ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbags16d08
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1dbj|AB052133.1| Triticum aestivum tck2a mRNA for casein kinase I... 359 3e-96
2dbj|AB213317.1| Lolium perenne Lpck2a-2 mRNA for casein protein ... 80 4e-12
3gb|AF517838.1| Lilium davidii CK2 catalytic alpha subunit mRNA, ... 48 0.015
4emb|BX571870.1| Photorhabdus luminescens subsp. laumondii TTO1 c... 40 3.6
5gb|AC155252.2| Mus musculus BAC clone RP24-190H19 from chromosom... 40 3.6
6gb|AC092415.3| Homo sapiens chromosome 3 clone RP11-9A14, comple... 40 3.6

>dbj|AB052133.1| Triticum aestivum tck2a mRNA for casein kinase II alpha, complete cds
          Length = 1531

 Score =  359 bits (181), Expect = 3e-96
 Identities = 249/273 (91%), Gaps = 1/273 (0%)
 Strand = Plus / Minus

                                                                        
Query: 7    ttgcgaactttcaatcaatcaggtttccntacacaaacaacaggagcaaatcacngttct 66
            ||||||| |||||||||||||||||||| ||||||||||||||||||||||||| |||||
Sbjct: 1401 ttgcgaagtttcaatcaatcaggtttccatacacaaacaacaggagcaaatcacagttct 1342

                                                                        
Query: 67   tttccccctcgacgat-agaggcacacaccacacaggctcttacctttcccagctgatcc 125
            ||||| ||||| |||| |||||||||||||||||||||||||||||||||||||||| ||
Sbjct: 1341 tttccgcctcgtcgatgagaggcacacaccacacaggctcttacctttcccagctgaccc 1282

                                                                        
Query: 126  aaccattatcgagttgtaatacgtgacaaagtcgctacaaggntgcngnttcatcacgcg 185
            ||||||||||||||  |||||| ||||||||||||||||||| ||| | ||| ||| |||
Sbjct: 1281 aaccattatcgagtcataatacatgacaaagtcgctacaaggatgcagcttcgtcaagcg 1222

                                                                        
Query: 186  ctgctcattcaatgtcagcaacngncctgctattgctattgcncgcgagtcctgctgttt 245
            |||||| ||||||||||||||| | | ||||||||||||||| | |||||||||||||||
Sbjct: 1221 ctgctcgttcaatgtcagcaacagtcttgctattgctattgcgcacgagtcctgctgttt 1162

                                             
Query: 246  tcagcggccctcacctgcaggaagtatggatgt 278
            || || ||||||||||| |||||||||||||||
Sbjct: 1161 tcggcagccctcacctggaggaagtatggatgt 1129



to top

>dbj|AB213317.1| Lolium perenne Lpck2a-2 mRNA for casein protein kinase 2 alpha
            subunit, complete cds
          Length = 1472

 Score = 79.8 bits (40), Expect = 4e-12
 Identities = 46/48 (95%)
 Strand = Plus / Minus

                                                            
Query: 231  cgagtcctgctgttttcagcggccctcacctgcaggaagtatggatgt 278
            ||||||||||||||||| |||||||||||||| |||||||||||||||
Sbjct: 1146 cgagtcctgctgttttctgcggccctcacctggaggaagtatggatgt 1099



 Score = 65.9 bits (33), Expect = 6e-08
 Identities = 42/45 (93%)
 Strand = Plus / Minus

                                                         
Query: 116  cagctgatccaaccattatcgagttgtaatacgtgacaaagtcgc 160
            |||||||||||||||||||||||||| ||||| |||| |||||||
Sbjct: 1263 cagctgatccaaccattatcgagttgaaatacatgaccaagtcgc 1219



to top

>gb|AF517838.1| Lilium davidii CK2 catalytic alpha subunit mRNA, complete cds
          Length = 1480

 Score = 48.1 bits (24), Expect = 0.015
 Identities = 42/48 (87%)
 Strand = Plus / Minus

                                                            
Query: 231  cgagtcctgctgttttcagcggccctcacctgcaggaagtatggatgt 278
            |||||||||||||| || || || |||||||| ||||| |||||||||
Sbjct: 1129 cgagtcctgctgttctctgctgctctcacctgaaggaaatatggatgt 1082



to top

>emb|BX571870.1| Photorhabdus luminescens subsp. laumondii TTO1 complete genome; segment
              12/17
          Length = 348505

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 41     aaacaacaggagcaaatcac 60
              ||||||||||||||||||||
Sbjct: 236396 aaacaacaggagcaaatcac 236377



to top

>gb|AC155252.2| Mus musculus BAC clone RP24-190H19 from chromosome 14, complete
             sequence
          Length = 152012

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 37    acacaaacaacaggagcaaa 56
             ||||||||||||||||||||
Sbjct: 91189 acacaaacaacaggagcaaa 91208



to top

>gb|AC092415.3| Homo sapiens chromosome 3 clone RP11-9A14, complete sequence
          Length = 181664

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 86     ggcacacaccacacaggctc 105
              ||||||||||||||||||||
Sbjct: 147455 ggcacacaccacacaggctc 147474


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,777,769
Number of Sequences: 3902068
Number of extensions: 1777769
Number of successful extensions: 31189
Number of sequences better than 10.0: 6
Number of HSP's better than 10.0 without gapping: 6
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 31181
Number of HSP's gapped (non-prelim): 7
length of query: 278
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 256
effective length of database: 17,147,199,772
effective search space: 4389683141632
effective search space used: 4389683141632
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top