||||||||||||||| || ||   |||||| ||||||||
Sbjct: 522 cttggccacacactcaagctcgtccttcttcttgatagcataggagttggaggagccctt 463

                                                          
Query: 257 ggcagcattgatcagctcatcagcaaggcactcagcaatggtcttga 303
           ||||||| |||| |||||||| || ||| ||||||||||||||||||
Sbjct: 462 ggcagcactgatgagctcatctgccaggaactcagcaatggtcttga 416



 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 116/142 (81%), Gaps = 2/142 (1%)
 Strand = Plus / Minus

                                                                       
Query: 490 gtgaggaggtggatgatctccatggtgtgcttgatgatgcggacggccatgatcttcttt 549
           ||||| || ||||||||||| | || |||||||| |||||| | |  ||||| |||||| 
Sbjct: 230 gtgagcagctggatgatctcgaaggcgtgcttgacgatgcgcatgatcatgagcttcttg 171

                                                                       
Query: 550 gcccgttgttgcgcccgtgcatcatgagggagttggtgaggcgctcgatgatggggcact 609
             | ||||||||| |||||| |||| | ||||| |||||||| ||| | |||||||||||
Sbjct: 170 --cggttgttgcggccgtgcgtcatcatggagtaggtgaggcactccacgatggggcact 113

                                 
Query: 610 gcgccttgcggaagcgcttggc 631
           | || ||||||||||| |||||
Sbjct: 112 gagctttgcggaagcgtttggc 91



to top

>emb|BX820728.1|CNS0A81J Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH63ZG02 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 797

 Score = 93.7 bits (47), Expect = 8e-16
 Identities = 80/91 (87%)
 Strand = Plus / Minus

                                                                       
Query: 213 atctcgtccttcttcttgatggcgtaactgttggatgagcccttggcagcattgatcagc 272
           ||||| || |||||||||||||| || |||||||| || ||||| ||||||||||| || 
Sbjct: 654 atctcatctttcttcttgatggcatagctgttggaagatccctttgcagcattgatgagt 595

                                          
Query: 273 tcatcagcaaggcactcagcaatggtcttga 303
           |||||||||||||||||||| || |||||||
Sbjct: 594 tcatcagcaaggcactcagcgattgtcttga 564



 Score = 46.1 bits (23), Expect = 0.16
 Identities = 98/122 (80%), Gaps = 2/122 (1%)
 Strand = Plus / Minus

                                                                       
Query: 495 gaggtggatgatctccatggtgtgcttgatgatgcggacggccatgatcttctttgcccg 554
           ||||||||| ||||||||||  ||||||| ||| | ||| ||||| | ||||||   || 
Sbjct: 373 gaggtggataatctccatggcatgcttgacgatcctgacagccatcaacttctta--cca 316

                                                                       
Query: 555 ttgttgcgcccgtgcatcatgagggagttggtgaggcgctcgatgatggggcactgcgcc 614
           ||||| |  |||||||||||||| ||||| ||||| | ||| |  || ||||||||||||
Sbjct: 315 ttgtttcttccgtgcatcatgagagagttagtgagcctctcaacaattgggcactgcgcc 256

             
Query: 615 tt 616
           ||
Sbjct: 255 tt 254



to top

>emb|Z68751.1|CET05E11 Caenorhabditis elegans Cosmid T05E11, complete sequence
          Length = 24554

 Score = 91.7 bits (46), Expect = 3e-15
 Identities = 100/118 (84%)
 Strand = Plus / Plus

                                                                        
Query: 184  cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 243
            |||| ||||| | |||||| |||||||||| ||| |||||||||||||| ||||| ||||
Sbjct: 6863 cttatcggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctgt 6922

                                                                      
Query: 244  tggatgagcccttggcagcattgatcagctcatcagcaaggcactcagcaatggtctt 301
            |||| || |||||||| || ||||| ||||||||||| | ||| || || ||||||||
Sbjct: 6923 tggaggatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtctt 6980



 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 98/120 (81%), Gaps = 2/120 (1%)
 Strand = Plus / Plus

                                                                        
Query: 488  cggtgaggaggtggatgatctccatggtgtgcttgatgatgcggacggccatgatcttct 547
            ||||||| | || ||||||||| | || |||||||| ||| | ||||| ||| | |||||
Sbjct: 7265 cggtgagcaagtagatgatctcaaaggcgtgcttgacgattctgacggtcataagcttct 7324

                                                                        
Query: 548  ttgcccgttgttgcgcccgtgcatcatgagggagttggtgaggcgctcgatgatggggca 607
            ||  ||||||||||| ||||||||||| | |||||||| ||| || |||| ||| |||||
Sbjct: 7325 tt--ccgttgttgcgtccgtgcatcatcaaggagttggcgagacgttcgacgattgggca 7382



to top

>ref|NM_069676.2| Caenorhabditis elegans Ribosomal Protein, Small subunit family
           member (rps-5) (rps-5) mRNA, complete cds
          Length = 755

 Score = 91.7 bits (46), Expect = 3e-15
 Identities = 100/118 (84%)
 Strand = Plus / Minus

                                                                       
Query: 184 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 243
           |||| ||||| | |||||| |||||||||| ||| |||||||||||||| ||||| ||||
Sbjct: 642 cttatcggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctgt 583

                                                                     
Query: 244 tggatgagcccttggcagcattgatcagctcatcagcaaggcactcagcaatggtctt 301
           |||| || |||||||| || ||||| ||||||||||| | ||| || || ||||||||
Sbjct: 582 tggaggatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtctt 525



 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 98/120 (81%), Gaps = 2/120 (1%)
 Strand = Plus / Minus

                                                                       
Query: 488 cggtgaggaggtggatgatctccatggtgtgcttgatgatgcggacggccatgatcttct 547
           ||||||| | || ||||||||| | || |||||||| ||| | ||||| ||| | |||||
Sbjct: 339 cggtgagcaagtagatgatctcaaaggcgtgcttgacgattctgacggtcataagcttct 280

                                                                       
Query: 548 ttgcccgttgttgcgcccgtgcatcatgagggagttggtgaggcgctcgatgatggggca 607
           ||  ||||||||||| ||||||||||| | |||||||| ||| || |||| ||| |||||
Sbjct: 279 tt--ccgttgttgcgtccgtgcatcatcaaggagttggcgagacgttcgacgattgggca 222



to top

>ref|XM_856770.1| PREDICTED: Canis familiaris similar to ribosomal protein S5,
           transcript variant 5 (LOC476366), mRNA
          Length = 793

 Score = 89.7 bits (45), Expect = 1e-14
 Identities = 99/117 (84%)
 Strand = Plus / Minus

                                                                       
Query: 187 aacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgttgg 246
           ||||||||| |||||| ||||| || | ||| |||||||||||||| || ||    ||||
Sbjct: 740 aacggttagacttggccacacgttccagctcatccttcttcttgatagcataggaattgg 681

                                                                    
Query: 247 atgagcccttggcagcattgatcagctcatcagcaaggcactcagcaatggtcttga 303
           | ||||||||||| |||||||| |||||||| || |||||||||||||| |||||||
Sbjct: 680 aagagcccttggctgcattgatgagctcatctgctaggcactcagcaatagtcttga 624



 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                
Query: 579 gagttggtgaggcgctcgatgatggggcactgcgccttgcggaagcgcttggc 631
           |||||||| |||||||| |  ||||||||||| ||||| ||||||||||||||
Sbjct: 351 gagttggtcaggcgctccacaatggggcactgtgccttacggaagcgcttggc 299



to top

>ref|XM_856740.1| PREDICTED: Canis familiaris similar to ribosomal protein S5,
           transcript variant 4 (LOC476366), mRNA
          Length = 680

 Score = 89.7 bits (45), Expect = 1e-14
 Identities = 99/117 (84%)
 Strand = Plus / Minus

                                                                       
Query: 187 aacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgttgg 246
           ||||||||| |||||| ||||| || | ||| |||||||||||||| || ||    ||||
Sbjct: 649 aacggttagacttggccacacgttccagctcatccttcttcttgatagcataggaattgg 590

                                                                    
Query: 247 atgagcccttggcagcattgatcagctcatcagcaaggcactcagcaatggtcttga 303
           | ||||||||||| |||||||| |||||||| || |||||||||||||| |||||||
Sbjct: 589 aagagcccttggctgcattgatgagctcatctgctaggcactcagcaatagtcttga 533



 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                
Query: 579 gagttggtgaggcgctcgatgatggggcactgcgccttgcggaagcgcttggc 631
           |||||||| |||||||| |  ||||||||||| ||||| ||||||||||||||
Sbjct: 282 gagttggtcaggcgctccacaatggggcactgtgccttacggaagcgcttggc 230



to top

>ref|XM_856714.1| PREDICTED: Canis familiaris similar to ribosomal protein S5,
           transcript variant 3 (LOC476366), mRNA
          Length = 678

 Score = 89.7 bits (45), Expect = 1e-14
 Identities = 99/117 (84%)
 Strand = Plus / Minus

                                                                       
Query: 187 aacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgttgg 246
           ||||||||| |||||| ||||| || | ||| |||||||||||||| || ||    ||||
Sbjct: 626 aacggttagacttggccacacgttccagctcatccttcttcttgatagcataggaattgg 567

                                                                    
Query: 247 atgagcccttggcagcattgatcagctcatcagcaaggcactcagcaatggtcttga 303
           | ||||||||||| |||||||| |||||||| || |||||||||||||| |||||||
Sbjct: 566 aagagcccttggctgcattgatgagctcatctgctaggcactcagcaatagtcttga 510



 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                
Query: 579 gagttggtgaggcgctcgatgatggggcactgcgccttgcggaagcgcttggc 631
           |||||||| |||||||| |  ||||||||||| ||||| ||||||||||||||
Sbjct: 282 gagttggtcaggcgctccacaatggggcactgtgccttacggaagcgcttggc 230



to top

>ref|XM_856685.1| PREDICTED: Canis familiaris similar to ribosomal protein S5,
           transcript variant 2 (LOC476366), mRNA
          Length = 507

 Score = 89.7 bits (45), Expect = 1e-14
 Identities = 99/117 (84%)
 Strand = Plus / Minus

                                                                       
Query: 187 aacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgttgg 246
           ||||||||| |||||| ||||| || | ||| |||||||||||||| || ||    ||||
Sbjct: 455 aacggttagacttggccacacgttccagctcatccttcttcttgatagcataggaattgg 396

                                                                    
Query: 247 atgagcccttggcagcattgatcagctcatcagcaaggcactcagcaatggtcttga 303
           | ||||||||||| |||||||| |||||||| || |||||||||||||| |||||||
Sbjct: 395 aagagcccttggctgcattgatgagctcatctgctaggcactcagcaatagtcttga 339



to top

>ref|XM_533568.2| PREDICTED: Canis familiaris similar to ribosomal protein S5,
           transcript variant 1 (LOC476366), mRNA
          Length = 724

 Score = 89.7 bits (45), Expect = 1e-14
 Identities = 99/117 (84%)
 Strand = Plus / Minus

                                                                       
Query: 187 aacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgttgg 246
           ||||||||| |||||| ||||| || | ||| |||||||||||||| || ||    ||||
Sbjct: 671 aacggttagacttggccacacgttccagctcatccttcttcttgatagcataggaattgg 612

                                                                    
Query: 247 atgagcccttggcagcattgatcagctcatcagcaaggcactcagcaatggtcttga 303
           | ||||||||||| |||||||| |||||||| || |||||||||||||| |||||||
Sbjct: 611 aagagcccttggctgcattgatgagctcatctgctaggcactcagcaatagtcttga 555



 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                
Query: 579 gagttggtgaggcgctcgatgatggggcactgcgccttgcggaagcgcttggc 631
           |||||||| |||||||| |  ||||||||||| ||||| ||||||||||||||
Sbjct: 282 gagttggtcaggcgctccacaatggggcactgtgccttacggaagcgcttggc 230



to top

>emb|AL050331.11|HSDJ486I3 Human DNA sequence from clone RP3-486I3 on chromosome 6q22.1-22.3
             Contains the 3' end of a novel gene, a novel gene, the
             gene for KIAA0721 (NAP (Nucleosome Assembly Protein)
             domain containing protein), a novel gene, an RPS5 (40S
             Ribosomal Protein S5) pseudogene, the TSPYL gene for
             TSPY-like (testis specific protein, Y-linked like), the 5'
             end of a novel gene, the 5' end of the SART gene for
             squamous cell carcinoma antigen recognised by T cell and
             two CpG islands, complete sequence
          Length = 118327

 Score = 89.7 bits (45), Expect = 1e-14
 Identities = 75/85 (88%)
 Strand = Plus / Plus

                                                                         
Query: 217   cgtccttcttcttgatggcgtaactgttggatgagcccttggcagcattgatcagctcat 276
             ||||||||||||| ||||| ||   |||||| |||||||||||||||||||| ||||| |
Sbjct: 85976 cgtccttcttcttaatggcataggagttggaggagcccttggcagcattgatgagctcct 86035

                                      
Query: 277   cagcaaggcactcagcaatggtctt 301
             | || ||||||||||||||||||||
Sbjct: 86036 ctgccaggcactcagcaatggtctt 86060



 Score = 42.1 bits (21), Expect = 2.5
 Identities = 60/73 (82%)
 Strand = Plus / Plus

                                                                         
Query: 552   ccgttgttgcgcccgtgcatcatgagggagttggtgaggcgctcgatgatggggcactgc 611
             ||||||||||  ||||||||||| | |||||| || |||||||| |  ||||| ||||| 
Sbjct: 86308 ccgttgttgcagccgtgcatcatcatggagttagtaaggcgctccacaatgggacactga 86367

                          
Query: 612   gccttgcggaagc 624
             || ||| ||||||
Sbjct: 86368 gctttgtggaagc 86380



to top

>ref|NG_000896.1| Homo sapiens ribosomal protein S5 pseudogene 1 (RPS5P1) on
           chromosome 6
          Length = 823

 Score = 89.7 bits (45), Expect = 1e-14
 Identities = 75/85 (88%)
 Strand = Plus / Plus

                                                                       
Query: 217 cgtccttcttcttgatggcgtaactgttggatgagcccttggcagcattgatcagctcat 276
           ||||||||||||| ||||| ||   |||||| |||||||||||||||||||| ||||| |
Sbjct: 141 cgtccttcttcttaatggcataggagttggaggagcccttggcagcattgatgagctcct 200

                                    
Query: 277 cagcaaggcactcagcaatggtctt 301
           | || ||||||||||||||||||||
Sbjct: 201 ctgccaggcactcagcaatggtctt 225



 Score = 42.1 bits (21), Expect = 2.5
 Identities = 60/73 (82%)
 Strand = Plus / Plus

                                                                       
Query: 552 ccgttgttgcgcccgtgcatcatgagggagttggtgaggcgctcgatgatggggcactgc 611
           ||||||||||  ||||||||||| | |||||| || |||||||| |  ||||| ||||| 
Sbjct: 473 ccgttgttgcagccgtgcatcatcatggagttagtaaggcgctccacaatgggacactga 532

                        
Query: 612 gccttgcggaagc 624
           || ||| ||||||
Sbjct: 533 gctttgtggaagc 545



to top

>gb|AY909418.1| Siniperca chuatsi clone C137 40S ribosomal protein S5 mRNA, partial
           cds
          Length = 254

 Score = 89.7 bits (45), Expect = 1e-14
 Identities = 114/136 (83%), Gaps = 2/136 (1%)
 Strand = Plus / Minus

                                                                       
Query: 496 aggtggatgatctccatggtgtgcttgatgatgcggacggccatgatcttctttgcccgt 555
           |||||||||||||| | ||  ||||||| |||||| |||| ||| | ||||||   ||||
Sbjct: 163 aggtggatgatctcgaaggcatgcttgacgatgcgcacggtcatcagcttcttg--ccgt 106

                                                                       
Query: 556 tgttgcgcccgtgcatcatgagggagttggtgaggcgctcgatgatggggcactgcgcct 615
           ||||||| ||||||||||| | ||||||||| || ||||| | |||||||||||| ||||
Sbjct: 105 tgttgcggccgtgcatcatcatggagttggtcagacgctccacgatggggcactgggcct 46

                           
Query: 616 tgcggaagcgcttggc 631
           | ||||| ||||||||
Sbjct: 45  tacggaaacgcttggc 30



 Score = 48.1 bits (24), Expect = 0.040
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 414 ccaatacgggtagcatcctcacgtggcccactgttgatgatggc 457
           ||||||||||| |  |||||||| || |||||||||||||||||
Sbjct: 244 ccaatacgggtggagtcctcacggggtccactgttgatgatggc 201



to top

>gb|AY650305.1| Macaca fascicularis ribosomal protein S5 mRNA, partial cds
          Length = 501

 Score = 87.7 bits (44), Expect = 5e-14
 Identities = 56/60 (93%)
 Strand = Plus / Minus

                                                                       
Query: 242 gttggatgagcccttggcagcattgatcagctcatcagcaaggcactcagcaatggtctt 301
           |||||| |||||||||||||||||||| |||||||| || ||||||||||||||||||||
Sbjct: 492 gttggaggagcccttggcagcattgatgagctcatctgccaggcactcagcaatggtctt 433



 Score = 71.9 bits (36), Expect = 3e-09
 Identities = 69/80 (86%)
 Strand = Plus / Minus

                                                                       
Query: 552 ccgttgttgcgcccgtgcatcatgagggagttggtgaggcgctcgatgatggggcactgc 611
           ||||||||||| ||||||||||| | |||||| ||||||||||| |  ||||| ||||| 
Sbjct: 185 ccgttgttgcggccgtgcatcatcatggagtttgtgaggcgctccacaatgggacactga 126

                               
Query: 612 gccttgcggaagcgcttggc 631
           || ||||||||||| |||||
Sbjct: 125 gctttgcggaagcgtttggc 106



to top

>ref|XM_518704.1| PREDICTED: Pan troglodytes similar to KIAA0721 protein (LOC462956),
           mRNA
          Length = 1755

 Score = 87.7 bits (44), Expect = 5e-14
 Identities = 74/84 (88%)
 Strand = Plus / Minus

                                                                       
Query: 218 gtccttcttcttgatggcgtaactgttggatgagcccttggcagcattgatcagctcatc 277
           |||||||||||| ||||| ||   |||||| |||||||||||||||||||| ||||| ||
Sbjct: 300 gtccttcttcttaatggcataggagttggaggagcccttggcagcattgatgagctcctc 241

                                   
Query: 278 agcaaggcactcagcaatggtctt 301
            || ||||||||||||||||||||
Sbjct: 240 tgccaggcactcagcaatggtctt 217



to top

>gb|BC058690.1| Mus musculus ribosomal protein S5, mRNA (cDNA clone MGC:63220
           IMAGE:6814814), complete cds
          Length = 749

 Score = 87.7 bits (44), Expect = 5e-14
 Identities = 107/128 (83%)
 Strand = Plus / Minus

                                                                       
Query: 189 cggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgttggat 248
           ||||||| |||||| |||||||| |  || || |||||||||||||| ||    ||||| 
Sbjct: 671 cggttagacttggccacacgctccagttcatctttcttcttgatggcataggaattggag 612

                                                                       
Query: 249 gagcccttggcagcattgatcagctcatcagcaaggcactcagcaatggtcttgacatta 308
           ||||||||||||||||| || |||||||| ||||||||||| || ||||||||||  || 
Sbjct: 611 gagcccttggcagcattaatgagctcatctgcaaggcactcggcgatggtcttgatgttc 552

                   
Query: 309 cggaaagc 316
           ||||||||
Sbjct: 551 cggaaagc 544



 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 67/80 (83%)
 Strand = Plus / Minus

                                                                       
Query: 552 ccgttgttgcgcccgtgcatcatgagggagttggtgaggcgctcgatgatggggcactgc 611
           |||||||| || || |||||||| | |||||| || |||||||| | |||||| || || 
Sbjct: 311 ccgttgttacgaccatgcatcatcatggagttagtaaggcgctccacgatgggacattgt 252

                               
Query: 612 gccttgcggaagcgcttggc 631
           || |||||||||||||||||
Sbjct: 251 gctttgcggaagcgcttggc 232



to top

>ref|NM_173232.1| Danio rerio ribosomal protein S5 (rps5), mRNA
          Length = 702

 Score = 87.7 bits (44), Expect = 5e-14
 Identities = 217/272 (79%), Gaps = 2/272 (0%)
 Strand = Plus / Minus

                                                                       
Query: 189 cggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgttggat 248
           ||||||| |||||| || | ||| | ||| || ||||||||||||||||||  |||| | 
Sbjct: 644 cggttagacttggccactctctccagctcatctttcttcttgatggcgtaagagttgtag 585

                                                                       
Query: 249 gagcccttggcagcattgatcagctcatcagcaaggcactcagcaatggtcttgacatta 308
           || ||||||||||| ||||| ||||| |||||||| ||||| || ||||||||||  || 
Sbjct: 584 gaacccttggcagcgttgatgagctcgtcagcaagacactctgcgatggtcttgatgttc 525

                                                                       
Query: 309 cggaaagc-gctctccctggcaccagtggtcagaaggtagatggcctggttcaccctcct 367
           | |||||| ||| || || |||||||||   || ||  ||||||||||||| || || | 
Sbjct: 524 ctgaaagcagct-tctcttgcaccagtgcagagcagccagatggcctggttgactctgcg 466

                                                                       
Query: 368 gaggggggagatatccacagcctgtctcctcacaacaccagctgacccaatacgggtagc 427
            |||||||| | ||| |||||||||||||||||    |||||    || |||||||| | 
Sbjct: 465 caggggggacacatcaacagcctgtctcctcacggttccagcacgtccgatacgggtgga 406

                                           
Query: 428 atcctcacgtggcccactgttgatgatggcgt 459
            |||||||| || |||||||||||||||||||
Sbjct: 405 gtcctcacgagggccactgttgatgatggcgt 374



 Score = 63.9 bits (32), Expect = 7e-07
 Identities = 68/80 (85%)
 Strand = Plus / Minus

                                                                       
Query: 552 ccgttgttgcgcccgtgcatcatgagggagttggtgaggcgctcgatgatggggcactgc 611
           ||||||||||| ||||||||||| | |||||| |||| |||||| |  ||||| ||||| 
Sbjct: 284 ccgttgttgcgtccgtgcatcatcatggagttagtgacgcgctccacaatgggacactga 225

                               
Query: 612 gccttgcggaagcgcttggc 631
           ||||| ||||| ||||||||
Sbjct: 224 gccttacggaaacgcttggc 205



to top

>emb|Y12431.1|MMRPS5 M.musculus mRNA for ribosomal protein S5
          Length = 715

 Score = 87.7 bits (44), Expect = 5e-14
 Identities = 107/128 (83%)
 Strand = Plus / Minus

                                                                       
Query: 189 cggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgttggat 248
           ||||||| |||||| |||||||| |  || || |||||||||||||| ||    ||||| 
Sbjct: 666 cggttagacttggccacacgctccagttcatctttcttcttgatggcataggaattggag 607

                                                                       
Query: 249 gagcccttggcagcattgatcagctcatcagcaaggcactcagcaatggtcttgacatta 308
           ||||||||||||||||| || |||||||| ||||||||||| || ||||||||||  || 
Sbjct: 606 gagcccttggcagcattaatgagctcatctgcaaggcactcggcgatggtcttgatgttc 547

                   
Query: 309 cggaaagc 316
           ||||||||
Sbjct: 546 cggaaagc 539



 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 67/80 (83%)
 Strand = Plus / Minus

                                                                       
Query: 552 ccgttgttgcgcccgtgcatcatgagggagttggtgaggcgctcgatgatggggcactgc 611
           |||||||| || || |||||||| | |||||| || |||||||| | |||||| || || 
Sbjct: 306 ccgttgttacgaccatgcatcatcatggagttagtaaggcgctccacgatgggacattgt 247

                               
Query: 612 gccttgcggaagcgcttggc 631
           || |||||||||||||||||
Sbjct: 246 gctttgcggaagcgcttggc 227



to top

>gb|AF506223.1| Danio rerio 40S ribosomal protein S5 (rps5) mRNA, complete cds
          Length = 702

 Score = 87.7 bits (44), Expect = 5e-14
 Identities = 217/272 (79%), Gaps = 2/272 (0%)
 Strand = Plus / Minus

                                                                       
Query: 189 cggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgttggat 248
           ||||||| |||||| || | ||| | ||| || ||||||||||||||||||  |||| | 
Sbjct: 644 cggttagacttggccactctctccagctcatctttcttcttgatggcgtaagagttgtag 585

                                                                       
Query: 249 gagcccttggcagcattgatcagctcatcagcaaggcactcagcaatggtcttgacatta 308
           || ||||||||||| ||||| ||||| |||||||| ||||| || ||||||||||  || 
Sbjct: 584 gaacccttggcagcgttgatgagctcgtcagcaagacactctgcgatggtcttgatgttc 525

                                                                       
Query: 309 cggaaagc-gctctccctggcaccagtggtcagaaggtagatggcctggttcaccctcct 367
           | |||||| ||| || || |||||||||   || ||  ||||||||||||| || || | 
Sbjct: 524 ctgaaagcagct-tctcttgcaccagtgcagagcagccagatggcctggttgactctgcg 466

                                                                       
Query: 368 gaggggggagatatccacagcctgtctcctcacaacaccagctgacccaatacgggtagc 427
            |||||||| | ||| |||||||||||||||||    |||||    || |||||||| | 
Sbjct: 465 caggggggacacatcaacagcctgtctcctcacggttccagcacgtccgatacgggtgga 406

                                           
Query: 428 atcctcacgtggcccactgttgatgatggcgt 459
            |||||||| || |||||||||||||||||||
Sbjct: 405 gtcctcacgagggccactgttgatgatggcgt 374



 Score = 63.9 bits (32), Expect = 7e-07
 Identities = 68/80 (85%)
 Strand = Plus / Minus

                                                                       
Query: 552 ccgttgttgcgcccgtgcatcatgagggagttggtgaggcgctcgatgatggggcactgc 611
           ||||||||||| ||||||||||| | |||||| |||| |||||| |  ||||| ||||| 
Sbjct: 284 ccgttgttgcgtccgtgcatcatcatggagttagtgacgcgctccacaatgggacactga 225

                               
Query: 612 gccttgcggaagcgcttggc 631
           ||||| ||||| ||||||||
Sbjct: 224 gccttacggaaacgcttggc 205



to top

>dbj|AK152449.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length
           enriched library, clone:I830072L04 product:ribosomal
           protein S5, full insert sequence
          Length = 731

 Score = 87.7 bits (44), Expect = 5e-14
 Identities = 107/128 (83%)
 Strand = Plus / Minus

                                                                       
Query: 189 cggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgttggat 248
           ||||||| |||||| |||||||| |  || || |||||||||||||| ||    ||||| 
Sbjct: 684 cggttagacttggccacacgctccagttcatctttcttcttgatggcataggaattggag 625

                                                                       
Query: 249 gagcccttggcagcattgatcagctcatcagcaaggcactcagcaatggtcttgacatta 308
           ||||||||||||||||| || |||||||| ||||||||||| || ||||||||||  || 
Sbjct: 624 gagcccttggcagcattaatgagctcatctgcaaggcactcggcgatggtcttgatgttc 565

                   
Query: 309 cggaaagc 316
           ||||||||
Sbjct: 564 cggaaagc 557



 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 67/80 (83%)
 Strand = Plus / Minus

                                                                       
Query: 552 ccgttgttgcgcccgtgcatcatgagggagttggtgaggcgctcgatgatggggcactgc 611
           |||||||| || || |||||||| | |||||| || |||||||| | |||||| || || 
Sbjct: 324 ccgttgttacgaccatgcatcatcatggagttagtaaggcgctccacgatgggacattgt 265

                               
Query: 612 gccttgcggaagcgcttggc 631
           || |||||||||||||||||
Sbjct: 264 gctttgcggaagcgcttggc 245



to top

>dbj|AK167533.1| Mus musculus 14 days embryo liver cDNA, RIKEN full-length enriched
           library, clone:I530018P15 product:ribosomal protein S5,
           full insert sequence
          Length = 731

 Score = 87.7 bits (44), Expect = 5e-14
 Identities = 107/128 (83%)
 Strand = Plus / Minus

                                                                       
Query: 189 cggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgttggat 248
           ||||||| |||||| |||||||| |  || || |||||||||||||| ||    ||||| 
Sbjct: 684 cggttagacttggccacacgctccagttcatctttcttcttgatggcataggaattggag 625

                                                                       
Query: 249 gagcccttggcagcattgatcagctcatcagcaaggcactcagcaatggtcttgacatta 308
           ||||||||||||||||| || |||||||| ||||||||||| || ||||||||||  || 
Sbjct: 624 gagcccttggcagcattaatgagctcatctgcaaggcactcggcgatggtcttgatgttc 565

                   
Query: 309 cggaaagc 316
           ||||||||
Sbjct: 564 cggaaagc 557



 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 67/80 (83%)
 Strand = Plus / Minus

                                                                       
Query: 552 ccgttgttgcgcccgtgcatcatgagggagttggtgaggcgctcgatgatggggcactgc 611
           |||||||| || || |||||||| | |||||| || |||||||| | |||||| || || 
Sbjct: 324 ccgttgttacgaccatgcatcatcatggagttagtaaggcgctccacgatgggacattgt 265

                               
Query: 612 gccttgcggaagcgcttggc 631
           || |||||||||||||||||
Sbjct: 264 gctttgcggaagcgcttggc 245



to top

>dbj|AK164079.1| Mus musculus 12 days embryo spinal cord cDNA, RIKEN full-length
           enriched library, clone:C530002K11 product:ribosomal
           protein S5, full insert sequence
          Length = 731

 Score = 87.7 bits (44), Expect = 5e-14
 Identities = 107/128 (83%)
 Strand = Plus / Minus

                                                                       
Query: 189 cggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgttggat 248
           ||||||| |||||| |||||||| |  || || |||||||||||||| ||    ||||| 
Sbjct: 684 cggttagacttggccacacgctccagttcatctttcttcttgatggcataggaattggag 625

                                                                       
Query: 249 gagcccttggcagcattgatcagctcatcagcaaggcactcagcaatggtcttgacatta 308
           ||||||||||||||||| || |||||||| ||||||||||| || ||||||||||  || 
Sbjct: 624 gagcccttggcagcattaatgagctcatctgcaaggcactcggcgatggtcttgatgttc 565

                   
Query: 309 cggaaagc 316
           ||||||||
Sbjct: 564 cggaaagc 557



 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 67/80 (83%)
 Strand = Plus / Minus

                                                                       
Query: 552 ccgttgttgcgcccgtgcatcatgagggagttggtgaggcgctcgatgatggggcactgc 611
           |||||||| || || |||||||| | |||||| || |||||||| | |||||| || || 
Sbjct: 324 ccgttgttacgaccatgcatcatcatggagttagtaaggcgctccacgatgggacattgt 265

                               
Query: 612 gccttgcggaagcgcttggc 631
           || |||||||||||||||||
Sbjct: 264 gctttgcggaagcgcttggc 245



to top

>dbj|AK160552.1| Mus musculus ES cells cDNA, RIKEN full-length enriched library,
           clone:2410046M18 product:ribosomal protein S5, full
           insert sequence
          Length = 731

 Score = 87.7 bits (44), Expect = 5e-14
 Identities = 107/128 (83%)
 Strand = Plus / Minus

                                                                       
Query: 189 cggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgttggat 248
           ||||||| |||||| |||||||| |  || || |||||||||||||| ||    ||||| 
Sbjct: 684 cggttagacttggccacacgctccagttcatctttcttcttgatggcataggaattggag 625

                                                                       
Query: 249 gagcccttggcagcattgatcagctcatcagcaaggcactcagcaatggtcttgacatta 308
           ||||||||||||||||| || |||||||| ||||||||||| || ||||||||||  || 
Sbjct: 624 gagcccttggcagcattaatgagctcatctgcaaggcactcggcgatggtcttgatgttc 565

                   
Query: 309 cggaaagc 316
           ||||||||
Sbjct: 564 cggaaagc 557



 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 67/80 (83%)
 Strand = Plus / Minus

                                                                       
Query: 552 ccgttgttgcgcccgtgcatcatgagggagttggtgaggcgctcgatgatggggcactgc 611
           |||||||| || || |||||||| | |||||| || |||||||| | |||||| || || 
Sbjct: 324 ccgttgttacgaccatgcatcatcatggagttagtaaggcgctccacgatgggacattgt 265

                               
Query: 612 gccttgcggaagcgcttggc 631
           || |||||||||||||||||
Sbjct: 264 gctttgcggaagcgcttggc 245



to top

>dbj|AK168106.1| Mus musculus TIB-55 BB88 cDNA, RIKEN full-length enriched library,
           clone:I730057M01 product:ribosomal protein S5, full
           insert sequence
          Length = 731

 Score = 87.7 bits (44), Expect = 5e-14
 Identities = 107/128 (83%)
 Strand = Plus / Minus

                                                                       
Query: 189 cggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgttggat 248
           ||||||| |||||| |||||||| |  || || |||||||||||||| ||    ||||| 
Sbjct: 684 cggttagacttggccacacgctccagttcatctttcttcttgatggcataggaattggag 625

                                                                       
Query: 249 gagcccttggcagcattgatcagctcatcagcaaggcactcagcaatggtcttgacatta 308
           ||||||||||||||||| || |||||||| ||||||||||| || ||||||||||  || 
Sbjct: 624 gagcccttggcagcattaatgagctcatctgcaaggcactcggcgatggtcttgatgttc 565

                   
Query: 309 cggaaagc 316
           ||||||||
Sbjct: 564 cggaaagc 557



 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 67/80 (83%)
 Strand = Plus / Minus

                                                                       
Query: 552 ccgttgttgcgcccgtgcatcatgagggagttggtgaggcgctcgatgatggggcactgc 611
           |||||||| || || |||||||| | |||||| || |||||||| | |||||| || || 
Sbjct: 324 ccgttgttacgaccatgcatcatcatggagttagtaaggcgctccacgatgggacattgt 265

                               
Query: 612 gccttgcggaagcgcttggc 631
           || |||||||||||||||||
Sbjct: 264 gctttgcggaagcgcttggc 245



to top

>dbj|AK168044.1| Mus musculus CRL-1722 L5178Y-R cDNA, RIKEN full-length enriched
           library, clone:I730048N14 product:ribosomal protein S5,
           full insert sequence
          Length = 731

 Score = 87.7 bits (44), Expect = 5e-14
 Identities = 107/128 (83%)
 Strand = Plus / Minus

                                                                       
Query: 189 cggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgttggat 248
           ||||||| |||||| |||||||| |  || || |||||||||||||| ||    ||||| 
Sbjct: 684 cggttagacttggccacacgctccagttcatctttcttcttgatggcataggaattggag 625

                                                                       
Query: 249 gagcccttggcagcattgatcagctcatcagcaaggcactcagcaatggtcttgacatta 308
           ||||||||||||||||| || |||||||| ||||||||||| || ||||||||||  || 
Sbjct: 624 gagcccttggcagcattaatgagctcatctgcaaggcactcggcgatggtcttgatgttc 565

                   
Query: 309 cggaaagc 316
           ||||||||
Sbjct: 564 cggaaagc 557



 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 67/80 (83%)
 Strand = Plus / Minus

                                                                       
Query: 552 ccgttgttgcgcccgtgcatcatgagggagttggtgaggcgctcgatgatggggcactgc 611
           |||||||| || || |||||||| | |||||| || |||||||| | |||||| || || 
Sbjct: 324 ccgttgttacgaccatgcatcatcatggagttagtaaggcgctccacgatgggacattgt 265

                               
Query: 612 gccttgcggaagcgcttggc 631
           || |||||||||||||||||
Sbjct: 264 gctttgcggaagcgcttggc 245



to top

>dbj|AK169016.1| Mus musculus 17 days embryo kidney cDNA, RIKEN full-length enriched
           library, clone:I920075A20 product:ribosomal protein S5,
           full insert sequence
          Length = 731

 Score = 87.7 bits (44), Expect = 5e-14
 Identities = 107/128 (83%)
 Strand = Plus / Minus

                                                                       
Query: 189 cggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgttggat 248
           ||||||| |||||| |||||||| |  || || |||||||||||||| ||    ||||| 
Sbjct: 684 cggttagacttggccacacgctccagttcatctttcttcttgatggcataggaattggag 625

                                                                       
Query: 249 gagcccttggcagcattgatcagctcatcagcaaggcactcagcaatggtcttgacatta 308
           ||||||||||||||||| || |||||||| ||||||||||| || ||||||||||  || 
Sbjct: 624 gagcccttggcagcattaatgagctcatctgcaaggcactcggcgatggtcttgatgttc 565

                   
Query: 309 cggaaagc 316
           ||||||||
Sbjct: 564 cggaaagc 557



 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 67/80 (83%)
 Strand = Plus / Minus

                                                                       
Query: 552 ccgttgttgcgcccgtgcatcatgagggagttggtgaggcgctcgatgatggggcactgc 611
           |||||||| || || |||||||| | |||||| || |||||||| | |||||| || || 
Sbjct: 324 ccgttgttacgaccatgcatcatcatggagttagtaaggcgctccacgatgggacattgt 265

                               
Query: 612 gccttgcggaagcgcttggc 631
           || |||||||||||||||||
Sbjct: 264 gctttgcggaagcgcttggc 245



to top

>dbj|AK172446.1| Mus musculus activated spleen cDNA, RIKEN full-length enriched
           library, clone:F830207P21 product:ribosomal protein S5,
           full insert sequence
          Length = 731

 Score = 87.7 bits (44), Expect = 5e-14
 Identities = 107/128 (83%)
 Strand = Plus / Minus

                                                                       
Query: 189 cggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgttggat 248
           ||||||| |||||| |||||||| |  || || |||||||||||||| ||    ||||| 
Sbjct: 684 cggttagacttggccacacgctccagttcatctttcttcttgatggcataggaattggag 625

                                                                       
Query: 249 gagcccttggcagcattgatcagctcatcagcaaggcactcagcaatggtcttgacatta 308
           ||||||||||||||||| || |||||||| ||||||||||| || ||||||||||  || 
Sbjct: 624 gagcccttggcagcattaatgagctcatctgcaaggcactcggcgatggtcttgatgttc 565

                   
Query: 309 cggaaagc 316
           ||||||||
Sbjct: 564 cggaaagc 557



 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 67/80 (83%)
 Strand = Plus / Minus

                                                                       
Query: 552 ccgttgttgcgcccgtgcatcatgagggagttggtgaggcgctcgatgatggggcactgc 611
           |||||||| || || |||||||| | |||||| || |||||||| | |||||| || || 
Sbjct: 324 ccgttgttacgaccatgcatcatcatggagttagtaaggcgctccacgatgggacattgt 265

                               
Query: 612 gccttgcggaagcgcttggc 631
           || |||||||||||||||||
Sbjct: 264 gctttgcggaagcgcttggc 245



to top

>dbj|AK020477.1| Mus musculus 12 days embryo embryonic body between diaphragm region
           and neck cDNA, RIKEN full-length enriched library,
           clone:9430066A13 product:ribosomal protein S5, full
           insert sequence
          Length = 732

 Score = 87.7 bits (44), Expect = 5e-14
 Identities = 107/128 (83%)
 Strand = Plus / Minus

                                                                       
Query: 189 cggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgttggat 248
           ||||||| |||||| |||||||| |  || || |||||||||||||| ||    ||||| 
Sbjct: 683 cggttagacttggccacacgctccagttcatctttcttcttgatggcataggaattggag 624

                                                                       
Query: 249 gagcccttggcagcattgatcagctcatcagcaaggcactcagcaatggtcttgacatta 308
           ||||||||||||||||| || |||||||| ||||||||||| || ||||||||||  || 
Sbjct: 623 gagcccttggcagcattaatgagctcatctgcaaggcactcggcgatggtcttgatgttc 564

                   
Query: 309 cggaaagc 316
           ||||||||
Sbjct: 563 cggaaagc 556



 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 67/80 (83%)
 Strand = Plus / Minus

                                                                       
Query: 552 ccgttgttgcgcccgtgcatcatgagggagttggtgaggcgctcgatgatggggcactgc 611
           |||||||| || || |||||||| | |||||| || |||||||| | |||||| || || 
Sbjct: 323 ccgttgttacgaccatgcatcatcatggagttagtaaggcgctccacgatgggacattgt 264

                               
Query: 612 gccttgcggaagcgcttggc 631
           || |||||||||||||||||
Sbjct: 263 gctttgcggaagcgcttggc 244



to top

>dbj|AK010681.1| Mus musculus ES cells cDNA, RIKEN full-length enriched library,
           clone:2410046E20 product:ribosomal protein S5, full
           insert sequence
          Length = 731

 Score = 87.7 bits (44), Expect = 5e-14
 Identities = 107/128 (83%)
 Strand = Plus / Minus

                                                                       
Query: 189 cggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgttggat 248
           ||||||| |||||| |||||||| |  || || |||||||||||||| ||    ||||| 
Sbjct: 684 cggttagacttggccacacgctccagttcatctttcttcttgatggcataggaattggag 625

                                                                       
Query: 249 gagcccttggcagcattgatcagctcatcagcaaggcactcagcaatggtcttgacatta 308
           ||||||||||||||||| || |||||||| ||||||||||| || ||||||||||  || 
Sbjct: 624 gagcccttggcagcattaatgagctcatctgcaaggcactcggcgatggtcttgatgttc 565

                   
Query: 309 cggaaagc 316
           ||||||||
Sbjct: 564 cggaaagc 557



 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 67/80 (83%)
 Strand = Plus / Minus

                                                                       
Query: 552 ccgttgttgcgcccgtgcatcatgagggagttggtgaggcgctcgatgatggggcactgc 611
           |||||||| || || |||||||| | |||||| || |||||||| | |||||| || || 
Sbjct: 324 ccgttgttacgaccatgcatcatcatggagttagtaaggcgctccacgatgggacattgt 265

                               
Query: 612 gccttgcggaagcgcttggc 631
           || |||||||||||||||||
Sbjct: 264 gctttgcggaagcgcttggc 245



to top

>dbj|AK009663.1| Mus musculus adult male tongue cDNA, RIKEN full-length enriched
           library, clone:2310037J07 product:ribosomal protein S5,
           full insert sequence
          Length = 731

 Score = 87.7 bits (44), Expect = 5e-14
 Identities = 107/128 (83%)
 Strand = Plus / Minus

                                                                       
Query: 189 cggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgttggat 248
           ||||||| |||||| |||||||| |  || || |||||||||||||| ||    ||||| 
Sbjct: 684 cggttagacttggccacacgctccagttcatctttcttcttgatggcataggaattggag 625

                                                                       
Query: 249 gagcccttggcagcattgatcagctcatcagcaaggcactcagcaatggtcttgacatta 308
           ||||||||||||||||| || |||||||| ||||||||||| || ||||||||||  || 
Sbjct: 624 gagcccttggcagcattaatgagctcatctgcaaggcactcggcgatggtcttgatgttc 565

                   
Query: 309 cggaaagc 316
           ||||||||
Sbjct: 564 cggaaagc 557



 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 67/80 (83%)
 Strand = Plus / Minus

                                                                       
Query: 552 ccgttgttgcgcccgtgcatcatgagggagttggtgaggcgctcgatgatggggcactgc 611
           |||||||| || || |||||||| | |||||| || |||||||| | |||||| || || 
Sbjct: 324 ccgttgttacgaccatgcatcatcatggagttagtaaggcgctccacgatgggacattgt 265

                               
Query: 612 gccttgcggaagcgcttggc 631
           || |||||||||||||||||
Sbjct: 264 gctttgcggaagcgcttggc 245



to top

>dbj|AK050622.1| Mus musculus 2 days neonate thymus thymic cells cDNA, RIKEN
           full-length enriched library, clone:C920021L03
           product:ribosomal protein S5, full insert sequence
          Length = 731

 Score = 87.7 bits (44), Expect = 5e-14
 Identities = 107/128 (83%)
 Strand = Plus / Minus

                                                                       
Query: 189 cggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgttggat 248
           ||||||| |||||| |||||||| |  || || |||||||||||||| ||    ||||| 
Sbjct: 684 cggttagacttggccacacgctccagttcatctttcttcttgatggcataggaattggag 625

                                                                       
Query: 249 gagcccttggcagcattgatcagctcatcagcaaggcactcagcaatggtcttgacatta 308
           ||||||||||||||||| || |||||||| ||||||||||| || ||||||||||  || 
Sbjct: 624 gagcccttggcagcattaatgagctcatctgcaaggcactcggcgatggtcttgatgttc 565

                   
Query: 309 cggaaagc 316
           ||||||||
Sbjct: 564 cggaaagc 557



 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 67/80 (83%)
 Strand = Plus / Minus

                                                                       
Query: 552 ccgttgttgcgcccgtgcatcatgagggagttggtgaggcgctcgatgatggggcactgc 611
           |||||||| || || |||||||| | |||||| || |||||||| | |||||| || || 
Sbjct: 324 ccgttgttacgaccatgcatcatcatggagttagtaaggcgctccacgatgggacattgt 265

                               
Query: 612 gccttgcggaagcgcttggc 631
           || |||||||||||||||||
Sbjct: 264 gctttgcggaagcgcttggc 245



to top

>dbj|AK050611.1| Mus musculus 2 days neonate thymus thymic cells cDNA, RIKEN
           full-length enriched library, clone:C920016K09
           product:ribosomal protein S5, full insert sequence
          Length = 731

 Score = 87.7 bits (44), Expect = 5e-14
 Identities = 107/128 (83%)
 Strand = Plus / Minus

                                                                       
Query: 189 cggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgttggat 248
           ||||||| |||||| |||||||| |  || || |||||||||||||| ||    ||||| 
Sbjct: 684 cggttagacttggccacacgctccagttcatctttcttcttgatggcataggaattggag 625

                                                                       
Query: 249 gagcccttggcagcattgatcagctcatcagcaaggcactcagcaatggtcttgacatta 308
           ||||||||||||||||| || |||||||| ||||||||||| || ||||||||||  || 
Sbjct: 624 gagcccttggcagcattaatgagctcatctgcaaggcactcggcgatggtcttgatgttc 565

                   
Query: 309 cggaaagc 316
           ||||||||
Sbjct: 564 cggaaagc 557



 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 67/80 (83%)
 Strand = Plus / Minus

                                                                       
Query: 552 ccgttgttgcgcccgtgcatcatgagggagttggtgaggcgctcgatgatggggcactgc 611
           |||||||| || || |||||||| | |||||| || |||||||| | |||||| || || 
Sbjct: 324 ccgttgttacgaccatgcatcatcatggagttagtaaggcgctccacgatgggacattgt 265

                               
Query: 612 gccttgcggaagcgcttggc 631
           || |||||||||||||||||
Sbjct: 264 gctttgcggaagcgcttggc 245



to top

>dbj|AK012481.1| Mus musculus 11 days embryo whole body cDNA, RIKEN full-length
           enriched library, clone:2700063O13 product:ribosomal
           protein S5, full insert sequence
          Length = 733

 Score = 87.7 bits (44), Expect = 5e-14
 Identities = 107/128 (83%)
 Strand = Plus / Minus

                                                                       
Query: 189 cggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgttggat 248
           ||||||| |||||| |||||||| |  || || |||||||||||||| ||    ||||| 
Sbjct: 684 cggttagacttggccacacgctccagttcatctttcttcttgatggcataggaattggag 625

                                                                       
Query: 249 gagcccttggcagcattgatcagctcatcagcaaggcactcagcaatggtcttgacatta 308
           ||||||||||||||||| || |||||||| ||||||||||| || ||||||||||  || 
Sbjct: 624 gagcccttggcagcattaatgagctcatctgcaaggcactcggcgatggtcttgatgttc 565

                   
Query: 309 cggaaagc 316
           ||||||||
Sbjct: 564 cggaaagc 557



 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 67/80 (83%)
 Strand = Plus / Minus

                                                                       
Query: 552 ccgttgttgcgcccgtgcatcatgagggagttggtgaggcgctcgatgatggggcactgc 611
           |||||||| || || |||||||| | |||||| || |||||||| | |||||| || || 
Sbjct: 324 ccgttgttacgaccatgcatcatcatggagttagtaaggcgctccacgatgggacattgt 265

                               
Query: 612 gccttgcggaagcgcttggc 631
           || |||||||||||||||||
Sbjct: 264 gctttgcggaagcgcttggc 245



to top

>dbj|AK012424.1| Mus musculus 11 days embryo whole body cDNA, RIKEN full-length
           enriched library, clone:2700054J16 product:ribosomal
           protein S5, full insert sequence
          Length = 731

 Score = 87.7 bits (44), Expect = 5e-14
 Identities = 107/128 (83%)
 Strand = Plus / Minus

                                                                       
Query: 189 cggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgttggat 248
           ||||||| |||||| |||||||| |  || || |||||||||||||| ||    ||||| 
Sbjct: 684 cggttagacttggccacacgctccagttcatctttcttcttgatggcataggaattggag 625

                                                                       
Query: 249 gagcccttggcagcattgatcagctcatcagcaaggcactcagcaatggtcttgacatta 308
           ||||||||||||||||| || |||||||| ||||||||||| || ||||||||||  || 
Sbjct: 624 gagcccttggcagcattaatgagctcatctgcaaggcactcggcgatggtcttgatgttc 565

                   
Query: 309 cggaaagc 316
           ||||||||
Sbjct: 564 cggaaagc 557



 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 67/80 (83%)
 Strand = Plus / Minus

                                                                       
Query: 552 ccgttgttgcgcccgtgcatcatgagggagttggtgaggcgctcgatgatggggcactgc 611
           |||||||| || || |||||||| | |||||| || |||||||| | |||||| || || 
Sbjct: 324 ccgttgttacgaccatgcatcatcatggagttagtaaggcgctccacgatgggacattgt 265

                               
Query: 612 gccttgcggaagcgcttggc 631
           || |||||||||||||||||
Sbjct: 264 gctttgcggaagcgcttggc 245



to top

>dbj|AK002235.1| Mus musculus adult male kidney cDNA, RIKEN full-length enriched
           library, clone:0610006D06 product:ribosomal protein S5,
           full insert sequence
          Length = 731

 Score = 87.7 bits (44), Expect = 5e-14
 Identities = 107/128 (83%)
 Strand = Plus / Minus

                                                                       
Query: 189 cggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgttggat 248
           ||||||| |||||| |||||||| |  || || |||||||||||||| ||    ||||| 
Sbjct: 684 cggttagacttggccacacgctccagttcatctttcttcttgatggcataggaattggag 625

                                                                       
Query: 249 gagcccttggcagcattgatcagctcatcagcaaggcactcagcaatggtcttgacatta 308
           ||||||||||||||||| || |||||||| ||||||||||| || ||||||||||  || 
Sbjct: 624 gagcccttggcagcattaatgagctcatctgcaaggcactcggcgatggtcttgatgttc 565

                   
Query: 309 cggaaagc 316
           ||||||||
Sbjct: 564 cggaaagc 557



 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 67/80 (83%)
 Strand = Plus / Minus

                                                                       
Query: 552 ccgttgttgcgcccgtgcatcatgagggagttggtgaggcgctcgatgatggggcactgc 611
           |||||||| || || |||||||| | |||||| || |||||||| | |||||| || || 
Sbjct: 324 ccgttgttacgaccatgcatcatcatggagttagtaaggcgctccacgatgggacattgt 265

                               
Query: 612 gccttgcggaagcgcttggc 631
           || |||||||||||||||||
Sbjct: 264 gctttgcggaagcgcttggc 245



to top

>dbj|AK020754.1| Mus musculus 0 day neonate thymus cDNA, RIKEN full-length enriched
           library, clone:A430101M19 product:ribosomal protein S5,
           full insert sequence
          Length = 731

 Score = 87.7 bits (44), Expect = 5e-14
 Identities = 107/128 (83%)
 Strand = Plus / Minus

                                                                       
Query: 189 cggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgttggat 248
           ||||||| |||||| |||||||| |  || || |||||||||||||| ||    ||||| 
Sbjct: 684 cggttagacttggccacacgctccagttcatctttcttcttgatggcataggaattggag 625

                                                                       
Query: 249 gagcccttggcagcattgatcagctcatcagcaaggcactcagcaatggtcttgacatta 308
           ||||||||||||||||| || |||||||| ||||||||||| || ||||||||||  || 
Sbjct: 624 gagcccttggcagcattaatgagctcatctgcaaggcactcggcgatggtcttgatgttc 565

                   
Query: 309 cggaaagc 316
           ||||||||
Sbjct: 564 cggaaagc 557



 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 67/80 (83%)
 Strand = Plus / Minus

                                                                       
Query: 552 ccgttgttgcgcccgtgcatcatgagggagttggtgaggcgctcgatgatggggcactgc 611
           |||||||| || || |||||||| | |||||| || |||||||| | |||||| || || 
Sbjct: 324 ccgttgttacgaccatgcatcatcatggagttagtaaggcgctccacgatgggacattgt 265

                               
Query: 612 gccttgcggaagcgcttggc 631
           || |||||||||||||||||
Sbjct: 264 gctttgcggaagcgcttggc 245



to top

>gb|BC020401.1| Mus musculus ribosomal protein S5, mRNA (cDNA clone IMAGE:3963156)
          Length = 726

 Score = 87.7 bits (44), Expect = 5e-14
 Identities = 107/128 (83%)
 Strand = Plus / Minus

                                                                       
Query: 189 cggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgttggat 248
           ||||||| |||||| |||||||| |  || || |||||||||||||| ||    ||||| 
Sbjct: 661 cggttagacttggccacacgctccagttcatctttcttcttgatggcataggaattggag 602

                                                                       
Query: 249 gagcccttggcagcattgatcagctcatcagcaaggcactcagcaatggtcttgacatta 308
           ||||||||||||||||| || |||||||| ||||||||||| || ||||||||||  || 
Sbjct: 601 gagcccttggcagcattaatgagctcatctgcaaggcactcggcgatggtcttgatgttc 542

                   
Query: 309 cggaaagc 316
           ||||||||
Sbjct: 541 cggaaagc 534



 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 67/80 (83%)
 Strand = Plus / Minus

                                                                       
Query: 552 ccgttgttgcgcccgtgcatcatgagggagttggtgaggcgctcgatgatggggcactgc 611
           |||||||| || || |||||||| | |||||| || |||||||| | |||||| || || 
Sbjct: 304 ccgttgttacgaccatgcatcatcatggagttagtaaggcgctccacgatgggacattgt 245

                               
Query: 612 gccttgcggaagcgcttggc 631
           || |||||||||||||||||
Sbjct: 244 gctttgcggaagcgcttggc 225



to top

>gb|AY194365.1| Vitis vinifera putative 40S ribosomal protein S5 (Rps5) mRNA,
           partial cds
          Length = 661

 Score = 85.7 bits (43), Expect = 2e-13
 Identities = 67/75 (89%)
 Strand = Plus / Minus

                                                                       
Query: 182 atcttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaact 241
           |||| ||||||||||||||||||| ||||| ||| | ||||| |||||||||||||| ||
Sbjct: 461 atctcaacggttagccttggcaactcgctcaatcccatcctttttcttgatggcgtagct 402

                          
Query: 242 gttggatgagccctt 256
           ||||||||| |||||
Sbjct: 401 gttggatgaaccctt 387



 Score = 46.1 bits (23), Expect = 0.16
 Identities = 65/79 (82%)
 Strand = Plus / Minus

                                                                       
Query: 375 gagatatccacagcctgtctcctcacaacaccagctgacccaatacgggtagcatcctca 434
           |||||||| ||||| ||||  || ||||| ||||| || |||||||| || ||||| || 
Sbjct: 268 gagatatcaacagcttgtcgtctaacaacgccagcagagccaatacgtgttgcatcttct 209

                              
Query: 435 cgtggcccactgttgatga 453
           | ||| |||||||||||||
Sbjct: 208 cttggtccactgttgatga 190



to top

>gb|AF517858.1| Griffithsia japonica isolate Gj431 40S ribosome protein S5 mRNA,
           complete cds
          Length = 889

 Score = 85.7 bits (43), Expect = 2e-13
 Identities = 97/115 (84%)
 Strand = Plus / Minus

                                                                       
Query: 189 cggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgttggat 248
           |||||||||||||| ||||| |||| ||||||||||||||||||||||||   |||||| 
Sbjct: 602 cggttagccttggcgacacgttcgacctcgtccttcttcttgatggcgtatgagttggag 543

                                                                  
Query: 249 gagcccttggcagcattgatcagctcatcagcaaggcactcagcaatggtcttga 303
           || ||||| || || ||||| || || || || ||||| || |||||||||||||
Sbjct: 542 gatcccttcgccgcgttgatgagttcgtctgcgaggcattcggcaatggtcttga 488



 Score = 83.8 bits (42), Expect = 7e-13
 Identities = 81/93 (87%), Gaps = 2/93 (2%)
 Strand = Plus / Minus

                                                                       
Query: 486 gtcggtgaggaggtggatgatctccatggtgtgcttgatgatgcggacggccatgatctt 545
           |||||||||||||| ||||||||| |  | |||||||| |||||| |||||||| | |||
Sbjct: 306 gtcggtgaggaggttgatgatctcgaacgagtgcttgacgatgcgcacggccatcacctt 247

                                            
Query: 546 ctttgcccgttgttgcgcccgtgcatcatgagg 578
           ||||  ||||||||||| |||||||||||||||
Sbjct: 246 cttt--ccgttgttgcggccgtgcatcatgagg 216



to top

>gb|AY857462.1| Suberites domuncula S5 mRNA, complete cds
          Length = 624

 Score = 85.7 bits (43), Expect = 2e-13
 Identities = 100/119 (84%)
 Strand = Plus / Minus

                                                                       
Query: 185 ttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgtt 244
           ||||||||||| |||||| ||||| || | ||| || |||||||| ||||||||    ||
Sbjct: 624 ttaacggttagacttggctacacgttccagctcatctttcttctttatggcgtaggaatt 565

                                                                      
Query: 245 ggatgagcccttggcagcattgatcagctcatcagcaaggcactcagcaatggtcttga 303
           |||||| ||||| ||||||||||| || ||||||||||| ||||| |||||| ||||||
Sbjct: 564 ggatgaaccctttgcagcattgataagttcatcagcaagacactctgcaatgctcttga 506



to top

>ref|XM_370161.1| Magnaporthe grisea 70-15 chromosome II hypothetical protein
           (MG06658.4) partial mRNA
          Length = 564

 Score = 83.8 bits (42), Expect = 7e-13
 Identities = 69/78 (88%)
 Strand = Plus / Minus

                                                                       
Query: 552 ccgttgttgcgcccgtgcatcatgagggagttggtgaggcgctcgatgatggggcactgc 611
           ||||||||||| ||||||||||| || |||||||| || ||||| ||||||||||| |  
Sbjct: 200 ccgttgttgcggccgtgcatcatcagagagttggtaagacgctcaatgatggggcagttg 141

                             
Query: 612 gccttgcggaagcgcttg 629
           ||||||||||||||||||
Sbjct: 140 gccttgcggaagcgcttg 123



 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 91/108 (84%)
 Strand = Plus / Minus

                                                                       
Query: 251 gcccttggcagcattgatcagctcatcagcaaggcactcagcaatggtcttgacattacg 310
           ||||||||| || ||||||| ||| ||||| | ||||||||| |||| |||||| || ||
Sbjct: 498 gcccttggcggcgttgatcaactcctcagccaagcactcagcgatggacttgacgttgcg 439

                                                           
Query: 311 gaaagcgctctccctggcaccagtggtcagaaggtagatggcctggtt 358
           ||||| |  ||| | ||||||||||||||| ||| |||||||||||||
Sbjct: 438 gaaagaggcctcgcgggcaccagtggtcaggagggagatggcctggtt 391



to top

>ref|XM_751645.1| Ustilago maydis 521 hypothetical protein (UM00591.1) partial mRNA
          Length = 747

 Score = 83.8 bits (42), Expect = 7e-13
 Identities = 78/90 (86%)
 Strand = Plus / Minus

                                                                       
Query: 200 ggcaacacgctcgatctcgtccttcttcttgatggcgtaactgttggatgagcccttggc 259
           |||||||||||| ||||||||   |||||||||||||||   |||||| |||||||||||
Sbjct: 732 ggcaacacgctccatctcgtcacgcttcttgatggcgtacgagttggacgagcccttggc 673

                                         
Query: 260 agcattgatcagctcatcagcaaggcactc 289
           ||| ||||| ||||| ||||| ||||||||
Sbjct: 672 agcgttgatgagctcgtcagcgaggcactc 643



 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 126/153 (82%), Gaps = 3/153 (1%)
 Strand = Plus / Minus

                                                                       
Query: 432 tcacgtggcccactgttgatgatggcgtcgacgatgatctggatggggttggccgtcggt 491
           ||||| || ||| |||||||||||||||| |||| ||||||||| ||||||| |||||||
Sbjct: 500 tcacgaggaccagtgttgatgatggcgtcaacgaggatctggatagggttgg-cgtcggt 442

                                                                       
Query: 492 gaggaggtggatgatctccatggtgtgcttgatgatgcggacggccatgatcttctttgc 551
            || |||| ||||||||| |  | |||   ||  ||||| || ||||||| ||||||   
Sbjct: 441 aagcaggttgatgatctcgaaagcgtgggcgacaatgcgaacagccatgagcttctt--g 384

                                            
Query: 552 ccgttgttgcgcccgtgcatcatgagggagttg 584
           ||||||||||| |||||||||||||| ||||||
Sbjct: 383 ccgttgttgcggccgtgcatcatgagcgagttg 351



to top

>emb|CR640277.2|CNS0ET0B Tetraodon nigroviridis full-length cDNA
          Length = 486

 Score = 83.8 bits (42), Expect = 7e-13
 Identities = 72/82 (87%)
 Strand = Plus / Minus

                                                                       
Query: 552 ccgttgttgcgcccgtgcatcatgagggagttggtgaggcgctcgatgatggggcactgc 611
           ||||||||||| ||||||||||| | ||||||||| || ||||| | |||||||||||| 
Sbjct: 289 ccgttgttgcgaccgtgcatcatcatggagttggtcagacgctccacgatggggcactgg 230

                                 
Query: 612 gccttgcggaagcgcttggccg 633
           ||||||||||| || |||||||
Sbjct: 229 gccttgcggaaacgtttggccg 208



 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 40/44 (90%)
 Strand = Plus / Minus

                                                       
Query: 414 ccaatacgggtagcatcctcacgtggcccactgttgatgatggc 457
           ||||||||||| | ||||||||| ||||| ||||||||||||||
Sbjct: 424 ccaatacgggtggaatcctcacggggcccgctgttgatgatggc 381



to top

>ref|NM_142150.2| Drosophila melanogaster Ribosomal protein S5b CG7014-RA (RpS5b),
           mRNA
          Length = 899

 Score = 83.8 bits (42), Expect = 7e-13
 Identities = 90/106 (84%)
 Strand = Plus / Minus

                                                                       
Query: 184 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 243
           ||||||| || | |||||| || ||||| | ||||||||||||||||||||||||   ||
Sbjct: 805 cttaacgattcgacttggccacgcgctccaactcgtccttcttcttgatggcgtaggagt 746

                                                         
Query: 244 tggatgagcccttggcagcattgatcagctcatcagcaaggcactc 289
           |||| || |||||||| || ||||||||||||||||| || |||||
Sbjct: 745 tggaggatcccttggcggcgttgatcagctcatcagccagacactc 700



 Score = 61.9 bits (31), Expect = 3e-06
 Identities = 128/158 (81%), Gaps = 3/158 (1%)
 Strand = Plus / Minus

                                                                       
Query: 499 tggatgatctccatggtgtgcttgatgatgcggacggccatgatcttctttgcccgttgt 558
           ||||||||||| | || |||||||| |||||||  ||| | || ||||||   |||||| 
Sbjct: 491 tggatgatctcgaaggcgtgcttgacgatgcggcaggcgaggagcttcttg--ccgttgc 434

                                                                       
Query: 559 tgcgcccgtgcatcatgagggagttggtgaggcgctcgatgatggggcactgcgccttgc 618
           ||||||| | |||||| ||   | ||||||||||||| | ||||||||| || |||||||
Sbjct: 433 tgcgccccttcatcatcagcccgctggtgaggcgctccacgatggggcattgggccttgc 374

                                                 
Query: 619 ggaagcgcttggccgagtagcgcccggccggagtgcgg 656
           |||| | ||||||||  ||||| |||| ||||||||||
Sbjct: 373 ggaatctcttggccgcatagcgtccgg-cggagtgcgg 337



to top

>gb|AY071138.1| Drosophila melanogaster RE17836 full length cDNA
          Length = 888

 Score = 83.8 bits (42), Expect = 7e-13
 Identities = 90/106 (84%)
 Strand = Plus / Minus

                                                                       
Query: 184 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 243
           ||||||| || | |||||| || ||||| | ||||||||||||||||||||||||   ||
Sbjct: 778 cttaacgattcgacttggccacgcgctccaactcgtccttcttcttgatggcgtaggagt 719

                                                         
Query: 244 tggatgagcccttggcagcattgatcagctcatcagcaaggcactc 289
           |||| || |||||||| || ||||||||||||||||| || |||||
Sbjct: 718 tggaggatcccttggcggcgttgatcagctcatcagccagacactc 673



 Score = 61.9 bits (31), Expect = 3e-06
 Identities = 128/158 (81%), Gaps = 3/158 (1%)
 Strand = Plus / Minus

                                                                       
Query: 499 tggatgatctccatggtgtgcttgatgatgcggacggccatgatcttctttgcccgttgt 558
           ||||||||||| | || |||||||| |||||||  ||| | || ||||||   |||||| 
Sbjct: 464 tggatgatctcgaaggcgtgcttgacgatgcggcaggcgaggagcttcttg--ccgttgc 407

                                                                       
Query: 559 tgcgcccgtgcatcatgagggagttggtgaggcgctcgatgatggggcactgcgccttgc 618
           ||||||| | |||||| ||   | ||||||||||||| | ||||||||| || |||||||
Sbjct: 406 tgcgccccttcatcatcagcccgctggtgaggcgctccacgatggggcattgggccttgc 347

                                                 
Query: 619 ggaagcgcttggccgagtagcgcccggccggagtgcgg 656
           |||| | ||||||||  ||||| |||| ||||||||||
Sbjct: 346 ggaatctcttggccgcatagcgtccgg-cggagtgcgg 310



to top

>gb|AC008136.4|AC008136 Drosophila melanogaster, chromosome 3R, region 88D-88E, BAC clone
             BACR08H11, complete sequence
          Length = 154890

 Score = 83.8 bits (42), Expect = 7e-13
 Identities = 90/106 (84%)
 Strand = Plus / Plus

                                                                         
Query: 184   cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 243
             ||||||| || | |||||| || ||||| | ||||||||||||||||||||||||   ||
Sbjct: 88987 cttaacgattcgacttggccacgcgctccaactcgtccttcttcttgatggcgtaggagt 89046

                                                           
Query: 244   tggatgagcccttggcagcattgatcagctcatcagcaaggcactc 289
             |||| || |||||||| || ||||||||||||||||| || |||||
Sbjct: 89047 tggaggatcccttggcggcgttgatcagctcatcagccagacactc 89092



 Score = 61.9 bits (31), Expect = 3e-06
 Identities = 128/158 (81%), Gaps = 3/158 (1%)
 Strand = Plus / Plus

                                                                         
Query: 499   tggatgatctccatggtgtgcttgatgatgcggacggccatgatcttctttgcccgttgt 558
             ||||||||||| | || |||||||| |||||||  ||| | || ||||||   |||||| 
Sbjct: 89559 tggatgatctcgaaggcgtgcttgacgatgcggcaggcgaggagcttcttg--ccgttgc 89616

                                                                         
Query: 559   tgcgcccgtgcatcatgagggagttggtgaggcgctcgatgatggggcactgcgccttgc 618
             ||||||| | |||||| ||   | ||||||||||||| | ||||||||| || |||||||
Sbjct: 89617 tgcgccccttcatcatcagcccgctggtgaggcgctccacgatggggcattgggccttgc 89676

                                                   
Query: 619   ggaagcgcttggccgagtagcgcccggccggagtgcgg 656
             |||| | ||||||||  ||||| |||| ||||||||||
Sbjct: 89677 ggaatctcttggccgcatagcgtccgg-cggagtgcgg 89713



to top

>gb|AC005721.3|AC005721 Drosophila melanogaster, chromosome 3R, region 88D8-88E1, BAC clone
             BACR48E23, complete sequence
          Length = 203183

 Score = 83.8 bits (42), Expect = 7e-13
 Identities = 90/106 (84%)
 Strand = Plus / Plus

                                                                         
Query: 184   cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 243
             ||||||| || | |||||| || ||||| | ||||||||||||||||||||||||   ||
Sbjct: 66606 cttaacgattcgacttggccacgcgctccaactcgtccttcttcttgatggcgtaggagt 66665

                                                           
Query: 244   tggatgagcccttggcagcattgatcagctcatcagcaaggcactc 289
             |||| || |||||||| || ||||||||||||||||| || |||||
Sbjct: 66666 tggaggatcccttggcggcgttgatcagctcatcagccagacactc 66711



 Score = 61.9 bits (31), Expect = 3e-06
 Identities = 128/158 (81%), Gaps = 3/158 (1%)
 Strand = Plus / Plus

                                                                         
Query: 499   tggatgatctccatggtgtgcttgatgatgcggacggccatgatcttctttgcccgttgt 558
             ||||||||||| | || |||||||| |||||||  ||| | || ||||||   |||||| 
Sbjct: 67178 tggatgatctcgaaggcgtgcttgacgatgcggcaggcgaggagcttcttg--ccgttgc 67235

                                                                         
Query: 559   tgcgcccgtgcatcatgagggagttggtgaggcgctcgatgatggggcactgcgccttgc 618
             ||||||| | |||||| ||   | ||||||||||||| | ||||||||| || |||||||
Sbjct: 67236 tgcgccccttcatcatcagcccgctggtgaggcgctccacgatggggcattgggccttgc 67295

                                                   
Query: 619   ggaagcgcttggccgagtagcgcccggccggagtgcgg 656
             |||| | ||||||||  ||||| |||| ||||||||||
Sbjct: 67296 ggaatctcttggccgcatagcgtccgg-cggagtgcgg 67332



to top

>gb|AE003706.5| Drosophila melanogaster chromosome 3R, section 44 of 118 of the complete
              sequence
          Length = 270961

 Score = 83.8 bits (42), Expect = 7e-13
 Identities = 90/106 (84%)
 Strand = Plus / Plus

                                                                          
Query: 184    cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 243
              ||||||| || | |||||| || ||||| | ||||||||||||||||||||||||   ||
Sbjct: 203133 cttaacgattcgacttggccacgcgctccaactcgtccttcttcttgatggcgtaggagt 203192

                                                            
Query: 244    tggatgagcccttggcagcattgatcagctcatcagcaaggcactc 289
              |||| || |||||||| || ||||||||||||||||| || |||||
Sbjct: 203193 tggaggatcccttggcggcgttgatcagctcatcagccagacactc 203238



 Score = 61.9 bits (31), Expect = 3e-06
 Identities = 128/158 (81%), Gaps = 3/158 (1%)
 Strand = Plus / Plus

                                                                          
Query: 499    tggatgatctccatggtgtgcttgatgatgcggacggccatgatcttctttgcccgttgt 558
              ||||||||||| | || |||||||| |||||||  ||| | || ||||||   |||||| 
Sbjct: 203705 tggatgatctcgaaggcgtgcttgacgatgcggcaggcgaggagcttcttg--ccgttgc 203762

                                                                          
Query: 559    tgcgcccgtgcatcatgagggagttggtgaggcgctcgatgatggggcactgcgccttgc 618
              ||||||| | |||||| ||   | ||||||||||||| | ||||||||| || |||||||
Sbjct: 203763 tgcgccccttcatcatcagcccgctggtgaggcgctccacgatggggcattgggccttgc 203822

                                                    
Query: 619    ggaagcgcttggccgagtagcgcccggccggagtgcgg 656
              |||| | ||||||||  ||||| |||| ||||||||||
Sbjct: 203823 ggaatctcttggccgcatagcgtccgg-cggagtgcgg 203859



to top

>emb|BX070858.1|CNS09QU6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC8AF11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 983

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 83/97 (85%)
 Strand = Plus / Plus

                                                                       
Query: 552 ccgttgttgcgcccgtgcatcatgagggagttggtgaggcgctcgatgatggggcactgc 611
           ||||||||||| || | |||||| || ||||||||||| ||||||| ||| |||||||| 
Sbjct: 701 ccgttgttgcggcccttcatcatcagcgagttggtgagacgctcgacgatcgggcactgg 760

                                                
Query: 612 gccttgcggaagcgcttggccgagtagcgcccggccg 648
           ||||||||||| |||||||| |  ||||| |||||||
Sbjct: 761 gccttgcggaaacgcttggcagcatagcgaccggccg 797



 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 79/94 (84%)
 Strand = Plus / Plus

                                                                       
Query: 184 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 243
           |||| ||||||| |||||| |||||||| | ||| ||||||||||||||||||||   ||
Sbjct: 337 cttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgagt 396

                                             
Query: 244 tggatgagcccttggcagcattgatcagctcatc 277
           | || || ||||| || || ||||||||||||||
Sbjct: 397 tcgacgaacccttcgcggcgttgatcagctcatc 430



to top

>emb|BX070857.1|CNS09QU5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC8AF11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 987

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 83/97 (85%)
 Strand = Plus / Minus

                                                                       
Query: 552 ccgttgttgcgcccgtgcatcatgagggagttggtgaggcgctcgatgatggggcactgc 611
           ||||||||||| || | |||||| || ||||||||||| ||||||| ||| |||||||| 
Sbjct: 362 ccgttgttgcggcccttcatcatcagcgagttggtgagacgctcgacgatcgggcactgg 303

                                                
Query: 612 gccttgcggaagcgcttggccgagtagcgcccggccg 648
           ||||||||||| |||||||| |  ||||| |||||||
Sbjct: 302 gccttgcggaaacgcttggcagcatagcgaccggccg 266



 Score = 61.9 bits (31), Expect = 3e-06
 Identities = 49/55 (89%)
 Strand = Plus / Minus

                                                                  
Query: 184 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgta 238
           |||| ||||||| |||||| |||||||| | ||| ||||||||||||||||||||
Sbjct: 725 cttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgta 671



to top

>emb|BX060985.1|CNS09J7X Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC41CD02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 861

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 83/97 (85%)
 Strand = Plus / Minus

                                                                       
Query: 552 ccgttgttgcgcccgtgcatcatgagggagttggtgaggcgctcgatgatggggcactgc 611
           ||||||||||| || | |||||| || ||||||||||| ||||||| ||| |||||||| 
Sbjct: 326 ccgttgttgcggcccttcatcatcagcgagttggtgagacgctcgacgatcgggcactgg 267

                                                
Query: 612 gccttgcggaagcgcttggccgagtagcgcccggccg 648
           ||||||||||| |||||||| |  ||||| |||||||
Sbjct: 266 gccttgcggaaacgcttggcagcatagcgaccggccg 230



 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 79/94 (84%)
 Strand = Plus / Minus

                                                                       
Query: 184 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 243
           |||| ||||||| |||||| |||||||| | ||| ||||||||||||||||||||   ||
Sbjct: 692 cttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgagt 633

                                             
Query: 244 tggatgagcccttggcagcattgatcagctcatc 277
           | || || ||||| || || ||||||||||||||
Sbjct: 632 tcgacgaacccttcgcggcgttgatcagctcatc 599



to top

>emb|BX069208.1|CNS09PKC Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC53DB03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 706

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 83/97 (85%)
 Strand = Plus / Minus

                                                                       
Query: 552 ccgttgttgcgcccgtgcatcatgagggagttggtgaggcgctcgatgatggggcactgc 611
           ||||||||||| || | |||||| || ||||||||||| ||||||| ||| |||||||| 
Sbjct: 383 ccgttgttgcggcccttcatcatcagcgagttggtgagacgctcgacgatcgggcactgg 324

                                                
Query: 612 gccttgcggaagcgcttggccgagtagcgcccggccg 648
           ||||||||||| |||||||| |  ||||| |||||||
Sbjct: 323 gccttgcggaaacgcttggcagcatagcgaccggccg 287



to top

>emb|BX069149.1|CNS09PIP Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC53CG07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1036

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 83/97 (85%)
 Strand = Plus / Minus

                                                                       
Query: 552 ccgttgttgcgcccgtgcatcatgagggagttggtgaggcgctcgatgatggggcactgc 611
           ||||||||||| || | |||||| || ||||||||||| ||||||| ||| |||||||| 
Sbjct: 372 ccgttgttgcggcccttcatcatcagcgagttggtgagacgctcgacgatcgggcactgg 313

                                                
Query: 612 gccttgcggaagcgcttggccgagtagcgcccggccg 648
           ||||||||||| |||||||| |  ||||| |||||||
Sbjct: 312 gccttgcggaaacgcttggcagcatagcgaccggccg 276



 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 79/94 (84%)
 Strand = Plus / Minus

                                                                       
Query: 184 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 243
           |||| ||||||| |||||| |||||||| | ||| ||||||||||||||||||||   ||
Sbjct: 737 cttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgagt 678

                                             
Query: 244 tggatgagcccttggcagcattgatcagctcatc 277
           | || || ||||| || || ||||||||||||||
Sbjct: 677 tcgacgaacccttcgcggcgttgatcagctcatc 644



to top

>emb|BX067805.1|CNS09OHD Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC51CF01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1032

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 83/97 (85%)
 Strand = Plus / Minus

                                                                       
Query: 552 ccgttgttgcgcccgtgcatcatgagggagttggtgaggcgctcgatgatggggcactgc 611
           ||||||||||| || | |||||| || ||||||||||| ||||||| ||| |||||||| 
Sbjct: 372 ccgttgttgcggcccttcatcatcagcgagttggtgagacgctcgacgatcgggcactgg 313

                                                
Query: 612 gccttgcggaagcgcttggccgagtagcgcccggccg 648
           ||||||||||| |||||||| |  ||||| |||||||
Sbjct: 312 gccttgcggaaacgcttggcagcatagcgaccggccg 276



 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 79/94 (84%)
 Strand = Plus / Minus

                                                                       
Query: 184 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 243
           |||| ||||||| |||||| |||||||| | ||| ||||||||||||||||||||   ||
Sbjct: 737 cttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgagt 678

                                             
Query: 244 tggatgagcccttggcagcattgatcagctcatc 277
           | || || ||||| || || ||||||||||||||
Sbjct: 677 tcgacgaacccttcgcggcgttgatcagctcatc 644



to top

>emb|BX067167.1|CNS09NZN Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC50CH11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 972

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 83/97 (85%)
 Strand = Plus / Minus

                                                                       
Query: 552 ccgttgttgcgcccgtgcatcatgagggagttggtgaggcgctcgatgatggggcactgc 611
           ||||||||||| || | |||||| || ||||||||||| ||||||| ||| |||||||| 
Sbjct: 391 ccgttgttgcggcccttcatcatcagcgagttggtgagacgctcgacgatcgggcactgg 332

                                                
Query: 612 gccttgcggaagcgcttggccgagtagcgcccggccg 648
           ||||||||||| |||||||| |  ||||| |||||||
Sbjct: 331 gccttgcggaaacgcttggcagcatagcgaccggccg 295



 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 79/94 (84%)
 Strand = Plus / Minus

                                                                       
Query: 184 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 243
           |||| ||||||| |||||| |||||||| | ||| ||||||||||||||||||||   ||
Sbjct: 756 cttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgagt 697

                                             
Query: 244 tggatgagcccttggcagcattgatcagctcatc 277
           | || || ||||| || || ||||||||||||||
Sbjct: 696 tcgacgaacccttcgcggcgttgatcagctcatc 663



to top

>emb|BX066872.1|CNS09NRG Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC50BD01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 639

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 83/97 (85%)
 Strand = Plus / Minus

                                                                       
Query: 552 ccgttgttgcgcccgtgcatcatgagggagttggtgaggcgctcgatgatggggcactgc 611
           ||||||||||| || | |||||| || ||||||||||| ||||||| ||| |||||||| 
Sbjct: 359 ccgttgttgcggcccttcatcatcagcgagttggtgagacgctcgacgatcgggcactgg 300

                                                
Query: 612 gccttgcggaagcgcttggccgagtagcgcccggccg 648
           ||||||||||| |||||||| |  ||||| |||||||
Sbjct: 299 gccttgcggaaacgcttggcagcatagcgaccggccg 263



to top

>emb|BX066614.1|CNS09NKA Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC5DH12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 934

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 83/97 (85%)
 Strand = Plus / Plus

                                                                       
Query: 552 ccgttgttgcgcccgtgcatcatgagggagttggtgaggcgctcgatgatggggcactgc 611
           ||||||||||| || | |||||| || ||||||||||| ||||||| ||| |||||||| 
Sbjct: 746 ccgttgttgcggcccttcatcatcagcgagttggtgagacgctcgacgatcgggcactgg 805

                                                
Query: 612 gccttgcggaagcgcttggccgagtagcgcccggccg 648
           ||||||||||| |||||||| |  ||||| |||||||
Sbjct: 806 gccttgcggaaacgcttggcagcatagcgaccggccg 842



 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 79/94 (84%)
 Strand = Plus / Plus

                                                                       
Query: 184 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 243
           |||| ||||||| |||||| |||||||| | ||| ||||||||||||||||||||   ||
Sbjct: 381 cttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgagt 440

                                             
Query: 244 tggatgagcccttggcagcattgatcagctcatc 277
           | || || ||||| || || ||||||||||||||
Sbjct: 441 tcgacgaacccttcgcggcgttgatcagctcatc 474



to top

>emb|BX066613.1|CNS09NK9 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC5DH12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 915

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 83/97 (85%)
 Strand = Plus / Minus

                                                                       
Query: 552 ccgttgttgcgcccgtgcatcatgagggagttggtgaggcgctcgatgatggggcactgc 611
           ||||||||||| || | |||||| || ||||||||||| ||||||| ||| |||||||| 
Sbjct: 376 ccgttgttgcggcccttcatcatcagcgagttggtgagacgctcgacgatcgggcactgg 317

                                                
Query: 612 gccttgcggaagcgcttggccgagtagcgcccggccg 648
           ||||||||||| |||||||| |  ||||| |||||||
Sbjct: 316 gccttgcggaaacgcttggcagcatagcgaccggccg 280



 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 79/94 (84%)
 Strand = Plus / Minus

                                                                       
Query: 184 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 243
           |||| ||||||| |||||| |||||||| | ||| ||||||||||||||||||||   ||
Sbjct: 741 cttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgagt 682

                                             
Query: 244 tggatgagcccttggcagcattgatcagctcatc 277
           | || || ||||| || || ||||||||||||||
Sbjct: 681 tcgacgaacccttcgcggcgttgatcagctcatc 648



to top

>emb|BX066320.1|CNS09NC4 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC5CD01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 958

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 83/97 (85%)
 Strand = Plus / Plus

                                                                       
Query: 552 ccgttgttgcgcccgtgcatcatgagggagttggtgaggcgctcgatgatggggcactgc 611
           ||||||||||| || | |||||| || ||||||||||| ||||||| ||| |||||||| 
Sbjct: 741 ccgttgttgcggcccttcatcatcagcgagttggtgagacgctcgacgatcgggcactgg 800

                                                
Query: 612 gccttgcggaagcgcttggccgagtagcgcccggccg 648
           ||||||||||| |||||||| |  ||||| |||||||
Sbjct: 801 gccttgcggaaacgcttggcagcatagcgaccggccg 837



 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 78/94 (82%)
 Strand = Plus / Plus

                                                                       
Query: 184 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 243
           |||| ||||||| |||||| |||||||| | | | ||||||||||||||||||||   ||
Sbjct: 377 cttatcggttagacttggccacacgctccagcccatccttcttcttgatggcgtacgagt 436

                                             
Query: 244 tggatgagcccttggcagcattgatcagctcatc 277
           | || || ||||| || || ||||||||||||||
Sbjct: 437 tcgacgaacccttcgcggcgttgatcagctcatc 470



to top

>emb|BX066319.1|CNS09NC3 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC5CD01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 984

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 83/97 (85%)
 Strand = Plus / Minus

                                                                       
Query: 552 ccgttgttgcgcccgtgcatcatgagggagttggtgaggcgctcgatgatggggcactgc 611
           ||||||||||| || | |||||| || ||||||||||| ||||||| ||| |||||||| 
Sbjct: 372 ccgttgttgcggcccttcatcatcagcgagttggtgagacgctcgacgatcgggcactgg 313

                                                
Query: 612 gccttgcggaagcgcttggccgagtagcgcccggccg 648
           ||||||||||| |||||||| |  ||||| |||||||
Sbjct: 312 gccttgcggaaacgcttggcagcatagcgaccggccg 276



 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 79/94 (84%)
 Strand = Plus / Minus

                                                                       
Query: 184 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 243
           |||| ||||||| |||||| |||||||| | ||| ||||||||||||||||||||   ||
Sbjct: 738 cttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgagt 679

                                             
Query: 244 tggatgagcccttggcagcattgatcagctcatc 277
           | || || ||||| || || ||||||||||||||
Sbjct: 678 tcgacgaacccttcgcggcgttgatcagctcatc 645



to top

>emb|BX065223.1|CNS09MHN Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC49AB01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 879

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 83/97 (85%)
 Strand = Plus / Minus

                                                                       
Query: 552 ccgttgttgcgcccgtgcatcatgagggagttggtgaggcgctcgatgatggggcactgc 611
           ||||||||||| || | |||||| || ||||||||||| ||||||| ||| |||||||| 
Sbjct: 354 ccgttgttgcggcccttcatcatcagcgagttggtgagacgctcgacgatcgggcactgg 295

                                                
Query: 612 gccttgcggaagcgcttggccgagtagcgcccggccg 648
           ||||||||||| |||||||| |  ||||| |||||||
Sbjct: 294 gccttgcggaaacgcttggcagcatagcgaccggccg 258



 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 79/94 (84%)
 Strand = Plus / Minus

                                                                       
Query: 184 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 243
           |||| ||||||| |||||| |||||||| | ||| ||||||||||||||||||||   ||
Sbjct: 719 cttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgagt 660

                                             
Query: 244 tggatgagcccttggcagcattgatcagctcatc 277
           | || || ||||| || || ||||||||||||||
Sbjct: 659 tcgacgaacccttcgcggcgttgatcagctcatc 626



to top

>emb|BX064990.1|CNS09MB6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC48CG05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 812

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 83/97 (85%)
 Strand = Plus / Minus

                                                                       
Query: 552 ccgttgttgcgcccgtgcatcatgagggagttggtgaggcgctcgatgatggggcactgc 611
           ||||||||||| || | |||||| || ||||||||||| ||||||| ||| |||||||| 
Sbjct: 203 ccgttgttgcggcccttcatcatcagcgagttggtgagacgctcgacgatcgggcactgg 144

                                                
Query: 612 gccttgcggaagcgcttggccgagtagcgcccggccg 648
           ||||||||||| |||||||| |  ||||| |||||||
Sbjct: 143 gccttgcggaaacgcttggcagcatagcgaccggccg 107



 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 79/94 (84%)
 Strand = Plus / Minus

                                                                       
Query: 184 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 243
           |||| ||||||| |||||| |||||||| | ||| ||||||||||||||||||||   ||
Sbjct: 569 cttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgagt 510

                                             
Query: 244 tggatgagcccttggcagcattgatcagctcatc 277
           | || || ||||| || || ||||||||||||||
Sbjct: 509 tcgacgaacccttcgcggcgttgatcagctcatc 476



to top

>emb|BX064714.1|CNS09M3I Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC48BA03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 859

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 83/97 (85%)
 Strand = Plus / Minus

                                                                       
Query: 552 ccgttgttgcgcccgtgcatcatgagggagttggtgaggcgctcgatgatggggcactgc 611
           ||||||||||| || | |||||| || ||||||||||| ||||||| ||| |||||||| 
Sbjct: 332 ccgttgttgcggcccttcatcatcagcgagttggtgagacgctcgacgatcgggcactgg 273

                                                
Query: 612 gccttgcggaagcgcttggccgagtagcgcccggccg 648
           ||||||||||| |||||||| |  ||||| |||||||
Sbjct: 272 gccttgcggaaacgcttggcagcatagcgaccggccg 236



 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 78/94 (82%)
 Strand = Plus / Minus

                                                                       
Query: 184 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 243
           |||| ||||||| | |||| |||||||| | ||| ||||||||||||||||||||   ||
Sbjct: 697 cttatcggttagacctggccacacgctccagctcatccttcttcttgatggcgtacgagt 638

                                             
Query: 244 tggatgagcccttggcagcattgatcagctcatc 277
           | || || ||||| || || ||||||||||||||
Sbjct: 637 tcgacgaacccttcgcggcgttgatcagctcatc 604



to top

>emb|BX064166.1|CNS09LOA Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC46BD05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1044

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 83/97 (85%)
 Strand = Plus / Minus

                                                                       
Query: 552 ccgttgttgcgcccgtgcatcatgagggagttggtgaggcgctcgatgatggggcactgc 611
           ||||||||||| || | |||||| || ||||||||||| ||||||| ||| |||||||| 
Sbjct: 372 ccgttgttgcggcccttcatcatcagcgagttggtgagacgctcgacgatcgggcactgg 313

                                                
Query: 612 gccttgcggaagcgcttggccgagtagcgcccggccg 648
           ||||||||||| |||||||| |  ||||| |||||||
Sbjct: 312 gccttgcggaaacgcttggcagcatagcgaccggccg 276



 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 79/94 (84%)
 Strand = Plus / Minus

                                                                       
Query: 184 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 243
           |||| ||||||| |||||| |||||||| | ||| ||||||||||||||||||||   ||
Sbjct: 738 cttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgagt 679

                                             
Query: 244 tggatgagcccttggcagcattgatcagctcatc 277
           | || || ||||| || || ||||||||||||||
Sbjct: 678 tcgacgaacccttcgcggcgttgatcagctcatc 645



to top

>emb|BX062350.1|CNS09K9U Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC43CD10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1011

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 83/97 (85%)
 Strand = Plus / Minus

                                                                       
Query: 552 ccgttgttgcgcccgtgcatcatgagggagttggtgaggcgctcgatgatggggcactgc 611
           ||||||||||| || | |||||| || ||||||||||| ||||||| ||| |||||||| 
Sbjct: 368 ccgttgttgcggcccttcatcatcagcgagttggtgagacgctcgacgatcgggcactgg 309

                                                
Query: 612 gccttgcggaagcgcttggccgagtagcgcccggccg 648
           ||||||||||| |||||||| |  ||||| |||||||
Sbjct: 308 gccttgcggaaacgcttggcagcatagcgaccggccg 272



 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 79/94 (84%)
 Strand = Plus / Minus

                                                                       
Query: 184 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 243
           |||| ||||||| |||||| |||||||| | ||| ||||||||||||||||||||   ||
Sbjct: 734 cttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgagt 675

                                             
Query: 244 tggatgagcccttggcagcattgatcagctcatc 277
           | || || ||||| || || ||||||||||||||
Sbjct: 674 tcgacgaacccttcgcggcgttgatcagctcatc 641



to top

>emb|BX061779.1|CNS09JTZ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC42DA09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 925

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 83/97 (85%)
 Strand = Plus / Minus

                                                                       
Query: 552 ccgttgttgcgcccgtgcatcatgagggagttggtgaggcgctcgatgatggggcactgc 611
           ||||||||||| || | |||||| || ||||||||||| ||||||| ||| |||||||| 
Sbjct: 368 ccgttgttgcggcccttcatcatcagcgagttggtgagacgctcgacgatcgggcactgg 309

                                                
Query: 612 gccttgcggaagcgcttggccgagtagcgcccggccg 648
           ||||||||||| |||||||| |  ||||| |||||||
Sbjct: 308 gccttgcggaaacgcttggcagcatagcgaccggccg 272



 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 79/94 (84%)
 Strand = Plus / Minus

                                                                       
Query: 184 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 243
           |||| ||||||| |||||| |||||||| | ||| ||||||||||||||||||||   ||
Sbjct: 733 cttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgagt 674

                                             
Query: 244 tggatgagcccttggcagcattgatcagctcatc 277
           | || || ||||| || || ||||||||||||||
Sbjct: 673 tcgacgaacccttcgcggcgttgatcagctcatc 640



to top

>emb|BX060577.1|CNS09IWL Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC41AA09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 973

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 83/97 (85%)
 Strand = Plus / Plus

                                                                       
Query: 552 ccgttgttgcgcccgtgcatcatgagggagttggtgaggcgctcgatgatggggcactgc 611
           ||||||||||| || | |||||| || ||||||||||| ||||||| ||| |||||||| 
Sbjct: 745 ccgttgttgcggcccttcatcatcagcgagttggtgagacgctcgacgatcgggcactgg 804

                                                
Query: 612 gccttgcggaagcgcttggccgagtagcgcccggccg 648
           ||||||||||| |||||||| |  ||||| |||||||
Sbjct: 805 gccttgcggaaacgcttggcagcatagcgaccggccg 841



 Score = 61.9 bits (31), Expect = 3e-06
 Identities = 49/55 (89%)
 Strand = Plus / Plus

                                                                  
Query: 184 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgta 238
           |||| ||||||| |||||| |||||||| | ||| ||||||||||||||||||||
Sbjct: 379 cttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgta 433



to top

>emb|BX060576.1|CNS09IWK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC41AA09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1001

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 83/97 (85%)
 Strand = Plus / Minus

                                                                       
Query: 552 ccgttgttgcgcccgtgcatcatgagggagttggtgaggcgctcgatgatggggcactgc 611
           ||||||||||| || | |||||| || ||||||||||| ||||||| ||| |||||||| 
Sbjct: 361 ccgttgttgcggcccttcatcatcagcgagttggtgagacgctcgacgatcgggcactgg 302

                                                
Query: 612 gccttgcggaagcgcttggccgagtagcgcccggccg 648
           ||||||||||| |||||||| |  ||||| |||||||
Sbjct: 301 gccttgcggaaacgcttggcagcatagcgaccggccg 265



 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 79/94 (84%)
 Strand = Plus / Minus

                                                                       
Query: 184 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 243
           |||| ||||||| |||||| |||||||| | ||| ||||||||||||||||||||   ||
Sbjct: 727 cttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgagt 668

                                             
Query: 244 tggatgagcccttggcagcattgatcagctcatc 277
           | || || ||||| || || ||||||||||||||
Sbjct: 667 tcgacgaacccttcgcggcgttgatcagctcatc 634



to top

>emb|BX060097.1|CNS09IJ9 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC40BD04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 972

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 83/97 (85%)
 Strand = Plus / Minus

                                                                       
Query: 552 ccgttgttgcgcccgtgcatcatgagggagttggtgaggcgctcgatgatggggcactgc 611
           ||||||||||| || | |||||| || ||||||||||| ||||||| ||| |||||||| 
Sbjct: 372 ccgttgttgcggcccttcatcatcagcgagttggtgagacgctcgacgatcgggcactgg 313

                                                
Query: 612 gccttgcggaagcgcttggccgagtagcgcccggccg 648
           ||||||||||| |||||||| |  ||||| |||||||
Sbjct: 312 gccttgcggaaacgcttggcagcatagcgaccggccg 276



 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 79/94 (84%)
 Strand = Plus / Minus

                                                                       
Query: 184 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 243
           |||| ||||||| |||||| |||||||| | ||| ||||||||||||||||||||   ||
Sbjct: 736 cttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgagt 677

                                             
Query: 244 tggatgagcccttggcagcattgatcagctcatc 277
           | || || ||||| || || ||||||||||||||
Sbjct: 676 tcgacgaacccttcgcggcgttgatcagctcatc 643



to top

>emb|BX059264.1|CNS09HW4 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC4AB01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 973

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 83/97 (85%)
 Strand = Plus / Minus

                                                                       
Query: 552 ccgttgttgcgcccgtgcatcatgagggagttggtgaggcgctcgatgatggggcactgc 611
           ||||||||||| || | |||||| || ||||||||||| ||||||| ||| |||||||| 
Sbjct: 367 ccgttgttgcggcccttcatcatcagcgagttggtgagacgctcgacgatcgggcactgg 308

                                                
Query: 612 gccttgcggaagcgcttggccgagtagcgcccggccg 648
           ||||||||||| |||||||| |  ||||| |||||||
Sbjct: 307 gccttgcggaaacgcttggcagcatagcgaccggccg 271



 Score = 61.9 bits (31), Expect = 3e-06
 Identities = 49/55 (89%)
 Strand = Plus / Minus

                                                                  
Query: 184 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgta 238
           |||| ||||||| |||||| |||||||| | ||| ||||||||||||||||||||
Sbjct: 732 cttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgta 678



to top

>emb|BX055956.1|CNS09FC8 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC34DB10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 356

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 83/97 (85%)
 Strand = Plus / Minus

                                                                       
Query: 552 ccgttgttgcgcccgtgcatcatgagggagttggtgaggcgctcgatgatggggcactgc 611
           ||||||||||| || | |||||| || ||||||||||| ||||||| ||| |||||||| 
Sbjct: 324 ccgttgttgcggcccttcatcatcagcgagttggtgagacgctcgacgatcgggcactgg 265

                                                
Query: 612 gccttgcggaagcgcttggccgagtagcgcccggccg 648
           ||||||||||| |||||||| |  ||||| |||||||
Sbjct: 264 gccttgcggaaacgcttggcagcatagcgaccggccg 228



to top

>emb|BX055954.1|CNS09FC6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC34DB09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 426

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 84/97 (86%), Gaps = 1/97 (1%)
 Strand = Plus / Minus

                                                                       
Query: 552 ccgttgttgcgcccgtgcatcatgagggagttggtgaggcgctcgatgatggggcactgc 611
           |||||||||||||| | |||||| || ||||||||||| ||||||| ||| |||||||| 
Sbjct: 364 ccgttgttgcgccctt-catcatcagcgagttggtgagacgctcgacgatcgggcactgg 306

                                                
Query: 612 gccttgcggaagcgcttggccgagtagcgcccggccg 648
           ||||||||||| |||||||| |  ||||| |||||||
Sbjct: 305 gccttgcggaaacgcttggcagcatagcgaccggccg 269



to top

>emb|BX056005.1|CNS09FDL Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC34DE07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 605

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 83/97 (85%)
 Strand = Plus / Minus

                                                                       
Query: 552 ccgttgttgcgcccgtgcatcatgagggagttggtgaggcgctcgatgatggggcactgc 611
           ||||||||||| || | |||||| || ||||||||||| ||||||| ||| |||||||| 
Sbjct: 334 ccgttgttgcggcccttcatcatcagcgagttggtgagacgctcgacgatcgggcactgg 275

                                                
Query: 612 gccttgcggaagcgcttggccgagtagcgcccggccg 648
           ||||||||||| |||||||| |  ||||| |||||||
Sbjct: 274 gccttgcggaaacgcttggcagcatagcgaccggccg 238



to top

>emb|BX055289.1|CNS09ETP Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC33DD09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 663

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 83/97 (85%)
 Strand = Plus / Minus

                                                                       
Query: 552 ccgttgttgcgcccgtgcatcatgagggagttggtgaggcgctcgatgatggggcactgc 611
           ||||||||||| || | |||||| || ||||||||||| ||||||| ||| |||||||| 
Sbjct: 375 ccgttgttgcggcccttcatcatcagcgagttggtgagacgctcgacgatcgggcactgg 316

                                                
Query: 612 gccttgcggaagcgcttggccgagtagcgcccggccg 648
           ||||||||||| |||||||| |  ||||| |||||||
Sbjct: 315 gccttgcggaaacgcttggcagcatagcgaccggccg 279



to top

>emb|BX054593.1|CNS09EAD Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC32DC06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 848

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 83/97 (85%)
 Strand = Plus / Minus

                                                                       
Query: 552 ccgttgttgcgcccgtgcatcatgagggagttggtgaggcgctcgatgatggggcactgc 611
           ||||||||||| || | |||||| || ||||||||||| ||||||| ||| |||||||| 
Sbjct: 159 ccgttgttgcggcccttcatcatcagcgagttggtgagacgctcgacgatcgggcactgg 100

                                                
Query: 612 gccttgcggaagcgcttggccgagtagcgcccggccg 648
           ||||||||||| |||||||| |  ||||| |||||||
Sbjct: 99  gccttgcggaaacgcttggcagcatagcgaccggccg 63



 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 79/94 (84%)
 Strand = Plus / Minus

                                                                       
Query: 184 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 243
           |||| ||||||| |||||| |||||||| | ||| ||||||||||||||||||||   ||
Sbjct: 525 cttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgagt 466

                                             
Query: 244 tggatgagcccttggcagcattgatcagctcatc 277
           | || || ||||| || || ||||||||||||||
Sbjct: 465 tcgacgaacccttcgcggcgttgatcagctcatc 432



to top

>emb|BX054146.1|CNS09DXY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC32AG07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 959

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 83/97 (85%)
 Strand = Plus / Minus

                                                                       
Query: 552 ccgttgttgcgcccgtgcatcatgagggagttggtgaggcgctcgatgatggggcactgc 611
           ||||||||||| || | |||||| || ||||||||||| ||||||| ||| |||||||| 
Sbjct: 336 ccgttgttgcggcccttcatcatcagcgagttggtgagacgctcgacgatcgggcactgg 277

                                                
Query: 612 gccttgcggaagcgcttggccgagtagcgcccggccg 648
           ||||||||||| |||||||| |  ||||| |||||||
Sbjct: 276 gccttgcggaaacgcttggcagcatagcgaccggccg 240



 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 79/94 (84%)
 Strand = Plus / Minus

                                                                       
Query: 184 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 243
           |||| ||||||| |||||| |||||||| | ||| ||||||||||||||||||||   ||
Sbjct: 702 cttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgagt 643

                                             
Query: 244 tggatgagcccttggcagcattgatcagctcatc 277
           | || || ||||| || || ||||||||||||||
Sbjct: 642 tcgacgaacccttcgcggcgttgatcagctcatc 609



to top

>emb|BX050132.1|CNS09AUG Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC26BF03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 914

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 83/97 (85%)
 Strand = Plus / Minus

                                                                       
Query: 552 ccgttgttgcgcccgtgcatcatgagggagttggtgaggcgctcgatgatggggcactgc 611
           ||||||||||| || | |||||| || ||||||||||| ||||||| ||| |||||||| 
Sbjct: 361 ccgttgttgcggcccttcatcatcagcgagttggtgagacgctcgacgatcgggcactgg 302

                                                
Query: 612 gccttgcggaagcgcttggccgagtagcgcccggccg 648
           ||||||||||| |||||||| |  ||||| |||||||
Sbjct: 301 gccttgcggaaacgcttggcagcatagcgaccggccg 265



 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 80/94 (85%)
 Strand = Plus / Minus

                                                                       
Query: 184 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 243
           |||| ||||||| ||||||||||||||| | ||| ||||||||||||||||||||   ||
Sbjct: 726 cttatcggttagacttggcaacacgctccagctcatccttcttcttgatggcgtacgagt 667

                                             
Query: 244 tggatgagcccttggcagcattgatcagctcatc 277
           | || || ||||| || || ||||||||||||||
Sbjct: 666 tcgacgaacccttcgcggcgttgatcagctcatc 633



to top

>emb|BX050939.1|CNS09BGV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC27DC12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 486

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 83/97 (85%)
 Strand = Plus / Minus

                                                                       
Query: 552 ccgttgttgcgcccgtgcatcatgagggagttggtgaggcgctcgatgatggggcactgc 611
           ||||||||||| || | |||||| || ||||||||||| ||||||| ||| |||||||| 
Sbjct: 335 ccgttgttgcggcccttcatcatcagcgagttggtgagacgctcgacgatcgggcactgg 276

                                                
Query: 612 gccttgcggaagcgcttggccgagtagcgcccggccg 648
           ||||||||||| |||||||| |  ||||| |||||||
Sbjct: 275 gccttgcggaaacgcttggcagcatagcgaccggccg 239



to top

>emb|BX050490.1|CNS09B4E Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC27AA12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 501

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 83/97 (85%)
 Strand = Plus / Minus

                                                                       
Query: 552 ccgttgttgcgcccgtgcatcatgagggagttggtgaggcgctcgatgatggggcactgc 611
           ||||||||||| || | |||||| || ||||||||||| ||||||| ||| |||||||| 
Sbjct: 341 ccgttgttgcggcccttcatcatcagcgagttggtgagacgctcgacgatcgggcactgg 282

                                                
Query: 612 gccttgcggaagcgcttggccgagtagcgcccggccg 648
           ||||||||||| |||||||| |  ||||| |||||||
Sbjct: 281 gccttgcggaaacgcttggcagcatagcgaccggccg 245



to top

>emb|BX050054.1|CNS09ASA Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC26BB07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 794

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 83/97 (85%)
 Strand = Plus / Minus

                                                                       
Query: 552 ccgttgttgcgcccgtgcatcatgagggagttggtgaggcgctcgatgatggggcactgc 611
           ||||||||||| || | |||||| || ||||||||||| ||||||| ||| |||||||| 
Sbjct: 239 ccgttgttgcggcccttcatcatcagcgagttggtgagacgctcgacgatcgggcactgg 180

                                                
Query: 612 gccttgcggaagcgcttggccgagtagcgcccggccg 648
           ||||||||||| |||||||| |  ||||| |||||||
Sbjct: 179 gccttgcggaaacgcttggcagcatagcgaccggccg 143



 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 79/94 (84%)
 Strand = Plus / Minus

                                                                       
Query: 184 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 243
           |||| ||||||| |||||| |||||||| | ||| ||||||||||||||||||||   ||
Sbjct: 604 cttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgagt 545

                                             
Query: 244 tggatgagcccttggcagcattgatcagctcatc 277
           | || || ||||| || || ||||||||||||||
Sbjct: 544 tcgacgaacccttcgcggcgttgatcagctcatc 511



to top

>emb|BX049760.1|CNS09AK4 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC25DD10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 786

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 83/97 (85%)
 Strand = Plus / Minus

                                                                       
Query: 552 ccgttgttgcgcccgtgcatcatgagggagttggtgaggcgctcgatgatggggcactgc 611
           ||||||||||| || | |||||| || ||||||||||| ||||||| ||| |||||||| 
Sbjct: 363 ccgttgttgcggcccttcatcatcagcgagttggtgagacgctcgacgatcgggcactgg 304

                                                
Query: 612 gccttgcggaagcgcttggccgagtagcgcccggccg 648
           ||||||||||| |||||||| |  ||||| |||||||
Sbjct: 303 gccttgcggaaacgcttggcagcatagcgaccggccg 267



 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 79/94 (84%)
 Strand = Plus / Minus

                                                                       
Query: 184 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 243
           |||| ||||||| |||||| |||||||| | ||| ||||||||||||||||||||   ||
Sbjct: 728 cttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgagt 669

                                             
Query: 244 tggatgagcccttggcagcattgatcagctcatc 277
           | || || ||||| || || ||||||||||||||
Sbjct: 668 tcgacgaacccttcgcggcgttgatcagctcatc 635



to top

>emb|BX030899.1|CNS08W07 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA46AE08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 989

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 83/97 (85%)
 Strand = Plus / Minus

                                                                       
Query: 552 ccgttgttgcgcccgtgcatcatgagggagttggtgaggcgctcgatgatggggcactgc 611
           ||||||||||| || | |||||| || ||||||||||| ||||||| ||| |||||||| 
Sbjct: 376 ccgttgttgcggcccttcatcatcagcgagttggtgagacgctcgacgatcgggcactgg 317

                                                
Query: 612 gccttgcggaagcgcttggccgagtagcgcccggccg 648
           ||||||||||| |||||||| |  ||||| |||||||
Sbjct: 316 gccttgcggaaacgcttggcagcatagcgaccggccg 280



 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 79/94 (84%)
 Strand = Plus / Minus

                                                                       
Query: 184 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 243
           |||| ||||||| |||||| |||||||| | ||| ||||||||||||||||||||   ||
Sbjct: 740 cttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgagt 681

                                             
Query: 244 tggatgagcccttggcagcattgatcagctcatc 277
           | || || ||||| || || ||||||||||||||
Sbjct: 680 tcgacgaacccttcgcggcgttgatcagctcatc 647



to top

>emb|BX048650.1|CNS099PA Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC23DG03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 552

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 83/97 (85%)
 Strand = Plus / Minus

                                                                       
Query: 552 ccgttgttgcgcccgtgcatcatgagggagttggtgaggcgctcgatgatggggcactgc 611
           ||||||||||| || | |||||| || ||||||||||| ||||||| ||| |||||||| 
Sbjct: 335 ccgttgttgcggcccttcatcatcagcgagttggtgagacgctcgacgatcgggcactgg 276

                                                
Query: 612 gccttgcggaagcgcttggccgagtagcgcccggccg 648
           ||||||||||| |||||||| |  ||||| |||||||
Sbjct: 275 gccttgcggaaacgcttggcagcatagcgaccggccg 239



to top

>emb|BX047888.1|CNS09944 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC22CG06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 265

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 83/97 (85%)
 Strand = Plus / Minus

                                                                       
Query: 552 ccgttgttgcgcccgtgcatcatgagggagttggtgaggcgctcgatgatggggcactgc 611
           ||||||||||| || | |||||| || ||||||||||| ||||||| ||| |||||||| 
Sbjct: 248 ccgttgttgcggcccttcatcatcagcgagttggtgagacgctcgacgatcgggcactgg 189

                                                
Query: 612 gccttgcggaagcgcttggccgagtagcgcccggccg 648
           ||||||||||| |||||||| |  ||||| |||||||
Sbjct: 188 gccttgcggaaacgcttggcagcatagcgaccggccg 152



to top

>emb|BX047653.1|CNS098XL Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC22BB10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 751

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 83/97 (85%)
 Strand = Plus / Minus

                                                                       
Query: 552 ccgttgttgcgcccgtgcatcatgagggagttggtgaggcgctcgatgatggggcactgc 611
           ||||||||||| || | |||||| || ||||||||||| ||||||| ||| |||||||| 
Sbjct: 374 ccgttgttgcggcccttcatcatcagcgagttggtgagacgctcgacgatcgggcactgg 315

                                                
Query: 612 gccttgcggaagcgcttggccgagtagcgcccggccg 648
           ||||||||||| |||||||| |  ||||| |||||||
Sbjct: 314 gccttgcggaaacgcttggcagcatagcgaccggccg 278



 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 79/94 (84%)
 Strand = Plus / Minus

                                                                       
Query: 184 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 243
           |||| ||||||| |||||| |||||||| | ||| ||||||||||||||||||||   ||
Sbjct: 739 cttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgagt 680

                                             
Query: 244 tggatgagcccttggcagcattgatcagctcatc 277
           | || || ||||| || || ||||||||||||||
Sbjct: 679 tcgacgaacccttcgcggcgttgatcagctcatc 646



to top

>emb|BX047407.1|CNS098QR Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC21CE06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 885

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 83/97 (85%)
 Strand = Plus / Plus

                                                                       
Query: 552 ccgttgttgcgcccgtgcatcatgagggagttggtgaggcgctcgatgatggggcactgc 611
           ||||||||||| || | |||||| || ||||||||||| ||||||| ||| |||||||| 
Sbjct: 684 ccgttgttgcggcccttcatcatcagcgagttggtgagacgctcgacgatcgggcactgg 743

                                                
Query: 612 gccttgcggaagcgcttggccgagtagcgcccggccg 648
           ||||||||||| |||||||| |  ||||| |||||||
Sbjct: 744 gccttgcggaaacgcttggcagcatagcgaccggccg 780



 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 79/94 (84%)
 Strand = Plus / Plus

                                                                       
Query: 184 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 243
           |||| ||||||| |||||| |||||||| | ||| ||||||||||||||||||||   ||
Sbjct: 319 cttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgagt 378

                                             
Query: 244 tggatgagcccttggcagcattgatcagctcatc 277
           | || || ||||| || || ||||||||||||||
Sbjct: 379 tcgacgaacccttcgcggcgttgatcagctcatc 412



to top

>emb|BX047406.1|CNS098QQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC21CE06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 915

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 83/97 (85%)
 Strand = Plus / Minus

                                                                       
Query: 552 ccgttgttgcgcccgtgcatcatgagggagttggtgaggcgctcgatgatggggcactgc 611
           ||||||||||| || | |||||| || ||||||||||| ||||||| ||| |||||||| 
Sbjct: 336 ccgttgttgcggcccttcatcatcagcgagttggtgagacgctcgacgatcgggcactgg 277

                                                
Query: 612 gccttgcggaagcgcttggccgagtagcgcccggccg 648
           ||||||||||| |||||||| |  ||||| |||||||
Sbjct: 276 gccttgcggaaacgcttggcagcatagcgaccggccg 240



 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 79/94 (84%)
 Strand = Plus / Minus

                                                                       
Query: 184 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 243
           |||| ||||||| |||||| |||||||| | ||| ||||||||||||||||||||   ||
Sbjct: 701 cttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgagt 642

                                             
Query: 244 tggatgagcccttggcagcattgatcagctcatc 277
           | || || ||||| || || ||||||||||||||
Sbjct: 641 tcgacgaacccttcgcggcgttgatcagctcatc 608



to top

>emb|BX047180.1|CNS098KG Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC21BA02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 703

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 83/97 (85%)
 Strand = Plus / Minus

                                                                       
Query: 552 ccgttgttgcgcccgtgcatcatgagggagttggtgaggcgctcgatgatggggcactgc 611
           ||||||||||| || | |||||| || ||||||||||| ||||||| ||| |||||||| 
Sbjct: 203 ccgttgttgcggcccttcatcatcagcgagttggtgagacgctcgacgatcgggcactgg 144

                                                
Query: 612 gccttgcggaagcgcttggccgagtagcgcccggccg 648
           ||||||||||| |||||||| |  ||||| |||||||
Sbjct: 143 gccttgcggaaacgcttggcagcatagcgaccggccg 107



 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 79/94 (84%)
 Strand = Plus / Minus

                                                                       
Query: 184 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 243
           |||| ||||||| |||||| |||||||| | ||| ||||||||||||||||||||   ||
Sbjct: 568 cttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgagt 509

                                             
Query: 244 tggatgagcccttggcagcattgatcagctcatc 277
           | || || ||||| || || ||||||||||||||
Sbjct: 508 tcgacgaacccttcgcggcgttgatcagctcatc 475



to top

>emb|BX046292.1|CNS097VS Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC2DE09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 960

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 83/97 (85%)
 Strand = Plus / Minus

                                                                       
Query: 552 ccgttgttgcgcccgtgcatcatgagggagttggtgaggcgctcgatgatggggcactgc 611
           ||||||||||| || | |||||| || ||||||||||| ||||||| ||| |||||||| 
Sbjct: 372 ccgttgttgcggcccttcatcatcagcgagttggtgagacgctcgacgatcgggcactgg 313

                                                
Query: 612 gccttgcggaagcgcttggccgagtagcgcccggccg 648
           ||||||||||| |||||||| |  ||||| |||||||
Sbjct: 312 gccttgcggaaacgcttggcagcatagcgaccggccg 276



 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 79/94 (84%)
 Strand = Plus / Minus

                                                                       
Query: 184 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 243
           |||| ||||||| |||||| |||||||| | ||| ||||||||||||||||||||   ||
Sbjct: 737 cttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgagt 678

                                             
Query: 244 tggatgagcccttggcagcattgatcagctcatc 277
           | || || ||||| || || ||||||||||||||
Sbjct: 677 tcgacgaacccttcgcggcgttgatcagctcatc 644



to top

>emb|BX045879.1|CNS097KB Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC2AH09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 982

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 83/97 (85%)
 Strand = Plus / Minus

                                                                       
Query: 552 ccgttgttgcgcccgtgcatcatgagggagttggtgaggcgctcgatgatggggcactgc 611
           ||||||||||| || | |||||| || ||||||||||| ||||||| ||| |||||||| 
Sbjct: 358 ccgttgttgcggcccttcatcatcagcgagttggtgagacgctcgacgatcgggcactgg 299

                                                
Query: 612 gccttgcggaagcgcttggccgagtagcgcccggccg 648
           ||||||||||| |||||||| |  ||||| |||||||
Sbjct: 298 gccttgcggaaacgcttggcagcatagcgaccggccg 262



 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 79/94 (84%)
 Strand = Plus / Minus

                                                                       
Query: 184 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 243
           |||| ||||||| |||||| |||||||| | ||| ||||||||||||||||||||   ||
Sbjct: 662 cttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgagt 603

                                             
Query: 244 tggatgagcccttggcagcattgatcagctcatc 277
           | || || ||||| || || ||||||||||||||
Sbjct: 602 tcgacgaacccttcgcggcgttgatcagctcatc 569



to top

>emb|BX042957.1|CNS095B5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC15AH11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 948

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 83/97 (85%)
 Strand = Plus / Plus

                                                                       
Query: 552 ccgttgttgcgcccgtgcatcatgagggagttggtgaggcgctcgatgatggggcactgc 611
           ||||||||||| || | |||||| || ||||||||||| ||||||| ||| |||||||| 
Sbjct: 763 ccgttgttgcggcccttcatcatcagcgagttggtgagacgctcgacgatcgggcactgg 822

                                                
Query: 612 gccttgcggaagcgcttggccgagtagcgcccggccg 648
           ||||||||||| |||||||| |  ||||| |||||||
Sbjct: 823 gccttgcggaaacgcttggcagcatagcgaccggccg 859



 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 79/94 (84%)
 Strand = Plus / Plus

                                                                       
Query: 184 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 243
           |||| ||||||| |||||| |||||||| | ||| ||||||||||||||||||||   ||
Sbjct: 399 cttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgagt 458

                                             
Query: 244 tggatgagcccttggcagcattgatcagctcatc 277
           | || || ||||| || || ||||||||||||||
Sbjct: 459 tcgacgaacccttcgcggcgttgatcagctcatc 492



to top

>emb|BX042956.1|CNS095B4 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC15AH11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 989

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 83/97 (85%)
 Strand = Plus / Minus

                                                                       
Query: 552 ccgttgttgcgcccgtgcatcatgagggagttggtgaggcgctcgatgatggggcactgc 611
           ||||||||||| || | |||||| || ||||||||||| ||||||| ||| |||||||| 
Sbjct: 395 ccgttgttgcggcccttcatcatcagcgagttggtgagacgctcgacgatcgggcactgg 336

                                                
Query: 612 gccttgcggaagcgcttggccgagtagcgcccggccg 648
           ||||||||||| |||||||| |  ||||| |||||||
Sbjct: 335 gccttgcggaaacgcttggcagcatagcgaccggccg 299



 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 79/94 (84%)
 Strand = Plus / Minus

                                                                       
Query: 184 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 243
           |||| ||||||| |||||| |||||||| | ||| ||||||||||||||||||||   ||
Sbjct: 760 cttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgagt 701

                                             
Query: 244 tggatgagcccttggcagcattgatcagctcatc 277
           | || || ||||| || || ||||||||||||||
Sbjct: 700 tcgacgaacccttcgcggcgttgatcagctcatc 667



to top

>emb|BX043656.1|CNS095UK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC16BF07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 983

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 83/97 (85%)
 Strand = Plus / Minus

                                                                       
Query: 552 ccgttgttgcgcccgtgcatcatgagggagttggtgaggcgctcgatgatggggcactgc 611
           ||||||||||| || | |||||| || ||||||||||| ||||||| ||| |||||||| 
Sbjct: 376 ccgttgttgcggcccttcatcatcagcgagttggtgagacgctcgacgatcgggcactgg 317

                                                
Query: 612 gccttgcggaagcgcttggccgagtagcgcccggccg 648
           ||||||||||| |||||||| |  ||||| |||||||
Sbjct: 316 gccttgcggaaacgcttggcagcatagcgaccggccg 280



 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 79/94 (84%)
 Strand = Plus / Minus

                                                                       
Query: 184 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 243
           |||| ||||||| |||||| |||||||| | ||| ||||||||||||||||||||   ||
Sbjct: 741 cttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgagt 682

                                             
Query: 244 tggatgagcccttggcagcattgatcagctcatc 277
           | || || ||||| || || ||||||||||||||
Sbjct: 681 tcgacgaacccttcgcggcgttgatcagctcatc 648



to top

>emb|BX043116.1|CNS095FK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC15CA04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 947

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 83/97 (85%)
 Strand = Plus / Minus

                                                                       
Query: 552 ccgttgttgcgcccgtgcatcatgagggagttggtgaggcgctcgatgatggggcactgc 611
           ||||||||||| || | |||||| || ||||||||||| ||||||| ||| |||||||| 
Sbjct: 332 ccgttgttgcggcccttcatcatcagcgagttggtgagacgctcgacgatcgggcactgg 273

                                                
Query: 612 gccttgcggaagcgcttggccgagtagcgcccggccg 648
           ||||||||||| |||||||| |  ||||| |||||||
Sbjct: 272 gccttgcggaaacgcttggcagcatagcgaccggccg 236



 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 78/94 (82%)
 Strand = Plus / Minus

                                                                       
Query: 184 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 243
           |||| ||||||| |||||| |||||||| | |||  |||||||||||||||||||   ||
Sbjct: 697 cttatcggttagacttggccacacgctccagctcacccttcttcttgatggcgtacgagt 638

                                             
Query: 244 tggatgagcccttggcagcattgatcagctcatc 277
           | || || ||||| || || ||||||||||||||
Sbjct: 637 tcgacgaacccttcgcggcgttgatcagctcatc 604



to top

>emb|BX041675.1|CNS094BJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC13BA11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 827

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 83/97 (85%)
 Strand = Plus / Minus

                                                                       
Query: 552 ccgttgttgcgcccgtgcatcatgagggagttggtgaggcgctcgatgatggggcactgc 611
           ||||||||||| || | |||||| || ||||||||||| ||||||| ||| |||||||| 
Sbjct: 363 ccgttgttgcggcccttcatcatcagcgagttggtgagacgctcgacgatcgggcactgg 304

                                                
Query: 612 gccttgcggaagcgcttggccgagtagcgcccggccg 648
           ||||||||||| |||||||| |  ||||| |||||||
Sbjct: 303 gccttgcggaaacgcttggcagcatagcgaccggccg 267



 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 79/94 (84%)
 Strand = Plus / Minus

                                                                       
Query: 184 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 243
           |||| ||||||| |||||| |||||||| | ||| ||||||||||||||||||||   ||
Sbjct: 728 cttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgagt 669

                                             
Query: 244 tggatgagcccttggcagcattgatcagctcatc 277
           | || || ||||| || || ||||||||||||||
Sbjct: 668 tcgacgaacccttcgcggcgttgatcagctcatc 635



to top

>emb|BX041950.1|CNS094J6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC13CG02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 678

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 83/97 (85%)
 Strand = Plus / Minus

                                                                       
Query: 552 ccgttgttgcgcccgtgcatcatgagggagttggtgaggcgctcgatgatggggcactgc 611
           ||||||||||| || | |||||| || ||||||||||| ||||||| ||| |||||||| 
Sbjct: 337 ccgttgttgcggcccttcatcatcagcgagttggtgagacgctcgacgatcgggcactgg 278

                                                
Query: 612 gccttgcggaagcgcttggccgagtagcgcccggccg 648
           ||||||||||| |||||||| |  ||||| |||||||
Sbjct: 277 gccttgcggaaacgcttggcagcatagcgaccggccg 241



 Score = 46.1 bits (23), Expect = 0.16
 Identities = 50/59 (84%)
 Strand = Plus / Minus

                                                                      
Query: 219 tccttcttcttgatggcgtaactgttggatgagcccttggcagcattgatcagctcatc 277
           ||||||||||||||||||||   ||| || || ||||| || || ||||||||||||||
Sbjct: 666 tccttcttcttgatggcgtacgagttcgacgaacccttcgcggcgttgatcagctcatc 608



to top

>emb|BX041256.1|CNS093ZW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC12CB04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 863

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 83/97 (85%)
 Strand = Plus / Minus

                                                                       
Query: 552 ccgttgttgcgcccgtgcatcatgagggagttggtgaggcgctcgatgatggggcactgc 611
           ||||||||||| || | |||||| || ||||||||||| ||||||| ||| |||||||| 
Sbjct: 203 ccgttgttgcggcccttcatcatcagcgagttggtgagacgctcgacgatcgggcactgg 144

                                                
Query: 612 gccttgcggaagcgcttggccgagtagcgcccggccg 648
           ||||||||||| |||||||| |  ||||| |||||||
Sbjct: 143 gccttgcggaaacgcttggcagcatagcgaccggccg 107



 Score = 61.9 bits (31), Expect = 3e-06
 Identities = 49/55 (89%)
 Strand = Plus / Minus

                                                                  
Query: 184 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgta 238
           |||| ||||||| |||||| |||||||| | ||| ||||||||||||||||||||
Sbjct: 569 cttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgta 515



to top

>emb|BX040008.1|CNS09318 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC10CC10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 877

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 83/97 (85%)
 Strand = Plus / Plus

                                                                       
Query: 552 ccgttgttgcgcccgtgcatcatgagggagttggtgaggcgctcgatgatggggcactgc 611
           ||||||||||| || | |||||| || ||||||||||| ||||||| ||| |||||||| 
Sbjct: 739 ccgttgttgcggcccttcatcatcagcgagttggtgagacgctcgacgatcgggcactgg 798

                                                
Query: 612 gccttgcggaagcgcttggccgagtagcgcccggccg 648
           ||||||||||| |||||||| |  ||||| |||||||
Sbjct: 799 gccttgcggaaacgcttggcagcatagcgaccggccg 835



 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 79/94 (84%)
 Strand = Plus / Plus

                                                                       
Query: 184 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 243
           |||| ||||||| |||||| |||||||| | ||| ||||||||||||||||||||   ||
Sbjct: 374 cttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgagt 433

                                             
Query: 244 tggatgagcccttggcagcattgatcagctcatc 277
           | || || ||||| || || ||||||||||||||
Sbjct: 434 tcgacgaacccttcgcggcgttgatcagctcatc 467



to top

>emb|BX040007.1|CNS09317 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC10CC10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 933

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 83/97 (85%)
 Strand = Plus / Minus

                                                                       
Query: 552 ccgttgttgcgcccgtgcatcatgagggagttggtgaggcgctcgatgatggggcactgc 611
           ||||||||||| || | |||||| || ||||||||||| ||||||| ||| |||||||| 
Sbjct: 378 ccgttgttgcggcccttcatcatcagcgagttggtgagacgctcgacgatcgggcactgg 319

                                                
Query: 612 gccttgcggaagcgcttggccgagtagcgcccggccg 648
           ||||||||||| |||||||| |  ||||| |||||||
Sbjct: 318 gccttgcggaaacgcttggcagcatagcgaccggccg 282



 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 79/94 (84%)
 Strand = Plus / Minus

                                                                       
Query: 184 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 243
           |||| ||||||| |||||| |||||||| | ||| ||||||||||||||||||||   ||
Sbjct: 743 cttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgagt 684

                                             
Query: 244 tggatgagcccttggcagcattgatcagctcatc 277
           | || || ||||| || || ||||||||||||||
Sbjct: 683 tcgacgaacccttcgcggcgttgatcagctcatc 650



to top

>emb|BX039701.1|CNS092SP Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC10AE06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 969

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 83/97 (85%)
 Strand = Plus / Minus

                                                                       
Query: 552 ccgttgttgcgcccgtgcatcatgagggagttggtgaggcgctcgatgatggggcactgc 611
           ||||||||||| || | |||||| || ||||||||||| ||||||| ||| |||||||| 
Sbjct: 376 ccgttgttgcggcccttcatcatcagcgagttggtgagacgctcgacgatcgggcactgg 317

                                                
Query: 612 gccttgcggaagcgcttggccgagtagcgcccggccg 648
           ||||||||||| |||||||| |  ||||| |||||||
Sbjct: 316 gccttgcggaaacgcttggcagcatagcgaccggccg 280



 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 79/94 (84%)
 Strand = Plus / Minus

                                                                       
Query: 184 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 243
           |||| ||||||| |||||| |||||||| | ||| ||||||||||||||||||||   ||
Sbjct: 741 cttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgagt 682

                                             
Query: 244 tggatgagcccttggcagcattgatcagctcatc 277
           | || || ||||| || || ||||||||||||||
Sbjct: 681 tcgacgaacccttcgcggcgttgatcagctcatc 648



to top

>emb|BX037484.1|CNS09134 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA9DH04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 977

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 83/97 (85%)
 Strand = Plus / Plus

                                                                       
Query: 552 ccgttgttgcgcccgtgcatcatgagggagttggtgaggcgctcgatgatggggcactgc 611
           ||||||||||| || | |||||| || ||||||||||| ||||||| ||| |||||||| 
Sbjct: 721 ccgttgttgcggcccttcatcatcagcgagttggtgagacgctcgacgatcgggcactgg 780

                                                
Query: 612 gccttgcggaagcgcttggccgagtagcgcccggccg 648
           ||||||||||| |||||||| |  ||||| |||||||
Sbjct: 781 gccttgcggaaacgcttggcagcatagcgaccggccg 817



 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 79/94 (84%)
 Strand = Plus / Plus

                                                                       
Query: 184 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 243
           |||| ||||||| |||||| |||||||| | ||| ||||||||||||||||||||   ||
Sbjct: 357 cttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgagt 416

                                             
Query: 244 tggatgagcccttggcagcattgatcagctcatc 277
           | || || ||||| || || ||||||||||||||
Sbjct: 417 tcgacgaacccttcgcggcgttgatcagctcatc 450



to top

>emb|BX037483.1|CNS09133 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA9DH04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 945

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 83/97 (85%)
 Strand = Plus / Minus

                                                                       
Query: 552 ccgttgttgcgcccgtgcatcatgagggagttggtgaggcgctcgatgatggggcactgc 611
           ||||||||||| || | |||||| || ||||||||||| ||||||| ||| |||||||| 
Sbjct: 362 ccgttgttgcggcccttcatcatcagcgagttggtgagacgctcgacgatcgggcactgg 303

                                                
Query: 612 gccttgcggaagcgcttggccgagtagcgcccggccg 648
           ||||||||||| |||||||| |  ||||| |||||||
Sbjct: 302 gccttgcggaaacgcttggcagcatagcgaccggccg 266



 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 79/94 (84%)
 Strand = Plus / Minus

                                                                       
Query: 184 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 243
           |||| ||||||| |||||| |||||||| | ||| ||||||||||||||||||||   ||
Sbjct: 727 cttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgagt 668

                                             
Query: 244 tggatgagcccttggcagcattgatcagctcatc 277
           | || || ||||| || || ||||||||||||||
Sbjct: 667 tcgacgaacccttcgcggcgttgatcagctcatc 634



to top

>emb|BX037292.1|CNS090XS Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA9CG12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 933

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 83/97 (85%)
 Strand = Plus / Minus

                                                                       
Query: 552 ccgttgttgcgcccgtgcatcatgagggagttggtgaggcgctcgatgatggggcactgc 611
           ||||||||||| || | |||||| || ||||||||||| ||||||| ||| |||||||| 
Sbjct: 325 ccgttgttgcggcccttcatcatcagcgagttggtgagacgctcgacgatcgggcactgg 266

                                                
Query: 612 gccttgcggaagcgcttggccgagtagcgcccggccg 648
           ||||||||||| |||||||| |  ||||| |||||||
Sbjct: 265 gccttgcggaaacgcttggcagcatagcgaccggccg 229



 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 79/94 (84%)
 Strand = Plus / Minus

                                                                       
Query: 184 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 243
           |||| ||||||| |||||| |||||||| | ||| ||||||||||||||||||||   ||
Sbjct: 691 cttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgagt 632

                                             
Query: 244 tggatgagcccttggcagcattgatcagctcatc 277
           | || || ||||| || || ||||||||||||||
Sbjct: 631 tcgacgaacccttcgcggcgttgatcagctcatc 598



to top

>emb|BX037168.1|CNS090UC Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA9CA11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 993

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 83/97 (85%)
 Strand = Plus / Plus

                                                                       
Query: 552 ccgttgttgcgcccgtgcatcatgagggagttggtgaggcgctcgatgatggggcactgc 611
           ||||||||||| || | |||||| || ||||||||||| ||||||| ||| |||||||| 
Sbjct: 734 ccgttgttgcggcccttcatcatcagcgagttggtgagacgctcgacgatcgggcactgg 793

                                                
Query: 612 gccttgcggaagcgcttggccgagtagcgcccggccg 648
           ||||||||||| |||||||| |  ||||| |||||||
Sbjct: 794 gccttgcggaaacgcttggcagcatagcgaccggccg 830



 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 79/94 (84%)
 Strand = Plus / Plus

                                                                       
Query: 184 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 243
           |||| ||||||| |||||| |||||||| | ||| ||||||||||||||||||||   ||
Sbjct: 370 cttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgagt 429

                                             
Query: 244 tggatgagcccttggcagcattgatcagctcatc 277
           | || || ||||| || || ||||||||||||||
Sbjct: 430 tcgacgaacccttcgcggcgttgatcagctcatc 463



to top

>emb|BX037167.1|CNS090UB Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA9CA11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 978

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 83/97 (85%)
 Strand = Plus / Minus

                                                                       
Query: 552 ccgttgttgcgcccgtgcatcatgagggagttggtgaggcgctcgatgatggggcactgc 611
           ||||||||||| || | |||||| || ||||||||||| ||||||| ||| |||||||| 
Sbjct: 411 ccgttgttgcggcccttcatcatcagcgagttggtgagacgctcgacgatcgggcactgg 352

                                                
Query: 612 gccttgcggaagcgcttggccgagtagcgcccggccg 648
           ||||||||||| |||||||| |  ||||| |||||||
Sbjct: 351 gccttgcggaaacgcttggcagcatagcgaccggccg 315



 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 79/94 (84%)
 Strand = Plus / Minus

                                                                       
Query: 184 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 243
           |||| ||||||| |||||| |||||||| | ||| ||||||||||||||||||||   ||
Sbjct: 776 cttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgagt 717

                                             
Query: 244 tggatgagcccttggcagcattgatcagctcatc 277
           | || || ||||| || || ||||||||||||||
Sbjct: 716 tcgacgaacccttcgcggcgttgatcagctcatc 683



to top

>emb|BX036321.1|CNS0906T Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA8AE07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 912

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 83/97 (85%)
 Strand = Plus / Plus

                                                                       
Query: 552 ccgttgttgcgcccgtgcatcatgagggagttggtgaggcgctcgatgatggggcactgc 611
           ||||||||||| || | |||||| || ||||||||||| ||||||| ||| |||||||| 
Sbjct: 744 ccgttgttgcggcccttcatcatcagcgagttggtgagacgctcgacgatcgggcactgg 803

                                                
Query: 612 gccttgcggaagcgcttggccgagtagcgcccggccg 648
           ||||||||||| |||||||| |  ||||| |||||||
Sbjct: 804 gccttgcggaaacgcttggcagcatagcgaccggccg 840



 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 79/94 (84%)
 Strand = Plus / Plus

                                                                       
Query: 184 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 243
           |||| ||||||| |||||| |||||||| | ||| ||||||||||||||||||||   ||
Sbjct: 378 cttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgagt 437

                                             
Query: 244 tggatgagcccttggcagcattgatcagctcatc 277
           | || || ||||| || || ||||||||||||||
Sbjct: 438 tcgacgaacccttcgcggcgttgatcagctcatc 471



to top

>emb|BX036320.1|CNS0906S Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA8AE07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 920

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 83/97 (85%)
 Strand = Plus / Minus

                                                                       
Query: 552 ccgttgttgcgcccgtgcatcatgagggagttggtgaggcgctcgatgatggggcactgc 611
           ||||||||||| || | |||||| || ||||||||||| ||||||| ||| |||||||| 
Sbjct: 416 ccgttgttgcggcccttcatcatcagcgagttggtgagacgctcgacgatcgggcactgg 357

                                                
Query: 612 gccttgcggaagcgcttggccgagtagcgcccggccg 648
           ||||||||||| |||||||| |  ||||| |||||||
Sbjct: 356 gccttgcggaaacgcttggcagcatagcgaccggccg 320



 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 79/94 (84%)
 Strand = Plus / Minus

                                                                       
Query: 184 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 243
           |||| ||||||| |||||| |||||||| | ||| ||||||||||||||||||||   ||
Sbjct: 782 cttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgagt 723

                                             
Query: 244 tggatgagcccttggcagcattgatcagctcatc 277
           | || || ||||| || || ||||||||||||||
Sbjct: 722 tcgacgaacccttcgcggcgttgatcagctcatc 689



to top

>emb|BX036088.1|CNS0900C Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA7DA09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 832

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 83/97 (85%)
 Strand = Plus / Minus

                                                                       
Query: 552 ccgttgttgcgcccgtgcatcatgagggagttggtgaggcgctcgatgatggggcactgc 611
           ||||||||||| || | |||||| || ||||||||||| ||||||| ||| |||||||| 
Sbjct: 203 ccgttgttgcggcccttcatcatcagcgagttggtgagacgctcgacgatcgggcactgg 144

                                                
Query: 612 gccttgcggaagcgcttggccgagtagcgcccggccg 648
           ||||||||||| |||||||| |  ||||| |||||||
Sbjct: 143 gccttgcggaaacgcttggcagcatagcgaccggccg 107



 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 79/94 (84%)
 Strand = Plus / Minus

                                                                       
Query: 184 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 243
           |||| ||||||| |||||| |||||||| | ||| ||||||||||||||||||||   ||
Sbjct: 569 cttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgagt 510

                                             
Query: 244 tggatgagcccttggcagcattgatcagctcatc 277
           | || || ||||| || || ||||||||||||||
Sbjct: 509 tcgacgaacccttcgcggcgttgatcagctcatc 476



to top

>emb|BX035877.1|CNS08ZUH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA7BF08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 933

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 83/97 (85%)
 Strand = Plus / Plus

                                                                       
Query: 552 ccgttgttgcgcccgtgcatcatgagggagttggtgaggcgctcgatgatggggcactgc 611
           ||||||||||| || | |||||| || ||||||||||| ||||||| ||| |||||||| 
Sbjct: 760 ccgttgttgcggcccttcatcatcagcgagttggtgagacgctcgacgatcgggcactgg 819

                                                
Query: 612 gccttgcggaagcgcttggccgagtagcgcccggccg 648
           ||||||||||| |||||||| |  ||||| |||||||
Sbjct: 820 gccttgcggaaacgcttggcagcatagcgaccggccg 856



 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 79/94 (84%)
 Strand = Plus / Plus

                                                                       
Query: 184 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 243
           |||| ||||||| |||||| |||||||| | ||| ||||||||||||||||||||   ||
Sbjct: 395 cttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgagt 454

                                             
Query: 244 tggatgagcccttggcagcattgatcagctcatc 277
           | || || ||||| || || ||||||||||||||
Sbjct: 455 tcgacgaacccttcgcggcgttgatcagctcatc 488



to top

>emb|BX035876.1|CNS08ZUG Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA7BF08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 952

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 83/97 (85%)
 Strand = Plus / Minus

                                                                       
Query: 552 ccgttgttgcgcccgtgcatcatgagggagttggtgaggcgctcgatgatggggcactgc 611
           ||||||||||| || | |||||| || ||||||||||| ||||||| ||| |||||||| 
Sbjct: 382 ccgttgttgcggcccttcatcatcagcgagttggtgagacgctcgacgatcgggcactgg 323

                                                
Query: 612 gccttgcggaagcgcttggccgagtagcgcccggccg 648
           ||||||||||| |||||||| |  ||||| |||||||
Sbjct: 322 gccttgcggaaacgcttggcagcatagcgaccggccg 286



 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 79/94 (84%)
 Strand = Plus / Minus

                                                                       
Query: 184 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 243
           |||| ||||||| |||||| |||||||| | ||| ||||||||||||||||||||   ||
Sbjct: 748 cttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgagt 689

                                             
Query: 244 tggatgagcccttggcagcattgatcagctcatc 277
           | || || ||||| || || ||||||||||||||
Sbjct: 688 tcgacgaacccttcgcggcgttgatcagctcatc 655



to top

>emb|BX035842.1|CNS08ZTI Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA7BE03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 767

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 83/97 (85%)
 Strand = Plus / Minus

                                                                       
Query: 552 ccgttgttgcgcccgtgcatcatgagggagttggtgaggcgctcgatgatggggcactgc 611
           ||||||||||| || | |||||| || ||||||||||| ||||||| ||| |||||||| 
Sbjct: 372 ccgttgttgcggcccttcatcatcagcgagttggtgagacgctcgacgatcgggcactgg 313

                                                
Query: 612 gccttgcggaagcgcttggccgagtagcgcccggccg 648
           ||||||||||| |||||||| |  ||||| |||||||
Sbjct: 312 gccttgcggaaacgcttggcagcatagcgaccggccg 276



 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 50/55 (90%)
 Strand = Plus / Minus

                                                                  
Query: 184 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgta 238
           |||| ||||||| ||||||||||||||| | ||| ||||||||||||||||||||
Sbjct: 738 cttatcggttagacttggcaacacgctccagctcatccttcttcttgatggcgta 684



to top

>emb|BX034797.1|CNS08Z0H Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA50DE06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 985

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 83/97 (85%)
 Strand = Plus / Minus

                                                                       
Query: 552 ccgttgttgcgcccgtgcatcatgagggagttggtgaggcgctcgatgatggggcactgc 611
           ||||||||||| || | |||||| || ||||||||||| ||||||| ||| |||||||| 
Sbjct: 370 ccgttgttgcggcccttcatcatcagcgagttggtgagacgctcgacgatcgggcactgg 311

                                                
Query: 612 gccttgcggaagcgcttggccgagtagcgcccggccg 648
           ||||||||||| |||||||| |  ||||| |||||||
Sbjct: 310 gccttgcggaaacgcttggcagcatagcgaccggccg 274



 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 79/94 (84%)
 Strand = Plus / Minus

                                                                       
Query: 184 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 243
           |||| ||||||| |||||| |||||||| | ||| ||||||||||||||||||||   ||
Sbjct: 736 cttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgagt 677

                                             
Query: 244 tggatgagcccttggcagcattgatcagctcatc 277
           | || || ||||| || || ||||||||||||||
Sbjct: 676 tcgacgaacccttcgcggcgttgatcagctcatc 643



to top

>emb|BX034367.1|CNS08YOJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA50BA05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1022

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 83/97 (85%)
 Strand = Plus / Plus

                                                                       
Query: 552 ccgttgttgcgcccgtgcatcatgagggagttggtgaggcgctcgatgatggggcactgc 611
           ||||||||||| || | |||||| || ||||||||||| ||||||| ||| |||||||| 
Sbjct: 717 ccgttgttgcggcccttcatcatcagcgagttggtgagacgctcgacgatcgggcactgg 776

                                                
Query: 612 gccttgcggaagcgcttggccgagtagcgcccggccg 648
           ||||||||||| |||||||| |  ||||| |||||||
Sbjct: 777 gccttgcggaaacgcttggcagcatagcgaccggccg 813



 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 79/94 (84%)
 Strand = Plus / Plus

                                                                       
Query: 184 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 243
           |||| ||||||| |||||| |||||||| | ||| ||||||||||||||||||||   ||
Sbjct: 353 cttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgagt 412

                                             
Query: 244 tggatgagcccttggcagcattgatcagctcatc 277
           | || || ||||| || || ||||||||||||||
Sbjct: 413 tcgacgaacccttcgcggcgttgatcagctcatc 446



to top

>emb|BX034366.1|CNS08YOI Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA50BA05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1068

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 83/97 (85%)
 Strand = Plus / Minus

                                                                       
Query: 552 ccgttgttgcgcccgtgcatcatgagggagttggtgaggcgctcgatgatggggcactgc 611
           ||||||||||| || | |||||| || ||||||||||| ||||||| ||| |||||||| 
Sbjct: 382 ccgttgttgcggcccttcatcatcagcgagttggtgagacgctcgacgatcgggcactgg 323

                                                
Query: 612 gccttgcggaagcgcttggccgagtagcgcccggccg 648
           ||||||||||| |||||||| |  ||||| |||||||
Sbjct: 322 gccttgcggaaacgcttggcagcatagcgaccggccg 286



 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 79/94 (84%)
 Strand = Plus / Minus

                                                                       
Query: 184 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 243
           |||| ||||||| |||||| |||||||| | ||| ||||||||||||||||||||   ||
Sbjct: 748 cttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgagt 689

                                             
Query: 244 tggatgagcccttggcagcattgatcagctcatc 277
           | || || ||||| || || ||||||||||||||
Sbjct: 688 tcgacgaacccttcgcggcgttgatcagctcatc 655



to top

>emb|BX034032.1|CNS08YF8 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA5DB03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 862

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 83/97 (85%)
 Strand = Plus / Plus

                                                                       
Query: 552 ccgttgttgcgcccgtgcatcatgagggagttggtgaggcgctcgatgatggggcactgc 611
           ||||||||||| || | |||||| || ||||||||||| ||||||| ||| |||||||| 
Sbjct: 634 ccgttgttgcggcccttcatcatcagcgagttggtgagacgctcgacgatcgggcactgg 693

                                                
Query: 612 gccttgcggaagcgcttggccgagtagcgcccggccg 648
           ||||||||||| |||||||| |  ||||| |||||||
Sbjct: 694 gccttgcggaaacgcttggcagcatagcgaccggccg 730



 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 79/94 (84%)
 Strand = Plus / Plus

                                                                       
Query: 184 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 243
           |||| ||||||| |||||| |||||||| | ||| ||||||||||||||||||||   ||
Sbjct: 270 cttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgagt 329

                                             
Query: 244 tggatgagcccttggcagcattgatcagctcatc 277
           | || || ||||| || || ||||||||||||||
Sbjct: 330 tcgacgaacccttcgcggcgttgatcagctcatc 363



to top

>emb|BX033399.1|CNS08XXN Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA49DD12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 980

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 83/97 (85%)
 Strand = Plus / Minus

                                                                       
Query: 552 ccgttgttgcgcccgtgcatcatgagggagttggtgaggcgctcgatgatggggcactgc 611
           ||||||||||| || | |||||| || ||||||||||| ||||||| ||| |||||||| 
Sbjct: 369 ccgttgttgcggcccttcatcatcagcgagttggtgagacgctcgacgatcgggcactgg 310

                                                
Query: 612 gccttgcggaagcgcttggccgagtagcgcccggccg 648
           ||||||||||| |||||||| |  ||||| |||||||
Sbjct: 309 gccttgcggaaacgcttggcagcatagcgaccggccg 273



 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 79/94 (84%)
 Strand = Plus / Minus

                                                                       
Query: 184 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 243
           |||| ||||||| |||||| |||||||| | ||| ||||||||||||||||||||   ||
Sbjct: 735 cttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgagt 676

                                             
Query: 244 tggatgagcccttggcagcattgatcagctcatc 277
           | || || ||||| || || ||||||||||||||
Sbjct: 675 tcgacgaacccttcgcggcgttgatcagctcatc 642



to top

>emb|BX032903.1|CNS08XJV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA49AD02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 900

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 83/97 (85%)
 Strand = Plus / Minus

                                                                       
Query: 552 ccgttgttgcgcccgtgcatcatgagggagttggtgaggcgctcgatgatggggcactgc 611
           ||||||||||| || | |||||| || ||||||||||| ||||||| ||| |||||||| 
Sbjct: 339 ccgttgttgcggcccttcatcatcagcgagttggtgagacgctcgacgatcgggcactgg 280

                                                
Query: 612 gccttgcggaagcgcttggccgagtagcgcccggccg 648
           ||||||||||| |||||||| |  ||||| |||||||
Sbjct: 279 gccttgcggaaacgcttggcagcatagcgaccggccg 243



 Score = 46.1 bits (23), Expect = 0.16
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                          
Query: 184 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttg 230
           |||| ||||||| |||||| |||||||| | ||| ||||||||||||
Sbjct: 705 cttatcggttagacttggccacacgctccagctcatccttcttcttg 659



to top

>emb|BX032460.1|CNS08X7K Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA48BD09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 843

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 83/97 (85%)
 Strand = Plus / Minus

                                                                       
Query: 552 ccgttgttgcgcccgtgcatcatgagggagttggtgaggcgctcgatgatggggcactgc 611
           ||||||||||| || | |||||| || ||||||||||| ||||||| ||| |||||||| 
Sbjct: 454 ccgttgttgcggcccttcatcatcagcgagttggtgagacgctcgacgatcgggcactgg 395

                                                
Query: 612 gccttgcggaagcgcttggccgagtagcgcccggccg 648
           ||||||||||| |||||||| |  ||||| |||||||
Sbjct: 394 gccttgcggaaacgcttggcagcatagcgaccggccg 358



 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 79/94 (84%)
 Strand = Plus / Minus

                                                                       
Query: 184 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 243
           |||| ||||||| |||||| |||||||| | ||| ||||||||||||||||||||   ||
Sbjct: 819 cttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgagt 760

                                             
Query: 244 tggatgagcccttggcagcattgatcagctcatc 277
           | || || ||||| || || ||||||||||||||
Sbjct: 759 tcgacgaacccttcgcggcgttgatcagctcatc 726



to top

>emb|BX031884.1|CNS08WRK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA47CA09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 979

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 83/97 (85%)
 Strand = Plus / Minus

                                                                       
Query: 552 ccgttgttgcgcccgtgcatcatgagggagttggtgaggcgctcgatgatggggcactgc 611
           ||||||||||| || | |||||| || ||||||||||| ||||||| ||| |||||||| 
Sbjct: 370 ccgttgttgcggcccttcatcatcagcgagttggtgagacgctcgacgatcgggcactgg 311

                                                
Query: 612 gccttgcggaagcgcttggccgagtagcgcccggccg 648
           ||||||||||| |||||||| |  ||||| |||||||
Sbjct: 310 gccttgcggaaacgcttggcagcatagcgaccggccg 274



 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 79/94 (84%)
 Strand = Plus / Minus

                                                                       
Query: 184 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 243
           |||| ||||||| |||||| |||||||| | ||| ||||||||||||||||||||   ||
Sbjct: 736 cttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgagt 677

                                             
Query: 244 tggatgagcccttggcagcattgatcagctcatc 277
           | || || ||||| || || ||||||||||||||
Sbjct: 676 tcgacgaacccttcgcggcgttgatcagctcatc 643



to top

>emb|BX031739.1|CNS08WNJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA47BC02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 916

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 83/97 (85%)
 Strand = Plus / Minus

                                                                       
Query: 552 ccgttgttgcgcccgtgcatcatgagggagttggtgaggcgctcgatgatggggcactgc 611
           ||||||||||| || | |||||| || ||||||||||| ||||||| ||| |||||||| 
Sbjct: 371 ccgttgttgcggcccttcatcatcagcgagttggtgagacgctcgacgatcgggcactgg 312

                                                
Query: 612 gccttgcggaagcgcttggccgagtagcgcccggccg 648
           ||||||||||| |||||||| |  ||||| |||||||
Sbjct: 311 gccttgcggaaacgcttggcagcatagcgaccggccg 275



 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 79/94 (84%)
 Strand = Plus / Minus

                                                                       
Query: 184 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 243
           |||| ||||||| |||||| |||||||| | ||| ||||||||||||||||||||   ||
Sbjct: 736 cttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgagt 677

                                             
Query: 244 tggatgagcccttggcagcattgatcagctcatc 277
           | || || ||||| || || ||||||||||||||
Sbjct: 676 tcgacgaacccttcgcggcgttgatcagctcatc 643



to top

>emb|BX031420.1|CNS08WEO Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA46DD10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 947

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 83/97 (85%)
 Strand = Plus / Minus

                                                                       
Query: 552 ccgttgttgcgcccgtgcatcatgagggagttggtgaggcgctcgatgatggggcactgc 611
           ||||||||||| || | |||||| || ||||||||||| ||||||| ||| |||||||| 
Sbjct: 379 ccgttgttgcggcccttcatcatcagcgagttggtgagacgctcgacgatcgggcactgg 320

                                                
Query: 612 gccttgcggaagcgcttggccgagtagcgcccggccg 648
           ||||||||||| |||||||| |  ||||| |||||||
Sbjct: 319 gccttgcggaaacgcttggcagcatagcgaccggccg 283



 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 79/94 (84%)
 Strand = Plus / Minus

                                                                       
Query: 184 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 243
           |||| ||||||| |||||| |||||||| | ||| ||||||||||||||||||||   ||
Sbjct: 744 cttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgagt 685

                                             
Query: 244 tggatgagcccttggcagcattgatcagctcatc 277
           | || || ||||| || || ||||||||||||||
Sbjct: 684 tcgacgaacccttcgcggcgttgatcagctcatc 651



to top

>emb|BX031299.1|CNS08WBB Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA46CG07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 877

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 83/97 (85%)
 Strand = Plus / Minus

                                                                       
Query: 552 ccgttgttgcgcccgtgcatcatgagggagttggtgaggcgctcgatgatggggcactgc 611
           ||||||||||| || | |||||| || ||||||||||| ||||||| ||| |||||||| 
Sbjct: 339 ccgttgttgcggcccttcatcatcagcgagttggtgagacgctcgacgatcgggcactgg 280

                                                
Query: 612 gccttgcggaagcgcttggccgagtagcgcccggccg 648
           ||||||||||| |||||||| |  ||||| |||||||
Sbjct: 279 gccttgcggaaacgcttggcagcatagcgaccggccg 243



 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 79/94 (84%)
 Strand = Plus / Minus

                                                                       
Query: 184 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 243
           |||| ||||||| |||||| |||||||| | ||| ||||||||||||||||||||   ||
Sbjct: 704 cttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgagt 645

                                             
Query: 244 tggatgagcccttggcagcattgatcagctcatc 277
           | || || ||||| || || ||||||||||||||
Sbjct: 644 tcgacgaacccttcgcggcgttgatcagctcatc 611



to top

>emb|BX031111.1|CNS08W63 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA46BG02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 920

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 83/97 (85%)
 Strand = Plus / Plus

                                                                       
Query: 552 ccgttgttgcgcccgtgcatcatgagggagttggtgaggcgctcgatgatggggcactgc 611
           ||||||||||| || | |||||| || ||||||||||| ||||||| ||| |||||||| 
Sbjct: 744 ccgttgttgcggcccttcatcatcagcgagttggtgagacgctcgacgatcgggcactgg 803

                                                
Query: 612 gccttgcggaagcgcttggccgagtagcgcccggccg 648
           ||||||||||| |||||||| |  ||||| |||||||
Sbjct: 804 gccttgcggaaacgcttggcagcatagcgaccggccg 840



 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 79/94 (84%)
 Strand = Plus / Plus

                                                                       
Query: 184 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 243
           |||| ||||||| |||||| |||||||| | ||| ||||||||||||||||||||   ||
Sbjct: 379 cttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgagt 438

                                             
Query: 244 tggatgagcccttggcagcattgatcagctcatc 277
           | || || ||||| || || ||||||||||||||
Sbjct: 439 tcgacgaacccttcgcggcgttgatcagctcatc 472



to top

>emb|BX031110.1|CNS08W62 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA46BG02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 920

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 83/97 (85%)
 Strand = Plus / Minus

                                                                       
Query: 552 ccgttgttgcgcccgtgcatcatgagggagttggtgaggcgctcgatgatggggcactgc 611
           ||||||||||| || | |||||| || ||||||||||| ||||||| ||| |||||||| 
Sbjct: 374 ccgttgttgcggcccttcatcatcagcgagttggtgagacgctcgacgatcgggcactgg 315

                                                
Query: 612 gccttgcggaagcgcttggccgagtagcgcccggccg 648
           ||||||||||| |||||||| |  ||||| |||||||
Sbjct: 314 gccttgcggaaacgcttggcagcatagcgaccggccg 278



 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 79/94 (84%)
 Strand = Plus / Minus

                                                                       
Query: 184 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 243
           |||| ||||||| |||||| |||||||| | ||| ||||||||||||||||||||   ||
Sbjct: 739 cttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgagt 680

                                             
Query: 244 tggatgagcccttggcagcattgatcagctcatc 277
           | || || ||||| || || ||||||||||||||
Sbjct: 679 tcgacgaacccttcgcggcgttgatcagctcatc 646



to top

>emb|BX030434.1|CNS08VNA Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA45BG02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 980

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 83/97 (85%)
 Strand = Plus / Minus

                                                                       
Query: 552 ccgttgttgcgcccgtgcatcatgagggagttggtgaggcgctcgatgatggggcactgc 611
           ||||||||||| || | |||||| || ||||||||||| ||||||| ||| |||||||| 
Sbjct: 370 ccgttgttgcggcccttcatcatcagcgagttggtgagacgctcgacgatcgggcactgg 311

                                                
Query: 612 gccttgcggaagcgcttggccgagtagcgcccggccg 648
           ||||||||||| |||||||| |  ||||| |||||||
Sbjct: 310 gccttgcggaaacgcttggcagcatagcgaccggccg 274



 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 79/94 (84%)
 Strand = Plus / Minus

                                                                       
Query: 184 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 243
           |||| ||||||| |||||| |||||||| | ||| ||||||||||||||||||||   ||
Sbjct: 736 cttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgagt 677

                                             
Query: 244 tggatgagcccttggcagcattgatcagctcatc 277
           | || || ||||| || || ||||||||||||||
Sbjct: 676 tcgacgaacccttcgcggcgttgatcagctcatc 643



to top

>emb|BX030022.1|CNS08VBU Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA44DD05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1013

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 83/97 (85%)
 Strand = Plus / Minus

                                                                       
Query: 552 ccgttgttgcgcccgtgcatcatgagggagttggtgaggcgctcgatgatggggcactgc 611
           ||||||||||| || | |||||| || ||||||||||| ||||||| ||| |||||||| 
Sbjct: 387 ccgttgttgcggcccttcatcatcagcgagttggtgagacgctcgacgatcgggcactgg 328

                                                
Query: 612 gccttgcggaagcgcttggccgagtagcgcccggccg 648
           ||||||||||| |||||||| |  ||||| |||||||
Sbjct: 327 gccttgcggaaacgcttggcagcatagcgaccggccg 291



 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 79/94 (84%)
 Strand = Plus / Minus

                                                                       
Query: 184 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 243
           |||| ||||||| |||||| |||||||| | ||| ||||||||||||||||||||   ||
Sbjct: 752 cttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgagt 693

                                             
Query: 244 tggatgagcccttggcagcattgatcagctcatc 277
           | || || ||||| || || ||||||||||||||
Sbjct: 692 tcgacgaacccttcgcggcgttgatcagctcatc 659



to top

>emb|BX030006.1|CNS08VBE Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA44DC08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 975

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 83/97 (85%)
 Strand = Plus / Plus

                                                                       
Query: 552 ccgttgttgcgcccgtgcatcatgagggagttggtgaggcgctcgatgatggggcactgc 611
           ||||||||||| || | |||||| || ||||||||||| ||||||| ||| |||||||| 
Sbjct: 746 ccgttgttgcggcccttcatcatcagcgagttggtgagacgctcgacgatcgggcactgg 805

                                                
Query: 612 gccttgcggaagcgcttggccgagtagcgcccggccg 648
           ||||||||||| |||||||| |  ||||| |||||||
Sbjct: 806 gccttgcggaaacgcttggcagcatagcgaccggccg 842



 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 79/94 (84%)
 Strand = Plus / Plus

                                                                       
Query: 184 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 243
           |||| ||||||| |||||| |||||||| | ||| ||||||||||||||||||||   ||
Sbjct: 380 cttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgagt 439

                                             
Query: 244 tggatgagcccttggcagcattgatcagctcatc 277
           | || || ||||| || || ||||||||||||||
Sbjct: 440 tcgacgaacccttcgcggcgttgatcagctcatc 473



to top

>emb|BX030005.1|CNS08VBD Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA44DC08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1021

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 83/97 (85%)
 Strand = Plus / Minus

                                                                       
Query: 552 ccgttgttgcgcccgtgcatcatgagggagttggtgaggcgctcgatgatggggcactgc 611
           ||||||||||| || | |||||| || ||||||||||| ||||||| ||| |||||||| 
Sbjct: 381 ccgttgttgcggcccttcatcatcagcgagttggtgagacgctcgacgatcgggcactgg 322

                                                
Query: 612 gccttgcggaagcgcttggccgagtagcgcccggccg 648
           ||||||||||| |||||||| |  ||||| |||||||
Sbjct: 321 gccttgcggaaacgcttggcagcatagcgaccggccg 285



 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 79/94 (84%)
 Strand = Plus / Minus

                                                                       
Query: 184 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 243
           |||| ||||||| |||||| |||||||| | ||| ||||||||||||||||||||   ||
Sbjct: 747 cttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgagt 688

                                             
Query: 244 tggatgagcccttggcagcattgatcagctcatc 277
           | || || ||||| || || ||||||||||||||
Sbjct: 687 tcgacgaacccttcgcggcgttgatcagctcatc 654



to top

>emb|BX029809.1|CNS08V5X Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA44CB10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 701

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 83/97 (85%)
 Strand = Plus / Minus

                                                                       
Query: 552 ccgttgttgcgcccgtgcatcatgagggagttggtgaggcgctcgatgatggggcactgc 611
           ||||||||||| || | |||||| || ||||||||||| ||||||| ||| |||||||| 
Sbjct: 390 ccgttgttgcggcccttcatcatcagcgagttggtgagacgctcgacgatcgggcactgg 331

                                                
Query: 612 gccttgcggaagcgcttggccgagtagcgcccggccg 648
           ||||||||||| |||||||| |  ||||| |||||||
Sbjct: 330 gccttgcggaaacgcttggcagcatagcgaccggccg 294



to top

>emb|BX029671.1|CNS08V23 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA44BD08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 953

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 83/97 (85%)
 Strand = Plus / Minus

                                                                       
Query: 552 ccgttgttgcgcccgtgcatcatgagggagttggtgaggcgctcgatgatggggcactgc 611
           ||||||||||| || | |||||| || ||||||||||| ||||||| ||| |||||||| 
Sbjct: 372 ccgttgttgcggcccttcatcatcagcgagttggtgagacgctcgacgatcgggcactga 313

                                                
Query: 612 gccttgcggaagcgcttggccgagtagcgcccggccg 648
           ||||||||||| |||||||| |  ||||| |||||||
Sbjct: 312 gccttgcggaaacgcttggcagcatagcgaccggccg 276



 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 79/94 (84%)
 Strand = Plus / Minus

                                                                       
Query: 184 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 243
           |||| ||||||| |||||| |||||||| | ||| ||||||||||||||||||||   ||
Sbjct: 738 cttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgagt 679

                                             
Query: 244 tggatgagcccttggcagcattgatcagctcatc 277
           | || || ||||| || || ||||||||||||||
Sbjct: 678 tcgacgaacccttcgcggcgttgatcagctcatc 645



to top

>emb|BX029068.1|CNS08ULC Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA43BH06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 715

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 83/97 (85%)
 Strand = Plus / Minus

                                                                       
Query: 552 ccgttgttgcgcccgtgcatcatgagggagttggtgaggcgctcgatgatggggcactgc 611
           ||||||||||| || | |||||| || ||||||||||| ||||||| ||| |||||||| 
Sbjct: 364 ccgttgttgcggcccttcatcatcagcgagttggtgagacgctcgacgatcgggcactgg 305

                                                
Query: 612 gccttgcggaagcgcttggccgagtagcgcccggccg 648
           ||||||||||| |||||||| |  ||||| |||||||
Sbjct: 304 gccttgcggaaacgcttggcagcatagcgaccggccg 268



 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 67/80 (83%)
 Strand = Plus / Minus

                                                                       
Query: 198 ttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgttggatgagcccttg 257
           ||||| |||||||| | ||| ||||||||||||||||||||   ||| || || ||||| 
Sbjct: 715 ttggccacacgctccagctcatccttcttcttgatggcgtacgagttcgacgaacccttc 656

                               
Query: 258 gcagcattgatcagctcatc 277
           || || ||||||||||||||
Sbjct: 655 gcggcgttgatcagctcatc 636



to top

>emb|BX028774.1|CNS08UD6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA42DH05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 991

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 83/97 (85%)
 Strand = Plus / Plus

                                                                       
Query: 552 ccgttgttgcgcccgtgcatcatgagggagttggtgaggcgctcgatgatggggcactgc 611
           ||||||||||| || | |||||| || ||||||||||| ||||||| ||| |||||||| 
Sbjct: 743 ccgttgttgcggcccttcatcatcagcgagttggtgagacgctcgacgatcgggcactgg 802

                                                
Query: 612 gccttgcggaagcgcttggccgagtagcgcccggccg 648
           ||||||||||| |||||||| |  ||||| |||||||
Sbjct: 803 gccttgcggaaacgcttggcagcatagcgaccggccg 839



 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 79/94 (84%)
 Strand = Plus / Plus

                                                                       
Query: 184 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 243
           |||| ||||||| |||||| |||||||| | ||| ||||||||||||||||||||   ||
Sbjct: 379 cttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgagt 438

                                             
Query: 244 tggatgagcccttggcagcattgatcagctcatc 277
           | || || ||||| || || ||||||||||||||
Sbjct: 439 tcgacgaacccttcgcggcgttgatcagctcatc 472



to top

>emb|BX028773.1|CNS08UD5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA42DH05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1044

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 83/97 (85%)
 Strand = Plus / Minus

                                                                       
Query: 552 ccgttgttgcgcccgtgcatcatgagggagttggtgaggcgctcgatgatggggcactgc 611
           ||||||||||| || | |||||| || ||||||||||| ||||||| ||| |||||||| 
Sbjct: 385 ccgttgttgcggcccttcatcatcagcgagttggtgagacgctcgacgatcgggcactgg 326

                                                
Query: 612 gccttgcggaagcgcttggccgagtagcgcccggccg 648
           ||||||||||| |||||||| |  ||||| |||||||
Sbjct: 325 gccttgcggaaacgcttggcagcatagcgaccggccg 289



 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 79/94 (84%)
 Strand = Plus / Minus

                                                                       
Query: 184 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 243
           |||| ||||||| |||||| |||||||| | ||| ||||||||||||||||||||   ||
Sbjct: 751 cttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgagt 692

                                             
Query: 244 tggatgagcccttggcagcattgatcagctcatc 277
           | || || ||||| || || ||||||||||||||
Sbjct: 691 tcgacgaacccttcgcggcgttgatcagctcatc 658



to top

>emb|BX028667.1|CNS08UA7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA42DC11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 894

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 83/97 (85%)
 Strand = Plus / Minus

                                                                       
Query: 552 ccgttgttgcgcccgtgcatcatgagggagttggtgaggcgctcgatgatggggcactgc 611
           ||||||||||| || | |||||| || ||||||||||| ||||||| ||| |||||||| 
Sbjct: 382 ccgttgttgcggcccttcatcatcagcgagttggtgagacgctcgacgatcgggcactgg 323

                                                
Query: 612 gccttgcggaagcgcttggccgagtagcgcccggccg 648
           ||||||||||| |||||||| |  ||||| |||||||
Sbjct: 322 gccttgcggaaacgcttggcagcatagcgaccggccg 286



 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 79/94 (84%)
 Strand = Plus / Minus

                                                                       
Query: 184 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 243
           |||| ||||||| |||||| |||||||| | ||| ||||||||||||||||||||   ||
Sbjct: 747 cttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgagt 688

                                             
Query: 244 tggatgagcccttggcagcattgatcagctcatc 277
           | || || ||||| || || ||||||||||||||
Sbjct: 687 tcgacgaacccttcgcggcgttgatcagctcatc 654



to top

>emb|BX028422.1|CNS08U3E Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA42BH06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 839

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 83/97 (85%)
 Strand = Plus / Plus

                                                                       
Query: 552 ccgttgttgcgcccgtgcatcatgagggagttggtgaggcgctcgatgatggggcactgc 611
           ||||||||||| || | |||||| || ||||||||||| ||||||| ||| |||||||| 
Sbjct: 735 ccgttgttgcggcccttcatcatcagcgagttggtgagacgctcgacgatcgggcactgg 794

                                                
Query: 612 gccttgcggaagcgcttggccgagtagcgcccggccg 648
           ||||||||||| |||||||| |  ||||| |||||||
Sbjct: 795 gccttgcggaaacgcttggcagcatagcgaccggccg 831



 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 79/94 (84%)
 Strand = Plus / Plus

                                                                       
Query: 184 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 243
           |||| ||||||| |||||| |||||||| | ||| ||||||||||||||||||||   ||
Sbjct: 371 cttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgagt 430

                                             
Query: 244 tggatgagcccttggcagcattgatcagctcatc 277
           | || || ||||| || || ||||||||||||||
Sbjct: 431 tcgacgaacccttcgcggcgttgatcagctcatc 464



to top

>emb|BX028421.1|CNS08U3D Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA42BH06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 728

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 83/97 (85%)
 Strand = Plus / Minus

                                                                       
Query: 552 ccgttgttgcgcccgtgcatcatgagggagttggtgaggcgctcgatgatggggcactgc 611
           ||||||||||| || | |||||| || ||||||||||| ||||||| ||| |||||||| 
Sbjct: 203 ccgttgttgcggcccttcatcatcagcgagttggtgagacgctcgacgatcgggcactgg 144

                                                
Query: 612 gccttgcggaagcgcttggccgagtagcgcccggccg 648
           ||||||||||| |||||||| |  ||||| |||||||
Sbjct: 143 gccttgcggaaacgcttggcagcatagcgaccggccg 107



 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 79/94 (84%)
 Strand = Plus / Minus

                                                                       
Query: 184 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 243
           |||| ||||||| |||||| |||||||| | ||| ||||||||||||||||||||   ||
Sbjct: 568 cttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgagt 509

                                             
Query: 244 tggatgagcccttggcagcattgatcagctcatc 277
           | || || ||||| || || ||||||||||||||
Sbjct: 508 tcgacgaacccttcgcggcgttgatcagctcatc 475



to top

>emb|BX028363.1|CNS08U1R Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA42BE09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 921

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 83/97 (85%)
 Strand = Plus / Plus

                                                                       
Query: 552 ccgttgttgcgcccgtgcatcatgagggagttggtgaggcgctcgatgatggggcactgc 611
           ||||||||||| || | |||||| || ||||||||||| ||||||| ||| |||||||| 
Sbjct: 740 ccgttgttgcggcccttcatcatcagcgagttggtgagacgctcgacgatcgggcactgg 799

                                                
Query: 612 gccttgcggaagcgcttggccgagtagcgcccggccg 648
           ||||||||||| |||||||| |  ||||| |||||||
Sbjct: 800 gccttgcggaaacgcttggcagcatagcgaccggccg 836



 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 79/94 (84%)
 Strand = Plus / Plus

                                                                       
Query: 184 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 243
           |||| ||||||| |||||| |||||||| | ||| ||||||||||||||||||||   ||
Sbjct: 375 cttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgagt 434

                                             
Query: 244 tggatgagcccttggcagcattgatcagctcatc 277
           | || || ||||| || || ||||||||||||||
Sbjct: 435 tcgacgaacccttcgcggcgttgatcagctcatc 468



to top

>emb|BX028362.1|CNS08U1Q Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA42BE09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 927

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 83/97 (85%)
 Strand = Plus / Minus

                                                                       
Query: 552 ccgttgttgcgcccgtgcatcatgagggagttggtgaggcgctcgatgatggggcactgc 611
           ||||||||||| || | |||||| || ||||||||||| ||||||| ||| |||||||| 
Sbjct: 374 ccgttgttgcggcccttcatcatcagcgagttggtgagacgctcgacgatcgggcactgg 315

                                                
Query: 612 gccttgcggaagcgcttggccgagtagcgcccggccg 648
           ||||||||||| |||||||| |  ||||| |||||||
Sbjct: 314 gccttgcggaaacgcttggcagcatagcgaccggccg 278



 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 79/94 (84%)
 Strand = Plus / Minus

                                                                       
Query: 184 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 243
           |||| ||||||| |||||| |||||||| | ||| ||||||||||||||||||||   ||
Sbjct: 739 cttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgagt 680

                                             
Query: 244 tggatgagcccttggcagcattgatcagctcatc 277
           | || || ||||| || || ||||||||||||||
Sbjct: 679 tcgacgaacccttcgcggcgttgatcagctcatc 646



to top

>emb|BX027498.1|CNS08TDQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA41AF10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 974

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 83/97 (85%)
 Strand = Plus / Minus

                                                                       
Query: 552 ccgttgttgcgcccgtgcatcatgagggagttggtgaggcgctcgatgatggggcactgc 611
           ||||||||||| || | |||||| || ||||||||||| ||||||| ||| |||||||| 
Sbjct: 391 ccgttgttgcggcccttcatcatcagcgagttggtgagacgctcgacgatcgggcactgg 332

                                                
Query: 612 gccttgcggaagcgcttggccgagtagcgcccggccg 648
           ||||||||||| |||||||| |  ||||| |||||||
Sbjct: 331 gccttgcggaaacgcttggcagcatagcgaccggccg 295



 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 79/94 (84%)
 Strand = Plus / Minus

                                                                       
Query: 184 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 243
           |||| ||||||| |||||| |||||||| | ||| ||||||||||||||||||||   ||
Sbjct: 757 cttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgagt 698

                                             
Query: 244 tggatgagcccttggcagcattgatcagctcatc 277
           | || || ||||| || || ||||||||||||||
Sbjct: 697 tcgacgaacccttcgcggcgttgatcagctcatc 664



to top

>emb|BX027480.1|CNS08TD8 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA41AF01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 678

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 83/97 (85%)
 Strand = Plus / Minus

                                                                       
Query: 552 ccgttgttgcgcccgtgcatcatgagggagttggtgaggcgctcgatgatggggcactgc 611
           ||||||||||| || | |||||| || ||||||||||| ||||||| ||| |||||||| 
Sbjct: 383 ccgttgttgcggcccttcatcatcagcgagttggtgagacgctcgacgatcgggcactgg 324

                                                
Query: 612 gccttgcggaagcgcttggccgagtagcgcccggccg 648
           ||||||||||| |||||||| |  ||||| |||||||
Sbjct: 323 gccttgcggaaacgcttggcagcatagcgaccggccg 287



to top

>emb|BX025592.1|CNS08RWS Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA39AH12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 901

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 83/97 (85%)
 Strand = Plus / Minus

                                                                       
Query: 552 ccgttgttgcgcccgtgcatcatgagggagttggtgaggcgctcgatgatggggcactgc 611
           ||||||||||| || | |||||| || ||||||||||| ||||||| ||| |||||||| 
Sbjct: 381 ccgttgttgcggcccttcatcatcagcgagttggtgagacgctcgacgatcgggcactgg 322

                                                
Query: 612 gccttgcggaagcgcttggccgagtagcgcccggccg 648
           ||||||||||| |||||||| |  ||||| |||||||
Sbjct: 321 gccttgcggaaacgcttggcagcatagcgaccggccg 285



 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 79/94 (84%)
 Strand = Plus / Minus

                                                                       
Query: 184 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 243
           |||| ||||||| |||||| |||||||| | ||| ||||||||||||||||||||   ||
Sbjct: 747 cttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgagt 688

                                             
Query: 244 tggatgagcccttggcagcattgatcagctcatc 277
           | || || ||||| || || ||||||||||||||
Sbjct: 687 tcgacgaacccttcgcggcgttgatcagctcatc 654



to top

>emb|BX022854.1|CNS08PSQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA34DG11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 709

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 83/97 (85%)
 Strand = Plus / Minus

                                                                       
Query: 552 ccgttgttgcgcccgtgcatcatgagggagttggtgaggcgctcgatgatggggcactgc 611
           ||||||||||| || | |||||| || ||||||||||| ||||||| ||| |||||||| 
Sbjct: 386 ccgttgttgcggcccttcatcatcagcgagttggtgagacgctcgacgatcgggcactgg 327

                                                
Query: 612 gccttgcggaagcgcttggccgagtagcgcccggccg 648
           ||||||||||| |||||||| |  ||||| |||||||
Sbjct: 326 gccttgcggaaacgcttggcagcatagcgaccggccg 290



to top

>emb|BX024680.1|CNS08R7G Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA37DA12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 809

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 83/97 (85%)
 Strand = Plus / Minus

                                                                       
Query: 552 ccgttgttgcgcccgtgcatcatgagggagttggtgaggcgctcgatgatggggcactgc 611
           ||||||||||| || | |||||| || ||||||||||| ||||||| ||| |||||||| 
Sbjct: 373 ccgttgttgcggcccttcatcatcagcgagttggtgagacgctcgacgatcgggcactgg 314

                                                
Query: 612 gccttgcggaagcgcttggccgagtagcgcccggccg 648
           ||||||||||| |||||||| |  ||||| |||||||
Sbjct: 313 gccttgcggaaacgcttggcagcatagcgaccggccg 277



 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 79/94 (84%)
 Strand = Plus / Minus

                                                                       
Query: 184 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 243
           |||| ||||||| |||||| |||||||| | ||| ||||||||||||||||||||   ||
Sbjct: 739 cttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgagt 680

                                             
Query: 244 tggatgagcccttggcagcattgatcagctcatc 277
           | || || ||||| || || ||||||||||||||
Sbjct: 679 tcgacgaacccttcgcggcgttgatcagctcatc 646



to top

>emb|BX024182.1|CNS08QTM Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA36DE12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 924

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 83/97 (85%)
 Strand = Plus / Minus

                                                                       
Query: 552 ccgttgttgcgcccgtgcatcatgagggagttggtgaggcgctcgatgatggggcactgc 611
           ||||||||||| || | |||||| || ||||||||||| ||||||| ||| |||||||| 
Sbjct: 366 ccgttgttgcggcccttcatcatcagcgagttggtgagacgctcgacgatcgggcactgg 307

                                                
Query: 612 gccttgcggaagcgcttggccgagtagcgcccggccg 648
           ||||||||||| |||||||| |  ||||| |||||||
Sbjct: 306 gccttgcggaaacgcttggcagcatagcgaccggccg 270



 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 79/94 (84%)
 Strand = Plus / Minus

                                                                       
Query: 184 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 243
           |||| ||||||| |||||| |||||||| | ||| ||||||||||||||||||||   ||
Sbjct: 731 cttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgagt 672

                                             
Query: 244 tggatgagcccttggcagcattgatcagctcatc 277
           | || || ||||| || || ||||||||||||||
Sbjct: 671 tcgacgaacccttcgcggcgttgatcagctcatc 638



to top

>emb|BX023855.1|CNS08QKJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA36BF12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 739

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 83/97 (85%)
 Strand = Plus / Minus

                                                                       
Query: 552 ccgttgttgcgcccgtgcatcatgagggagttggtgaggcgctcgatgatggggcactgc 611
           ||||||||||| || | |||||| || ||||||||||| ||||||| ||| |||||||| 
Sbjct: 390 ccgttgttgcggcccttcatcatcagcgagttggtgagacgctcgacgatcgggcactgg 331

                                                
Query: 612 gccttgcggaagcgcttggccgagtagcgcccggccg 648
           ||||||||||| |||||||| |  ||||| |||||||
Sbjct: 330 gccttgcggaaacgcttggcagcatagcgaccggccg 294



 Score = 52.0 bits (26), Expect = 0.003
 Identities = 62/74 (83%)
 Strand = Plus / Minus

                                                                       
Query: 204 acacgctcgatctcgtccttcttcttgatggcgtaactgttggatgagcccttggcagca 263
           |||||||| | ||| ||||||||||||||||||||   ||| || || ||||| || || 
Sbjct: 735 acacgctccagctcatccttcttcttgatggcgtacgagttcgacgaacccttcgcggcg 676

                         
Query: 264 ttgatcagctcatc 277
           ||||||||||||||
Sbjct: 675 ttgatcagctcatc 662



to top

>emb|BX023607.1|CNS08QDN Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA36AC10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 963

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 83/97 (85%)
 Strand = Plus / Plus

                                                                       
Query: 552 ccgttgttgcgcccgtgcatcatgagggagttggtgaggcgctcgatgatggggcactgc 611
           ||||||||||| || | |||||| || ||||||||||| ||||||| ||| |||||||| 
Sbjct: 744 ccgttgttgcggcccttcatcatcagcgagttggtgagacgctcgacgatcgggcactgg 803

                                                
Query: 612 gccttgcggaagcgcttggccgagtagcgcccggccg 648
           ||||||||||| |||||||| |  ||||| |||||||
Sbjct: 804 gccttgcggaaacgcttggcagcatagcgaccggccg 840



 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 79/94 (84%)
 Strand = Plus / Plus

                                                                       
Query: 184 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 243
           |||| ||||||| |||||| |||||||| | ||| ||||||||||||||||||||   ||
Sbjct: 380 cttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgagt 439

                                             
Query: 244 tggatgagcccttggcagcattgatcagctcatc 277
           | || || ||||| || || ||||||||||||||
Sbjct: 440 tcgacgaacccttcgcggcgttgatcagctcatc 473



to top

>emb|BX023606.1|CNS08QDM Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA36AC10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 973

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 83/97 (85%)
 Strand = Plus / Minus

                                                                       
Query: 552 ccgttgttgcgcccgtgcatcatgagggagttggtgaggcgctcgatgatggggcactgc 611
           ||||||||||| || | |||||| || ||||||||||| ||||||| ||| |||||||| 
Sbjct: 394 ccgttgttgcggcccttcatcatcagcgagttggtgagacgctcgacgatcgggcactgg 335

                                                
Query: 612 gccttgcggaagcgcttggccgagtagcgcccggccg 648
           ||||||||||| |||||||| |  ||||| |||||||
Sbjct: 334 gccttgcggaaacgcttggcagcatagcgaccggccg 298



 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 79/94 (84%)
 Strand = Plus / Minus

                                                                       
Query: 184 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 243
           |||| ||||||| |||||| |||||||| | ||| ||||||||||||||||||||   ||
Sbjct: 760 cttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgagt 701

                                             
Query: 244 tggatgagcccttggcagcattgatcagctcatc 277
           | || || ||||| || || ||||||||||||||
Sbjct: 700 tcgacgaacccttcgcggcgttgatcagctcatc 667



to top

>emb|BX023496.1|CNS08QAK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA35DF09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 983

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 83/97 (85%)
 Strand = Plus / Minus

                                                                       
Query: 552 ccgttgttgcgcccgtgcatcatgagggagttggtgaggcgctcgatgatggggcactgc 611
           ||||||||||| || | |||||| || ||||||||||| ||||||| ||| |||||||| 
Sbjct: 380 ccgttgttgcggcccttcatcatcagcgagttggtgagacgctcgacgatcgggcactgg 321

                                                
Query: 612 gccttgcggaagcgcttggccgagtagcgcccggccg 648
           ||||||||||| |||||||| |  ||||| |||||||
Sbjct: 320 gccttgcggaaacgcttggcagcatagcgaccggccg 284



 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 79/94 (84%)
 Strand = Plus / Minus

                                                                       
Query: 184 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 243
           |||| ||||||| |||||| |||||||| | ||| ||||||||||||||||||||   ||
Sbjct: 746 cttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgagt 687

                                             
Query: 244 tggatgagcccttggcagcattgatcagctcatc 277
           | || || ||||| || || ||||||||||||||
Sbjct: 686 tcgacgaacccttcgcggcgttgatcagctcatc 653



to top

>emb|BX023083.1|CNS08PZ3 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA35BB11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 947

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 83/97 (85%)
 Strand = Plus / Minus

                                                                       
Query: 552 ccgttgttgcgcccgtgcatcatgagggagttggtgaggcgctcgatgatggggcactgc 611
           ||||||||||| || | |||||| || ||||||||||| ||||||| ||| |||||||| 
Sbjct: 363 ccgttgttgcggcccttcatcatcagcgagttggtgagacgctcgacgatcgggcactgg 304

                                                
Query: 612 gccttgcggaagcgcttggccgagtagcgcccggccg 648
           ||||||||||| |||||||| |  ||||| |||||||
Sbjct: 303 gccttgcggaaacgcttggcagcatagcgaccggccg 267



 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 79/94 (84%)
 Strand = Plus / Minus

                                                                       
Query: 184 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 243
           |||| ||||||| |||||| |||||||| | ||| ||||||||||||||||||||   ||
Sbjct: 728 cttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgagt 669

                                             
Query: 244 tggatgagcccttggcagcattgatcagctcatc 277
           | || || ||||| || || ||||||||||||||
Sbjct: 668 tcgacgaacccttcgcggcgttgatcagctcatc 635



to top

>emb|BX022243.1|CNS08PBR Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA34AC10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 938

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 83/97 (85%)
 Strand = Plus / Plus

                                                                       
Query: 552 ccgttgttgcgcccgtgcatcatgagggagttggtgaggcgctcgatgatggggcactgc 611
           ||||||||||| || | |||||| || ||||||||||| ||||||| ||| |||||||| 
Sbjct: 759 ccgttgttgcggcccttcatcatcagcgagttggtgagacgctcgacgatcgggcactgg 818

                                                
Query: 612 gccttgcggaagcgcttggccgagtagcgcccggccg 648
           ||||||||||| |||||||| |  ||||| |||||||
Sbjct: 819 gccttgcggaaacgcttggcagcatagcgaccggccg 855



 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 79/94 (84%)
 Strand = Plus / Plus

                                                                       
Query: 184 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 243
           |||| ||||||| |||||| |||||||| | ||| ||||||||||||||||||||   ||
Sbjct: 394 cttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgagt 453

                                             
Query: 244 tggatgagcccttggcagcattgatcagctcatc 277
           | || || ||||| || || ||||||||||||||
Sbjct: 454 tcgacgaacccttcgcggcgttgatcagctcatc 487



to top

>emb|BX022242.1|CNS08PBQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA34AC10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 921

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 83/97 (85%)
 Strand = Plus / Minus

                                                                       
Query: 552 ccgttgttgcgcccgtgcatcatgagggagttggtgaggcgctcgatgatggggcactgc 611
           ||||||||||| || | |||||| || ||||||||||| ||||||| ||| |||||||| 
Sbjct: 329 ccgttgttgcggcccttcatcatcagcgagttggtgagacgctcgacgatcgggcactgg 270

                                                
Query: 612 gccttgcggaagcgcttggccgagtagcgcccggccg 648
           ||||||||||| |||||||| |  ||||| |||||||
Sbjct: 269 gccttgcggaaacgcttggcagcatagcgaccggccg 233



 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 79/94 (84%)
 Strand = Plus / Minus

                                                                       
Query: 184 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 243
           |||| ||||||| |||||| |||||||| | ||| ||||||||||||||||||||   ||
Sbjct: 694 cttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgagt 635

                                             
Query: 244 tggatgagcccttggcagcattgatcagctcatc 277
           | || || ||||| || || ||||||||||||||
Sbjct: 634 tcgacgaacccttcgcggcgttgatcagctcatc 601



to top

>emb|BX022047.1|CNS08P6B Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA32DA06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 954

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 83/97 (85%)
 Strand = Plus / Minus

                                                                       
Query: 552 ccgttgttgcgcccgtgcatcatgagggagttggtgaggcgctcgatgatggggcactgc 611
           ||||||||||| || | |||||| || ||||||||||| ||||||| ||| |||||||| 
Sbjct: 413 ccgttgttgcggcccttcatcatcagcgagttggtgagacgctcgacgatcgggcactgg 354

                                                
Query: 612 gccttgcggaagcgcttggccgagtagcgcccggccg 648
           ||||||||||| |||||||| |  ||||| |||||||
Sbjct: 353 gccttgcggaaacgcttggcagcatagcgaccggccg 317



 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 79/94 (84%)
 Strand = Plus / Minus

                                                                       
Query: 184 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 243
           |||| ||||||| |||||| |||||||| | ||| ||||||||||||||||||||   ||
Sbjct: 778 cttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgagt 719

                                             
Query: 244 tggatgagcccttggcagcattgatcagctcatc 277
           | || || ||||| || || ||||||||||||||
Sbjct: 718 tcgacgaacccttcgcggcgttgatcagctcatc 685



to top

>emb|BX021562.1|CNS08OSU Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA31DH07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 899

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 83/97 (85%)
 Strand = Plus / Minus

                                                                       
Query: 552 ccgttgttgcgcccgtgcatcatgagggagttggtgaggcgctcgatgatggggcactgc 611
           ||||||||||| || | |||||| || ||||||||||| ||||||| ||| |||||||| 
Sbjct: 369 ccgttgttgcggcccttcatcatcagcgagttggtgagacgctcgacgatcgggcactgg 310

                                                
Query: 612 gccttgcggaagcgcttggccgagtagcgcccggccg 648
           ||||||||||| |||||||| |  ||||| |||||||
Sbjct: 309 gccttgcggaaacgcttggcagcatagcgaccggccg 273



 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 79/94 (84%)
 Strand = Plus / Minus

                                                                       
Query: 184 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 243
           |||| ||||||| |||||| |||||||| | ||| ||||||||||||||||||||   ||
Sbjct: 734 cttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgagt 675

                                             
Query: 244 tggatgagcccttggcagcattgatcagctcatc 277
           | || || ||||| || || ||||||||||||||
Sbjct: 674 tcgacgaacccttcgcggcgttgatcagctcatc 641



to top

>emb|BX021278.1|CNS08OKY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA31CB12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 667

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 83/97 (85%)
 Strand = Plus / Minus

                                                                       
Query: 552 ccgttgttgcgcccgtgcatcatgagggagttggtgaggcgctcgatgatggggcactgc 611
           ||||||||||| || | |||||| || ||||||||||| ||||||| ||| |||||||| 
Sbjct: 392 ccgttgttgcggcccttcatcatcagcgagttggtgagacgctcgacgatcgggcactgg 333

                                                
Query: 612 gccttgcggaagcgcttggccgagtagcgcccggccg 648
           ||||||||||| |||||||| |  ||||| |||||||
Sbjct: 332 gccttgcggaaacgcttggcagcatagcgaccggccg 296



to top

>emb|BX020767.1|CNS08O6R Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA30CD11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 710

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 83/97 (85%)
 Strand = Plus / Minus

                                                                       
Query: 552 ccgttgttgcgcccgtgcatcatgagggagttggtgaggcgctcgatgatggggcactgc 611
           ||||||||||| || | |||||| || ||||||||||| ||||||| ||| |||||||| 
Sbjct: 287 ccgttgttgcggcccttcatcatcagcgagttggtgagacgctcgacgatcgggcactgg 228

                                                
Query: 612 gccttgcggaagcgcttggccgagtagcgcccggccg 648
           ||||||||||| |||||||| |  ||||| |||||||
Sbjct: 227 gccttgcggaaacgcttggcagcatagcgaccggccg 191



 Score = 61.9 bits (31), Expect = 3e-06
 Identities = 49/55 (89%)
 Strand = Plus / Minus

                                                                  
Query: 184 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgta 238
           |||| ||||||| |||||| |||||||| | ||| ||||||||||||||||||||
Sbjct: 652 cttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgta 598



to top

>emb|BX018908.1|CNS08MR4 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA28CH02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 846

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 83/97 (85%)
 Strand = Plus / Plus

                                                                       
Query: 552 ccgttgttgcgcccgtgcatcatgagggagttggtgaggcgctcgatgatggggcactgc 611
           ||||||||||| || | |||||| || ||||||||||| ||||||| ||| |||||||| 
Sbjct: 718 ccgttgttgcggcccttcatcatcagcgagttggtgagacgctcgacgatcgggcactgg 777

                                                
Query: 612 gccttgcggaagcgcttggccgagtagcgcccggccg 648
           ||||||||||| |||||||| |  ||||| |||||||
Sbjct: 778 gccttgcggaaacgcttggcagcatagcgaccggccg 814



 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 79/94 (84%)
 Strand = Plus / Plus

                                                                       
Query: 184 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 243
           |||| ||||||| |||||| |||||||| | ||| ||||||||||||||||||||   ||
Sbjct: 353 cttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgagt 412

                                             
Query: 244 tggatgagcccttggcagcattgatcagctcatc 277
           | || || ||||| || || ||||||||||||||
Sbjct: 413 tcgacgaacccttcgcggcgttgatcagctcatc 446



to top

>emb|BX018907.1|CNS08MR3 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA28CH02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 921

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 83/97 (85%)
 Strand = Plus / Minus

                                                                       
Query: 552 ccgttgttgcgcccgtgcatcatgagggagttggtgaggcgctcgatgatggggcactgc 611
           ||||||||||| || | |||||| || ||||||||||| ||||||| ||| |||||||| 
Sbjct: 327 ccgttgttgcggcccttcatcatcagcgagttggtgagacgctcgacgatcgggcactgg 268

                                                
Query: 612 gccttgcggaagcgcttggccgagtagcgcccggccg 648
           ||||||||||| |||||||| |  ||||| |||||||
Sbjct: 267 gccttgcggaaacgcttggcagcatagcgaccggccg 231



 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 79/94 (84%)
 Strand = Plus / Minus

                                                                       
Query: 184 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 243
           |||| ||||||| |||||| |||||||| | ||| ||||||||||||||||||||   ||
Sbjct: 692 cttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgagt 633

                                             
Query: 244 tggatgagcccttggcagcattgatcagctcatc 277
           | || || ||||| || || ||||||||||||||
Sbjct: 632 tcgacgaacccttcgcggcgttgatcagctcatc 599



to top

>emb|BX018088.1|CNS08M4C Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA27BD06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 396

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 83/97 (85%)
 Strand = Plus / Minus

                                                                       
Query: 552 ccgttgttgcgcccgtgcatcatgagggagttggtgaggcgctcgatgatggggcactgc 611
           ||||||||||| || | |||||| || ||||||||||| ||||||| ||| |||||||| 
Sbjct: 379 ccgttgttgcggcccttcatcatcagcgagttggtgagacgctcgacgatcgggcactgg 320

                                                
Query: 612 gccttgcggaagcgcttggccgagtagcgcccggccg 648
           ||||||||||| |||||||| |  ||||| |||||||
Sbjct: 319 gccttgcggaaacgcttggcagcatagcgaccggccg 283



to top

>emb|BX017024.1|CNS08LAS Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA25CD01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 434

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 83/97 (85%)
 Strand = Plus / Minus

                                                                       
Query: 552 ccgttgttgcgcccgtgcatcatgagggagttggtgaggcgctcgatgatggggcactgc 611
           ||||||||||| || | |||||| || ||||||||||| ||||||| ||| |||||||| 
Sbjct: 333 ccgttgttgcggcccttcatcatcagcgagttggtgagacgctcgacgatcgggcactgg 274

                                                
Query: 612 gccttgcggaagcgcttggccgagtagcgcccggccg 648
           ||||||||||| |||||||| |  ||||| |||||||
Sbjct: 273 gccttgcggaaacgcttggcagcatagcgaccggccg 237


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 5,617,996
Number of Sequences: 3902068
Number of extensions: 5617996
Number of successful extensions: 115273
Number of sequences better than 10.0: 782
Number of HSP's better than 10.0 without gapping: 773
Number of HSP's successfully gapped in prelim test: 9
Number of HSP's that attempted gapping in prelim test: 112623
Number of HSP's gapped (non-prelim): 2514
length of query: 710
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 687
effective length of database: 17,143,297,704
effective search space: 11777445522648
effective search space used: 11777445522648
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top