ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | rbags16o20 |
|---|---|
| Clone Library Name | barley_pub |
>emb|X62725.1|HVRNPL172 H.vulgare mRNA for ribosomal protein L17-2 Length = 854 Score = 1316 bits (664), Expect = 0.0 Identities = 664/664 (100%) Strand = Plus / Minus Query: 51 aaaaagtggatcattcaaagcaaccaaaaagtgaattgccaaactcttaagtgtacagcc 110 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 854 aaaaagtggatcattcaaagcaaccaaaaagtgaattgccaaactcttaagtgtacagcc 795 Query: 111 cgaaaggacaaagatctctaagaaacaagttctggtgggctaatgctcgaatatccgaaa 170 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 794 cgaaaggacaaagatctctaagaaacaagttctggtgggctaatgctcgaatatccgaaa 735 Query: 171 cagttttagcatatataaagaccattcgcaatcacaaggatagcatcaaccttaacaaat 230 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 734 cagttttagcatatataaagaccattcgcaatcacaaggatagcatcaaccttaacaaat 675 Query: 231 ccttactccatgttggtaccaaaaacatctaggaggcaacaaacactgccaccaaaggta 290 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 674 ccttactccatgttggtaccaaaaacatctaggaggcaacaaacactgccaccaaaggta 615 Query: 291 cttgaaaggaactacaactaagattctcagacaaatgcagccactccgttagcttagata 350 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 614 cttgaaaggaactacaactaagattctcagacaaatgcagccactccgttagcttagata 555 Query: 351 gctttccttggtgcaacgacgttgtcagcctccttcttcacaggctcttccttctctgac 410 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 554 gctttccttggtgcaacgacgttgtcagcctccttcttcacaggctcttccttctctgac 495 Query: 411 aagatcagctcaatgtggcaggggttggacatgtaagggttgatgcgtccatgagcacgg 470 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 494 aagatcagctcaatgtggcaggggttggacatgtaagggttgatgcgtccatgagcacgg 435 Query: 471 tacgtccggcgcctctgcttttgggcttggttcacctggatgtgtgaaatgtagaggttg 530 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 434 tacgtccggcgcctctgcttttgggcttggttcacctggatgtgtgaaatgtagaggttg 375 Query: 531 tcgacatccaagcctttaacttcagcgttactctcagcattcttcagcaaatccagcacg 590 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 374 tcgacatccaagcctttaacttcagcgttactctcagcattcttcagcaaatccagcacg 315 Query: 591 aactgggccgactttgcaggccagcgaccctgcccatttggctggcggttctttacttgt 650 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 314 aactgggccgactttgcaggccagcgaccctgcccatttggctggcggttctttacttgt 255 Query: 651 gcagtacggcccacacctctgcagtatctacggaagggaattgcttgcttgtgagcgaga 710 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 254 gcagtacggcccacacctctgcagtatctacggaagggaattgcttgcttgtgagcgaga 195 Query: 711 acat 714 |||| Sbjct: 194 acat 191
>gb|AF034948.1|AF034948 Zea mays ribosomal protein L17 (rpl17) mRNA, complete cds Length = 746 Score = 349 bits (176), Expect = 8e-93 Identities = 296/336 (88%) Strand = Plus / Minus Query: 371 gttgtcagcctccttcttcacaggctcttccttctctgacaagatcagctcaatgtggca 430 |||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||| Sbjct: 532 gttgtcagcctctttcttcacaggctcttccttctctgacagaatcagctcaatgtggca 473 Query: 431 ggggttggacatgtaagggttgatgcgtccatgagcacggtacgtccggcgcctctgctt 490 ||| ||||||||||||||| |||||||| ||||||||||| || |||||||||||||| Sbjct: 472 aggggaggacatgtaagggttaatgcgtccgtgagcacggtaggtgcggcgcctctgctt 413 Query: 491 ttgggcttggttcacctggatgtgtgaaatgtagaggttgtcgacatccaagcctttaac 550 |||||||||||||||||||||||||||| ||||||||||| || ||||||||||| || Sbjct: 412 ctgggcttggttcacctggatgtgtgaaacatagaggttgtccacgtccaagcctttcac 353 Query: 551 ttcagcgttactctcagcattcttcagcaaatccagcacgaactgggccgactttgcagg 610 |||||||||||||||||||||||||||||||||| | |||| ||| ||||| |||| Sbjct: 352 atcagcgttactctcagcattcttcagcaaatccaatatgaacctggctgacttaacagg 293 Query: 611 ccagcgaccctgcccatttggctggcggttctttacttgtgcagtacggcccacacctct 670 |||||||||||||||||| | ||||| |||| ||||||| || || || ||||||| Sbjct: 292 ccagcgaccctgcccattggagtggcgagactttgcttgtgcggtgcgaccaacacctcc 233 Query: 671 gcagtatctacggaagggaattgcttgcttgtgagc 706 |||||||| |||||||||||||| ||||||||||| Sbjct: 232 acagtatctccggaagggaattgcctgcttgtgagc 197
>ref|XM_483472.1| Oryza sativa (japonica cultivar-group), mRNA Length = 755 Score = 325 bits (164), Expect = 1e-85 Identities = 290/332 (87%) Strand = Plus / Minus Query: 375 tcagcctccttcttcacaggctcttccttctctgacaagatcagctcaatgtggcagggg 434 |||| ||| |||||||| | ||||||||||||||||||||| ||||| | ||||||||| Sbjct: 557 tcaggctctttcttcacggcctcttccttctctgacaagataagctcgacgtggcagggt 498 Query: 435 ttggacatgtaagggttgatgcgtccatgagcacggtacgtccggcgcctctgcttttgg 494 |||||||||||| ||||||||||||||||||||||| |||||||| |||||||| ||| Sbjct: 497 gaggacatgtaaggattgatgcgtccatgagcacggtatgtccggcgtctctgcttctgg 438 Query: 495 gcttggttcacctggatgtgtgaaatgtagaggttgtcgacatccaagcctttaacttca 554 ||||||||||||||||||||||||| | |||||||||||||||||||||||||||| ||| Sbjct: 437 gcttggttcacctggatgtgtgaaacgaagaggttgtcgacatccaagcctttaacatca 378 Query: 555 gcgttactctcagcattcttcagcaaatccagcacgaactgggccgactttgcaggccag 614 ||||||||||||||||||||||||| ||||| | |||| ||| || || |||||||| Sbjct: 377 gcgttactctcagcattcttcagcagatccaaaatgaacctggctgatttggcaggccac 318 Query: 615 cgaccctgcccatttggctggcggttctttacttgtgcagtacggcccacacctctgcag 674 | ||||||||||||| ||||| ||| |||||||||||||||||||| |||| ||| Sbjct: 317 ctgccctgcccatttgattggcgagacttcacttgtgcagtacggcccacgcctccacag 258 Query: 675 tatctacggaagggaattgcttgcttgtgagc 706 || || | |||||||||||| ||||||||||| Sbjct: 257 taccttctgaagggaattgcctgcttgtgagc 226
>dbj|AK120448.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013100M19, full insert sequence Length = 839 Score = 325 bits (164), Expect = 1e-85 Identities = 290/332 (87%) Strand = Plus / Minus Query: 375 tcagcctccttcttcacaggctcttccttctctgacaagatcagctcaatgtggcagggg 434 |||| ||| |||||||| | ||||||||||||||||||||| ||||| | ||||||||| Sbjct: 614 tcaggctctttcttcacggcctcttccttctctgacaagataagctcgacgtggcagggt 555 Query: 435 ttggacatgtaagggttgatgcgtccatgagcacggtacgtccggcgcctctgcttttgg 494 |||||||||||| ||||||||||||||||||||||| |||||||| |||||||| ||| Sbjct: 554 gaggacatgtaaggattgatgcgtccatgagcacggtatgtccggcgtctctgcttctgg 495 Query: 495 gcttggttcacctggatgtgtgaaatgtagaggttgtcgacatccaagcctttaacttca 554 ||||||||||||||||||||||||| | |||||||||||||||||||||||||||| ||| Sbjct: 494 gcttggttcacctggatgtgtgaaacgaagaggttgtcgacatccaagcctttaacatca 435 Query: 555 gcgttactctcagcattcttcagcaaatccagcacgaactgggccgactttgcaggccag 614 ||||||||||||||||||||||||| ||||| | |||| ||| || || |||||||| Sbjct: 434 gcgttactctcagcattcttcagcagatccaaaatgaacctggctgatttggcaggccac 375 Query: 615 cgaccctgcccatttggctggcggttctttacttgtgcagtacggcccacacctctgcag 674 | ||||||||||||| ||||| ||| |||||||||||||||||||| |||| ||| Sbjct: 374 ctgccctgcccatttgattggcgagacttcacttgtgcagtacggcccacgcctccacag 315 Query: 675 tatctacggaagggaattgcttgcttgtgagc 706 || || | |||||||||||| ||||||||||| Sbjct: 314 taccttctgaagggaattgcctgcttgtgagc 283
>dbj|AK062052.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-044-B07, full insert sequence Length = 755 Score = 325 bits (164), Expect = 1e-85 Identities = 290/332 (87%) Strand = Plus / Minus Query: 375 tcagcctccttcttcacaggctcttccttctctgacaagatcagctcaatgtggcagggg 434 |||| ||| |||||||| | ||||||||||||||||||||| ||||| | ||||||||| Sbjct: 557 tcaggctctttcttcacggcctcttccttctctgacaagataagctcgacgtggcagggt 498 Query: 435 ttggacatgtaagggttgatgcgtccatgagcacggtacgtccggcgcctctgcttttgg 494 |||||||||||| ||||||||||||||||||||||| |||||||| |||||||| ||| Sbjct: 497 gaggacatgtaaggattgatgcgtccatgagcacggtatgtccggcgtctctgcttctgg 438 Query: 495 gcttggttcacctggatgtgtgaaatgtagaggttgtcgacatccaagcctttaacttca 554 ||||||||||||||||||||||||| | |||||||||||||||||||||||||||| ||| Sbjct: 437 gcttggttcacctggatgtgtgaaacgaagaggttgtcgacatccaagcctttaacatca 378 Query: 555 gcgttactctcagcattcttcagcaaatccagcacgaactgggccgactttgcaggccag 614 ||||||||||||||||||||||||| ||||| | |||| ||| || || |||||||| Sbjct: 377 gcgttactctcagcattcttcagcagatccaaaatgaacctggctgatttggcaggccac 318 Query: 615 cgaccctgcccatttggctggcggttctttacttgtgcagtacggcccacacctctgcag 674 | ||||||||||||| ||||| ||| |||||||||||||||||||| |||| ||| Sbjct: 317 ctgccctgcccatttgattggcgagacttcacttgtgcagtacggcccacgcctccacag 258 Query: 675 tatctacggaagggaattgcttgcttgtgagc 706 || || | |||||||||||| ||||||||||| Sbjct: 257 taccttctgaagggaattgcctgcttgtgagc 226
>emb|X62724.1|HVRNPL171 H.vulgare mRNA for ribosomal protein L17-1 Length = 785 Score = 264 bits (133), Expect = 4e-67 Identities = 280/329 (85%) Strand = Plus / Minus Query: 375 tcagcctccttcttcacaggctcttccttctctgacaagatcagctcaatgtggcagggg 434 ||||||||||||||||| |||||||||||||| ||||||||||||||||||||||| ||| Sbjct: 536 tcagcctccttcttcaccggctcttccttctcagacaagatcagctcaatgtggcatggg 477 Query: 435 ttggacatgtaagggttgatgcgtccatgagcacggtacgtccggcgcctctgcttttgg 494 ||||||||||| |||||||||||||||||||||||||| |||| ||||| |||||| ||| Sbjct: 476 ttggacatgtaggggttgatgcgtccatgagcacggtaggtcctgcgccgctgcttctgg 417 Query: 495 gcttggttcacctggatgtgtgaaatgtagaggttgtcgacatccaagcctttaacttca 554 || |||||||| |||||||| ||||||||||| || ||||| | ||||| || ||| Sbjct: 416 gcctggttcacttggatgtgcgaaatgtagagagcatccacatcaagacctttcacctca 357 Query: 555 gcgttactctcagcattcttcagcaaatccagcacgaactgggccgactttgcaggccag 614 || || ||||| || ||||| || | |||||| ||||||| || ||||| ||||||||| Sbjct: 356 gcattgctctctgcgttctttagaagatccagaacgaacttagcagacttggcaggccag 297 Query: 615 cgaccctgcccatttggctggcggttctttacttgtgcagtacggcccacacctctgcag 674 || ||||| ||||||||||| |||||||| || || || || || || ||||| | |||| Sbjct: 296 cgtccctgaccatttggctgacggttcttaacctgggccgtgcgtccaacaccacggcag 237 Query: 675 tatctacggaagggaattgcttgcttgtg 703 || || |||||||| || ||||||||||| Sbjct: 236 tacctccggaaggggatggcttgcttgtg 208
>gb|AF264022.1| Poa secunda ribosomal protein L17-1 mRNA, complete cds Length = 808 Score = 248 bits (125), Expect = 2e-62 Identities = 278/329 (84%) Strand = Plus / Minus Query: 375 tcagcctccttcttcacaggctcttccttctctgacaagatcagctcaatgtggcagggg 434 |||||||| |||||||| ||||| |||||||| |||||||| |||||||||||||| ||| Sbjct: 510 tcagcctctttcttcactggctcctccttctcggacaagatgagctcaatgtggcacggg 451 Query: 435 ttggacatgtaagggttgatgcgtccatgagcacggtacgtccggcgcctctgcttttgg 494 || |||||||| ||||| |||||||||||||||||||| |||| ||||| |||||| ||| Sbjct: 450 ttagacatgtaggggttaatgcgtccatgagcacggtaggtcctgcgccgctgcttctgg 391 Query: 495 gcttggttcacctggatgtgtgaaatgtagaggttgtcgacatccaagcctttaacttca 554 || |||||||| ||||||||||| |||||||| || ||||||| ||||| || ||| Sbjct: 390 gcctggttcacttggatgtgtgagatgtagagagcatcaacatccagacctttcacctca 331 Query: 555 gcgttactctcagcattcttcagcaaatccagcacgaactgggccgactttgcaggccag 614 || || ||||| || ||||| || | |||||| || ||||| || ||||| ||||||||| Sbjct: 330 gcattgctctctgcgttcttgagaagatccagaacaaactgagcagacttggcaggccag 271 Query: 615 cgaccctgcccatttggctggcggttctttacttgtgcagtacggcccacacctctgcag 674 |||||||| |||||||||||||||||||| |||| || ||||| || ||||| | |||| Sbjct: 270 cgaccctgaccatttggctggcggttcttagcttgagcggtacgtccaacaccacggcag 211 Query: 675 tatctacggaagggaattgcttgcttgtg 703 || || |||||||| || || |||||||| Sbjct: 210 tacctgcggaaggggatggcctgcttgtg 182
>ref|NM_105410.2| Arabidopsis thaliana structural constituent of ribosome AT1G67430 mRNA, complete cds Length = 713 Score = 176 bits (89), Expect = 7e-41 Identities = 260/317 (82%) Strand = Plus / Minus Query: 390 acaggctcttccttctctgacaagatcagctcaatgtggcaggggttggacatgtaaggg 449 ||||||||||||||||||||||| |||| |||||||||||| |||||||||||||||||| Sbjct: 505 acaggctcttccttctctgacaaaatcaactcaatgtggcatgggttggacatgtaaggg 446 Query: 450 ttgatgcgtccatgagcacggtacgtccggcgcctctgcttttgggcttggttcacctgg 509 ||||| | ||| ||||||||||| |||| | ||| |||||| ||| |||||||| ||| Sbjct: 445 ttgattcttccgtgagcacggtaagtccttctcctttgctttgcggcctggttcacttgg 386 Query: 510 atgtgtgaaatgtagaggttgtcgacatccaagcctttaacttcagcgttactctcagca 569 |||||||| ||| ||||| || |||||||| ||||| || ||||| || |||||||| Sbjct: 385 atgtgtgatatgaagagggcatcaacatccaaacctttcacctcagcattgctctcagcg 326 Query: 570 ttcttcagcaaatccagcacgaactgggccgactttgcaggccagcgaccctgcccattt 629 ||||| |||||||| || || ||||| || ||||| || ||||| || || || ||||| Sbjct: 325 ttcttgagcaaatcaagaacaaactgagcagacttggctggccaacgtccttgaccatta 266 Query: 630 ggctggcggttctttacttgtgcagtacggcccacacctctgcagtatctacggaaggga 689 | || | |||||| |||| ||||| | || |||||||||||| | | ||||||| Sbjct: 265 gagtgcctgttcttagcttgagcagttctcccaacacctctgcagaaacgtgtgaaggga 206 Query: 690 attgcttgcttgtgagc 706 ||||||||||||||||| Sbjct: 205 attgcttgcttgtgagc 189
>gb|AY081524.1| Arabidopsis thaliana unknown protein mRNA, complete cds Length = 564 Score = 176 bits (89), Expect = 7e-41 Identities = 260/317 (82%) Strand = Plus / Minus Query: 390 acaggctcttccttctctgacaagatcagctcaatgtggcaggggttggacatgtaaggg 449 ||||||||||||||||||||||| |||| |||||||||||| |||||||||||||||||| Sbjct: 473 acaggctcttccttctctgacaaaatcaactcaatgtggcatgggttggacatgtaaggg 414 Query: 450 ttgatgcgtccatgagcacggtacgtccggcgcctctgcttttgggcttggttcacctgg 509 ||||| | ||| ||||||||||| |||| | ||| |||||| ||| |||||||| ||| Sbjct: 413 ttgattcttccgtgagcacggtaagtccttctcctttgctttgcggcctggttcacttgg 354 Query: 510 atgtgtgaaatgtagaggttgtcgacatccaagcctttaacttcagcgttactctcagca 569 |||||||| ||| ||||| || |||||||| ||||| || ||||| || |||||||| Sbjct: 353 atgtgtgatatgaagagggcatcaacatccaaacctttcacctcagcattgctctcagcg 294 Query: 570 ttcttcagcaaatccagcacgaactgggccgactttgcaggccagcgaccctgcccattt 629 ||||| |||||||| || || ||||| || ||||| || ||||| || || || ||||| Sbjct: 293 ttcttgagcaaatcaagaacaaactgagcagacttggctggccaacgtccttgaccatta 234 Query: 630 ggctggcggttctttacttgtgcagtacggcccacacctctgcagtatctacggaaggga 689 | || | |||||| |||| ||||| | || |||||||||||| | | ||||||| Sbjct: 233 gagtgcctgttcttagcttgagcagttctcccaacacctctgcagaaacgtgtgaaggga 174 Query: 690 attgcttgcttgtgagc 706 ||||||||||||||||| Sbjct: 173 attgcttgcttgtgagc 157
>gb|AY042862.1| Arabidopsis thaliana ribosomal protein L17-like protein (T1F15.11) mRNA, complete cds Length = 711 Score = 176 bits (89), Expect = 7e-41 Identities = 260/317 (82%) Strand = Plus / Minus Query: 390 acaggctcttccttctctgacaagatcagctcaatgtggcaggggttggacatgtaaggg 449 ||||||||||||||||||||||| |||| |||||||||||| |||||||||||||||||| Sbjct: 505 acaggctcttccttctctgacaaaatcaactcaatgtggcatgggttggacatgtaaggg 446 Query: 450 ttgatgcgtccatgagcacggtacgtccggcgcctctgcttttgggcttggttcacctgg 509 ||||| | ||| ||||||||||| |||| | ||| |||||| ||| |||||||| ||| Sbjct: 445 ttgattcttccgtgagcacggtaagtccttctcctttgctttgcggcctggttcacttgg 386 Query: 510 atgtgtgaaatgtagaggttgtcgacatccaagcctttaacttcagcgttactctcagca 569 |||||||| ||| ||||| || |||||||| ||||| || ||||| || |||||||| Sbjct: 385 atgtgtgatatgaagagggcatcaacatccaaacctttcacctcagcattgctctcagcg 326 Query: 570 ttcttcagcaaatccagcacgaactgggccgactttgcaggccagcgaccctgcccattt 629 ||||| |||||||| || || ||||| || ||||| || ||||| || || || ||||| Sbjct: 325 ttcttgagcaaatcaagaacaaactgagcagacttggctggccaacgtccttgaccatta 266 Query: 630 ggctggcggttctttacttgtgcagtacggcccacacctctgcagtatctacggaaggga 689 | || | |||||| |||| ||||| | || |||||||||||| | | ||||||| Sbjct: 265 gagtgcctgttcttagcttgagcagttctcccaacacctctgcagaaacgtgtgaaggga 206 Query: 690 attgcttgcttgtgagc 706 ||||||||||||||||| Sbjct: 205 attgcttgcttgtgagc 189
>ref|XM_450351.1| Oryza sativa (japonica cultivar-group), mRNA Length = 813 Score = 168 bits (85), Expect = 2e-38 Identities = 268/329 (81%) Strand = Plus / Minus Query: 375 tcagcctccttcttcacaggctcttccttctctgacaagatcagctcaatgtggcagggg 434 |||| ||| |||||||| || |||||||||||||||| ||| |||||||||||||| ||| Sbjct: 566 tcaggctctttcttcactggttcttccttctctgacaggataagctcaatgtggcacggg 507 Query: 435 ttggacatgtaagggttgatgcgtccatgagcacggtacgtccggcgcctctgcttttgg 494 |||||||||||||||||||||||||||||||||||| || |||||||||||||| ||| Sbjct: 506 gaggacatgtaagggttgatgcgtccatgagcacggtaggtacggcgcctctgcttctgg 447 Query: 495 gcttggttcacctggatgtgtgaaatgtagaggttgtcgacatccaagcctttaacttca 554 || ||||| || || ||||| || | || || | || ||||||| ||||| || ||| Sbjct: 446 gcctggttaacttgaatgtgggacacataaagagtatcaacatccagacctttcacctca 387 Query: 555 gcgttactctcagcattcttcagcaaatccagcacgaactgggccgactttgcaggccag 614 || || ||||| |||||||| || | |||||| | ||| || ||||| ||||||||| Sbjct: 386 gcattgctctctgcattcttaagaagatccagaatgaatctagcagacttggcaggccag 327 Query: 615 cgaccctgcccatttggctggcggttctttacttgtgcagtacggcccacacctctgcag 674 || ||||| || |||| ||||| ||| |||| ||||| ||||| ||||| | |||| Sbjct: 326 cgtccctgaccgtttgaatggcgtgacttagcttgagcagtgcggccaacaccaccgcag 267 Query: 675 tatctacggaagggaattgcttgcttgtg 703 || ||||||||||| || ||||||||||| Sbjct: 266 tacctacggaaggggatagcttgcttgtg 238
>ref|XM_507427.1| PREDICTED Oryza sativa (japonica cultivar-group), P0523B07.46 mRNA Length = 914 Score = 168 bits (85), Expect = 2e-38 Identities = 268/329 (81%) Strand = Plus / Minus Query: 375 tcagcctccttcttcacaggctcttccttctctgacaagatcagctcaatgtggcagggg 434 |||| ||| |||||||| || |||||||||||||||| ||| |||||||||||||| ||| Sbjct: 567 tcaggctctttcttcactggttcttccttctctgacaggataagctcaatgtggcacggg 508 Query: 435 ttggacatgtaagggttgatgcgtccatgagcacggtacgtccggcgcctctgcttttgg 494 |||||||||||||||||||||||||||||||||||| || |||||||||||||| ||| Sbjct: 507 gaggacatgtaagggttgatgcgtccatgagcacggtaggtacggcgcctctgcttctgg 448 Query: 495 gcttggttcacctggatgtgtgaaatgtagaggttgtcgacatccaagcctttaacttca 554 || ||||| || || ||||| || | || || | || ||||||| ||||| || ||| Sbjct: 447 gcctggttaacttgaatgtgggacacataaagagtatcaacatccagacctttcacctca 388 Query: 555 gcgttactctcagcattcttcagcaaatccagcacgaactgggccgactttgcaggccag 614 || || ||||| |||||||| || | |||||| | ||| || ||||| ||||||||| Sbjct: 387 gcattgctctctgcattcttaagaagatccagaatgaatctagcagacttggcaggccag 328 Query: 615 cgaccctgcccatttggctggcggttctttacttgtgcagtacggcccacacctctgcag 674 || ||||| || |||| ||||| ||| |||| ||||| ||||| ||||| | |||| Sbjct: 327 cgtccctgaccgtttgaatggcgtgacttagcttgagcagtgcggccaacaccaccgcag 268 Query: 675 tatctacggaagggaattgcttgcttgtg 703 || ||||||||||| || ||||||||||| Sbjct: 267 tacctacggaaggggatagcttgcttgtg 239
>ref|XM_506642.2| PREDICTED Oryza sativa (japonica cultivar-group), P0523B07.46 mRNA Length = 936 Score = 168 bits (85), Expect = 2e-38 Identities = 268/329 (81%) Strand = Plus / Minus Query: 375 tcagcctccttcttcacaggctcttccttctctgacaagatcagctcaatgtggcagggg 434 |||| ||| |||||||| || |||||||||||||||| ||| |||||||||||||| ||| Sbjct: 553 tcaggctctttcttcactggttcttccttctctgacaggataagctcaatgtggcacggg 494 Query: 435 ttggacatgtaagggttgatgcgtccatgagcacggtacgtccggcgcctctgcttttgg 494 |||||||||||||||||||||||||||||||||||| || |||||||||||||| ||| Sbjct: 493 gaggacatgtaagggttgatgcgtccatgagcacggtaggtacggcgcctctgcttctgg 434 Query: 495 gcttggttcacctggatgtgtgaaatgtagaggttgtcgacatccaagcctttaacttca 554 || ||||| || || ||||| || | || || | || ||||||| ||||| || ||| Sbjct: 433 gcctggttaacttgaatgtgggacacataaagagtatcaacatccagacctttcacctca 374 Query: 555 gcgttactctcagcattcttcagcaaatccagcacgaactgggccgactttgcaggccag 614 || || ||||| |||||||| || | |||||| | ||| || ||||| ||||||||| Sbjct: 373 gcattgctctctgcattcttaagaagatccagaatgaatctagcagacttggcaggccag 314 Query: 615 cgaccctgcccatttggctggcggttctttacttgtgcagtacggcccacacctctgcag 674 || ||||| || |||| ||||| ||| |||| ||||| ||||| ||||| | |||| Sbjct: 313 cgtccctgaccgtttgaatggcgtgacttagcttgagcagtgcggccaacaccaccgcag 254 Query: 675 tatctacggaagggaattgcttgcttgtg 703 || ||||||||||| || ||||||||||| Sbjct: 253 tacctacggaaggggatagcttgcttgtg 225
>emb|BX817777.1|CNS0AE81 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTSIL40ZG06 of Silique of strain col-0 of Arabidopsis thaliana (thale cress) Length = 680 Score = 168 bits (85), Expect = 2e-38 Identities = 259/317 (81%) Strand = Plus / Minus Query: 390 acaggctcttccttctctgacaagatcagctcaatgtggcaggggttggacatgtaaggg 449 ||||||||||||||||||||||| |||| |||||||||||| |||||||||||||||||| Sbjct: 493 acaggctcttccttctctgacaaaatcaactcaatgtggcatgggttggacatgtaaggg 434 Query: 450 ttgatgcgtccatgagcacggtacgtccggcgcctctgcttttgggcttggttcacctgg 509 ||||| | ||| ||||||||||| |||| | ||| |||||| ||| ||||| || ||| Sbjct: 433 ttgattcttccgtgagcacggtaagtccttctcctttgctttgcggcctggttaacttgg 374 Query: 510 atgtgtgaaatgtagaggttgtcgacatccaagcctttaacttcagcgttactctcagca 569 |||||||| ||| ||||| || |||||||| ||||| || ||||| || |||||||| Sbjct: 373 atgtgtgatatgaagagggcatcaacatccaaacctttcacctcagcattgctctcagcg 314 Query: 570 ttcttcagcaaatccagcacgaactgggccgactttgcaggccagcgaccctgcccattt 629 ||||| |||||||| || || ||||| || ||||| || ||||| || || || ||||| Sbjct: 313 ttcttgagcaaatcaagaacaaactgagcagacttggctggccaacgtccttgaccatta 254 Query: 630 ggctggcggttctttacttgtgcagtacggcccacacctctgcagtatctacggaaggga 689 | || | |||||| |||| ||||| | || |||||||||||| | | ||||||| Sbjct: 253 gagtgcctgttcttagcttgagcagttctcccaacacctctgcagaaacgtgtgaaggga 194 Query: 690 attgcttgcttgtgagc 706 ||||||||||||||||| Sbjct: 193 attgcttgcttgtgagc 177
>dbj|AK120273.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013048E22, full insert sequence Length = 915 Score = 168 bits (85), Expect = 2e-38 Identities = 268/329 (81%) Strand = Plus / Minus Query: 375 tcagcctccttcttcacaggctcttccttctctgacaagatcagctcaatgtggcagggg 434 |||| ||| |||||||| || |||||||||||||||| ||| |||||||||||||| ||| Sbjct: 567 tcaggctctttcttcactggttcttccttctctgacaggataagctcaatgtggcacggg 508 Query: 435 ttggacatgtaagggttgatgcgtccatgagcacggtacgtccggcgcctctgcttttgg 494 |||||||||||||||||||||||||||||||||||| || |||||||||||||| ||| Sbjct: 507 gaggacatgtaagggttgatgcgtccatgagcacggtaggtacggcgcctctgcttctgg 448 Query: 495 gcttggttcacctggatgtgtgaaatgtagaggttgtcgacatccaagcctttaacttca 554 || ||||| || || ||||| || | || || | || ||||||| ||||| || ||| Sbjct: 447 gcctggttaacttgaatgtgggacacataaagagtatcaacatccagacctttcacctca 388 Query: 555 gcgttactctcagcattcttcagcaaatccagcacgaactgggccgactttgcaggccag 614 || || ||||| |||||||| || | |||||| | ||| || ||||| ||||||||| Sbjct: 387 gcattgctctctgcattcttaagaagatccagaatgaatctagcagacttggcaggccag 328 Query: 615 cgaccctgcccatttggctggcggttctttacttgtgcagtacggcccacacctctgcag 674 || ||||| || |||| ||||| ||| |||| ||||| ||||| ||||| | |||| Sbjct: 327 cgtccctgaccgtttgaatggcgtgacttagcttgagcagtgcggccaacaccaccgcag 268 Query: 675 tatctacggaagggaattgcttgcttgtg 703 || ||||||||||| || ||||||||||| Sbjct: 267 tacctacggaaggggatagcttgcttgtg 239
>dbj|AK105087.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-047-A12, full insert sequence Length = 834 Score = 168 bits (85), Expect = 2e-38 Identities = 268/329 (81%) Strand = Plus / Minus Query: 375 tcagcctccttcttcacaggctcttccttctctgacaagatcagctcaatgtggcagggg 434 |||| ||| |||||||| || |||||||||||||||| ||| |||||||||||||| ||| Sbjct: 587 tcaggctctttcttcactggttcttccttctctgacaggataagctcaatgtggcacggg 528 Query: 435 ttggacatgtaagggttgatgcgtccatgagcacggtacgtccggcgcctctgcttttgg 494 |||||||||||||||||||||||||||||||||||| || |||||||||||||| ||| Sbjct: 527 gaggacatgtaagggttgatgcgtccatgagcacggtaggtacggcgcctctgcttctgg 468 Query: 495 gcttggttcacctggatgtgtgaaatgtagaggttgtcgacatccaagcctttaacttca 554 || ||||| || || ||||| || | || || | || ||||||| ||||| || ||| Sbjct: 467 gcctggttaacttgaatgtgggacacataaagagtatcaacatccagacctttcacctca 408 Query: 555 gcgttactctcagcattcttcagcaaatccagcacgaactgggccgactttgcaggccag 614 || || ||||| |||||||| || | |||||| | ||| || ||||| ||||||||| Sbjct: 407 gcattgctctctgcattcttaagaagatccagaatgaatctagcagacttggcaggccag 348 Query: 615 cgaccctgcccatttggctggcggttctttacttgtgcagtacggcccacacctctgcag 674 || ||||| || |||| ||||| ||| |||| ||||| ||||| ||||| | |||| Sbjct: 347 cgtccctgaccgtttgaatggcgtgacttagcttgagcagtgcggccaacaccaccgcag 288 Query: 675 tatctacggaagggaattgcttgcttgtg 703 || ||||||||||| || ||||||||||| Sbjct: 287 tacctacggaaggggatagcttgcttgtg 259
>dbj|AK072488.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023134I03, full insert sequence Length = 936 Score = 168 bits (85), Expect = 2e-38 Identities = 268/329 (81%) Strand = Plus / Minus Query: 375 tcagcctccttcttcacaggctcttccttctctgacaagatcagctcaatgtggcagggg 434 |||| ||| |||||||| || |||||||||||||||| ||| |||||||||||||| ||| Sbjct: 553 tcaggctctttcttcactggttcttccttctctgacaggataagctcaatgtggcacggg 494 Query: 435 ttggacatgtaagggttgatgcgtccatgagcacggtacgtccggcgcctctgcttttgg 494 |||||||||||||||||||||||||||||||||||| || |||||||||||||| ||| Sbjct: 493 gaggacatgtaagggttgatgcgtccatgagcacggtaggtacggcgcctctgcttctgg 434 Query: 495 gcttggttcacctggatgtgtgaaatgtagaggttgtcgacatccaagcctttaacttca 554 || ||||| || || ||||| || | || || | || ||||||| ||||| || ||| Sbjct: 433 gcctggttaacttgaatgtgggacacataaagagtatcaacatccagacctttcacctca 374 Query: 555 gcgttactctcagcattcttcagcaaatccagcacgaactgggccgactttgcaggccag 614 || || ||||| |||||||| || | |||||| | ||| || ||||| ||||||||| Sbjct: 373 gcattgctctctgcattcttaagaagatccagaatgaatctagcagacttggcaggccag 314 Query: 615 cgaccctgcccatttggctggcggttctttacttgtgcagtacggcccacacctctgcag 674 || ||||| || |||| ||||| ||| |||| ||||| ||||| ||||| | |||| Sbjct: 313 cgtccctgaccgtttgaatggcgtgacttagcttgagcagtgcggccaacaccaccgcag 254 Query: 675 tatctacggaagggaattgcttgcttgtg 703 || ||||||||||| || ||||||||||| Sbjct: 253 tacctacggaaggggatagcttgcttgtg 225
>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete sequence Length = 28434780 Score = 161 bits (81), Expect = 4e-36 Identities = 96/101 (95%) Strand = Plus / Plus Query: 450 ttgatgcgtccatgagcacggtacgtccggcgcctctgcttttgggcttggttcacctgg 509 ||||||||||||||||||||||| |||||||| |||||||| |||||||||||||||||| Sbjct: 26399460 ttgatgcgtccatgagcacggtatgtccggcgtctctgcttctgggcttggttcacctgg 26399519 Query: 510 atgtgtgaaatgtagaggttgtcgacatccaagcctttaac 550 |||||||||| | |||||||||||||||||||||||||||| Sbjct: 26399520 atgtgtgaaacgaagaggttgtcgacatccaagcctttaac 26399560 Score = 109 bits (55), Expect = 1e-20 Identities = 130/155 (83%) Strand = Plus / Plus Query: 552 tcagcgttactctcagcattcttcagcaaatccagcacgaactgggccgactttgcaggc 611 |||||||||||||||||||||||||||| ||||| | |||| ||| || || |||||| Sbjct: 26399659 tcagcgttactctcagcattcttcagcagatccaaaatgaacctggctgatttggcaggc 26399718 Query: 612 cagcgaccctgcccatttggctggcggttctttacttgtgcagtacggcccacacctctg 671 || | ||||||||||||| ||||| ||| |||||||||||||||||||| |||| Sbjct: 26399719 cacctgccctgcccatttgattggcgagacttcacttgtgcagtacggcccacgcctcca 26399778 Query: 672 cagtatctacggaagggaattgcttgcttgtgagc 706 ||||| || | |||||||||||| ||||||||||| Sbjct: 26399779 cagtaccttctgaagggaattgcctgcttgtgagc 26399813 Score = 65.9 bits (33), Expect = 2e-07 Identities = 60/69 (86%) Strand = Plus / Plus Query: 379 cctccttcttcacaggctcttccttctctgacaagatcagctcaatgtggcaggggttgg 438 |||| |||||||| | ||||||||||||||||||||| ||||| | ||||||||| || Sbjct: 26399319 cctctttcttcacggcctcttccttctctgacaagataagctcgacgtggcagggtgagg 26399378 Query: 439 acatgtaag 447 ||||||||| Sbjct: 26399379 acatgtaag 26399387 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 11 ctctctgttcctaaatataa 30 |||||||||||||||||||| Sbjct: 22936622 ctctctgttcctaaatataa 22936641
>dbj|AP003920.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC clone:OJ1789_C07 Length = 138944 Score = 161 bits (81), Expect = 4e-36 Identities = 96/101 (95%) Strand = Plus / Plus Query: 450 ttgatgcgtccatgagcacggtacgtccggcgcctctgcttttgggcttggttcacctgg 509 ||||||||||||||||||||||| |||||||| |||||||| |||||||||||||||||| Sbjct: 49012 ttgatgcgtccatgagcacggtatgtccggcgtctctgcttctgggcttggttcacctgg 49071 Query: 510 atgtgtgaaatgtagaggttgtcgacatccaagcctttaac 550 |||||||||| | |||||||||||||||||||||||||||| Sbjct: 49072 atgtgtgaaacgaagaggttgtcgacatccaagcctttaac 49112 Score = 109 bits (55), Expect = 1e-20 Identities = 130/155 (83%) Strand = Plus / Plus Query: 552 tcagcgttactctcagcattcttcagcaaatccagcacgaactgggccgactttgcaggc 611 |||||||||||||||||||||||||||| ||||| | |||| ||| || || |||||| Sbjct: 49211 tcagcgttactctcagcattcttcagcagatccaaaatgaacctggctgatttggcaggc 49270 Query: 612 cagcgaccctgcccatttggctggcggttctttacttgtgcagtacggcccacacctctg 671 || | ||||||||||||| ||||| ||| |||||||||||||||||||| |||| Sbjct: 49271 cacctgccctgcccatttgattggcgagacttcacttgtgcagtacggcccacgcctcca 49330 Query: 672 cagtatctacggaagggaattgcttgcttgtgagc 706 ||||| || | |||||||||||| ||||||||||| Sbjct: 49331 cagtaccttctgaagggaattgcctgcttgtgagc 49365 Score = 65.9 bits (33), Expect = 2e-07 Identities = 60/69 (86%) Strand = Plus / Plus Query: 379 cctccttcttcacaggctcttccttctctgacaagatcagctcaatgtggcaggggttgg 438 |||| |||||||| | ||||||||||||||||||||| ||||| | ||||||||| || Sbjct: 48871 cctctttcttcacggcctcttccttctctgacaagataagctcgacgtggcagggtgagg 48930 Query: 439 acatgtaag 447 ||||||||| Sbjct: 48931 acatgtaag 48939
>dbj|AP004015.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC clone:OJ1770_H02 Length = 170648 Score = 161 bits (81), Expect = 4e-36 Identities = 96/101 (95%) Strand = Plus / Plus Query: 450 ttgatgcgtccatgagcacggtacgtccggcgcctctgcttttgggcttggttcacctgg 509 ||||||||||||||||||||||| |||||||| |||||||| |||||||||||||||||| Sbjct: 129041 ttgatgcgtccatgagcacggtatgtccggcgtctctgcttctgggcttggttcacctgg 129100 Query: 510 atgtgtgaaatgtagaggttgtcgacatccaagcctttaac 550 |||||||||| | |||||||||||||||||||||||||||| Sbjct: 129101 atgtgtgaaacgaagaggttgtcgacatccaagcctttaac 129141 Score = 109 bits (55), Expect = 1e-20 Identities = 130/155 (83%) Strand = Plus / Plus Query: 552 tcagcgttactctcagcattcttcagcaaatccagcacgaactgggccgactttgcaggc 611 |||||||||||||||||||||||||||| ||||| | |||| ||| || || |||||| Sbjct: 129240 tcagcgttactctcagcattcttcagcagatccaaaatgaacctggctgatttggcaggc 129299 Query: 612 cagcgaccctgcccatttggctggcggttctttacttgtgcagtacggcccacacctctg 671 || | ||||||||||||| ||||| ||| |||||||||||||||||||| |||| Sbjct: 129300 cacctgccctgcccatttgattggcgagacttcacttgtgcagtacggcccacgcctcca 129359 Query: 672 cagtatctacggaagggaattgcttgcttgtgagc 706 ||||| || | |||||||||||| ||||||||||| Sbjct: 129360 cagtaccttctgaagggaattgcctgcttgtgagc 129394 Score = 65.9 bits (33), Expect = 2e-07 Identities = 60/69 (86%) Strand = Plus / Plus Query: 379 cctccttcttcacaggctcttccttctctgacaagatcagctcaatgtggcaggggttgg 438 |||| |||||||| | ||||||||||||||||||||| ||||| | ||||||||| || Sbjct: 128900 cctctttcttcacggcctcttccttctctgacaagataagctcgacgtggcagggtgagg 128959 Query: 439 acatgtaag 447 ||||||||| Sbjct: 128960 acatgtaag 128968
>ref|NM_102503.2| Arabidopsis thaliana structural constituent of ribosome AT1G27400 mRNA, complete cds Length = 826 Score = 159 bits (80), Expect = 2e-35 Identities = 197/236 (83%) Strand = Plus / Minus Query: 384 ttcttcacaggctcttccttctctgacaagatcagctcaatgtggcaggggttggacatg 443 ||||||||||||||||| ||||||||||| |||| |||||||||||| ||||| |||||| Sbjct: 574 ttcttcacaggctcttctttctctgacaaaatcaactcaatgtggcatgggtttgacatg 515 Query: 444 taagggttgatgcgtccatgagcacggtacgtccggcgcctctgcttttgggcttggttc 503 ||||| ||||| | |||||||||||| || |||| | |||||| ||| ||||||||| Sbjct: 514 taaggattgattcttccatgagcacgatatgtccttctcctctgttttgctgcttggttc 455 Query: 504 acctggatgtgtgaaatgtagaggttgtcgacatccaagcctttaacttcagcgttactc 563 || |||||||| |||||| | ||| ||||||||||| ||||| || ||||| || ||| Sbjct: 454 acttggatgtgagaaatgaaaagggcatcgacatccaaacctttgacctcagcattgctc 395 Query: 564 tcagcattcttcagcaaatccagcacgaactgggccgactttgcaggccagcgacc 619 ||||||||||| || | ||| || ||||| || || || || |||||||||||||| Sbjct: 394 tcagcattcttgagaagatcaagaacgaattgagcagatttagcaggccagcgacc 339
>gb|AY077651.1| Arabidopsis thaliana At1g27400/F17L21_20 mRNA, complete cds Length = 531 Score = 159 bits (80), Expect = 2e-35 Identities = 197/236 (83%) Strand = Plus / Minus Query: 384 ttcttcacaggctcttccttctctgacaagatcagctcaatgtggcaggggttggacatg 443 ||||||||||||||||| ||||||||||| |||| |||||||||||| ||||| |||||| Sbjct: 479 ttcttcacaggctcttctttctctgacaaaatcaactcaatgtggcatgggtttgacatg 420 Query: 444 taagggttgatgcgtccatgagcacggtacgtccggcgcctctgcttttgggcttggttc 503 ||||| ||||| | |||||||||||| || |||| | |||||| ||| ||||||||| Sbjct: 419 taaggattgattcttccatgagcacgatatgtccttctcctctgttttgctgcttggttc 360 Query: 504 acctggatgtgtgaaatgtagaggttgtcgacatccaagcctttaacttcagcgttactc 563 || |||||||| |||||| | ||| ||||||||||| ||||| || ||||| || ||| Sbjct: 359 acttggatgtgagaaatgaaaagggcatcgacatccaaacctttgacctcagcattgctc 300 Query: 564 tcagcattcttcagcaaatccagcacgaactgggccgactttgcaggccagcgacc 619 ||||||||||| || | ||| || ||||| || || || || |||||||||||||| Sbjct: 299 tcagcattcttgagaagatcaagaacgaattgagcagatttagcaggccagcgacc 244
>gb|AF428449.1|AF428449 Arabidopsis thaliana At1g27400/F17L21_20 mRNA, complete cds Length = 712 Score = 159 bits (80), Expect = 2e-35 Identities = 197/236 (83%) Strand = Plus / Minus Query: 384 ttcttcacaggctcttccttctctgacaagatcagctcaatgtggcaggggttggacatg 443 ||||||||||||||||| ||||||||||| |||| |||||||||||| ||||| |||||| Sbjct: 514 ttcttcacaggctcttctttctctgacaaaatcaactcaatgtggcatgggtttgacatg 455 Query: 444 taagggttgatgcgtccatgagcacggtacgtccggcgcctctgcttttgggcttggttc 503 ||||| ||||| | |||||||||||| || |||| | |||||| ||| ||||||||| Sbjct: 454 taaggattgattcttccatgagcacgatatgtccttctcctctgttttgctgcttggttc 395 Query: 504 acctggatgtgtgaaatgtagaggttgtcgacatccaagcctttaacttcagcgttactc 563 || |||||||| |||||| | ||| ||||||||||| ||||| || ||||| || ||| Sbjct: 394 acttggatgtgagaaatgaaaagggcatcgacatccaaacctttgacctcagcattgctc 335 Query: 564 tcagcattcttcagcaaatccagcacgaactgggccgactttgcaggccagcgacc 619 ||||||||||| || | ||| || ||||| || || || || |||||||||||||| Sbjct: 334 tcagcattcttgagaagatcaagaacgaattgagcagatttagcaggccagcgacc 279
>gb|AF428271.1|AF428271 Arabidopsis thaliana At1g27400/F17L21_20 mRNA, complete cds Length = 762 Score = 159 bits (80), Expect = 2e-35 Identities = 197/236 (83%) Strand = Plus / Minus Query: 384 ttcttcacaggctcttccttctctgacaagatcagctcaatgtggcaggggttggacatg 443 ||||||||||||||||| ||||||||||| |||| |||||||||||| ||||| |||||| Sbjct: 514 ttcttcacaggctcttctttctctgacaaaatcaactcaatgtggcatgggtttgacatg 455 Query: 444 taagggttgatgcgtccatgagcacggtacgtccggcgcctctgcttttgggcttggttc 503 ||||| ||||| | |||||||||||| || |||| | |||||| ||| ||||||||| Sbjct: 454 taaggattgattcttccatgagcacgatatgtccttctcctctgttttgctgcttggttc 395 Query: 504 acctggatgtgtgaaatgtagaggttgtcgacatccaagcctttaacttcagcgttactc 563 || |||||||| |||||| | ||| ||||||||||| ||||| || ||||| || ||| Sbjct: 394 acttggatgtgagaaatgaaaagggcatcgacatccaaacctttgacctcagcattgctc 335 Query: 564 tcagcattcttcagcaaatccagcacgaactgggccgactttgcaggccagcgacc 619 ||||||||||| || | ||| || ||||| || || || || |||||||||||||| Sbjct: 334 tcagcattcttgagaagatcaagaacgaattgagcagatttagcaggccagcgacc 279
>gb|AY037249.1| Arabidopsis thaliana At1g27400/F17L21_20 mRNA, complete cds Length = 767 Score = 159 bits (80), Expect = 2e-35 Identities = 197/236 (83%) Strand = Plus / Minus Query: 384 ttcttcacaggctcttccttctctgacaagatcagctcaatgtggcaggggttggacatg 443 ||||||||||||||||| ||||||||||| |||| |||||||||||| ||||| |||||| Sbjct: 514 ttcttcacaggctcttctttctctgacaaaatcaactcaatgtggcatgggtttgacatg 455 Query: 444 taagggttgatgcgtccatgagcacggtacgtccggcgcctctgcttttgggcttggttc 503 ||||| ||||| | |||||||||||| || |||| | |||||| ||| ||||||||| Sbjct: 454 taaggattgattcttccatgagcacgatatgtccttctcctctgttttgctgcttggttc 395 Query: 504 acctggatgtgtgaaatgtagaggttgtcgacatccaagcctttaacttcagcgttactc 563 || |||||||| |||||| | ||| ||||||||||| ||||| || ||||| || ||| Sbjct: 394 acttggatgtgagaaatgaaaagggcatcgacatccaaacctttgacctcagcattgctc 335 Query: 564 tcagcattcttcagcaaatccagcacgaactgggccgactttgcaggccagcgacc 619 ||||||||||| || | ||| || ||||| || || || || |||||||||||||| Sbjct: 334 tcagcattcttgagaagatcaagaacgaattgagcagatttagcaggccagcgacc 279
>gb|AY088522.1| Arabidopsis thaliana clone 749 mRNA, complete sequence Length = 747 Score = 159 bits (80), Expect = 2e-35 Identities = 197/236 (83%) Strand = Plus / Minus Query: 384 ttcttcacaggctcttccttctctgacaagatcagctcaatgtggcaggggttggacatg 443 ||||||||||||||||| ||||||||||| |||| |||||||||||| ||||| |||||| Sbjct: 574 ttcttcacaggctcttctttctctgacaaaatcaactcaatgtggcatgggtttgacatg 515 Query: 444 taagggttgatgcgtccatgagcacggtacgtccggcgcctctgcttttgggcttggttc 503 ||||| ||||| | |||||||||||| || |||| | |||||| ||| ||||||||| Sbjct: 514 taaggattgattcttccatgagcacgatatgtccttctcctctgttttgctgcttggttc 455 Query: 504 acctggatgtgtgaaatgtagaggttgtcgacatccaagcctttaacttcagcgttactc 563 || |||||||| |||||| | ||| ||||||||||| ||||| || ||||| || ||| Sbjct: 454 acttggatgtgagaaatgaaaagggcatcgacatccaaacctttgacctcagcattgctc 395 Query: 564 tcagcattcttcagcaaatccagcacgaactgggccgactttgcaggccagcgacc 619 ||||||||||| || | ||| || ||||| || || || || |||||||||||||| Sbjct: 394 tcagcattcttgagaagatcaagaacgaattgagcagatttagcaggccagcgacc 339
>gb|AY103585.1| Zea mays PCO123564 mRNA sequence Length = 1953 Score = 159 bits (80), Expect = 2e-35 Identities = 170/200 (85%) Strand = Plus / Plus Query: 375 tcagcctccttcttcacaggctcttccttctctgacaagatcagctcaatgtggcagggg 434 |||||||| |||||||| ||||||||||||||||||||||| || || |||||||| ||| Sbjct: 1242 tcagcctctttcttcacgggctcttccttctctgacaagatgagttcgatgtggcacggg 1301 Query: 435 ttggacatgtaagggttgatgcgtccatgagcacggtacgtccggcgcctctgcttttgg 494 ||||||||||||||||||||| |||||||| ||||| |||| ||||| |||||| || Sbjct: 1302 gaggacatgtaagggttgatgcgcccatgagcgcggtaggtcctgcgccgctgcttctga 1361 Query: 495 gcttggttcacctggatgtgtgaaatgtagaggttgtcgacatccaagcctttaacttca 554 || |||||||| || |||||||| | |||||| | |||||||| | ||||| || ||| Sbjct: 1362 gcctggttcacttgaatgtgtgacacatagagggtatcgacatcaagaccttttacctca 1421 Query: 555 gcgttactctcagcattctt 574 || || |||||||||||||| Sbjct: 1422 gcattgctctcagcattctt 1441 Score = 40.1 bits (20), Expect = 9.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 607 caggccagcgaccctgcccatttg 630 |||||||||| ||||||||||||| Sbjct: 1474 caggccagcgtccctgcccatttg 1497
>gb|BT017485.1| Zea mays clone EL01N0412G01.c mRNA sequence Length = 640 Score = 135 bits (68), Expect = 2e-28 Identities = 104/116 (89%) Strand = Plus / Minus Query: 375 tcagcctccttcttcacaggctcttccttctctgacaagatcagctcaatgtggcagggg 434 |||||||| |||||||| |||||||||||||| |||||||| ||||| |||||||| ||| Sbjct: 493 tcagcctctttcttcactggctcttccttctccgacaagatgagctctatgtggcatggg 434 Query: 435 ttggacatgtaagggttgatgcgtccatgagcacggtacgtccggcgcctctgctt 490 |||||||||||||||||||||||||||||||||||| |||| ||| | |||||| Sbjct: 433 gaggacatgtaagggttgatgcgtccatgagcacggtatgtcctgcgtcgctgctt 378
>gb|AY109488.1| Zea mays CL9529_1 mRNA sequence Length = 1024 Score = 135 bits (68), Expect = 2e-28 Identities = 104/116 (89%) Strand = Plus / Plus Query: 375 tcagcctccttcttcacaggctcttccttctctgacaagatcagctcaatgtggcagggg 434 |||||||| |||||||| |||||||||||||| |||||||| ||||| |||||||| ||| Sbjct: 430 tcagcctctttcttcactggctcttccttctccgacaagatgagctcgatgtggcatggg 489 Query: 435 ttggacatgtaagggttgatgcgtccatgagcacggtacgtccggcgcctctgctt 490 |||||||||||||||||||||||||||||||||||| |||| ||| | |||||| Sbjct: 490 gaggacatgtaagggttgatgcgtccatgagcacggtatgtcctgcgtcgctgctt 545
>gb|AF307336.1|AF307336 Petunia x hybrida ribosomal protein (PETRP) mRNA, complete cds Length = 819 Score = 105 bits (53), Expect = 2e-19 Identities = 152/185 (82%) Strand = Plus / Minus Query: 396 tcttccttctctgacaagatcagctcaatgtggcaggggttggacatgtaagggttgatg 455 |||||||| || ||||| |||| |||||| |||||||| || |||||||| || ||||| Sbjct: 498 tcttccttttcagacaatatcaactcaatatggcagggattagacatgtagggattgatt 439 Query: 456 cgtccatgagcacggtacgtccggcgcctctgcttttgggcttggttcacctggatgtgt 515 | ||||||||||||||| |||||||||||||| || || |||||||| || |||||||| Sbjct: 438 cttccatgagcacggtatgtccggcgcctctgtttctgtgcttggtttacttggatgtga 379 Query: 516 gaaatgtagaggttgtcgacatccaagcctttaacttcagcgttactctcagcattcttc 575 || || || || |||||||| |||||||||||||| || ||||||||||| || Sbjct: 378 cttatataaagtgaatccacatccaaacctttaacttcagcattgctctcagcatttttg 319 Query: 576 agcaa 580 ||||| Sbjct: 318 agcaa 314
>ref|XM_323004.1| Neurospora crassa OR74A 60S RIBOSOMAL PROTEIN L17 [MIPS] (NCU03703.1) partial mRNA Length = 585 Score = 91.7 bits (46), Expect = 3e-15 Identities = 85/98 (86%) Strand = Plus / Minus Query: 417 agctcaatgtggcaggggttggacatgtaagggttgatgcgtccatgagcacggtacgtc 476 ||||| ||||||||||||||||||||||| ||||||||||| || ||||| ||||| || Sbjct: 467 agctcgatgtggcaggggttggacatgtaggggttgatgcgaccgtgagcgcggtaagtg 408 Query: 477 cggcgcctctgcttttgggcttggttcacctggatgtg 514 ||||| | |||||| |||| ||||| ||||||||||| Sbjct: 407 cggcggcgctgcttgggggcctggttgacctggatgtg 370
>ref|XM_956386.1| Neurospora crassa OR74A 60S RIBOSOMAL PROTEIN L17 [MIPS] (NCU03703.1) partial mRNA Length = 585 Score = 91.7 bits (46), Expect = 3e-15 Identities = 85/98 (86%) Strand = Plus / Minus Query: 417 agctcaatgtggcaggggttggacatgtaagggttgatgcgtccatgagcacggtacgtc 476 ||||| ||||||||||||||||||||||| ||||||||||| || ||||| ||||| || Sbjct: 467 agctcgatgtggcaggggttggacatgtaggggttgatgcgaccgtgagcgcggtaagtg 408 Query: 477 cggcgcctctgcttttgggcttggttcacctggatgtg 514 ||||| | |||||| |||| ||||| ||||||||||| Sbjct: 407 cggcggcgctgcttgggggcctggttgacctggatgtg 370
>ref|XM_382047.1| Gibberella zeae PH-1 chromosome 1 RL17_NEUCR 60S ribosomal protein L17 (FG01871.1) partial mRNA Length = 558 Score = 91.7 bits (46), Expect = 3e-15 Identities = 85/98 (86%) Strand = Plus / Minus Query: 417 agctcaatgtggcaggggttggacatgtaagggttgatgcgtccatgagcacggtacgtc 476 ||||| |||||||||||||||||||||||||||||||| || || ||||||||||| ||| Sbjct: 443 agctcgatgtggcaggggttggacatgtaagggttgatacgaccgtgagcacggtatgtc 384 Query: 477 cggcgcctctgcttttgggcttggttcacctggatgtg 514 | || | |||||| |||| ||||| ||||||||||| Sbjct: 383 cttcgtcgctgcttgggggcctggttgacctggatgtg 346
>gb|AC004393.2|T1F15 Arabidopsis thaliana chromosome 1 BAC T1F15 sequence, complete sequence Length = 60066 Score = 91.7 bits (46), Expect = 3e-15 Identities = 55/58 (94%) Strand = Plus / Plus Query: 390 acaggctcttccttctctgacaagatcagctcaatgtggcaggggttggacatgtaag 447 ||||||||||||||||||||||| |||| |||||||||||| |||||||||||||||| Sbjct: 43906 acaggctcttccttctctgacaaaatcaactcaatgtggcatgggttggacatgtaag 43963 Score = 48.1 bits (24), Expect = 0.040 Identities = 24/24 (100%) Strand = Plus / Plus Query: 683 gaagggaattgcttgcttgtgagc 706 |||||||||||||||||||||||| Sbjct: 44375 gaagggaattgcttgcttgtgagc 44398 Score = 48.1 bits (24), Expect = 0.040 Identities = 66/80 (82%) Strand = Plus / Plus Query: 448 ggttgatgcgtccatgagcacggtacgtccggcgcctctgcttttgggcttggttcacct 507 ||||||| | ||| ||||||||||| |||| | ||| |||||| ||| |||||||| | Sbjct: 44048 ggttgattcttccgtgagcacggtaagtccttctcctttgctttgcggcctggttcactt 44107 Query: 508 ggatgtgtgaaatgtagagg 527 |||||||||| ||| ||||| Sbjct: 44108 ggatgtgtgatatgaagagg 44127
>gb|AC004557.2|AC004557 Genomic sequence for Arabidopsis thaliana BAC F17L21 from chromosome I, complete sequence Length = 99690 Score = 89.7 bits (45), Expect = 1e-14 Identities = 63/69 (91%) Strand = Plus / Minus Query: 379 cctccttcttcacaggctcttccttctctgacaagatcagctcaatgtggcaggggttgg 438 |||| ||||||||||||||||| ||||||||||| |||| |||||||||||| ||||| | Sbjct: 60465 cctctttcttcacaggctcttctttctctgacaaaatcaactcaatgtggcatgggtttg 60406 Query: 439 acatgtaag 447 ||||||||| Sbjct: 60405 acatgtaag 60397 Score = 44.1 bits (22), Expect = 0.63 Identities = 73/90 (81%) Strand = Plus / Minus Query: 458 tccatgagcacggtacgtccggcgcctctgcttttgggcttggttcacctggatgtgtga 517 |||||||||||| || |||| | |||||| ||| ||||||||||| |||||||| || Sbjct: 60296 tccatgagcacgatatgtccttctcctctgttttgctgcttggttcacttggatgtgaga 60237 Query: 518 aatgtagaggttgtcgacatccaagccttt 547 |||| | ||| ||||||||||| ||||| Sbjct: 60236 aatgaaaagggcatcgacatccaaaccttt 60207 Score = 40.1 bits (20), Expect = 9.8 Identities = 56/68 (82%) Strand = Plus / Minus Query: 552 tcagcgttactctcagcattcttcagcaaatccagcacgaactgggccgactttgcaggc 611 ||||| || |||||||||||||| || | ||| || ||||| || || || || |||||| Sbjct: 60118 tcagcattgctctcagcattcttgagaagatcaagaacgaattgagcagatttagcaggc 60059 Query: 612 cagcgacc 619 |||||||| Sbjct: 60058 cagcgacc 60051
>gb|DQ207869.1| Solanum tuberosum clone 086A10 ribosomal protein PETRP-like mRNA, complete cds Length = 729 Score = 87.7 bits (44), Expect = 5e-14 Identities = 161/200 (80%) Strand = Plus / Minus Query: 384 ttcttcacaggctcttccttctctgacaagatcagctcaatgtggcaggggttggacatg 443 ||||| |||| |||||||||||| || || |||| |||||| |||||||||| ||||| Sbjct: 509 ttcttgacagactcttccttctcagataaaatcaactcaatatggcaggggtgagacata 450 Query: 444 taagggttgatgcgtccatgagcacggtacgtccggcgcctctgcttttgggcttggttc 503 || ||||| || | |||||| |||||||| || || || ||||| ||||| |||| ||| Sbjct: 449 taggggttaattcttccatgtgcacggtaggtacgacgtctctgtttttgagcttcattc 390 Query: 504 acctggatgtgtgaaatgtagaggttgtcgacatccaagcctttaacttcagcgttactc 563 || |||||||| || || || || || |||||||| ||||| || |||||||| ||| Sbjct: 389 acttggatgtgagatatataaagtgaatccacatccaaacctttcacctcagcgttgctc 330 Query: 564 tcagcattcttcagcaaatc 583 |||||||| || |||||||| Sbjct: 329 tcagcatttttgagcaaatc 310
>gb|DQ252494.1| Solanum tuberosum clone 063E12 ribosomal protein PETRP-like mRNA, complete cds Length = 760 Score = 87.7 bits (44), Expect = 5e-14 Identities = 161/200 (80%) Strand = Plus / Minus Query: 384 ttcttcacaggctcttccttctctgacaagatcagctcaatgtggcaggggttggacatg 443 ||||| |||| |||||||||||| || || |||| |||||| |||||||||| ||||| Sbjct: 520 ttcttgacagactcttccttctcagataaaatcaactcaatatggcaggggtgagacata 461 Query: 444 taagggttgatgcgtccatgagcacggtacgtccggcgcctctgcttttgggcttggttc 503 || ||||| || | ||| || |||||||| || || |||||||| ||||| |||| ||| Sbjct: 460 taggggttaattcttccgtgtgcacggtaggtacgacgcctctgtttttgagcttcattc 401 Query: 504 acctggatgtgtgaaatgtagaggttgtcgacatccaagcctttaacttcagcgttactc 563 || |||||||| || || || || || |||||||| ||||| || |||||||| ||| Sbjct: 400 acttggatgtgagatatataaagtgaatccacatccaaacctttcacctcagcgttgctc 341 Query: 564 tcagcattcttcagcaaatc 583 |||||||| || |||||||| Sbjct: 340 tcagcatttttgagcaaatc 321
>gb|AY310814.1| Nicotiana benthamiana clone 12-173 unknown mRNA Length = 202 Score = 85.7 bits (43), Expect = 2e-13 Identities = 105/126 (83%) Strand = Plus / Minus Query: 458 tccatgagcacggtacgtccggcgcctctgcttttgggcttggttcacctggatgtgtga 517 ||||||||| |||||||| ||||||||||| ||||| |||| ||||| |||||||| || Sbjct: 197 tccatgagctcggtacgtacggcgcctctgtttttgtgcttnattcacttggatgtgaga 138 Query: 518 aatgtagaggttgtcgacatccaagcctttaacttcagcgttactctcagcattcttcag 577 ||| | || || ||||||||||||||||| ||||| || |||||||||||||| || Sbjct: 137 tatgaaaagtgaatccacatccaagcctttaacctcagcattgctctcagcattcttgag 78 Query: 578 caaatc 583 ||||| Sbjct: 77 taaatc 72
>ref|XM_364349.1| Magnaporthe grisea 70-15 hypothetical protein (MG09194.4) partial mRNA Length = 561 Score = 83.8 bits (42), Expect = 7e-13 Identities = 84/98 (85%) Strand = Plus / Minus Query: 417 agctcaatgtggcaggggttggacatgtaagggttgatgcgtccatgagcacggtacgtc 476 ||||| |||||||||||| ||||||||||||||||| || || || |||||||||||| Sbjct: 443 agctcgatgtggcaggggcaagacatgtaagggttgatacgaccgtgggcacggtacgtc 384 Query: 477 cggcgcctctgcttttgggcttggttcacctggatgtg 514 ||||| | |||||| |||| ||||| ||||||||||| Sbjct: 383 cggcggcgctgcttgggggcctggttgacctggatgtg 346
>gb|AY849668.1| Magnaporthe grisea 60S ribosomal protein L17-like protein mRNA, complete cds Length = 1200 Score = 83.8 bits (42), Expect = 7e-13 Identities = 84/98 (85%) Strand = Plus / Minus Query: 417 agctcaatgtggcaggggttggacatgtaagggttgatgcgtccatgagcacggtacgtc 476 ||||| |||||||||||| ||||||||||||||||| || || || |||||||||||| Sbjct: 514 agctcgatgtggcaggggcaagacatgtaagggttgatacgaccgtgggcacggtacgtc 455 Query: 477 cggcgcctctgcttttgggcttggttcacctggatgtg 514 ||||| | |||||| |||| ||||| ||||||||||| Sbjct: 454 cggcggcgctgcttgggggcctggttgacctggatgtg 417
>gb|AY496096.1| Capsicum annuum ribosomal protein PETRP mRNA, complete cds Length = 765 Score = 79.8 bits (40), Expect = 1e-11 Identities = 154/192 (80%) Strand = Plus / Minus Query: 395 ctcttccttctctgacaagatcagctcaatgtggcaggggttggacatgtaagggttgat 454 |||||||||||| ||||| | || |||||| ||||| |||| ||||| || ||||| || Sbjct: 512 ctcttccttctcagacaataccaactcaatatggcaagggtgagacatataggggttaat 453 Query: 455 gcgtccatgagcacggtacgtccggcgcctctgcttttgggcttggttcacctggatgtg 514 | ||| || || ||||| || ||||||||||| ||||| || ||||| || |||||||| Sbjct: 452 tcttccgtgtgctcggtatgtgcggcgcctctgtttttgtgcctggtttacttggatgtg 393 Query: 515 tgaaatgtagaggttgtcgacatccaagcctttaacttcagcgttactctcagcattctt 574 || ||| | || || ||||||||||||||||| ||||| || ||||||||||| || Sbjct: 392 agatatgaaaagtgaatccacatccaagcctttaacctcagcattgctctcagcattttt 333 Query: 575 cagcaaatccag 586 || |||||||| Sbjct: 332 gagtaaatccag 321
>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete sequence Length = 22696651 Score = 77.8 bits (39), Expect = 4e-11 Identities = 51/55 (92%) Strand = Plus / Plus Query: 448 ggttgatgcgtccatgagcacggtacgtccggcgcctctgcttttgggcttggtt 502 ||||||||||||||||||||||||| || |||||||||||||| ||||| ||||| Sbjct: 4337323 ggttgatgcgtccatgagcacggtaggtacggcgcctctgcttctgggcctggtt 4337377 Score = 73.8 bits (37), Expect = 7e-10 Identities = 61/69 (88%) Strand = Plus / Plus Query: 379 cctccttcttcacaggctcttccttctctgacaagatcagctcaatgtggcaggggttgg 438 |||| |||||||| || |||||||||||||||| ||| |||||||||||||| ||| || Sbjct: 4337174 cctctttcttcactggttcttccttctctgacaggataagctcaatgtggcacggggagg 4337233 Query: 439 acatgtaag 447 ||||||||| Sbjct: 4337234 acatgtaag 4337242 Score = 56.0 bits (28), Expect = 2e-04 Identities = 85/104 (81%) Strand = Plus / Plus Query: 600 gactttgcaggccagcgaccctgcccatttggctggcggttctttacttgtgcagtacgg 659 ||||| ||||||||||| ||||| || |||| ||||| ||| |||| ||||| ||| Sbjct: 4337556 gacttggcaggccagcgtccctgaccgtttgaatggcgtgacttagcttgagcagtgcgg 4337615 Query: 660 cccacacctctgcagtatctacggaagggaattgcttgcttgtg 703 || ||||| | |||||| ||||||||||| || ||||||||||| Sbjct: 4337616 ccaacaccaccgcagtacctacggaaggggatagcttgcttgtg 4337659
>dbj|AP006441.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC clone:B1279D09 Length = 134793 Score = 77.8 bits (39), Expect = 4e-11 Identities = 51/55 (92%) Strand = Plus / Plus Query: 448 ggttgatgcgtccatgagcacggtacgtccggcgcctctgcttttgggcttggtt 502 ||||||||||||||||||||||||| || |||||||||||||| ||||| ||||| Sbjct: 40141 ggttgatgcgtccatgagcacggtaggtacggcgcctctgcttctgggcctggtt 40195 Score = 73.8 bits (37), Expect = 7e-10 Identities = 61/69 (88%) Strand = Plus / Plus Query: 379 cctccttcttcacaggctcttccttctctgacaagatcagctcaatgtggcaggggttgg 438 |||| |||||||| || |||||||||||||||| ||| |||||||||||||| ||| || Sbjct: 39992 cctctttcttcactggttcttccttctctgacaggataagctcaatgtggcacggggagg 40051 Query: 439 acatgtaag 447 ||||||||| Sbjct: 40052 acatgtaag 40060 Score = 56.0 bits (28), Expect = 2e-04 Identities = 85/104 (81%) Strand = Plus / Plus Query: 600 gactttgcaggccagcgaccctgcccatttggctggcggttctttacttgtgcagtacgg 659 ||||| ||||||||||| ||||| || |||| ||||| ||| |||| ||||| ||| Sbjct: 40374 gacttggcaggccagcgtccctgaccgtttgaatggcgtgacttagcttgagcagtgcgg 40433 Query: 660 cccacacctctgcagtatctacggaagggaattgcttgcttgtg 703 || ||||| | |||||| ||||||||||| || ||||||||||| Sbjct: 40434 ccaacaccaccgcagtacctacggaaggggatagcttgcttgtg 40477
>dbj|AP005589.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC clone:P0523B07 Length = 170510 Score = 77.8 bits (39), Expect = 4e-11 Identities = 51/55 (92%) Strand = Plus / Plus Query: 448 ggttgatgcgtccatgagcacggtacgtccggcgcctctgcttttgggcttggtt 502 ||||||||||||||||||||||||| || |||||||||||||| ||||| ||||| Sbjct: 161082 ggttgatgcgtccatgagcacggtaggtacggcgcctctgcttctgggcctggtt 161136 Score = 73.8 bits (37), Expect = 7e-10 Identities = 61/69 (88%) Strand = Plus / Plus Query: 379 cctccttcttcacaggctcttccttctctgacaagatcagctcaatgtggcaggggttgg 438 |||| |||||||| || |||||||||||||||| ||| |||||||||||||| ||| || Sbjct: 160933 cctctttcttcactggttcttccttctctgacaggataagctcaatgtggcacggggagg 160992 Query: 439 acatgtaag 447 ||||||||| Sbjct: 160993 acatgtaag 161001 Score = 56.0 bits (28), Expect = 2e-04 Identities = 85/104 (81%) Strand = Plus / Plus Query: 600 gactttgcaggccagcgaccctgcccatttggctggcggttctttacttgtgcagtacgg 659 ||||| ||||||||||| ||||| || |||| ||||| ||| |||| ||||| ||| Sbjct: 161315 gacttggcaggccagcgtccctgaccgtttgaatggcgtgacttagcttgagcagtgcgg 161374 Query: 660 cccacacctctgcagtatctacggaagggaattgcttgcttgtg 703 || ||||| | |||||| ||||||||||| || ||||||||||| Sbjct: 161375 ccaacaccaccgcagtacctacggaaggggatagcttgcttgtg 161418
>gb|AF076975.1|AF076975 Populus alba unknown mRNA, partial cds Length = 578 Score = 77.8 bits (39), Expect = 4e-11 Identities = 158/195 (81%), Gaps = 2/195 (1%) Strand = Plus / Minus Query: 419 ctcaatgtggcaggggttggacatgtaagggttgatgcgtccatgagcacggtacgtccg 478 |||||||||||| || | |||||||||||| || || | |||||| || ||||| || || Sbjct: 322 ctcaatgtggcaaggct-ggacatgtaaggattaattcttccatgcgc-cggtaagtacg 265 Query: 479 gcgcctctgcttttgggcttggttcacctggatgtgtgaaatgtagaggttgtcgacatc 538 || |||||||| || || || |||||||||||||| ||||||||||| || ||||| Sbjct: 264 acgtctctgcttctgtgcctgattcacctggatgtgagaaatgtagagtgcatccacatc 205 Query: 539 caagcctttaacttcagcgttactctcagcattcttcagcaaatccagcacgaactgggc 598 ||| || || || ||||| || ||||| |||||||| || |||||||| | ||||| ||| Sbjct: 204 caaacccttgacctcagcattgctctcggcattcttgagtaaatccaggatgaacttggc 145 Query: 599 cgactttgcaggcca 613 ||||| |||||||| Sbjct: 144 agacttggcaggcca 130
>ref|XM_653288.1| Aspergillus nidulans FGSC A4 hypothetical protein (AN0776.2), mRNA Length = 555 Score = 71.9 bits (36), Expect = 3e-09 Identities = 51/56 (91%) Strand = Plus / Minus Query: 417 agctcaatgtggcaggggttggacatgtaagggttgatgcgtccatgagcacggta 472 ||||| |||||||||||||||| ||||||||||||||| || || ||||||||||| Sbjct: 443 agctcgatgtggcaggggttggtcatgtaagggttgatacgaccgtgagcacggta 388
>gb|DQ235197.1| Solanum tuberosum clone 168G07 ribosomal protein PETRP-like mRNA, complete cds Length = 774 Score = 69.9 bits (35), Expect = 1e-08 Identities = 107/131 (81%) Strand = Plus / Minus Query: 384 ttcttcacaggctcttccttctctgacaagatcagctcaatgtggcaggggttggacatg 443 ||||| |||| |||||||||||| || || |||| |||||| |||||||||| ||||| Sbjct: 514 ttcttgacagactcttccttctcggataaaatcaactcaatatggcaggggtgagacata 455 Query: 444 taagggttgatgcgtccatgagcacggtacgtccggcgcctctgcttttgggcttggttc 503 || ||||| || | ||| || |||||||| || || |||||||| ||||| |||| ||| Sbjct: 454 taggggttaattcttccgtgtgcacggtaggtacgacgcctctgtttttgagcttcattc 395 Query: 504 acctggatgtg 514 || |||||||| Sbjct: 394 acttggatgtg 384
>ref|XM_747718.1| Aspergillus fumigatus Af293 60s ribosomal protein yL17-b (Afu1g14410) partial mRNA Length = 585 Score = 63.9 bits (32), Expect = 7e-07 Identities = 50/56 (89%) Strand = Plus / Minus Query: 417 agctcaatgtggcaggggttggacatgtaagggttgatgcgtccatgagcacggta 472 ||||| |||||||||||||||| |||||| |||||||| || || ||||||||||| Sbjct: 464 agctcgatgtggcaggggttggtcatgtaggggttgatacgaccgtgagcacggta 409
>emb|AL451014.1|NCB9B15 Neurospora crassa DNA linkage group V BAC clone B9B15 Length = 81650 Score = 60.0 bits (30), Expect = 1e-05 Identities = 36/38 (94%) Strand = Plus / Minus Query: 417 agctcaatgtggcaggggttggacatgtaagggttgat 454 ||||| ||||||||||||||||||||||| |||||||| Sbjct: 76796 agctcgatgtggcaggggttggacatgtaggggttgat 76759
>dbj|AB226154.1| Aspergillus oryzae cDNA, contig sequence: AoEST3012 Length = 1075 Score = 56.0 bits (28), Expect = 2e-04 Identities = 49/56 (87%) Strand = Plus / Minus Query: 417 agctcaatgtggcaggggttggacatgtaagggttgatgcgtccatgagcacggta 472 ||||| |||||||| ||||||| |||||| |||||||| || || ||||||||||| Sbjct: 501 agctcgatgtggcaagggttggtcatgtaggggttgatacgaccgtgagcacggta 446
>gb|AF306827.1|AF306827 Triticum monococcum subsp. monococcum clone 437 cytosolic acetyl-CoA carboxylase gene, partial cds Length = 1812 Score = 56.0 bits (28), Expect = 2e-04 Identities = 34/36 (94%) Strand = Plus / Minus Query: 13 ctctgttcctaaatataagacgttttgacagttcaa 48 |||||||||||||||||||||||||| |||||||| Sbjct: 764 ctctgttcctaaatataagacgtttttgcagttcaa 729 Score = 48.1 bits (24), Expect = 0.040 Identities = 33/36 (91%) Strand = Plus / Plus Query: 13 ctctgttcctaaatataagacgttttgacagttcaa 48 ||||||| |||||||||||||||||| |||||||| Sbjct: 692 ctctgtttctaaatataagacgtttttgcagttcaa 727
>gb|AF401571.1| Ictalurus punctatus ribosomal protein L17 mRNA, complete cds Length = 600 Score = 56.0 bits (28), Expect = 2e-04 Identities = 52/60 (86%) Strand = Plus / Minus Query: 413 gatcagctcaatgtggcaggggttggacatgtaagggttgatgcgtccatgagcacggta 472 ||||| |||||||||||||||| | |||||| |||||||||||||| || |||||||| Sbjct: 463 gatcatctcaatgtggcagggggagctcatgtaggggttgatgcgtccgtgggcacggta 404
>emb|AJ876806.1| Acanthamoeba polyphaga mRNA for putative ribosomal L17-like protein Length = 545 Score = 56.0 bits (28), Expect = 2e-04 Identities = 31/32 (96%) Strand = Plus / Minus Query: 423 atgtggcaggggttggacatgtaagggttgat 454 ||||||||||||||||||||||| |||||||| Sbjct: 423 atgtggcaggggttggacatgtaggggttgat 392
>gb|AY853172.1| Pectinaria gouldii ribosomal protein L17 mRNA, complete cds Length = 666 Score = 54.0 bits (27), Expect = 7e-04 Identities = 45/51 (88%) Strand = Plus / Minus Query: 416 cagctcaatgtggcaggggttggacatgtaagggttgatgcgtccatgagc 466 ||||||||||||||| ||| || |||||| ||||||||||| |||||||| Sbjct: 472 cagctcaatgtggcatgggctgctcatgtaggggttgatgcgaccatgagc 422
>gb|BC055097.1| Danio rerio zgc:65996, mRNA (cDNA clone MGC:65996 IMAGE:6792826), complete cds Length = 636 Score = 54.0 bits (27), Expect = 7e-04 Identities = 63/75 (84%) Strand = Plus / Minus Query: 440 catgtaagggttgatgcgtccatgagcacggtacgtccggcgcctctgcttttgggcttg 499 |||||| |||||||||||||| ||||| ||||| || || |||| | |||| |||| | Sbjct: 428 catgtaggggttgatgcgtccgtgagcgcggtaggtacgtcgccgcatctttggggcctt 369 Query: 500 gttcacctggatgtg 514 ||||||||||||||| Sbjct: 368 gttcacctggatgtg 354
>ref|NM_212760.1| Danio rerio zgc:65996 (zgc:65996), mRNA Length = 636 Score = 54.0 bits (27), Expect = 7e-04 Identities = 63/75 (84%) Strand = Plus / Minus Query: 440 catgtaagggttgatgcgtccatgagcacggtacgtccggcgcctctgcttttgggcttg 499 |||||| |||||||||||||| ||||| ||||| || || |||| | |||| |||| | Sbjct: 428 catgtaggggttgatgcgtccgtgagcgcggtaggtacgtcgccgcatctttggggcctt 369 Query: 500 gttcacctggatgtg 514 ||||||||||||||| Sbjct: 368 gttcacctggatgtg 354
>emb|BX649607.1| Aspergillus fumigatus BAC pilot project supercontig; segment 3/3 Length = 227448 Score = 52.0 bits (26), Expect = 0.003 Identities = 35/38 (92%) Strand = Plus / Minus Query: 417 agctcaatgtggcaggggttggacatgtaagggttgat 454 ||||| |||||||||||||||| |||||| |||||||| Sbjct: 202049 agctcgatgtggcaggggttggtcatgtaggggttgat 202012
>gb|AF306829.1|AF306829 Triticum urartu clone 581 cytosolic acetyl-CoA carboxylase gene, partial cds Length = 1812 Score = 52.0 bits (26), Expect = 0.003 Identities = 26/26 (100%) Strand = Plus / Minus Query: 13 ctctgttcctaaatataagacgtttt 38 |||||||||||||||||||||||||| Sbjct: 764 ctctgttcctaaatataagacgtttt 739 Score = 48.1 bits (24), Expect = 0.040 Identities = 33/36 (91%) Strand = Plus / Plus Query: 13 ctctgttcctaaatataagacgttttgacagttcaa 48 ||||||| |||||||||||||||||| |||||||| Sbjct: 692 ctctgtttctaaatataagacgtttttgcagttcaa 727
>gb|AF306828.1|AF306828 Triticum turgidum subsp. dicoccoides clone 465 cytosolic acetyl-CoA carboxylase gene, partial cds Length = 1836 Score = 52.0 bits (26), Expect = 0.003 Identities = 26/26 (100%) Strand = Plus / Minus Query: 13 ctctgttcctaaatataagacgtttt 38 |||||||||||||||||||||||||| Sbjct: 764 ctctgttcctaaatataagacgtttt 739
>gb|AF306826.1|AF306826 Triticum timopheevii subsp. armeniacum clone 506 cytosolic acetyl-CoA carboxylase gene, partial cds Length = 1797 Score = 52.0 bits (26), Expect = 0.003 Identities = 26/26 (100%) Strand = Plus / Plus Query: 13 ctctgttcctaaatataagacgtttt 38 |||||||||||||||||||||||||| Sbjct: 700 ctctgttcctaaatataagacgtttt 725
>gb|AF306825.1|AF306825 Triticum timopheevii subsp. timopheevii clone 513 cytosolic acetyl-CoA carboxylase gene, partial cds Length = 1796 Score = 52.0 bits (26), Expect = 0.003 Identities = 26/26 (100%) Strand = Plus / Plus Query: 13 ctctgttcctaaatataagacgtttt 38 |||||||||||||||||||||||||| Sbjct: 700 ctctgttcctaaatataagacgtttt 725
>gb|AF306824.1|AF306824 Triticum timopheevii subsp. armeniacum clone 453 cytosolic acetyl-CoA carboxylase gene, partial cds Length = 1812 Score = 52.0 bits (26), Expect = 0.003 Identities = 26/26 (100%) Strand = Plus / Minus Query: 13 ctctgttcctaaatataagacgtttt 38 |||||||||||||||||||||||||| Sbjct: 764 ctctgttcctaaatataagacgtttt 739 Score = 48.1 bits (24), Expect = 0.040 Identities = 33/36 (91%) Strand = Plus / Plus Query: 13 ctctgttcctaaatataagacgttttgacagttcaa 48 ||||||| |||||||||||||||||| |||||||| Sbjct: 692 ctctgtttctaaatataagacgtttttgcagttcaa 727
>gb|AY389972.1| Xenopus laevis ribosomal protein L17 mRNA, partial cds Length = 472 Score = 50.1 bits (25), Expect = 0.010 Identities = 31/33 (93%) Strand = Plus / Minus Query: 440 catgtaagggttgatgcgtccatgagcacggta 472 |||||| ||||||||||| |||||||||||||| Sbjct: 394 catgtaggggttgatgcgaccatgagcacggta 362
>gb|AY389929.1| Latimeria chalumnae ribosomal protein L17 mRNA, partial cds Length = 472 Score = 50.1 bits (25), Expect = 0.010 Identities = 31/33 (93%) Strand = Plus / Minus Query: 440 catgtaagggttgatgcgtccatgagcacggta 472 |||||||||||||||||| || ||||||||||| Sbjct: 394 catgtaagggttgatgcggccgtgagcacggta 362
>gb|DQ400416.1| Triticum aestivum starch synthase IV (SSIV) gene, complete cds Length = 7137 Score = 50.1 bits (25), Expect = 0.010 Identities = 31/33 (93%) Strand = Plus / Plus Query: 13 ctctgttcctaaatataagacgttttgacagtt 45 |||||||||||||| |||||||||||| ||||| Sbjct: 2812 ctctgttcctaaatgtaagacgttttggcagtt 2844
>gb|BC043971.1| Xenopus laevis similar to ribosomal protein L17, mRNA (cDNA clone IMAGE:5571114), partial cds Length = 627 Score = 50.1 bits (25), Expect = 0.010 Identities = 31/33 (93%) Strand = Plus / Minus Query: 440 catgtaagggttgatgcgtccatgagcacggta 472 |||||| ||||||||||| |||||||||||||| Sbjct: 431 catgtaggggttgatgcgaccatgagcacggta 399
>gb|BC053781.1| Xenopus laevis cDNA clone IMAGE:6876276, containing frame-shift errors Length = 651 Score = 50.1 bits (25), Expect = 0.010 Identities = 31/33 (93%) Strand = Plus / Minus Query: 440 catgtaagggttgatgcgtccatgagcacggta 472 |||||| ||||||||||| |||||||||||||| Sbjct: 450 catgtaggggttgatgcgaccatgagcacggta 418
>gb|DQ066273.1| Ixodes scapularis isolate is-all-clu554 ribosomal protein L17 mRNA, complete cds Length = 558 Score = 50.1 bits (25), Expect = 0.010 Identities = 55/65 (84%) Strand = Plus / Minus Query: 413 gatcagctcaatgtggcaggggttggacatgtaagggttgatgcgtccatgagcacggta 472 ||||| |||||||||||| ||| || |||||| |||||||||||||| || || ||||| Sbjct: 447 gatcacctcaatgtggcacgggctgctcatgtacgggttgatgcgtccgtgggcgcggta 388 Query: 473 cgtcc 477 |||| Sbjct: 387 ggtcc 383
>gb|AF459639.1| Triticum monococcum BAC clones 116F2 and 115G1 gene sequence Length = 215241 Score = 50.1 bits (25), Expect = 0.010 Identities = 28/29 (96%) Strand = Plus / Plus Query: 11 ctctctgttcctaaatataagacgttttg 39 ||||||||||||||||||| ||||||||| Sbjct: 32396 ctctctgttcctaaatatatgacgttttg 32424
>gb|AY439417.1| Armigeres subalbatus ASAP ID: 39833 cytosolic large ribosomal subunit L17 mRNA sequence Length = 671 Score = 48.1 bits (24), Expect = 0.040 Identities = 39/44 (88%) Strand = Plus / Minus Query: 438 gacatgtaagggttgatgcgtccatgagcacggtacgtccggcg 481 |||||||| || |||||||| ||||| ||||||||||| ||||| Sbjct: 457 gacatgtacggattgatgcgaccatgggcacggtacgtacggcg 414
>emb|AM049048.1| Carabus granulatus mRNA for ribosomal protein L17e (rpL17e gene) Length = 549 Score = 48.1 bits (24), Expect = 0.040 Identities = 42/48 (87%) Strand = Plus / Minus Query: 438 gacatgtaagggttgatgcgtccatgagcacggtacgtccggcgcctc 485 |||||||| |||||||| || || |||||||||||||| || |||||| Sbjct: 422 gacatgtacgggttgatacgaccgtgagcacggtacgtgcgtcgcctc 375
>gb|AC023722.4| Drosophila melanogaster X BAC RP98-48O24 (Roswell Park Cancer Institute Drosophila BAC Library) complete sequence Length = 191590 Score = 48.1 bits (24), Expect = 0.040 Identities = 39/44 (88%) Strand = Plus / Plus Query: 438 gacatgtaagggttgatgcgtccatgagcacggtacgtccggcg 481 |||||||| || |||||||| ||||| ||||||||||| ||||| Sbjct: 56271 gacatgtagggattgatgcgaccatgggcacggtacgtgcggcg 56314
>gb|AC023699.4| Drosophila melanogaster X BAC RP98-11K20 (Roswell Park Cancer Institute Drosophila BAC Library) complete sequence Length = 177941 Score = 48.1 bits (24), Expect = 0.040 Identities = 39/44 (88%) Strand = Plus / Plus Query: 438 gacatgtaagggttgatgcgtccatgagcacggtacgtccggcg 481 |||||||| || |||||||| ||||| ||||||||||| ||||| Sbjct: 160375 gacatgtagggattgatgcgaccatgggcacggtacgtgcggcg 160418
>ref|NM_167089.1| Drosophila melanogaster Ribosomal protein L17 CG3203-RC, transcript variant C (RpL17), mRNA Length = 919 Score = 48.1 bits (24), Expect = 0.040 Identities = 39/44 (88%) Strand = Plus / Minus Query: 438 gacatgtaagggttgatgcgtccatgagcacggtacgtccggcg 481 |||||||| || |||||||| ||||| ||||||||||| ||||| Sbjct: 540 gacatgtagggattgatgcgaccatgggcacggtacgtgcggcg 497
>ref|NM_167088.1| Drosophila melanogaster Ribosomal protein L17 CG3203-RB, transcript variant B (RpL17), mRNA Length = 873 Score = 48.1 bits (24), Expect = 0.040 Identities = 39/44 (88%) Strand = Plus / Minus Query: 438 gacatgtaagggttgatgcgtccatgagcacggtacgtccggcg 481 |||||||| || |||||||| ||||| ||||||||||| ||||| Sbjct: 494 gacatgtagggattgatgcgaccatgggcacggtacgtgcggcg 451
>ref|NM_167087.1| Drosophila melanogaster Ribosomal protein L17 CG3203-RA, transcript variant A (RpL17), mRNA Length = 837 Score = 48.1 bits (24), Expect = 0.040 Identities = 39/44 (88%) Strand = Plus / Minus Query: 438 gacatgtaagggttgatgcgtccatgagcacggtacgtccggcg 481 |||||||| || |||||||| ||||| ||||||||||| ||||| Sbjct: 458 gacatgtagggattgatgcgaccatgggcacggtacgtgcggcg 415
>ref|NM_132118.2| Drosophila melanogaster Ribosomal protein L17 CG3203-RD, transcript variant D (RpL17), mRNA Length = 1065 Score = 48.1 bits (24), Expect = 0.040 Identities = 39/44 (88%) Strand = Plus / Minus Query: 438 gacatgtaagggttgatgcgtccatgagcacggtacgtccggcg 481 |||||||| || |||||||| ||||| ||||||||||| ||||| Sbjct: 686 gacatgtagggattgatgcgaccatgggcacggtacgtgcggcg 643
>gb|AY060845.1| Drosophila melanogaster GM02242 full length cDNA Length = 885 Score = 48.1 bits (24), Expect = 0.040 Identities = 39/44 (88%) Strand = Plus / Minus Query: 438 gacatgtaagggttgatgcgtccatgagcacggtacgtccggcg 481 |||||||| || |||||||| ||||| ||||||||||| ||||| Sbjct: 686 gacatgtagggattgatgcgaccatgggcacggtacgtgcggcg 643
>gb|AE003438.3| Drosophila melanogaster chromosome X, section 22 of 74 of the complete sequence Length = 299943 Score = 48.1 bits (24), Expect = 0.040 Identities = 39/44 (88%) Strand = Plus / Plus Query: 438 gacatgtaagggttgatgcgtccatgagcacggtacgtccggcg 481 |||||||| || |||||||| ||||| ||||||||||| ||||| Sbjct: 202262 gacatgtagggattgatgcgaccatgggcacggtacgtgcggcg 202305
>gb|AY769286.1| Bombyx mori ribosomal protein L17 (RpL17) mRNA, complete cds Length = 620 Score = 46.1 bits (23), Expect = 0.16 Identities = 32/35 (91%) Strand = Plus / Minus Query: 438 gacatgtaagggttgatgcgtccatgagcacggta 472 |||||||| ||||||||||| || ||||||||||| Sbjct: 437 gacatgtaggggttgatgcgaccgtgagcacggta 403
>gb|BC049299.1| Danio rerio cDNA clone IMAGE:5914772, **** WARNING: chimeric clone **** Length = 1854 Score = 46.1 bits (23), Expect = 0.16 Identities = 62/75 (82%) Strand = Plus / Minus Query: 440 catgtaagggttgatgcgtccatgagcacggtacgtccggcgcctctgcttttgggcttg 499 |||||| |||||||||||||| ||||| ||||| || || |||| | |||| |||| | Sbjct: 1672 catgtaggggttgatgcgtccgtgagcgcggtaggtacgtcgccgcatctttggggcctt 1613 Query: 500 gttcacctggatgtg 514 ||| ||||||||||| Sbjct: 1612 gtttacctggatgtg 1598
>ref|XM_680042.1| PREDICTED: Danio rerio similar to Ribosomal protein L17 (LOC572750), mRNA Length = 631 Score = 46.1 bits (23), Expect = 0.16 Identities = 62/75 (82%) Strand = Plus / Minus Query: 440 catgtaagggttgatgcgtccatgagcacggtacgtccggcgcctctgcttttgggcttg 499 |||||| |||||||||||||| ||||| ||||| || || |||| | |||| |||| | Sbjct: 462 catgtaggggttgatgcgtccgtgagcgcggtaggtacgtcgccgcatctttggggcctt 403 Query: 500 gttcacctggatgtg 514 ||| ||||||||||| Sbjct: 402 gtttacctggatgtg 388
>emb|AL115613.1|CNS01CJP Botrytis cinerea strain T4 cDNA library Length = 720 Score = 46.1 bits (23), Expect = 0.16 Identities = 53/63 (84%) Strand = Plus / Minus Query: 410 caagatcagctcaatgtggcaggggttggacatgtaagggttgatgcgtccatgagcacg 469 |||||||| || |||||||| || || |||||||| |||||||| || || |||||||| Sbjct: 474 caagatcaattcgatgtggcaaggatttgacatgtatgggttgatacgaccgtgagcacg 415 Query: 470 gta 472 ||| Sbjct: 414 gta 412
>emb|AL114989.1|CNS01C2D Botrytis cinerea strain T4 cDNA library Length = 420 Score = 46.1 bits (23), Expect = 0.16 Identities = 53/63 (84%) Strand = Plus / Minus Query: 410 caagatcagctcaatgtggcaggggttggacatgtaagggttgatgcgtccatgagcacg 469 |||||||| || |||||||| || || |||||||| |||||||| || || |||||||| Sbjct: 198 caagatcaattcgatgtggcaaggatttgacatgtatgggttgatacgaccgtgagcacg 139 Query: 470 gta 472 ||| Sbjct: 138 gta 136
>emb|AL114758.1|CNS01BVY Botrytis cinerea strain T4 cDNA library Length = 840 Score = 46.1 bits (23), Expect = 0.16 Identities = 53/63 (84%) Strand = Plus / Minus Query: 410 caagatcagctcaatgtggcaggggttggacatgtaagggttgatgcgtccatgagcacg 469 |||||||| || |||||||| || || |||||||| |||||||| || || |||||||| Sbjct: 460 caagatcaattcgatgtggcaaggatttgacatgtatgggttgatacgaccgtgagcacg 401 Query: 470 gta 472 ||| Sbjct: 400 gta 398
>emb|AL114552.1|CNS01BQ8 Botrytis cinerea strain T4 cDNA library Length = 456 Score = 46.1 bits (23), Expect = 0.16 Identities = 53/63 (84%) Strand = Plus / Minus Query: 410 caagatcagctcaatgtggcaggggttggacatgtaagggttgatgcgtccatgagcacg 469 |||||||| || |||||||| || || |||||||| |||||||| || || |||||||| Sbjct: 200 caagatcaattcgatgtggcaaggatttgacatgtatgggttgatacgaccgtgagcacg 141 Query: 470 gta 472 ||| Sbjct: 140 gta 138
>emb|AL113871.1|CNS01B7B Botrytis cinerea strain T4 cDNA library Length = 600 Score = 46.1 bits (23), Expect = 0.16 Identities = 53/63 (84%) Strand = Plus / Minus Query: 410 caagatcagctcaatgtggcaggggttggacatgtaagggttgatgcgtccatgagcacg 469 |||||||| || |||||||| || || |||||||| |||||||| || || |||||||| Sbjct: 371 caagatcaattcgatgtggcaaggatttgacatgtatgggttgatacgaccgtgagcacg 312 Query: 470 gta 472 ||| Sbjct: 311 gta 309
>emb|AL113217.1|CNS01AP5 Botrytis cinerea strain T4 cDNA library Length = 516 Score = 46.1 bits (23), Expect = 0.16 Identities = 53/63 (84%) Strand = Plus / Minus Query: 410 caagatcagctcaatgtggcaggggttggacatgtaagggttgatgcgtccatgagcacg 469 |||||||| || |||||||| || || |||||||| |||||||| || || |||||||| Sbjct: 286 caagatcaattcgatgtggcaaggatttgacatgtatgggttgatacgaccgtgagcacg 227 Query: 470 gta 472 ||| Sbjct: 226 gta 224
>emb|AL113064.1|CNS01AKW Botrytis cinerea strain T4 cDNA library Length = 636 Score = 46.1 bits (23), Expect = 0.16 Identities = 53/63 (84%) Strand = Plus / Minus Query: 410 caagatcagctcaatgtggcaggggttggacatgtaagggttgatgcgtccatgagcacg 469 |||||||| || |||||||| || || |||||||| |||||||| || || |||||||| Sbjct: 454 caagatcaattcgatgtggcaaggatttgacatgtatgggttgatacgaccgtgagcacg 395 Query: 470 gta 472 ||| Sbjct: 394 gta 392
>emb|AL112375.1|CNS01A1R Botrytis cinerea strain T4 cDNA library Length = 660 Score = 46.1 bits (23), Expect = 0.16 Identities = 53/63 (84%) Strand = Plus / Minus Query: 410 caagatcagctcaatgtggcaggggttggacatgtaagggttgatgcgtccatgagcacg 469 |||||||| || |||||||| || || |||||||| |||||||| || || |||||||| Sbjct: 480 caagatcaattcgatgtggcaaggatttgacatgtatgggttgatacgaccgtgagcacg 421 Query: 470 gta 472 ||| Sbjct: 420 gta 418
>emb|AL112009.1|CNS019RL Botrytis cinerea strain T4 cDNA library Length = 636 Score = 46.1 bits (23), Expect = 0.16 Identities = 53/63 (84%) Strand = Plus / Minus Query: 410 caagatcagctcaatgtggcaggggttggacatgtaagggttgatgcgtccatgagcacg 469 |||||||| || |||||||| || || |||||||| |||||||| || || |||||||| Sbjct: 501 caagatcaattcgatgtggcaaggatttgacatgtatgggttgatacgaccgtgagcacg 442 Query: 470 gta 472 ||| Sbjct: 441 gta 439
>emb|AL111981.1|CNS019QT Botrytis cinerea strain T4 cDNA library Length = 636 Score = 46.1 bits (23), Expect = 0.16 Identities = 53/63 (84%) Strand = Plus / Minus Query: 410 caagatcagctcaatgtggcaggggttggacatgtaagggttgatgcgtccatgagcacg 469 |||||||| || |||||||| || || |||||||| |||||||| || || |||||||| Sbjct: 372 caagatcaattcgatgtggcaaggatttgacatgtatgggttgatacgaccgtgagcacg 313 Query: 470 gta 472 ||| Sbjct: 312 gta 310
>emb|AL111483.1|CNS019CZ Botrytis cinerea strain T4 cDNA library Length = 696 Score = 46.1 bits (23), Expect = 0.16 Identities = 53/63 (84%) Strand = Plus / Minus Query: 410 caagatcagctcaatgtggcaggggttggacatgtaagggttgatgcgtccatgagcacg 469 |||||||| || |||||||| || || |||||||| |||||||| || || |||||||| Sbjct: 461 caagatcaattcgatgtggcaaggatttgacatgtatgggttgatacgaccgtgagcacg 402 Query: 470 gta 472 ||| Sbjct: 401 gta 399
>emb|AL111872.1|CNS019NS Botrytis cinerea strain T4 cDNA library Length = 720 Score = 46.1 bits (23), Expect = 0.16 Identities = 53/63 (84%) Strand = Plus / Minus Query: 410 caagatcagctcaatgtggcaggggttggacatgtaagggttgatgcgtccatgagcacg 469 |||||||| || |||||||| || || |||||||| |||||||| || || |||||||| Sbjct: 461 caagatcaattcgatgtggcaaggatttgacatgtatgggttgatacgaccgtgagcacg 402 Query: 470 gta 472 ||| Sbjct: 401 gta 399
>emb|AL111750.1|CNS019KE Botrytis cinerea strain T4 cDNA library Length = 636 Score = 46.1 bits (23), Expect = 0.16 Identities = 53/63 (84%) Strand = Plus / Minus Query: 410 caagatcagctcaatgtggcaggggttggacatgtaagggttgatgcgtccatgagcacg 469 |||||||| || |||||||| || || |||||||| |||||||| || || |||||||| Sbjct: 480 caagatcaattcgatgtggcaaggatttgacatgtatgggttgatacgaccgtgagcacg 421 Query: 470 gta 472 ||| Sbjct: 420 gta 418
>emb|AL111381.1|CNS019A5 Botrytis cinerea strain T4 cDNA library Length = 660 Score = 46.1 bits (23), Expect = 0.16 Identities = 53/63 (84%) Strand = Plus / Minus Query: 410 caagatcagctcaatgtggcaggggttggacatgtaagggttgatgcgtccatgagcacg 469 |||||||| || |||||||| || || |||||||| |||||||| || || |||||||| Sbjct: 466 caagatcaattcgatgtggcaaggatttgacatgtatgggttgatacgaccgtgagcacg 407 Query: 470 gta 472 ||| Sbjct: 406 gta 404
>emb|AL110722.1|CNS018RV Botrytis cinerea strain T4 cDNA library Length = 660 Score = 46.1 bits (23), Expect = 0.16 Identities = 53/63 (84%) Strand = Plus / Minus Query: 410 caagatcagctcaatgtggcaggggttggacatgtaagggttgatgcgtccatgagcacg 469 |||||||| || |||||||| || || |||||||| |||||||| || || |||||||| Sbjct: 469 caagatcaattcgatgtggcaaggatttgacatgtatgggttgatacgaccgtgagcacg 410 Query: 470 gta 472 ||| Sbjct: 409 gta 407
>emb|AL110976.1|CNS018YX Botrytis cinerea strain T4 cDNA library Length = 660 Score = 46.1 bits (23), Expect = 0.16 Identities = 53/63 (84%) Strand = Plus / Minus Query: 410 caagatcagctcaatgtggcaggggttggacatgtaagggttgatgcgtccatgagcacg 469 |||||||| || |||||||| || || |||||||| |||||||| || || |||||||| Sbjct: 463 caagatcaattcgatgtggcaaggatttgacatgtatgggttgatacgaccgtgagcacg 404 Query: 470 gta 472 ||| Sbjct: 403 gta 401
>emb|BX000991.8| Zebrafish DNA sequence from clone CH211-203L7 in linkage group 6, complete sequence Length = 170966 Score = 46.1 bits (23), Expect = 0.16 Identities = 62/75 (82%) Strand = Plus / Plus Query: 440 catgtaagggttgatgcgtccatgagcacggtacgtccggcgcctctgcttttgggcttg 499 |||||| |||||||||||||| ||||| ||||| || || |||| | |||| |||| | Sbjct: 121973 catgtaggggttgatgcgtccgtgagcgcggtaggtacgtcgccgcatctttggggcctt 122032 Query: 500 gttcacctggatgtg 514 ||| ||||||||||| Sbjct: 122033 gtttacctggatgtg 122047
>emb|BX005111.4| Zebrafish DNA sequence from clone CH211-273E17 in linkage group 21, complete sequence Length = 169747 Score = 46.1 bits (23), Expect = 0.16 Identities = 62/75 (82%) Strand = Plus / Plus Query: 440 catgtaagggttgatgcgtccatgagcacggtacgtccggcgcctctgcttttgggcttg 499 |||||| |||||||||||||| ||||| ||||| || || |||| | |||| |||| | Sbjct: 5500 catgtaggggttgatgcgtccgtgagcgcggtaggtacgtcgccgcatctttggggcctt 5559 Query: 500 gttcacctggatgtg 514 ||| ||||||||||| Sbjct: 5560 gtttacctggatgtg 5574
>gb|BC106165.1| Mus musculus ribosomal protein L17, mRNA (cDNA clone MGC:118163 IMAGE:5007649), complete cds Length = 623 Score = 44.1 bits (22), Expect = 0.63 Identities = 25/26 (96%) Strand = Plus / Minus Query: 546 ttaacttcagcgttactctcagcatt 571 |||| ||||||||||||||||||||| Sbjct: 333 ttaagttcagcgttactctcagcatt 308
>gb|AC115026.16| Mus musculus chromosome 1, clone RP24-238A19, complete sequence Length = 191726 Score = 44.1 bits (22), Expect = 0.63 Identities = 25/26 (96%) Strand = Plus / Minus Query: 546 ttaacttcagcgttactctcagcatt 571 |||| ||||||||||||||||||||| Sbjct: 12227 ttaagttcagcgttactctcagcatt 12202
>gb|AC114629.12| Mus musculus chromosome 1, clone RP24-111F20, complete sequence Length = 178437 Score = 44.1 bits (22), Expect = 0.63 Identities = 25/26 (96%) Strand = Plus / Minus Query: 546 ttaacttcagcgttactctcagcatt 571 |||| ||||||||||||||||||||| Sbjct: 117567 ttaagttcagcgttactctcagcatt 117542
>ref|XM_493847.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1128 Score = 44.1 bits (22), Expect = 0.63 Identities = 22/22 (100%) Strand = Plus / Minus Query: 479 gcgcctctgcttttgggcttgg 500 |||||||||||||||||||||| Sbjct: 36 gcgcctctgcttttgggcttgg 15
>gb|AC123713.13| Mus musculus chromosome 7, clone RP23-391D20, complete sequence Length = 183590 Score = 44.1 bits (22), Expect = 0.63 Identities = 25/26 (96%) Strand = Plus / Plus Query: 546 ttaacttcagcgttactctcagcatt 571 |||| ||||||||||||||||||||| Sbjct: 118909 ttaagttcagcgttactctcagcatt 118934
>ref|XM_864148.1| PREDICTED: Bos taurus similar to 60S ribosomal protein L17 (L23) (Amino acid starvation-induced protein) (ASI) (LOC613402), mRNA Length = 623 Score = 44.1 bits (22), Expect = 0.63 Identities = 34/38 (89%) Strand = Plus / Minus Query: 534 acatccaagcctttaacttcagcgttactctcagcatt 571 ||||| ||||| |||| ||||||||||||||| ||||| Sbjct: 348 acatctaagcccttaagttcagcgttactctctgcatt 311
>gb|BC054424.1| Mus musculus ribosomal protein L17, mRNA (cDNA clone MGC:62665 IMAGE:5011645), complete cds Length = 623 Score = 44.1 bits (22), Expect = 0.63 Identities = 25/26 (96%) Strand = Plus / Minus Query: 546 ttaacttcagcgttactctcagcatt 571 |||| ||||||||||||||||||||| Sbjct: 337 ttaagttcagcgttactctcagcatt 312
>gb|AC132486.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone P0473H02, complete sequence Length = 141027 Score = 44.1 bits (22), Expect = 0.63 Identities = 22/22 (100%) Strand = Plus / Plus Query: 11 ctctctgttcctaaatataaga 32 |||||||||||||||||||||| Sbjct: 82904 ctctctgttcctaaatataaga 82925
>gb|AC160540.7| Mus musculus chromosome 7, clone RP23-44O19, complete sequence Length = 221807 Score = 44.1 bits (22), Expect = 0.63 Identities = 25/26 (96%) Strand = Plus / Minus Query: 546 ttaacttcagcgttactctcagcatt 571 |||| ||||||||||||||||||||| Sbjct: 4951 ttaagttcagcgttactctcagcatt 4926
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 Length = 36102668 Score = 44.1 bits (22), Expect = 0.63 Identities = 22/22 (100%) Strand = Plus / Plus Query: 479 gcgcctctgcttttgggcttgg 500 |||||||||||||||||||||| Sbjct: 9699444 gcgcctctgcttttgggcttgg 9699465
>gb|AC147243.2| Mus musculus BAC clone RP23-444P22 from chromosome 6, complete sequence Length = 181025 Score = 44.1 bits (22), Expect = 0.63 Identities = 34/38 (89%) Strand = Plus / Minus Query: 534 acatccaagcctttaacttcagcgttactctcagcatt 571 ||||| || ||||||| ||||||||||||||| ||||| Sbjct: 178325 acatctaaacctttaagttcagcgttactctctgcatt 178288
>ref|XR_002222.1| PREDICTED: Mus musculus hypothetical LOC638052 (LOC638052), mRNA Length = 588 Score = 44.1 bits (22), Expect = 0.63 Identities = 25/26 (96%) Strand = Plus / Minus Query: 546 ttaacttcagcgttactctcagcatt 571 |||| ||||||||||||||||||||| Sbjct: 305 ttaagttcagcgttactctcagcatt 280
>gb|AC125122.4| Mus musculus BAC clone RP24-269O4 from chromosome 18, complete sequence Length = 173614 Score = 44.1 bits (22), Expect = 0.63 Identities = 25/26 (96%) Strand = Plus / Plus Query: 546 ttaacttcagcgttactctcagcatt 571 |||| ||||||||||||||||||||| Sbjct: 49229 ttaagttcagcgttactctcagcatt 49254
>gb|AC125175.4| Mus musculus BAC clone RP24-572I8 from chromosome 6, complete sequence Length = 167991 Score = 44.1 bits (22), Expect = 0.63 Identities = 34/38 (89%) Strand = Plus / Minus Query: 534 acatccaagcctttaacttcagcgttactctcagcatt 571 ||||| || ||||||| ||||||||||||||| ||||| Sbjct: 49180 acatctaaacctttaagttcagcgttactctctgcatt 49143
>emb|AM049046.1| Agriotes lineatus mRNA for ribosomal protein L17e (rpL17e gene) Length = 567 Score = 44.1 bits (22), Expect = 0.63 Identities = 34/38 (89%) Strand = Plus / Minus Query: 438 gacatgtaagggttgatgcgtccatgagcacggtacgt 475 ||||||||||||||||| | ||||| ||||||||||| Sbjct: 422 gacatgtaagggttgatcctaccatgggcacggtacgt 385
>ref|XM_849460.1| PREDICTED: Canis familiaris similar to 60S ribosomal protein L17 (L23) (LOC611750), mRNA Length = 525 Score = 44.1 bits (22), Expect = 0.63 Identities = 22/22 (100%) Strand = Plus / Minus Query: 493 gggcttggttcacctggatgtg 514 |||||||||||||||||||||| Sbjct: 355 gggcttggttcacctggatgtg 334
>gb|BC003896.1| Mus musculus ribosomal protein L17, mRNA (cDNA clone IMAGE:3594373), partial cds Length = 639 Score = 44.1 bits (22), Expect = 0.63 Identities = 25/26 (96%) Strand = Plus / Minus Query: 546 ttaacttcagcgttactctcagcatt 571 |||| ||||||||||||||||||||| Sbjct: 346 ttaagttcagcgttactctcagcatt 321
>gb|AC084405.6| Oryza sativa chromosome 3 BAC OSJNBa0044H10 genomic sequence, complete sequence Length = 165113 Score = 44.1 bits (22), Expect = 0.63 Identities = 22/22 (100%) Strand = Plus / Plus Query: 479 gcgcctctgcttttgggcttgg 500 |||||||||||||||||||||| Sbjct: 120343 gcgcctctgcttttgggcttgg 120364
>dbj|AK137077.1| Mus musculus 12 days embryo embryonic body between diaphragm region and neck cDNA, RIKEN full-length enriched library, clone:9430063I05 product:ribosomal protein L17, full insert sequence Length = 622 Score = 44.1 bits (22), Expect = 0.63 Identities = 25/26 (96%) Strand = Plus / Minus Query: 546 ttaacttcagcgttactctcagcatt 571 |||| ||||||||||||||||||||| Sbjct: 351 ttaagttcagcgttactctcagcatt 326
>gb|AE016818.1| Ashbya gossypii (= Eremothecium gossypii) ATCC 10895 chromosome V, complete sequence Length = 1519138 Score = 44.1 bits (22), Expect = 0.63 Identities = 31/34 (91%) Strand = Plus / Minus Query: 486 tgcttttgggcttggttcacctggatgtgtgaaa 519 |||||| |||| ||||||||||||||||| |||| Sbjct: 367057 tgctttggggcgtggttcacctggatgtgggaaa 367024
>gb|AC159622.2| Mus musculus BAC clone RP24-289D12 from chromosome 12, complete sequence Length = 174662 Score = 44.1 bits (22), Expect = 0.63 Identities = 25/26 (96%) Strand = Plus / Plus Query: 546 ttaacttcagcgttactctcagcatt 571 |||| ||||||||||||||||||||| Sbjct: 60511 ttaagttcagcgttactctcagcatt 60536
>dbj|AK088443.1| Mus musculus 2 days neonate thymus thymic cells cDNA, RIKEN full-length enriched library, clone:E430016L24 product:ribosomal protein L17, full insert sequence Length = 624 Score = 44.1 bits (22), Expect = 0.63 Identities = 25/26 (96%) Strand = Plus / Minus Query: 546 ttaacttcagcgttactctcagcatt 571 |||| ||||||||||||||||||||| Sbjct: 353 ttaagttcagcgttactctcagcatt 328
>dbj|AK002770.1| Mus musculus adult male kidney cDNA, RIKEN full-length enriched library, clone:0610037F23 product:ribosomal protein L17, full insert sequence Length = 628 Score = 44.1 bits (22), Expect = 0.63 Identities = 25/26 (96%) Strand = Plus / Minus Query: 546 ttaacttcagcgttactctcagcatt 571 |||| ||||||||||||||||||||| Sbjct: 350 ttaagttcagcgttactctcagcatt 325
>dbj|AK011133.1| Mus musculus 10 days embryo whole body cDNA, RIKEN full-length enriched library, clone:2600001G14 product:ribosomal protein L17, full insert sequence Length = 731 Score = 44.1 bits (22), Expect = 0.63 Identities = 25/26 (96%) Strand = Plus / Minus Query: 546 ttaacttcagcgttactctcagcatt 571 |||| ||||||||||||||||||||| Sbjct: 350 ttaagttcagcgttactctcagcatt 325
>dbj|AK011132.1| Mus musculus 10 days embryo whole body cDNA, RIKEN full-length enriched library, clone:2600001G12 product:ribosomal protein L17, full insert sequence Length = 731 Score = 44.1 bits (22), Expect = 0.63 Identities = 25/26 (96%) Strand = Plus / Minus Query: 546 ttaacttcagcgttactctcagcatt 571 |||| ||||||||||||||||||||| Sbjct: 350 ttaagttcagcgttactctcagcatt 325
>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete sequence Length = 29737217 Score = 44.1 bits (22), Expect = 0.63 Identities = 22/22 (100%) Strand = Plus / Plus Query: 11 ctctctgttcctaaatataaga 32 |||||||||||||||||||||| Sbjct: 5760530 ctctctgttcctaaatataaga 5760551
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete sequence Length = 36192742 Score = 44.1 bits (22), Expect = 0.63 Identities = 22/22 (100%) Strand = Plus / Plus Query: 479 gcgcctctgcttttgggcttgg 500 |||||||||||||||||||||| Sbjct: 9697565 gcgcctctgcttttgggcttgg 9697586
>gb|BC094640.1| Mus musculus ribosomal protein L17, mRNA (cDNA clone IMAGE:1332253), partial cds Length = 605 Score = 44.1 bits (22), Expect = 0.63 Identities = 25/26 (96%) Strand = Plus / Minus Query: 546 ttaacttcagcgttactctcagcatt 571 |||| ||||||||||||||||||||| Sbjct: 317 ttaagttcagcgttactctcagcatt 292
>gb|AY130352.1| Petromyzon marinus ribosomal protein L17 mRNA, partial cds Length = 472 Score = 44.1 bits (22), Expect = 0.63 Identities = 40/46 (86%) Strand = Plus / Minus Query: 440 catgtaagggttgatgcgtccatgagcacggtacgtccggcgcctc 485 |||||| ||||||||||| || || || |||||||| ||||||||| Sbjct: 394 catgtaggggttgatgcggccgtgcgcgcggtacgtgcggcgcctc 349
>gb|AF204176.2|AF204176 Mus musculus chromosome 10 popeye protein 3 (Pop3) mRNA, complete cds Length = 2376 Score = 44.1 bits (22), Expect = 0.63 Identities = 25/26 (96%) Strand = Plus / Minus Query: 546 ttaacttcagcgttactctcagcatt 571 |||| ||||||||||||||||||||| Sbjct: 350 ttaagttcagcgttactctcagcatt 325
>dbj|AK179773.1| Mus musculus cDNA, clone:Y0G0111K14, strand:minus, reference:ENSEMBL:Mouse-Transcript- ENST:ENSMUST00000070455, based on BLAT search Length = 278 Score = 44.1 bits (22), Expect = 0.63 Identities = 25/26 (96%) Strand = Plus / Minus Query: 546 ttaacttcagcgttactctcagcatt 571 |||| ||||||||||||||||||||| Sbjct: 267 ttaagttcagcgttactctcagcatt 242
>gb|BC091759.1| Mus musculus ribosomal protein L17, mRNA (cDNA clone MGC:103267 IMAGE:4982640), complete cds Length = 672 Score = 44.1 bits (22), Expect = 0.63 Identities = 25/26 (96%) Strand = Plus / Minus Query: 546 ttaacttcagcgttactctcagcatt 571 |||| ||||||||||||||||||||| Sbjct: 383 ttaagttcagcgttactctcagcatt 358
>dbj|AK110522.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-167-H04, full insert sequence Length = 944 Score = 44.1 bits (22), Expect = 0.63 Identities = 52/62 (83%) Strand = Plus / Minus Query: 417 agctcaatgtggcaggggttggacatgtaagggttgatgcgtccatgagcacggtacgtc 476 ||||| ||||||||||| |||||||| |||||||| || || || |||||||||||| Sbjct: 501 agctcgatgtggcagggcgacgacatgtaggggttgatacgaccgtgggcacggtacgtc 442 Query: 477 cg 478 || Sbjct: 441 cg 440
>ref|NM_210078.1| Eremothecium gossypii AEL137Wp (AEL137W), mRNA Length = 555 Score = 44.1 bits (22), Expect = 0.63 Identities = 31/34 (91%) Strand = Plus / Minus Query: 486 tgcttttgggcttggttcacctggatgtgtgaaa 519 |||||| |||| ||||||||||||||||| |||| Sbjct: 374 tgctttggggcgtggttcacctggatgtgggaaa 341
>gb|AC136516.3| Mus musculus BAC clone RP23-223E24 from 7, complete sequence Length = 179611 Score = 44.1 bits (22), Expect = 0.63 Identities = 25/26 (96%) Strand = Plus / Plus Query: 546 ttaacttcagcgttactctcagcatt 571 |||| ||||||||||||||||||||| Sbjct: 57282 ttaagttcagcgttactctcagcatt 57307
>emb|AL732365.17| Mouse DNA sequence from clone RP23-357O2 on chromosome X, complete sequence Length = 192659 Score = 44.1 bits (22), Expect = 0.63 Identities = 25/26 (96%) Strand = Plus / Minus Query: 546 ttaacttcagcgttactctcagcatt 571 |||| ||||||||||||||||||||| Sbjct: 76073 ttaagttcagcgttactctcagcatt 76048
>gb|BC090401.1| Mus musculus cDNA clone IMAGE:5253366, containing frame-shift errors Length = 608 Score = 44.1 bits (22), Expect = 0.63 Identities = 25/26 (96%) Strand = Plus / Minus Query: 546 ttaacttcagcgttactctcagcatt 571 |||| ||||||||||||||||||||| Sbjct: 321 ttaagttcagcgttactctcagcatt 296
>ref|NM_001002239.1| Mus musculus ribosomal protein L17 (Rpl17), mRNA Length = 731 Score = 44.1 bits (22), Expect = 0.63 Identities = 25/26 (96%) Strand = Plus / Minus Query: 546 ttaacttcagcgttactctcagcatt 571 |||| ||||||||||||||||||||| Sbjct: 350 ttaagttcagcgttactctcagcatt 325
>gb|BC090990.1| Mus musculus ribosomal protein L17, mRNA (cDNA clone MGC:107305 IMAGE:30297115), complete cds Length = 650 Score = 44.1 bits (22), Expect = 0.63 Identities = 25/26 (96%) Strand = Plus / Minus Query: 546 ttaacttcagcgttactctcagcatt 571 |||| ||||||||||||||||||||| Sbjct: 349 ttaagttcagcgttactctcagcatt 324
>gb|BC092091.1| Mus musculus ribosomal protein L17, mRNA (cDNA clone MGC:103289 IMAGE:5252962), complete cds Length = 643 Score = 44.1 bits (22), Expect = 0.63 Identities = 25/26 (96%) Strand = Plus / Minus Query: 546 ttaacttcagcgttactctcagcatt 571 |||| ||||||||||||||||||||| Sbjct: 337 ttaagttcagcgttactctcagcatt 312
>gb|AC112259.4| Mus musculus BAC clone RP23-179F7 from 12, complete sequence Length = 190525 Score = 44.1 bits (22), Expect = 0.63 Identities = 25/26 (96%) Strand = Plus / Minus Query: 546 ttaacttcagcgttactctcagcatt 571 |||| ||||||||||||||||||||| Sbjct: 4522 ttaagttcagcgttactctcagcatt 4497
>gb|AC147029.3| Mus musculus BAC clone RP23-239P5 from 12, complete sequence Length = 194385 Score = 44.1 bits (22), Expect = 0.63 Identities = 25/26 (96%) Strand = Plus / Minus Query: 546 ttaacttcagcgttactctcagcatt 571 |||| ||||||||||||||||||||| Sbjct: 179501 ttaagttcagcgttactctcagcatt 179476
>gb|BC077192.1| Xenopus laevis MGC78885 protein, mRNA (cDNA clone MGC:78885 IMAGE:4174034), complete cds Length = 678 Score = 42.1 bits (21), Expect = 2.5 Identities = 30/33 (90%) Strand = Plus / Minus Query: 440 catgtaagggttgatgcgtccatgagcacggta 472 |||||| ||||||||||| |||||||| ||||| Sbjct: 443 catgtaggggttgatgcgaccatgagcgcggta 411
>gb|AY389930.1| Protopterus dolloi ribosomal protein L17 mRNA, partial cds Length = 472 Score = 42.1 bits (21), Expect = 2.5 Identities = 30/33 (90%) Strand = Plus / Minus Query: 440 catgtaagggttgatgcgtccatgagcacggta 472 ||||||||||||||| || ||||| |||||||| Sbjct: 394 catgtaagggttgattcggccatgggcacggta 362
>ref|XM_757044.1| Ustilago maydis 521 hypothetical protein (UM05990.1) partial mRNA Length = 699 Score = 42.1 bits (21), Expect = 2.5 Identities = 30/33 (90%) Strand = Plus / Minus Query: 443 gtaagggttgatgcgtccatgagcacggtacgt 475 |||||||||||| || || |||||||||||||| Sbjct: 555 gtaagggttgatacgaccgtgagcacggtacgt 523
>emb|AL360269.21| Human DNA sequence from clone RP11-192I3 on chromosome 1 Contains the WNT9A gene for wingless-type MMTV integration site family, member 9A and a CpG island, complete sequence Length = 141703 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 495 gcttggttcacctggatgtgt 515 ||||||||||||||||||||| Sbjct: 3559 gcttggttcacctggatgtgt 3539
>emb|AL158040.14| Human DNA sequence from clone RP11-360G10 on chromosome 10 Contains the 5' end of the gene for KIAA0940 protein, a succinate dehydrogenase complex pseudogene, the 5' end of a novel gene (FLJ20445), a nucleolar protein family A member 2 pseudogene 1 (NOLA2P1) and a CpG island, complete sequence Length = 213648 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 245 ggtaccaaaaacatctaggag 265 ||||||||||||||||||||| Sbjct: 39925 ggtaccaaaaacatctaggag 39945
>gb|AC101789.9| Mus musculus chromosome 1, clone RP24-150F11, complete sequence Length = 150474 Score = 42.1 bits (21), Expect = 2.5 Identities = 27/29 (93%) Strand = Plus / Minus Query: 543 cctttaacttcagcgttactctcagcatt 571 |||||||||||||| |||||||| ||||| Sbjct: 44907 cctttaacttcagcattactctctgcatt 44879
>gb|AC158587.3| Mus musculus chromosome 7, clone RP24-156F13, complete sequence Length = 152262 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 418 gctcaatgtggcaggggttgg 438 ||||||||||||||||||||| Sbjct: 10699 gctcaatgtggcaggggttgg 10679
>gb|AC154880.17| Mus musculus chromosome 15, clone RP24-191N3, complete sequence Length = 184220 Score = 42.1 bits (21), Expect = 2.5 Identities = 30/33 (90%) Strand = Plus / Minus Query: 380 ctccttcttcacaggctcttccttctctgacaa 412 ||||| ||||| |||||||||||||| |||||| Sbjct: 26116 ctcctccttcagaggctcttccttctgtgacaa 26084
>gb|AC123698.15| Mus musculus chromosome 15, clone RP23-331P14, complete sequence Length = 201739 Score = 40.1 bits (20), Expect = 9.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 51 aaaaagtggatcattcaaagcaac 74 ||||||||||| |||||||||||| Sbjct: 137515 aaaaagtggataattcaaagcaac 137538
>gb|AY833083.1| Taeniopygia guttata ribosomal protein L17 mRNA, complete cds Length = 633 Score = 40.1 bits (20), Expect = 9.8 Identities = 26/28 (92%) Strand = Plus / Minus Query: 552 tcagcgttactctcagcattcttcagca 579 |||||||| ||||| ||||||||||||| Sbjct: 325 tcagcgttgctctctgcattcttcagca 298
>gb|DQ214552.1| Taeniopygia guttata clone 0058P0043B12 ribosomal protein L17 variant 2-like mRNA, complete sequence Length = 753 Score = 40.1 bits (20), Expect = 9.8 Identities = 26/28 (92%) Strand = Plus / Minus Query: 552 tcagcgttactctcagcattcttcagca 579 |||||||| ||||| ||||||||||||| Sbjct: 447 tcagcgttgctctctgcattcttcagca 420
>gb|DQ214551.1| Taeniopygia guttata clone 0058P0013B11 ribosomal protein L17 variant 1-like mRNA, complete sequence Length = 651 Score = 40.1 bits (20), Expect = 9.8 Identities = 26/28 (92%) Strand = Plus / Minus Query: 552 tcagcgttactctcagcattcttcagca 579 |||||||| ||||| ||||||||||||| Sbjct: 346 tcagcgttgctctctgcattcttcagca 319
>ref|XM_592636.2| PREDICTED: Bos taurus similar to Microtubule-associated protein 1B (MAP 1B), transcript variant 1 (LOC514739), mRNA Length = 7737 Score = 40.1 bits (20), Expect = 9.8 Identities = 26/28 (92%) Strand = Plus / Minus Query: 378 gcctccttcttcacaggctcttccttct 405 ||||| ||||| |||||||||||||||| Sbjct: 2316 gcctctttcttgacaggctcttccttct 2289
>ref|XM_871792.1| PREDICTED: Bos taurus similar to Microtubule-associated protein 1B (MAP 1B), transcript variant 5 (LOC514739), mRNA Length = 7807 Score = 40.1 bits (20), Expect = 9.8 Identities = 26/28 (92%) Strand = Plus / Minus Query: 378 gcctccttcttcacaggctcttccttct 405 ||||| ||||| |||||||||||||||| Sbjct: 2386 gcctctttcttgacaggctcttccttct 2359
>ref|XM_871695.1| PREDICTED: Bos taurus similar to Microtubule-associated protein 1B (MAP 1B), transcript variant 4 (LOC514739), mRNA Length = 7762 Score = 40.1 bits (20), Expect = 9.8 Identities = 26/28 (92%) Strand = Plus / Minus Query: 378 gcctccttcttcacaggctcttccttct 405 ||||| ||||| |||||||||||||||| Sbjct: 2341 gcctctttcttgacaggctcttccttct 2314
>ref|XM_871601.1| PREDICTED: Bos taurus similar to Microtubule-associated protein 1B (MAP 1B), transcript variant 3 (LOC514739), mRNA Length = 7812 Score = 40.1 bits (20), Expect = 9.8 Identities = 26/28 (92%) Strand = Plus / Minus Query: 378 gcctccttcttcacaggctcttccttct 405 ||||| ||||| |||||||||||||||| Sbjct: 2391 gcctctttcttgacaggctcttccttct 2364
>ref|XM_863836.1| PREDICTED: Bos taurus similar to Microtubule-associated protein 1B (MAP 1B), transcript variant 2 (LOC514739), mRNA Length = 7957 Score = 40.1 bits (20), Expect = 9.8 Identities = 26/28 (92%) Strand = Plus / Minus Query: 378 gcctccttcttcacaggctcttccttct 405 ||||| ||||| |||||||||||||||| Sbjct: 2536 gcctctttcttgacaggctcttccttct 2509
>ref|XM_584664.2| PREDICTED: Bos taurus similar to 60S ribosomal protein L17 (L23) (Amino acid starvation-induced protein) (ASI) (LOC507961), mRNA Length = 590 Score = 40.1 bits (20), Expect = 9.8 Identities = 77/96 (80%) Strand = Plus / Minus Query: 419 ctcaatgtggcaggggttggacatgtaagggttgatgcgtccatgagcacggtacgtccg 478 ||||||||||||||| | |||||| |||||||| || || ||||| | ||| |||| Sbjct: 457 ctcaatgtggcagggagagctcatgtaggggttgatccgaccgtgagctctgtaagtcct 398 Query: 479 gcgcctctgcttttgggcttggttcacctggatgtg 514 ||||| | ||| |||||| ||||||||||||||| Sbjct: 397 gcgccgcatcttgggggctttgttcacctggatgtg 362
>gb|AC124669.8| Mus musculus chromosome 1, clone RP23-110B5, complete sequence Length = 201456 Score = 40.1 bits (20), Expect = 9.8 Identities = 29/32 (90%) Strand = Plus / Plus Query: 540 aagcctttaacttcagcgttactctcagcatt 571 ||||| |||| ||||||||||||||| ||||| Sbjct: 115419 aagcccttaagttcagcgttactctctgcatt 115450
>emb|CR318599.18| Zebrafish DNA sequence from clone DKEY-28D5 in linkage group 22, complete sequence Length = 222575 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 172 agttttagcatatataaaga 191 |||||||||||||||||||| Sbjct: 52588 agttttagcatatataaaga 52607
>gb|AC125076.4| Mus musculus BAC clone RP23-472F9 from chromosome 2, complete sequence Length = 165496 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 85 attgccaaactcttaagtgt 104 |||||||||||||||||||| Sbjct: 163185 attgccaaactcttaagtgt 163204
>gb|AY232017.1| Drosophila yakuba clone yak-ad_CG3203 mRNA sequence Length = 465 Score = 40.1 bits (20), Expect = 9.8 Identities = 38/44 (86%) Strand = Plus / Minus Query: 438 gacatgtaagggttgatgcgtccatgagcacggtacgtccggcg 481 |||||||| || |||||||| || || ||||||||||| ||||| Sbjct: 422 gacatgtagggattgatgcgaccgtgggcacggtacgtgcggcg 379
>gb|AY231666.1| Drosophila yakuba clone yak-em_CG3203 mRNA sequence Length = 558 Score = 40.1 bits (20), Expect = 9.8 Identities = 38/44 (86%) Strand = Plus / Minus Query: 438 gacatgtaagggttgatgcgtccatgagcacggtacgtccggcg 481 |||||||| || |||||||| || || ||||||||||| ||||| Sbjct: 422 gacatgtagggattgatgcgaccgtgggcacggtacgtgcggcg 379
>gb|AC155344.1| Brassica rapa subsp. pekinensis clone KBrH080A08, complete sequence Length = 110038 Score = 40.1 bits (20), Expect = 9.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 14 tctgttcctaaatataagacgttt 37 ||||||||||||||||||| |||| Sbjct: 31592 tctgttcctaaatataagatgttt 31615
>gb|AC184177.1| Pan troglodytes BAC clone CH251-641A13 from chromosome 4, complete sequence Length = 13843 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 53 aaagtggatcattcaaagca 72 |||||||||||||||||||| Sbjct: 172 aaagtggatcattcaaagca 191
>emb|BX072428.1|CNS09S1S Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAD1BD05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 700 Score = 40.1 bits (20), Expect = 9.8 Identities = 38/44 (86%) Strand = Plus / Plus Query: 438 gacatgtaagggttgatgcgtccatgagcacggtacgtccggcg 481 |||||||| || |||||||| || || ||||||||||| ||||| Sbjct: 273 gacatgtacggattgatgcgaccgtgcgcacggtacgtgcggcg 316
>emb|BX072427.1|CNS09S1R Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAD1BD05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 677 Score = 40.1 bits (20), Expect = 9.8 Identities = 38/44 (86%) Strand = Plus / Minus Query: 438 gacatgtaagggttgatgcgtccatgagcacggtacgtccggcg 481 |||||||| || |||||||| || || ||||||||||| ||||| Sbjct: 472 gacatgtacggattgatgcgaccgtgcgcacggtacgtgcggcg 429
>emb|BX072323.1|CNS09RYV Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAD1AG12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 740 Score = 40.1 bits (20), Expect = 9.8 Identities = 38/44 (86%) Strand = Plus / Plus Query: 438 gacatgtaagggttgatgcgtccatgagcacggtacgtccggcg 481 |||||||| || |||||||| || || ||||||||||| ||||| Sbjct: 285 gacatgtacggattgatgcgaccgtgcgcacggtacgtgcggcg 328
>emb|BX072322.1|CNS09RYU Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAD1AG12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 734 Score = 40.1 bits (20), Expect = 9.8 Identities = 38/44 (86%) Strand = Plus / Minus Query: 438 gacatgtaagggttgatgcgtccatgagcacggtacgtccggcg 481 |||||||| || |||||||| || || ||||||||||| ||||| Sbjct: 471 gacatgtacggattgatgcgaccgtgcgcacggtacgtgcggcg 428
>emb|BX030951.1|CNS08W1N Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA46AG10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 769 Score = 40.1 bits (20), Expect = 9.8 Identities = 38/44 (86%) Strand = Plus / Minus Query: 438 gacatgtaagggttgatgcgtccatgagcacggtacgtccggcg 481 |||||||| || |||||||| || || ||||||||||| ||||| Sbjct: 455 gacatgtacggattgatgcgaccgtgcgcacggtacgtgcggcg 412
>emb|BX049636.1|CNS09AGO Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC25CG03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 782 Score = 40.1 bits (20), Expect = 9.8 Identities = 38/44 (86%) Strand = Plus / Minus Query: 438 gacatgtaagggttgatgcgtccatgagcacggtacgtccggcg 481 |||||||| || |||||||| || || ||||||||||| ||||| Sbjct: 474 gacatgtacggattgatgcgaccgtgcgcacggtacgtgcggcg 431
>emb|BX043819.1|CNS095Z3 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC16CF06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 776 Score = 40.1 bits (20), Expect = 9.8 Identities = 38/44 (86%) Strand = Plus / Minus Query: 438 gacatgtaagggttgatgcgtccatgagcacggtacgtccggcg 481 |||||||| || |||||||| || || ||||||||||| ||||| Sbjct: 469 gacatgtacggattgatgcgaccgtgcgcacggtacgtgcggcg 426
>emb|BX039024.1|CNS0929W Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAB3CG03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 727 Score = 40.1 bits (20), Expect = 9.8 Identities = 38/44 (86%) Strand = Plus / Plus Query: 438 gacatgtaagggttgatgcgtccatgagcacggtacgtccggcg 481 |||||||| || |||||||| || || ||||||||||| ||||| Sbjct: 281 gacatgtacggattgatgcgaccgtgcgcacggtacgtgcggcg 324
>emb|BX038683.1|CNS0920F Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAB3AG04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 670 Score = 40.1 bits (20), Expect = 9.8 Identities = 38/44 (86%) Strand = Plus / Plus Query: 438 gacatgtaagggttgatgcgtccatgagcacggtacgtccggcg 481 |||||||| || |||||||| || || ||||||||||| ||||| Sbjct: 304 gacatgtacggattgatgcgaccgtgcgcacggtacgtgcggcg 347
>emb|BX038603.1|CNS091Y7 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAB3AC10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 747 Score = 40.1 bits (20), Expect = 9.8 Identities = 38/44 (86%) Strand = Plus / Plus Query: 438 gacatgtaagggttgatgcgtccatgagcacggtacgtccggcg 481 |||||||| || |||||||| || || ||||||||||| ||||| Sbjct: 282 gacatgtacggattgatgcgaccgtgcgcacggtacgtgcggcg 325
>emb|BX038373.1|CNS091RT Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAB2DA08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 698 Score = 40.1 bits (20), Expect = 9.8 Identities = 38/44 (86%) Strand = Plus / Plus Query: 438 gacatgtaagggttgatgcgtccatgagcacggtacgtccggcg 481 |||||||| || |||||||| || || ||||||||||| ||||| Sbjct: 295 gacatgtacggattgatgcgaccgtgcgcacggtacgtgcggcg 338
>emb|BX038372.1|CNS091RS Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAB2DA08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 721 Score = 40.1 bits (20), Expect = 9.8 Identities = 38/44 (86%) Strand = Plus / Minus Query: 438 gacatgtaagggttgatgcgtccatgagcacggtacgtccggcg 481 |||||||| || |||||||| || || ||||||||||| ||||| Sbjct: 475 gacatgtacggattgatgcgaccgtgcgcacggtacgtgcggcg 432
>emb|BX038121.1|CNS091KT Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAB2BE03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 739 Score = 40.1 bits (20), Expect = 9.8 Identities = 38/44 (86%) Strand = Plus / Minus Query: 438 gacatgtaagggttgatgcgtccatgagcacggtacgtccggcg 481 |||||||| || |||||||| || || ||||||||||| ||||| Sbjct: 472 gacatgtacggattgatgcgaccgtgcgcacggtacgtgcggcg 429
>emb|BX037870.1|CNS091DU Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAB2AA08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 739 Score = 40.1 bits (20), Expect = 9.8 Identities = 38/44 (86%) Strand = Plus / Plus Query: 438 gacatgtaagggttgatgcgtccatgagcacggtacgtccggcg 481 |||||||| || |||||||| || || ||||||||||| ||||| Sbjct: 275 gacatgtacggattgatgcgaccgtgcgcacggtacgtgcggcg 318
>emb|BX037869.1|CNS091DT Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAB2AA08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 734 Score = 40.1 bits (20), Expect = 9.8 Identities = 38/44 (86%) Strand = Plus / Minus Query: 438 gacatgtaagggttgatgcgtccatgagcacggtacgtccggcg 481 |||||||| || |||||||| || || ||||||||||| ||||| Sbjct: 474 gacatgtacggattgatgcgaccgtgcgcacggtacgtgcggcg 431
>emb|BX037857.1|CNS091DH Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAB1BH12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 684 Score = 40.1 bits (20), Expect = 9.8 Identities = 38/44 (86%) Strand = Plus / Minus Query: 438 gacatgtaagggttgatgcgtccatgagcacggtacgtccggcg 481 |||||||| || |||||||| || || ||||||||||| ||||| Sbjct: 474 gacatgtacggattgatgcgaccgtgcgcacggtacgtgcggcg 431
>emb|BX035571.1|CNS08ZLZ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA6DH09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 596 Score = 40.1 bits (20), Expect = 9.8 Identities = 38/44 (86%) Strand = Plus / Minus Query: 438 gacatgtaagggttgatgcgtccatgagcacggtacgtccggcg 481 |||||||| || |||||||| || || ||||||||||| ||||| Sbjct: 292 gacatgtacggattgatgcgaccgtgcgcacggtacgtgcggcg 249
>emb|BX035435.1|CNS08ZI7 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA6DB02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 657 Score = 40.1 bits (20), Expect = 9.8 Identities = 38/44 (86%) Strand = Plus / Minus Query: 438 gacatgtaagggttgatgcgtccatgagcacggtacgtccggcg 481 |||||||| || |||||||| || || ||||||||||| ||||| Sbjct: 331 gacatgtacggattgatgcgaccgtgcgcacggtacgtgcggcg 288
>emb|BX032768.1|CNS08XG4 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA48DE06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 755 Score = 40.1 bits (20), Expect = 9.8 Identities = 38/44 (86%) Strand = Plus / Minus Query: 438 gacatgtaagggttgatgcgtccatgagcacggtacgtccggcg 481 |||||||| || |||||||| || || ||||||||||| ||||| Sbjct: 446 gacatgtacggattgatgcgaccgtgcgcacggtacgtgcggcg 403
>emb|BX031235.1|CNS08W9J Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA46CD08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 773 Score = 40.1 bits (20), Expect = 9.8 Identities = 38/44 (86%) Strand = Plus / Minus Query: 438 gacatgtaagggttgatgcgtccatgagcacggtacgtccggcg 481 |||||||| || |||||||| || || ||||||||||| ||||| Sbjct: 464 gacatgtacggattgatgcgaccgtgcgcacggtacgtgcggcg 421
>emb|BX030409.1|CNS08VML Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA45BF01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 764 Score = 40.1 bits (20), Expect = 9.8 Identities = 38/44 (86%) Strand = Plus / Minus Query: 438 gacatgtaagggttgatgcgtccatgagcacggtacgtccggcg 481 |||||||| || |||||||| || || ||||||||||| ||||| Sbjct: 446 gacatgtacggattgatgcgaccgtgcgcacggtacgtgcggcg 403
>emb|BX030139.1|CNS08VF3 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA45AA12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 768 Score = 40.1 bits (20), Expect = 9.8 Identities = 38/44 (86%) Strand = Plus / Minus Query: 438 gacatgtaagggttgatgcgtccatgagcacggtacgtccggcg 481 |||||||| || |||||||| || || ||||||||||| ||||| Sbjct: 452 gacatgtacggattgatgcgaccgtgcgcacggtacgtgcggcg 409
>emb|BX025125.1|CNS08RJT Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA38CA12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 765 Score = 40.1 bits (20), Expect = 9.8 Identities = 38/44 (86%) Strand = Plus / Minus Query: 438 gacatgtaagggttgatgcgtccatgagcacggtacgtccggcg 481 |||||||| || |||||||| || || ||||||||||| ||||| Sbjct: 451 gacatgtacggattgatgcgaccgtgcgcacggtacgtgcggcg 408
>emb|BX023237.1|CNS08Q3D Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA35CB06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 543 Score = 40.1 bits (20), Expect = 9.8 Identities = 38/44 (86%) Strand = Plus / Minus Query: 438 gacatgtaagggttgatgcgtccatgagcacggtacgtccggcg 481 |||||||| || |||||||| || || ||||||||||| ||||| Sbjct: 474 gacatgtacggattgatgcgaccgtgcgcacggtacgtgcggcg 431
>emb|BX018947.1|CNS08MS7 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA28DB03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 716 Score = 40.1 bits (20), Expect = 9.8 Identities = 38/44 (86%) Strand = Plus / Minus Query: 438 gacatgtaagggttgatgcgtccatgagcacggtacgtccggcg 481 |||||||| || |||||||| || || ||||||||||| ||||| Sbjct: 442 gacatgtacggattgatgcgaccgtgcgcacggtacgtgcggcg 399
>emb|BX017968.1|CNS08M10 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA27AF06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 760 Score = 40.1 bits (20), Expect = 9.8 Identities = 38/44 (86%) Strand = Plus / Minus Query: 438 gacatgtaagggttgatgcgtccatgagcacggtacgtccggcg 481 |||||||| || |||||||| || || ||||||||||| ||||| Sbjct: 455 gacatgtacggattgatgcgaccgtgcgcacggtacgtgcggcg 412
>emb|BX015112.1|CNS08JTO Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA22CH01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 749 Score = 40.1 bits (20), Expect = 9.8 Identities = 38/44 (86%) Strand = Plus / Minus Query: 438 gacatgtaagggttgatgcgtccatgagcacggtacgtccggcg 481 |||||||| || |||||||| || || ||||||||||| ||||| Sbjct: 447 gacatgtacggattgatgcgaccgtgcgcacggtacgtgcggcg 404
>emb|BX014670.1|CNS08JHE Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA22AC12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 746 Score = 40.1 bits (20), Expect = 9.8 Identities = 38/44 (86%) Strand = Plus / Minus Query: 438 gacatgtaagggttgatgcgtccatgagcacggtacgtccggcg 481 |||||||| || |||||||| || || ||||||||||| ||||| Sbjct: 455 gacatgtacggattgatgcgaccgtgcgcacggtacgtgcggcg 412
>emb|BX010848.1|CNS08GJ8 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA17BE09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 599 Score = 40.1 bits (20), Expect = 9.8 Identities = 38/44 (86%) Strand = Plus / Minus Query: 438 gacatgtaagggttgatgcgtccatgagcacggtacgtccggcg 481 |||||||| || |||||||| || || ||||||||||| ||||| Sbjct: 448 gacatgtacggattgatgcgaccgtgcgcacggtacgtgcggcg 405
>emb|BX008885.1|CNS08F0P Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA14CB02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 644 Score = 40.1 bits (20), Expect = 9.8 Identities = 38/44 (86%) Strand = Plus / Minus Query: 438 gacatgtaagggttgatgcgtccatgagcacggtacgtccggcg 481 |||||||| || |||||||| || || ||||||||||| ||||| Sbjct: 337 gacatgtacggattgatgcgaccgtgcgcacggtacgtgcggcg 294
>emb|BX007837.1|CNS08E7L Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA13AB07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 757 Score = 40.1 bits (20), Expect = 9.8 Identities = 38/44 (86%) Strand = Plus / Minus Query: 438 gacatgtaagggttgatgcgtccatgagcacggtacgtccggcg 481 |||||||| || |||||||| || || ||||||||||| ||||| Sbjct: 449 gacatgtacggattgatgcgaccgtgcgcacggtacgtgcggcg 406
>emb|BX006721.1|CNS08DCL Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA11BD01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 767 Score = 40.1 bits (20), Expect = 9.8 Identities = 38/44 (86%) Strand = Plus / Minus Query: 438 gacatgtaagggttgatgcgtccatgagcacggtacgtccggcg 481 |||||||| || |||||||| || || ||||||||||| ||||| Sbjct: 448 gacatgtacggattgatgcgaccgtgcgcacggtacgtgcggcg 405
>emb|BX006285.1|CNS08D0H Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA10CF12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 796 Score = 40.1 bits (20), Expect = 9.8 Identities = 38/44 (86%) Strand = Plus / Minus Query: 438 gacatgtaagggttgatgcgtccatgagcacggtacgtccggcg 481 |||||||| || |||||||| || || ||||||||||| ||||| Sbjct: 470 gacatgtacggattgatgcgaccgtgcgcacggtacgtgcggcg 427
>emb|BX006192.1|CNS08CXW Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA10CB07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 712 Score = 40.1 bits (20), Expect = 9.8 Identities = 38/44 (86%) Strand = Plus / Minus Query: 438 gacatgtaagggttgatgcgtccatgagcacggtacgtccggcg 481 |||||||| || |||||||| || || ||||||||||| ||||| Sbjct: 436 gacatgtacggattgatgcgaccgtgcgcacggtacgtgcggcg 393
>emb|Z46902.1|SC8224 S.cerevisiae chromosome IX cosmid 8224 and right telomere Length = 8956 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 gaatatccgaaacagtttta 178 |||||||||||||||||||| Sbjct: 227 gaatatccgaaacagtttta 246
>emb|X71382.1|PCRPL17 P.carnea mRNA for 60S ribosomal protein L17 Length = 577 Score = 40.1 bits (20), Expect = 9.8 Identities = 29/32 (90%) Strand = Plus / Minus Query: 438 gacatgtaagggttgatgcgtccatgagcacg 469 |||||||| || |||||||| ||||||||||| Sbjct: 432 gacatgtatggattgatgcgaccatgagcacg 401
>gb|AC124864.3| Homo sapiens BAC clone RP11-570J4 from 4, complete sequence Length = 166797 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 53 aaagtggatcattcaaagca 72 |||||||||||||||||||| Sbjct: 126580 aaagtggatcattcaaagca 126561
>gb|AF023539.1| Simulium vittatum cytochrome b gene, mitochondrial gene encoding mitochondrial protein, partial cds Length = 246 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 218 aaccttaacaaatccttact 237 |||||||||||||||||||| Sbjct: 66 aaccttaacaaatccttact 85
>gb|AC011328.11| Homo sapiens chromosome 10 clone RP11-295O23, complete sequence Length = 216031 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 510 atgtgtgaaatgtagaggtt 529 |||||||||||||||||||| Sbjct: 180562 atgtgtgaaatgtagaggtt 180543
>gb|AC094080.4| Homo sapiens chromosome 5 clone CTB-77K22, complete sequence Length = 118504 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 236 ctccatgttggtaccaaaaa 255 |||||||||||||||||||| Sbjct: 49528 ctccatgttggtaccaaaaa 49547
>gb|DQ113909.1| Hordeum vulgare subsp. vulgare cultivar Morex inducer of CBF expression 2 (ICE2) gene, partial cds Length = 2512 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 16 tgttcctaaatataagacgt 35 |||||||||||||||||||| Sbjct: 1314 tgttcctaaatataagacgt 1333
>gb|DQ113908.1| Hordeum vulgare subsp. vulgare cultivar Dicktoo inducer of CBF expression 2 (ICE2) gene, partial cds Length = 2512 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 16 tgttcctaaatataagacgt 35 |||||||||||||||||||| Sbjct: 1314 tgttcctaaatataagacgt 1333
>gb|AF402775.1|AF402775 Epiphyas postvittana pheromone gland acyl-CoA delta-9 desaturase mRNA, complete cds Length = 1705 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 28 taagacgttttgacagttca 47 |||||||||||||||||||| Sbjct: 1356 taagacgttttgacagttca 1375
>gb|AE006470.1| Chlorobium tepidum TLS, complete genome Length = 2154946 Score = 40.1 bits (20), Expect = 9.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 152 aatgctcgaatatccgaaacagtt 175 |||||||||||||||| ||||||| Sbjct: 1233540 aatgctcgaatatccggaacagtt 1233563
>gb|AY130354.1| Branchiostoma lanceolatum ribosomal protein L17 mRNA, partial cds Length = 472 Score = 40.1 bits (20), Expect = 9.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 410 caagatcagctcaatgtggcaggg 433 |||||||| ||||||||||||||| Sbjct: 424 caagatcatctcaatgtggcaggg 401
>gb|AC011379.7| Homo sapiens chromosome 5 clone CTB-131B5, complete sequence Length = 170797 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 236 ctccatgttggtaccaaaaa 255 |||||||||||||||||||| Sbjct: 132964 ctccatgttggtaccaaaaa 132983
>gb|AC078822.28| Homo sapiens 12 BAC RP11-216I5 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 166825 Score = 40.1 bits (20), Expect = 9.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 610 gccagcgaccctgcccatttggct 633 |||||| ||||||||||||||||| Sbjct: 157624 gccagcaaccctgcccatttggct 157647
>gb|AF250324.1|AF250324 Homo sapiens chromosome 4q35 BAC clones RPCI-11-463J17 and RPCI-6-92G13RCB2, complete sequence Length = 245708 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 53 aaagtggatcattcaaagca 72 |||||||||||||||||||| Sbjct: 36033 aaagtggatcattcaaagca 36052
>gb|AC109491.3| Homo sapiens chromosome 5 clone RP11-727F19, complete sequence Length = 127489 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 503 cacctggatgtgtgaaatgt 522 |||||||||||||||||||| Sbjct: 49084 cacctggatgtgtgaaatgt 49065
>emb|BX000522.11| Zebrafish DNA sequence from clone CH211-146K11, complete sequence Length = 175406 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 110 ccgaaaggacaaagatctct 129 |||||||||||||||||||| Sbjct: 2381 ccgaaaggacaaagatctct 2362
>dbj|AP006461.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC clone:P0104B02 Length = 169588 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 11 ctctctgttcctaaatataa 30 |||||||||||||||||||| Sbjct: 110460 ctctctgttcctaaatataa 110479
>ref|XM_551370.1| Anopheles gambiae str. PEST ENSANGP00000011784 (ENSANGG00000009295), mRNA Length = 667 Score = 40.1 bits (20), Expect = 9.8 Identities = 38/44 (86%) Strand = Plus / Minus Query: 438 gacatgtaagggttgatgcgtccatgagcacggtacgtccggcg 481 |||||||| || |||||||| || || ||||||||||| ||||| Sbjct: 462 gacatgtacggattgatgcgaccgtgcgcacggtacgtgcggcg 419
>ref|XM_551371.1| Anopheles gambiae str. PEST ENSANGP00000026842 (ENSANGG00000009295), mRNA Length = 737 Score = 40.1 bits (20), Expect = 9.8 Identities = 38/44 (86%) Strand = Plus / Minus Query: 438 gacatgtaagggttgatgcgtccatgagcacggtacgtccggcg 481 |||||||| || |||||||| || || ||||||||||| ||||| Sbjct: 469 gacatgtacggattgatgcgaccgtgcgcacggtacgtgcggcg 426
>emb|CR388128.18| Zebrafish DNA sequence from clone CH211-127B17 in linkage group 18, complete sequence Length = 180022 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 110 ccgaaaggacaaagatctct 129 |||||||||||||||||||| Sbjct: 144337 ccgaaaggacaaagatctct 144356
>gb|DQ332484.1| Synthetic construct Saccharomyces cerevisiae clone FLH201457.01X YPS6 gene, complete sequence Length = 1614 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 gaatatccgaaacagtttta 178 |||||||||||||||||||| Sbjct: 952 gaatatccgaaacagtttta 933
>gb|U86875.1|HCU86875 Hyphantria cunea prophenoloxidase (HcProPO) mRNA, complete cds Length = 3164 Score = 40.1 bits (20), Expect = 9.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 434 gttggacatgtaagggttgatgcg 457 |||| ||||||||||||||||||| Sbjct: 466 gttgaacatgtaagggttgatgcg 443
>emb|AL928987.13| Mouse DNA sequence from clone RP23-55M21 on chromosome 2, complete sequence Length = 150363 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 85 attgccaaactcttaagtgt 104 |||||||||||||||||||| Sbjct: 76511 attgccaaactcttaagtgt 76492 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 6,049,231 Number of Sequences: 3902068 Number of extensions: 6049231 Number of successful extensions: 108751 Number of sequences better than 10.0: 224 Number of HSP's better than 10.0 without gapping: 224 Number of HSP's successfully gapped in prelim test: 1 Number of HSP's that attempted gapping in prelim test: 108100 Number of HSP's gapped (non-prelim): 634 length of query: 714 length of database: 17,233,045,268 effective HSP length: 23 effective length of query: 691 effective length of database: 17,143,297,704 effective search space: 11846018713464 effective search space used: 11846018713464 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)
