Clone Name	rbags16j20
Clone Library Name	barley_pub

---

No.	Definition	Score (bits)	E Value
1	ref|XM_464969.1| Oryza sativa (japonica cultivar-group), mRNA	337	2e-89
2	dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D...	337	2e-89
3	dbj|AP005533.3| Oryza sativa (japonica cultivar-group) genomic D...	337	2e-89
4	dbj|AP004001.3| Oryza sativa (japonica cultivar-group) genomic D...	337	2e-89
5	dbj|AK121593.1| Oryza sativa (japonica cultivar-group) cDNA clon...	337	2e-89
6	ref|NM_197775.1| Oryza sativa (japonica cultivar-group) putative...	335	8e-89
7	gb|AC084763.4| Oryza sativa chromosome 10 BAC OSJNBa0027P10 geno...	335	8e-89
8	dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic D...	335	8e-89
9	dbj|AK066340.1| Oryza sativa (japonica cultivar-group) cDNA clon...	335	8e-89
10	gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome...	335	8e-89
11	gb|BT016577.1| Zea mays clone Contig410 mRNA sequence	319	5e-84
12	gb|BT017753.1| Zea mays clone EL01N0450E09.c mRNA sequence	297	2e-77
13	gb|AY104535.1| Zea mays PCO094675 mRNA sequence	256	6e-65
14	emb|X68202.1|CSL27 C.stellata mRNA for ribosomal protein L27	96	1e-16
15	ref|NM_117587.2| Arabidopsis thaliana structural constituent of ...	72	2e-09
16	gb|DQ226702.1| Boechera divaricarpa isolate SLW-A-H01 mRNA sequence	72	2e-09
17	gb|BT014180.1| Lycopersicon esculentum clone 133344F, mRNA sequence	72	2e-09
18	emb|Z97337.2|ATFCA2 Arabidopsis thaliana DNA chromosome 4, ESSA ...	72	2e-09
19	gb|AY096731.1| Arabidopsis thaliana putative ribosomal protein (...	72	2e-09
20	gb|AY063987.1| Arabidopsis thaliana putative ribosomal protein (...	72	2e-09
21	emb|BX827228.1|CNS0A2SV Arabidopsis thaliana Full-length cDNA Co...	72	2e-09
22	emb|BX827216.1|CNS0A2RL Arabidopsis thaliana Full-length cDNA Co...	72	2e-09
23	gb|AY085487.1| Arabidopsis thaliana clone 15384 mRNA, complete s...	72	2e-09
24	emb|AL161540.2|ATCHRIV40 Arabidopsis thaliana DNA chromosome 4, ...	72	2e-09
25	gb|AF401581.1| Ictalurus punctatus ribosomal protein L27 mRNA, c...	66	1e-07
26	ref|NM_128781.2| Arabidopsis thaliana structural constituent of ...	64	5e-07
27	gb|AC006223.4| Arabidopsis thaliana chromosome 2 clone F22D22 ma...	64	5e-07
28	gb|BT021972.1| Arabidopsis thaliana At2g32220 mRNA, complete cds	64	5e-07
29	ref|XM_850644.1| PREDICTED: Canis familiaris similar to ribosoma...	60	7e-06
30	ref|XM_543309.2| PREDICTED: Canis familiaris similar to ribosoma...	60	7e-06
31	emb|CR733949.2|CNS0GT3G Tetraodon nigroviridis full-length cDNA	60	7e-06
32	gb|AC134322.25| Medicago truncatula clone mth2-17i21, complete s...	60	7e-06
33	gb|AC131248.14| Medicago truncatula clone mth2-28n22, complete s...	60	7e-06
34	gb|AF266223.1|AF266223 Gillichthys mirabilis ribosomal protein L...	60	7e-06
35	gb|AY610378.1| Sus scrofa clone relu1310b_k10.y1.abd, mRNA sequence	60	7e-06
36	dbj|AB043975.1| Panax ginseng mRNA for ribosomal protein L27, co...	60	7e-06
37	gb|AF548324.1| Branchiostoma belcheri ribosomal protein L27 mRNA...	58	3e-05
38	gb|AF003143.2| Caenorhabditis elegans cosmid C53H9, complete seq...	58	3e-05
39	ref|NM_058504.4| Caenorhabditis elegans Ribosomal Protein, Large...	58	3e-05
40	gb|U89308.1|CEU89308 Caenorhabditis elegans ribosomal protein L2...	58	3e-05
41	gb|AY682471.1| Chara globularis 60S ribosomal protein L27 mRNA, ...	56	1e-04
42	gb|U10046.1|PSU10046 Pisum sativum ribosomal protein L27 homolog...	56	1e-04
43	ref|XM_370196.1| Magnaporthe grisea 70-15 chromosome II hypothet...	54	4e-04
44	ref|XM_951518.1| Neurospora crassa OR74A hypothetical protein (N...	54	4e-04
45	ref|XM_328265.1| Neurospora crassa OR74A hypothetical protein (N...	54	4e-04
46	gb|AY508978.1| Pectinaria gouldii ribosomal protein L27 mRNA, co...	54	4e-04
47	ref|XM_500549.1| Yarrowia lipolytica CLIB122, YALI0B05896g predi...	54	4e-04
48	emb|BX284754.1|NCB23G1 Neurospora crassa DNA linkage group II BA...	54	4e-04
49	emb|CR382128.1| Yarrowia lipolytica chromosome B of strain CLIB1...	54	4e-04
50	gb|AY292611.1| Oikopleura dioica 60S ribosomal protein RL27 (RL2...	52	0.002
51	emb|BX060631.1|CNS09IY3 Single read from an extremity of a full-...	52	0.002
52	emb|BX006453.1|CNS08D55 Single read from an extremity of a full-...	52	0.002
53	emb|BX006452.1|CNS08D54 Single read from an extremity of a full-...	52	0.002
54	emb|Z30162.1|ST60SRP27 S.tuberosum mRNA for 60S ribosomal protei...	52	0.002
55	emb|BX072103.1|CNS09RSR Single read from an extremity of a full-...	50	0.007
56	emb|BX072102.1|CNS09RSQ Single read from an extremity of a full-...	50	0.007
57	emb|BX072101.1|CNS09RSP Single read from an extremity of a full-...	50	0.007
58	emb|BX072044.1|CNS09RR4 Single read from an extremity of a full-...	50	0.007
59	emb|BX072043.1|CNS09RR3 Single read from an extremity of a full-...	50	0.007
60	emb|BX071795.1|CNS09RK7 Single read from an extremity of a full-...	50	0.007
61	emb|BX071794.1|CNS09RK6 Single read from an extremity of a full-...	50	0.007
62	emb|BX071773.1|CNS09RJL Single read from an extremity of a full-...	50	0.007
63	emb|BX071772.1|CNS09RJK Single read from an extremity of a full-...	50	0.007
64	emb|BX071703.1|CNS09RHN Single read from an extremity of a full-...	50	0.007
65	emb|BX071702.1|CNS09RHM Single read from an extremity of a full-...	50	0.007
66	emb|BX071484.1|CNS09RBK Single read from an extremity of a full-...	50	0.007
67	emb|BX071483.1|CNS09RBJ Single read from an extremity of a full-...	50	0.007
68	emb|BX071109.1|CNS09R15 Single read from an extremity of a full-...	50	0.007
69	emb|BX071108.1|CNS09R14 Single read from an extremity of a full-...	50	0.007
70	emb|BX071294.1|CNS09R6A Single read from an extremity of a full-...	50	0.007
71	emb|BX070984.1|CNS09QXO Single read from an extremity of a full-...	50	0.007
72	emb|BX070983.1|CNS09QXN Single read from an extremity of a full-...	50	0.007
73	emb|BX070927.1|CNS09QW3 Single read from an extremity of a full-...	50	0.007
74	emb|BX070926.1|CNS09QW2 Single read from an extremity of a full-...	50	0.007
75	emb|BX070787.1|CNS09QS7 Single read from an extremity of a full-...	50	0.007
76	emb|BX070786.1|CNS09QS6 Single read from an extremity of a full-...	50	0.007
77	emb|BX070589.1|CNS09QMP Single read from an extremity of a full-...	50	0.007
78	emb|BX070475.1|CNS09QJJ Single read from an extremity of a full-...	50	0.007
79	emb|BX070293.1|CNS09QEH Single read from an extremity of a full-...	50	0.007
80	emb|BX070240.1|CNS09QD0 Single read from an extremity of a full-...	50	0.007
81	emb|BX070239.1|CNS09QCZ Single read from an extremity of a full-...	50	0.007
82	emb|BX070199.1|CNS09QBV Single read from an extremity of a full-...	50	0.007
83	emb|BX069996.1|CNS09Q68 Single read from an extremity of a full-...	50	0.007
84	emb|BX069995.1|CNS09Q67 Single read from an extremity of a full-...	50	0.007
85	emb|BX069838.1|CNS09Q1U Single read from an extremity of a full-...	50	0.007
86	emb|BX069837.1|CNS09Q1T Single read from an extremity of a full-...	50	0.007
87	emb|BX069816.1|CNS09Q18 Single read from an extremity of a full-...	50	0.007
88	emb|BX069815.1|CNS09Q17 Single read from an extremity of a full-...	50	0.007
89	emb|BX061095.1|CNS09JAZ Single read from an extremity of a full-...	50	0.007
90	emb|BX061094.1|CNS09JAY Single read from an extremity of a full-...	50	0.007
91	emb|BX060930.1|CNS09J6E Single read from an extremity of a full-...	50	0.007
92	emb|BX060929.1|CNS09J6D Single read from an extremity of a full-...	50	0.007
93	emb|BX069521.1|CNS09PT1 Single read from an extremity of a full-...	50	0.007
94	emb|BX069520.1|CNS09PT0 Single read from an extremity of a full-...	50	0.007
95	emb|BX069417.1|CNS09PQ5 Single read from an extremity of a full-...	50	0.007
96	emb|BX069416.1|CNS09PQ4 Single read from an extremity of a full-...	50	0.007
97	emb|BX069166.1|CNS09PJ6 Single read from an extremity of a full-...	50	0.007
98	emb|BX069144.1|CNS09PIK Single read from an extremity of a full-...	50	0.007
99	emb|BX069128.1|CNS09PI4 Single read from an extremity of a full-...	50	0.007
100	emb|BX069070.1|CNS09PGI Single read from an extremity of a full-...	50	0.007
101	emb|BX069043.1|CNS09PFR Single read from an extremity of a full-...	50	0.007
102	emb|BX069042.1|CNS09PFQ Single read from an extremity of a full-...	50	0.007
103	emb|BX069033.1|CNS09PFH Single read from an extremity of a full-...	50	0.007
104	emb|BX069032.1|CNS09PFG Single read from an extremity of a full-...	50	0.007
105	emb|BX069017.1|CNS09PF1 Single read from an extremity of a full-...	50	0.007
106	emb|BX069016.1|CNS09PF0 Single read from an extremity of a full-...	50	0.007
107	emb|BX068777.1|CNS09P8D Single read from an extremity of a full-...	50	0.007
108	emb|BX068776.1|CNS09P8C Single read from an extremity of a full-...	50	0.007
109	emb|BX068480.1|CNS09P04 Single read from an extremity of a full-...	50	0.007
110	emb|BX068479.1|CNS09P03 Single read from an extremity of a full-...	50	0.007
111	emb|BX068045.1|CNS09OO1 Single read from an extremity of a full-...	50	0.007
112	emb|BX067898.1|CNS09OJY Single read from an extremity of a full-...	50	0.007
113	emb|BX067672.1|CNS09ODO Single read from an extremity of a full-...	50	0.007
114	emb|BX067447.1|CNS09O7F Single read from an extremity of a full-...	50	0.007
115	emb|BX067015.1|CNS09NVF Single read from an extremity of a full-...	50	0.007
116	emb|BX067014.1|CNS09NVE Single read from an extremity of a full-...	50	0.007
117	emb|BX067249.1|CNS09O1X Single read from an extremity of a full-...	50	0.007
118	emb|BX067248.1|CNS09O1W Single read from an extremity of a full-...	50	0.007
119	emb|BX067222.1|CNS09O16 Single read from an extremity of a full-...	50	0.007
120	emb|BX067221.1|CNS09O15 Single read from an extremity of a full-...	50	0.007
121	emb|BX067182.1|CNS09O02 Single read from an extremity of a full-...	50	0.007
122	emb|BX067181.1|CNS09O01 Single read from an extremity of a full-...	50	0.007
123	emb|BX067173.1|CNS09NZT Single read from an extremity of a full-...	50	0.007
124	emb|BX066730.1|CNS09NNI Single read from an extremity of a full-...	50	0.007
125	emb|BX066729.1|CNS09NNH Single read from an extremity of a full-...	50	0.007
126	emb|BX066569.1|CNS09NJ1 Single read from an extremity of a full-...	50	0.007
127	emb|BX066542.1|CNS09NIA Single read from an extremity of a full-...	50	0.007
128	emb|BX066541.1|CNS09NI9 Single read from an extremity of a full-...	50	0.007
129	emb|BX066194.1|CNS09N8M Single read from an extremity of a full-...	50	0.007
130	emb|BX066150.1|CNS09N7E Single read from an extremity of a full-...	50	0.007
131	emb|BX066095.1|CNS09N5V Single read from an extremity of a full-...	50	0.007
132	emb|BX065973.1|CNS09N2H Single read from an extremity of a full-...	50	0.007
133	emb|BX065830.1|CNS09MYI Single read from an extremity of a full-...	50	0.007
134	emb|BX065804.1|CNS09MXS Single read from an extremity of a full-...	50	0.007
135	emb|BX065733.1|CNS09MVT Single read from an extremity of a full-...	50	0.007
136	emb|BX065586.1|CNS09MRQ Single read from an extremity of a full-...	50	0.007
137	emb|BX065527.1|CNS09MQ3 Single read from an extremity of a full-...	50	0.007
138	emb|BX065526.1|CNS09MQ2 Single read from an extremity of a full-...	50	0.007
139	emb|BX065395.1|CNS09MMF Single read from an extremity of a full-...	50	0.007
140	emb|BX065394.1|CNS09MME Single read from an extremity of a full-...	50	0.007
141	emb|BX065267.1|CNS09MIV Single read from an extremity of a full-...	50	0.007
142	emb|BX064786.1|CNS09M5I Single read from an extremity of a full-...	50	0.007
143	emb|BX064578.1|CNS09LZQ Single read from an extremity of a full-...	50	0.007
144	emb|BX064318.1|CNS09LSI Single read from an extremity of a full-...	50	0.007
145	emb|BX064317.1|CNS09LSH Single read from an extremity of a full-...	50	0.007
146	emb|BX064256.1|CNS09LQS Single read from an extremity of a full-...	50	0.007
147	emb|BX064193.1|CNS09LP1 Single read from an extremity of a full-...	50	0.007
148	emb|BX064192.1|CNS09LP0 Single read from an extremity of a full-...	50	0.007
149	emb|BX064097.1|CNS09LMD Single read from an extremity of a full-...	50	0.007
150	emb|BX064096.1|CNS09LMC Single read from an extremity of a full-...	50	0.007
151	emb|BX064002.1|CNS09LJQ Single read from an extremity of a full-...	50	0.007
152	emb|BX064001.1|CNS09LJP Single read from an extremity of a full-...	50	0.007
153	emb|BX063528.1|CNS09L6K Single read from an extremity of a full-...	50	0.007
154	emb|BX063517.1|CNS09L69 Single read from an extremity of a full-...	50	0.007
155	emb|BX063516.1|CNS09L68 Single read from an extremity of a full-...	50	0.007
156	emb|BX063197.1|CNS09KXD Single read from an extremity of a full-...	50	0.007
157	emb|BX063196.1|CNS09KXC Single read from an extremity of a full-...	50	0.007
158	emb|BX063195.1|CNS09KXB Single read from an extremity of a full-...	50	0.007
159	emb|BX063194.1|CNS09KXA Single read from an extremity of a full-...	50	0.007
160	emb|BX063139.1|CNS09KVR Single read from an extremity of a full-...	50	0.007
161	emb|BX063083.1|CNS09KU7 Single read from an extremity of a full-...	50	0.007
162	emb|BX062398.1|CNS09KB6 Single read from an extremity of a full-...	50	0.007
163	emb|BX062397.1|CNS09KB5 Single read from an extremity of a full-...	50	0.007
164	emb|BX062248.1|CNS09K70 Single read from an extremity of a full-...	50	0.007
165	emb|BX062217.1|CNS09K65 Single read from an extremity of a full-...	50	0.007
166	emb|BX061945.1|CNS09JYL Single read from an extremity of a full-...	50	0.007
167	emb|BX061917.1|CNS09JXT Single read from an extremity of a full-...	50	0.007
168	emb|BX061916.1|CNS09JXS Single read from an extremity of a full-...	50	0.007
169	emb|BX061583.1|CNS09JOJ Single read from an extremity of a full-...	50	0.007
170	emb|BX060671.1|CNS09IZ7 Single read from an extremity of a full-...	50	0.007
171	emb|BX060630.1|CNS09IY2 Single read from an extremity of a full-...	50	0.007
172	emb|BX060522.1|CNS09IV2 Single read from an extremity of a full-...	50	0.007
173	emb|BX060521.1|CNS09IV1 Single read from an extremity of a full-...	50	0.007
174	emb|BX060463.1|CNS09ITF Single read from an extremity of a full-...	50	0.007
175	emb|BX060462.1|CNS09ITE Single read from an extremity of a full-...	50	0.007
176	emb|BX060432.1|CNS09ISK Single read from an extremity of a full-...	50	0.007
177	emb|BX060431.1|CNS09ISJ Single read from an extremity of a full-...	50	0.007
178	emb|BX060386.1|CNS09IRA Single read from an extremity of a full-...	50	0.007
179	emb|BX060385.1|CNS09IR9 Single read from an extremity of a full-...	50	0.007
180	emb|BX060142.1|CNS09IKI Single read from an extremity of a full-...	50	0.007
181	emb|BX060141.1|CNS09IKH Single read from an extremity of a full-...	50	0.007
182	emb|BX059766.1|CNS09IA2 Single read from an extremity of a full-...	50	0.007
183	emb|BX059737.1|CNS09I99 Single read from an extremity of a full-...	50	0.007
184	emb|BX059721.1|CNS09I8T Single read from an extremity of a full-...	50	0.007
185	emb|BX059691.1|CNS09I7Z Single read from an extremity of a full-...	50	0.007
186	emb|BX059325.1|CNS09HXT Single read from an extremity of a full-...	50	0.007
187	emb|BX059324.1|CNS09HXS Single read from an extremity of a full-...	50	0.007
188	emb|BX059251.1|CNS09HVR Single read from an extremity of a full-...	50	0.007
189	emb|BX059147.1|CNS09HSV Single read from an extremity of a full-...	50	0.007
190	emb|BX059146.1|CNS09HSU Single read from an extremity of a full-...	50	0.007
191	emb|BX059121.1|CNS09HS5 Single read from an extremity of a full-...	50	0.007
192	emb|BX059021.1|CNS09HPD Single read from an extremity of a full-...	50	0.007
193	emb|BX059020.1|CNS09HPC Single read from an extremity of a full-...	50	0.007
194	emb|BX058945.1|CNS09HN9 Single read from an extremity of a full-...	50	0.007
195	emb|BX058944.1|CNS09HN8 Single read from an extremity of a full-...	50	0.007
196	emb|BX058853.1|CNS09HKP Single read from an extremity of a full-...	50	0.007
197	emb|BX058608.1|CNS09HDW Single read from an extremity of a full-...	50	0.007
198	emb|BX058465.1|CNS09H9X Single read from an extremity of a full-...	50	0.007
199	emb|BX056668.1|CNS09FW0 Single read from an extremity of a full-...	50	0.007
200	emb|BX057944.1|CNS09GVG Single read from an extremity of a full-...	50	0.007
201	emb|BX057637.1|CNS09GMX Single read from an extremity of a full-...	50	0.007
202	emb|BX057636.1|CNS09GMW Single read from an extremity of a full-...	50	0.007
203	emb|BX057549.1|CNS09GKH Single read from an extremity of a full-...	50	0.007
204	emb|BX057548.1|CNS09GKG Single read from an extremity of a full-...	50	0.007
205	emb|BX057428.1|CNS09GH4 Single read from an extremity of a full-...	50	0.007
206	emb|BX057427.1|CNS09GH3 Single read from an extremity of a full-...	50	0.007
207	emb|BX057217.1|CNS09GB9 Single read from an extremity of a full-...	50	0.007
208	emb|BX057111.1|CNS09G8B Single read from an extremity of a full-...	50	0.007
209	emb|BX057064.1|CNS09G70 Single read from an extremity of a full-...	50	0.007
210	emb|BX056980.1|CNS09G4O Single read from an extremity of a full-...	50	0.007
211	emb|BX056911.1|CNS09G2R Single read from an extremity of a full-...	50	0.007
212	emb|BX056910.1|CNS09G2Q Single read from an extremity of a full-...	50	0.007
213	emb|BX056816.1|CNS09G04 Single read from an extremity of a full-...	50	0.007
214	emb|BX056561.1|CNS09FT1 Single read from an extremity of a full-...	50	0.007
215	emb|BX056560.1|CNS09FT0 Single read from an extremity of a full-...	50	0.007
216	emb|BX056536.1|CNS09FSC Single read from an extremity of a full-...	50	0.007
217	emb|BX056232.1|CNS09FJW Single read from an extremity of a full-...	50	0.007
218	emb|BX056161.1|CNS09FHX Single read from an extremity of a full-...	50	0.007
219	emb|BX056160.1|CNS09FHW Single read from an extremity of a full-...	50	0.007
220	emb|BX055158.1|CNS09EQ2 Single read from an extremity of a full-...	50	0.007
221	emb|BX053204.1|CNS09D7S Single read from an extremity of a full-...	50	0.007
222	emb|BX054990.1|CNS09ELE Single read from an extremity of a full-...	50	0.007
223	emb|BX054749.1|CNS09EEP Single read from an extremity of a full-...	50	0.007
224	emb|BX053049.1|CNS09D3H Single read from an extremity of a full-...	50	0.007
225	emb|BX053048.1|CNS09D3G Single read from an extremity of a full-...	50	0.007
226	emb|BX054473.1|CNS09E71 Single read from an extremity of a full-...	50	0.007
227	emb|BX054408.1|CNS09E58 Single read from an extremity of a full-...	50	0.007
228	emb|BX054219.1|CNS09DZZ Single read from an extremity of a full-...	50	0.007
229	emb|BX054218.1|CNS09DZY Single read from an extremity of a full-...	50	0.007
230	emb|BX053917.1|CNS09DRL Single read from an extremity of a full-...	50	0.007
231	emb|BX053763.1|CNS09DNB Single read from an extremity of a full-...	50	0.007
232	emb|BX053650.1|CNS09DK6 Single read from an extremity of a full-...	50	0.007
233	emb|BX053531.1|CNS09DGV Single read from an extremity of a full-...	50	0.007
234	emb|BX053530.1|CNS09DGU Single read from an extremity of a full-...	50	0.007
235	emb|BX052795.1|CNS09CWF Single read from an extremity of a full-...	50	0.007
236	emb|BX052794.1|CNS09CWE Single read from an extremity of a full-...	50	0.007
237	emb|BX052608.1|CNS09CR8 Single read from an extremity of a full-...	50	0.007
238	emb|BX052607.1|CNS09CR7 Single read from an extremity of a full-...	50	0.007
239	emb|BX052579.1|CNS09CQF Single read from an extremity of a full-...	50	0.007
240	emb|BX052578.1|CNS09CQE Single read from an extremity of a full-...	50	0.007
241	emb|BX052518.1|CNS09COQ Single read from an extremity of a full-...	50	0.007
242	emb|BX052517.1|CNS09COP Single read from an extremity of a full-...	50	0.007
243	emb|BX052512.1|CNS09COK Single read from an extremity of a full-...	50	0.007
244	emb|BX052511.1|CNS09COJ Single read from an extremity of a full-...	50	0.007
245	emb|BX052483.1|CNS09CNR Single read from an extremity of a full-...	50	0.007
246	emb|BX052482.1|CNS09CNQ Single read from an extremity of a full-...	50	0.007
247	emb|BX052424.1|CNS09CM4 Single read from an extremity of a full-...	50	0.007
248	emb|BX052396.1|CNS09CLC Single read from an extremity of a full-...	50	0.007
249	emb|BX052389.1|CNS09CL5 Single read from an extremity of a full-...	50	0.007
250	emb|BX052388.1|CNS09CL4 Single read from an extremity of a full-...	50	0.007
251	emb|BX052226.1|CNS09CGM Single read from an extremity of a full-...	50	0.007
252	emb|BX052225.1|CNS09CGL Single read from an extremity of a full-...	50	0.007
253	emb|BX051970.1|CNS09C9I Single read from an extremity of a full-...	50	0.007
254	emb|BX051912.1|CNS09C7W Single read from an extremity of a full-...	50	0.007
255	emb|BX051911.1|CNS09C7V Single read from an extremity of a full-...	50	0.007
256	emb|BX050265.1|CNS09AY5 Single read from an extremity of a full-...	50	0.007
257	emb|BX050184.1|CNS09AVW Single read from an extremity of a full-...	50	0.007
258	emb|BX050183.1|CNS09AVV Single read from an extremity of a full-...	50	0.007
259	emb|BX050112.1|CNS09ATW Single read from an extremity of a full-...	50	0.007
260	emb|BX050111.1|CNS09ATV Single read from an extremity of a full-...	50	0.007
261	emb|BX051261.1|CNS09BPT Single read from an extremity of a full-...	50	0.007
262	emb|BX051260.1|CNS09BPS Single read from an extremity of a full-...	50	0.007
263	emb|BX051015.1|CNS09BIZ Single read from an extremity of a full-...	50	0.007
264	emb|BX050930.1|CNS09BGM Single read from an extremity of a full-...	50	0.007
265	emb|BX050819.1|CNS09BDJ Single read from an extremity of a full-...	50	0.007
266	emb|BX050476.1|CNS09B40 Single read from an extremity of a full-...	50	0.007
267	emb|BX050475.1|CNS09B3Z Single read from an extremity of a full-...	50	0.007
268	emb|BX050063.1|CNS09ASJ Single read from an extremity of a full-...	50	0.007
269	emb|BX050062.1|CNS09ASI Single read from an extremity of a full-...	50	0.007
270	emb|BX049956.1|CNS09APK Single read from an extremity of a full-...	50	0.007
271	emb|BX049955.1|CNS09APJ Single read from an extremity of a full-...	50	0.007
272	emb|BX049940.1|CNS09AP4 Single read from an extremity of a full-...	50	0.007
273	emb|BX049705.1|CNS09AIL Single read from an extremity of a full-...	50	0.007
274	emb|BX049704.1|CNS09AIK Single read from an extremity of a full-...	50	0.007
275	emb|BX049693.1|CNS09AI9 Single read from an extremity of a full-...	50	0.007
276	emb|BX049692.1|CNS09AI8 Single read from an extremity of a full-...	50	0.007
277	emb|BX049619.1|CNS09AG7 Single read from an extremity of a full-...	50	0.007
278	emb|BX049594.1|CNS09AFI Single read from an extremity of a full-...	50	0.007
279	emb|BX049526.1|CNS09ADM Single read from an extremity of a full-...	50	0.007
280	emb|BX049299.1|CNS09A7B Single read from an extremity of a full-...	50	0.007
281	emb|BX049259.1|CNS09A67 Single read from an extremity of a full-...	50	0.007
282	emb|BX049258.1|CNS09A66 Single read from an extremity of a full-...	50	0.007
283	emb|BX049231.1|CNS09A5F Single read from an extremity of a full-...	50	0.007
284	emb|BX049230.1|CNS09A5E Single read from an extremity of a full-...	50	0.007
285	emb|BX049013.1|CNS099ZD Single read from an extremity of a full-...	50	0.007
286	emb|BX049012.1|CNS099ZC Single read from an extremity of a full-...	50	0.007
287	emb|BX048919.1|CNS099WR Single read from an extremity of a full-...	50	0.007
288	emb|BX048918.1|CNS099WQ Single read from an extremity of a full-...	50	0.007
289	emb|BX048913.1|CNS099WL Single read from an extremity of a full-...	50	0.007
290	emb|BX048912.1|CNS099WK Single read from an extremity of a full-...	50	0.007
291	emb|BX048854.1|CNS099UY Single read from an extremity of a full-...	50	0.007
292	emb|BX048810.1|CNS099TQ Single read from an extremity of a full-...	50	0.007
293	emb|BX048809.1|CNS099TP Single read from an extremity of a full-...	50	0.007
294	emb|BX048748.1|CNS099S0 Single read from an extremity of a full-...	50	0.007
295	emb|BX048677.1|CNS099Q1 Single read from an extremity of a full-...	50	0.007
296	emb|BX046549.1|CNS0982X Single read from an extremity of a full-...	50	0.007
297	emb|BX046430.1|CNS097ZM Single read from an extremity of a full-...	50	0.007
298	emb|BX046429.1|CNS097ZL Single read from an extremity of a full-...	50	0.007
299	emb|BX048342.1|CNS099GQ Single read from an extremity of a full-...	50	0.007
300	emb|BX048271.1|CNS099ER Single read from an extremity of a full-...	50	0.007
301	emb|BX048270.1|CNS099EQ Single read from an extremity of a full-...	50	0.007
302	emb|BX048165.1|CNS099BT Single read from an extremity of a full-...	50	0.007
303	emb|BX048164.1|CNS099BS Single read from an extremity of a full-...	50	0.007
304	emb|BX047978.1|CNS0996M Single read from an extremity of a full-...	50	0.007
305	emb|BX047977.1|CNS0996L Single read from an extremity of a full-...	50	0.007
306	emb|BX047590.1|CNS098VU Single read from an extremity of a full-...	50	0.007
307	emb|BX047515.1|CNS098TR Single read from an extremity of a full-...	50	0.007
308	emb|BX047261.1|CNS098MP Single read from an extremity of a full-...	50	0.007
309	emb|BX047134.1|CNS098J6 Single read from an extremity of a full-...	50	0.007
310	emb|BX047133.1|CNS098J5 Single read from an extremity of a full-...	50	0.007
311	emb|BX047120.1|CNS098IS Single read from an extremity of a full-...	50	0.007
312	emb|BX047119.1|CNS098IR Single read from an extremity of a full-...	50	0.007
313	emb|BX047061.1|CNS098H5 Single read from an extremity of a full-...	50	0.007
314	emb|BX046817.1|CNS098AD Single read from an extremity of a full-...	50	0.007
315	emb|BX046816.1|CNS098AC Single read from an extremity of a full-...	50	0.007
316	emb|BX046784.1|CNS0989G Single read from an extremity of a full-...	50	0.007
317	emb|BX046783.1|CNS0989F Single read from an extremity of a full-...	50	0.007
318	emb|BX046260.1|CNS097UW Single read from an extremity of a full-...	50	0.007
319	emb|BX046259.1|CNS097UV Single read from an extremity of a full-...	50	0.007
320	emb|BX046221.1|CNS097TT Single read from an extremity of a full-...	50	0.007
321	emb|BX046085.1|CNS097Q1 Single read from an extremity of a full-...	50	0.007
322	emb|BX045716.1|CNS097FS Single read from an extremity of a full-...	50	0.007
323	emb|BX045715.1|CNS097FR Single read from an extremity of a full-...	50	0.007
324	emb|BX045556.1|CNS097BC Single read from an extremity of a full-...	50	0.007
325	emb|BX045555.1|CNS097BB Single read from an extremity of a full-...	50	0.007
326	emb|BX045403.1|CNS09773 Single read from an extremity of a full-...	50	0.007
327	emb|BX045134.1|CNS096ZM Single read from an extremity of a full-...	50	0.007
328	emb|BX044945.1|CNS096UD Single read from an extremity of a full-...	50	0.007
329	emb|BX044944.1|CNS096UC Single read from an extremity of a full-...	50	0.007
330	emb|BX044938.1|CNS096U6 Single read from an extremity of a full-...	50	0.007
331	emb|BX045333.1|CNS09755 Single read from an extremity of a full-...	50	0.007
332	emb|BX045149.1|CNS09701 Single read from an extremity of a full-...	50	0.007
333	emb|BX045148.1|CNS09700 Single read from an extremity of a full-...	50	0.007
334	emb|BX044899.1|CNS096T3 Single read from an extremity of a full-...	50	0.007
335	emb|BX044760.1|CNS096P8 Single read from an extremity of a full-...	50	0.007
336	emb|BX044759.1|CNS096P7 Single read from an extremity of a full-...	50	0.007
337	emb|BX044734.1|CNS096OI Single read from an extremity of a full-...	50	0.007
338	emb|BX044733.1|CNS096OH Single read from an extremity of a full-...	50	0.007
339	emb|BX043058.1|CNS095DY Single read from an extremity of a full-...	50	0.007
340	emb|BX042942.1|CNS095AQ Single read from an extremity of a full-...	50	0.007
341	emb|BX042940.1|CNS095AO Single read from an extremity of a full-...	50	0.007
342	emb|BX044572.1|CNS096K0 Single read from an extremity of a full-...	50	0.007
343	emb|BX044571.1|CNS096JZ Single read from an extremity of a full-...	50	0.007
344	emb|BX044556.1|CNS096JK Single read from an extremity of a full-...	50	0.007
345	emb|BX044555.1|CNS096JJ Single read from an extremity of a full-...	50	0.007
346	emb|BX044543.1|CNS096J7 Single read from an extremity of a full-...	50	0.007
347	emb|BX044359.1|CNS096E3 Single read from an extremity of a full-...	50	0.007
348	emb|BX044326.1|CNS096D6 Single read from an extremity of a full-...	50	0.007
349	emb|BX043414.1|CNS095NU Single read from an extremity of a full-...	50	0.007
350	emb|BX043413.1|CNS095NT Single read from an extremity of a full-...	50	0.007
351	emb|BX043705.1|CNS095VX Single read from an extremity of a full-...	50	0.007
352	emb|BX043704.1|CNS095VW Single read from an extremity of a full-...	50	0.007
353	emb|BX043693.1|CNS095VL Single read from an extremity of a full-...	50	0.007
354	emb|BX043692.1|CNS095VK Single read from an extremity of a full-...	50	0.007
355	emb|BX043620.1|CNS095TK Single read from an extremity of a full-...	50	0.007
356	emb|BX043253.1|CNS095JD Single read from an extremity of a full-...	50	0.007
357	emb|BX043218.1|CNS095IE Single read from an extremity of a full-...	50	0.007
358	emb|BX043217.1|CNS095ID Single read from an extremity of a full-...	50	0.007
359	emb|BX042607.1|CNS0951F Single read from an extremity of a full-...	50	0.007
360	emb|BX042544.1|CNS094ZO Single read from an extremity of a full-...	50	0.007
361	emb|BX042501.1|CNS094YH Single read from an extremity of a full-...	50	0.007
362	emb|BX042314.1|CNS094TA Single read from an extremity of a full-...	50	0.007
363	emb|BX042313.1|CNS094T9 Single read from an extremity of a full-...	50	0.007
364	emb|BX042171.1|CNS094PB Single read from an extremity of a full-...	50	0.007
365	emb|BX042170.1|CNS094PA Single read from an extremity of a full-...	50	0.007
366	emb|BX042114.1|CNS094NQ Single read from an extremity of a full-...	50	0.007
367	emb|BX042113.1|CNS094NP Single read from an extremity of a full-...	50	0.007
368	emb|BX041967.1|CNS094JN Single read from an extremity of a full-...	50	0.007
369	emb|BX041966.1|CNS094JM Single read from an extremity of a full-...	50	0.007
370	emb|BX041543.1|CNS0947V Single read from an extremity of a full-...	50	0.007
371	emb|BX041542.1|CNS0947U Single read from an extremity of a full-...	50	0.007
372	emb|BX041157.1|CNS093X5 Single read from an extremity of a full-...	50	0.007
373	emb|BX041079.1|CNS093UZ Single read from an extremity of a full-...	50	0.007
374	emb|BX041078.1|CNS093UY Single read from an extremity of a full-...	50	0.007
375	emb|BX041061.1|CNS093UH Single read from an extremity of a full-...	50	0.007
376	emb|BX041042.1|CNS093TY Single read from an extremity of a full-...	50	0.007
377	emb|BX041041.1|CNS093TX Single read from an extremity of a full-...	50	0.007
378	emb|BX041013.1|CNS093T5 Single read from an extremity of a full-...	50	0.007
379	emb|BX041004.1|CNS093SW Single read from an extremity of a full-...	50	0.007
380	emb|BX041003.1|CNS093SV Single read from an extremity of a full-...	50	0.007
381	emb|BX040961.1|CNS093RP Single read from an extremity of a full-...	50	0.007
382	emb|BX040913.1|CNS093QD Single read from an extremity of a full-...	50	0.007
383	emb|BX040657.1|CNS093J9 Single read from an extremity of a full-...	50	0.007
384	emb|BX040656.1|CNS093J8 Single read from an extremity of a full-...	50	0.007
385	emb|BX040549.1|CNS093G9 Single read from an extremity of a full-...	50	0.007
386	emb|BX040526.1|CNS093FM Single read from an extremity of a full-...	50	0.007
387	emb|BX040525.1|CNS093FL Single read from an extremity of a full-...	50	0.007
388	emb|BX040483.1|CNS093EF Single read from an extremity of a full-...	50	0.007
389	emb|BX040482.1|CNS093EE Single read from an extremity of a full-...	50	0.007
390	emb|BX040432.1|CNS093D0 Single read from an extremity of a full-...	50	0.007
391	emb|BX040275.1|CNS0938N Single read from an extremity of a full-...	50	0.007
392	emb|BX040094.1|CNS0933M Single read from an extremity of a full-...	50	0.007
393	emb|BX040093.1|CNS0933L Single read from an extremity of a full-...	50	0.007
394	emb|BX039846.1|CNS092WQ Single read from an extremity of a full-...	50	0.007
395	emb|BX039845.1|CNS092WP Single read from an extremity of a full-...	50	0.007
396	emb|BX039411.1|CNS092KN Single read from an extremity of a full-...	50	0.007
397	emb|BX039258.1|CNS092GE Single read from an extremity of a full-...	50	0.007
398	emb|BX039226.1|CNS092FI Single read from an extremity of a full-...	50	0.007
399	emb|BX038716.1|CNS0921C Single read from an extremity of a full-...	50	0.007
400	emb|BX038017.1|CNS091HX Single read from an extremity of a full-...	50	0.007
401	emb|BX038016.1|CNS091HW Single read from an extremity of a full-...	50	0.007
402	emb|BX037836.1|CNS091CW Single read from an extremity of a full-...	50	0.007
403	emb|BX037835.1|CNS091CV Single read from an extremity of a full-...	50	0.007
404	emb|BX035905.1|CNS08ZV9 Single read from an extremity of a full-...	50	0.007
405	emb|BX035473.1|CNS08ZJ9 Single read from an extremity of a full-...	50	0.007
406	emb|BX035472.1|CNS08ZJ8 Single read from an extremity of a full-...	50	0.007
407	emb|BX034565.1|CNS08YU1 Single read from an extremity of a full-...	50	0.007
408	emb|BX034564.1|CNS08YU0 Single read from an extremity of a full-...	50	0.007
409	emb|BX034153.1|CNS08YIL Single read from an extremity of a full-...	50	0.007
410	emb|BX034152.1|CNS08YIK Single read from an extremity of a full-...	50	0.007
411	emb|BX033493.1|CNS08Y09 Single read from an extremity of a full-...	50	0.007
412	emb|BX031539.1|CNS08WHZ Single read from an extremity of a full-...	50	0.007
413	emb|BX031538.1|CNS08WHY Single read from an extremity of a full-...	50	0.007
414	emb|BX029440.1|CNS08UVO Single read from an extremity of a full-...	50	0.007
415	emb|BX029439.1|CNS08UVN Single read from an extremity of a full-...	50	0.007
416	emb|BX029319.1|CNS08USB Single read from an extremity of a full-...	50	0.007
417	emb|BX029318.1|CNS08USA Single read from an extremity of a full-...	50	0.007
418	emb|BX029180.1|CNS08UOG Single read from an extremity of a full-...	50	0.007
419	emb|BX029179.1|CNS08UOF Single read from an extremity of a full-...	50	0.007
420	emb|BX028718.1|CNS08UBM Single read from an extremity of a full-...	50	0.007
421	emb|BX028717.1|CNS08UBL Single read from an extremity of a full-...	50	0.007
422	emb|BX026644.1|CNS08SQ0 Single read from an extremity of a full-...	50	0.007
423	emb|BX026643.1|CNS08SPZ Single read from an extremity of a full-...	50	0.007
424	emb|BX026053.1|CNS08S9L Single read from an extremity of a full-...	50	0.007
425	emb|BX026052.1|CNS08S9K Single read from an extremity of a full-...	50	0.007
426	emb|BX025871.1|CNS08S4J Single read from an extremity of a full-...	50	0.007
427	emb|BX025777.1|CNS08S1X Single read from an extremity of a full-...	50	0.007
428	emb|BX025776.1|CNS08S1W Single read from an extremity of a full-...	50	0.007
429	emb|BX024996.1|CNS08RG8 Single read from an extremity of a full-...	50	0.007
430	emb|BX024995.1|CNS08RG7 Single read from an extremity of a full-...	50	0.007
431	emb|BX024990.1|CNS08RG2 Single read from an extremity of a full-...	50	0.007
432	emb|BX024989.1|CNS08RG1 Single read from an extremity of a full-...	50	0.007
433	emb|BX023126.1|CNS08Q0A Single read from an extremity of a full-...	50	0.007
434	emb|BX022230.1|CNS08PBE Single read from an extremity of a full-...	50	0.007
435	emb|BX022229.1|CNS08PBD Single read from an extremity of a full-...	50	0.007
436	emb|BX021905.1|CNS08P2D Single read from an extremity of a full-...	50	0.007
437	emb|BX021904.1|CNS08P2C Single read from an extremity of a full-...	50	0.007
438	emb|BX021723.1|CNS08OXB Single read from an extremity of a full-...	50	0.007
439	emb|BX021634.1|CNS08OUU Single read from an extremity of a full-...	50	0.007
440	emb|BX021059.1|CNS08OEV Single read from an extremity of a full-...	50	0.007
441	emb|BX017503.1|CNS08LO3 Single read from an extremity of a full-...	50	0.007
442	emb|BX017502.1|CNS08LO2 Single read from an extremity of a full-...	50	0.007
443	emb|BX017166.1|CNS08LEQ Single read from an extremity of a full-...	50	0.007
444	emb|BX017165.1|CNS08LEP Single read from an extremity of a full-...	50	0.007
445	emb|BX016802.1|CNS08L4M Single read from an extremity of a full-...	50	0.007
446	emb|BX015130.1|CNS08JU6 Single read from an extremity of a full-...	50	0.007
447	emb|BX015002.1|CNS08JQM Single read from an extremity of a full-...	50	0.007
448	emb|BX013744.1|CNS08IRO Single read from an extremity of a full-...	50	0.007
449	emb|BX013575.1|CNS08IMZ Single read from an extremity of a full-...	50	0.007
450	emb|BX013574.1|CNS08IMY Single read from an extremity of a full-...	50	0.007
451	emb|BX013565.1|CNS08IMP Single read from an extremity of a full-...	50	0.007
452	emb|BX013564.1|CNS08IMO Single read from an extremity of a full-...	50	0.007
453	emb|BX012455.1|CNS08HRV Single read from an extremity of a full-...	50	0.007
454	emb|BX012454.1|CNS08HRU Single read from an extremity of a full-...	50	0.007
455	emb|BX012250.1|CNS08HM6 Single read from an extremity of a full-...	50	0.007
456	emb|BX012249.1|CNS08HM5 Single read from an extremity of a full-...	50	0.007
457	emb|BX009742.1|CNS08FOI Single read from an extremity of a full-...	50	0.007
458	emb|BX009741.1|CNS08FOH Single read from an extremity of a full-...	50	0.007
459	emb|BX009281.1|CNS08FBP Single read from an extremity of a full-...	50	0.007
460	emb|BX009280.1|CNS08FBO Single read from an extremity of a full-...	50	0.007
461	emb|BX008197.1|CNS08EHL Single read from an extremity of a full-...	50	0.007
462	emb|BX008196.1|CNS08EHK Single read from an extremity of a full-...	50	0.007
463	emb|BX007065.1|CNS08DM5 Single read from an extremity of a full-...	50	0.007
464	emb|BX007002.1|CNS08DKE Single read from an extremity of a full-...	50	0.007
465	emb|BX007001.1|CNS08DKD Single read from an extremity of a full-...	50	0.007
466	emb|BX007137.1|CNS08DO5 Single read from an extremity of a full-...	50	0.007
467	emb|BX007136.1|CNS08DO4 Single read from an extremity of a full-...	50	0.007
468	emb|BX006303.1|CNS08D0Z Single read from an extremity of a full-...	50	0.007
469	emb|BX006302.1|CNS08D0Y Single read from an extremity of a full-...	50	0.007
470	emb|BX006198.1|CNS08CY2 Single read from an extremity of a full-...	50	0.007
471	emb|BX005818.1|CNS08CNI Single read from an extremity of a full-...	50	0.007
472	emb|BX005574.1|CNS08CGQ Single read from an extremity of a full-...	50	0.007
473	gb|U10045.1|PSU10045 Pisum sativum ribosomal protein L27 homolog...	50	0.007
474	gb|U10044.1|PSU10044 Pisum sativum ribosomal protein L27 homolog...	50	0.007
475	gb|U10043.1|PSU10043 Pisum sativum ribosomal protein L27 homolog...	50	0.007
476	ref|NM_113120.2| Arabidopsis thaliana structural constituent of ...	48	0.028
477	emb|BX072104.1|CNS09RSS Single read from an extremity of a full-...	48	0.028
478	emb|BX070590.1|CNS09QMQ Single read from an extremity of a full-...	48	0.028
479	emb|BX068046.1|CNS09OO2 Single read from an extremity of a full-...	48	0.028
480	emb|BX066570.1|CNS09NJ2 Single read from an extremity of a full-...	48	0.028
481	emb|BX065974.1|CNS09N2I Single read from an extremity of a full-...	48	0.028
482	emb|BX065587.1|CNS09MRR Single read from an extremity of a full-...	48	0.028
483	emb|BX065268.1|CNS09MIW Single read from an extremity of a full-...	48	0.028
484	emb|BX063140.1|CNS09KVS Single read from an extremity of a full-...	48	0.028
485	emb|BX063130.1|CNS09KVI Single read from an extremity of a full-...	48	0.028
486	emb|BX059767.1|CNS09IA3 Single read from an extremity of a full-...	48	0.028
487	emb|BX059252.1|CNS09HVS Single read from an extremity of a full-...	48	0.028
488	emb|BX058922.1|CNS09HMM Single read from an extremity of a full-...	48	0.028
489	emb|BX057112.1|CNS09G8C Single read from an extremity of a full-...	48	0.028
490	emb|BX055633.1|CNS09F39 Single read from an extremity of a full-...	48	0.028
491	emb|BX052425.1|CNS09CM5 Single read from an extremity of a full-...	48	0.028
492	emb|BX052061.1|CNS09CC1 Single read from an extremity of a full-...	48	0.028
493	emb|BX052060.1|CNS09CC0 Single read from an extremity of a full-...	48	0.028
494	emb|BX048855.1|CNS099UZ Single read from an extremity of a full-...	48	0.028
495	emb|BX048749.1|CNS099S1 Single read from an extremity of a full-...	48	0.028
496	emb|BX047516.1|CNS098TS Single read from an extremity of a full-...	48	0.028
497	emb|BX047062.1|CNS098H6 Single read from an extremity of a full-...	48	0.028
498	emb|BX046086.1|CNS097Q2 Single read from an extremity of a full-...	48	0.028
499	emb|BX042963.1|CNS095BB Single read from an extremity of a full-...	48	0.028
500	emb|BX044360.1|CNS096E4 Single read from an extremity of a full-...	48	0.028

---

>ref|XM_464969.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 689

 Score =  337 bits (170), Expect = 2e-89
 Identities = 258/288 (89%)
 Strand = Plus / Minus

                                                                       
Query: 210 cctagaagcggagcttggtgaagaaccacctgttcttgccggtcttgaacctctcctcga 269
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 525 cctagaagcggagcttggtgaagaaccacctgttcttgccggtcttgaacctctcctcga 466

                                                                       
Query: 270 gcttggccttggcggacttggcggcggtgagcttcttgtccttggtggtgagggagtcgg 329
           |    |||||||||| ||||  |||||  | |||||||||   ||||| ||||| |||||
Sbjct: 465 ggcgagccttggcggccttgcaggcggccaccttcttgtcgcgggtggcgagggcgtcgg 406

                                                                       
Query: 330 gggcgccggaggccacctccttgaggtcgacgtcgagggtgtagcgggtgggcatgangt 389
           |  | ||||||||||| ||||||| |||||||||||||||||||||||||||||||| ||
Sbjct: 405 gtcccccggaggccacgtccttgaagtcgacgtcgagggtgtagcgggtgggcatgatgt 346

                                                                       
Query: 390 gggtgaagttgacgagcttgaggaagaccttgacgcgcgacttcttggccgtcttcttng 449
           ||||||||||||||||||||||||||  |||||| | ||||||||| ||||||||||| |
Sbjct: 345 gggtgaagttgacgagcttgaggaagcacttgaccctcgacttcttcgccgtcttcttcg 286

                                                           
Query: 450 ccgagtccttgcggatcaccttcttggggtacttcgccaggccggcga 497
           ||||||||||||||||||||||||| |||||||| || ||||||||||
Sbjct: 285 ccgagtccttgcggatcaccttcttcgggtacttggcgaggccggcga 238

---

>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
                sequence
          Length = 35954743

 Score =  337 bits (170), Expect = 2e-89
 Identities = 258/288 (89%)
 Strand = Plus / Plus

                                                                            
Query: 210      cctagaagcggagcttggtgaagaaccacctgttcttgccggtcttgaacctctcctcga 269
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 10700091 cctagaagcggagcttggtgaagaaccacctgttcttgccggtcttgaacctctcctcga 10700150

                                                                            
Query: 270      gcttggccttggcggacttggcggcggtgagcttcttgtccttggtggtgagggagtcgg 329
                |    |||||||||| ||||  |||||  | |||||||||   ||||| ||||| |||||
Sbjct: 10700151 ggcgagccttggcggccttgcaggcggccaccttcttgtcgcgggtggcgagggcgtcgg 10700210

                                                                            
Query: 330      gggcgccggaggccacctccttgaggtcgacgtcgagggtgtagcgggtgggcatgangt 389
                |  | ||||||||||| ||||||| |||||||||||||||||||||||||||||||| ||
Sbjct: 10700211 gtcccccggaggccacgtccttgaagtcgacgtcgagggtgtagcgggtgggcatgatgt 10700270

                                                                            
Query: 390      gggtgaagttgacgagcttgaggaagaccttgacgcgcgacttcttggccgtcttcttng 449
                ||||||||||||||||||||||||||  |||||| | ||||||||| ||||||||||| |
Sbjct: 10700271 gggtgaagttgacgagcttgaggaagcacttgaccctcgacttcttcgccgtcttcttcg 10700330

                                                                
Query: 450      ccgagtccttgcggatcaccttcttggggtacttcgccaggccggcga 497
                ||||||||||||||||||||||||| |||||||| || ||||||||||
Sbjct: 10700331 ccgagtccttgcggatcaccttcttcgggtacttggcgaggccggcga 10700378

---

>dbj|AP005533.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
              clone:OSJNBa0018M09
          Length = 157377

 Score =  337 bits (170), Expect = 2e-89
 Identities = 258/288 (89%)
 Strand = Plus / Plus

                                                                          
Query: 210    cctagaagcggagcttggtgaagaaccacctgttcttgccggtcttgaacctctcctcga 269
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 117781 cctagaagcggagcttggtgaagaaccacctgttcttgccggtcttgaacctctcctcga 117840

                                                                          
Query: 270    gcttggccttggcggacttggcggcggtgagcttcttgtccttggtggtgagggagtcgg 329
              |    |||||||||| ||||  |||||  | |||||||||   ||||| ||||| |||||
Sbjct: 117841 ggcgagccttggcggccttgcaggcggccaccttcttgtcgcgggtggcgagggcgtcgg 117900

                                                                          
Query: 330    gggcgccggaggccacctccttgaggtcgacgtcgagggtgtagcgggtgggcatgangt 389
              |  | ||||||||||| ||||||| |||||||||||||||||||||||||||||||| ||
Sbjct: 117901 gtcccccggaggccacgtccttgaagtcgacgtcgagggtgtagcgggtgggcatgatgt 117960

                                                                          
Query: 390    gggtgaagttgacgagcttgaggaagaccttgacgcgcgacttcttggccgtcttcttng 449
              ||||||||||||||||||||||||||  |||||| | ||||||||| ||||||||||| |
Sbjct: 117961 gggtgaagttgacgagcttgaggaagcacttgaccctcgacttcttcgccgtcttcttcg 118020

                                                              
Query: 450    ccgagtccttgcggatcaccttcttggggtacttcgccaggccggcga 497
              ||||||||||||||||||||||||| |||||||| || ||||||||||
Sbjct: 118021 ccgagtccttgcggatcaccttcttcgggtacttggcgaggccggcga 118068

---

>dbj|AP004001.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OJ1115_D03
          Length = 169378

 Score =  337 bits (170), Expect = 2e-89
 Identities = 258/288 (89%)
 Strand = Plus / Plus

                                                                         
Query: 210   cctagaagcggagcttggtgaagaaccacctgttcttgccggtcttgaacctctcctcga 269
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 39572 cctagaagcggagcttggtgaagaaccacctgttcttgccggtcttgaacctctcctcga 39631

                                                                         
Query: 270   gcttggccttggcggacttggcggcggtgagcttcttgtccttggtggtgagggagtcgg 329
             |    |||||||||| ||||  |||||  | |||||||||   ||||| ||||| |||||
Sbjct: 39632 ggcgagccttggcggccttgcaggcggccaccttcttgtcgcgggtggcgagggcgtcgg 39691

                                                                         
Query: 330   gggcgccggaggccacctccttgaggtcgacgtcgagggtgtagcgggtgggcatgangt 389
             |  | ||||||||||| ||||||| |||||||||||||||||||||||||||||||| ||
Sbjct: 39692 gtcccccggaggccacgtccttgaagtcgacgtcgagggtgtagcgggtgggcatgatgt 39751

                                                                         
Query: 390   gggtgaagttgacgagcttgaggaagaccttgacgcgcgacttcttggccgtcttcttng 449
             ||||||||||||||||||||||||||  |||||| | ||||||||| ||||||||||| |
Sbjct: 39752 gggtgaagttgacgagcttgaggaagcacttgaccctcgacttcttcgccgtcttcttcg 39811

                                                             
Query: 450   ccgagtccttgcggatcaccttcttggggtacttcgccaggccggcga 497
             ||||||||||||||||||||||||| |||||||| || ||||||||||
Sbjct: 39812 ccgagtccttgcggatcaccttcttcgggtacttggcgaggccggcga 39859

---

>dbj|AK121593.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033038C19, full
           insert sequence
          Length = 689

 Score =  337 bits (170), Expect = 2e-89
 Identities = 258/288 (89%)
 Strand = Plus / Minus

                                                                       
Query: 210 cctagaagcggagcttggtgaagaaccacctgttcttgccggtcttgaacctctcctcga 269
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 525 cctagaagcggagcttggtgaagaaccacctgttcttgccggtcttgaacctctcctcga 466

                                                                       
Query: 270 gcttggccttggcggacttggcggcggtgagcttcttgtccttggtggtgagggagtcgg 329
           |    |||||||||| ||||  |||||  | |||||||||   ||||| ||||| |||||
Sbjct: 465 ggcgagccttggcggccttgcaggcggccaccttcttgtcgcgggtggcgagggcgtcgg 406

                                                                       
Query: 330 gggcgccggaggccacctccttgaggtcgacgtcgagggtgtagcgggtgggcatgangt 389
           |  | ||||||||||| ||||||| |||||||||||||||||||||||||||||||| ||
Sbjct: 405 gtcccccggaggccacgtccttgaagtcgacgtcgagggtgtagcgggtgggcatgatgt 346

                                                                       
Query: 390 gggtgaagttgacgagcttgaggaagaccttgacgcgcgacttcttggccgtcttcttng 449
           ||||||||||||||||||||||||||  |||||| | ||||||||| ||||||||||| |
Sbjct: 345 gggtgaagttgacgagcttgaggaagcacttgaccctcgacttcttcgccgtcttcttcg 286

                                                           
Query: 450 ccgagtccttgcggatcaccttcttggggtacttcgccaggccggcga 497
           ||||||||||||||||||||||||| |||||||| || ||||||||||
Sbjct: 285 ccgagtccttgcggatcaccttcttcgggtacttggcgaggccggcga 238

---

>ref|NM_197775.1| Oryza sativa (japonica cultivar-group) putative ribosomal protein
           L27 (OSJNBa0027P10.10), mRNA
          Length = 676

 Score =  335 bits (169), Expect = 8e-89
 Identities = 256/285 (89%), Gaps = 3/285 (1%)
 Strand = Plus / Minus

                                                                       
Query: 213 agaagcggagcttggtgaagaaccacctgttcttgccggtcttgaacctctcctcgagct 272
           |||||||||||||||||||||||||||||||||||||||||||||| |  ||||||||  
Sbjct: 449 agaagcggagcttggtgaagaaccacctgttcttgccggtcttgaagcggtcctcgaggc 390

                                                                       
Query: 273 tggccttggcggacttggcggcggtgagcttcttgtccttggtggtgagggagtcggggg 332
             |||||||||||||||  ||||| || |||||||||| |||||| ||| | ||||||  
Sbjct: 389 gcgccttggcggacttgcaggcggcgaccttcttgtccctggtggcgagcgcgtcgggc- 331

                                                                       
Query: 333 cgccggaggccacctccttgaggtcgacgtcgagggtgtagcgggtgggcatgangtggg 392
             || | ||| ||||||||||||||||||||||||||||||||||||||||||| |||||
Sbjct: 330 --cccgcggcgacctccttgaggtcgacgtcgagggtgtagcgggtgggcatgaggtggg 273

                                                                       
Query: 393 tgaagttgacgagcttgaggaagaccttgacgcgcgacttcttggccgtcttcttngccg 452
           |||||||||||||||||||||||  |||||||||||||||||| ||||||||||| ||||
Sbjct: 272 tgaagttgacgagcttgaggaagcacttgacgcgcgacttcttcgccgtcttcttcgccg 213

                                                        
Query: 453 agtccttgcggatcaccttcttggggtacttcgccaggccggcga 497
           ||||||||||||||||||||||||||||||| || ||||||||||
Sbjct: 212 agtccttgcggatcaccttcttggggtacttggcgaggccggcga 168

---

>gb|AC084763.4| Oryza sativa chromosome 10 BAC OSJNBa0027P10 genomic sequence, complete
             sequence
          Length = 141307

 Score =  335 bits (169), Expect = 8e-89
 Identities = 256/285 (89%), Gaps = 3/285 (1%)
 Strand = Plus / Plus

                                                                         
Query: 213   agaagcggagcttggtgaagaaccacctgttcttgccggtcttgaacctctcctcgagct 272
             |||||||||||||||||||||||||||||||||||||||||||||| |  ||||||||  
Sbjct: 84027 agaagcggagcttggtgaagaaccacctgttcttgccggtcttgaagcggtcctcgaggc 84086

                                                                         
Query: 273   tggccttggcggacttggcggcggtgagcttcttgtccttggtggtgagggagtcggggg 332
               |||||||||||||||  ||||| || |||||||||| |||||| ||| | ||||||  
Sbjct: 84087 gcgccttggcggacttgcaggcggcgaccttcttgtccctggtggcgagcgcgtcgggc- 84145

                                                                         
Query: 333   cgccggaggccacctccttgaggtcgacgtcgagggtgtagcgggtgggcatgangtggg 392
               || | ||| ||||||||||||||||||||||||||||||||||||||||||| |||||
Sbjct: 84146 --cccgcggcgacctccttgaggtcgacgtcgagggtgtagcgggtgggcatgaggtggg 84203

                                                                         
Query: 393   tgaagttgacgagcttgaggaagaccttgacgcgcgacttcttggccgtcttcttngccg 452
             |||||||||||||||||||||||  |||||||||||||||||| ||||||||||| ||||
Sbjct: 84204 tgaagttgacgagcttgaggaagcacttgacgcgcgacttcttcgccgtcttcttcgccg 84263

                                                          
Query: 453   agtccttgcggatcaccttcttggggtacttcgccaggccggcga 497
             ||||||||||||||||||||||||||||||| || ||||||||||
Sbjct: 84264 agtccttgcggatcaccttcttggggtacttggcgaggccggcga 84308

---

>dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 10, complete
                sequence
          Length = 22685906

 Score =  335 bits (169), Expect = 8e-89
 Identities = 256/285 (89%), Gaps = 3/285 (1%)
 Strand = Plus / Plus

                                                                            
Query: 213      agaagcggagcttggtgaagaaccacctgttcttgccggtcttgaacctctcctcgagct 272
                |||||||||||||||||||||||||||||||||||||||||||||| |  ||||||||  
Sbjct: 21769344 agaagcggagcttggtgaagaaccacctgttcttgccggtcttgaagcggtcctcgaggc 21769403

                                                                            
Query: 273      tggccttggcggacttggcggcggtgagcttcttgtccttggtggtgagggagtcggggg 332
                  |||||||||||||||  ||||| || |||||||||| |||||| ||| | ||||||  
Sbjct: 21769404 gcgccttggcggacttgcaggcggcgaccttcttgtccctggtggcgagcgcgtcgggc- 21769462

                                                                            
Query: 333      cgccggaggccacctccttgaggtcgacgtcgagggtgtagcgggtgggcatgangtggg 392
                  || | ||| ||||||||||||||||||||||||||||||||||||||||||| |||||
Sbjct: 21769463 --cccgcggcgacctccttgaggtcgacgtcgagggtgtagcgggtgggcatgaggtggg 21769520

                                                                            
Query: 393      tgaagttgacgagcttgaggaagaccttgacgcgcgacttcttggccgtcttcttngccg 452
                |||||||||||||||||||||||  |||||||||||||||||| ||||||||||| ||||
Sbjct: 21769521 tgaagttgacgagcttgaggaagcacttgacgcgcgacttcttcgccgtcttcttcgccg 21769580

                                                             
Query: 453      agtccttgcggatcaccttcttggggtacttcgccaggccggcga 497
                ||||||||||||||||||||||||||||||| || ||||||||||
Sbjct: 21769581 agtccttgcggatcaccttcttggggtacttggcgaggccggcga 21769625

---

>dbj|AK066340.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013064A22, full
           insert sequence
          Length = 723

 Score =  335 bits (169), Expect = 8e-89
 Identities = 256/285 (89%), Gaps = 3/285 (1%)
 Strand = Plus / Minus

                                                                       
Query: 213 agaagcggagcttggtgaagaaccacctgttcttgccggtcttgaacctctcctcgagct 272
           |||||||||||||||||||||||||||||||||||||||||||||| |  ||||||||  
Sbjct: 463 agaagcggagcttggtgaagaaccacctgttcttgccggtcttgaagcggtcctcgaggc 404

                                                                       
Query: 273 tggccttggcggacttggcggcggtgagcttcttgtccttggtggtgagggagtcggggg 332
             |||||||||||||||  ||||| || |||||||||| |||||| ||| | ||||||  
Sbjct: 403 gcgccttggcggacttgcaggcggcgaccttcttgtccctggtggcgagcgcgtcgggc- 345

                                                                       
Query: 333 cgccggaggccacctccttgaggtcgacgtcgagggtgtagcgggtgggcatgangtggg 392
             || | ||| ||||||||||||||||||||||||||||||||||||||||||| |||||
Sbjct: 344 --cccgcggcgacctccttgaggtcgacgtcgagggtgtagcgggtgggcatgaggtggg 287

                                                                       
Query: 393 tgaagttgacgagcttgaggaagaccttgacgcgcgacttcttggccgtcttcttngccg 452
           |||||||||||||||||||||||  |||||||||||||||||| ||||||||||| ||||
Sbjct: 286 tgaagttgacgagcttgaggaagcacttgacgcgcgacttcttcgccgtcttcttcgccg 227

                                                        
Query: 453 agtccttgcggatcaccttcttggggtacttcgccaggccggcga 497
           ||||||||||||||||||||||||||||||| || ||||||||||
Sbjct: 226 agtccttgcggatcaccttcttggggtacttggcgaggccggcga 182

---

>gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence
          Length = 22698374

 Score =  335 bits (169), Expect = 8e-89
 Identities = 256/285 (89%), Gaps = 3/285 (1%)
 Strand = Plus / Plus

                                                                            
Query: 213      agaagcggagcttggtgaagaaccacctgttcttgccggtcttgaacctctcctcgagct 272
                |||||||||||||||||||||||||||||||||||||||||||||| |  ||||||||  
Sbjct: 21781007 agaagcggagcttggtgaagaaccacctgttcttgccggtcttgaagcggtcctcgaggc 21781066

                                                                            
Query: 273      tggccttggcggacttggcggcggtgagcttcttgtccttggtggtgagggagtcggggg 332
                  |||||||||||||||  ||||| || |||||||||| |||||| ||| | ||||||  
Sbjct: 21781067 gcgccttggcggacttgcaggcggcgaccttcttgtccctggtggcgagcgcgtcgggc- 21781125

                                                                            
Query: 333      cgccggaggccacctccttgaggtcgacgtcgagggtgtagcgggtgggcatgangtggg 392
                  || | ||| ||||||||||||||||||||||||||||||||||||||||||| |||||
Sbjct: 21781126 --cccgcggcgacctccttgaggtcgacgtcgagggtgtagcgggtgggcatgaggtggg 21781183

                                                                            
Query: 393      tgaagttgacgagcttgaggaagaccttgacgcgcgacttcttggccgtcttcttngccg 452
                |||||||||||||||||||||||  |||||||||||||||||| ||||||||||| ||||
Sbjct: 21781184 tgaagttgacgagcttgaggaagcacttgacgcgcgacttcttcgccgtcttcttcgccg 21781243

                                                             
Query: 453      agtccttgcggatcaccttcttggggtacttcgccaggccggcga 497
                ||||||||||||||||||||||||||||||| || ||||||||||
Sbjct: 21781244 agtccttgcggatcaccttcttggggtacttggcgaggccggcga 21781288

---

>gb|BT016577.1| Zea mays clone Contig410 mRNA sequence
          Length = 724

 Score =  319 bits (161), Expect = 5e-84
 Identities = 255/287 (88%)
 Strand = Plus / Minus

                                                                       
Query: 211 ctagaagcggagcttggtgaagaaccacctgttcttgccggtcttgaacctctcctcgag 270
           |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||
Sbjct: 454 ctagaagcggagcttggtaaagaaccacctgttcttgccggtcttgaacctctcctcgag 395

                                                                       
Query: 271 cttggccttggcggacttggcggcggtgagcttcttgtccttggtggtgagggagtcggg 330
               |||||||||| ||||   |||| || |||||||||   ||||| ||| | ||||||
Sbjct: 394 gcgcgccttggcggccttgcatgcggcgaccttcttgtcgcgggtggagagcgcgtcggg 335

                                                                       
Query: 331 ggcgccggaggccacctccttgaggtcgacgtcgagggtgtagcgggtgggcatgangtg 390
             |||||| |||||| ||||||| |||||||||||||||||||||||||||||||| |||
Sbjct: 334 cccgccggtggccacgtccttgaagtcgacgtcgagggtgtagcgggtgggcatgaggtg 275

                                                                       
Query: 391 ggtgaagttgacgagcttgaggaagaccttgacgcgcgacttcttggccgtcttcttngc 450
           |||||||||||||||||||| ||||  |||||||||||||||||| ||||||||||| ||
Sbjct: 274 ggtgaagttgacgagcttgatgaagcacttgacgcgcgacttcttcgccgtcttcttggc 215

                                                          
Query: 451 cgagtccttgcggatcaccttcttggggtacttcgccaggccggcga 497
           ||||||| |||||| |||||||||||||||||| || ||||||||||
Sbjct: 214 cgagtccctgcggaccaccttcttggggtacttggcgaggccggcga 168

---

>gb|BT017753.1| Zea mays clone EL01N0450E09.c mRNA sequence
          Length = 537

 Score =  297 bits (150), Expect = 2e-77
 Identities = 253/288 (87%)
 Strand = Plus / Minus

                                                                       
Query: 210 cctagaagcggagcttggtgaagaaccacctgttcttgccggtcttgaacctctcctcga 269
           |||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||
Sbjct: 336 cctaaaagcggagcttggtaaagaaccacctgttcttgccggtcttgaacctctcctcga 277

                                                                       
Query: 270 gcttggccttggcggacttggcggcggtgagcttcttgtccttggtggtgagggagtcgg 329
           |    |||||||||| ||||  |||   || ||||||||||  ||||| ||| | |||||
Sbjct: 276 ggcgcgccttggcggccttgcaggcttcgaccttcttgtcccgggtggagagcgcgtcgg 217

                                                                       
Query: 330 gggcgccggaggccacctccttgaggtcgacgtcgagggtgtagcgggtgggcatgangt 389
           |  |||| || || || ||||||| |||||||||||||||||||||||||||||||| ||
Sbjct: 216 gcccgcccgatgcgacgtccttgaagtcgacgtcgagggtgtagcgggtgggcatgaggt 157

                                                                       
Query: 390 gggtgaagttgacgagcttgaggaagaccttgacgcgcgacttcttggccgtcttcttng 449
           | ||||| ||||||||||||| ||||  ||||||||| |||||||||||||||||||| |
Sbjct: 156 gagtgaaattgacgagcttgatgaagcacttgacgcgggacttcttggccgtcttcttgg 97

                                                           
Query: 450 ccgagtccttgcggatcaccttcttggggtacttcgccaggccggcga 497
           | |||||||||||||||||||||||||||||||| |||||||||||||
Sbjct: 96  cggagtccttgcggatcaccttcttggggtacttggccaggccggcga 49

---

>gb|AY104535.1| Zea mays PCO094675 mRNA sequence
          Length = 995

 Score =  256 bits (129), Expect = 6e-65
 Identities = 247/287 (86%)
 Strand = Plus / Minus

                                                                       
Query: 211 ctagaagcggagcttggtgaagaaccacctgttcttgccggtcttgaacctctcctcgag 270
           |||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||
Sbjct: 478 ctagaagcggagcttggtaaagaaccacctgttcttgccggtcttgaacctctcctcaag 419

                                                                       
Query: 271 cttggccttggcggacttggcggcggtgagcttcttgtccttggtggtgagggagtcggg 330
               || ||||| | ||||  ||||| || ||||||||| | ||| | ||| | ||||||
Sbjct: 418 gcgcgctttggccgtcttgcaggcggcgaccttcttgtcgtgggtagagagtgcgtcggg 359

                                                                       
Query: 331 ggcgccggaggccacctccttgaggtcgacgtcgagggtgtagcgggtgggcatgangtg 390
             | |||| ||| || |||||||  ||||||||||||||||||||||||||||||| |||
Sbjct: 358 cccaccggtggcgacatccttgaaatcgacgtcgagggtgtagcgggtgggcatgaggtg 299

                                                                       
Query: 391 ggtgaagttgacgagcttgaggaagaccttgacgcgcgacttcttggccgtcttcttngc 450
            ||||||||||||||||||| ||||  |||||||||||||||||| || |||||||| ||
Sbjct: 298 agtgaagttgacgagcttgatgaagcacttgacgcgcgacttcttcgcagtcttcttggc 239

                                                          
Query: 451 cgagtccttgcggatcaccttcttggggtacttcgccaggccggcga 497
            ||||||||||||||||||||||| |||||||| || ||||| ||||
Sbjct: 238 ggagtccttgcggatcaccttctttgggtacttggcgaggcctgcga 192

---

>emb|X68202.1|CSL27 C.stellata mRNA for ribosomal protein L27
          Length = 485

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 54/56 (96%)
 Strand = Plus / Minus

                                                                   
Query: 212 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttgaacctctcctc 267
           |||||||| ||||||||||||||||||||||||||||||||||||||| |||||||
Sbjct: 427 tagaagcgcagcttggtgaagaaccacctgttcttgccggtcttgaacttctcctc 372



 Score = 48.1 bits (24), Expect = 0.028
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                  
Query: 348 ccttgaggtcgacgtcgagggtgtagcgggtgggcatgangtgggtgaagttgac 402
           |||||| ||| || || |||||||||||||||||||| | |||| || |||||||
Sbjct: 300 ccttgaagtccacatccagggtgtagcgggtgggcatcaggtggttgtagttgac 246

---

>ref|NM_117587.2| Arabidopsis thaliana structural constituent of ribosome AT4G15000
           mRNA, complete cds
          Length = 657

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 54/60 (90%)
 Strand = Plus / Minus

                                                                       
Query: 220 gagcttggtgaagaaccacctgttcttgccggtcttgaacctctcctcgagcttggcctt 279
           ||||||||| |||||||| |||||||| ||||| |||||||||||||| ||||| |||||
Sbjct: 462 gagcttggtaaagaaccatctgttcttaccggttttgaacctctcctcaagcttagcctt 403

---

>gb|DQ226702.1| Boechera divaricarpa isolate SLW-A-H01 mRNA sequence
          Length = 379

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 54/60 (90%)
 Strand = Plus / Minus

                                                                       
Query: 220 gagcttggtgaagaaccacctgttcttgccggtcttgaacctctcctcgagcttggcctt 279
           ||||||||||||||||||||||||||| || |||||||| | |||||| ||||| |||||
Sbjct: 215 gagcttggtgaagaaccacctgttcttcccagtcttgaaacgctcctcaagcttagcctt 156

---

>gb|BT014180.1| Lycopersicon esculentum clone 133344F, mRNA sequence
          Length = 640

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 100/122 (81%)
 Strand = Plus / Minus

                                                                       
Query: 362 tcgagggtgtagcgggtgggcatgangtgggtgaagttgacgagcttgaggaagaccttg 421
           ||||| ||||| || || ||||||| |||| || |||| |||||||||| |||  |||| 
Sbjct: 301 tcgagtgtgtaacgagtaggcatgatgtggttgtagttcacgagcttgatgaaagcctta 242

                                                                       
Query: 422 acgcgcgacttcttggccgtcttcttngccgagtccttgcggatcaccttcttggggtac 481
           || || || ||||| |||  |||||| || || |||||||||||||||||||| ||||||
Sbjct: 241 acacgagatttcttcgcctgcttctttgctgaatccttgcggatcaccttcttcgggtac 182

             
Query: 482 tt 483
           ||
Sbjct: 181 tt 180



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 52/61 (85%)
 Strand = Plus / Minus

                                                                       
Query: 221 agcttggtgaagaaccacctgttcttgccggtcttgaacctctcctcgagcttggccttg 280
           |||||||| |||||||| |  || || |||||||||||||||||||| ||| | ||||||
Sbjct: 436 agcttggtaaagaaccagcgatttttcccggtcttgaacctctcctcaagcctagccttg 377

            
Query: 281 g 281
           |
Sbjct: 376 g 376

---

>emb|Z97337.2|ATFCA2 Arabidopsis thaliana DNA chromosome 4, ESSA I FCA contig fragment No. 2
          Length = 202860

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 54/60 (90%)
 Strand = Plus / Minus

                                                                          
Query: 220    gagcttggtgaagaaccacctgttcttgccggtcttgaacctctcctcgagcttggcctt 279
              ||||||||| |||||||| |||||||| ||||| |||||||||||||| ||||| |||||
Sbjct: 137361 gagcttggtaaagaaccatctgttcttaccggttttgaacctctcctcaagcttagcctt 137302

---

>gb|AY096731.1| Arabidopsis thaliana putative ribosomal protein (At4g15000) mRNA,
           complete cds
          Length = 439

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 54/60 (90%)
 Strand = Plus / Minus

                                                                       
Query: 220 gagcttggtgaagaaccacctgttcttgccggtcttgaacctctcctcgagcttggcctt 279
           ||||||||| |||||||| |||||||| ||||| |||||||||||||| ||||| |||||
Sbjct: 399 gagcttggtaaagaaccatctgttcttaccggttttgaacctctcctcaagcttagcctt 340

---

>gb|AY063987.1| Arabidopsis thaliana putative ribosomal protein (At4g15000) mRNA,
           complete cds
          Length = 640

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 54/60 (90%)
 Strand = Plus / Minus

                                                                       
Query: 220 gagcttggtgaagaaccacctgttcttgccggtcttgaacctctcctcgagcttggcctt 279
           ||||||||| |||||||| |||||||| ||||| |||||||||||||| ||||| |||||
Sbjct: 462 gagcttggtaaagaaccatctgttcttaccggttttgaacctctcctcaagcttagcctt 403

---

>emb|BX827228.1|CNS0A2SV Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS23ZG03 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 625

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 54/60 (90%)
 Strand = Plus / Minus

                                                                       
Query: 220 gagcttggtgaagaaccacctgttcttgccggtcttgaacctctcctcgagcttggcctt 279
           ||||||||| |||||||| |||||||| ||||| |||||||||||||| ||||| |||||
Sbjct: 438 gagcttggtaaagaaccatctgttcttaccggttttgaacctctcctcaagcttagcctt 379

---

>emb|BX827216.1|CNS0A2RL Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS22ZD04 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 625

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 54/60 (90%)
 Strand = Plus / Minus

                                                                       
Query: 220 gagcttggtgaagaaccacctgttcttgccggtcttgaacctctcctcgagcttggcctt 279
           ||||||||| |||||||| |||||||| ||||| |||||||||||||| ||||| |||||
Sbjct: 438 gagcttggtaaagaaccatctgttcttaccggttttgaacctctcctcaagcttagcctt 379

---

>gb|AY085487.1| Arabidopsis thaliana clone 15384 mRNA, complete sequence
          Length = 631

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 54/60 (90%)
 Strand = Plus / Minus

                                                                       
Query: 220 gagcttggtgaagaaccacctgttcttgccggtcttgaacctctcctcgagcttggcctt 279
           ||||||||| |||||||| |||||||| || ||||||||||||||||| ||||| |||||
Sbjct: 460 gagcttggtaaagaaccatctgttcttaccagtcttgaacctctcctcaagcttagcctt 401

---

>emb|AL161540.2|ATCHRIV40 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 40
          Length = 197405

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 54/60 (90%)
 Strand = Plus / Minus

                                                                         
Query: 220   gagcttggtgaagaaccacctgttcttgccggtcttgaacctctcctcgagcttggcctt 279
             ||||||||| |||||||| |||||||| ||||| |||||||||||||| ||||| |||||
Sbjct: 82815 gagcttggtaaagaaccatctgttcttaccggttttgaacctctcctcaagcttagcctt 82756

---

>gb|AF401581.1| Ictalurus punctatus ribosomal protein L27 mRNA, complete cds
          Length = 469

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 63/73 (86%)
 Strand = Plus / Minus

                                                                       
Query: 210 cctagaagcggagcttggtgaagaaccacctgttcttgccggtcttgaacctctcctcga 269
           ||||||| ||||||||   |||||||||  ||||||||||||||||| |||||||||| |
Sbjct: 431 cctagaatcggagcttctggaagaaccatttgttcttgccggtcttgtacctctcctcaa 372

                        
Query: 270 gcttggccttggc 282
            |||| |||||||
Sbjct: 371 acttgaccttggc 359

---

>ref|NM_128781.2| Arabidopsis thaliana structural constituent of ribosome AT2G32220
           mRNA, complete cds
          Length = 605

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 41/44 (93%)
 Strand = Plus / Minus

                                                       
Query: 221 agcttggtgaagaaccacctgttcttgccggtcttgaacctctc 264
           ||||||||||||||||| ||||||||||| ||||| ||||||||
Sbjct: 424 agcttggtgaagaaccatctgttcttgccagtcttaaacctctc 381



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                    
Query: 422 acgcgcgacttcttggccgtcttcttngccgagtccttgcg 462
           |||||||| ||||| ||||||||||| ||||| ||||||||
Sbjct: 229 acgcgcgatttcttagccgtcttctttgccgaatccttgcg 189

---

>gb|AC006223.4| Arabidopsis thaliana chromosome 2 clone F22D22 map TEn5, complete
             sequence
          Length = 103194

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 41/44 (93%)
 Strand = Plus / Plus

                                                         
Query: 221   agcttggtgaagaaccacctgttcttgccggtcttgaacctctc 264
             ||||||||||||||||| ||||||||||| ||||| ||||||||
Sbjct: 10068 agcttggtgaagaaccatctgttcttgccagtcttaaacctctc 10111



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 37/41 (90%)
 Strand = Plus / Plus

                                                      
Query: 422   acgcgcgacttcttggccgtcttcttngccgagtccttgcg 462
             |||||||| ||||| ||||||||||| ||||| ||||||||
Sbjct: 10263 acgcgcgatttcttagccgtcttctttgccgaatccttgcg 10303

---

>gb|BT021972.1| Arabidopsis thaliana At2g32220 mRNA, complete cds
          Length = 509

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 41/44 (93%)
 Strand = Plus / Minus

                                                       
Query: 221 agcttggtgaagaaccacctgttcttgccggtcttgaacctctc 264
           ||||||||||||||||| ||||||||||| ||||| ||||||||
Sbjct: 417 agcttggtgaagaaccatctgttcttgccagtcttaaacctctc 374



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                    
Query: 422 acgcgcgacttcttggccgtcttcttngccgagtccttgcg 462
           |||||||| ||||| ||||||||||| ||||| ||||||||
Sbjct: 222 acgcgcgatttcttagccgtcttctttgccgaatccttgcg 182

---

>ref|XM_850644.1| PREDICTED: Canis familiaris similar to ribosomal protein L27,
           transcript variant 3 (LOC486183), mRNA
          Length = 464

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 48/54 (88%)
 Strand = Plus / Minus

                                                                 
Query: 229 gaagaaccacctgttcttgccggtcttgaacctctcctcgagcttggccttggc 282
           |||||||||| | ||||||| ||||||| |||||||||||| |||| |||||||
Sbjct: 411 gaagaaccacttattcttgctggtcttgtacctctcctcgaacttgaccttggc 358

---

>ref|XM_543309.2| PREDICTED: Canis familiaris similar to ribosomal protein L27,
           transcript variant 1 (LOC486183), mRNA
          Length = 483

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 48/54 (88%)
 Strand = Plus / Minus

                                                                 
Query: 229 gaagaaccacctgttcttgccggtcttgaacctctcctcgagcttggccttggc 282
           |||||||||| | ||||||| ||||||| |||||||||||| |||| |||||||
Sbjct: 426 gaagaaccacttattcttgctggtcttgtacctctcctcgaacttgaccttggc 373

---

>emb|CR733949.2|CNS0GT3G Tetraodon nigroviridis full-length cDNA
          Length = 479

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 48/54 (88%)
 Strand = Plus / Minus

                                                                 
Query: 229 gaagaaccacctgttcttgccggtcttgaacctctcctcgagcttggccttggc 282
           |||||||||| |||| ||||| |||||| |||||||||| | ||||||||||||
Sbjct: 422 gaagaaccacttgtttttgcccgtcttgtacctctcctcaaacttggccttggc 369

---

>gb|AC134322.25| Medicago truncatula clone mth2-17i21, complete sequence
          Length = 136954

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 39/42 (92%)
 Strand = Plus / Minus

                                                        
Query: 220    gagcttggtgaagaaccacctgttcttgccggtcttgaacct 261
              |||||||||||||||||| |||||||| ||||| ||||||||
Sbjct: 110830 gagcttggtgaagaaccatctgttcttcccggttttgaacct 110789



 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 73    atccaatctaaaaacatagtc 93
             |||||||||||||||||||||
Sbjct: 23032 atccaatctaaaaacatagtc 23012

---

>gb|AC131248.14| Medicago truncatula clone mth2-28n22, complete sequence
          Length = 136333

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                               
Query: 220   gagcttggtgaagaaccacctgttcttgccggtcttgaacctctcctcga 269
             ||||||||| ||||||||||| ||||| || ||||| |||||||||||||
Sbjct: 38418 gagcttggtaaagaaccacctattctttccagtcttaaacctctcctcga 38467

---

>gb|AF266223.1|AF266223 Gillichthys mirabilis ribosomal protein L27 mRNA, complete cds
          Length = 474

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 48/54 (88%)
 Strand = Plus / Minus

                                                                 
Query: 229 gaagaaccacctgttcttgccggtcttgaacctctcctcgagcttggccttggc 282
           ||||||||||||||| ||||| |||||| |||||||||| | |||| |||||||
Sbjct: 421 gaagaaccacctgtttttgcccgtcttgtacctctcctcaaacttgaccttggc 368

---

>gb|AY610378.1| Sus scrofa clone relu1310b_k10.y1.abd, mRNA sequence
          Length = 483

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 48/54 (88%)
 Strand = Plus / Minus

                                                                 
Query: 229 gaagaaccacctgttcttgccggtcttgaacctctcctcgagcttggccttggc 282
           |||||||||  ||||||||||||||||| | |||||||||| |||| |||||||
Sbjct: 413 gaagaaccatttgttcttgccggtcttgtatctctcctcgaacttgaccttggc 360

---

>dbj|AB043975.1| Panax ginseng mRNA for ribosomal protein L27, complete cds
          Length = 649

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                    
Query: 427 cgacttcttggccgtcttcttngccgagtccttgcggatcaccttcttggggtactt 483
           ||||||||| ||||||||||| |||||||| || |  ||||||||||| ||||||||
Sbjct: 210 cgacttcttcgccgtcttcttcgccgagtctttccttatcaccttcttcgggtactt 154

---

>gb|AF548324.1| Branchiostoma belcheri ribosomal protein L27 mRNA, complete cds
          Length = 514

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                    
Query: 211 ctagaagcggagcttggtgaagaaccacctgttcttgccggtcttgaacctctcctc 267
           ||||||||| |||||   |||||||||| ||||||||||||||||| | ||||||||
Sbjct: 442 ctagaagcgtagcttctggaagaaccacttgttcttgccggtcttgtatctctcctc 386

---

>gb|AF003143.2| Caenorhabditis elegans cosmid C53H9, complete sequence
          Length = 7003

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                     
Query: 224  ttggtgaagaaccacctgttcttgccggtcttgaacctctcctcgagcttggccttg 280
            ||||||||||||||| ||||||| ||||||||| | | |||||||| ||||| ||||
Sbjct: 3200 ttggtgaagaaccacttgttctttccggtcttgtaacgctcctcgaacttggacttg 3144

---

>ref|NM_058504.4| Caenorhabditis elegans Ribosomal Protein, Large subunit family
           member (rpl-27) (rpl-27) mRNA, complete cds
          Length = 463

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                    
Query: 224 ttggtgaagaaccacctgttcttgccggtcttgaacctctcctcgagcttggccttg 280
           ||||||||||||||| ||||||| ||||||||| | | |||||||| ||||| ||||
Sbjct: 406 ttggtgaagaaccacttgttctttccggtcttgtaacgctcctcgaacttggacttg 350

---

>gb|U89308.1|CEU89308 Caenorhabditis elegans ribosomal protein L27 homolog mRNA, SL2
           trans-spliced, complete cds
          Length = 506

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                    
Query: 224 ttggtgaagaaccacctgttcttgccggtcttgaacctctcctcgagcttggccttg 280
           ||||||||||||||| ||||||| ||||||||| | | |||||||| ||||| ||||
Sbjct: 426 ttggtgaagaaccacttgttctttccggtcttgtaacgctcctcgaacttggacttg 370

---

>gb|AY682471.1| Chara globularis 60S ribosomal protein L27 mRNA, complete cds
          Length = 830

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                           
Query: 223 cttggtgaagaaccacctgttcttgccggtcttgaacctctcctcgag 270
           ||||| ||| ||||| |||||||| || ||||||||||||||||||||
Sbjct: 466 cttggagaaaaaccatctgttctttcctgtcttgaacctctcctcgag 419

---

>gb|U10046.1|PSU10046 Pisum sativum ribosomal protein L27 homolog (RPL27-5) mRNA,
           complete cds
          Length = 568

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 40/44 (90%)
 Strand = Plus / Minus

                                                       
Query: 221 agcttggtgaagaaccacctgttcttgccggtcttgaacctctc 264
           ||||||||||| |||||||||||||| || || |||||||||||
Sbjct: 436 agcttggtgaaaaaccacctgttcttccctgttttgaacctctc 393

---

>ref|XM_370196.1| Magnaporthe grisea 70-15 chromosome II hypothetical protein
           (MG06693.4) partial mRNA
          Length = 450

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 47/54 (87%)
 Strand = Plus / Minus

                                                                 
Query: 362 tcgagggtgtagcgggtgggcatgangtgggtgaagttgacgagcttgaggaag 415
           ||||| ||||||||||||||||||| |||| || ||||||| | ||||| ||||
Sbjct: 302 tcgagagtgtagcgggtgggcatgaggtggttgtagttgacaaccttgacgaag 249

---

>ref|XM_951518.1| Neurospora crassa OR74A hypothetical protein (NCU01827.1) partial
           mRNA
          Length = 408

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 47/54 (87%)
 Strand = Plus / Minus

                                                                 
Query: 362 tcgagggtgtagcgggtgggcatgangtgggtgaagttgacgagcttgaggaag 415
           ||||||||||||||||||||||| | |||| || |||||| || ||||| ||||
Sbjct: 260 tcgagggtgtagcgggtgggcatcaagtggttgtagttgatgaccttgatgaag 207



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                     
Query: 226 ggtgaagaaccacctgttcttgccgg 251
           ||||||||||||||||||||||||||
Sbjct: 393 ggtgaagaaccacctgttcttgccgg 368

---

>ref|XM_328265.1| Neurospora crassa OR74A hypothetical protein (NCU01827.1) partial
           mRNA
          Length = 408

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 47/54 (87%)
 Strand = Plus / Minus

                                                                 
Query: 362 tcgagggtgtagcgggtgggcatgangtgggtgaagttgacgagcttgaggaag 415
           ||||||||||||||||||||||| | |||| || |||||| || ||||| ||||
Sbjct: 260 tcgagggtgtagcgggtgggcatcaagtggttgtagttgatgaccttgatgaag 207



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                     
Query: 226 ggtgaagaaccacctgttcttgccgg 251
           ||||||||||||||||||||||||||
Sbjct: 393 ggtgaagaaccacctgttcttgccgg 368

---

>gb|AY508978.1| Pectinaria gouldii ribosomal protein L27 mRNA, complete cds
          Length = 519

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 27/27 (100%)
 Strand = Plus / Minus

                                      
Query: 220 gagcttggtgaagaaccacctgttctt 246
           |||||||||||||||||||||||||||
Sbjct: 444 gagcttggtgaagaaccacctgttctt 418

---

>ref|XM_500549.1| Yarrowia lipolytica CLIB122, YALI0B05896g predicted mRNA
          Length = 396

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                              
Query: 212 tagaagcggagcttggtgaagaaccacctgttctt 246
           ||||| ||||||||||||||||||||| |||||||
Sbjct: 395 tagaatcggagcttggtgaagaaccacttgttctt 361



 Score = 48.1 bits (24), Expect = 0.028
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                  
Query: 361 gtcgagggtgtagcgggtgggcatgangtgggtgaagttgacgagcttgaggaag 415
           |||||||||||| || |||||||| | |||| || ||||||||| ||||| ||||
Sbjct: 246 gtcgagggtgtatcgagtgggcatcatgtggttgtagttgacgaccttgatgaag 192

---

>emb|BX284754.1|NCB23G1 Neurospora crassa DNA linkage group II BAC contig B23G1
          Length = 106111

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 47/54 (87%)
 Strand = Plus / Minus

                                                                   
Query: 362   tcgagggtgtagcgggtgggcatgangtgggtgaagttgacgagcttgaggaag 415
             ||||||||||||||||||||||| | |||| || |||||| || ||||| ||||
Sbjct: 94691 tcgagggtgtagcgggtgggcatcaagtggttgtagttgatgaccttgatgaag 94638



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                       
Query: 226   ggtgaagaaccacctgttcttgccgg 251
             ||||||||||||||||||||||||||
Sbjct: 94824 ggtgaagaaccacctgttcttgccgg 94799

---

>emb|CR382128.1| Yarrowia lipolytica chromosome B of strain CLIB122 of Yarrowia lipolytica
          Length = 3066374

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                                 
Query: 212    tagaagcggagcttggtgaagaaccacctgttctt 246
              ||||| ||||||||||||||||||||| |||||||
Sbjct: 790846 tagaatcggagcttggtgaagaaccacttgttctt 790812



 Score = 48.1 bits (24), Expect = 0.028
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                     
Query: 361    gtcgagggtgtagcgggtgggcatgangtgggtgaagttgacgagcttgaggaag 415
              |||||||||||| || |||||||| | |||| || ||||||||| ||||| ||||
Sbjct: 790697 gtcgagggtgtatcgagtgggcatcatgtggttgtagttgacgaccttgatgaag 790643

---

>gb|AY292611.1| Oikopleura dioica 60S ribosomal protein RL27 (RL27) gene, complete
           cds
          Length = 691

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 41/46 (89%)
 Strand = Plus / Minus

                                                         
Query: 211 ctagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 256
           |||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 691 ctagaatcggagcttctggaagaaccacttgttcttgccggtcttg 646

---

>emb|BX060631.1|CNS09IY3 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC41AD04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 570

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 29/30 (96%)
 Strand = Plus / Plus

                                         
Query: 227 gtgaagaaccacctgttcttgccggtcttg 256
           |||||||||||| |||||||||||||||||
Sbjct: 347 gtgaagaaccacttgttcttgccggtcttg 376

---

>emb|BX006453.1|CNS08D55 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA10DG02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 879

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 56/66 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttgaacctctcctcgagc 271
           ||||| ||||||||   |||||||||| |||||||||||||||||   | |||||||| |
Sbjct: 472 tagaaacggagcttctggaagaaccacttgttcttgccggtcttgtgtcgctcctcgaac 531

                 
Query: 272 ttggcc 277
           ||||||
Sbjct: 532 ttggcc 537

---

>emb|BX006452.1|CNS08D54 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA10DG02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 914

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 56/66 (84%)
 Strand = Plus / Minus

                                                                       
Query: 212 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttgaacctctcctcgagc 271
           ||||| ||||||||   |||||||||| |||||||||||||||||   | |||||||| |
Sbjct: 409 tagaaacggagcttctggaagaaccacttgttcttgccggtcttgtgtcgctcctcgaac 350

                 
Query: 272 ttggcc 277
           ||||||
Sbjct: 349 ttggcc 344

---

>emb|Z30162.1|ST60SRP27 S.tuberosum mRNA for 60S ribosomal protein L27
          Length = 612

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 96/120 (80%)
 Strand = Plus / Minus

                                                                       
Query: 362 tcgagggtgtagcgggtgggcatgangtgggtgaagttgacgagcttgaggaagaccttg 421
           ||||| ||||| || || ||||||| |||| || |||| |||||||||| |||  |||| 
Sbjct: 288 tcgagtgtgtaacgagttggcatgatgtggttgtagttcacgagcttgatgaaagccttc 229

                                                                       
Query: 422 acgcgcgacttcttggccgtcttcttngccgagtccttgcggatcaccttcttggggtac 481
           || || || |||||| | |  ||||| || || || ||||||||||||||||| ||||||
Sbjct: 228 acacgagatttcttgcctgctttctttgctgaatctttgcggatcaccttcttcgggtac 169

---

>emb|BX072103.1|CNS09RSR Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC9DF05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 971

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 212 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 256
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 464 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 420

---

>emb|BX072102.1|CNS09RSQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC9DF04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 918

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                        
Query: 212 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 256
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 485 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 529

---

>emb|BX072101.1|CNS09RSP Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC9DF04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 985

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 212 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 256
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 472 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 428

---

>emb|BX072044.1|CNS09RR4 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC9DC10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 893

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                        
Query: 212 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 256
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 470 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 514

---

>emb|BX072043.1|CNS09RR3 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC9DC10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 965

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 212 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 256
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 460 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 416

---

>emb|BX071795.1|CNS09RK7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC9BH08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1002

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                        
Query: 212 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 256
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 493 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 537

---

>emb|BX071794.1|CNS09RK6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC9BH08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 992

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 212 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 256
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 449 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 405

---

>emb|BX071773.1|CNS09RJL Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC9BG09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 755

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                        
Query: 212 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 256
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 487 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 531

---

>emb|BX071772.1|CNS09RJK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC9BG09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 804

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 212 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 256
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 452 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 408

---

>emb|BX071703.1|CNS09RHN Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC9BD05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 953

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                        
Query: 212 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 256
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 471 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 515

---

>emb|BX071702.1|CNS09RHM Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC9BD05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 946

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 212 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 256
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 436 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 392

---

>emb|BX071484.1|CNS09RBK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC9AB11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 899

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                        
Query: 212 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 256
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 477 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 521

---

>emb|BX071483.1|CNS09RBJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC9AB11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 983

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 212 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 256
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 459 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 415

---

>emb|BX071109.1|CNS09R15 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC8CA09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 912

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                        
Query: 212 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 256
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 469 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 513

---

>emb|BX071108.1|CNS09R14 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC8CA09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 969

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 212 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 256
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 451 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 407

---

>emb|BX071294.1|CNS09R6A Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC8DB02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 685

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 212 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 256
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 434 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 390

---

>emb|BX070984.1|CNS09QXO Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC8BD05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 914

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                        
Query: 212 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 256
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 484 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 528

---

>emb|BX070983.1|CNS09QXN Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC8BD05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 815

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 212 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 256
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 480 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 436

---

>emb|BX070927.1|CNS09QW3 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC8BA12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 804

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                        
Query: 212 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 256
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 478 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 522

---

>emb|BX070926.1|CNS09QW2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC8BA12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 685

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 212 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 256
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 438 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 394

---

>emb|BX070787.1|CNS09QS7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC8AC04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 915

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                        
Query: 212 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 256
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 479 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 523

---

>emb|BX070786.1|CNS09QS6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC8AC04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 959

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 212 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 256
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 465 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 421

---

>emb|BX070589.1|CNS09QMP Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC7DA06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 979

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 212 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 256
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 843 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 799

---

>emb|BX070475.1|CNS09QJJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC7CD04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 488

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 212 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 256
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 426 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 382

---

>emb|BX070293.1|CNS09QEH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC7BC12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 505

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 212 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 256
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 444 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 400

---

>emb|BX070240.1|CNS09QD0 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC7BA08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 811

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                        
Query: 212 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 256
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 474 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 518

---

>emb|BX070239.1|CNS09QCZ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC7BA08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 862

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 212 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 256
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 455 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 411

---

>emb|BX070199.1|CNS09QBV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC7AG07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 751

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                        
Query: 212 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 256
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 473 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 517

---

>emb|BX069996.1|CNS09Q68 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC6DE07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 955

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                        
Query: 212 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 256
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 469 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 513

---

>emb|BX069995.1|CNS09Q67 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC6DE07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 979

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 212 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 256
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 452 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 408

---

>emb|BX069838.1|CNS09Q1U Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC6CF06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 704

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                        
Query: 212 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 256
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 470 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 514

---

>emb|BX069837.1|CNS09Q1T Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC6CF06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 711

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 212 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 256
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 435 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 391

---

>emb|BX069816.1|CNS09Q18 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC6CE07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 965

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                        
Query: 212 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 256
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 486 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 530

---

>emb|BX069815.1|CNS09Q17 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC6CE07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 707

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 212 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 256
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 456 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 412

---

>emb|BX061095.1|CNS09JAZ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC41CH11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 911

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                        
Query: 212 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 256
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 466 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 510

---

>emb|BX061094.1|CNS09JAY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC41CH11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 953

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 212 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 256
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 435 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 391

---

>emb|BX060930.1|CNS09J6E Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC41CA10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 649

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                        
Query: 212 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 256
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 462 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 506

---

>emb|BX060929.1|CNS09J6D Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC41CA10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 509

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 212 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 256
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 393 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 349

---

>emb|BX069521.1|CNS09PT1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC6AH04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 923

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                        
Query: 212 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 256
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 491 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 535

---

>emb|BX069520.1|CNS09PT0 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC6AH04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 958

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 212 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 256
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 474 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 430

---

>emb|BX069417.1|CNS09PQ5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC6AC10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 860

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                        
Query: 212 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 256
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 474 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 518

---

>emb|BX069416.1|CNS09PQ4 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC6AC10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 839

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 212 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 256
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 405 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 361

---

>emb|BX069166.1|CNS09PJ6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC53CH04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 684

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 212 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 256
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 388 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 344

---

>emb|BX069144.1|CNS09PIK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC53CG04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 948

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 212 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 256
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 415 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 371

---

>emb|BX069128.1|CNS09PI4 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC53CF08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 990

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 212 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 256
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 453 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 409

---

>emb|BX069070.1|CNS09PGI Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC53CD03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 994

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 212 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 256
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 456 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 412

---

>emb|BX069043.1|CNS09PFR Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC53CC01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 937

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                        
Query: 212 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 256
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 495 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 539

---

>emb|BX069042.1|CNS09PFQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC53CC01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1008

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 212 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 256
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 458 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 414

---

>emb|BX069033.1|CNS09PFH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC53CB08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 819

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                        
Query: 212 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 256
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 488 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 532

---

>emb|BX069032.1|CNS09PFG Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC53CB08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 954

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 212 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 256
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 437 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 393

---

>emb|BX069017.1|CNS09PF1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC53CA12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 665

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                        
Query: 212 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 256
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 491 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 535

---

>emb|BX069016.1|CNS09PF0 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC53CA12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 684

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 212 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 256
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 451 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 407

---

>emb|BX068777.1|CNS09P8D Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC53AG03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 949

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                        
Query: 212 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 256
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 468 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 512

---

>emb|BX068776.1|CNS09P8C Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC53AG03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 952

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 212 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 256
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 420 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 376

---

>emb|BX068480.1|CNS09P04 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC52DA09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 637

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                        
Query: 212 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 256
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 463 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 507

---

>emb|BX068479.1|CNS09P03 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC52DA09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 872

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 212 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 256
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 406 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 362

---

>emb|BX068045.1|CNS09OO1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC52AC09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 674

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 212 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 256
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 457 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 413

---

>emb|BX067898.1|CNS09OJY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC51DB09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1007

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                        
Query: 212 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 256
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 488 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 532

---

>emb|BX067672.1|CNS09ODO Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC51BH03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 901

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 212 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 256
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 427 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 383

---

>emb|BX067447.1|CNS09O7F Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC51AE12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 991

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 212 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 256
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 452 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 408

---

>emb|BX067015.1|CNS09NVF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC50CB03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 839

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                        
Query: 212 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 256
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 470 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 514

---

>emb|BX067014.1|CNS09NVE Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC50CB03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 942

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 212 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 256
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 445 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 401

---

>emb|BX067249.1|CNS09O1X Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC50DD09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 958

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                        
Query: 212 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 256
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 469 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 513

---

>emb|BX067248.1|CNS09O1W Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC50DD09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 962

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 212 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 256
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 427 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 383

---

>emb|BX067222.1|CNS09O16 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC50DC06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 988

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                        
Query: 212 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 256
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 474 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 518

---

>emb|BX067221.1|CNS09O15 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC50DC06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 981

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 212 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 256
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 453 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 409

---

>emb|BX067182.1|CNS09O02 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC50DA07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 946

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                        
Query: 212 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 256
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 473 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 517

---

>emb|BX067181.1|CNS09O01 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC50DA07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 969

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 212 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 256
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 461 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 417

---

>emb|BX067173.1|CNS09NZT Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC50DA02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 917

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 212 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 256
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 392 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 348

---

>emb|BX066730.1|CNS09NNI Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC50AE11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 550

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                        
Query: 212 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 256
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 496 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 540

---

>emb|BX066729.1|CNS09NNH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC50AE11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 802

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 212 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 256
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 472 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 428

---

>emb|BX066569.1|CNS09NJ1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC5DG02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 986

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 212 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 256
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 452 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 408

---

>emb|BX066542.1|CNS09NIA Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC5DE12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 956

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                        
Query: 212 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 256
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 479 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 523

---

>emb|BX066541.1|CNS09NI9 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC5DE12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 976

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 212 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 256
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 453 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 409

---

>emb|BX066194.1|CNS09N8M Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC5BF04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 805

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 212 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 256
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 431 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 387

---

>emb|BX066150.1|CNS09N7E Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC5BD06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 947

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 212 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 256
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 456 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 412

---

>emb|BX066095.1|CNS09N5V Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC5BB01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 961

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 212 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 256
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 433 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 389

---

>emb|BX065973.1|CNS09N2H Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC5AD03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 735

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 212 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 256
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 391 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 347

---

>emb|BX065830.1|CNS09MYI Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC49DE07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 699

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 212 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 256
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 446 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 402

---

>emb|BX065804.1|CNS09MXS Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC49DD05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 607

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 212 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 256
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 462 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 418

---

>emb|BX065733.1|CNS09MVT Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC49DA03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 748

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 212 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 256
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 388 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 344

---

>emb|BX065586.1|CNS09MRQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC49CB10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 973

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 212 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 256
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 441 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 397

---

>emb|BX065527.1|CNS09MQ3 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC49BH02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 965

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                        
Query: 212 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 256
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 486 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 530

---

>emb|BX065526.1|CNS09MQ2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC49BH02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 990

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 212 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 256
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 453 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 409

---

>emb|BX065395.1|CNS09MMF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC49BB04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 918

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                        
Query: 212 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 256
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 456 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 500

---

>emb|BX065394.1|CNS09MME Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC49BB04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 961

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 212 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 256
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 433 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 389

---

>emb|BX065267.1|CNS09MIV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC49AD01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 960

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 212 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 256
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 442 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 398

---

>emb|BX064786.1|CNS09M5I Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC48BE05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 793

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 212 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 256
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 427 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 383

---

>emb|BX064578.1|CNS09LZQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC46DF08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 652

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 212 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 256
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 407 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 363

---

>emb|BX064318.1|CNS09LSI Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC46CB11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 919

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                        
Query: 212 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 256
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 485 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 529

---

>emb|BX064317.1|CNS09LSH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC46CB11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 937

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 212 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 256
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 467 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 423

---

>emb|BX064256.1|CNS09LQS Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC46BH03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 908

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 212 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 256
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 449 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 405

---

>emb|BX064193.1|CNS09LP1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC46BE07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 889

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                        
Query: 212 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 256
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 457 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 501

---

>emb|BX064192.1|CNS09LP0 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC46BE07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 976

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 212 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 256
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 451 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 407

---

>emb|BX064097.1|CNS09LMD Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC46BA02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1000

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                        
Query: 212 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 256
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 484 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 528

---

>emb|BX064096.1|CNS09LMC Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC46BA02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 997

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 212 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 256
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 458 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 414

---

>emb|BX064002.1|CNS09LJQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC46AE01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 735

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                        
Query: 212 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 256
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 464 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 508

---

>emb|BX064001.1|CNS09LJP Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC46AE01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 967

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 212 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 256
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 452 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 408

---

>emb|BX063528.1|CNS09L6K Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC45BF02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 465

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 212 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 256
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 435 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 391

---

>emb|BX063517.1|CNS09L69 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC45BE05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 720

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                        
Query: 212 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 256
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 314 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 358

---

>emb|BX063516.1|CNS09L68 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC45BE05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 910

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 212 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 256
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 437 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 393

---

>emb|BX063197.1|CNS09KXD Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC44DF01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 959

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                        
Query: 212 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 256
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 473 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 517

---

>emb|BX063196.1|CNS09KXC Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC44DF01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 976

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 212 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 256
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 463 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 419

---

>emb|BX063195.1|CNS09KXB Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC44DE12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 911

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                        
Query: 212 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 256
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 466 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 510

---

>emb|BX063194.1|CNS09KXA Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC44DE12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 964

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 212 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 256
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 462 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 418

---

>emb|BX063139.1|CNS09KVR Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC44DC05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 917

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 212 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 256
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 457 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 413

---

>emb|BX063083.1|CNS09KU7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC44CH09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1044

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 212 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 256
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 501 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 457

---

>emb|BX062398.1|CNS09KB6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC43CG01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 985

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                        
Query: 212 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 256
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 480 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 524

---

>emb|BX062397.1|CNS09KB5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC43CG01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 989

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 212 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 256
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 451 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 407

---

>emb|BX062248.1|CNS09K70 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC43BG09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 974

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 212 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 256
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 443 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 399

---

>emb|BX062217.1|CNS09K65 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC43BF02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 982

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                        
Query: 212 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 256
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 473 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 517

---

>emb|BX061945.1|CNS09JYL Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC43AA02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 538

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 212 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 256
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 416 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 372

---

>emb|BX061917.1|CNS09JXT Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC42DG09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 971

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                        
Query: 212 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 256
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 465 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 509

---

>emb|BX061916.1|CNS09JXS Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC42DG09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 947

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 212 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 256
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 431 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 387

---

>emb|BX061583.1|CNS09JOJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC42CA04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 727

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 212 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 256
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 440 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 396

---

>emb|BX060671.1|CNS09IZ7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC41AF02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 408

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 212 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 256
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 110 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 66

---

>emb|BX060630.1|CNS09IY2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC41AD04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 114

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 212 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 256
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 47  tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 3

---

>emb|BX060522.1|CNS09IV2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC40DG02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 965

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                        
Query: 212 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 256
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 459 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 503

---

>emb|BX060521.1|CNS09IV1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC40DG02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 966

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 212 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 256
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 445 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 401

---

>emb|BX060463.1|CNS09ITF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC40DD05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 663

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                        
Query: 212 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 256
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 469 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 513

---

>emb|BX060462.1|CNS09ITE Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC40DD05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 831

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 212 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 256
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 446 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 402

---

>emb|BX060432.1|CNS09ISK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC40DC01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 649

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                        
Query: 212 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 256
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 475 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 519

---

>emb|BX060431.1|CNS09ISJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC40DC01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 925

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 212 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 256
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 446 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 402

---

>emb|BX060386.1|CNS09IRA Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC40CH10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 790

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                        
Query: 212 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 256
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 482 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 526

---

>emb|BX060385.1|CNS09IR9 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC40CH10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 737

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 212 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 256
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 467 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 423

---

>emb|BX060142.1|CNS09IKI Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC40BF03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 934

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                        
Query: 212 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 256
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 438 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 482

---

>emb|BX060141.1|CNS09IKH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC40BF03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 948

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 212 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 256
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 430 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 386

---

>emb|BX059766.1|CNS09IA2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC4DC08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 983

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 212 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 256
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 451 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 407

---

>emb|BX059737.1|CNS09I99 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC4DA10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 907

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 212 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 256
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 436 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 392

---

>emb|BX059721.1|CNS09I8T Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC4CH10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 966

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 212 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 256
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 439 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 395

---

>emb|BX059691.1|CNS09I7Z Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC4CG01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 500

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 212 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 256
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 431 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 387

---

>emb|BX059325.1|CNS09HXT Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC4AE03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 953

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                        
Query: 212 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 256
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 492 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 536

---

>emb|BX059324.1|CNS09HXS Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC4AE03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 960

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 212 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 256
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 460 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 416

---

>emb|BX059251.1|CNS09HVR Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC4AA05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 978

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 212 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 256
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 445 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 401

---

>emb|BX059147.1|CNS09HSV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC39DD11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 992

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                        
Query: 212 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 256
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 486 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 530

---

>emb|BX059146.1|CNS09HSU Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC39DD11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 991

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 212 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 256
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 464 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 420

---

>emb|BX059121.1|CNS09HS5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC39DC10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 989

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 212 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 256
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 445 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 401

---

>emb|BX059021.1|CNS09HPD Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC39CG05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 798

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                        
Query: 212 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 256
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 458 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 502

---

>emb|BX059020.1|CNS09HPC Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC39CG05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 856

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 212 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 256
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 439 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 395

---

>emb|BX058945.1|CNS09HN9 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC39CC12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1002

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                        
Query: 212 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 256
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 500 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 544

---

>emb|BX058944.1|CNS09HN8 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC39CC12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 983

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 212 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 256
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 471 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 427

---

>emb|BX058853.1|CNS09HKP Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC39BG12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 954

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 212 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 256
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 429 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 385

---

>emb|BX058608.1|CNS09HDW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC39AD07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 449

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 212 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 256
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 436 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 392

---

>emb|BX058465.1|CNS09H9X Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC38DE10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 855

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 212 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 256
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 464 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 420

---

>emb|BX056668.1|CNS09FW0 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC36AE08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 975

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 212 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 256
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 448 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 404

---

>emb|BX057944.1|CNS09GVG Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC38AE02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 975

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 212 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 256
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 450 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 406

---

>emb|BX057637.1|CNS09GMX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC37CG05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 847

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                        
Query: 212 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 256
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 500 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 544

---

>emb|BX057636.1|CNS09GMW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC37CG05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 952

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 212 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 256
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 438 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 394

---

>emb|BX057549.1|CNS09GKH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC37CC04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 904

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                        
Query: 212 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 256
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 489 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 533

---

>emb|BX057548.1|CNS09GKG Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC37CC04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 910

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 212 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 256
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 440 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 396

---

>emb|BX057428.1|CNS09GH4 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC37BE07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 552

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                        
Query: 212 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 256
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 455 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 499

---

>emb|BX057427.1|CNS09GH3 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC37BE07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 668

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 212 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 256
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 447 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 403

---

>emb|BX057217.1|CNS09GB9 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC37AC08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 583

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 212 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 256
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 446 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 402

---

>emb|BX057111.1|CNS09G8B Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC36DF09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 835

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 212 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 256
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 449 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 405

---

>emb|BX057064.1|CNS09G70 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC36DD08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 654

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 212 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 256
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 469 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 425

---

>emb|BX056980.1|CNS09G4O Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC36CH10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 494

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 212 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 256
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 437 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 393

---

>emb|BX056911.1|CNS09G2R Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC36CD08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 705

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                        
Query: 212 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 256
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 511 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 555

---

>emb|BX056910.1|CNS09G2Q Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC36CD08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 779

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 212 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 256
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 472 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 428

---

>emb|BX056816.1|CNS09G04 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC36BF09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 756

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 212 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 256
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 401 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 357

---

>emb|BX056561.1|CNS09FT1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC35DG11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 800

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                        
Query: 212 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 256
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 480 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 524

---

>emb|BX056560.1|CNS09FT0 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC35DG11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 976

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 212 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 256
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 453 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 409

---

>emb|BX056536.1|CNS09FSC Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC35DF08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 820

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 212 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 256
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 394 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 350

---

>emb|BX056232.1|CNS09FJW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC35BG01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 547

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 212 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 256
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 442 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 398

---

>emb|BX056161.1|CNS09FHX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC35BB10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 956

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                        
Query: 212 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 256
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 485 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 529

---

>emb|BX056160.1|CNS09FHW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC35BB10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 963

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 212 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 256
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 452 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 408

---

>emb|BX055158.1|CNS09EQ2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC33CF11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 511

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 212 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 256
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 385 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 341

---

>emb|BX053204.1|CNS09D7S Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC30DA12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 752

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 212 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 256
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 461 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 417

---

>emb|BX054990.1|CNS09ELE Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC33BF03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 767

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 212 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 256
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 224 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 180

---

>emb|BX054749.1|CNS09EEP Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC33AC01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 927

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 212 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 256
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 454 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 410

---

>emb|BX053049.1|CNS09D3H Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC30BH09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 954

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                        
Query: 212 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 256
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 474 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 518

---

>emb|BX053048.1|CNS09D3G Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC30BH09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 900

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 212 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 256
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 405 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 361

---

>emb|BX054473.1|CNS09E71 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC32CF02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 769

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 212 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 256
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 357 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 313

---

>emb|BX054408.1|CNS09E58 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC32CC03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 733

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 212 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 256
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 358 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 314

---

>emb|BX054219.1|CNS09DZZ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC32BB09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 934

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                        
Query: 212 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 256
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 493 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 537

---

>emb|BX054218.1|CNS09DZY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC32BB09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 712

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 212 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 256
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 465 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 421

---

>emb|BX053917.1|CNS09DRL Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC31DE03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 482

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 212 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 256
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 430 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 386

---

>emb|BX053763.1|CNS09DNB Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC31CE09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 825

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 212 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 256
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 474 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 430

---

>emb|BX053650.1|CNS09DK6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC31BH01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 923

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 212 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 256
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 436 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 392

---

>emb|BX053531.1|CNS09DGV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC31AH12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 909

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                        
Query: 212 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 256
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 470 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 514

---

>emb|BX053530.1|CNS09DGU Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC31AH12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 945

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 212 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 256
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 442 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 398

---

>emb|BX052795.1|CNS09CWF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC30AD12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 897

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                        
Query: 212 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 256
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 509 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 553

---

>emb|BX052794.1|CNS09CWE Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC30AD12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 933

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 212 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 256
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 470 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 426

---

>emb|BX052608.1|CNS09CR8 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC3DB01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 651

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                        
Query: 212 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 256
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 481 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 525

---

>emb|BX052607.1|CNS09CR7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC3DB01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 900

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 212 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 256
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 430 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 386

---

>emb|BX052579.1|CNS09CQF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC3CH05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 926

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                        
Query: 212 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 256
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 478 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 522

---

>emb|BX052578.1|CNS09CQE Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC3CH05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 975

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 212 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 256
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 466 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 422

---

>emb|BX052518.1|CNS09COQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC3CE07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 958

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                        
Query: 212 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 256
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 481 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 525

---

>emb|BX052517.1|CNS09COP Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC3CE07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 983

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 212 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 256
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 453 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 409

---

>emb|BX052512.1|CNS09COK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC3CE04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 946

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                        
Query: 212 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 256
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 489 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 533

---

>emb|BX052511.1|CNS09COJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC3CE04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 992

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 212 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 256
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 464 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 420

---

>emb|BX052483.1|CNS09CNR Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC3CD01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 974

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                        
Query: 212 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 256
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 482 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 526

---

>emb|BX052482.1|CNS09CNQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC3CD01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 987

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 212 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 256
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 452 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 408

---

>emb|BX052424.1|CNS09CM4 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC3CA06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 957

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 212 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 256
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 453 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 409

---

>emb|BX052396.1|CNS09CLC Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC3BH04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 929

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 212 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 256
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 455 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 411

---

>emb|BX052389.1|CNS09CL5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC3BG12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 922

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                        
Query: 212 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 256
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 476 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 520

---

>emb|BX052388.1|CNS09CL4 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC3BG12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 930

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 212 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 256
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 457 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 413


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,964,607
Number of Sequences: 3902068
Number of extensions: 3964607
Number of successful extensions: 79091
Number of sequences better than 10.0: 668
Number of HSP's better than 10.0 without gapping: 668
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 78114
Number of HSP's gapped (non-prelim): 965
length of query: 497
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 475
effective length of database: 17,147,199,772
effective search space: 8144919891700
effective search space used: 8144919891700
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)

---