| Clone Name | rbags15p13 |
|---|---|
| Clone Library Name | barley_pub |
>emb|AL112356.1|CNS01A18 Botrytis cinerea strain T4 cDNA library Length = 660 Score = 48.1 bits (24), Expect = 0.011 Identities = 24/24 (100%) Strand = Plus / Minus Query: 84 tgagtggagatttgaatttgccag 107 |||||||||||||||||||||||| Sbjct: 356 tgagtggagatttgaatttgccag 333
>emb|AL356240.15| Human DNA sequence from clone RP5-873F21 on chromosome 11 Contains part of a novel gene for brain protein 239, ESTs and GSSs, complete sequence Length = 114144 Score = 44.1 bits (22), Expect = 0.18 Identities = 25/26 (96%) Strand = Plus / Plus Query: 78 ttcagttgagtggagatttgaatttg 103 ||||||||| |||||||||||||||| Sbjct: 98306 ttcagttgattggagatttgaatttg 98331
>gb|AC119801.14| Mus musculus, clone RP23-54N13, complete sequence Length = 251756 Score = 44.1 bits (22), Expect = 0.18 Identities = 25/26 (96%) Strand = Plus / Minus Query: 113 cattgtagatataatcccagtgctta 138 |||||||| ||||||||||||||||| Sbjct: 70840 cattgtagctataatcccagtgctta 70815
>gb|AC004779.1| Homo sapiens chromosome 16, cosmid clone 304A10 (LANL), complete sequence Length = 35687 Score = 42.1 bits (21), Expect = 0.69 Identities = 21/21 (100%) Strand = Plus / Plus Query: 122 tataatcccagtgcttaggga 142 ||||||||||||||||||||| Sbjct: 21322 tataatcccagtgcttaggga 21342
>gb|AC005564.1| Homo sapiens chromosome 16, cosmid clone 420F6 (LANL), complete sequence Length = 37930 Score = 42.1 bits (21), Expect = 0.69 Identities = 21/21 (100%) Strand = Plus / Plus Query: 122 tataatcccagtgcttaggga 142 ||||||||||||||||||||| Sbjct: 11608 tataatcccagtgcttaggga 11628
>gb|AY679523.1| Homo sapiens cell division cycle 2-like 5 (cholinesterase-related cell division controller) (CDC2L5) gene, complete cds Length = 148952 Score = 42.1 bits (21), Expect = 0.69 Identities = 21/21 (100%) Strand = Plus / Minus Query: 122 tataatcccagtgcttaggga 142 ||||||||||||||||||||| Sbjct: 138827 tataatcccagtgcttaggga 138807
>emb|AL354712.18| Human DNA sequence from clone RP4-597A16 on chromosome 1p36.13-36.23 Contains the 5' end of a novel leucine rich repeat domain containing protein, a novel gene, a pseudogene similar to part of WD repeat domain, the 5' end of the gene for lung type-I cell membrane-associated glycoprotein (T1A-2) and a CpG island, complete sequence Length = 123288 Score = 42.1 bits (21), Expect = 0.69 Identities = 21/21 (100%) Strand = Plus / Minus Query: 122 tataatcccagtgcttaggga 142 ||||||||||||||||||||| Sbjct: 114834 tataatcccagtgcttaggga 114814
>emb|AL133350.16| Human DNA sequence from clone RP11-155N8 on chromosome 10 Contains GSSs and STSs, complete sequence Length = 89833 Score = 42.1 bits (21), Expect = 0.69 Identities = 21/21 (100%) Strand = Plus / Plus Query: 124 taatcccagtgcttagggaag 144 ||||||||||||||||||||| Sbjct: 3655 taatcccagtgcttagggaag 3675
>gb|AC129803.3| Homo sapiens 3 BAC RP11-15N24 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 185721 Score = 42.1 bits (21), Expect = 0.69 Identities = 21/21 (100%) Strand = Plus / Plus Query: 122 tataatcccagtgcttaggga 142 ||||||||||||||||||||| Sbjct: 106775 tataatcccagtgcttaggga 106795
>gb|AC112212.2| Homo sapiens chromosome 3 clone RP11-185E15, complete sequence Length = 168752 Score = 42.1 bits (21), Expect = 0.69 Identities = 21/21 (100%) Strand = Plus / Minus Query: 122 tataatcccagtgcttaggga 142 ||||||||||||||||||||| Sbjct: 154625 tataatcccagtgcttaggga 154605
>gb|AC078813.13| Homo sapiens 3q BAC RP11-149B11 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 142000 Score = 42.1 bits (21), Expect = 0.69 Identities = 21/21 (100%) Strand = Plus / Minus Query: 122 tataatcccagtgcttaggga 142 ||||||||||||||||||||| Sbjct: 83003 tataatcccagtgcttaggga 82983
>gb|AC099328.2| Homo sapiens chromosome 3 clone RP11-62G11, complete sequence Length = 156066 Score = 42.1 bits (21), Expect = 0.69 Identities = 21/21 (100%) Strand = Plus / Minus Query: 122 tataatcccagtgcttaggga 142 ||||||||||||||||||||| Sbjct: 58842 tataatcccagtgcttaggga 58822
>gb|AC008771.4|AC008771 Homo sapiens chromosome 5 clone CTD-2015H6, complete sequence Length = 123169 Score = 42.1 bits (21), Expect = 0.69 Identities = 21/21 (100%) Strand = Plus / Minus Query: 124 taatcccagtgcttagggaag 144 ||||||||||||||||||||| Sbjct: 77283 taatcccagtgcttagggaag 77263
>gb|AC018764.8| Homo sapiens chromosome 5 clone CTD-2327L5, complete sequence Length = 126052 Score = 42.1 bits (21), Expect = 0.69 Identities = 21/21 (100%) Strand = Plus / Plus Query: 124 taatcccagtgcttagggaag 144 ||||||||||||||||||||| Sbjct: 104277 taatcccagtgcttagggaag 104297
>gb|AC007151.2|AC007151 Homo sapiens clone RPCI-11_95J11, complete sequence Length = 165196 Score = 42.1 bits (21), Expect = 0.69 Identities = 21/21 (100%) Strand = Plus / Minus Query: 122 tataatcccagtgcttaggga 142 ||||||||||||||||||||| Sbjct: 65963 tataatcccagtgcttaggga 65943
>gb|AC006023.2|AC006023 Homo sapiens PAC clone RP5-1147A1 from 7p14-p12, complete sequence Length = 157385 Score = 42.1 bits (21), Expect = 0.69 Identities = 21/21 (100%) Strand = Plus / Minus Query: 122 tataatcccagtgcttaggga 142 ||||||||||||||||||||| Sbjct: 53346 tataatcccagtgcttaggga 53326
>emb|AJ315157.1|HSA315157 Homo sapiens t(8;16)(p11;p13) chimeric CBP/MOZ genomic DNA from acute myeloid leukemia patient (case 4) Length = 419 Score = 42.1 bits (21), Expect = 0.69 Identities = 21/21 (100%) Strand = Plus / Plus Query: 122 tataatcccagtgcttaggga 142 ||||||||||||||||||||| Sbjct: 44 tataatcccagtgcttaggga 64
>gb|AC125448.16| Mus musculus chromosome 10, clone RP23-122D10, complete sequence Length = 188948 Score = 40.1 bits (20), Expect = 2.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 69 tagctgctattcagttgagt 88 |||||||||||||||||||| Sbjct: 183841 tagctgctattcagttgagt 183860
>gb|AC153564.6| Mus musculus 10 BAC RP23-39C23 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 241022 Score = 40.1 bits (20), Expect = 2.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 69 tagctgctattcagttgagt 88 |||||||||||||||||||| Sbjct: 5488 tagctgctattcagttgagt 5507
>gb|AC073901.5| Homo sapiens BAC clone RP11-222O23 from 7, complete sequence Length = 170654 Score = 40.1 bits (20), Expect = 2.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 124 taatcccagtgcttagggaagtgt 147 |||||||||||||| ||||||||| Sbjct: 129036 taatcccagtgctttgggaagtgt 129013
>emb|AL355338.33| Human DNA sequence from clone RP11-12G12 on chromosome 13 Contains the gene for zinc finger protein of the cerebellum 5 (ZIC5), the ZIC2 gene for Zic family member 2 (odd-paired homolog Drosophila), a 13kDa differentiation-associated protein (DAP13) pseudogene, an asparagine synthetase (ASNS) pseudogene, the 5' end of the PCCA gene for propionyl Coenzyme A carboxylase alpha polypeptide and seven CpG islands, complete sequence Length = 153762 Score = 40.1 bits (20), Expect = 2.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 121 atataatcccagtgcttagggaag 144 ||||||||||||||||| |||||| Sbjct: 90136 atataatcccagtgctttgggaag 90159
>emb|AL691470.17| Mouse DNA sequence from clone RP23-160F12 on chromosome 11 Contains the 3' end of gene FLJ13305, a novel gene, a novel gene (1700061J23Rik) and a CpG island, complete sequence Length = 195614 Score = 40.1 bits (20), Expect = 2.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 122 tataatcccagtgcttaggg 141 |||||||||||||||||||| Sbjct: 108099 tataatcccagtgcttaggg 108118
>emb|CR352324.11| Zebrafish DNA sequence from clone CH211-218L14 in linkage group 12, complete sequence Length = 206894 Score = 40.1 bits (20), Expect = 2.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 70 agctgctattcagttgagtggaga 93 |||||| ||||||||||||||||| Sbjct: 30227 agctgccattcagttgagtggaga 30204
>gb|AC007448.14| Homo sapiens chromosome 17, clone RP11-401F2, complete sequence Length = 195558 Score = 40.1 bits (20), Expect = 2.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 122 tataatcccagtgcttagggaagt 145 |||||||||||||||| ||||||| Sbjct: 67044 tataatcccagtgctttgggaagt 67067
>emb|AL445883.3|CNS07EEQ Human chromosome 14 DNA sequence BAC R-908D14 of library RPCI-11 from chromosome 14 of Homo sapiens (Human), complete sequence Length = 169496 Score = 40.1 bits (20), Expect = 2.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 122 tataatcccagtgcttagggaagt 145 |||||||||||||||| ||||||| Sbjct: 62229 tataatcccagtgctttgggaagt 62206
>emb|AL355885.4|CNS05TCW Human chromosome 14 DNA sequence BAC R-434O22 of library RPCI-11 from chromosome 14 of Homo sapiens (Human), complete sequence Length = 174442 Score = 40.1 bits (20), Expect = 2.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 122 tataatcccagtgcttagggaagt 145 |||||||||||||||| ||||||| Sbjct: 19952 tataatcccagtgctttgggaagt 19975
>gb|AC159815.3| Mus musculus BAC clone RP23-324H19 from chromosome 12, complete sequence Length = 213030 Score = 40.1 bits (20), Expect = 2.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 122 tataatcccagtgcttaggg 141 |||||||||||||||||||| Sbjct: 177842 tataatcccagtgcttaggg 177861
>gb|AC155232.1| Mus musculus BAC clone RP24-374P12 from 12, complete sequence Length = 139740 Score = 40.1 bits (20), Expect = 2.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 122 tataatcccagtgcttaggg 141 |||||||||||||||||||| Sbjct: 115804 tataatcccagtgcttaggg 115785
>emb|AL663088.10| Mouse DNA sequence from clone RP23-293H17 on chromosome 11, complete sequence Length = 243290 Score = 40.1 bits (20), Expect = 2.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 121 atataatcccagtgcttagg 140 |||||||||||||||||||| Sbjct: 26890 atataatcccagtgcttagg 26871
>gb|AC006534.10| Homo sapiens chromosome 17, clone RP11-557B23, complete sequence Length = 216789 Score = 40.1 bits (20), Expect = 2.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 123 ataatcccagtgcttagggaagtg 146 ||||||||||||||| |||||||| Sbjct: 126100 ataatcccagtgctttgggaagtg 126077 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 1,481,502 Number of Sequences: 3902068 Number of extensions: 1481502 Number of successful extensions: 96906 Number of sequences better than 10.0: 30 Number of HSP's better than 10.0 without gapping: 30 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 96834 Number of HSP's gapped (non-prelim): 72 length of query: 216 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 194 effective length of database: 17,147,199,772 effective search space: 3326556755768 effective search space used: 3326556755768 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)