ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | rbags16i04 |
|---|---|
| Clone Library Name | barley_pub |
>ref|XM_478736.1| Oryza sativa (japonica cultivar-group), mRNA Length = 486 Score = 361 bits (182), Expect = 1e-96 Identities = 263/290 (90%) Strand = Plus / Minus Query: 197 ccggtggttccagctggaacgaccttcaggacattgaatctcacagttttcgacaggggc 256 ||||||| ||||||||| | |||||||||||| ||||| ||||||||||||||||| ||| Sbjct: 449 ccggtggatccagctgggatgaccttcaggacgttgaacctcacagttttcgacagcggc 390 Query: 257 ctgcactggccaatgatgacatggtcgccttccttgacacggaagcagggggagatgtga 316 |||||||||||||||||||||||||| |||||||||||||||||||| ||||||| |||| Sbjct: 389 ctgcactggccaatgatgacatggtcaccttccttgacacggaagcatggggagacgtga 330 Query: 317 gctgggatgttggagtgcctcttctcatacctctgatacttcttcacaaagtgaaggtag 376 || || |||||||| ||||||||||||||||||||||| |||||||||||||| |||||| Sbjct: 329 gccggaatgttggaatgcctcttctcatacctctgatatttcttcacaaagtggaggtag 270 Query: 377 ttcctgcgcacgatgatcgtcctgttcatcttggcgctgtggcaggttccagctatgatt 436 |||||||| || ||||| |||||||||||||| || || ||||| ||||| || |||||| Sbjct: 269 ttcctgcgaacaatgatagtcctgttcatcttagcactatggcatgttccggcaatgatt 210 Query: 437 ctgcccctgatggcaacagttccagtgaatgggcacttcttgtcaatgta 486 ||||| ||||| | ||||||||||||||||||||||||||| |||||||| Sbjct: 209 ctgcctctgatagaaacagttccagtgaatgggcacttcttatcaatgta 160
>dbj|AK121056.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023056G18, full insert sequence Length = 790 Score = 361 bits (182), Expect = 1e-96 Identities = 263/290 (90%) Strand = Plus / Minus Query: 197 ccggtggttccagctggaacgaccttcaggacattgaatctcacagttttcgacaggggc 256 ||||||| ||||||||| | |||||||||||| ||||| ||||||||||||||||| ||| Sbjct: 576 ccggtggatccagctgggatgaccttcaggacgttgaacctcacagttttcgacagcggc 517 Query: 257 ctgcactggccaatgatgacatggtcgccttccttgacacggaagcagggggagatgtga 316 |||||||||||||||||||||||||| |||||||||||||||||||| ||||||| |||| Sbjct: 516 ctgcactggccaatgatgacatggtcaccttccttgacacggaagcatggggagacgtga 457 Query: 317 gctgggatgttggagtgcctcttctcatacctctgatacttcttcacaaagtgaaggtag 376 || || |||||||| ||||||||||||||||||||||| |||||||||||||| |||||| Sbjct: 456 gccggaatgttggaatgcctcttctcatacctctgatatttcttcacaaagtggaggtag 397 Query: 377 ttcctgcgcacgatgatcgtcctgttcatcttggcgctgtggcaggttccagctatgatt 436 |||||||| || ||||| |||||||||||||| || || ||||| ||||| || |||||| Sbjct: 396 ttcctgcgaacaatgatagtcctgttcatcttagcactatggcatgttccggcaatgatt 337 Query: 437 ctgcccctgatggcaacagttccagtgaatgggcacttcttgtcaatgta 486 ||||| ||||| | ||||||||||||||||||||||||||| |||||||| Sbjct: 336 ctgcctctgatagaaacagttccagtgaatgggcacttcttatcaatgta 287
>emb|X55967.1|ZMRPS11C Maize mRNA for cytoplasmic ribosomal protein S11 Length = 789 Score = 319 bits (161), Expect = 5e-84 Identities = 254/285 (89%) Strand = Plus / Minus Query: 205 tccagctggaacgaccttcaggacattgaatctcacagttttcgacaggggcctgcactg 264 ||||||||||| ||| || | ||||||||| ||||||||||| || |||||||||||||| Sbjct: 511 tccagctggaatgactttgacgacattgaacctcacagtttttgataggggcctgcactg 452 Query: 265 gccaatgatgacatggtcgccttccttgacacggaagcagggggagatgtgagctgggat 324 ||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||| || Sbjct: 451 gccaatgatgacatggtcgccttccttcacacggaagcatggggagatgtgagctggaat 392 Query: 325 gttggagtgcctcttctcatacctctgatacttcttcacaaagtgaaggtagttcctgcg 384 ||||||||||||||| ||||||||||| || ||||| |||||||| || ||||||||||| Sbjct: 391 gttggagtgcctcttttcatacctctggtatttcttaacaaagtggagatagttcctgcg 332 Query: 385 cacgatgatcgtcctgttcatcttggcgctgtggcaggttccagctatgattctgcccct 444 || ||||| || ||||||||||| || |||||||| |||||||| || |||||||| || Sbjct: 331 aacaatgatggttctgttcatcttagcactgtggcatgttccagcaataattctgcctct 272 Query: 445 gatggcaacagttccagtgaatgggcacttcttgtcaatgtaggt 489 ||| | ||| |||||||||||||| || ||||||||||||||||| Sbjct: 271 gatagaaacggttccagtgaatggacatttcttgtcaatgtaggt 227
>gb|AY109839.1| Zea mays CL2091_1 mRNA sequence Length = 807 Score = 305 bits (154), Expect = 7e-80 Identities = 251/285 (88%) Strand = Plus / Minus Query: 205 tccagctggaacgaccttcaggacattgaatctcacagttttcgacaggggcctgcactg 264 ||||||||||| |||||| | ||||||||| ||||||| || |||||||||||||| Sbjct: 524 tccagctggaatgaccttaacgacattgaacctcacagnnnnngataggggcctgcactg 465 Query: 265 gccaatgatgacatggtcgccttccttgacacggaagcagggggagatgtgagctgggat 324 ||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||| || Sbjct: 464 gccaatgatgacatggtcgccttccttcacacggaagcatggggagatgtgagctggaat 405 Query: 325 gttggagtgcctcttctcatacctctgatacttcttcacaaagtgaaggtagttcctgcg 384 ||||||||||||||| ||||||||||| || ||||| |||||||| |||||||||||||| Sbjct: 404 gttggagtgcctcttttcatacctctggtatttcttaacaaagtggaggtagttcctgcg 345 Query: 385 cacgatgatcgtcctgttcatcttggcgctgtggcaggttccagctatgattctgcccct 444 || ||||| || |||||||| || || |||||||| |||||||| || |||||||| || Sbjct: 344 aacaatgatggttctgttcattttagcactgtggcatgttccagcaataattctgcctct 285 Query: 445 gatggcaacagttccagtgaatgggcacttcttgtcaatgtaggt 489 ||| | ||| |||||||||||||| || ||||||||||||||||| Sbjct: 284 gatagaaacggttccagtgaatggacatttcttgtcaatgtaggt 240
>gb|BT016344.1| Zea mays clone Contig177 mRNA sequence Length = 777 Score = 301 bits (152), Expect = 1e-78 Identities = 236/264 (89%) Strand = Plus / Minus Query: 226 gacattgaatctcacagttttcgacaggggcctgcactggccaatgatgacatggtcgcc 285 ||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||| || Sbjct: 504 gacattgaacctcacagtttttgacaggggcctgcactggccaatgatgacatggtcacc 445 Query: 286 ttccttgacacggaagcagggggagatgtgagctgggatgttggagtgcctcttctcata 345 |||||| ||||||||||| || ||||||||||| || ||||||||||||||||||||||| Sbjct: 444 ttccttcacacggaagcatggagagatgtgagcaggaatgttggagtgcctcttctcata 385 Query: 346 cctctgatacttcttcacaaagtgaaggtagttcctgcgcacgatgatcgtcctgttcat 405 |||||| || ||||| |||||||| |||||||||||||| | ||||| || |||||||| Sbjct: 384 cctctggtatttctttacaaagtggaggtagttcctgcgaccaatgatagttctgttcat 325 Query: 406 cttggcgctgtggcaggttccagctatgattctgcccctgatggcaacagttccagtgaa 465 ||| || |||||||| || ||||| || |||||||| ||||| | | ||||||||||||| Sbjct: 324 cttagcactgtggcatgtcccagcaataattctgcctctgatagaaccagttccagtgaa 265 Query: 466 tgggcacttcttgtcaatgtaggt 489 |||||| ||||||||||||||||| Sbjct: 264 tgggcatttcttgtcaatgtaggt 241
>dbj|AK120520.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013124K01, full insert sequence Length = 822 Score = 210 bits (106), Expect = 3e-51 Identities = 235/278 (84%) Strand = Plus / Minus Query: 212 ggaacgaccttcaggacattgaatctcacagttttcgacaggggcctgcactggccaatg 271 |||| ||||||||| |||||||| ||||| || || ||||| |||||||||||||||||| Sbjct: 519 ggaatgaccttcagcacattgaacctcacggtctttgacagtggcctgcactggccaatg 460 Query: 272 atgacatggtcgccttccttgacacggaagcagggggagatgtgagctgggatgttggag 331 || || || || |||||||| ||||||||||| || || |||||||| || || |||||| Sbjct: 459 atcacgtgatctccttccttaacacggaagcacggtgaaatgtgagcaggaatattggag 400 Query: 332 tgcctcttctcatacctctgatacttcttcacaaagtgaaggtagttcctgcgcacgatg 391 ||||||||||| |||||||| |||||||| |||||||| || || ||||| || || || Sbjct: 399 tgcctcttctcgtacctctggtacttcttgacaaagtgcagataattcctccgaacaata 340 Query: 392 atcgtcctgttcatcttggcgctgtggcaggttccagctatgattctgcccctgatggca 451 || |||||||||||||| || || || || |||||||||||||| | ||||| || | Sbjct: 339 atggtcctgttcatcttagcactatgacatgttccagctatgatacgacccctaattgat 280 Query: 452 acagttccagtgaatgggcacttcttgtcaatgtaggt 489 ||||| |||||||||||||| ||||||||||||||||| Sbjct: 279 acagtaccagtgaatgggcatttcttgtcaatgtaggt 242
>ref|NM_114752.2| Arabidopsis thaliana EMB1080; structural constituent of ribosome AT3G48930 (EMB1080) mRNA, complete cds Length = 806 Score = 208 bits (105), Expect = 1e-50 Identities = 225/265 (84%) Strand = Plus / Minus Query: 218 accttcaggacattgaatctcacagttttcgacaggggcctgcactggccaatgatgaca 277 ||||||| |||||||| ||||| || ||||||| |||||||| ||||||||||||| | Sbjct: 505 accttcaacacattgaacctcactgtcttcgacaatggcctgcattggccaatgatgata 446 Query: 278 tggtcgccttccttgacacggaagcagggggagatgtgagctgggatgttggagtgcctc 337 ||||| |||||||| ||||||||||| || |||| ||||| || ||||| || |||||| Sbjct: 445 tggtctccttccttaacacggaagcatggtgagacatgagccggaatgtttgaatgcctc 386 Query: 338 ttctcatacctctgatacttcttcacaaagtgaaggtagttcctgcgcacgatgatcgtc 397 |||||||||||||||||||||||||||||||||||||| | ||| |||||||| || ||| Sbjct: 385 ttctcatacctctgatacttcttcacaaagtgaaggtaatcccttcgcacgataatggtc 326 Query: 398 ctgttcatcttggcgctgtggcaggttccagctatgattctgcccctgatggcaacagtt 457 || | ||| || || |||||||| || ||||||| ||| | || || |||| ||||||| Sbjct: 325 ctctgcattttcgcactgtggcaagtaccagctaagatacgacctctaatggaaacagtt 266 Query: 458 ccagtgaatgggcacttcttgtcaa 482 |||||||| ||||| |||||||||| Sbjct: 265 ccagtgaaggggcatttcttgtcaa 241
>gb|AY081614.1| Arabidopsis thaliana cytosolic ribosomal protein S11 (At3g48930) mRNA, complete cds Length = 610 Score = 208 bits (105), Expect = 1e-50 Identities = 225/265 (84%) Strand = Plus / Minus Query: 218 accttcaggacattgaatctcacagttttcgacaggggcctgcactggccaatgatgaca 277 ||||||| |||||||| ||||| || ||||||| |||||||| ||||||||||||| | Sbjct: 428 accttcaacacattgaacctcactgtcttcgacaatggcctgcattggccaatgatgata 369 Query: 278 tggtcgccttccttgacacggaagcagggggagatgtgagctgggatgttggagtgcctc 337 ||||| |||||||| ||||||||||| || |||| ||||| || ||||| || |||||| Sbjct: 368 tggtctccttccttaacacggaagcatggtgagacatgagccggaatgtttgaatgcctc 309 Query: 338 ttctcatacctctgatacttcttcacaaagtgaaggtagttcctgcgcacgatgatcgtc 397 |||||||||||||||||||||||||||||||||||||| | ||| |||||||| || ||| Sbjct: 308 ttctcatacctctgatacttcttcacaaagtgaaggtaatcccttcgcacgataatggtc 249 Query: 398 ctgttcatcttggcgctgtggcaggttccagctatgattctgcccctgatggcaacagtt 457 || | ||| || || |||||||| || ||||||| ||| | || || |||| ||||||| Sbjct: 248 ctctgcattttcgcactgtggcaagtaccagctaagatacgacctctaatggaaacagtt 189 Query: 458 ccagtgaatgggcacttcttgtcaa 482 |||||||| ||||| |||||||||| Sbjct: 188 ccagtgaaggggcatttcttgtcaa 164
>gb|AY059947.1| Arabidopsis thaliana cytosolic ribosomal protein S11 (At3g48930; T2J13.230) mRNA, complete cds Length = 690 Score = 208 bits (105), Expect = 1e-50 Identities = 225/265 (84%) Strand = Plus / Minus Query: 218 accttcaggacattgaatctcacagttttcgacaggggcctgcactggccaatgatgaca 277 ||||||| |||||||| ||||| || ||||||| |||||||| ||||||||||||| | Sbjct: 507 accttcaacacattgaacctcactgtcttcgacaatggcctgcattggccaatgatgata 448 Query: 278 tggtcgccttccttgacacggaagcagggggagatgtgagctgggatgttggagtgcctc 337 ||||| |||||||| ||||||||||| || |||| ||||| || ||||| || |||||| Sbjct: 447 tggtctccttccttaacacggaagcatggtgagacatgagccggaatgtttgaatgcctc 388 Query: 338 ttctcatacctctgatacttcttcacaaagtgaaggtagttcctgcgcacgatgatcgtc 397 |||||||||||||||||||||||||||||||||||||| | ||| |||||||| || ||| Sbjct: 387 ttctcatacctctgatacttcttcacaaagtgaaggtaatcccttcgcacgataatggtc 328 Query: 398 ctgttcatcttggcgctgtggcaggttccagctatgattctgcccctgatggcaacagtt 457 || | ||| || || |||||||| || ||||||| ||| | || || |||| ||||||| Sbjct: 327 ctctgcattttcgcactgtggcaagtaccagctaagatacgacctctaatggaaacagtt 268 Query: 458 ccagtgaatgggcacttcttgtcaa 482 |||||||| ||||| |||||||||| Sbjct: 267 ccagtgaaggggcatttcttgtcaa 243
>emb|BX825783.1|CNS0A6DQ Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTSIL62ZC12 of Silique of strain col-0 of Arabidopsis thaliana (thale cress) Length = 627 Score = 208 bits (105), Expect = 1e-50 Identities = 225/265 (84%) Strand = Plus / Minus Query: 218 accttcaggacattgaatctcacagttttcgacaggggcctgcactggccaatgatgaca 277 ||||||| |||||||| ||||| || ||||||| |||||||| ||||||||||||| | Sbjct: 481 accttcaacacattgaacctcactgtcttcgacaatggcctgcattggccaatgatgata 422 Query: 278 tggtcgccttccttgacacggaagcagggggagatgtgagctgggatgttggagtgcctc 337 ||||| |||||||| ||||||||||| || |||| ||||| || ||||| || |||||| Sbjct: 421 tggtctccttccttaacacggaagcatggtgagacatgagccggaatgtttgaatgcctc 362 Query: 338 ttctcatacctctgatacttcttcacaaagtgaaggtagttcctgcgcacgatgatcgtc 397 |||||||||||||||||||||||||||||||||||||| | ||| |||||||| || ||| Sbjct: 361 ttctcatacctctgatacttcttcacaaagtgaaggtaatcccttcgcacgataatggtc 302 Query: 398 ctgttcatcttggcgctgtggcaggttccagctatgattctgcccctgatggcaacagtt 457 || | ||| || || |||||||| || ||||||| ||| | || || |||| ||||||| Sbjct: 301 ctctgcattttcgcactgtggcaagtaccagctaagatacgacctctaatggaaacagtt 242 Query: 458 ccagtgaatgggcacttcttgtcaa 482 |||||||| ||||| |||||||||| Sbjct: 241 ccagtgaaggggcatttcttgtcaa 217
>gb|J05216.1|ATHRPS11A A.thaliana ribosomal protein S11 mRNA, 3' end Length = 702 Score = 208 bits (105), Expect = 1e-50 Identities = 225/265 (84%) Strand = Plus / Minus Query: 218 accttcaggacattgaatctcacagttttcgacaggggcctgcactggccaatgatgaca 277 ||||||| |||||||| ||||| || ||||||| |||||||| ||||||||||||| | Sbjct: 494 accttcaacacattgaacctcactgtcttcgacaatggcctgcattggccaatgatgata 435 Query: 278 tggtcgccttccttgacacggaagcagggggagatgtgagctgggatgttggagtgcctc 337 ||||| |||||||| ||||||||||| || |||| ||||| || ||||| || |||||| Sbjct: 434 tggtctccttccttaacacggaagcatggtgagacatgagccggaatgtttgaatgcctc 375 Query: 338 ttctcatacctctgatacttcttcacaaagtgaaggtagttcctgcgcacgatgatcgtc 397 |||||||||||||||||||||||||||||||||||||| | ||| |||||||| || ||| Sbjct: 374 ttctcatacctctgatacttcttcacaaagtgaaggtaatcccttcgcacgataatggtc 315 Query: 398 ctgttcatcttggcgctgtggcaggttccagctatgattctgcccctgatggcaacagtt 457 || | ||| || || |||||||| || ||||||| ||| | || || |||| ||||||| Sbjct: 314 ctctgcattttcgcactgtggcaagtaccagctaagatacgacctctaatggaaacagtt 255 Query: 458 ccagtgaatgggcacttcttgtcaa 482 |||||||| ||||| |||||||||| Sbjct: 254 ccagtgaaggggcatttcttgtcaa 230
>ref|NM_186337.1| Oryza sativa (japonica cultivar-group), mRNA Length = 513 Score = 206 bits (104), Expect = 5e-50 Identities = 140/152 (92%) Strand = Plus / Minus Query: 197 ccggtggttccagctggaacgaccttcaggacattgaatctcacagttttcgacaggggc 256 ||||||| ||||||||| | |||||||||||| ||||| ||||||||||||||||| ||| Sbjct: 476 ccggtggatccagctgggatgaccttcaggacgttgaacctcacagttttcgacagcggc 417 Query: 257 ctgcactggccaatgatgacatggtcgccttccttgacacggaagcagggggagatgtga 316 |||||||||||||||||||||||||| |||||||||||||||||||| ||||||| |||| Sbjct: 416 ctgcactggccaatgatgacatggtcaccttccttgacacggaagcatggggagacgtga 357 Query: 317 gctgggatgttggagtgcctcttctcatacct 348 || || |||||||| ||||||||||||||||| Sbjct: 356 gccggaatgttggaatgcctcttctcatacct 325 Score = 168 bits (85), Expect = 1e-38 Identities = 127/141 (90%) Strand = Plus / Minus Query: 346 cctctgatacttcttcacaaagtgaaggtagttcctgcgcacgatgatcgtcctgttcat 405 ||||||||| ||||| ||||| || |||||||||||||| || ||||| || |||||||| Sbjct: 300 cctctgatatttcttgacaaaatggaggtagttcctgcgaacaatgatagttctgttcat 241 Query: 406 cttggcgctgtggcaggttccagctatgattctgcccctgatggcaacagttccagtgaa 465 |||||| |||||||| |||||||| ||||||||||| ||||| | ||||||||||||||| Sbjct: 240 cttggcactgtggcatgttccagcaatgattctgcctctgatagaaacagttccagtgaa 181 Query: 466 tgggcacttcttgtcaatgta 486 ||||||||||||||||||||| Sbjct: 180 tgggcacttcttgtcaatgta 160
>ref|XM_473871.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 513 Score = 206 bits (104), Expect = 5e-50 Identities = 140/152 (92%) Strand = Plus / Minus Query: 197 ccggtggttccagctggaacgaccttcaggacattgaatctcacagttttcgacaggggc 256 ||||||| ||||||||| | |||||||||||| ||||| ||||||||||||||||| ||| Sbjct: 476 ccggtggatccagctgggatgaccttcaggacgttgaacctcacagttttcgacagcggc 417 Query: 257 ctgcactggccaatgatgacatggtcgccttccttgacacggaagcagggggagatgtga 316 |||||||||||||||||||||||||| |||||||||||||||||||| ||||||| |||| Sbjct: 416 ctgcactggccaatgatgacatggtcaccttccttgacacggaagcatggggagacgtga 357 Query: 317 gctgggatgttggagtgcctcttctcatacct 348 || || |||||||| ||||||||||||||||| Sbjct: 356 gccggaatgttggaatgcctcttctcatacct 325 Score = 168 bits (85), Expect = 1e-38 Identities = 127/141 (90%) Strand = Plus / Minus Query: 346 cctctgatacttcttcacaaagtgaaggtagttcctgcgcacgatgatcgtcctgttcat 405 ||||||||| ||||| ||||| || |||||||||||||| || ||||| || |||||||| Sbjct: 300 cctctgatatttcttgacaaaatggaggtagttcctgcgaacaatgatagttctgttcat 241 Query: 406 cttggcgctgtggcaggttccagctatgattctgcccctgatggcaacagttccagtgaa 465 |||||| |||||||| |||||||| ||||||||||| ||||| | ||||||||||||||| Sbjct: 240 cttggcactgtggcatgttccagcaatgattctgcctctgatagaaacagttccagtgaa 181 Query: 466 tgggcacttcttgtcaatgta 486 ||||||||||||||||||||| Sbjct: 180 tgggcacttcttgtcaatgta 160
>ref|XM_473872.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 558 Score = 206 bits (104), Expect = 5e-50 Identities = 140/152 (92%) Strand = Plus / Minus Query: 197 ccggtggttccagctggaacgaccttcaggacattgaatctcacagttttcgacaggggc 256 ||||||| ||||||||| | |||||||||||| ||||| ||||||||||||||||| ||| Sbjct: 521 ccggtggatccagctgggatgaccttcaggacgttgaacctcacagttttcgacagcggc 462 Query: 257 ctgcactggccaatgatgacatggtcgccttccttgacacggaagcagggggagatgtga 316 |||||||||||||||||||||||||| |||||||||||||||||||| ||||||| |||| Sbjct: 461 ctgcactggccaatgatgacatggtcaccttccttgacacggaagcatggggagacgtga 402 Query: 317 gctgggatgttggagtgcctcttctcatacct 348 || || |||||||| ||||||||||||||||| Sbjct: 401 gccggaatgttggaatgcctcttctcatacct 370 Score = 168 bits (85), Expect = 1e-38 Identities = 127/141 (90%) Strand = Plus / Minus Query: 346 cctctgatacttcttcacaaagtgaaggtagttcctgcgcacgatgatcgtcctgttcat 405 ||||||||| |||||||||||||| |||||||||||||| || ||||| ||||||||||| Sbjct: 300 cctctgatatttcttcacaaagtggaggtagttcctgcgaacaatgatagtcctgttcat 241 Query: 406 cttggcgctgtggcaggttccagctatgattctgcccctgatggcaacagttccagtgaa 465 ||| || || ||||| |||||||| ||||||||||| ||||| | ||||||||||||||| Sbjct: 240 cttagcactatggcatgttccagcaatgattctgcctctgatagaaacagttccagtgaa 181 Query: 466 tgggcacttcttgtcaatgta 486 |||||||||||| |||||||| Sbjct: 180 tgggcacttcttatcaatgta 160
>emb|BX822120.1|CNS0A70U Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB14ZF01 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 704 Score = 200 bits (101), Expect = 3e-48 Identities = 224/265 (84%) Strand = Plus / Minus Query: 218 accttcaggacattgaatctcacagttttcgacaggggcctgcactggccaatgatgaca 277 ||||||| |||||||| ||||| || ||||||| |||||||| ||||||||||||| | Sbjct: 483 accttcaacacattgaacctcactgtcttcgacaatggcctgcattggccaatgatgata 424 Query: 278 tggtcgccttccttgacacggaagcagggggagatgtgagctgggatgttggagtgcctc 337 ||||| |||||||| ||||||||||| || |||| ||||| || ||||| || |||||| Sbjct: 423 tggtctccttccttaacacggaagcatggtgagacatgagccggaatgtttgaatgcctc 364 Query: 338 ttctcatacctctgatacttcttcacaaagtgaaggtagttcctgcgcacgatgatcgtc 397 |||||||||||||||||||||||||||||||||||||| | ||| |||||||| || ||| Sbjct: 363 ttctcatacctctgatacttcttcacaaagtgaaggtaatcccttcgcacgataatggtc 304 Query: 398 ctgttcatcttggcgctgtggcaggttccagctatgattctgcccctgatggcaacagtt 457 || | ||| || || |||||||| || ||||||| ||| | || || |||| ||||||| Sbjct: 303 ctctgcattttcgcactgtggcaagtaccagctaagatacgacctctaatggaaacagtt 244 Query: 458 ccagtgaatgggcacttcttgtcaa 482 ||||| || ||||| |||||||||| Sbjct: 243 ccagttaaggggcatttcttgtcaa 219
>gb|AY088032.1| Arabidopsis thaliana clone 40559 mRNA, complete sequence Length = 695 Score = 200 bits (101), Expect = 3e-48 Identities = 224/265 (84%) Strand = Plus / Minus Query: 218 accttcaggacattgaatctcacagttttcgacaggggcctgcactggccaatgatgaca 277 ||||||| |||||||| ||||| || ||||||| |||||||| ||||||||||||| | Sbjct: 511 accttcaacacattgaacctcactgtcttcgacaatggcctgcattggccaatgatgata 452 Query: 278 tggtcgccttccttgacacggaagcagggggagatgtgagctgggatgttggagtgcctc 337 ||||| |||||||| ||||||||||| || |||| ||||| || ||||| || |||||| Sbjct: 451 tggtctccttccttaacacggaagcatggtgagacatgagcaggaatgttagaatgcctc 392 Query: 338 ttctcatacctctgatacttcttcacaaagtgaaggtagttcctgcgcacgatgatcgtc 397 ||||| |||||||||||||||||||||||||||||||| | ||| |||||||| || ||| Sbjct: 391 ttctcgtacctctgatacttcttcacaaagtgaaggtaatcccttcgcacgataatggtc 332 Query: 398 ctgttcatcttggcgctgtggcaggttccagctatgattctgcccctgatggcaacagtt 457 || | ||| ||||| || ||||| || ||||||| ||| | || || |||| ||||||| Sbjct: 331 ctctgcattttggcactatggcaagtaccagctaagatacgacctctaatggaaacagtt 272 Query: 458 ccagtgaatgggcacttcttgtcaa 482 |||||||| ||||| |||||||||| Sbjct: 271 ccagtgaaggggcatttcttgtcaa 247
>ref|NM_122279.2| Arabidopsis thaliana RPS11-BETA (RIBOSOMAL PROTEIN S11-BETA); structural constituent of ribosome AT5G23740 (RPS11-BETA) mRNA, complete cds Length = 797 Score = 186 bits (94), Expect = 5e-44 Identities = 232/278 (83%) Strand = Plus / Minus Query: 209 gctggaacgaccttcaggacattgaatctcacagttttcgacaggggcctgcactggcca 268 ||||||| |||||||| |||||||| || || || ||||||| |||||||| |||||| Sbjct: 543 gctggaatcaccttcagcacattgaacctaaccgtcttcgacaacggcctgcattggcca 484 Query: 269 atgatgacatggtcgccttccttgacacggaagcagggggagatgtgagctgggatgttg 328 |||||||||||||| ||||||||||||||||| || || |||| || || ||||||||| Sbjct: 483 atgatgacatggtcaccttccttgacacggaaacacggtgagacatgggcagggatgttg 424 Query: 329 gagtgcctcttctcatacctctgatacttcttcacaaagtgaaggtagttcctgcgcacg 388 || || ||||||||||| | |||||||||||||||||||||||||| ||||| || || Sbjct: 423 gaatgtctcttctcatatcgttgatacttcttcacaaagtgaaggtaattcctacgaaca 364 Query: 389 atgatcgtcctgttcatcttggcgctgtggcaggttccagctatgattctgcccctgatg 448 ||||| || || | ||||||||| |||||||| || ||||||| ||| | || ||||| Sbjct: 363 atgatggttctctgcatcttggcactgtggcaagtaccagctaagatacgtcctctgata 304 Query: 449 gcaacagttccagtgaatgggcacttcttgtcaatgta 486 | ||| |||||||||||||| || || |||||||||| Sbjct: 303 gaaacggttccagtgaatggacatttactgtcaatgta 266
>gb|AY062955.1| Arabidopsis thaliana putative 40S ribosomal protein S11 (At5g23740) mRNA, complete cds Length = 511 Score = 186 bits (94), Expect = 5e-44 Identities = 232/278 (83%) Strand = Plus / Minus Query: 209 gctggaacgaccttcaggacattgaatctcacagttttcgacaggggcctgcactggcca 268 ||||||| |||||||| |||||||| || || || ||||||| |||||||| |||||| Sbjct: 437 gctggaatcaccttcagcacattgaacctaaccgtcttcgacaacggcctgcattggcca 378 Query: 269 atgatgacatggtcgccttccttgacacggaagcagggggagatgtgagctgggatgttg 328 |||||||||||||| ||||||||||||||||| || || |||| || || ||||||||| Sbjct: 377 atgatgacatggtcaccttccttgacacggaaacacggtgagacatgggcagggatgttg 318 Query: 329 gagtgcctcttctcatacctctgatacttcttcacaaagtgaaggtagttcctgcgcacg 388 || || ||||||||||| | |||||||||||||||||||||||||| ||||| || || Sbjct: 317 gaatgtctcttctcatatcgttgatacttcttcacaaagtgaaggtaattcctacgaaca 258 Query: 389 atgatcgtcctgttcatcttggcgctgtggcaggttccagctatgattctgcccctgatg 448 ||||| || || | ||||||||| |||||||| || ||||||| ||| | || ||||| Sbjct: 257 atgatggttctctgcatcttggcactgtggcaagtaccagctaagatacgtcctctgata 198 Query: 449 gcaacagttccagtgaatgggcacttcttgtcaatgta 486 | ||| |||||||||||||| || || |||||||||| Sbjct: 197 gaaacggttccagtgaatggacatttactgtcaatgta 160
>gb|AF360280.1| Arabidopsis thaliana putative 40S ribosomal protein S11 (At5g23740) mRNA, complete cds Length = 736 Score = 186 bits (94), Expect = 5e-44 Identities = 232/278 (83%) Strand = Plus / Minus Query: 209 gctggaacgaccttcaggacattgaatctcacagttttcgacaggggcctgcactggcca 268 ||||||| |||||||| |||||||| || || || ||||||| |||||||| |||||| Sbjct: 541 gctggaatcaccttcagcacattgaacctaaccgtcttcgacaacggcctgcattggcca 482 Query: 269 atgatgacatggtcgccttccttgacacggaagcagggggagatgtgagctgggatgttg 328 |||||||||||||| ||||||||||||||||| || || |||| || || ||||||||| Sbjct: 481 atgatgacatggtcaccttccttgacacggaaacacggtgagacatgggcagggatgttg 422 Query: 329 gagtgcctcttctcatacctctgatacttcttcacaaagtgaaggtagttcctgcgcacg 388 || || ||||||||||| | |||||||||||||||||||||||||| ||||| || || Sbjct: 421 gaatgtctcttctcatatcgttgatacttcttcacaaagtgaaggtaattcctacgaaca 362 Query: 389 atgatcgtcctgttcatcttggcgctgtggcaggttccagctatgattctgcccctgatg 448 ||||| || || | ||||||||| |||||||| || ||||||| ||| | || ||||| Sbjct: 361 atgatggttctctgcatcttggcactgtggcaagtaccagctaagatacgtcctctgata 302 Query: 449 gcaacagttccagtgaatgggcacttcttgtcaatgta 486 | ||| |||||||||||||| || || |||||||||| Sbjct: 301 gaaacggttccagtgaatggacatttactgtcaatgta 264
>gb|AY087240.1| Arabidopsis thaliana clone 33187 mRNA, complete sequence Length = 716 Score = 186 bits (94), Expect = 5e-44 Identities = 232/278 (83%) Strand = Plus / Minus Query: 209 gctggaacgaccttcaggacattgaatctcacagttttcgacaggggcctgcactggcca 268 ||||||| |||||||| |||||||| || || || ||||||| |||||||| |||||| Sbjct: 543 gctggaatcaccttcagcacattgaacctaaccgtcttcgacaacggcctgcattggcca 484 Query: 269 atgatgacatggtcgccttccttgacacggaagcagggggagatgtgagctgggatgttg 328 |||||||||||||| ||||||||||||||||| || || |||| || || ||||||||| Sbjct: 483 atgatgacatggtcaccttccttgacacggaaacacggtgagacatgggcagggatgttg 424 Query: 329 gagtgcctcttctcatacctctgatacttcttcacaaagtgaaggtagttcctgcgcacg 388 || || ||||||||||| | |||||||||||||||||||||||||| ||||| || || Sbjct: 423 gaatgtctcttctcatatcgttgatacttcttcacaaagtgaaggtaattcctacgaaca 364 Query: 389 atgatcgtcctgttcatcttggcgctgtggcaggttccagctatgattctgcccctgatg 448 ||||| || || | ||||||||| |||||||| || ||||||| ||| | || ||||| Sbjct: 363 atgatggttctctgcatcttggcactgtggcaagtaccagctaagatacgtcctctgata 304 Query: 449 gcaacagttccagtgaatgggcacttcttgtcaatgta 486 | ||| |||||||||||||| || || |||||||||| Sbjct: 303 gaaacggttccagtgaatggacatttactgtcaatgta 266
>emb|BX830649.1|CNS0A1DA Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB9ZG08 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 648 Score = 178 bits (90), Expect = 1e-41 Identities = 231/278 (83%) Strand = Plus / Minus Query: 209 gctggaacgaccttcaggacattgaatctcacagttttcgacaggggcctgcactggcca 268 ||||||| |||||||| |||||||| || | || ||||||| |||||||| |||||| Sbjct: 509 gctggaatcaccttcagcacattgaacctttccgtcttcgacaacggcctgcattggcca 450 Query: 269 atgatgacatggtcgccttccttgacacggaagcagggggagatgtgagctgggatgttg 328 |||||||||||||| ||||||||||||||||| || || |||| || || ||||||||| Sbjct: 449 atgatgacatggtcaccttccttgacacggaaacacggtgagacatgggcagggatgttg 390 Query: 329 gagtgcctcttctcatacctctgatacttcttcacaaagtgaaggtagttcctgcgcacg 388 || || ||||||||||| | |||||||||||||||||||||||||| ||||| || || Sbjct: 389 gaatgtctcttctcatatcgttgatacttcttcacaaagtgaaggtaattcctacgaaca 330 Query: 389 atgatcgtcctgttcatcttggcgctgtggcaggttccagctatgattctgcccctgatg 448 ||||| || || | ||||||||| |||||||| || ||||||| ||| | || ||||| Sbjct: 329 atgatggttctctgcatcttggcactgtggcaagtaccagctaagatacgtcctctgata 270 Query: 449 gcaacagttccagtgaatgggcacttcttgtcaatgta 486 | ||| |||||||||||||| || || |||||||||| Sbjct: 269 gaaacggttccagtgaatggacatttactgtcaatgta 232
>emb|AL731610.4|OSJN00255 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0070C17, complete sequence Length = 160484 Score = 168 bits (85), Expect = 1e-38 Identities = 127/141 (90%) Strand = Plus / Minus Query: 346 cctctgatacttcttcacaaagtgaaggtagttcctgcgcacgatgatcgtcctgttcat 405 ||||||||| |||||||||||||| |||||||||||||| || ||||| ||||||||||| Sbjct: 123339 cctctgatatttcttcacaaagtggaggtagttcctgcgaacaatgatagtcctgttcat 123280 Query: 406 cttggcgctgtggcaggttccagctatgattctgcccctgatggcaacagttccagtgaa 465 ||| || || ||||| |||||||| ||||||||||| ||||| | ||||||||||||||| Sbjct: 123279 cttagcactatggcatgttccagcaatgattctgcctctgatagaaacagttccagtgaa 123220 Query: 466 tgggcacttcttgtcaatgta 486 |||||||||||| |||||||| Sbjct: 123219 tgggcacttcttatcaatgta 123199 Score = 168 bits (85), Expect = 1e-38 Identities = 127/141 (90%) Strand = Plus / Minus Query: 346 cctctgatacttcttcacaaagtgaaggtagttcctgcgcacgatgatcgtcctgttcat 405 ||||||||| ||||| ||||| || |||||||||||||| || ||||| || |||||||| Sbjct: 120715 cctctgatatttcttgacaaaatggaggtagttcctgcgaacaatgatagttctgttcat 120656 Query: 406 cttggcgctgtggcaggttccagctatgattctgcccctgatggcaacagttccagtgaa 465 |||||| |||||||| |||||||| ||||||||||| ||||| | ||||||||||||||| Sbjct: 120655 cttggcactgtggcatgttccagcaatgattctgcctctgatagaaacagttccagtgaa 120596 Query: 466 tgggcacttcttgtcaatgta 486 ||||||||||||||||||||| Sbjct: 120595 tgggcacttcttgtcaatgta 120575 Score = 137 bits (69), Expect = 4e-29 Identities = 87/93 (93%) Strand = Plus / Minus Query: 256 cctgcactggccaatgatgacatggtcgccttccttgacacggaagcagggggagatgtg 315 ||||||||||||||||||||||||||| |||||||||||||||||||| ||||||| ||| Sbjct: 123501 cctgcactggccaatgatgacatggtcaccttccttgacacggaagcatggggagacgtg 123442 Query: 316 agctgggatgttggagtgcctcttctcatacct 348 ||| || |||||||| ||||||||||||||||| Sbjct: 123441 agccggaatgttggaatgcctcttctcatacct 123409 Score = 137 bits (69), Expect = 4e-29 Identities = 87/93 (93%) Strand = Plus / Minus Query: 256 cctgcactggccaatgatgacatggtcgccttccttgacacggaagcagggggagatgtg 315 ||||||||||||||||||||||||||| |||||||||||||||||||| ||||||| ||| Sbjct: 120890 cctgcactggccaatgatgacatggtcaccttccttgacacggaagcatggggagacgtg 120831 Query: 316 agctgggatgttggagtgcctcttctcatacct 348 ||| || |||||||| ||||||||||||||||| Sbjct: 120830 agccggaatgttggaatgcctcttctcatacct 120798 Score = 77.8 bits (39), Expect = 3e-11 Identities = 57/63 (90%) Strand = Plus / Minus Query: 197 ccggtggttccagctggaacgaccttcaggacattgaatctcacagttttcgacaggggc 256 ||||||| ||||||||| | |||||||||||| ||||| ||||||||||||||||| ||| Sbjct: 123705 ccggtggatccagctgggatgaccttcaggacgttgaacctcacagttttcgacagcggc 123646 Query: 257 ctg 259 ||| Sbjct: 123645 ctg 123643 Score = 77.8 bits (39), Expect = 3e-11 Identities = 57/63 (90%) Strand = Plus / Minus Query: 197 ccggtggttccagctggaacgaccttcaggacattgaatctcacagttttcgacaggggc 256 ||||||| ||||||||| | |||||||||||| ||||| ||||||||||||||||| ||| Sbjct: 121094 ccggtggatccagctgggatgaccttcaggacgttgaacctcacagttttcgacagcggc 121035 Query: 257 ctg 259 ||| Sbjct: 121034 ctg 121032
>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete sequence Length = 35498469 Score = 168 bits (85), Expect = 1e-38 Identities = 127/141 (90%) Strand = Plus / Minus Query: 346 cctctgatacttcttcacaaagtgaaggtagttcctgcgcacgatgatcgtcctgttcat 405 ||||||||| |||||||||||||| |||||||||||||| || ||||| ||||||||||| Sbjct: 31141258 cctctgatatttcttcacaaagtggaggtagttcctgcgaacaatgatagtcctgttcat 31141199 Query: 406 cttggcgctgtggcaggttccagctatgattctgcccctgatggcaacagttccagtgaa 465 ||| || || ||||| |||||||| ||||||||||| ||||| | ||||||||||||||| Sbjct: 31141198 cttagcactatggcatgttccagcaatgattctgcctctgatagaaacagttccagtgaa 31141139 Query: 466 tgggcacttcttgtcaatgta 486 |||||||||||| |||||||| Sbjct: 31141138 tgggcacttcttatcaatgta 31141118 Score = 168 bits (85), Expect = 1e-38 Identities = 127/141 (90%) Strand = Plus / Minus Query: 346 cctctgatacttcttcacaaagtgaaggtagttcctgcgcacgatgatcgtcctgttcat 405 ||||||||| ||||| ||||| || |||||||||||||| || ||||| || |||||||| Sbjct: 31138634 cctctgatatttcttgacaaaatggaggtagttcctgcgaacaatgatagttctgttcat 31138575 Query: 406 cttggcgctgtggcaggttccagctatgattctgcccctgatggcaacagttccagtgaa 465 |||||| |||||||| |||||||| ||||||||||| ||||| | ||||||||||||||| Sbjct: 31138574 cttggcactgtggcatgttccagcaatgattctgcctctgatagaaacagttccagtgaa 31138515 Query: 466 tgggcacttcttgtcaatgta 486 ||||||||||||||||||||| Sbjct: 31138514 tgggcacttcttgtcaatgta 31138494 Score = 137 bits (69), Expect = 4e-29 Identities = 87/93 (93%) Strand = Plus / Minus Query: 256 cctgcactggccaatgatgacatggtcgccttccttgacacggaagcagggggagatgtg 315 ||||||||||||||||||||||||||| |||||||||||||||||||| ||||||| ||| Sbjct: 31141420 cctgcactggccaatgatgacatggtcaccttccttgacacggaagcatggggagacgtg 31141361 Query: 316 agctgggatgttggagtgcctcttctcatacct 348 ||| || |||||||| ||||||||||||||||| Sbjct: 31141360 agccggaatgttggaatgcctcttctcatacct 31141328 Score = 137 bits (69), Expect = 4e-29 Identities = 87/93 (93%) Strand = Plus / Minus Query: 256 cctgcactggccaatgatgacatggtcgccttccttgacacggaagcagggggagatgtg 315 ||||||||||||||||||||||||||| |||||||||||||||||||| ||||||| ||| Sbjct: 31138809 cctgcactggccaatgatgacatggtcaccttccttgacacggaagcatggggagacgtg 31138750 Query: 316 agctgggatgttggagtgcctcttctcatacct 348 ||| || |||||||| ||||||||||||||||| Sbjct: 31138749 agccggaatgttggaatgcctcttctcatacct 31138717 Score = 95.6 bits (48), Expect = 1e-16 Identities = 120/144 (83%) Strand = Plus / Plus Query: 346 cctctgatacttcttcacaaagtgaaggtagttcctgcgcacgatgatcgtcctgttcat 405 |||||| |||||||| |||||||| || || ||||| || || || || ||||||||||| Sbjct: 25052760 cctctggtacttcttgacaaagtgcagataattcctccgaacaataatggtcctgttcat 25052819 Query: 406 cttggcgctgtggcaggttccagctatgattctgcccctgatggcaacagttccagtgaa 465 ||| || || || || |||||||||||||| | ||||| || | ||||| |||||||| Sbjct: 25052820 cttagcactatgacatgttccagctatgatacgacccctaattgatacagtaccagtgaa 25052879 Query: 466 tgggcacttcttgtcaatgtaggt 489 |||||| ||||||||||||||||| Sbjct: 25052880 tgggcatttcttgtcaatgtaggt 25052903 Score = 89.7 bits (45), Expect = 8e-15 Identities = 81/93 (87%) Strand = Plus / Plus Query: 256 cctgcactggccaatgatgacatggtcgccttccttgacacggaagcagggggagatgtg 315 |||||||||||||||||| || || || |||||||| ||||||||||| || || ||||| Sbjct: 25052582 cctgcactggccaatgatcacgtgatctccttccttaacacggaagcacggtgaaatgtg 25052641 Query: 316 agctgggatgttggagtgcctcttctcatacct 348 ||| || || ||||||||||||||||| ||||| Sbjct: 25052642 agcaggaatattggagtgcctcttctcgtacct 25052674 Score = 77.8 bits (39), Expect = 3e-11 Identities = 57/63 (90%) Strand = Plus / Minus Query: 197 ccggtggttccagctggaacgaccttcaggacattgaatctcacagttttcgacaggggc 256 ||||||| ||||||||| | |||||||||||| ||||| ||||||||||||||||| ||| Sbjct: 31141624 ccggtggatccagctgggatgaccttcaggacgttgaacctcacagttttcgacagcggc 31141565 Query: 257 ctg 259 ||| Sbjct: 31141564 ctg 31141562 Score = 77.8 bits (39), Expect = 3e-11 Identities = 57/63 (90%) Strand = Plus / Minus Query: 197 ccggtggttccagctggaacgaccttcaggacattgaatctcacagttttcgacaggggc 256 ||||||| ||||||||| | |||||||||||| ||||| ||||||||||||||||| ||| Sbjct: 31139013 ccggtggatccagctgggatgaccttcaggacgttgaacctcacagttttcgacagcggc 31138954 Query: 257 ctg 259 ||| Sbjct: 31138953 ctg 31138951
>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete sequence Length = 29644043 Score = 168 bits (85), Expect = 1e-38 Identities = 127/141 (90%) Strand = Plus / Plus Query: 346 cctctgatacttcttcacaaagtgaaggtagttcctgcgcacgatgatcgtcctgttcat 405 ||||||||| ||||| ||||| || |||||||||||||| || ||||| || |||||||| Sbjct: 22604284 cctctgatatttcttgacaaaatggaggtagttcctgcgaacaatgatagttctgttcat 22604343 Query: 406 cttggcgctgtggcaggttccagctatgattctgcccctgatggcaacagttccagtgaa 465 |||||| |||||||| |||||||| ||||||||||| ||||| | ||||||||||||||| Sbjct: 22604344 cttggcactgtggcatgttccagcaatgattctgcctctgatagaaacagttccagtgaa 22604403 Query: 466 tgggcacttcttgtcaatgta 486 ||||||||||||||||||||| Sbjct: 22604404 tgggcacttcttgtcaatgta 22604424 Score = 161 bits (81), Expect = 3e-36 Identities = 126/141 (89%) Strand = Plus / Plus Query: 346 cctctgatacttcttcacaaagtgaaggtagttcctgcgcacgatgatcgtcctgttcat 405 ||||||||| |||||||||||||| |||||||||||||| || ||||| ||||||||||| Sbjct: 22601657 cctctgatatttcttcacaaagtggaggtagttcctgcgaacaatgatagtcctgttcat 22601716 Query: 406 cttggcgctgtggcaggttccagctatgattctgcccctgatggcaacagttccagtgaa 465 ||| || || ||||| ||||| || ||||||||||| ||||| | ||||||||||||||| Sbjct: 22601717 cttagcactatggcatgttccggcaatgattctgcctctgatagaaacagttccagtgaa 22601776 Query: 466 tgggcacttcttgtcaatgta 486 |||||||||||| |||||||| Sbjct: 22601777 tgggcacttcttatcaatgta 22601797 Score = 137 bits (69), Expect = 4e-29 Identities = 87/93 (93%) Strand = Plus / Plus Query: 256 cctgcactggccaatgatgacatggtcgccttccttgacacggaagcagggggagatgtg 315 ||||||||||||||||||||||||||| |||||||||||||||||||| ||||||| ||| Sbjct: 22604109 cctgcactggccaatgatgacatggtcaccttccttgacacggaagcatggggagacgtg 22604168 Query: 316 agctgggatgttggagtgcctcttctcatacct 348 ||| || |||||||| ||||||||||||||||| Sbjct: 22604169 agccggaatgttggaatgcctcttctcatacct 22604201 Score = 137 bits (69), Expect = 4e-29 Identities = 87/93 (93%) Strand = Plus / Plus Query: 256 cctgcactggccaatgatgacatggtcgccttccttgacacggaagcagggggagatgtg 315 ||||||||||||||||||||||||||| |||||||||||||||||||| ||||||| ||| Sbjct: 22601506 cctgcactggccaatgatgacatggtcaccttccttgacacggaagcatggggagacgtg 22601565 Query: 316 agctgggatgttggagtgcctcttctcatacct 348 ||| || |||||||| ||||||||||||||||| Sbjct: 22601566 agccggaatgttggaatgcctcttctcatacct 22601598 Score = 77.8 bits (39), Expect = 3e-11 Identities = 57/63 (90%) Strand = Plus / Plus Query: 197 ccggtggttccagctggaacgaccttcaggacattgaatctcacagttttcgacaggggc 256 ||||||| ||||||||| | |||||||||||| ||||| ||||||||||||||||| ||| Sbjct: 22603905 ccggtggatccagctgggatgaccttcaggacgttgaacctcacagttttcgacagcggc 22603964 Query: 257 ctg 259 ||| Sbjct: 22603965 ctg 22603967 Score = 77.8 bits (39), Expect = 3e-11 Identities = 57/63 (90%) Strand = Plus / Plus Query: 197 ccggtggttccagctggaacgaccttcaggacattgaatctcacagttttcgacaggggc 256 ||||||| ||||||||| | |||||||||||| ||||| ||||||||||||||||| ||| Sbjct: 22601302 ccggtggatccagctgggatgaccttcaggacgttgaacctcacagttttcgacagcggc 22601361 Query: 257 ctg 259 ||| Sbjct: 22601362 ctg 22601364
>dbj|AP003932.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OJ1773_H01 Length = 146543 Score = 168 bits (85), Expect = 1e-38 Identities = 127/141 (90%) Strand = Plus / Plus Query: 346 cctctgatacttcttcacaaagtgaaggtagttcctgcgcacgatgatcgtcctgttcat 405 ||||||||| ||||| ||||| || |||||||||||||| || ||||| || |||||||| Sbjct: 22182 cctctgatatttcttgacaaaatggaggtagttcctgcgaacaatgatagttctgttcat 22241 Query: 406 cttggcgctgtggcaggttccagctatgattctgcccctgatggcaacagttccagtgaa 465 |||||| |||||||| |||||||| ||||||||||| ||||| | ||||||||||||||| Sbjct: 22242 cttggcactgtggcatgttccagcaatgattctgcctctgatagaaacagttccagtgaa 22301 Query: 466 tgggcacttcttgtcaatgta 486 ||||||||||||||||||||| Sbjct: 22302 tgggcacttcttgtcaatgta 22322 Score = 161 bits (81), Expect = 3e-36 Identities = 126/141 (89%) Strand = Plus / Plus Query: 346 cctctgatacttcttcacaaagtgaaggtagttcctgcgcacgatgatcgtcctgttcat 405 ||||||||| |||||||||||||| |||||||||||||| || ||||| ||||||||||| Sbjct: 19555 cctctgatatttcttcacaaagtggaggtagttcctgcgaacaatgatagtcctgttcat 19614 Query: 406 cttggcgctgtggcaggttccagctatgattctgcccctgatggcaacagttccagtgaa 465 ||| || || ||||| ||||| || ||||||||||| ||||| | ||||||||||||||| Sbjct: 19615 cttagcactatggcatgttccggcaatgattctgcctctgatagaaacagttccagtgaa 19674 Query: 466 tgggcacttcttgtcaatgta 486 |||||||||||| |||||||| Sbjct: 19675 tgggcacttcttatcaatgta 19695 Score = 137 bits (69), Expect = 4e-29 Identities = 87/93 (93%) Strand = Plus / Plus Query: 256 cctgcactggccaatgatgacatggtcgccttccttgacacggaagcagggggagatgtg 315 ||||||||||||||||||||||||||| |||||||||||||||||||| ||||||| ||| Sbjct: 22007 cctgcactggccaatgatgacatggtcaccttccttgacacggaagcatggggagacgtg 22066 Query: 316 agctgggatgttggagtgcctcttctcatacct 348 ||| || |||||||| ||||||||||||||||| Sbjct: 22067 agccggaatgttggaatgcctcttctcatacct 22099 Score = 137 bits (69), Expect = 4e-29 Identities = 87/93 (93%) Strand = Plus / Plus Query: 256 cctgcactggccaatgatgacatggtcgccttccttgacacggaagcagggggagatgtg 315 ||||||||||||||||||||||||||| |||||||||||||||||||| ||||||| ||| Sbjct: 19404 cctgcactggccaatgatgacatggtcaccttccttgacacggaagcatggggagacgtg 19463 Query: 316 agctgggatgttggagtgcctcttctcatacct 348 ||| || |||||||| ||||||||||||||||| Sbjct: 19464 agccggaatgttggaatgcctcttctcatacct 19496 Score = 77.8 bits (39), Expect = 3e-11 Identities = 57/63 (90%) Strand = Plus / Plus Query: 197 ccggtggttccagctggaacgaccttcaggacattgaatctcacagttttcgacaggggc 256 ||||||| ||||||||| | |||||||||||| ||||| ||||||||||||||||| ||| Sbjct: 21803 ccggtggatccagctgggatgaccttcaggacgttgaacctcacagttttcgacagcggc 21862 Query: 257 ctg 259 ||| Sbjct: 21863 ctg 21865 Score = 77.8 bits (39), Expect = 3e-11 Identities = 57/63 (90%) Strand = Plus / Plus Query: 197 ccggtggttccagctggaacgaccttcaggacattgaatctcacagttttcgacaggggc 256 ||||||| ||||||||| | |||||||||||| ||||| ||||||||||||||||| ||| Sbjct: 19200 ccggtggatccagctgggatgaccttcaggacgttgaacctcacagttttcgacagcggc 19259 Query: 257 ctg 259 ||| Sbjct: 19260 ctg 19262
>dbj|AP003705.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OJ1112_E08 Length = 119926 Score = 168 bits (85), Expect = 1e-38 Identities = 127/141 (90%) Strand = Plus / Plus Query: 346 cctctgatacttcttcacaaagtgaaggtagttcctgcgcacgatgatcgtcctgttcat 405 ||||||||| ||||| ||||| || |||||||||||||| || ||||| || |||||||| Sbjct: 84666 cctctgatatttcttgacaaaatggaggtagttcctgcgaacaatgatagttctgttcat 84725 Query: 406 cttggcgctgtggcaggttccagctatgattctgcccctgatggcaacagttccagtgaa 465 |||||| |||||||| |||||||| ||||||||||| ||||| | ||||||||||||||| Sbjct: 84726 cttggcactgtggcatgttccagcaatgattctgcctctgatagaaacagttccagtgaa 84785 Query: 466 tgggcacttcttgtcaatgta 486 ||||||||||||||||||||| Sbjct: 84786 tgggcacttcttgtcaatgta 84806 Score = 161 bits (81), Expect = 3e-36 Identities = 126/141 (89%) Strand = Plus / Plus Query: 346 cctctgatacttcttcacaaagtgaaggtagttcctgcgcacgatgatcgtcctgttcat 405 ||||||||| |||||||||||||| |||||||||||||| || ||||| ||||||||||| Sbjct: 82039 cctctgatatttcttcacaaagtggaggtagttcctgcgaacaatgatagtcctgttcat 82098 Query: 406 cttggcgctgtggcaggttccagctatgattctgcccctgatggcaacagttccagtgaa 465 ||| || || ||||| ||||| || ||||||||||| ||||| | ||||||||||||||| Sbjct: 82099 cttagcactatggcatgttccggcaatgattctgcctctgatagaaacagttccagtgaa 82158 Query: 466 tgggcacttcttgtcaatgta 486 |||||||||||| |||||||| Sbjct: 82159 tgggcacttcttatcaatgta 82179 Score = 137 bits (69), Expect = 4e-29 Identities = 87/93 (93%) Strand = Plus / Plus Query: 256 cctgcactggccaatgatgacatggtcgccttccttgacacggaagcagggggagatgtg 315 ||||||||||||||||||||||||||| |||||||||||||||||||| ||||||| ||| Sbjct: 84491 cctgcactggccaatgatgacatggtcaccttccttgacacggaagcatggggagacgtg 84550 Query: 316 agctgggatgttggagtgcctcttctcatacct 348 ||| || |||||||| ||||||||||||||||| Sbjct: 84551 agccggaatgttggaatgcctcttctcatacct 84583 Score = 137 bits (69), Expect = 4e-29 Identities = 87/93 (93%) Strand = Plus / Plus Query: 256 cctgcactggccaatgatgacatggtcgccttccttgacacggaagcagggggagatgtg 315 ||||||||||||||||||||||||||| |||||||||||||||||||| ||||||| ||| Sbjct: 81888 cctgcactggccaatgatgacatggtcaccttccttgacacggaagcatggggagacgtg 81947 Query: 316 agctgggatgttggagtgcctcttctcatacct 348 ||| || |||||||| ||||||||||||||||| Sbjct: 81948 agccggaatgttggaatgcctcttctcatacct 81980 Score = 77.8 bits (39), Expect = 3e-11 Identities = 57/63 (90%) Strand = Plus / Plus Query: 197 ccggtggttccagctggaacgaccttcaggacattgaatctcacagttttcgacaggggc 256 ||||||| ||||||||| | |||||||||||| ||||| ||||||||||||||||| ||| Sbjct: 84287 ccggtggatccagctgggatgaccttcaggacgttgaacctcacagttttcgacagcggc 84346 Query: 257 ctg 259 ||| Sbjct: 84347 ctg 84349 Score = 77.8 bits (39), Expect = 3e-11 Identities = 57/63 (90%) Strand = Plus / Plus Query: 197 ccggtggttccagctggaacgaccttcaggacattgaatctcacagttttcgacaggggc 256 ||||||| ||||||||| | |||||||||||| ||||| ||||||||||||||||| ||| Sbjct: 81684 ccggtggatccagctgggatgaccttcaggacgttgaacctcacagttttcgacagcggc 81743 Query: 257 ctg 259 ||| Sbjct: 81744 ctg 81746
>gb|L07877.1|ATHRPS11B Arabidopsis thaliana ribosomal protein S11 (RPS11-beta) mRNA, complete cds Length = 684 Score = 161 bits (81), Expect = 3e-36 Identities = 222/269 (82%) Strand = Plus / Minus Query: 218 accttcaggacattgaatctcacagttttcgacaggggcctgcactggccaatgatgaca 277 |||||||| |||||||| || || || ||||||| |||||||| ||||||||||||||| Sbjct: 501 accttcagcacattgaacctaaccgtcttcgacaacggcctgcattggccaatgatgaca 442 Query: 278 tggtcgccttccttgacacggaagcagggggagatgtgagctgggatgttggagtgcctc 337 ||||| ||||||||||||||||| || || |||| || || ||||||| ||| || ||| Sbjct: 441 tggtcaccttccttgacacggaaacacggtgagacatgggcagggatgtgggaatgtctc 382 Query: 338 ttctcatacctctgatacttcttcacaaagtgaaggtagttcctgcgcacgatgatcgtc 397 |||||||| | ||||||||||||||||||||||||| | ||| || || ||||| || Sbjct: 381 ttctcatatcggggatacttcttcacaaagtgaaggtaatccctacgaacaatgatggtt 322 Query: 398 ctgttcatcttggcgctgtggcaggttccagctatgattctgcccctgatggcaacagtt 457 || | ||||||||| |||||||| || ||||||| ||| | || ||||| | ||| ||| Sbjct: 321 ctctgcatcttggcactgtggcaagtaccagctaagatacgtcctctgatagaaacggtt 262 Query: 458 ccagtgaatgggcacttcttgtcaatgta 486 ||||||||||| || || |||||||||| Sbjct: 261 ccagtgaatggacatttactgtcaatgta 233
>gb|BT014186.1| Lycopersicon esculentum clone 133363F, mRNA sequence Length = 726 Score = 151 bits (76), Expect = 3e-33 Identities = 232/284 (81%) Strand = Plus / Minus Query: 209 gctggaacgaccttcaggacattgaatctcacagttttcgacaggggcctgcactggcca 268 ||||||| ||||||| |||||||| ||||||||||| || | ||||||||||||||| Sbjct: 517 gctggaatcaccttcaatacattgaacctcacagttttggataaaggcctgcactggcca 458 Query: 269 atgatgacatggtcgccttccttgacacggaagcagggggagatgtgagctgggatgttg 328 || | ||||| || || || || ||||||||||| || || ||||||||||| || ||| Sbjct: 457 atagtaacatgatctccctctttcacacggaagcatggtgatatgtgagctggaatattg 398 Query: 329 gagtgcctcttctcatacctctgatacttcttcacaaagtgaaggtagttcctgcgcacg 388 ||||| ||||||||||| |||||||||||||| ||| | || ||||| || | || || Sbjct: 397 gagtgtctcttctcatatctctgatacttcttgacataatgtaggtaattgcgtcgaaca 338 Query: 389 atgatcgtcctgttcatcttggcgctgtggcaggttccagctatgattctgcccctgatg 448 ||||| |||||||||||||| || |||||||| || ||||| | ||| | ||| | ||| Sbjct: 337 atgatggtcctgttcatcttagcactgtggcatgtgccagcaaggatacggcctcggata 278 Query: 449 gcaacagttccagtgaatgggcacttcttgtcaatgtaggtacc 492 | |||| | |||||||||||||| ||||||||||| || ||||| Sbjct: 277 gaaacattgccagtgaatgggcatttcttgtcaatatatgtacc 234
>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete sequence Length = 28434780 Score = 139 bits (70), Expect = 1e-29 Identities = 127/146 (86%) Strand = Plus / Plus Query: 344 tacctctgatacttcttcacaaagtgaaggtagttcctgcgcacgatgatcgtcctgttc 403 |||| |||||| ||||||||||| || |||||||| ||||| |||||||| ||||| ||| Sbjct: 6238866 taccgctgatatttcttcacaaaatggaggtagtttctgcgtacgatgattgtcctattc 6238925 Query: 404 atcttggcgctgtggcaggttccagctatgattctgcccctgatggcaacagttccagtg 463 |||||||| |||||||| |||||||| || ||||| || ||||| | ||||||||||||| Sbjct: 6238926 atcttggcactgtggcatgttccagcaataattctacctctgatagaaacagttccagtg 6238985 Query: 464 aatgggcacttcttgtcaatgtaggt 489 |||||||| ||||| || |||||||| Sbjct: 6238986 aatgggcatttcttatcgatgtaggt 6239011 Score = 123 bits (62), Expect = 6e-25 Identities = 83/90 (92%) Strand = Plus / Plus Query: 256 cctgcactggccaatgatgacatggtcgccttccttgacacggaagcagggggagatgtg 315 ||||||||||||||||||||||||||| |||||||| ||||||||||| || || ||||| Sbjct: 6238692 cctgcactggccaatgatgacatggtcaccttccttaacacggaagcatggagaaatgtg 6238751 Query: 316 agctgggatgttggagtgcctcttctcata 345 |||||| ||||||||||||||||| ||||| Sbjct: 6238752 agctggaatgttggagtgcctcttttcata 6238781
>dbj|AP003919.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC clone:OJ1734_E04 Length = 101439 Score = 139 bits (70), Expect = 1e-29 Identities = 127/146 (86%) Strand = Plus / Plus Query: 344 tacctctgatacttcttcacaaagtgaaggtagttcctgcgcacgatgatcgtcctgttc 403 |||| |||||| ||||||||||| || |||||||| ||||| |||||||| ||||| ||| Sbjct: 25003 taccgctgatatttcttcacaaaatggaggtagtttctgcgtacgatgattgtcctattc 25062 Query: 404 atcttggcgctgtggcaggttccagctatgattctgcccctgatggcaacagttccagtg 463 |||||||| |||||||| |||||||| || ||||| || ||||| | ||||||||||||| Sbjct: 25063 atcttggcactgtggcatgttccagcaataattctacctctgatagaaacagttccagtg 25122 Query: 464 aatgggcacttcttgtcaatgtaggt 489 |||||||| ||||| || |||||||| Sbjct: 25123 aatgggcatttcttatcgatgtaggt 25148 Score = 123 bits (62), Expect = 6e-25 Identities = 83/90 (92%) Strand = Plus / Plus Query: 256 cctgcactggccaatgatgacatggtcgccttccttgacacggaagcagggggagatgtg 315 ||||||||||||||||||||||||||| |||||||| ||||||||||| || || ||||| Sbjct: 24829 cctgcactggccaatgatgacatggtcaccttccttaacacggaagcatggagaaatgtg 24888 Query: 316 agctgggatgttggagtgcctcttctcata 345 |||||| ||||||||||||||||| ||||| Sbjct: 24889 agctggaatgttggagtgcctcttttcata 24918
>dbj|AP003875.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC clone:OJ1119_C05 Length = 126112 Score = 139 bits (70), Expect = 1e-29 Identities = 127/146 (86%) Strand = Plus / Plus Query: 344 tacctctgatacttcttcacaaagtgaaggtagttcctgcgcacgatgatcgtcctgttc 403 |||| |||||| ||||||||||| || |||||||| ||||| |||||||| ||||| ||| Sbjct: 102259 taccgctgatatttcttcacaaaatggaggtagtttctgcgtacgatgattgtcctattc 102318 Query: 404 atcttggcgctgtggcaggttccagctatgattctgcccctgatggcaacagttccagtg 463 |||||||| |||||||| |||||||| || ||||| || ||||| | ||||||||||||| Sbjct: 102319 atcttggcactgtggcatgttccagcaataattctacctctgatagaaacagttccagtg 102378 Query: 464 aatgggcacttcttgtcaatgtaggt 489 |||||||| ||||| || |||||||| Sbjct: 102379 aatgggcatttcttatcgatgtaggt 102404 Score = 123 bits (62), Expect = 6e-25 Identities = 83/90 (92%) Strand = Plus / Plus Query: 256 cctgcactggccaatgatgacatggtcgccttccttgacacggaagcagggggagatgtg 315 ||||||||||||||||||||||||||| |||||||| ||||||||||| || || ||||| Sbjct: 102085 cctgcactggccaatgatgacatggtcaccttccttaacacggaagcatggagaaatgtg 102144 Query: 316 agctgggatgttggagtgcctcttctcata 345 |||||| ||||||||||||||||| ||||| Sbjct: 102145 agctggaatgttggagtgcctcttttcata 102174
>ref|NM_119226.2| Arabidopsis thaliana structural constituent of ribosome AT4G30800 mRNA, complete cds Length = 808 Score = 129 bits (65), Expect = 9e-27 Identities = 185/225 (82%) Strand = Plus / Minus Query: 204 ttccagctggaacgaccttcaggacattgaatctcacagttttcgacaggggcctgcact 263 ||||||| |||| |||||||||||||||||| ||||| || || |||| |||||||| | Sbjct: 491 ttccagccggaatgaccttcaggacattgaacctcaccgtctttgacaatggcctgcatt 432 Query: 264 ggccaatgatgacatggtcgccttccttgacacggaagcagggggagatgtgagctggga 323 | |||||| | ||| | || ||||| |||||||||||||| ||||| | ||||| || | Sbjct: 431 gcccaatggtaacacgatctccttctttgacacggaagcacggggaaacatgagcaggaa 372 Query: 324 tgttggagtgcctcttctcatacctctgatacttcttcacaaagtgaaggtagttcctgc 383 |||| ||||| || |||||||| || |||||||||||||||| ||||| |||| ||| | Sbjct: 371 tgtttgagtgtcttttctcatatcttcgatacttcttcacaaaatgaagatagtccctac 312 Query: 384 gcacgatgatcgtcctgttcatcttggcgctgtggcaggttccag 428 | || ||||||||||| | |||||| || ||||| || ||||||| Sbjct: 311 gaacaatgatcgtcctctgcatctttgcactgtgacaagttccag 267
>gb|AY091204.1| Arabidopsis thaliana putative ribosomal protein S11 (At4g30800) mRNA, complete cds Length = 511 Score = 129 bits (65), Expect = 9e-27 Identities = 185/225 (82%) Strand = Plus / Minus Query: 204 ttccagctggaacgaccttcaggacattgaatctcacagttttcgacaggggcctgcact 263 ||||||| |||| |||||||||||||||||| ||||| || || |||| |||||||| | Sbjct: 442 ttccagccggaatgaccttcaggacattgaacctcaccgtctttgacaatggcctgcatt 383 Query: 264 ggccaatgatgacatggtcgccttccttgacacggaagcagggggagatgtgagctggga 323 | |||||| | ||| | || ||||| |||||||||||||| ||||| | ||||| || | Sbjct: 382 gcccaatggtaacacgatctccttctttgacacggaagcacggggaaacatgagcaggaa 323 Query: 324 tgttggagtgcctcttctcatacctctgatacttcttcacaaagtgaaggtagttcctgc 383 |||| ||||| || |||||||| || |||||||||||||||| ||||| |||| ||| | Sbjct: 322 tgtttgagtgtcttttctcatatcttcgatacttcttcacaaaatgaagatagtccctac 263 Query: 384 gcacgatgatcgtcctgttcatcttggcgctgtggcaggttccag 428 | || ||||||||||| | |||||| || ||||| || ||||||| Sbjct: 262 gaacaatgatcgtcctctgcatctttgcactgtgacaagttccag 218
>gb|AY046037.1| Arabidopsis thaliana putative ribosomal protein S11 (At4g30800) mRNA, complete cds Length = 829 Score = 129 bits (65), Expect = 9e-27 Identities = 185/225 (82%) Strand = Plus / Minus Query: 204 ttccagctggaacgaccttcaggacattgaatctcacagttttcgacaggggcctgcact 263 ||||||| |||| |||||||||||||||||| ||||| || || |||| |||||||| | Sbjct: 491 ttccagccggaatgaccttcaggacattgaacctcaccgtctttgacaatggcctgcatt 432 Query: 264 ggccaatgatgacatggtcgccttccttgacacggaagcagggggagatgtgagctggga 323 | |||||| | ||| | || ||||| |||||||||||||| ||||| | ||||| || | Sbjct: 431 gcccaatggtaacacgatctccttctttgacacggaagcacggggaaacatgagcaggaa 372 Query: 324 tgttggagtgcctcttctcatacctctgatacttcttcacaaagtgaaggtagttcctgc 383 |||| ||||| || |||||||| || |||||||||||||||| ||||| |||| ||| | Sbjct: 371 tgtttgagtgtcttttctcatatcttcgatacttcttcacaaaatgaagatagtccctac 312 Query: 384 gcacgatgatcgtcctgttcatcttggcgctgtggcaggttccag 428 | || ||||||||||| | |||||| || ||||| || ||||||| Sbjct: 311 gaacaatgatcgtcctctgcatctttgcactgtgacaagttccag 267
>dbj|AK058705.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-019-C09, full insert sequence Length = 365 Score = 119 bits (60), Expect = 9e-24 Identities = 93/104 (89%) Strand = Plus / Minus Query: 230 ttgaatctcacagttttcgacaggggcctgcactggccaatgatgacatggtcgccttcc 289 ||||| ||||||||||| || | ||||||||||||||||||||||||||||| |||||| Sbjct: 104 ttgaacctcacagtttttgataaaggcctgcactggccaatgatgacatggtcaccttcc 45 Query: 290 ttgacacggaagcagggggagatgtgagctgggatgttggagtg 333 || ||||||||||| || || ||||||||||| ||||||||||| Sbjct: 44 ttaacacggaagcatggagaaatgtgagctggaatgttggagtg 1
>emb|AL132967.1|ATT2J13 Arabidopsis thaliana DNA chromosome 3, BAC clone T2J13 Length = 85109 Score = 109 bits (55), Expect = 9e-21 Identities = 118/139 (84%) Strand = Plus / Minus Query: 344 tacctctgatacttcttcacaaagtgaaggtagttcctgcgcacgatgatcgtcctgttc 403 |||||||||||||||||||||||||||||||| | ||| |||||||| || ||||| | | Sbjct: 78054 tacctctgatacttcttcacaaagtgaaggtaatcccttcgcacgataatggtcctctgc 77995 Query: 404 atcttggcgctgtggcaggttccagctatgattctgcccctgatggcaacagttccagtg 463 || || || |||||||| || ||||||| ||| | || || |||| ||||||||||||| Sbjct: 77994 attttcgcactgtggcaagtaccagctaagatacgacctctaatggaaacagttccagtg 77935 Query: 464 aatgggcacttcttgtcaa 482 || ||||| |||||||||| Sbjct: 77934 aaggggcatttcttgtcaa 77916 Score = 89.7 bits (45), Expect = 8e-15 Identities = 81/93 (87%) Strand = Plus / Minus Query: 256 cctgcactggccaatgatgacatggtcgccttccttgacacggaagcagggggagatgtg 315 |||||| ||||||||||||| |||||| |||||||| ||||||||||| || |||| || Sbjct: 78224 cctgcattggccaatgatgatatggtctccttccttaacacggaagcatggtgagacatg 78165 Query: 316 agctgggatgttggagtgcctcttctcatacct 348 ||| || ||||| || ||||||||||||||||| Sbjct: 78164 agccggaatgtttgaatgcctcttctcatacct 78132
>gb|L28828.1|ATHMTRIPR Arabidopsis thaliana ribosomal protein S11 gene, complete cds Length = 2725 Score = 109 bits (55), Expect = 9e-21 Identities = 118/139 (84%) Strand = Plus / Minus Query: 344 tacctctgatacttcttcacaaagtgaaggtagttcctgcgcacgatgatcgtcctgttc 403 |||||||||||||||||||||||||||||||| | ||| |||||||| || ||||| | | Sbjct: 1963 tacctctgatacttcttcacaaagtgaaggtaatcccttcgcacgataatggtcctctgc 1904 Query: 404 atcttggcgctgtggcaggttccagctatgattctgcccctgatggcaacagttccagtg 463 || || || |||||||| || ||||||| ||| | || || |||| ||||||||||||| Sbjct: 1903 attttcgcactgtggcaagtaccagctaagatacgacctctaatggaaacagttccagtg 1844 Query: 464 aatgggcacttcttgtcaa 482 || ||||| |||||||||| Sbjct: 1843 aaggggcatttcttgtcaa 1825 Score = 89.7 bits (45), Expect = 8e-15 Identities = 81/93 (87%) Strand = Plus / Minus Query: 256 cctgcactggccaatgatgacatggtcgccttccttgacacggaagcagggggagatgtg 315 |||||| ||||||||||||| |||||| |||||||| ||||||||||| || |||| || Sbjct: 2133 cctgcattggccaatgatgatatggtctccttccttaacacggaagcatggtgagacatg 2074 Query: 316 agctgggatgttggagtgcctcttctcatacct 348 ||| || ||||| || ||||||||||||||||| Sbjct: 2073 agccggaatgtttgaatgcctcttctcatacct 2041
>gb|M31024.1|SOYRPS11A Soybean ribosomal protein S11 mRNA, 3' end Length = 677 Score = 105 bits (53), Expect = 1e-19 Identities = 215/269 (79%) Strand = Plus / Minus Query: 221 ttcaggacattgaatctcacagttttcgacaggggcctgcactggccaatgatgacatgg 280 |||| ||||||||| ||||| || || || || |||||||| || ||||| || || || Sbjct: 371 ttcaagacattgaacctcactgtcttagagagaggcctgcattgaccaataataacgtga 312 Query: 281 tcgccttccttgacacggaagcagggggagatgtgagctgggatgttggagtgcctcttc 340 || |||||||| ||||||||| || || || ||||| || || || |||||||||||| Sbjct: 311 tccccttccttcacacggaaggcaggtgatatatgagcaggaatatttgagtgcctcttc 252 Query: 341 tcatacctctgatacttcttcacaaagtgaaggtagttcctgcgcacgatgatcgtcctg 400 || |||||||| |||||||| | ||| || || || ||||| | || || || |||||| Sbjct: 251 tcgtacctctggtacttcttgataaaatggagataattccttctaacaataatagtcctg 192 Query: 401 ttcatcttggcgctgtggcaggttccagctatgattctgcccctgatggcaacagttcca 460 |||||||| || ||||| || |||||||| | ||| | ||| | ||||| |||| | ||| Sbjct: 191 ttcatcttagcactgtgacatgttccagccaagatacggccacggatggaaacattgcca 132 Query: 461 gtgaatgggcacttcttgtcaatgtaggt 489 ||||| ||||||||||||||||| ||||| Sbjct: 131 gtgaaggggcacttcttgtcaatataggt 103
>emb|X66036.1|DTS11RP D.tertiolecta mRNA for S11 ribosomal protein Length = 692 Score = 103 bits (52), Expect = 5e-19 Identities = 88/100 (88%) Strand = Plus / Minus Query: 248 gacaggggcctgcactggccaatgatgacatggtcgccttccttgacacggaagcagggg 307 ||||| ||||||||||||||||||||||| ||| || ||| | ||||||||||| ||| Sbjct: 431 gacagaggcctgcactggccaatgatgacggtgtctccatcccttacacggaagcatggg 372 Query: 308 gagatgtgagctgggatgttggagtgcctcttctcatacc 347 |||| ||| ||||||||||||| ||||||||||||||||| Sbjct: 371 gagacgtgtgctgggatgttggtgtgcctcttctcatacc 332
>dbj|D29727.1|RICYK41 Oryza sativa mRNA, partial homologous to ribosomal protein S11 gene Length = 316 Score = 99.6 bits (50), Expect = 8e-18 Identities = 75/82 (91%), Gaps = 1/82 (1%) Strand = Plus / Minus Query: 406 cttggcgctgtggcaggttcca-gctatgattctgcccctgatggcaacagttccagtga 464 |||||| |||||||| |||||| || ||||||||||| ||||| | |||||||||||||| Sbjct: 316 cttggcactgtggcatgttccaagcaatgattctgcctctgatagaaacagttccagtga 257 Query: 465 atgggcacttcttgtcaatgta 486 |||||||||||||||||||||| Sbjct: 256 atgggcacttcttgtcaatgta 235
>ref|XM_473070.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 444 Score = 95.6 bits (48), Expect = 1e-16 Identities = 120/144 (83%) Strand = Plus / Minus Query: 346 cctctgatacttcttcacaaagtgaaggtagttcctgcgcacgatgatcgtcctgttcat 405 |||||| |||||||| |||||||| || || ||||| || || || || ||||||||||| Sbjct: 300 cctctggtacttcttgacaaagtgcagataattcctccgaacaataatggtcctgttcat 241 Query: 406 cttggcgctgtggcaggttccagctatgattctgcccctgatggcaacagttccagtgaa 465 ||| || || || || |||||||||||||| | ||||| || | ||||| |||||||| Sbjct: 240 cttagcactatgacatgttccagctatgatacgacccctaattgatacagtaccagtgaa 181 Query: 466 tgggcacttcttgtcaatgtaggt 489 |||||| ||||||||||||||||| Sbjct: 180 tgggcatttcttgtcaatgtaggt 157 Score = 56.0 bits (28), Expect = 1e-04 Identities = 49/56 (87%) Strand = Plus / Minus Query: 293 acacggaagcagggggagatgtgagctgggatgttggagtgcctcttctcatacct 348 ||||||||||| || || |||||||| || || ||||||||||||||||| ||||| Sbjct: 441 acacggaagcacggtgaaatgtgagcaggaatattggagtgcctcttctcgtacct 386
>emb|AL606604.4| Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0014K14, complete sequence Length = 150187 Score = 95.6 bits (48), Expect = 1e-16 Identities = 120/144 (83%) Strand = Plus / Plus Query: 346 cctctgatacttcttcacaaagtgaaggtagttcctgcgcacgatgatcgtcctgttcat 405 |||||| |||||||| |||||||| || || ||||| || || || || ||||||||||| Sbjct: 187 cctctggtacttcttgacaaagtgcagataattcctccgaacaataatggtcctgttcat 246 Query: 406 cttggcgctgtggcaggttccagctatgattctgcccctgatggcaacagttccagtgaa 465 ||| || || || || |||||||||||||| | ||||| || | ||||| |||||||| Sbjct: 247 cttagcactatgacatgttccagctatgatacgacccctaattgatacagtaccagtgaa 306 Query: 466 tgggcacttcttgtcaatgtaggt 489 |||||| ||||||||||||||||| Sbjct: 307 tgggcatttcttgtcaatgtaggt 330 Score = 89.7 bits (45), Expect = 8e-15 Identities = 81/93 (87%) Strand = Plus / Plus Query: 256 cctgcactggccaatgatgacatggtcgccttccttgacacggaagcagggggagatgtg 315 |||||||||||||||||| || || || |||||||| ||||||||||| || || ||||| Sbjct: 9 cctgcactggccaatgatcacgtgatctccttccttaacacggaagcacggtgaaatgtg 68 Query: 316 agctgggatgttggagtgcctcttctcatacct 348 ||| || || ||||||||||||||||| ||||| Sbjct: 69 agcaggaatattggagtgcctcttctcgtacct 101
>gb|AY438661.1| Quercus petraea ribosomal protein S11 gene, partial cds and 3' UTR Length = 572 Score = 91.7 bits (46), Expect = 2e-15 Identities = 79/90 (87%) Strand = Plus / Minus Query: 256 cctgcactggccaatgatgacatggtcgccttccttgacacggaagcagggggagatgtg 315 |||||||||||||||| |||| ||||| || || || ||||| ||||| ||||| ||||| Sbjct: 230 cctgcactggccaatggtgacgtggtctccctctttcacacgaaagcatggggatatgtg 171 Query: 316 agctgggatgttggagtgcctcttctcata 345 ||||||||||| ||||||||||||||||| Sbjct: 170 tgctgggatgtttgagtgcctcttctcata 141
>dbj|AB005244.2| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MRO11 Length = 82415 Score = 91.7 bits (46), Expect = 2e-15 Identities = 79/90 (87%) Strand = Plus / Plus Query: 256 cctgcactggccaatgatgacatggtcgccttccttgacacggaagcagggggagatgtg 315 |||||| |||||||||||||||||||| ||||||||||||||||| || || |||| || Sbjct: 6111 cctgcattggccaatgatgacatggtcaccttccttgacacggaaacacggtgagacatg 6170 Query: 316 agctgggatgttggagtgcctcttctcata 345 || ||||||||||| || ||||||||||| Sbjct: 6171 ggcagggatgttggaatgtctcttctcata 6200 Score = 89.7 bits (45), Expect = 8e-15 Identities = 114/137 (83%) Strand = Plus / Plus Query: 350 tgatacttcttcacaaagtgaaggtagttcctgcgcacgatgatcgtcctgttcatcttg 409 |||||||||||||||||||||||||| ||||| || || ||||| || || | ||||||| Sbjct: 6298 tgatacttcttcacaaagtgaaggtaattcctacgaacaatgatggttctctgcatcttg 6357 Query: 410 gcgctgtggcaggttccagctatgattctgcccctgatggcaacagttccagtgaatggg 469 || |||||||| || ||||||| ||| | || ||||| | ||| |||||||||||||| Sbjct: 6358 gcactgtggcaagtaccagctaagatacgtcctctgatagaaacggttccagtgaatgga 6417 Query: 470 cacttcttgtcaatgta 486 || || |||||||||| Sbjct: 6418 catttactgtcaatgta 6434
>gb|AF227626.1|AF227626 Euphorbia esula 40S ribosomal protein S11 mRNA, complete cds Length = 745 Score = 79.8 bits (40), Expect = 8e-12 Identities = 151/188 (80%) Strand = Plus / Minus Query: 230 ttgaatctcacagttttcgacaggggcctgcactggccaatgatgacatggtcgccttcc 289 ||||| |||||||| || |||| |||||||| || ||||| || |||||||| || ||| Sbjct: 464 ttgaacctcacagtcttagacaaaggcctgcattgaccaataataacatggtctccctcc 405 Query: 290 ttgacacggaagcagggggagatgtgagctgggatgttggagtgcctcttctcatacctc 349 || ||||||||||| ||||| | || |||||||| ||||| || | ||||||||||||| Sbjct: 404 ttcacacggaagcatggggacacatgtgctgggatattggaatgacgcttctcatacctc 345 Query: 350 tgatacttcttcacaaagtgaaggtagttcctgcgcacgatgatcgtcctgttcatcttg 409 || || || || | ||| || ||||| |||| | ||||| || |||||||||||||| Sbjct: 344 tggtattttttgataaaatggaggtaattccgcctaacgataattgtcctgttcatcttt 285 Query: 410 gcgctgtg 417 || ||||| Sbjct: 284 gcactgtg 277
>gb|AC138131.16| Medicago truncatula clone mth2-21h11, complete sequence Length = 127696 Score = 77.8 bits (39), Expect = 3e-11 Identities = 120/147 (81%) Strand = Plus / Minus Query: 343 atacctctgatacttcttcacaaagtgaaggtagttcctgcgcacgatgatcgtcctgtt 402 |||||||||||| ||||| | |||||||| || ||||| | || | || ||||| || Sbjct: 63266 atacctctgatatttcttgatgaagtgaagataattcctcctaacaacaatagtcctatt 63207 Query: 403 catcttggcgctgtggcaggttccagctatgattctgcccctgatggcaacagttccagt 462 |||||| || ||||| || |||||||||| || | ||||| ||||| |||| | ||||| Sbjct: 63206 catcttagcactgtgacaagttccagctaaaatacggccccggatggaaacattgccagt 63147 Query: 463 gaatgggcacttcttgtcaatgtaggt 489 ||| ||||||||||||||||||||||| Sbjct: 63146 gaaagggcacttcttgtcaatgtaggt 63120 Score = 60.0 bits (30), Expect = 7e-06 Identities = 75/90 (83%) Strand = Plus / Minus Query: 256 cctgcactggccaatgatgacatggtcgccttccttgacacggaagcagggggagatgtg 315 |||||| |||||||| || ||||| || |||||||| ||||| |||||||| || | || Sbjct: 63446 cctgcattggccaataataacatgatctccttccttaacacgaaagcagggtgatacatg 63387 Query: 316 agctgggatgttggagtgcctcttctcata 345 || || ||||| ||||||||||||||||| Sbjct: 63386 ggcaggaatgtttgagtgcctcttctcata 63357
>gb|AC125480.33| Medicago truncatula clone mth2-8c24, complete sequence Length = 119718 Score = 75.8 bits (38), Expect = 1e-10 Identities = 65/74 (87%) Strand = Plus / Plus Query: 275 acatggtcgccttccttgacacggaagcagggggagatgtgagctgggatgttggagtgc 334 |||||||| |||||||||||||||||||| || || | |||||||| ||||| || ||| Sbjct: 56399 acatggtctccttccttgacacggaagcaaggtgatacatgagctggaatgtttgaatgc 56458 Query: 335 ctcttctcatacct 348 |||||||||||||| Sbjct: 56459 ctcttctcatacct 56472 Score = 67.9 bits (34), Expect = 3e-08 Identities = 121/150 (80%) Strand = Plus / Plus Query: 343 atacctctgatacttcttcacaaagtgaaggtagttcctgcgcacgatgatcgtcctgtt 402 |||||||||||||||||| | ||||||||| || ||||| | || || || ||||| || Sbjct: 56568 atacctctgatacttcttaataaagtgaagataattcctcctgacaataatagtcctatt 56627 Query: 403 catcttggcgctgtggcaggttccagctatgattctgcccctgatggcaacagttccagt 462 ||| || || || ||||| ||||| |||| ||| | || | ||| | |||| | || || Sbjct: 56628 cattttagcactatggcaagttccggctaagatacgacctcggatagaaacattgccggt 56687 Query: 463 gaatgggcacttcttgtcaatgtaggtacc 492 |||||| ||||||||||||||||||||||| Sbjct: 56688 gaatggacacttcttgtcaatgtaggtacc 56717
>gb|L28831.1|SOYRIPR Glycine max ribosomal protein S11 gene, complete cds Length = 3708 Score = 69.9 bits (35), Expect = 7e-09 Identities = 80/95 (84%) Strand = Plus / Minus Query: 395 gtcctgttcatcttggcgctgtggcaggttccagctatgattctgcccctgatggcaaca 454 |||||||||||||| || ||||| || |||||||| | ||| | ||| | ||||| |||| Sbjct: 2655 gtcctgttcatcttagcactgtgacatgttccagccaagatacggccacggatggaaaca 2596 Query: 455 gttccagtgaatgggcacttcttgtcaatgtaggt 489 | |||||||| ||||||||||||||||| ||||| Sbjct: 2595 ttgccagtgaaggggcacttcttgtcaatataggt 2561
>emb|AL161577.2|ATCHRIV73 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 73 Length = 194862 Score = 60.0 bits (30), Expect = 7e-06 Identities = 66/78 (84%) Strand = Plus / Minus Query: 351 gatacttcttcacaaagtgaaggtagttcctgcgcacgatgatcgtcctgttcatcttgg 410 |||||||||||||||| ||||| |||| ||| || || ||||||||||| | |||||| | Sbjct: 147719 gatacttcttcacaaaatgaagatagtccctacgaacaatgatcgtcctctgcatctttg 147660 Query: 411 cgctgtggcaggttccag 428 | ||||| || ||||||| Sbjct: 147659 cactgtgacaagttccag 147642 Score = 50.1 bits (25), Expect = 0.007 Identities = 34/37 (91%) Strand = Plus / Minus Query: 204 ttccagctggaacgaccttcaggacattgaatctcac 240 ||||||| |||| |||||||||||||||||| ||||| Sbjct: 148080 ttccagccggaatgaccttcaggacattgaacctcac 148044 Score = 44.1 bits (22), Expect = 0.43 Identities = 52/62 (83%) Strand = Plus / Minus Query: 284 ccttccttgacacggaagcagggggagatgtgagctgggatgttggagtgcctcttctca 343 ||||| |||||||||||||| ||||| | ||||| || ||||| ||||| || |||||| Sbjct: 147867 ccttctttgacacggaagcacggggaaacatgagcaggaatgtttgagtgtcttttctca 147808 Query: 344 ta 345 || Sbjct: 147807 ta 147806
>emb|AL022198.1|ATF6I18 Arabidopsis thaliana DNA chromosome 4, BAC clone F6I18 (ESSA project) Length = 122322 Score = 60.0 bits (30), Expect = 7e-06 Identities = 66/78 (84%) Strand = Plus / Plus Query: 351 gatacttcttcacaaagtgaaggtagttcctgcgcacgatgatcgtcctgttcatcttgg 410 |||||||||||||||| ||||| |||| ||| || || ||||||||||| | |||||| | Sbjct: 120114 gatacttcttcacaaaatgaagatagtccctacgaacaatgatcgtcctctgcatctttg 120173 Query: 411 cgctgtggcaggttccag 428 | ||||| || ||||||| Sbjct: 120174 cactgtgacaagttccag 120191 Score = 50.1 bits (25), Expect = 0.007 Identities = 34/37 (91%) Strand = Plus / Plus Query: 204 ttccagctggaacgaccttcaggacattgaatctcac 240 ||||||| |||| |||||||||||||||||| ||||| Sbjct: 119753 ttccagccggaatgaccttcaggacattgaacctcac 119789 Score = 44.1 bits (22), Expect = 0.43 Identities = 52/62 (83%) Strand = Plus / Plus Query: 284 ccttccttgacacggaagcagggggagatgtgagctgggatgttggagtgcctcttctca 343 ||||| |||||||||||||| ||||| | ||||| || ||||| ||||| || |||||| Sbjct: 119966 ccttctttgacacggaagcacggggaaacatgagcaggaatgtttgagtgtcttttctca 120025 Query: 344 ta 345 || Sbjct: 120026 ta 120027
>emb|AL109787.1|ATT10C21 Arabidopsis thaliana DNA chromosome 4, BAC clone T10C21 Length = 77860 Score = 60.0 bits (30), Expect = 7e-06 Identities = 66/78 (84%) Strand = Plus / Minus Query: 351 gatacttcttcacaaagtgaaggtagttcctgcgcacgatgatcgtcctgttcatcttgg 410 |||||||||||||||| ||||| |||| ||| || || ||||||||||| | |||||| | Sbjct: 46604 gatacttcttcacaaaatgaagatagtccctacgaacaatgatcgtcctctgcatctttg 46545 Query: 411 cgctgtggcaggttccag 428 | ||||| || ||||||| Sbjct: 46544 cactgtgacaagttccag 46527 Score = 50.1 bits (25), Expect = 0.007 Identities = 34/37 (91%) Strand = Plus / Minus Query: 204 ttccagctggaacgaccttcaggacattgaatctcac 240 ||||||| |||| |||||||||||||||||| ||||| Sbjct: 46965 ttccagccggaatgaccttcaggacattgaacctcac 46929 Score = 44.1 bits (22), Expect = 0.43 Identities = 52/62 (83%) Strand = Plus / Minus Query: 284 ccttccttgacacggaagcagggggagatgtgagctgggatgttggagtgcctcttctca 343 ||||| |||||||||||||| ||||| | ||||| || ||||| ||||| || |||||| Sbjct: 46752 ccttctttgacacggaagcacggggaaacatgagcaggaatgtttgagtgtcttttctca 46693 Query: 344 ta 345 || Sbjct: 46692 ta 46691
>gb|DQ460045.1| Marmota monax ribosomal protein S11 mRNA, partial cds Length = 459 Score = 58.0 bits (29), Expect = 3e-05 Identities = 41/45 (91%) Strand = Plus / Minus Query: 445 gatggcaacagttccagtgaatgggcacttcttgtcaatgtaggt 489 ||||| |||| | |||||||| ||||||||||||||||||||||| Sbjct: 238 gatggaaacattaccagtgaaagggcacttcttgtcaatgtaggt 194
>gb|AY769326.1| Bombyx mori ribosomal protein S11-2 (RpS11-2) mRNA, complete cds Length = 509 Score = 56.0 bits (28), Expect = 1e-04 Identities = 34/36 (94%) Strand = Plus / Minus Query: 458 ccagtgaatgggcacttcttgtcaatgtaggtaccc 493 |||||||| || |||||||||||||||||||||||| Sbjct: 185 ccagtgaagggacacttcttgtcaatgtaggtaccc 150
>gb|AY769325.1| Bombyx mori ribosomal protein S11-1 (RpS11-1) mRNA, complete cds Length = 513 Score = 56.0 bits (28), Expect = 1e-04 Identities = 34/36 (94%) Strand = Plus / Minus Query: 458 ccagtgaatgggcacttcttgtcaatgtaggtaccc 493 |||||||| || |||||||||||||||||||||||| Sbjct: 188 ccagtgaagggacacttcttgtcaatgtaggtaccc 153
>gb|AY706955.1| Bombyx mori ribosomal protein S11 (S11) mRNA, complete cds Length = 518 Score = 56.0 bits (28), Expect = 1e-04 Identities = 34/36 (94%) Strand = Plus / Minus Query: 458 ccagtgaatgggcacttcttgtcaatgtaggtaccc 493 |||||||| || |||||||||||||||||||||||| Sbjct: 195 ccagtgaagggacacttcttgtcaatgtaggtaccc 160
>ref|XM_961331.1| PREDICTED: Tribolium castaneum similar to CG8857-PA, isoform A, transcript variant 1 (LOC657461), mRNA Length = 498 Score = 56.0 bits (28), Expect = 1e-04 Identities = 40/44 (90%) Strand = Plus / Minus Query: 443 ctgatggcaacagttccagtgaatgggcacttcttgtcaatgta 486 ||||||| |||| ||||||||||||| || |||||||||||||| Sbjct: 188 ctgatggaaacatttccagtgaatggacatttcttgtcaatgta 145
>ref|XM_970640.1| PREDICTED: Tribolium castaneum similar to CG8857-PA, isoform A, transcript variant 2 (LOC657461), mRNA Length = 507 Score = 56.0 bits (28), Expect = 1e-04 Identities = 40/44 (90%) Strand = Plus / Minus Query: 443 ctgatggcaacagttccagtgaatgggcacttcttgtcaatgta 486 ||||||| |||| ||||||||||||| || |||||||||||||| Sbjct: 197 ctgatggaaacatttccagtgaatggacatttcttgtcaatgta 154
>gb|DQ401082.1| Chlamydomonas sp. ICE-L 40S ribosomal protein S11 (RPS11) mRNA, complete cds Length = 576 Score = 56.0 bits (28), Expect = 1e-04 Identities = 31/32 (96%) Strand = Plus / Minus Query: 458 ccagtgaatgggcacttcttgtcaatgtaggt 489 |||||||| ||||||||||||||||||||||| Sbjct: 201 ccagtgaaggggcacttcttgtcaatgtaggt 170 Score = 48.1 bits (24), Expect = 0.027 Identities = 39/44 (88%) Strand = Plus / Minus Query: 332 tgcctcttctcatacctctgatacttcttcacaaagtgaaggta 375 ||||||||||| ||||| |||||||||||||||||| ||||| Sbjct: 327 tgcctcttctcgtacctggcatacttcttcacaaagtgcaggta 284
>emb|AJ005170.1|CPAJ5170 Cyanophora paradoxa partial mRNA for 40S ribosomal protein S11 Length = 626 Score = 54.0 bits (27), Expect = 4e-04 Identities = 45/51 (88%) Strand = Plus / Minus Query: 217 gaccttcaggacattgaatctcacagttttcgacaggggcctgcactggcc 267 |||||||||||||||||| | || || ||||||||||||| ||||||||| Sbjct: 439 gaccttcaggacattgaagcggacggtcttcgacaggggccggcactggcc 389 Score = 42.1 bits (21), Expect = 1.7 Identities = 27/29 (93%) Strand = Plus / Minus Query: 458 ccagtgaatgggcacttcttgtcaatgta 486 |||||||| |||||||||||||| ||||| Sbjct: 198 ccagtgaacgggcacttcttgtcgatgta 170
>gb|AY232057.1| Drosophila yakuba clone yak-ad_CG8857 mRNA sequence Length = 465 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 467 gggcacttcttgtcaatgtaggtacc 492 |||||||||||||||||||||||||| Sbjct: 173 gggcacttcttgtcaatgtaggtacc 148
>ref|XM_448726.1| Candida glabrata CBS138, CAGL0K11748g partial mRNA Length = 471 Score = 50.1 bits (25), Expect = 0.007 Identities = 28/29 (96%) Strand = Plus / Minus Query: 458 ccagtgaatgggcacttcttgtcaatgta 486 ||||||||||| ||||||||||||||||| Sbjct: 185 ccagtgaatggacacttcttgtcaatgta 157
>emb|CR380957.1| Candida glabrata strain CBS138 chromosome K complete sequence Length = 1302002 Score = 50.1 bits (25), Expect = 0.007 Identities = 28/29 (96%) Strand = Plus / Minus Query: 458 ccagtgaatgggcacttcttgtcaatgta 486 ||||||||||| ||||||||||||||||| Sbjct: 1131142 ccagtgaatggacacttcttgtcaatgta 1131114
>gb|AF400208.1| Spodoptera frugiperda ribosomal protein S11 mRNA, complete cds Length = 519 Score = 50.1 bits (25), Expect = 0.007 Identities = 28/29 (96%) Strand = Plus / Minus Query: 458 ccagtgaatgggcacttcttgtcaatgta 486 ||||||||||||||||||||||| ||||| Sbjct: 197 ccagtgaatgggcacttcttgtcgatgta 169
>ref|XM_517681.1| PREDICTED: Pan troglodytes similar to ribosomal protein S11 (LOC461780), mRNA Length = 477 Score = 48.1 bits (24), Expect = 0.027 Identities = 30/32 (93%) Strand = Plus / Minus Query: 458 ccagtgaatgggcacttcttgtcaatgtaggt 489 |||||||| ||||| ||||||||||||||||| Sbjct: 191 ccagtgaaggggcatttcttgtcaatgtaggt 160
>ref|NM_001030833.1| Gallus gallus ribosomal protein S11 (RPS11), mRNA Length = 477 Score = 48.1 bits (24), Expect = 0.027 Identities = 30/32 (93%) Strand = Plus / Minus Query: 458 ccagtgaatgggcacttcttgtcaatgtaggt 489 |||||||| |||||||||||||| |||||||| Sbjct: 191 ccagtgaaggggcacttcttgtcgatgtaggt 160
>gb|AE017341.1| Cryptococcus neoformans var. neoformans JEC21 chromosome 1, complete sequence Length = 2300533 Score = 48.1 bits (24), Expect = 0.027 Identities = 30/32 (93%) Strand = Plus / Minus Query: 458 ccagtgaatgggcacttcttgtcaatgtaggt 489 |||||||| |||||||||||||| |||||||| Sbjct: 1766933 ccagtgaaggggcacttcttgtcgatgtaggt 1766902
>gb|BC070224.1| Homo sapiens ribosomal protein S11, mRNA (cDNA clone MGC:88205 IMAGE:4809182), complete cds Length = 562 Score = 48.1 bits (24), Expect = 0.027 Identities = 30/32 (93%) Strand = Plus / Minus Query: 458 ccagtgaatgggcacttcttgtcaatgtaggt 489 |||||||| ||||| ||||||||||||||||| Sbjct: 194 ccagtgaaggggcatttcttgtcaatgtaggt 163
>gb|BC016378.1| Homo sapiens ribosomal protein S11, mRNA (cDNA clone MGC:27330 IMAGE:4667201), complete cds Length = 565 Score = 48.1 bits (24), Expect = 0.027 Identities = 30/32 (93%) Strand = Plus / Minus Query: 458 ccagtgaatgggcacttcttgtcaatgtaggt 489 |||||||| ||||| ||||||||||||||||| Sbjct: 197 ccagtgaaggggcatttcttgtcaatgtaggt 166
>gb|BC007283.1| Homo sapiens ribosomal protein S11, mRNA (cDNA clone MGC:15628 IMAGE:3343839), complete cds Length = 597 Score = 48.1 bits (24), Expect = 0.027 Identities = 30/32 (93%) Strand = Plus / Minus Query: 458 ccagtgaatgggcacttcttgtcaatgtaggt 489 |||||||| ||||| ||||||||||||||||| Sbjct: 242 ccagtgaaggggcatttcttgtcaatgtaggt 211
>gb|BC010028.2| Homo sapiens ribosomal protein S11, mRNA (cDNA clone MGC:19681 IMAGE:3357773), complete cds Length = 597 Score = 48.1 bits (24), Expect = 0.027 Identities = 30/32 (93%) Strand = Plus / Minus Query: 458 ccagtgaatgggcacttcttgtcaatgtaggt 489 |||||||| ||||| ||||||||||||||||| Sbjct: 242 ccagtgaaggggcatttcttgtcaatgtaggt 211
>gb|BC007603.1| Homo sapiens ribosomal protein S11, mRNA (cDNA clone MGC:15679 IMAGE:3350204), complete cds Length = 597 Score = 48.1 bits (24), Expect = 0.027 Identities = 30/32 (93%) Strand = Plus / Minus Query: 458 ccagtgaatgggcacttcttgtcaatgtaggt 489 |||||||| ||||| ||||||||||||||||| Sbjct: 242 ccagtgaaggggcatttcttgtcaatgtaggt 211
>gb|BC012641.1| Mus musculus ribosomal protein S11, mRNA (cDNA clone MGC:13737 IMAGE:4019309), complete cds Length = 635 Score = 48.1 bits (24), Expect = 0.027 Identities = 33/36 (91%) Strand = Plus / Minus Query: 458 ccagtgaatgggcacttcttgtcaatgtaggtaccc 493 |||||||| ||||| |||||||| |||||||||||| Sbjct: 283 ccagtgaaggggcatttcttgtctatgtaggtaccc 248
>ref|NM_001015.3| Homo sapiens ribosomal protein S11 (RPS11), mRNA Length = 641 Score = 48.1 bits (24), Expect = 0.027 Identities = 30/32 (93%) Strand = Plus / Minus Query: 458 ccagtgaatgggcacttcttgtcaatgtaggt 489 |||||||| ||||| ||||||||||||||||| Sbjct: 271 ccagtgaaggggcatttcttgtcaatgtaggt 240
>ref|XM_566991.1| Cryptococcus neoformans var. neoformans JEC21 ribosomal protein S11 (CNA06500) partial mRNA Length = 592 Score = 48.1 bits (24), Expect = 0.027 Identities = 30/32 (93%) Strand = Plus / Minus Query: 458 ccagtgaatgggcacttcttgtcaatgtaggt 489 |||||||| |||||||||||||| |||||||| Sbjct: 188 ccagtgaaggggcacttcttgtcgatgtaggt 157
>gb|AC126256.4| Mus musculus BAC clone RP24-235B15 from chromosome 7, complete sequence Length = 188677 Score = 48.1 bits (24), Expect = 0.027 Identities = 33/36 (91%) Strand = Plus / Plus Query: 458 ccagtgaatgggcacttcttgtcaatgtaggtaccc 493 |||||||| ||||| |||||||| |||||||||||| Sbjct: 167368 ccagtgaaggggcatttcttgtctatgtaggtaccc 167403
>gb|BC007945.2| Homo sapiens ribosomal protein S11, mRNA (cDNA clone MGC:14322 IMAGE:4297932), complete cds Length = 613 Score = 48.1 bits (24), Expect = 0.027 Identities = 30/32 (93%) Strand = Plus / Minus Query: 458 ccagtgaatgggcacttcttgtcaatgtaggt 489 |||||||| ||||| ||||||||||||||||| Sbjct: 243 ccagtgaaggggcatttcttgtcaatgtaggt 212
>gb|BC024649.1| Homo sapiens cDNA clone IMAGE:3864427, **** WARNING: chimeric clone **** Length = 1079 Score = 48.1 bits (24), Expect = 0.027 Identities = 30/32 (93%) Strand = Plus / Minus Query: 458 ccagtgaatgggcacttcttgtcaatgtaggt 489 |||||||| ||||| ||||||||||||||||| Sbjct: 726 ccagtgaaggggcatttcttgtcaatgtaggt 695
>emb|AL592164.6| Human DNA sequence from clone RP13-126P21 on chromosome X Contains a ribosomal protein S11 (RPS11) pseudogene and a CpG island, complete sequence Length = 124687 Score = 48.1 bits (24), Expect = 0.027 Identities = 30/32 (93%) Strand = Plus / Minus Query: 458 ccagtgaatgggcacttcttgtcaatgtaggt 489 |||||||| ||||| ||||||||||||||||| Sbjct: 60870 ccagtgaaggggcatttcttgtcaatgtaggt 60839
>gb|BC100025.1| Homo sapiens ribosomal protein S11, mRNA (cDNA clone MGC:111369 IMAGE:30565084), complete cds Length = 680 Score = 48.1 bits (24), Expect = 0.027 Identities = 30/32 (93%) Strand = Plus / Minus Query: 458 ccagtgaatgggcacttcttgtcaatgtaggt 489 |||||||| ||||| ||||||||||||||||| Sbjct: 293 ccagtgaaggggcatttcttgtcaatgtaggt 262
>emb|CR622474.1| full-length cDNA clone CS0DI048YO17 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 518 Score = 48.1 bits (24), Expect = 0.027 Identities = 30/32 (93%) Strand = Plus / Minus Query: 458 ccagtgaatgggcacttcttgtcaatgtaggt 489 |||||||| ||||| ||||||||||||||||| Sbjct: 178 ccagtgaaggggcatttcttgtcaatgtaggt 147
>emb|CR619273.1| full-length cDNA clone CS0DD004YJ13 of Neuroblastoma Cot 50-normalized of Homo sapiens (human) Length = 518 Score = 48.1 bits (24), Expect = 0.027 Identities = 30/32 (93%) Strand = Plus / Minus Query: 458 ccagtgaatgggcacttcttgtcaatgtaggt 489 |||||||| ||||| ||||||||||||||||| Sbjct: 178 ccagtgaaggggcatttcttgtcaatgtaggt 147
>emb|CR616168.1| full-length cDNA clone CS0DI042YK07 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 518 Score = 48.1 bits (24), Expect = 0.027 Identities = 30/32 (93%) Strand = Plus / Minus Query: 458 ccagtgaatgggcacttcttgtcaatgtaggt 489 |||||||| ||||| ||||||||||||||||| Sbjct: 178 ccagtgaaggggcatttcttgtcaatgtaggt 147
>emb|CR603659.1| full-length cDNA clone CS0DG003YB11 of B cells (Ramos cell line) of Homo sapiens (human) Length = 518 Score = 48.1 bits (24), Expect = 0.027 Identities = 30/32 (93%) Strand = Plus / Minus Query: 458 ccagtgaatgggcacttcttgtcaatgtaggt 489 |||||||| ||||| ||||||||||||||||| Sbjct: 178 ccagtgaaggggcatttcttgtcaatgtaggt 147
>emb|CR601848.1| full-length cDNA clone CS0CAP001YM19 of Thymus of Homo sapiens (human) Length = 541 Score = 48.1 bits (24), Expect = 0.027 Identities = 30/32 (93%) Strand = Plus / Minus Query: 458 ccagtgaatgggcacttcttgtcaatgtaggt 489 |||||||| ||||| ||||||||||||||||| Sbjct: 189 ccagtgaaggggcatttcttgtcaatgtaggt 158
>emb|CR598342.1| full-length cDNA clone CS0DL003YJ01 of B cells (Ramos cell line) Cot 25-normalized of Homo sapiens (human) Length = 518 Score = 48.1 bits (24), Expect = 0.027 Identities = 30/32 (93%) Strand = Plus / Minus Query: 458 ccagtgaatgggcacttcttgtcaatgtaggt 489 |||||||| ||||| ||||||||||||||||| Sbjct: 178 ccagtgaaggggcatttcttgtcaatgtaggt 147
>gb|AC010619.7| Homo sapiens chromosome 19 clone CTD-3148I10, complete sequence Length = 179394 Score = 48.1 bits (24), Expect = 0.027 Identities = 30/32 (93%) Strand = Plus / Minus Query: 458 ccagtgaatgggcacttcttgtcaatgtaggt 489 |||||||| ||||| ||||||||||||||||| Sbjct: 84734 ccagtgaaggggcatttcttgtcaatgtaggt 84703
>emb|CR591220.1| full-length cDNA clone CS0DC026YF21 of Neuroblastoma Cot 25-normalized of Homo sapiens (human) Length = 518 Score = 48.1 bits (24), Expect = 0.027 Identities = 30/32 (93%) Strand = Plus / Minus Query: 458 ccagtgaatgggcacttcttgtcaatgtaggt 489 |||||||| ||||| ||||||||||||||||| Sbjct: 178 ccagtgaaggggcatttcttgtcaatgtaggt 147
>dbj|AB226116.1| Aspergillus oryzae cDNA, contig sequence: AoEST2973 Length = 974 Score = 48.1 bits (24), Expect = 0.027 Identities = 30/32 (93%) Strand = Plus / Minus Query: 458 ccagtgaatgggcacttcttgtcaatgtaggt 489 |||||||| |||||||||||||| |||||||| Sbjct: 296 ccagtgaaggggcacttcttgtcgatgtaggt 265
>dbj|D49429.1|MUSF9 Mus musculus PW29 mRNA for pokeweed agglutinin-binding protein, complete cds Length = 3929 Score = 48.1 bits (24), Expect = 0.027 Identities = 33/36 (91%) Strand = Plus / Plus Query: 458 ccagtgaatgggcacttcttgtcaatgtaggtaccc 493 |||||||| ||||| |||||||| |||||||||||| Sbjct: 345 ccagtgaaggggcatttcttgtctatgtaggtaccc 380
>dbj|AK150738.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length enriched library, clone:I830014L05 product:ribosomal protein S11, full insert sequence Length = 577 Score = 48.1 bits (24), Expect = 0.027 Identities = 33/36 (91%) Strand = Plus / Minus Query: 458 ccagtgaatgggcacttcttgtcaatgtaggtaccc 493 |||||||| ||||| |||||||| |||||||||||| Sbjct: 244 ccagtgaaggggcatttcttgtctatgtaggtaccc 209
>gb|AC167287.2| Pan troglodytes chromosome X clone RP43-056J23 map human ortholog p11.4, complete sequence Length = 164383 Score = 48.1 bits (24), Expect = 0.027 Identities = 30/32 (93%) Strand = Plus / Minus Query: 458 ccagtgaatgggcacttcttgtcaatgtaggt 489 |||||||| ||||| ||||||||||||||||| Sbjct: 728 ccagtgaaggggcatttcttgtcaatgtaggt 697
>dbj|AK005147.1| Mus musculus adult male cerebellum cDNA, RIKEN full-length enriched library, clone:1500004H08 product:ribosomal protein S11, full insert sequence Length = 549 Score = 48.1 bits (24), Expect = 0.027 Identities = 33/36 (91%) Strand = Plus / Minus Query: 458 ccagtgaatgggcacttcttgtcaatgtaggtaccc 493 |||||||| ||||| |||||||| |||||||||||| Sbjct: 214 ccagtgaaggggcatttcttgtctatgtaggtaccc 179
>dbj|AK011207.1| Mus musculus 10 days embryo whole body cDNA, RIKEN full-length enriched library, clone:2600014C13 product:ribosomal protein S11, full insert sequence Length = 1106 Score = 48.1 bits (24), Expect = 0.027 Identities = 33/36 (91%) Strand = Plus / Minus Query: 458 ccagtgaatgggcacttcttgtcaatgtaggtaccc 493 |||||||| ||||| |||||||| |||||||||||| Sbjct: 772 ccagtgaaggggcatttcttgtctatgtaggtaccc 737
>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete sequence Length = 35954743 Score = 48.1 bits (24), Expect = 0.027 Identities = 33/36 (91%) Strand = Plus / Plus Query: 346 cctctgatacttcttcacaaagtgaaggtagttcct 381 ||||| ||||||||| ||||||||||| |||||||| Sbjct: 24175707 cctctaatacttcttgacaaagtgaagatagttcct 24175742 Score = 42.1 bits (21), Expect = 1.7 Identities = 27/29 (93%) Strand = Plus / Plus Query: 461 gtgaatgggcacttcttgtcaatgtaggt 489 ||||||||||| ||||| ||||||||||| Sbjct: 24175832 gtgaatgggcatttcttatcaatgtaggt 24175860
>gb|AC127070.10| Homo sapiens 12 BAC RP11-46H11 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 181012 Score = 48.1 bits (24), Expect = 0.027 Identities = 30/32 (93%) Strand = Plus / Plus Query: 458 ccagtgaatgggcacttcttgtcaatgtaggt 489 |||||||| ||||| ||||||||||||||||| Sbjct: 123927 ccagtgaaggggcatttcttgtcaatgtaggt 123958
>gb|AY892455.1| Synthetic construct Homo sapiens clone FLH030244.01L ribosomal protein S11 (RPS11) mRNA, partial cds Length = 477 Score = 48.1 bits (24), Expect = 0.027 Identities = 30/32 (93%) Strand = Plus / Minus Query: 458 ccagtgaatgggcacttcttgtcaatgtaggt 489 |||||||| ||||| ||||||||||||||||| Sbjct: 191 ccagtgaaggggcatttcttgtcaatgtaggt 160
>gb|AY889972.1| Synthetic construct Homo sapiens clone FLH030248.01X ribosomal protein S11 (RPS11) mRNA, complete cds Length = 477 Score = 48.1 bits (24), Expect = 0.027 Identities = 30/32 (93%) Strand = Plus / Minus Query: 458 ccagtgaatgggcacttcttgtcaatgtaggt 489 |||||||| ||||| ||||||||||||||||| Sbjct: 191 ccagtgaaggggcatttcttgtcaatgtaggt 160
>dbj|AP005286.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ1004_A05 Length = 174290 Score = 48.1 bits (24), Expect = 0.027 Identities = 33/36 (91%) Strand = Plus / Plus Query: 346 cctctgatacttcttcacaaagtgaaggtagttcct 381 ||||| ||||||||| ||||||||||| |||||||| Sbjct: 134448 cctctaatacttcttgacaaagtgaagatagttcct 134483 Score = 42.1 bits (21), Expect = 1.7 Identities = 27/29 (93%) Strand = Plus / Plus Query: 461 gtgaatgggcacttcttgtcaatgtaggt 489 ||||||||||| ||||| ||||||||||| Sbjct: 134573 gtgaatgggcatttcttatcaatgtaggt 134601
>gb|BC018829.2| Homo sapiens ribosomal protein S11, mRNA (cDNA clone IMAGE:3343838) Length = 597 Score = 48.1 bits (24), Expect = 0.027 Identities = 30/32 (93%) Strand = Plus / Minus Query: 458 ccagtgaatgggcacttcttgtcaatgtaggt 489 |||||||| ||||| ||||||||||||||||| Sbjct: 242 ccagtgaaggggcatttcttgtcaatgtaggt 211
>ref|NM_013725.2| Mus musculus ribosomal protein S11 (Rps11), mRNA Length = 635 Score = 48.1 bits (24), Expect = 0.027 Identities = 33/36 (91%) Strand = Plus / Minus Query: 458 ccagtgaatgggcacttcttgtcaatgtaggtaccc 493 |||||||| ||||| |||||||| |||||||||||| Sbjct: 283 ccagtgaaggggcatttcttgtctatgtaggtaccc 248
>gb|AC149868.2| Mus musculus BAC clone RP23-226I6 from 7, complete sequence Length = 190971 Score = 48.1 bits (24), Expect = 0.027 Identities = 33/36 (91%) Strand = Plus / Plus Query: 458 ccagtgaatgggcacttcttgtcaatgtaggtaccc 493 |||||||| ||||| |||||||| |||||||||||| Sbjct: 108782 ccagtgaaggggcatttcttgtctatgtaggtaccc 108817
>gb|AC150897.2| Mus musculus BAC clone RP23-289F7 from 7, complete sequence Length = 227073 Score = 48.1 bits (24), Expect = 0.027 Identities = 33/36 (91%) Strand = Plus / Minus Query: 458 ccagtgaatgggcacttcttgtcaatgtaggtaccc 493 |||||||| ||||| |||||||| |||||||||||| Sbjct: 223255 ccagtgaaggggcatttcttgtctatgtaggtaccc 223220
>gb|U93864.1|MMU93864 Mus musculus ribosomal protein S11 mRNA, complete cds Length = 537 Score = 48.1 bits (24), Expect = 0.027 Identities = 33/36 (91%) Strand = Plus / Minus Query: 458 ccagtgaatgggcacttcttgtcaatgtaggtaccc 493 |||||||| ||||| |||||||| |||||||||||| Sbjct: 199 ccagtgaaggggcatttcttgtctatgtaggtaccc 164
>emb|X06617.1|HSRPS11 Human mRNA for ribosomal protein S11 Length = 543 Score = 48.1 bits (24), Expect = 0.027 Identities = 30/32 (93%) Strand = Plus / Minus Query: 458 ccagtgaatgggcacttcttgtcaatgtaggt 489 |||||||| ||||| ||||||||||||||||| Sbjct: 206 ccagtgaaggggcatttcttgtcaatgtaggt 175
>dbj|AB028894.1| Mus musculus Rps11, U35 genes for ribosomal protein S11 and U35 snoRNA, complete cds and sequence Length = 3682 Score = 48.1 bits (24), Expect = 0.027 Identities = 33/36 (91%) Strand = Plus / Minus Query: 458 ccagtgaatgggcacttcttgtcaatgtaggtaccc 493 |||||||| ||||| |||||||| |||||||||||| Sbjct: 2870 ccagtgaaggggcatttcttgtctatgtaggtaccc 2835
>dbj|AB028893.1| Homo sapiens RPL13A, U32, U33, U34, U35, RPS11, U35 genes for ribosomal protein L13a and S11, U32, U33, U34, U35, and U35 snoRNA, complete cds and sequence Length = 13208 Score = 48.1 bits (24), Expect = 0.027 Identities = 30/32 (93%) Strand = Plus / Minus Query: 458 ccagtgaatgggcacttcttgtcaatgtaggt 489 |||||||| ||||| ||||||||||||||||| Sbjct: 10763 ccagtgaaggggcatttcttgtcaatgtaggt 10732
>dbj|AB032798.1| Gallus gallus genes for ribosomal protein S11 and U35 small nucleolar RNAs, complete cds and complete sequences Length = 3298 Score = 48.1 bits (24), Expect = 0.027 Identities = 30/32 (93%) Strand = Plus / Minus Query: 458 ccagtgaatgggcacttcttgtcaatgtaggt 489 |||||||| |||||||||||||| |||||||| Sbjct: 1395 ccagtgaaggggcacttcttgtcgatgtaggt 1364
>ref|XM_657734.1| Aspergillus nidulans FGSC A4 hypothetical protein (AN5222.2), mRNA Length = 483 Score = 46.1 bits (23), Expect = 0.11 Identities = 26/27 (96%) Strand = Plus / Minus Query: 461 gtgaatgggcacttcttgtcaatgtag 487 ||||| ||||||||||||||||||||| Sbjct: 194 gtgaaggggcacttcttgtcaatgtag 168
>ref|XM_744452.1| Aspergillus fumigatus Af293 40s ribosomal protein S11 (Afu2g04130) partial mRNA Length = 531 Score = 46.1 bits (23), Expect = 0.11 Identities = 26/27 (96%) Strand = Plus / Minus Query: 461 gtgaatgggcacttcttgtcaatgtag 487 ||||| ||||||||||||||||||||| Sbjct: 194 gtgaaggggcacttcttgtcaatgtag 168
>emb|CR734701.2|CNS0GTOC Tetraodon nigroviridis full-length cDNA Length = 510 Score = 46.1 bits (23), Expect = 0.11 Identities = 29/31 (93%) Strand = Plus / Minus Query: 456 ttccagtgaatgggcacttcttgtcaatgta 486 |||||||||| ||||| |||||||||||||| Sbjct: 157 ttccagtgaaggggcatttcttgtcaatgta 127
>emb|CR734657.2|CNS0GTN4 Tetraodon nigroviridis full-length cDNA Length = 576 Score = 46.1 bits (23), Expect = 0.11 Identities = 29/31 (93%) Strand = Plus / Minus Query: 456 ttccagtgaatgggcacttcttgtcaatgta 486 |||||||||| ||||| |||||||||||||| Sbjct: 223 ttccagtgaaggggcatttcttgtcaatgta 193
>emb|CR734641.2|CNS0GTMO Tetraodon nigroviridis full-length cDNA Length = 604 Score = 46.1 bits (23), Expect = 0.11 Identities = 29/31 (93%) Strand = Plus / Minus Query: 456 ttccagtgaatgggcacttcttgtcaatgta 486 |||||||||| ||||| |||||||||||||| Sbjct: 246 ttccagtgaaggggcatttcttgtcaatgta 216
>emb|CR652486.2|CNS0F2FG Tetraodon nigroviridis full-length cDNA Length = 579 Score = 46.1 bits (23), Expect = 0.11 Identities = 29/31 (93%) Strand = Plus / Minus Query: 456 ttccagtgaatgggcacttcttgtcaatgta 486 |||||||||| ||||| |||||||||||||| Sbjct: 226 ttccagtgaaggggcatttcttgtcaatgta 196
>emb|CR734098.2|CNS0GT7L Tetraodon nigroviridis full-length cDNA Length = 567 Score = 46.1 bits (23), Expect = 0.11 Identities = 29/31 (93%) Strand = Plus / Minus Query: 456 ttccagtgaatgggcacttcttgtcaatgta 486 |||||||||| ||||| |||||||||||||| Sbjct: 224 ttccagtgaaggggcatttcttgtcaatgta 194
>emb|CR733594.2|CNS0GSTL Tetraodon nigroviridis full-length cDNA Length = 578 Score = 46.1 bits (23), Expect = 0.11 Identities = 29/31 (93%) Strand = Plus / Minus Query: 456 ttccagtgaatgggcacttcttgtcaatgta 486 |||||||||| ||||| |||||||||||||| Sbjct: 225 ttccagtgaaggggcatttcttgtcaatgta 195
>emb|CR733664.2|CNS0GSVJ Tetraodon nigroviridis full-length cDNA Length = 579 Score = 46.1 bits (23), Expect = 0.11 Identities = 29/31 (93%) Strand = Plus / Minus Query: 456 ttccagtgaatgggcacttcttgtcaatgta 486 |||||||||| ||||| |||||||||||||| Sbjct: 226 ttccagtgaaggggcatttcttgtcaatgta 196
>emb|CR729123.2|CNS0GPJD Tetraodon nigroviridis full-length cDNA Length = 580 Score = 46.1 bits (23), Expect = 0.11 Identities = 29/31 (93%) Strand = Plus / Minus Query: 456 ttccagtgaatgggcacttcttgtcaatgta 486 |||||||||| ||||| |||||||||||||| Sbjct: 223 ttccagtgaaggggcatttcttgtcaatgta 193
>emb|CR720206.2|CNS0GINO Tetraodon nigroviridis full-length cDNA Length = 581 Score = 46.1 bits (23), Expect = 0.11 Identities = 29/31 (93%) Strand = Plus / Minus Query: 456 ttccagtgaatgggcacttcttgtcaatgta 486 |||||||||| ||||| |||||||||||||| Sbjct: 225 ttccagtgaaggggcatttcttgtcaatgta 195
>emb|CR720163.2|CNS0GIMH Tetraodon nigroviridis full-length cDNA Length = 579 Score = 46.1 bits (23), Expect = 0.11 Identities = 29/31 (93%) Strand = Plus / Minus Query: 456 ttccagtgaatgggcacttcttgtcaatgta 486 |||||||||| ||||| |||||||||||||| Sbjct: 226 ttccagtgaaggggcatttcttgtcaatgta 196
>emb|CR722960.2|CNS0GKS6 Tetraodon nigroviridis full-length cDNA Length = 583 Score = 46.1 bits (23), Expect = 0.11 Identities = 29/31 (93%) Strand = Plus / Minus Query: 456 ttccagtgaatgggcacttcttgtcaatgta 486 |||||||||| ||||| |||||||||||||| Sbjct: 226 ttccagtgaaggggcatttcttgtcaatgta 196
>emb|CR722729.2|CNS0GKLR Tetraodon nigroviridis full-length cDNA Length = 533 Score = 46.1 bits (23), Expect = 0.11 Identities = 29/31 (93%) Strand = Plus / Minus Query: 456 ttccagtgaatgggcacttcttgtcaatgta 486 |||||||||| ||||| |||||||||||||| Sbjct: 176 ttccagtgaaggggcatttcttgtcaatgta 146
>emb|CR722589.2|CNS0GKHV Tetraodon nigroviridis full-length cDNA Length = 580 Score = 46.1 bits (23), Expect = 0.11 Identities = 29/31 (93%) Strand = Plus / Minus Query: 456 ttccagtgaatgggcacttcttgtcaatgta 486 |||||||||| ||||| |||||||||||||| Sbjct: 227 ttccagtgaaggggcatttcttgtcaatgta 197
>emb|CR722385.2|CNS0GKC7 Tetraodon nigroviridis full-length cDNA Length = 579 Score = 46.1 bits (23), Expect = 0.11 Identities = 29/31 (93%) Strand = Plus / Minus Query: 456 ttccagtgaatgggcacttcttgtcaatgta 486 |||||||||| ||||| |||||||||||||| Sbjct: 226 ttccagtgaaggggcatttcttgtcaatgta 196
>emb|CR722279.2|CNS0GK99 Tetraodon nigroviridis full-length cDNA Length = 579 Score = 46.1 bits (23), Expect = 0.11 Identities = 29/31 (93%) Strand = Plus / Minus Query: 456 ttccagtgaatgggcacttcttgtcaatgta 486 |||||||||| ||||| |||||||||||||| Sbjct: 226 ttccagtgaaggggcatttcttgtcaatgta 196
>emb|CR722172.2|CNS0GK6A Tetraodon nigroviridis full-length cDNA Length = 582 Score = 46.1 bits (23), Expect = 0.11 Identities = 29/31 (93%) Strand = Plus / Minus Query: 456 ttccagtgaatgggcacttcttgtcaatgta 486 |||||||||| ||||| |||||||||||||| Sbjct: 226 ttccagtgaaggggcatttcttgtcaatgta 196
>emb|CR721659.2|CNS0GJS1 Tetraodon nigroviridis full-length cDNA Length = 579 Score = 46.1 bits (23), Expect = 0.11 Identities = 29/31 (93%) Strand = Plus / Minus Query: 456 ttccagtgaatgggcacttcttgtcaatgta 486 |||||||||| ||||| |||||||||||||| Sbjct: 226 ttccagtgaaggggcatttcttgtcaatgta 196
>emb|CR721616.2|CNS0GJQU Tetraodon nigroviridis full-length cDNA Length = 581 Score = 46.1 bits (23), Expect = 0.11 Identities = 29/31 (93%) Strand = Plus / Minus Query: 456 ttccagtgaatgggcacttcttgtcaatgta 486 |||||||||| ||||| |||||||||||||| Sbjct: 225 ttccagtgaaggggcatttcttgtcaatgta 195
>emb|CR721494.2|CNS0GJNG Tetraodon nigroviridis full-length cDNA Length = 582 Score = 46.1 bits (23), Expect = 0.11 Identities = 29/31 (93%) Strand = Plus / Minus Query: 456 ttccagtgaatgggcacttcttgtcaatgta 486 |||||||||| ||||| |||||||||||||| Sbjct: 226 ttccagtgaaggggcatttcttgtcaatgta 196
>emb|CR721276.2|CNS0GJHE Tetraodon nigroviridis full-length cDNA Length = 582 Score = 46.1 bits (23), Expect = 0.11 Identities = 29/31 (93%) Strand = Plus / Minus Query: 456 ttccagtgaatgggcacttcttgtcaatgta 486 |||||||||| ||||| |||||||||||||| Sbjct: 226 ttccagtgaaggggcatttcttgtcaatgta 196
>emb|CR721073.2|CNS0GJBR Tetraodon nigroviridis full-length cDNA Length = 579 Score = 46.1 bits (23), Expect = 0.11 Identities = 29/31 (93%) Strand = Plus / Minus Query: 456 ttccagtgaatgggcacttcttgtcaatgta 486 |||||||||| ||||| |||||||||||||| Sbjct: 226 ttccagtgaaggggcatttcttgtcaatgta 196
>emb|CR720906.2|CNS0GJ74 Tetraodon nigroviridis full-length cDNA Length = 580 Score = 46.1 bits (23), Expect = 0.11 Identities = 29/31 (93%) Strand = Plus / Minus Query: 456 ttccagtgaatgggcacttcttgtcaatgta 486 |||||||||| ||||| |||||||||||||| Sbjct: 224 ttccagtgaaggggcatttcttgtcaatgta 194
>emb|CR720856.2|CNS0GJ5Q Tetraodon nigroviridis full-length cDNA Length = 580 Score = 46.1 bits (23), Expect = 0.11 Identities = 29/31 (93%) Strand = Plus / Minus Query: 456 ttccagtgaatgggcacttcttgtcaatgta 486 |||||||||| ||||| |||||||||||||| Sbjct: 223 ttccagtgaaggggcatttcttgtcaatgta 193
>emb|CR719840.2|CNS0GIDI Tetraodon nigroviridis full-length cDNA Length = 575 Score = 46.1 bits (23), Expect = 0.11 Identities = 29/31 (93%) Strand = Plus / Minus Query: 456 ttccagtgaatgggcacttcttgtcaatgta 486 |||||||||| ||||| |||||||||||||| Sbjct: 222 ttccagtgaaggggcatttcttgtcaatgta 192
>emb|CR719341.2|CNS0GHZN Tetraodon nigroviridis full-length cDNA Length = 579 Score = 46.1 bits (23), Expect = 0.11 Identities = 29/31 (93%) Strand = Plus / Minus Query: 456 ttccagtgaatgggcacttcttgtcaatgta 486 |||||||||| ||||| |||||||||||||| Sbjct: 226 ttccagtgaaggggcatttcttgtcaatgta 196
>emb|CR718672.2|CNS0GHH2 Tetraodon nigroviridis full-length cDNA Length = 581 Score = 46.1 bits (23), Expect = 0.11 Identities = 29/31 (93%) Strand = Plus / Minus Query: 456 ttccagtgaatgggcacttcttgtcaatgta 486 |||||||||| ||||| |||||||||||||| Sbjct: 225 ttccagtgaaggggcatttcttgtcaatgta 195
>emb|CR718361.2|CNS0GH8F Tetraodon nigroviridis full-length cDNA Length = 573 Score = 46.1 bits (23), Expect = 0.11 Identities = 29/31 (93%) Strand = Plus / Minus Query: 456 ttccagtgaatgggcacttcttgtcaatgta 486 |||||||||| ||||| |||||||||||||| Sbjct: 220 ttccagtgaaggggcatttcttgtcaatgta 190
>emb|CR718344.2|CNS0GH7Y Tetraodon nigroviridis full-length cDNA Length = 579 Score = 46.1 bits (23), Expect = 0.11 Identities = 29/31 (93%) Strand = Plus / Minus Query: 456 ttccagtgaatgggcacttcttgtcaatgta 486 |||||||||| ||||| |||||||||||||| Sbjct: 226 ttccagtgaaggggcatttcttgtcaatgta 196
>emb|CR718177.2|CNS0GH3B Tetraodon nigroviridis full-length cDNA Length = 579 Score = 46.1 bits (23), Expect = 0.11 Identities = 29/31 (93%) Strand = Plus / Minus Query: 456 ttccagtgaatgggcacttcttgtcaatgta 486 |||||||||| ||||| |||||||||||||| Sbjct: 226 ttccagtgaaggggcatttcttgtcaatgta 196
>emb|CR718123.2|CNS0GH1T Tetraodon nigroviridis full-length cDNA Length = 579 Score = 46.1 bits (23), Expect = 0.11 Identities = 29/31 (93%) Strand = Plus / Minus Query: 456 ttccagtgaatgggcacttcttgtcaatgta 486 |||||||||| ||||| |||||||||||||| Sbjct: 226 ttccagtgaaggggcatttcttgtcaatgta 196
>emb|CR716899.2|CNS0GG3W Tetraodon nigroviridis full-length cDNA Length = 585 Score = 46.1 bits (23), Expect = 0.11 Identities = 29/31 (93%) Strand = Plus / Minus Query: 456 ttccagtgaatgggcacttcttgtcaatgta 486 |||||||||| ||||| |||||||||||||| Sbjct: 226 ttccagtgaaggggcatttcttgtcaatgta 196
>emb|CR716723.2|CNS0GFZ0 Tetraodon nigroviridis full-length cDNA Length = 579 Score = 46.1 bits (23), Expect = 0.11 Identities = 29/31 (93%) Strand = Plus / Minus Query: 456 ttccagtgaatgggcacttcttgtcaatgta 486 |||||||||| ||||| |||||||||||||| Sbjct: 226 ttccagtgaaggggcatttcttgtcaatgta 196
>emb|CR716358.2|CNS0GFOV Tetraodon nigroviridis full-length cDNA Length = 584 Score = 46.1 bits (23), Expect = 0.11 Identities = 29/31 (93%) Strand = Plus / Minus Query: 456 ttccagtgaatgggcacttcttgtcaatgta 486 |||||||||| ||||| |||||||||||||| Sbjct: 226 ttccagtgaaggggcatttcttgtcaatgta 196
>emb|CR716234.2|CNS0GFLF Tetraodon nigroviridis full-length cDNA Length = 579 Score = 46.1 bits (23), Expect = 0.11 Identities = 29/31 (93%) Strand = Plus / Minus Query: 456 ttccagtgaatgggcacttcttgtcaatgta 486 |||||||||| ||||| |||||||||||||| Sbjct: 226 ttccagtgaaggggcatttcttgtcaatgta 196
>emb|CR716090.2|CNS0GFHI Tetraodon nigroviridis full-length cDNA Length = 579 Score = 46.1 bits (23), Expect = 0.11 Identities = 29/31 (93%) Strand = Plus / Minus Query: 456 ttccagtgaatgggcacttcttgtcaatgta 486 |||||||||| ||||| |||||||||||||| Sbjct: 226 ttccagtgaaggggcatttcttgtcaatgta 196
>emb|CR716035.2|CNS0GFFZ Tetraodon nigroviridis full-length cDNA Length = 579 Score = 46.1 bits (23), Expect = 0.11 Identities = 29/31 (93%) Strand = Plus / Minus Query: 456 ttccagtgaatgggcacttcttgtcaatgta 486 |||||||||| ||||| |||||||||||||| Sbjct: 226 ttccagtgaaggggcatttcttgtcaatgta 196
>emb|CR711356.2|CNS0GBU0 Tetraodon nigroviridis full-length cDNA Length = 579 Score = 46.1 bits (23), Expect = 0.11 Identities = 29/31 (93%) Strand = Plus / Minus Query: 456 ttccagtgaatgggcacttcttgtcaatgta 486 |||||||||| ||||| |||||||||||||| Sbjct: 226 ttccagtgaaggggcatttcttgtcaatgta 196
>emb|CR714262.2|CNS0GE2Q Tetraodon nigroviridis full-length cDNA Length = 573 Score = 46.1 bits (23), Expect = 0.11 Identities = 29/31 (93%) Strand = Plus / Minus Query: 456 ttccagtgaatgggcacttcttgtcaatgta 486 |||||||||| ||||| |||||||||||||| Sbjct: 220 ttccagtgaaggggcatttcttgtcaatgta 190
>emb|CR713310.2|CNS0GDCA Tetraodon nigroviridis full-length cDNA Length = 583 Score = 46.1 bits (23), Expect = 0.11 Identities = 29/31 (93%) Strand = Plus / Minus Query: 456 ttccagtgaatgggcacttcttgtcaatgta 486 |||||||||| ||||| |||||||||||||| Sbjct: 226 ttccagtgaaggggcatttcttgtcaatgta 196
>emb|CR713166.2|CNS0GD8A Tetraodon nigroviridis full-length cDNA Length = 579 Score = 46.1 bits (23), Expect = 0.11 Identities = 29/31 (93%) Strand = Plus / Minus Query: 456 ttccagtgaatgggcacttcttgtcaatgta 486 |||||||||| ||||| |||||||||||||| Sbjct: 226 ttccagtgaaggggcatttcttgtcaatgta 196
>emb|CR713164.2|CNS0GD88 Tetraodon nigroviridis full-length cDNA Length = 579 Score = 46.1 bits (23), Expect = 0.11 Identities = 29/31 (93%) Strand = Plus / Minus Query: 456 ttccagtgaatgggcacttcttgtcaatgta 486 |||||||||| ||||| |||||||||||||| Sbjct: 226 ttccagtgaaggggcatttcttgtcaatgta 196
>emb|CR713096.2|CNS0GD6C Tetraodon nigroviridis full-length cDNA Length = 574 Score = 46.1 bits (23), Expect = 0.11 Identities = 29/31 (93%) Strand = Plus / Minus Query: 456 ttccagtgaatgggcacttcttgtcaatgta 486 |||||||||| ||||| |||||||||||||| Sbjct: 220 ttccagtgaaggggcatttcttgtcaatgta 190
>emb|CR712642.2|CNS0GCTQ Tetraodon nigroviridis full-length cDNA Length = 582 Score = 46.1 bits (23), Expect = 0.11 Identities = 29/31 (93%) Strand = Plus / Minus Query: 456 ttccagtgaatgggcacttcttgtcaatgta 486 |||||||||| ||||| |||||||||||||| Sbjct: 226 ttccagtgaaggggcatttcttgtcaatgta 196
>emb|CR711273.2|CNS0GBRP Tetraodon nigroviridis full-length cDNA Length = 579 Score = 46.1 bits (23), Expect = 0.11 Identities = 29/31 (93%) Strand = Plus / Minus Query: 456 ttccagtgaatgggcacttcttgtcaatgta 486 |||||||||| ||||| |||||||||||||| Sbjct: 226 ttccagtgaaggggcatttcttgtcaatgta 196
>emb|CR710920.2|CNS0GBHW Tetraodon nigroviridis full-length cDNA Length = 583 Score = 46.1 bits (23), Expect = 0.11 Identities = 29/31 (93%) Strand = Plus / Minus Query: 456 ttccagtgaatgggcacttcttgtcaatgta 486 |||||||||| ||||| |||||||||||||| Sbjct: 226 ttccagtgaaggggcatttcttgtcaatgta 196
>emb|CR710308.2|CNS0GB0W Tetraodon nigroviridis full-length cDNA Length = 573 Score = 46.1 bits (23), Expect = 0.11 Identities = 29/31 (93%) Strand = Plus / Minus Query: 456 ttccagtgaatgggcacttcttgtcaatgta 486 |||||||||| ||||| |||||||||||||| Sbjct: 220 ttccagtgaaggggcatttcttgtcaatgta 190
>emb|CR710242.2|CNS0GAZ2 Tetraodon nigroviridis full-length cDNA Length = 579 Score = 46.1 bits (23), Expect = 0.11 Identities = 29/31 (93%) Strand = Plus / Minus Query: 456 ttccagtgaatgggcacttcttgtcaatgta 486 |||||||||| ||||| |||||||||||||| Sbjct: 226 ttccagtgaaggggcatttcttgtcaatgta 196
>emb|CR708886.2|CNS0G9XE Tetraodon nigroviridis full-length cDNA Length = 573 Score = 46.1 bits (23), Expect = 0.11 Identities = 29/31 (93%) Strand = Plus / Minus Query: 456 ttccagtgaatgggcacttcttgtcaatgta 486 |||||||||| ||||| |||||||||||||| Sbjct: 220 ttccagtgaaggggcatttcttgtcaatgta 190
>emb|CR708656.2|CNS0G9R0 Tetraodon nigroviridis full-length cDNA Length = 578 Score = 46.1 bits (23), Expect = 0.11 Identities = 29/31 (93%) Strand = Plus / Minus Query: 456 ttccagtgaatgggcacttcttgtcaatgta 486 |||||||||| ||||| |||||||||||||| Sbjct: 225 ttccagtgaaggggcatttcttgtcaatgta 195
>emb|CR708653.2|CNS0G9QX Tetraodon nigroviridis full-length cDNA Length = 582 Score = 46.1 bits (23), Expect = 0.11 Identities = 29/31 (93%) Strand = Plus / Minus Query: 456 ttccagtgaatgggcacttcttgtcaatgta 486 |||||||||| ||||| |||||||||||||| Sbjct: 226 ttccagtgaaggggcatttcttgtcaatgta 196
>emb|CR708345.2|CNS0G9ID Tetraodon nigroviridis full-length cDNA Length = 579 Score = 46.1 bits (23), Expect = 0.11 Identities = 29/31 (93%) Strand = Plus / Minus Query: 456 ttccagtgaatgggcacttcttgtcaatgta 486 |||||||||| ||||| |||||||||||||| Sbjct: 226 ttccagtgaaggggcatttcttgtcaatgta 196
>emb|CR708331.2|CNS0G9HZ Tetraodon nigroviridis full-length cDNA Length = 579 Score = 46.1 bits (23), Expect = 0.11 Identities = 29/31 (93%) Strand = Plus / Minus Query: 456 ttccagtgaatgggcacttcttgtcaatgta 486 |||||||||| ||||| |||||||||||||| Sbjct: 226 ttccagtgaaggggcatttcttgtcaatgta 196
>emb|CR708220.2|CNS0G9EW Tetraodon nigroviridis full-length cDNA Length = 582 Score = 46.1 bits (23), Expect = 0.11 Identities = 29/31 (93%) Strand = Plus / Minus Query: 456 ttccagtgaatgggcacttcttgtcaatgta 486 |||||||||| ||||| |||||||||||||| Sbjct: 226 ttccagtgaaggggcatttcttgtcaatgta 196
>emb|CR707436.2|CNS0G8T4 Tetraodon nigroviridis full-length cDNA Length = 579 Score = 46.1 bits (23), Expect = 0.11 Identities = 29/31 (93%) Strand = Plus / Minus Query: 456 ttccagtgaatgggcacttcttgtcaatgta 486 |||||||||| ||||| |||||||||||||| Sbjct: 226 ttccagtgaaggggcatttcttgtcaatgta 196
>emb|CR707393.2|CNS0G8RX Tetraodon nigroviridis full-length cDNA Length = 579 Score = 46.1 bits (23), Expect = 0.11 Identities = 29/31 (93%) Strand = Plus / Minus Query: 456 ttccagtgaatgggcacttcttgtcaatgta 486 |||||||||| ||||| |||||||||||||| Sbjct: 222 ttccagtgaaggggcatttcttgtcaatgta 192
>emb|CR707172.2|CNS0G8LS Tetraodon nigroviridis full-length cDNA Length = 579 Score = 46.1 bits (23), Expect = 0.11 Identities = 29/31 (93%) Strand = Plus / Minus Query: 456 ttccagtgaatgggcacttcttgtcaatgta 486 |||||||||| ||||| |||||||||||||| Sbjct: 226 ttccagtgaaggggcatttcttgtcaatgta 196
>emb|CR705901.2|CNS0G7MH Tetraodon nigroviridis full-length cDNA Length = 582 Score = 46.1 bits (23), Expect = 0.11 Identities = 29/31 (93%) Strand = Plus / Minus Query: 456 ttccagtgaatgggcacttcttgtcaatgta 486 |||||||||| ||||| |||||||||||||| Sbjct: 226 ttccagtgaaggggcatttcttgtcaatgta 196
>emb|CR706827.2|CNS0G8C7 Tetraodon nigroviridis full-length cDNA Length = 580 Score = 46.1 bits (23), Expect = 0.11 Identities = 29/31 (93%) Strand = Plus / Minus Query: 456 ttccagtgaatgggcacttcttgtcaatgta 486 |||||||||| ||||| |||||||||||||| Sbjct: 226 ttccagtgaaggggcatttcttgtcaatgta 196
>emb|CR706665.2|CNS0G87P Tetraodon nigroviridis full-length cDNA Length = 576 Score = 46.1 bits (23), Expect = 0.11 Identities = 29/31 (93%) Strand = Plus / Minus Query: 456 ttccagtgaatgggcacttcttgtcaatgta 486 |||||||||| ||||| |||||||||||||| Sbjct: 223 ttccagtgaaggggcatttcttgtcaatgta 193
>emb|CR705532.2|CNS0G7C8 Tetraodon nigroviridis full-length cDNA Length = 582 Score = 46.1 bits (23), Expect = 0.11 Identities = 29/31 (93%) Strand = Plus / Minus Query: 456 ttccagtgaatgggcacttcttgtcaatgta 486 |||||||||| ||||| |||||||||||||| Sbjct: 226 ttccagtgaaggggcatttcttgtcaatgta 196
>emb|CR704867.2|CNS0G6TR Tetraodon nigroviridis full-length cDNA Length = 580 Score = 46.1 bits (23), Expect = 0.11 Identities = 29/31 (93%) Strand = Plus / Minus Query: 456 ttccagtgaatgggcacttcttgtcaatgta 486 |||||||||| ||||| |||||||||||||| Sbjct: 224 ttccagtgaaggggcatttcttgtcaatgta 194
>emb|CR705068.2|CNS0G6ZC Tetraodon nigroviridis full-length cDNA Length = 583 Score = 46.1 bits (23), Expect = 0.11 Identities = 29/31 (93%) Strand = Plus / Minus Query: 456 ttccagtgaatgggcacttcttgtcaatgta 486 |||||||||| ||||| |||||||||||||| Sbjct: 226 ttccagtgaaggggcatttcttgtcaatgta 196
>emb|CR705065.2|CNS0G6Z9 Tetraodon nigroviridis full-length cDNA Length = 576 Score = 46.1 bits (23), Expect = 0.11 Identities = 29/31 (93%) Strand = Plus / Minus Query: 456 ttccagtgaatgggcacttcttgtcaatgta 486 |||||||||| ||||| |||||||||||||| Sbjct: 226 ttccagtgaaggggcatttcttgtcaatgta 196
>emb|CR705044.2|CNS0G6YO Tetraodon nigroviridis full-length cDNA Length = 583 Score = 46.1 bits (23), Expect = 0.11 Identities = 29/31 (93%) Strand = Plus / Minus Query: 456 ttccagtgaatgggcacttcttgtcaatgta 486 |||||||||| ||||| |||||||||||||| Sbjct: 226 ttccagtgaaggggcatttcttgtcaatgta 196
>emb|CR704795.2|CNS0G6RR Tetraodon nigroviridis full-length cDNA Length = 583 Score = 46.1 bits (23), Expect = 0.11 Identities = 29/31 (93%) Strand = Plus / Minus Query: 456 ttccagtgaatgggcacttcttgtcaatgta 486 |||||||||| ||||| |||||||||||||| Sbjct: 226 ttccagtgaaggggcatttcttgtcaatgta 196
>emb|CR704791.2|CNS0G6RN Tetraodon nigroviridis full-length cDNA Length = 579 Score = 46.1 bits (23), Expect = 0.11 Identities = 29/31 (93%) Strand = Plus / Minus Query: 456 ttccagtgaatgggcacttcttgtcaatgta 486 |||||||||| ||||| |||||||||||||| Sbjct: 226 ttccagtgaaggggcatttcttgtcaatgta 196
>emb|CR704383.2|CNS0G6GB Tetraodon nigroviridis full-length cDNA Length = 579 Score = 46.1 bits (23), Expect = 0.11 Identities = 29/31 (93%) Strand = Plus / Minus Query: 456 ttccagtgaatgggcacttcttgtcaatgta 486 |||||||||| ||||| |||||||||||||| Sbjct: 226 ttccagtgaaggggcatttcttgtcaatgta 196
>emb|CR704283.2|CNS0G6DJ Tetraodon nigroviridis full-length cDNA Length = 583 Score = 46.1 bits (23), Expect = 0.11 Identities = 29/31 (93%) Strand = Plus / Minus Query: 456 ttccagtgaatgggcacttcttgtcaatgta 486 |||||||||| ||||| |||||||||||||| Sbjct: 226 ttccagtgaaggggcatttcttgtcaatgta 196
>emb|CR704170.2|CNS0G6AE Tetraodon nigroviridis full-length cDNA Length = 579 Score = 46.1 bits (23), Expect = 0.11 Identities = 29/31 (93%) Strand = Plus / Minus Query: 456 ttccagtgaatgggcacttcttgtcaatgta 486 |||||||||| ||||| |||||||||||||| Sbjct: 226 ttccagtgaaggggcatttcttgtcaatgta 196
>emb|CR704057.2|CNS0G679 Tetraodon nigroviridis full-length cDNA Length = 579 Score = 46.1 bits (23), Expect = 0.11 Identities = 29/31 (93%) Strand = Plus / Minus Query: 456 ttccagtgaatgggcacttcttgtcaatgta 486 |||||||||| ||||| |||||||||||||| Sbjct: 226 ttccagtgaaggggcatttcttgtcaatgta 196
>emb|CR703838.2|CNS0G616 Tetraodon nigroviridis full-length cDNA Length = 583 Score = 46.1 bits (23), Expect = 0.11 Identities = 29/31 (93%) Strand = Plus / Minus Query: 456 ttccagtgaatgggcacttcttgtcaatgta 486 |||||||||| ||||| |||||||||||||| Sbjct: 226 ttccagtgaaggggcatttcttgtcaatgta 196
>emb|CR703743.2|CNS0G5YJ Tetraodon nigroviridis full-length cDNA Length = 579 Score = 46.1 bits (23), Expect = 0.11 Identities = 29/31 (93%) Strand = Plus / Minus Query: 456 ttccagtgaatgggcacttcttgtcaatgta 486 |||||||||| ||||| |||||||||||||| Sbjct: 226 ttccagtgaaggggcatttcttgtcaatgta 196
>emb|CR703440.2|CNS0G5Q4 Tetraodon nigroviridis full-length cDNA Length = 609 Score = 46.1 bits (23), Expect = 0.11 Identities = 29/31 (93%) Strand = Plus / Minus Query: 456 ttccagtgaatgggcacttcttgtcaatgta 486 |||||||||| ||||| |||||||||||||| Sbjct: 256 ttccagtgaaggggcatttcttgtcaatgta 226
>emb|CR702639.2|CNS0G53V Tetraodon nigroviridis full-length cDNA Length = 583 Score = 46.1 bits (23), Expect = 0.11 Identities = 29/31 (93%) Strand = Plus / Minus Query: 456 ttccagtgaatgggcacttcttgtcaatgta 486 |||||||||| ||||| |||||||||||||| Sbjct: 226 ttccagtgaaggggcatttcttgtcaatgta 196
>emb|CR702598.2|CNS0G52Q Tetraodon nigroviridis full-length cDNA Length = 579 Score = 46.1 bits (23), Expect = 0.11 Identities = 29/31 (93%) Strand = Plus / Minus Query: 456 ttccagtgaatgggcacttcttgtcaatgta 486 |||||||||| ||||| |||||||||||||| Sbjct: 226 ttccagtgaaggggcatttcttgtcaatgta 196
>emb|CR702381.2|CNS0G4WP Tetraodon nigroviridis full-length cDNA Length = 579 Score = 46.1 bits (23), Expect = 0.11 Identities = 29/31 (93%) Strand = Plus / Minus Query: 456 ttccagtgaatgggcacttcttgtcaatgta 486 |||||||||| ||||| |||||||||||||| Sbjct: 226 ttccagtgaaggggcatttcttgtcaatgta 196
>emb|CR702172.2|CNS0G4QW Tetraodon nigroviridis full-length cDNA Length = 579 Score = 46.1 bits (23), Expect = 0.11 Identities = 29/31 (93%) Strand = Plus / Minus Query: 456 ttccagtgaatgggcacttcttgtcaatgta 486 |||||||||| ||||| |||||||||||||| Sbjct: 226 ttccagtgaaggggcatttcttgtcaatgta 196
>emb|CR701977.2|CNS0G4LH Tetraodon nigroviridis full-length cDNA Length = 580 Score = 46.1 bits (23), Expect = 0.11 Identities = 29/31 (93%) Strand = Plus / Minus Query: 456 ttccagtgaatgggcacttcttgtcaatgta 486 |||||||||| ||||| |||||||||||||| Sbjct: 223 ttccagtgaaggggcatttcttgtcaatgta 193
>emb|CR701646.2|CNS0G4CA Tetraodon nigroviridis full-length cDNA Length = 581 Score = 46.1 bits (23), Expect = 0.11 Identities = 29/31 (93%) Strand = Plus / Minus Query: 456 ttccagtgaatgggcacttcttgtcaatgta 486 |||||||||| ||||| |||||||||||||| Sbjct: 226 ttccagtgaaggggcatttcttgtcaatgta 196
>emb|CR701614.2|CNS0G4BE Tetraodon nigroviridis full-length cDNA Length = 582 Score = 46.1 bits (23), Expect = 0.11 Identities = 29/31 (93%) Strand = Plus / Minus Query: 456 ttccagtgaatgggcacttcttgtcaatgta 486 |||||||||| ||||| |||||||||||||| Sbjct: 226 ttccagtgaaggggcatttcttgtcaatgta 196
>emb|CR700754.2|CNS0G3NI Tetraodon nigroviridis full-length cDNA Length = 581 Score = 46.1 bits (23), Expect = 0.11 Identities = 29/31 (93%) Strand = Plus / Minus Query: 456 ttccagtgaatgggcacttcttgtcaatgta 486 |||||||||| ||||| |||||||||||||| Sbjct: 225 ttccagtgaaggggcatttcttgtcaatgta 195
>emb|CR700705.2|CNS0G3M5 Tetraodon nigroviridis full-length cDNA Length = 583 Score = 46.1 bits (23), Expect = 0.11 Identities = 29/31 (93%) Strand = Plus / Minus Query: 456 ttccagtgaatgggcacttcttgtcaatgta 486 |||||||||| ||||| |||||||||||||| Sbjct: 226 ttccagtgaaggggcatttcttgtcaatgta 196
>emb|CR700519.2|CNS0G3GZ Tetraodon nigroviridis full-length cDNA Length = 582 Score = 46.1 bits (23), Expect = 0.11 Identities = 29/31 (93%) Strand = Plus / Minus Query: 456 ttccagtgaatgggcacttcttgtcaatgta 486 |||||||||| ||||| |||||||||||||| Sbjct: 226 ttccagtgaaggggcatttcttgtcaatgta 196
>emb|CR700338.2|CNS0G3BY Tetraodon nigroviridis full-length cDNA Length = 579 Score = 46.1 bits (23), Expect = 0.11 Identities = 29/31 (93%) Strand = Plus / Minus Query: 456 ttccagtgaatgggcacttcttgtcaatgta 486 |||||||||| ||||| |||||||||||||| Sbjct: 226 ttccagtgaaggggcatttcttgtcaatgta 196
>emb|CR699682.2|CNS0G2TQ Tetraodon nigroviridis full-length cDNA Length = 579 Score = 46.1 bits (23), Expect = 0.11 Identities = 29/31 (93%) Strand = Plus / Minus Query: 456 ttccagtgaatgggcacttcttgtcaatgta 486 |||||||||| ||||| |||||||||||||| Sbjct: 226 ttccagtgaaggggcatttcttgtcaatgta 196
>emb|CR699595.2|CNS0G2RB Tetraodon nigroviridis full-length cDNA Length = 579 Score = 46.1 bits (23), Expect = 0.11 Identities = 29/31 (93%) Strand = Plus / Minus Query: 456 ttccagtgaatgggcacttcttgtcaatgta 486 |||||||||| ||||| |||||||||||||| Sbjct: 226 ttccagtgaaggggcatttcttgtcaatgta 196
>emb|CR699525.2|CNS0G2PD Tetraodon nigroviridis full-length cDNA Length = 590 Score = 46.1 bits (23), Expect = 0.11 Identities = 29/31 (93%) Strand = Plus / Minus Query: 456 ttccagtgaatgggcacttcttgtcaatgta 486 |||||||||| ||||| |||||||||||||| Sbjct: 232 ttccagtgaaggggcatttcttgtcaatgta 202
>emb|CR691350.2|CNS0FWEA Tetraodon nigroviridis full-length cDNA Length = 583 Score = 46.1 bits (23), Expect = 0.11 Identities = 29/31 (93%) Strand = Plus / Minus Query: 456 ttccagtgaatgggcacttcttgtcaatgta 486 |||||||||| ||||| |||||||||||||| Sbjct: 226 ttccagtgaaggggcatttcttgtcaatgta 196
>emb|CR691225.2|CNS0FWAT Tetraodon nigroviridis full-length cDNA Length = 579 Score = 46.1 bits (23), Expect = 0.11 Identities = 29/31 (93%) Strand = Plus / Minus Query: 456 ttccagtgaatgggcacttcttgtcaatgta 486 |||||||||| ||||| |||||||||||||| Sbjct: 226 ttccagtgaaggggcatttcttgtcaatgta 196
>emb|CR699401.2|CNS0G2LX Tetraodon nigroviridis full-length cDNA Length = 579 Score = 46.1 bits (23), Expect = 0.11 Identities = 29/31 (93%) Strand = Plus / Minus Query: 456 ttccagtgaatgggcacttcttgtcaatgta 486 |||||||||| ||||| |||||||||||||| Sbjct: 226 ttccagtgaaggggcatttcttgtcaatgta 196
>emb|CR699147.2|CNS0G2EV Tetraodon nigroviridis full-length cDNA Length = 543 Score = 46.1 bits (23), Expect = 0.11 Identities = 29/31 (93%) Strand = Plus / Minus Query: 456 ttccagtgaatgggcacttcttgtcaatgta 486 |||||||||| ||||| |||||||||||||| Sbjct: 187 ttccagtgaaggggcatttcttgtcaatgta 157
>emb|CR698972.2|CNS0G2A0 Tetraodon nigroviridis full-length cDNA Length = 579 Score = 46.1 bits (23), Expect = 0.11 Identities = 29/31 (93%) Strand = Plus / Minus Query: 456 ttccagtgaatgggcacttcttgtcaatgta 486 |||||||||| ||||| |||||||||||||| Sbjct: 226 ttccagtgaaggggcatttcttgtcaatgta 196
>emb|CR698736.2|CNS0G23G Tetraodon nigroviridis full-length cDNA Length = 580 Score = 46.1 bits (23), Expect = 0.11 Identities = 29/31 (93%) Strand = Plus / Minus Query: 456 ttccagtgaatgggcacttcttgtcaatgta 486 |||||||||| ||||| |||||||||||||| Sbjct: 224 ttccagtgaaggggcatttcttgtcaatgta 194
>emb|CR698478.2|CNS0G1WA Tetraodon nigroviridis full-length cDNA Length = 579 Score = 46.1 bits (23), Expect = 0.11 Identities = 29/31 (93%) Strand = Plus / Minus Query: 456 ttccagtgaatgggcacttcttgtcaatgta 486 |||||||||| ||||| |||||||||||||| Sbjct: 226 ttccagtgaaggggcatttcttgtcaatgta 196
>emb|CR698393.2|CNS0G1TX Tetraodon nigroviridis full-length cDNA Length = 582 Score = 46.1 bits (23), Expect = 0.11 Identities = 29/31 (93%) Strand = Plus / Minus Query: 456 ttccagtgaatgggcacttcttgtcaatgta 486 |||||||||| ||||| |||||||||||||| Sbjct: 226 ttccagtgaaggggcatttcttgtcaatgta 196
>emb|CR698371.2|CNS0G1TB Tetraodon nigroviridis full-length cDNA Length = 579 Score = 46.1 bits (23), Expect = 0.11 Identities = 29/31 (93%) Strand = Plus / Minus Query: 456 ttccagtgaatgggcacttcttgtcaatgta 486 |||||||||| ||||| |||||||||||||| Sbjct: 226 ttccagtgaaggggcatttcttgtcaatgta 196
>emb|CR698347.2|CNS0G1SN Tetraodon nigroviridis full-length cDNA Length = 579 Score = 46.1 bits (23), Expect = 0.11 Identities = 29/31 (93%) Strand = Plus / Minus Query: 456 ttccagtgaatgggcacttcttgtcaatgta 486 |||||||||| ||||| |||||||||||||| Sbjct: 226 ttccagtgaaggggcatttcttgtcaatgta 196
>emb|CR698160.2|CNS0G1NG Tetraodon nigroviridis full-length cDNA Length = 579 Score = 46.1 bits (23), Expect = 0.11 Identities = 29/31 (93%) Strand = Plus / Minus Query: 456 ttccagtgaatgggcacttcttgtcaatgta 486 |||||||||| ||||| |||||||||||||| Sbjct: 226 ttccagtgaaggggcatttcttgtcaatgta 196
>emb|CR698132.2|CNS0G1MO Tetraodon nigroviridis full-length cDNA Length = 582 Score = 46.1 bits (23), Expect = 0.11 Identities = 29/31 (93%) Strand = Plus / Minus Query: 456 ttccagtgaatgggcacttcttgtcaatgta 486 |||||||||| ||||| |||||||||||||| Sbjct: 226 ttccagtgaaggggcatttcttgtcaatgta 196
>emb|CR698013.2|CNS0G1JD Tetraodon nigroviridis full-length cDNA Length = 574 Score = 46.1 bits (23), Expect = 0.11 Identities = 29/31 (93%) Strand = Plus / Minus Query: 456 ttccagtgaatgggcacttcttgtcaatgta 486 |||||||||| ||||| |||||||||||||| Sbjct: 221 ttccagtgaaggggcatttcttgtcaatgta 191
>emb|CR697953.2|CNS0G1HP Tetraodon nigroviridis full-length cDNA Length = 579 Score = 46.1 bits (23), Expect = 0.11 Identities = 29/31 (93%) Strand = Plus / Minus Query: 456 ttccagtgaatgggcacttcttgtcaatgta 486 |||||||||| ||||| |||||||||||||| Sbjct: 226 ttccagtgaaggggcatttcttgtcaatgta 196
>emb|CR697921.2|CNS0G1GT Tetraodon nigroviridis full-length cDNA Length = 582 Score = 46.1 bits (23), Expect = 0.11 Identities = 29/31 (93%) Strand = Plus / Minus Query: 456 ttccagtgaatgggcacttcttgtcaatgta 486 |||||||||| ||||| |||||||||||||| Sbjct: 226 ttccagtgaaggggcatttcttgtcaatgta 196
>emb|CR697053.2|CNS0G0SP Tetraodon nigroviridis full-length cDNA Length = 579 Score = 46.1 bits (23), Expect = 0.11 Identities = 29/31 (93%) Strand = Plus / Minus Query: 456 ttccagtgaatgggcacttcttgtcaatgta 486 |||||||||| ||||| |||||||||||||| Sbjct: 226 ttccagtgaaggggcatttcttgtcaatgta 196
>emb|CR695928.2|CNS0FZXG Tetraodon nigroviridis full-length cDNA Length = 578 Score = 46.1 bits (23), Expect = 0.11 Identities = 29/31 (93%) Strand = Plus / Minus Query: 456 ttccagtgaatgggcacttcttgtcaatgta 486 |||||||||| ||||| |||||||||||||| Sbjct: 226 ttccagtgaaggggcatttcttgtcaatgta 196
>emb|CR695019.2|CNS0FZ87 Tetraodon nigroviridis full-length cDNA Length = 579 Score = 46.1 bits (23), Expect = 0.11 Identities = 29/31 (93%) Strand = Plus / Minus Query: 456 ttccagtgaatgggcacttcttgtcaatgta 486 |||||||||| ||||| |||||||||||||| Sbjct: 226 ttccagtgaaggggcatttcttgtcaatgta 196
>emb|CR695001.2|CNS0FZ7P Tetraodon nigroviridis full-length cDNA Length = 584 Score = 46.1 bits (23), Expect = 0.11 Identities = 29/31 (93%) Strand = Plus / Minus Query: 456 ttccagtgaatgggcacttcttgtcaatgta 486 |||||||||| ||||| |||||||||||||| Sbjct: 226 ttccagtgaaggggcatttcttgtcaatgta 196
>emb|CR694911.2|CNS0FZ57 Tetraodon nigroviridis full-length cDNA Length = 579 Score = 46.1 bits (23), Expect = 0.11 Identities = 29/31 (93%) Strand = Plus / Minus Query: 456 ttccagtgaatgggcacttcttgtcaatgta 486 |||||||||| ||||| |||||||||||||| Sbjct: 226 ttccagtgaaggggcatttcttgtcaatgta 196
>emb|CR694776.2|CNS0FZ1G Tetraodon nigroviridis full-length cDNA Length = 579 Score = 46.1 bits (23), Expect = 0.11 Identities = 29/31 (93%) Strand = Plus / Minus Query: 456 ttccagtgaatgggcacttcttgtcaatgta 486 |||||||||| ||||| |||||||||||||| Sbjct: 226 ttccagtgaaggggcatttcttgtcaatgta 196
>emb|CR694058.2|CNS0FYHI Tetraodon nigroviridis full-length cDNA Length = 583 Score = 46.1 bits (23), Expect = 0.11 Identities = 29/31 (93%) Strand = Plus / Minus Query: 456 ttccagtgaatgggcacttcttgtcaatgta 486 |||||||||| ||||| |||||||||||||| Sbjct: 226 ttccagtgaaggggcatttcttgtcaatgta 196
>emb|CR694008.2|CNS0FYG4 Tetraodon nigroviridis full-length cDNA Length = 579 Score = 46.1 bits (23), Expect = 0.11 Identities = 29/31 (93%) Strand = Plus / Minus Query: 456 ttccagtgaatgggcacttcttgtcaatgta 486 |||||||||| ||||| |||||||||||||| Sbjct: 226 ttccagtgaaggggcatttcttgtcaatgta 196
>emb|CR691077.2|CNS0FW6P Tetraodon nigroviridis full-length cDNA Length = 582 Score = 46.1 bits (23), Expect = 0.11 Identities = 29/31 (93%) Strand = Plus / Minus Query: 456 ttccagtgaatgggcacttcttgtcaatgta 486 |||||||||| ||||| |||||||||||||| Sbjct: 226 ttccagtgaaggggcatttcttgtcaatgta 196
>emb|CR691057.2|CNS0FW65 Tetraodon nigroviridis full-length cDNA Length = 579 Score = 46.1 bits (23), Expect = 0.11 Identities = 29/31 (93%) Strand = Plus / Minus Query: 456 ttccagtgaatgggcacttcttgtcaatgta 486 |||||||||| ||||| |||||||||||||| Sbjct: 226 ttccagtgaaggggcatttcttgtcaatgta 196
>emb|CR690553.2|CNS0FVS5 Tetraodon nigroviridis full-length cDNA Length = 579 Score = 46.1 bits (23), Expect = 0.11 Identities = 29/31 (93%) Strand = Plus / Minus Query: 456 ttccagtgaatgggcacttcttgtcaatgta 486 |||||||||| ||||| |||||||||||||| Sbjct: 226 ttccagtgaaggggcatttcttgtcaatgta 196
>emb|CR688440.2|CNS0FU5G Tetraodon nigroviridis full-length cDNA Length = 543 Score = 46.1 bits (23), Expect = 0.11 Identities = 29/31 (93%) Strand = Plus / Minus Query: 456 ttccagtgaatgggcacttcttgtcaatgta 486 |||||||||| ||||| |||||||||||||| Sbjct: 187 ttccagtgaaggggcatttcttgtcaatgta 157
>emb|CR689872.2|CNS0FV98 Tetraodon nigroviridis full-length cDNA Length = 582 Score = 46.1 bits (23), Expect = 0.11 Identities = 29/31 (93%) Strand = Plus / Minus Query: 456 ttccagtgaatgggcacttcttgtcaatgta 486 |||||||||| ||||| |||||||||||||| Sbjct: 226 ttccagtgaaggggcatttcttgtcaatgta 196
>emb|CR689687.2|CNS0FV43 Tetraodon nigroviridis full-length cDNA Length = 579 Score = 46.1 bits (23), Expect = 0.11 Identities = 29/31 (93%) Strand = Plus / Minus Query: 456 ttccagtgaatgggcacttcttgtcaatgta 486 |||||||||| ||||| |||||||||||||| Sbjct: 226 ttccagtgaaggggcatttcttgtcaatgta 196
>emb|CR688518.2|CNS0FU7M Tetraodon nigroviridis full-length cDNA Length = 579 Score = 46.1 bits (23), Expect = 0.11 Identities = 29/31 (93%) Strand = Plus / Minus Query: 456 ttccagtgaatgggcacttcttgtcaatgta 486 |||||||||| ||||| |||||||||||||| Sbjct: 226 ttccagtgaaggggcatttcttgtcaatgta 196
>emb|CR688230.2|CNS0FTZM Tetraodon nigroviridis full-length cDNA Length = 580 Score = 46.1 bits (23), Expect = 0.11 Identities = 29/31 (93%) Strand = Plus / Minus Query: 456 ttccagtgaatgggcacttcttgtcaatgta 486 |||||||||| ||||| |||||||||||||| Sbjct: 226 ttccagtgaaggggcatttcttgtcaatgta 196
>emb|CR687994.2|CNS0FTT2 Tetraodon nigroviridis full-length cDNA Length = 579 Score = 46.1 bits (23), Expect = 0.11 Identities = 29/31 (93%) Strand = Plus / Minus Query: 456 ttccagtgaatgggcacttcttgtcaatgta 486 |||||||||| ||||| |||||||||||||| Sbjct: 226 ttccagtgaaggggcatttcttgtcaatgta 196
>emb|CR687796.2|CNS0FTNK Tetraodon nigroviridis full-length cDNA Length = 582 Score = 46.1 bits (23), Expect = 0.11 Identities = 29/31 (93%) Strand = Plus / Minus Query: 456 ttccagtgaatgggcacttcttgtcaatgta 486 |||||||||| ||||| |||||||||||||| Sbjct: 226 ttccagtgaaggggcatttcttgtcaatgta 196
>emb|CR687762.2|CNS0FTMM Tetraodon nigroviridis full-length cDNA Length = 579 Score = 46.1 bits (23), Expect = 0.11 Identities = 29/31 (93%) Strand = Plus / Minus Query: 456 ttccagtgaatgggcacttcttgtcaatgta 486 |||||||||| ||||| |||||||||||||| Sbjct: 226 ttccagtgaaggggcatttcttgtcaatgta 196
>emb|CR687156.2|CNS0FT5S Tetraodon nigroviridis full-length cDNA Length = 579 Score = 46.1 bits (23), Expect = 0.11 Identities = 29/31 (93%) Strand = Plus / Minus Query: 456 ttccagtgaatgggcacttcttgtcaatgta 486 |||||||||| ||||| |||||||||||||| Sbjct: 226 ttccagtgaaggggcatttcttgtcaatgta 196
>emb|CR686934.2|CNS0FSZM Tetraodon nigroviridis full-length cDNA Length = 577 Score = 46.1 bits (23), Expect = 0.11 Identities = 29/31 (93%) Strand = Plus / Minus Query: 456 ttccagtgaatgggcacttcttgtcaatgta 486 |||||||||| ||||| |||||||||||||| Sbjct: 224 ttccagtgaaggggcatttcttgtcaatgta 194
>emb|CR686874.2|CNS0FSXY Tetraodon nigroviridis full-length cDNA Length = 581 Score = 46.1 bits (23), Expect = 0.11 Identities = 29/31 (93%) Strand = Plus / Minus Query: 456 ttccagtgaatgggcacttcttgtcaatgta 486 |||||||||| ||||| |||||||||||||| Sbjct: 226 ttccagtgaaggggcatttcttgtcaatgta 196
>emb|CR685500.2|CNS0FRVS Tetraodon nigroviridis full-length cDNA Length = 584 Score = 46.1 bits (23), Expect = 0.11 Identities = 29/31 (93%) Strand = Plus / Minus Query: 456 ttccagtgaatgggcacttcttgtcaatgta 486 |||||||||| ||||| |||||||||||||| Sbjct: 228 ttccagtgaaggggcatttcttgtcaatgta 198
>emb|CR685380.2|CNS0FRSG Tetraodon nigroviridis full-length cDNA Length = 582 Score = 46.1 bits (23), Expect = 0.11 Identities = 29/31 (93%) Strand = Plus / Minus Query: 456 ttccagtgaatgggcacttcttgtcaatgta 486 |||||||||| ||||| |||||||||||||| Sbjct: 226 ttccagtgaaggggcatttcttgtcaatgta 196
>emb|CR681934.2|CNS0FP4Q Tetraodon nigroviridis full-length cDNA Length = 582 Score = 46.1 bits (23), Expect = 0.11 Identities = 29/31 (93%) Strand = Plus / Minus Query: 456 ttccagtgaatgggcacttcttgtcaatgta 486 |||||||||| ||||| |||||||||||||| Sbjct: 226 ttccagtgaaggggcatttcttgtcaatgta 196
>emb|CR683386.2|CNS0FQ92 Tetraodon nigroviridis full-length cDNA Length = 579 Score = 46.1 bits (23), Expect = 0.11 Identities = 29/31 (93%) Strand = Plus / Minus Query: 456 ttccagtgaatgggcacttcttgtcaatgta 486 |||||||||| ||||| |||||||||||||| Sbjct: 226 ttccagtgaaggggcatttcttgtcaatgta 196
>emb|CR683574.2|CNS0FQEA Tetraodon nigroviridis full-length cDNA Length = 583 Score = 46.1 bits (23), Expect = 0.11 Identities = 29/31 (93%) Strand = Plus / Minus Query: 456 ttccagtgaatgggcacttcttgtcaatgta 486 |||||||||| ||||| |||||||||||||| Sbjct: 226 ttccagtgaaggggcatttcttgtcaatgta 196
>emb|CR683321.2|CNS0FQ79 Tetraodon nigroviridis full-length cDNA Length = 579 Score = 46.1 bits (23), Expect = 0.11 Identities = 29/31 (93%) Strand = Plus / Minus Query: 456 ttccagtgaatgggcacttcttgtcaatgta 486 |||||||||| ||||| |||||||||||||| Sbjct: 226 ttccagtgaaggggcatttcttgtcaatgta 196
>emb|CR682989.2|CNS0FPY1 Tetraodon nigroviridis full-length cDNA Length = 582 Score = 46.1 bits (23), Expect = 0.11 Identities = 29/31 (93%) Strand = Plus / Minus Query: 456 ttccagtgaatgggcacttcttgtcaatgta 486 |||||||||| ||||| |||||||||||||| Sbjct: 226 ttccagtgaaggggcatttcttgtcaatgta 196
>emb|CR682953.2|CNS0FPX1 Tetraodon nigroviridis full-length cDNA Length = 583 Score = 46.1 bits (23), Expect = 0.11 Identities = 29/31 (93%) Strand = Plus / Minus Query: 456 ttccagtgaatgggcacttcttgtcaatgta 486 |||||||||| ||||| |||||||||||||| Sbjct: 226 ttccagtgaaggggcatttcttgtcaatgta 196
>emb|CR682919.2|CNS0FPW3 Tetraodon nigroviridis full-length cDNA Length = 578 Score = 46.1 bits (23), Expect = 0.11 Identities = 29/31 (93%) Strand = Plus / Minus Query: 456 ttccagtgaatgggcacttcttgtcaatgta 486 |||||||||| ||||| |||||||||||||| Sbjct: 225 ttccagtgaaggggcatttcttgtcaatgta 195
>emb|CR682587.2|CNS0FPMV Tetraodon nigroviridis full-length cDNA Length = 582 Score = 46.1 bits (23), Expect = 0.11 Identities = 29/31 (93%) Strand = Plus / Minus Query: 456 ttccagtgaatgggcacttcttgtcaatgta 486 |||||||||| ||||| |||||||||||||| Sbjct: 226 ttccagtgaaggggcatttcttgtcaatgta 196
>emb|CR682407.2|CNS0FPHV Tetraodon nigroviridis full-length cDNA Length = 584 Score = 46.1 bits (23), Expect = 0.11 Identities = 29/31 (93%) Strand = Plus / Minus Query: 456 ttccagtgaatgggcacttcttgtcaatgta 486 |||||||||| ||||| |||||||||||||| Sbjct: 226 ttccagtgaaggggcatttcttgtcaatgta 196
>emb|CR682359.2|CNS0FPGJ Tetraodon nigroviridis full-length cDNA Length = 579 Score = 46.1 bits (23), Expect = 0.11 Identities = 29/31 (93%) Strand = Plus / Minus Query: 456 ttccagtgaatgggcacttcttgtcaatgta 486 |||||||||| ||||| |||||||||||||| Sbjct: 226 ttccagtgaaggggcatttcttgtcaatgta 196
>emb|CR682213.2|CNS0FPCH Tetraodon nigroviridis full-length cDNA Length = 579 Score = 46.1 bits (23), Expect = 0.11 Identities = 29/31 (93%) Strand = Plus / Minus Query: 456 ttccagtgaatgggcacttcttgtcaatgta 486 |||||||||| ||||| |||||||||||||| Sbjct: 226 ttccagtgaaggggcatttcttgtcaatgta 196
>emb|CR681517.2|CNS0FOT5 Tetraodon nigroviridis full-length cDNA Length = 578 Score = 46.1 bits (23), Expect = 0.11 Identities = 29/31 (93%) Strand = Plus / Minus Query: 456 ttccagtgaatgggcacttcttgtcaatgta 486 |||||||||| ||||| |||||||||||||| Sbjct: 225 ttccagtgaaggggcatttcttgtcaatgta 195
>emb|CR681132.2|CNS0FOIG Tetraodon nigroviridis full-length cDNA Length = 579 Score = 46.1 bits (23), Expect = 0.11 Identities = 29/31 (93%) Strand = Plus / Minus Query: 456 ttccagtgaatgggcacttcttgtcaatgta 486 |||||||||| ||||| |||||||||||||| Sbjct: 226 ttccagtgaaggggcatttcttgtcaatgta 196
>emb|CR680914.2|CNS0FOCE Tetraodon nigroviridis full-length cDNA Length = 574 Score = 46.1 bits (23), Expect = 0.11 Identities = 29/31 (93%) Strand = Plus / Minus Query: 456 ttccagtgaatgggcacttcttgtcaatgta 486 |||||||||| ||||| |||||||||||||| Sbjct: 217 ttccagtgaaggggcatttcttgtcaatgta 187
>emb|CR680406.2|CNS0FNYA Tetraodon nigroviridis full-length cDNA Length = 578 Score = 46.1 bits (23), Expect = 0.11 Identities = 29/31 (93%) Strand = Plus / Minus Query: 456 ttccagtgaatgggcacttcttgtcaatgta 486 |||||||||| ||||| |||||||||||||| Sbjct: 225 ttccagtgaaggggcatttcttgtcaatgta 195 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 4,652,952 Number of Sequences: 3902068 Number of extensions: 4652952 Number of successful extensions: 67803 Number of sequences better than 10.0: 570 Number of HSP's better than 10.0 without gapping: 571 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 67002 Number of HSP's gapped (non-prelim): 792 length of query: 493 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 471 effective length of database: 17,147,199,772 effective search space: 8076331092612 effective search space used: 8076331092612 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)
