| Clone Name | rbags16d08 |
|---|---|
| Clone Library Name | barley_pub |
>dbj|AB052133.1| Triticum aestivum tck2a mRNA for casein kinase II alpha, complete cds Length = 1531 Score = 359 bits (181), Expect = 3e-96 Identities = 249/273 (91%), Gaps = 1/273 (0%) Strand = Plus / Minus Query: 7 ttgcgaactttcaatcaatcaggtttccntacacaaacaacaggagcaaatcacngttct 66 ||||||| |||||||||||||||||||| ||||||||||||||||||||||||| ||||| Sbjct: 1401 ttgcgaagtttcaatcaatcaggtttccatacacaaacaacaggagcaaatcacagttct 1342 Query: 67 tttccccctcgacgat-agaggcacacaccacacaggctcttacctttcccagctgatcc 125 ||||| ||||| |||| |||||||||||||||||||||||||||||||||||||||| || Sbjct: 1341 tttccgcctcgtcgatgagaggcacacaccacacaggctcttacctttcccagctgaccc 1282 Query: 126 aaccattatcgagttgtaatacgtgacaaagtcgctacaaggntgcngnttcatcacgcg 185 |||||||||||||| |||||| ||||||||||||||||||| ||| | ||| ||| ||| Sbjct: 1281 aaccattatcgagtcataatacatgacaaagtcgctacaaggatgcagcttcgtcaagcg 1222 Query: 186 ctgctcattcaatgtcagcaacngncctgctattgctattgcncgcgagtcctgctgttt 245 |||||| ||||||||||||||| | | ||||||||||||||| | ||||||||||||||| Sbjct: 1221 ctgctcgttcaatgtcagcaacagtcttgctattgctattgcgcacgagtcctgctgttt 1162 Query: 246 tcagcggccctcacctgcaggaagtatggatgt 278 || || ||||||||||| ||||||||||||||| Sbjct: 1161 tcggcagccctcacctggaggaagtatggatgt 1129
>dbj|AB213317.1| Lolium perenne Lpck2a-2 mRNA for casein protein kinase 2 alpha subunit, complete cds Length = 1472 Score = 79.8 bits (40), Expect = 4e-12 Identities = 46/48 (95%) Strand = Plus / Minus Query: 231 cgagtcctgctgttttcagcggccctcacctgcaggaagtatggatgt 278 ||||||||||||||||| |||||||||||||| ||||||||||||||| Sbjct: 1146 cgagtcctgctgttttctgcggccctcacctggaggaagtatggatgt 1099 Score = 65.9 bits (33), Expect = 6e-08 Identities = 42/45 (93%) Strand = Plus / Minus Query: 116 cagctgatccaaccattatcgagttgtaatacgtgacaaagtcgc 160 |||||||||||||||||||||||||| ||||| |||| ||||||| Sbjct: 1263 cagctgatccaaccattatcgagttgaaatacatgaccaagtcgc 1219
>gb|AF517838.1| Lilium davidii CK2 catalytic alpha subunit mRNA, complete cds Length = 1480 Score = 48.1 bits (24), Expect = 0.015 Identities = 42/48 (87%) Strand = Plus / Minus Query: 231 cgagtcctgctgttttcagcggccctcacctgcaggaagtatggatgt 278 |||||||||||||| || || || |||||||| ||||| ||||||||| Sbjct: 1129 cgagtcctgctgttctctgctgctctcacctgaaggaaatatggatgt 1082
>emb|BX571870.1| Photorhabdus luminescens subsp. laumondii TTO1 complete genome; segment 12/17 Length = 348505 Score = 40.1 bits (20), Expect = 3.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 41 aaacaacaggagcaaatcac 60 |||||||||||||||||||| Sbjct: 236396 aaacaacaggagcaaatcac 236377
>gb|AC155252.2| Mus musculus BAC clone RP24-190H19 from chromosome 14, complete sequence Length = 152012 Score = 40.1 bits (20), Expect = 3.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 37 acacaaacaacaggagcaaa 56 |||||||||||||||||||| Sbjct: 91189 acacaaacaacaggagcaaa 91208
>gb|AC092415.3| Homo sapiens chromosome 3 clone RP11-9A14, complete sequence Length = 181664 Score = 40.1 bits (20), Expect = 3.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 86 ggcacacaccacacaggctc 105 |||||||||||||||||||| Sbjct: 147455 ggcacacaccacacaggctc 147474 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 1,777,769 Number of Sequences: 3902068 Number of extensions: 1777769 Number of successful extensions: 31189 Number of sequences better than 10.0: 6 Number of HSP's better than 10.0 without gapping: 6 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 31181 Number of HSP's gapped (non-prelim): 7 length of query: 278 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 256 effective length of database: 17,147,199,772 effective search space: 4389683141632 effective search space used: 4389683141632 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)