ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbags15o15
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AY108990.1| Zea mays PCO064985 mRNA sequence 46 0.006
2gb|AC120416.11| Mus musculus chromosome 1, clone RP24-472N18, co... 38 1.3
3gb|AC113456.9| Mus musculus chromosome 1, clone RP23-257E16, com... 38 1.3
4gb|AC161005.4| Pan troglodytes BAC clone CH251-668M6 from chromo... 36 5.3
5emb|CT009509.7| Mouse DNA sequence from clone RP23-140C10 on chr... 36 5.3
6gb|AC002382.1| Homo sapiens BAC clone CTB-22J17 from 7, complete... 36 5.3
7gb|AC097537.2| Homo sapiens BAC clone RP11-806K15 from 4, comple... 36 5.3
8gb|AC161386.4| Pan troglodytes BAC clone CH251-497P4 from chromo... 36 5.3

>gb|AY108990.1| Zea mays PCO064985 mRNA sequence
          Length = 1517

 Score = 46.1 bits (23), Expect = 0.006
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 1   atcctttgncaacgnganaatctgtgaatgcactga 36
           |||||||| ||| | || ||||||||||||||||||
Sbjct: 965 atcctttggcaatgtgaaaatctgtgaatgcactga 930



to top

>gb|AC120416.11| Mus musculus chromosome 1, clone RP24-472N18, complete sequence
          Length = 199727

 Score = 38.2 bits (19), Expect = 1.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 23    tgtgaatgcactgattggt 41
             |||||||||||||||||||
Sbjct: 63021 tgtgaatgcactgattggt 63003



to top

>gb|AC113456.9| Mus musculus chromosome 1, clone RP23-257E16, complete sequence
          Length = 174902

 Score = 38.2 bits (19), Expect = 1.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 23    tgtgaatgcactgattggt 41
             |||||||||||||||||||
Sbjct: 60714 tgtgaatgcactgattggt 60732



to top

>gb|AC161005.4| Pan troglodytes BAC clone CH251-668M6 from chromosome 7, complete
              sequence
          Length = 217746

 Score = 36.2 bits (18), Expect = 5.3
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                
Query: 23     tgtgaatgcactgattgg 40
              ||||||||||||||||||
Sbjct: 118553 tgtgaatgcactgattgg 118536



to top

>emb|CT009509.7| Mouse DNA sequence from clone RP23-140C10 on chromosome 13, complete
              sequence
          Length = 218144

 Score = 36.2 bits (18), Expect = 5.3
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                
Query: 24     gtgaatgcactgattggt 41
              ||||||||||||||||||
Sbjct: 116946 gtgaatgcactgattggt 116929



to top

>gb|AC002382.1| Homo sapiens BAC clone CTB-22J17 from 7, complete sequence
          Length = 125590

 Score = 36.2 bits (18), Expect = 5.3
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 23    tgtgaatgcactgattgg 40
             ||||||||||||||||||
Sbjct: 32222 tgtgaatgcactgattgg 32239



to top

>gb|AC097537.2| Homo sapiens BAC clone RP11-806K15 from 4, complete sequence
          Length = 138574

 Score = 36.2 bits (18), Expect = 5.3
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 25    tgaatgcactgattggta 42
             ||||||||||||||||||
Sbjct: 17492 tgaatgcactgattggta 17475



to top

>gb|AC161386.4| Pan troglodytes BAC clone CH251-497P4 from chromosome 7, complete
              sequence
          Length = 193048

 Score = 36.2 bits (18), Expect = 5.3
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                
Query: 23     tgtgaatgcactgattgg 40
              ||||||||||||||||||
Sbjct: 185586 tgtgaatgcactgattgg 185569


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 130,503
Number of Sequences: 3902068
Number of extensions: 130503
Number of successful extensions: 34957
Number of sequences better than 10.0: 8
Number of HSP's better than 10.0 without gapping: 8
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 34949
Number of HSP's gapped (non-prelim): 8
length of query: 44
length of database: 17,233,045,268
effective HSP length: 20
effective length of query: 24
effective length of database: 17,155,003,908
effective search space: 411720093792
effective search space used: 411720093792
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 18 (36.2 bits)
to top