>gb|AC104650.2| Homo sapiens BAC clone RP11-117J13 from 4, complete sequence
          Length = 163948

 Score = 42.1 bits (21), Expect = 0.57
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 86    actagaaagcccagcacactg 106
             |||||||||||||||||||||
Sbjct: 62008 actagaaagcccagcacactg 61988

>emb|AL135786.17| Human DNA sequence from clone RP11-12D24 on chromosome 9p23-24.3
            Contains the RLN1 gene for relaxin 1(H1) (RLXH1),the RLN2
            gene for relaxin 2 (H2) (RLXH2), a  high-mobility group
            nucleosomal binding domain 2 (HMGN2) pseudogene, a  novel
            pseudogene, the gene for uncharacterized hematopoietic
            stem/progenitor cells protein (MDS030), a novel
            pseudogene (FLJ39176) and four CpG islands, complete
            sequence
          Length = 156592

 Score = 38.2 bits (19), Expect = 8.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 3    tgactaatgttttctgttt 21
            |||||||||||||||||||
Sbjct: 3236 tgactaatgttttctgttt 3254

>emb|CR382135.1| Debaryomyces hansenii chromosome C of strain CBS767 of Debaryomyces
               hansenii
          Length = 1592360

 Score = 38.2 bits (19), Expect = 8.9
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                      
Query: 13      tttctgtttacaccgtaaacagg 35
               ||||||||||||| |||||||||
Sbjct: 1307571 tttctgtttacacagtaaacagg 1307549

>dbj|AB219931.1| Xenopus laevis Xnr5-a, Xnr5-b, Xnr5-c genes, partial and complete cds
          Length = 14029

 Score = 38.2 bits (19), Expect = 8.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 3    tgactaatgttttctgttt 21
            |||||||||||||||||||
Sbjct: 7887 tgactaatgttttctgttt 7905

>gb|AC092623.2| Homo sapiens BAC clone RP11-260E12 from 2, complete sequence
          Length = 172344

 Score = 38.2 bits (19), Expect = 8.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 86     actagaaagcccagcacac 104
              |||||||||||||||||||
Sbjct: 164383 actagaaagcccagcacac 164365


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 731,361
Number of Sequences: 3902068
Number of extensions: 731361
Number of successful extensions: 45580
Number of sequences better than 10.0: 5
Number of HSP's better than 10.0 without gapping: 5
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 45567
Number of HSP's gapped (non-prelim): 13
length of query: 181
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 159
effective length of database: 17,147,199,772
effective search space: 2726404763748
effective search space used: 2726404763748
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)