| Clone Name | rbags15n07 |
|---|---|
| Clone Library Name | barley_pub |
>gb|L11740.1|BLYEFIA Barley elongation factor 1 alpha, (EF-1A) mRNA sequence Length = 1725 Score = 1019 bits (514), Expect = 0.0 Identities = 548/557 (98%), Gaps = 3/557 (0%) Strand = Plus / Minus Query: 1 atgatgactttntatggtagcaacattaactgatgaagttccaccaacacaactcgaacg 60 ||||||||| | ||||||||||||||||||||||||||||||||||||||||| |||||| Sbjct: 1640 atgatgactatatatggtagcaacattaactgatgaagttccaccaacacaac-cgaacg 1582 Query: 61 atacaatgaccagtagctttaagcagttcaaacacttgctcgacacaaataacccaagcg 120 ||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||| Sbjct: 1581 atacaatgaccag-agctttaagcagttcaaacactt-ctcgacacaaataacccaagcg 1524 Query: 121 actaaaacaactatcgccaccaccaaacaccgccaccgccaccatagatgtggtaaagaa 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1523 actaaaacaactatcgccaccaccaaacaccgccaccgccaccatagatgtggtaaagaa 1464 Query: 181 cctgacaccatctcatttcttcttgatcgcagccttggtaaccttggcgccggtcggctc 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1463 cctgacaccatctcatttcttcttgatcgcagccttggtaaccttggcgccggtcggctc 1404 Query: 241 cttcttctcnacgctcttgatcacacccacagcaaccgtctgcctnatgtcacgcacggc 300 ||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||| Sbjct: 1403 cttcttctccacgctcttgatcacacccacagcaaccgtctgcctcatgtcacgcacggc 1344 Query: 301 aaaccgacccagaggagggtactgggcaaaggtctccaccaccatgggcttggttggaat 360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1343 aaaccgacccagaggagggtactgggcaaaggtctccaccaccatgggcttggttggaat 1284 Query: 361 catcttgacgaacccagcatcaccattcttgagaaacttgggcgctgcctccagctcctt 420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1283 catcttgacgaacccagcatcaccattcttgagaaacttgggcgctgcctccagctcctt 1224 Query: 421 gccggaccgcctgtcgatcttggtctggatctcggcgaacttgacggcnatgtgggatgt 480 |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| Sbjct: 1223 gccggaccgcctgtcgatcttggtctggatctcggcgaacttgacggcgatgtgggatgt 1164 Query: 481 gtggcagtccagcacangggcataaccgttgctgatctggccagggtggttcatgatgat 540 |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1163 gtggcagtccagcacaggggcataaccgttgctgatctggccagggtggttcatgatgat 1104 Query: 541 gacctgggcagtgaagt 557 ||||||||||||||||| Sbjct: 1103 gacctgggcagtgaagt 1087
>emb|Z23130.1|HVBLT63A H.vulgare BLT63 mRNA, complete CDS Length = 1560 Score = 987 bits (498), Expect = 0.0 Identities = 530/538 (98%), Gaps = 3/538 (0%) Strand = Plus / Minus Query: 20 gcaacattaactgatgaagttccaccaacacaactcgaacgatacaatgaccagtagctt 79 |||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||| Sbjct: 1560 gcaacattaactgatgaagttccaccaacacaac-cgaacgatacaatgaccag-agctt 1503 Query: 80 taagcagttcaaacacttgctcgacacaaataacccaagcgactaaaacaactatcgcca 139 |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| Sbjct: 1502 taagcagttcaaacactt-ctcgacacaaataacccaagcgactaaaacaactatcgcca 1444 Query: 140 ccaccaaacaccgccaccgccaccatagatgtggtaaagaacctgacaccatctcatttc 199 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1443 ccaccaaacaccgccaccgccaccatagatgtggtaaagaacctgacaccatctcatttc 1384 Query: 200 ttcttgatcgcagccttggtaaccttggcgccggtcggctccttcttctcnacgctcttg 259 |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| Sbjct: 1383 ttcttgatcgcagccttggtaaccttggcgccggtcggctccttcttctccacgctcttg 1324 Query: 260 atcacacccacagcaaccgtctgcctnatgtcacgcacggcaaaccgacccagaggaggg 319 |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| Sbjct: 1323 atcacacccacagcaaccgtctgcctcatgtcacgcacggcaaaccgacccagaggaggg 1264 Query: 320 tactgggcaaaggtctccaccaccatgggcttggttggaatcatcttgacgaacccagca 379 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1263 tactgggcaaaggtctccaccaccatgggcttggttggaatcatcttgacgaacccagca 1204 Query: 380 tcaccattcttgagaaacttgggcgctgcctccagctccttgccggaccgcctgtcgatc 439 |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| Sbjct: 1203 tcaccattcttgagaaacttgggcgctgcctccagctccttgcccgaccgcctgtcgatc 1144 Query: 440 ttggtctggatctcggcgaacttgacggcnatgtgggatgtgtggcagtccagcacangg 499 ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| || Sbjct: 1143 ttggtctggatctcggcgaacttgacggcgatgtgggatgtgtggcagtccagcacaggg 1084 Query: 500 gcataaccgttgctgatctggccagggtggttcatgatgatgacctgggcagtgaagt 557 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1083 gcataaccgttgctgatctggccagggtggttcatgatgatgacctgggcagtgaagt 1026
>gb|AF479046.1| Triticum aestivum elongation factor-1 alpha mRNA, partial cds Length = 432 Score = 440 bits (222), Expect = e-120 Identities = 328/365 (89%) Strand = Plus / Minus Query: 193 tcatttcttcttgatcgcagccttggtaaccttggcgccggtcggctccttcttctcnac 252 ||||||||||||| |||||||||||| ||||||||||||||||| ||||| ||||| || Sbjct: 432 tcatttcttcttggccgcagccttggtcaccttggcgccggtcggatccttnttctccac 373 Query: 253 gctcttgatcacacccacagcaaccgtctgcctnatgtcacgcacggcaaaccgacccag 312 | |||||| || ||||| |||||||||||||| ||||||||||| ||||| || ||||| Sbjct: 372 ggccttgataacgcccaccgcaaccgtctgcctcatgtcacgcacagcaaagcggcccag 313 Query: 313 aggagggtactgggcaaaggtctccaccaccatgggcttggttggaatcatcttgacgaa 372 ||||||||||| || |||||||||||||||||||||||||| || |||||||||||||| Sbjct: 312 gggagggtactgagcgaaggtctccaccaccatgggcttggtggggatcatcttgacgaa 253 Query: 373 cccagcatcaccattcttgagaaacttgggcgctgcctccagctccttgccggaccgcct 432 ||| |||||||| |||||||| ||||||||||| ||||| | ||||||||| ||||||| Sbjct: 252 cccggcatcaccgttcttgaggaacttgggcgccgcctcaatctccttgccagaccgccg 193 Query: 433 gtcgatcttggtctggatctcggcgaacttgacggcnatgtgggatgtgtggcagtccag 492 ||||||||||||||||||||| || |||||||| || |||||||| |||||||||||||| Sbjct: 192 gtcgatcttggtctggatctcagcaaacttgacagcgatgtgggacgtgtggcagtccag 133 Query: 493 cacangggcataaccgttgctgatctggccagggtggttcatgatgatgacctgggcagt 552 ||| ||||||| |||||||||||||||||||||||||||||||||||||||||||| || Sbjct: 132 cactggggcatagccgttgctgatctggccagggtggttcatgatgatgacctgggcggt 73 Query: 553 gaagt 557 ||||| Sbjct: 72 gaagt 68
>dbj|D63581.1| Oryza sativa mRNA for EF-1 alpha, complete cds Length = 1630 Score = 319 bits (161), Expect = 5e-84 Identities = 307/357 (85%) Strand = Plus / Minus Query: 192 ctcatttcttcttgatcgcagccttggtaaccttggcgccggtcggctccttcttctcna 251 |||||||||||||| ||||||||||| |||||||| ||||| || ||||||||||| | Sbjct: 1406 ctcatttcttcttggcggcagccttggtcaccttggcaccggttgggtccttcttctcca 1347 Query: 252 cgctcttgatcacacccacagcaaccgtctgcctnatgtcacgcacggcaaaccgaccca 311 || ||||||| || || ||||| ||||| ||||| ||||||||||||||||| ||||| | Sbjct: 1346 cgttcttgatgacgccaacagccaccgtttgcctcatgtcacgcacggcaaaacgaccaa 1287 Query: 312 gaggagggtactgggcaaaggtctccaccaccatgggcttggttggaatcatcttgacga 371 |||||||||||| | ||||||||||| |||||||||||||| ||||||||||| || | Sbjct: 1286 gaggagggtactcagagaaggtctccacaaccatgggcttggtgggaatcatcttaacca 1227 Query: 372 acccagcatcaccattcttgagaaacttgggcgctgcctccagctccttgccggaccgcc 431 ||||||||||| |||||||| ||||||||| | |||||||||||||||||| || | Sbjct: 1226 taccagcatcaccgttcttgaggaacttgggctccttctccagctccttgccggatcgtc 1167 Query: 432 tgtcgatcttggtctggatctcggcgaacttgacggcnatgtgggatgtgtggcagtcca 491 |||||||||||||| | ||| || ||||||||||| |||||||| ||||||||||||| Sbjct: 1166 tgtcgatcttggtcaccagctcagcaaacttgacggcaatgtgggaggtgtggcagtcca 1107 Query: 492 gcacangggcataaccgttgctgatctggccagggtggttcatgatgatgacctggg 548 |||| |||| || ||||||| |||||| |||||||||||||||||||| ||||||| Sbjct: 1106 gcactggggcgtagccgttgccgatctgcccagggtggttcatgatgatcacctggg 1050
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 Length = 36102668 Score = 309 bits (156), Expect = 5e-81 Identities = 305/356 (85%) Strand = Plus / Minus Query: 193 tcatttcttcttgatcgcagccttggtaaccttggcgccggtcggctccttcttctcnac 252 ||||||||||||| ||||||||||| |||||||| ||||| || ||||||||||| || Sbjct: 4084355 tcatttcttcttggcggcagccttggtcaccttggcaccggttgggtccttcttctccac 4084296 Query: 253 gctcttgatcacacccacagcaaccgtctgcctnatgtcacgcacggcaaaccgacccag 312 | ||||||| || || ||||| ||||| ||||| ||||||||||||||||| ||||| || Sbjct: 4084295 gttcttgatgacgccaacagccaccgtttgcctcatgtcacgcacggcaaaacgaccaag 4084236 Query: 313 aggagggtactgggcaaaggtctccaccaccatgggcttggttggaatcatcttgacgaa 372 ||||||||||| | ||||||||||| |||||||||||||| ||||||||||| || | Sbjct: 4084235 aggagggtactcagagaaggtctccacaaccatgggcttggtgggaatcatcttaaccat 4084176 Query: 373 cccagcatcaccattcttgagaaacttgggcgctgcctccagctccttgccggaccgcct 432 ||||||||||| |||||||| ||||||||| | |||||||||||| || || || || Sbjct: 4084175 accagcatcaccgttcttgaggaacttgggctccttctccagctccttaccagatcgtct 4084116 Query: 433 gtcgatcttggtctggatctcggcgaacttgacggcnatgtgggatgtgtggcagtccag 492 ||||||||||||| | ||| || ||||||||||| |||||||| |||||||||||||| Sbjct: 4084115 gtcgatcttggtcaccagctcagcaaacttgacggcaatgtgggaggtgtggcagtccag 4084056 Query: 493 cacangggcataaccgttgctgatctggccagggtggttcatgatgatgacctggg 548 ||| |||| || ||||||| ||||||||||||||||||||||||||| ||||||| Sbjct: 4084055 cactggggcgtagccgttgccgatctggccagggtggttcatgatgatcacctggg 4084000 Score = 303 bits (153), Expect = 3e-79 Identities = 305/357 (85%) Strand = Plus / Minus Query: 192 ctcatttcttcttgatcgcagccttggtaaccttggcgccggtcggctccttcttctcna 251 |||||||||||||| ||||||||||| |||||||| ||||| || ||||||||||| | Sbjct: 4101208 ctcatttcttcttggcggcagccttggtcaccttggcaccggttgggtccttcttctcca 4101149 Query: 252 cgctcttgatcacacccacagcaaccgtctgcctnatgtcacgcacggcaaaccgaccca 311 || ||||||| || || ||||| ||||| ||||| ||||||||||||||||| ||||| | Sbjct: 4101148 cgttcttgatgacgccaacagccaccgtttgcctcatgtcacgcacggcaaaacgaccaa 4101089 Query: 312 gaggagggtactgggcaaaggtctccaccaccatgggcttggttggaatcatcttgacga 371 |||||||||||| | ||||||||||| |||||||||||||| ||||||||||| || | Sbjct: 4101088 gaggagggtactcagagaaggtctccacaaccatgggcttggtgggaatcatcttaacca 4101029 Query: 372 acccagcatcaccattcttgagaaacttgggcgctgcctccagctccttgccggaccgcc 431 ||||||||||| |||||||| ||||||||| | |||||||||||||||||| || | Sbjct: 4101028 taccagcatcaccgttcttgaggaacttgggctccttctccagctccttgccggatcgtc 4100969 Query: 432 tgtcgatcttggtctggatctcggcgaacttgacggcnatgtgggatgtgtggcagtcca 491 |||||||||||||| | ||| || ||||||||||| ||||| || ||||||||||||| Sbjct: 4100968 tgtcgatcttggtcaccagctcagcaaacttgacggcaatgtgtgaggtgtggcagtcca 4100909 Query: 492 gcacangggcataaccgttgctgatctggccagggtggttcatgatgatgacctggg 548 |||| |||| || || |||| |||||| |||||||||||||||||||| ||||||| Sbjct: 4100908 gcactggggcgtagccattgccgatctgcccagggtggttcatgatgatcacctggg 4100852 Score = 303 bits (153), Expect = 3e-79 Identities = 305/357 (85%) Strand = Plus / Minus Query: 192 ctcatttcttcttgatcgcagccttggtaaccttggcgccggtcggctccttcttctcna 251 |||||||||||||| ||||||||||| |||||||| ||||| || ||||||||||| | Sbjct: 4078916 ctcatttcttcttggcggcagccttggtcaccttggcaccggttgggtccttcttctcca 4078857 Query: 252 cgctcttgatcacacccacagcaaccgtctgcctnatgtcacgcacggcaaaccgaccca 311 || ||||||| || || ||||| ||||| ||||| ||||| ||||||||||| ||||| | Sbjct: 4078856 cgttcttgatgacgccaacagccaccgtttgcctcatgtcccgcacggcaaaacgaccaa 4078797 Query: 312 gaggagggtactgggcaaaggtctccaccaccatgggcttggttggaatcatcttgacga 371 |||||||||||| | ||||||||||| |||||||||||||| ||||||||||| || | Sbjct: 4078796 gaggagggtactcagagaaggtctccacaaccatgggcttggtgggaatcatcttaacca 4078737 Query: 372 acccagcatcaccattcttgagaaacttgggcgctgcctccagctccttgccggaccgcc 431 ||||||||||| |||||||| ||||||||| | |||||||||||| || || || | Sbjct: 4078736 taccagcatcaccgttcttgaggaacttgggctccttctccagctccttaccagatcgtc 4078677 Query: 432 tgtcgatcttggtctggatctcggcgaacttgacggcnatgtgggatgtgtggcagtcca 491 |||||||||||||| | ||| || ||||||||||| |||||||| ||||||||||||| Sbjct: 4078676 tgtcgatcttggtcaccagctcagcaaacttgacggcaatgtgggaggtgtggcagtcca 4078617 Query: 492 gcacangggcataaccgttgctgatctggccagggtggttcatgatgatgacctggg 548 |||| |||| || ||||||| ||||||||||||||||||||||||||| ||||||| Sbjct: 4078616 gcactggggcgtagccgttgccgatctggccagggtggttcatgatgatcacctggg 4078560 Score = 264 bits (133), Expect = 3e-67 Identities = 300/357 (84%) Strand = Plus / Minus Query: 192 ctcatttcttcttgatcgcagccttggtaaccttggcgccggtcggctccttcttctcna 251 |||| ||||||||| ||||||||||| |||||||| ||||| || ||||||||||| | Sbjct: 4095038 ctcacttcttcttggcggcagccttggtcaccttggcaccggttgggtccttcttctcca 4094979 Query: 252 cgctcttgatcacacccacagcaaccgtctgcctnatgtcacgcacggcaaaccgaccca 311 || ||||||| || || ||||| ||||| ||||| ||||||||||| ||||| ||||| | Sbjct: 4094978 cgttcttgatgacgccaacagccaccgtttgcctcatgtcacgcaccgcaaaacgaccaa 4094919 Query: 312 gaggagggtactgggcaaaggtctccaccaccatgggcttggttggaatcatcttgacga 371 |||||||||||| | ||||||||||| |||||||||||||| |||||||||||||| | Sbjct: 4094918 gaggagggtactcagagaaggtctccacaaccatgggcttggtaggaatcatcttgacca 4094859 Query: 372 acccagcatcaccattcttgagaaacttgggcgctgcctccagctccttgccggaccgcc 431 ||||||||||| ||||| | ||||||||| | ||||||||||||||| || || | Sbjct: 4094858 taccagcatcaccgttcttcaagaacttgggctccttctccagctccttgccagatcgtc 4094799 Query: 432 tgtcgatcttggtctggatctcggcgaacttgacggcnatgtgggatgtgtggcagtcca 491 |||| ||||||||| | ||| || |||||||| || |||||||| ||||||||||||| Sbjct: 4094798 tgtcaatcttggtcaccagctcagcaaacttgacagcaatgtgggaggtgtggcagtcca 4094739 Query: 492 gcacangggcataaccgttgctgatctggccagggtggttcatgatgatgacctggg 548 |||| | ||||| ||||| | |||||| |||||||||||||||||||| ||||||| Sbjct: 4094738 gcactggagcatagccgttaccgatctgcccagggtggttcatgatgatcacctggg 4094682
>gb|AC090484.4| Genomic sequence for Oryza sativa, Nipponbare strain, clone OSJNBa0061L19, from chromosome 3, complete sequence Length = 153322 Score = 309 bits (156), Expect = 5e-81 Identities = 305/356 (85%) Strand = Plus / Plus Query: 193 tcatttcttcttgatcgcagccttggtaaccttggcgccggtcggctccttcttctcnac 252 ||||||||||||| ||||||||||| |||||||| ||||| || ||||||||||| || Sbjct: 15013 tcatttcttcttggcggcagccttggtcaccttggcaccggttgggtccttcttctccac 15072 Query: 253 gctcttgatcacacccacagcaaccgtctgcctnatgtcacgcacggcaaaccgacccag 312 | ||||||| || || ||||| ||||| ||||| ||||||||||||||||| ||||| || Sbjct: 15073 gttcttgatgacgccaacagccaccgtttgcctcatgtcacgcacggcaaaacgaccaag 15132 Query: 313 aggagggtactgggcaaaggtctccaccaccatgggcttggttggaatcatcttgacgaa 372 ||||||||||| | ||||||||||| |||||||||||||| ||||||||||| || | Sbjct: 15133 aggagggtactcagagaaggtctccacaaccatgggcttggtgggaatcatcttaaccat 15192 Query: 373 cccagcatcaccattcttgagaaacttgggcgctgcctccagctccttgccggaccgcct 432 ||||||||||| |||||||| ||||||||| | |||||||||||| || || || || Sbjct: 15193 accagcatcaccgttcttgaggaacttgggctccttctccagctccttaccagatcgtct 15252 Query: 433 gtcgatcttggtctggatctcggcgaacttgacggcnatgtgggatgtgtggcagtccag 492 ||||||||||||| | ||| || ||||||||||| |||||||| |||||||||||||| Sbjct: 15253 gtcgatcttggtcaccagctcagcaaacttgacggcaatgtgggaggtgtggcagtccag 15312 Query: 493 cacangggcataaccgttgctgatctggccagggtggttcatgatgatgacctggg 548 ||| |||| || ||||||| ||||||||||||||||||||||||||| ||||||| Sbjct: 15313 cactggggcgtagccgttgccgatctggccagggtggttcatgatgatcacctggg 15368 Score = 303 bits (153), Expect = 3e-79 Identities = 305/357 (85%) Strand = Plus / Plus Query: 192 ctcatttcttcttgatcgcagccttggtaaccttggcgccggtcggctccttcttctcna 251 |||||||||||||| ||||||||||| |||||||| ||||| || ||||||||||| | Sbjct: 20452 ctcatttcttcttggcggcagccttggtcaccttggcaccggttgggtccttcttctcca 20511 Query: 252 cgctcttgatcacacccacagcaaccgtctgcctnatgtcacgcacggcaaaccgaccca 311 || ||||||| || || ||||| ||||| ||||| ||||| ||||||||||| ||||| | Sbjct: 20512 cgttcttgatgacgccaacagccaccgtttgcctcatgtcccgcacggcaaaacgaccaa 20571 Query: 312 gaggagggtactgggcaaaggtctccaccaccatgggcttggttggaatcatcttgacga 371 |||||||||||| | ||||||||||| |||||||||||||| ||||||||||| || | Sbjct: 20572 gaggagggtactcagagaaggtctccacaaccatgggcttggtgggaatcatcttaacca 20631 Query: 372 acccagcatcaccattcttgagaaacttgggcgctgcctccagctccttgccggaccgcc 431 ||||||||||| |||||||| ||||||||| | |||||||||||| || || || | Sbjct: 20632 taccagcatcaccgttcttgaggaacttgggctccttctccagctccttaccagatcgtc 20691 Query: 432 tgtcgatcttggtctggatctcggcgaacttgacggcnatgtgggatgtgtggcagtcca 491 |||||||||||||| | ||| || ||||||||||| |||||||| ||||||||||||| Sbjct: 20692 tgtcgatcttggtcaccagctcagcaaacttgacggcaatgtgggaggtgtggcagtcca 20751 Query: 492 gcacangggcataaccgttgctgatctggccagggtggttcatgatgatgacctggg 548 |||| |||| || ||||||| ||||||||||||||||||||||||||| ||||||| Sbjct: 20752 gcactggggcgtagccgttgccgatctggccagggtggttcatgatgatcacctggg 20808 Score = 264 bits (133), Expect = 3e-67 Identities = 300/357 (84%) Strand = Plus / Plus Query: 192 ctcatttcttcttgatcgcagccttggtaaccttggcgccggtcggctccttcttctcna 251 |||| ||||||||| ||||||||||| |||||||| ||||| || ||||||||||| | Sbjct: 4330 ctcacttcttcttggcggcagccttggtcaccttggcaccggttgggtccttcttctcca 4389 Query: 252 cgctcttgatcacacccacagcaaccgtctgcctnatgtcacgcacggcaaaccgaccca 311 || ||||||| || || ||||| ||||| ||||| ||||||||||| ||||| ||||| | Sbjct: 4390 cgttcttgatgacgccaacagccaccgtttgcctcatgtcacgcaccgcaaaacgaccaa 4449 Query: 312 gaggagggtactgggcaaaggtctccaccaccatgggcttggttggaatcatcttgacga 371 |||||||||||| | ||||||||||| |||||||||||||| |||||||||||||| | Sbjct: 4450 gaggagggtactcagagaaggtctccacaaccatgggcttggtaggaatcatcttgacca 4509 Query: 372 acccagcatcaccattcttgagaaacttgggcgctgcctccagctccttgccggaccgcc 431 ||||||||||| ||||| | ||||||||| | ||||||||||||||| || || | Sbjct: 4510 taccagcatcaccgttcttcaagaacttgggctccttctccagctccttgccagatcgtc 4569 Query: 432 tgtcgatcttggtctggatctcggcgaacttgacggcnatgtgggatgtgtggcagtcca 491 |||| ||||||||| | ||| || |||||||| || |||||||| ||||||||||||| Sbjct: 4570 tgtcaatcttggtcaccagctcagcaaacttgacagcaatgtgggaggtgtggcagtcca 4629 Query: 492 gcacangggcataaccgttgctgatctggccagggtggttcatgatgatgacctggg 548 |||| | ||||| ||||| | |||||| |||||||||||||||||||| ||||||| Sbjct: 4630 gcactggagcatagccgttaccgatctgcccagggtggttcatgatgatcacctggg 4686
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete sequence Length = 36192742 Score = 309 bits (156), Expect = 5e-81 Identities = 305/356 (85%) Strand = Plus / Minus Query: 193 tcatttcttcttgatcgcagccttggtaaccttggcgccggtcggctccttcttctcnac 252 ||||||||||||| ||||||||||| |||||||| ||||| || ||||||||||| || Sbjct: 4084466 tcatttcttcttggcggcagccttggtcaccttggcaccggttgggtccttcttctccac 4084407 Query: 253 gctcttgatcacacccacagcaaccgtctgcctnatgtcacgcacggcaaaccgacccag 312 | ||||||| || || ||||| ||||| ||||| ||||||||||||||||| ||||| || Sbjct: 4084406 gttcttgatgacgccaacagccaccgtttgcctcatgtcacgcacggcaaaacgaccaag 4084347 Query: 313 aggagggtactgggcaaaggtctccaccaccatgggcttggttggaatcatcttgacgaa 372 ||||||||||| | ||||||||||| |||||||||||||| ||||||||||| || | Sbjct: 4084346 aggagggtactcagagaaggtctccacaaccatgggcttggtgggaatcatcttaaccat 4084287 Query: 373 cccagcatcaccattcttgagaaacttgggcgctgcctccagctccttgccggaccgcct 432 ||||||||||| |||||||| ||||||||| | |||||||||||| || || || || Sbjct: 4084286 accagcatcaccgttcttgaggaacttgggctccttctccagctccttaccagatcgtct 4084227 Query: 433 gtcgatcttggtctggatctcggcgaacttgacggcnatgtgggatgtgtggcagtccag 492 ||||||||||||| | ||| || ||||||||||| |||||||| |||||||||||||| Sbjct: 4084226 gtcgatcttggtcaccagctcagcaaacttgacggcaatgtgggaggtgtggcagtccag 4084167 Query: 493 cacangggcataaccgttgctgatctggccagggtggttcatgatgatgacctggg 548 ||| |||| || ||||||| ||||||||||||||||||||||||||| ||||||| Sbjct: 4084166 cactggggcgtagccgttgccgatctggccagggtggttcatgatgatcacctggg 4084111 Score = 303 bits (153), Expect = 3e-79 Identities = 305/357 (85%) Strand = Plus / Minus Query: 192 ctcatttcttcttgatcgcagccttggtaaccttggcgccggtcggctccttcttctcna 251 |||||||||||||| ||||||||||| |||||||| ||||| || ||||||||||| | Sbjct: 4101317 ctcatttcttcttggcggcagccttggtcaccttggcaccggttgggtccttcttctcca 4101258 Query: 252 cgctcttgatcacacccacagcaaccgtctgcctnatgtcacgcacggcaaaccgaccca 311 || ||||||| || || ||||| ||||| ||||| ||||||||||||||||| ||||| | Sbjct: 4101257 cgttcttgatgacgccaacagccaccgtttgcctcatgtcacgcacggcaaaacgaccaa 4101198 Query: 312 gaggagggtactgggcaaaggtctccaccaccatgggcttggttggaatcatcttgacga 371 |||||||||||| | ||||||||||| |||||||||||||| ||||||||||| || | Sbjct: 4101197 gaggagggtactcagagaaggtctccacaaccatgggcttggtgggaatcatcttaacca 4101138 Query: 372 acccagcatcaccattcttgagaaacttgggcgctgcctccagctccttgccggaccgcc 431 ||||||||||| |||||||| ||||||||| | |||||||||||||||||| || | Sbjct: 4101137 taccagcatcaccgttcttgaggaacttgggctccttctccagctccttgccggatcgtc 4101078 Query: 432 tgtcgatcttggtctggatctcggcgaacttgacggcnatgtgggatgtgtggcagtcca 491 |||||||||||||| | ||| || ||||||||||| ||||| || ||||||||||||| Sbjct: 4101077 tgtcgatcttggtcaccagctcagcaaacttgacggcaatgtgtgaggtgtggcagtcca 4101018 Query: 492 gcacangggcataaccgttgctgatctggccagggtggttcatgatgatgacctggg 548 |||| |||| || || |||| |||||| |||||||||||||||||||| ||||||| Sbjct: 4101017 gcactggggcgtagccattgccgatctgcccagggtggttcatgatgatcacctggg 4100961 Score = 303 bits (153), Expect = 3e-79 Identities = 305/357 (85%) Strand = Plus / Minus Query: 192 ctcatttcttcttgatcgcagccttggtaaccttggcgccggtcggctccttcttctcna 251 |||||||||||||| ||||||||||| |||||||| ||||| || ||||||||||| | Sbjct: 4079027 ctcatttcttcttggcggcagccttggtcaccttggcaccggttgggtccttcttctcca 4078968 Query: 252 cgctcttgatcacacccacagcaaccgtctgcctnatgtcacgcacggcaaaccgaccca 311 || ||||||| || || ||||| ||||| ||||| ||||| ||||||||||| ||||| | Sbjct: 4078967 cgttcttgatgacgccaacagccaccgtttgcctcatgtcccgcacggcaaaacgaccaa 4078908 Query: 312 gaggagggtactgggcaaaggtctccaccaccatgggcttggttggaatcatcttgacga 371 |||||||||||| | ||||||||||| |||||||||||||| ||||||||||| || | Sbjct: 4078907 gaggagggtactcagagaaggtctccacaaccatgggcttggtgggaatcatcttaacca 4078848 Query: 372 acccagcatcaccattcttgagaaacttgggcgctgcctccagctccttgccggaccgcc 431 ||||||||||| |||||||| ||||||||| | |||||||||||| || || || | Sbjct: 4078847 taccagcatcaccgttcttgaggaacttgggctccttctccagctccttaccagatcgtc 4078788 Query: 432 tgtcgatcttggtctggatctcggcgaacttgacggcnatgtgggatgtgtggcagtcca 491 |||||||||||||| | ||| || ||||||||||| |||||||| ||||||||||||| Sbjct: 4078787 tgtcgatcttggtcaccagctcagcaaacttgacggcaatgtgggaggtgtggcagtcca 4078728 Query: 492 gcacangggcataaccgttgctgatctggccagggtggttcatgatgatgacctggg 548 |||| |||| || ||||||| ||||||||||||||||||||||||||| ||||||| Sbjct: 4078727 gcactggggcgtagccgttgccgatctggccagggtggttcatgatgatcacctggg 4078671 Score = 264 bits (133), Expect = 3e-67 Identities = 300/357 (84%) Strand = Plus / Minus Query: 192 ctcatttcttcttgatcgcagccttggtaaccttggcgccggtcggctccttcttctcna 251 |||| ||||||||| ||||||||||| |||||||| ||||| || ||||||||||| | Sbjct: 4095149 ctcacttcttcttggcggcagccttggtcaccttggcaccggttgggtccttcttctcca 4095090 Query: 252 cgctcttgatcacacccacagcaaccgtctgcctnatgtcacgcacggcaaaccgaccca 311 || ||||||| || || ||||| ||||| ||||| ||||||||||| ||||| ||||| | Sbjct: 4095089 cgttcttgatgacgccaacagccaccgtttgcctcatgtcacgcaccgcaaaacgaccaa 4095030 Query: 312 gaggagggtactgggcaaaggtctccaccaccatgggcttggttggaatcatcttgacga 371 |||||||||||| | ||||||||||| |||||||||||||| |||||||||||||| | Sbjct: 4095029 gaggagggtactcagagaaggtctccacaaccatgggcttggtaggaatcatcttgacca 4094970 Query: 372 acccagcatcaccattcttgagaaacttgggcgctgcctccagctccttgccggaccgcc 431 ||||||||||| ||||| | ||||||||| | ||||||||||||||| || || | Sbjct: 4094969 taccagcatcaccgttcttcaagaacttgggctccttctccagctccttgccagatcgtc 4094910 Query: 432 tgtcgatcttggtctggatctcggcgaacttgacggcnatgtgggatgtgtggcagtcca 491 |||| ||||||||| | ||| || |||||||| || |||||||| ||||||||||||| Sbjct: 4094909 tgtcaatcttggtcaccagctcagcaaacttgacagcaatgtgggaggtgtggcagtcca 4094850 Query: 492 gcacangggcataaccgttgctgatctggccagggtggttcatgatgatgacctggg 548 |||| | ||||| ||||| | |||||| |||||||||||||||||||| ||||||| Sbjct: 4094849 gcactggagcatagccgttaccgatctgcccagggtggttcatgatgatcacctggg 4094793
>dbj|AK119537.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-204-B11, full insert sequence Length = 1722 Score = 309 bits (156), Expect = 5e-81 Identities = 305/356 (85%) Strand = Plus / Minus Query: 193 tcatttcttcttgatcgcagccttggtaaccttggcgccggtcggctccttcttctcnac 252 ||||||||||||| ||||||||||| |||||||| ||||| || ||||||||||| || Sbjct: 1441 tcatttcttcttggcggcagccttggtcaccttggcaccggttgggtccttcttctccac 1382 Query: 253 gctcttgatcacacccacagcaaccgtctgcctnatgtcacgcacggcaaaccgacccag 312 | ||||||| || || ||||| ||||| ||||| ||||||||||||||||| ||||| || Sbjct: 1381 gttcttgatgacgccaacagccaccgtttgcctcatgtcacgcacggcaaaacgaccaag 1322 Query: 313 aggagggtactgggcaaaggtctccaccaccatgggcttggttggaatcatcttgacgaa 372 ||||||||||| | ||||||||||| |||||||||||||| ||||||||||| || | Sbjct: 1321 aggagggtactcagagaaggtctccacaaccatgggcttggtgggaatcatcttaaccat 1262 Query: 373 cccagcatcaccattcttgagaaacttgggcgctgcctccagctccttgccggaccgcct 432 ||||||||||| |||||||| ||||||||| | |||||||||||| || || || || Sbjct: 1261 accagcatcaccgttcttgaggaacttgggctccttctccagctccttaccagatcgtct 1202 Query: 433 gtcgatcttggtctggatctcggcgaacttgacggcnatgtgggatgtgtggcagtccag 492 ||||||||||||| | ||| || ||||||||||| |||||||| |||||||||||||| Sbjct: 1201 gtcgatcttggtcaccagctcagcaaacttgacggcaatgtgggaggtgtggcagtccag 1142 Query: 493 cacangggcataaccgttgctgatctggccagggtggttcatgatgatgacctggg 548 ||| |||| || ||||||| ||||||||||||||||||||||||||| ||||||| Sbjct: 1141 cactggggcgtagccgttgccgatctggccagggtggttcatgatgatcacctggg 1086
>dbj|AK061464.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-308-C01, full insert sequence Length = 1620 Score = 309 bits (156), Expect = 5e-81 Identities = 305/356 (85%) Strand = Plus / Minus Query: 193 tcatttcttcttgatcgcagccttggtaaccttggcgccggtcggctccttcttctcnac 252 ||||||||||||| ||||||||||| |||||||| ||||| || ||||||||||| || Sbjct: 1440 tcatttcttcttggcggcagccttggtcaccttggcaccggttgggtccttcttctccac 1381 Query: 253 gctcttgatcacacccacagcaaccgtctgcctnatgtcacgcacggcaaaccgacccag 312 | ||||||| || || ||||| ||||| ||||| ||||||||||||||||| ||||| || Sbjct: 1380 gttcttgatgacgccaacagccaccgtttgcctcatgtcacgcacggcaaaacgaccaag 1321 Query: 313 aggagggtactgggcaaaggtctccaccaccatgggcttggttggaatcatcttgacgaa 372 ||||||||||| | ||||||||||| |||||||||||||| ||||||||||| || | Sbjct: 1320 aggagggtactcagagaaggtctccacaaccatgggcttggtgggaatcatcttaaccat 1261 Query: 373 cccagcatcaccattcttgagaaacttgggcgctgcctccagctccttgccggaccgcct 432 ||||||||||| |||||||| ||||||||| | |||||||||||| || || || || Sbjct: 1260 accagcatcaccgttcttgaggaacttgggctccttctccagctccttaccagatcgtct 1201 Query: 433 gtcgatcttggtctggatctcggcgaacttgacggcnatgtgggatgtgtggcagtccag 492 ||||||||||||| | ||| || ||||||||||| |||||||| |||||||||||||| Sbjct: 1200 gtcgatcttggtcaccagctcagcaaacttgacggcaatgtgggaggtgtggcagtccag 1141 Query: 493 cacangggcataaccgttgctgatctggccagggtggttcatgatgatgacctggg 548 ||| |||| || ||||||| ||||||||||||||||||||||||||| ||||||| Sbjct: 1140 cactggggcgtagccgttgccgatctggccagggtggttcatgatgatcacctggg 1085
>emb|Z50789.1|HVEF1ALFA H.vulgare mRNA for elongation factor 1-alpha Length = 1609 Score = 307 bits (155), Expect = 2e-80 Identities = 310/363 (85%) Strand = Plus / Minus Query: 195 atttcttcttgatcgcagccttggtaaccttggcgccggtcggctccttcttctcnacgc 254 ||||||||||||| ||||||||||| |||||||| ||||| || ||||||||||| |||| Sbjct: 1398 atttcttcttgatggcagccttggtcaccttggctccggtggggtccttcttctccacgc 1339 Query: 255 tcttgatcacacccacagcaaccgtctgcctnatgtcacgcacggcaaaccgacccagag 314 |||||| ||||| ||||| || || ||||| |||||||| || ||||| ||||| |||| Sbjct: 1338 ccttgatgacaccaacagccacagtttgcctcatgtcacggacagcaaaacgaccaagag 1279 Query: 315 gagggtactgggcaaaggtctccaccaccatgggcttggttggaatcatcttgacgaacc 374 ||||||| ||||||||||||||| |||||||||||||| ||||||||||| || | | Sbjct: 1278 gagggtaagtggcaaaggtctccacaaccatgggcttggtgggaatcatcttcactatac 1219 Query: 375 cagcatcaccattcttgagaaacttgggcgctgcctccagctccttgccggaccgcctgt 434 ||||||||||||||||||| ||||||||| |||||||||||||| || || ||||||| Sbjct: 1218 cagcatcaccattcttgaggaacttgggcagggcctccagctccttacctgatcgcctgt 1159 Query: 435 cgatcttggtctggatctcggcgaacttgacggcnatgtgggatgtgtggcagtccagca 494 ||||||||||| | ||| || |||||||| || ||||| || |||||||||||||||| Sbjct: 1158 cgatcttggtcaccagctcagcaaacttgacagcaatgtgtgaggtgtggcagtccagca 1099 Query: 495 cangggcataaccgttgctgatctggccagggtggttcatgatgatgacctgggcagtga 554 | | || || ||||||| ||||| |||||||||||||||||||||||||||| |||| Sbjct: 1098 ctggagcgtagccgttgccaatctgaccagggtggttcatgatgatgacctgggaggtga 1039 Query: 555 agt 557 ||| Sbjct: 1038 agt 1036
>gb|M90077.1|WHTTEF1X Wheat translation elongation factor 1 alpha-subunit (TEF1) mRNA, complete cds Length = 2062 Score = 305 bits (154), Expect = 8e-80 Identities = 312/366 (85%) Strand = Plus / Minus Query: 192 ctcatttcttcttgatcgcagccttggtaaccttggcgccggtcggctccttcttctcna 251 |||||||||||||||| ||||||||||| |||||||||||||| || ||||||||||| | Sbjct: 1826 ctcatttcttcttgatggcagccttggtcaccttggcgccggttgggtccttcttctcca 1767 Query: 252 cgctcttgatcacacccacagcaaccgtctgcctnatgtcacgcacggcaaaccgaccca 311 | | |||||| ||||| ||||| || || ||||| |||||||| || ||||| ||||| | Sbjct: 1766 cacccttgatgacaccaacagccacagtttgcctcatgtcacggacagcaaaacgaccaa 1707 Query: 312 gaggagggtactgggcaaaggtctccaccaccatgggcttggttggaatcatcttgacga 371 |||| ||||| |||||||||||||| |||||||||||||| ||||||||||| || | Sbjct: 1706 gaggtgggtaagtagcaaaggtctccacaaccatgggcttggtgggaatcatcttcacta 1647 Query: 372 acccagcatcaccattcttgagaaacttgggcgctgcctccagctccttgccggaccgcc 431 |||||||||||||||||||| ||||||||| |||||||||||||| || || |||| Sbjct: 1646 tgccagcatcaccattcttgaggaacttgggcagggcctccagctccttaccagatcgcc 1587 Query: 432 tgtcgatcttggtctggatctcggcgaacttgacggcnatgtgggatgtgtggcagtcca 491 |||||||||||||| | ||| || |||||||| || ||||| || ||||||||||||| Sbjct: 1586 tgtcgatcttggtcaccagctcagcaaacttgacagcaatgtgcgaggtgtggcagtcca 1527 Query: 492 gcacangggcataaccgttgctgatctggccagggtggttcatgatgatgacctgggcag 551 |||| |||| || ||||||| ||||| |||||||||||||||||||||||||||| | Sbjct: 1526 gcactggggcgtagccgttgccaatctgaccagggtggttcatgatgatgacctgggagg 1467 Query: 552 tgaagt 557 |||||| Sbjct: 1466 tgaagt 1461
>gb|AC125472.2| Oryza sativa (japonica cultivar-group) chromosome 3 clone OSJNBa0050H14, complete sequence Length = 142245 Score = 303 bits (153), Expect = 3e-79 Identities = 305/357 (85%) Strand = Plus / Minus Query: 192 ctcatttcttcttgatcgcagccttggtaaccttggcgccggtcggctccttcttctcna 251 |||||||||||||| ||||||||||| |||||||| ||||| || ||||||||||| | Sbjct: 1845 ctcatttcttcttggcggcagccttggtcaccttggcaccggttgggtccttcttctcca 1786 Query: 252 cgctcttgatcacacccacagcaaccgtctgcctnatgtcacgcacggcaaaccgaccca 311 || ||||||| || || ||||| ||||| ||||| ||||||||||||||||| ||||| | Sbjct: 1785 cgttcttgatgacgccaacagccaccgtttgcctcatgtcacgcacggcaaaacgaccaa 1726 Query: 312 gaggagggtactgggcaaaggtctccaccaccatgggcttggttggaatcatcttgacga 371 |||||||||||| | ||||||||||| |||||||||||||| ||||||||||| || | Sbjct: 1725 gaggagggtactcagagaaggtctccacaaccatgggcttggtgggaatcatcttaacca 1666 Query: 372 acccagcatcaccattcttgagaaacttgggcgctgcctccagctccttgccggaccgcc 431 ||||||||||| |||||||| ||||||||| | |||||||||||||||||| || | Sbjct: 1665 taccagcatcaccgttcttgaggaacttgggctccttctccagctccttgccggatcgtc 1606 Query: 432 tgtcgatcttggtctggatctcggcgaacttgacggcnatgtgggatgtgtggcagtcca 491 |||||||||||||| | ||| || ||||||||||| ||||| || ||||||||||||| Sbjct: 1605 tgtcgatcttggtcaccagctcagcaaacttgacggcaatgtgtgaggtgtggcagtcca 1546 Query: 492 gcacangggcataaccgttgctgatctggccagggtggttcatgatgatgacctggg 548 |||| |||| || || |||| |||||| |||||||||||||||||||| ||||||| Sbjct: 1545 gcactggggcgtagccattgccgatctgcccagggtggttcatgatgatcacctggg 1489
>dbj|AK105030.2| Oryza sativa (japonica cultivar-group) cDNA clone:001-012-F06, full insert sequence Length = 1632 Score = 303 bits (153), Expect = 3e-79 Identities = 305/357 (85%) Strand = Plus / Minus Query: 192 ctcatttcttcttgatcgcagccttggtaaccttggcgccggtcggctccttcttctcna 251 |||||||||||||| ||||||||||| |||||||| ||||| || ||||||||||| | Sbjct: 1440 ctcatttcttcttggcggcagccttggtcaccttggcaccggttgggtccttcttctcca 1381 Query: 252 cgctcttgatcacacccacagcaaccgtctgcctnatgtcacgcacggcaaaccgaccca 311 || ||||||| || || ||||| ||||| ||||| ||||| ||||||||||| ||||| | Sbjct: 1380 cgttcttgatgacgccaacagccaccgtttgcctcatgtcccgcacggcaaaacgaccaa 1321 Query: 312 gaggagggtactgggcaaaggtctccaccaccatgggcttggttggaatcatcttgacga 371 |||||||||||| | ||||||||||| |||||||||||||| ||||||||||| || | Sbjct: 1320 gaggagggtactcagagaaggtctccacaaccatgggcttggtgggaatcatcttaacca 1261 Query: 372 acccagcatcaccattcttgagaaacttgggcgctgcctccagctccttgccggaccgcc 431 ||||||||||| |||||||| ||||||||| | |||||||||||| || || || | Sbjct: 1260 taccagcatcaccgttcttgaggaacttgggctccttctccagctccttaccagatcgtc 1201 Query: 432 tgtcgatcttggtctggatctcggcgaacttgacggcnatgtgggatgtgtggcagtcca 491 |||||||||||||| | ||| || ||||||||||| |||||||| ||||||||||||| Sbjct: 1200 tgtcgatcttggtcaccagctcagcaaacttgacggcaatgtgggaggtgtggcagtcca 1141 Query: 492 gcacangggcataaccgttgctgatctggccagggtggttcatgatgatgacctggg 548 |||| |||| || ||||||| ||||||||||||||||||||||||||| ||||||| Sbjct: 1140 gcactggggcgtagccgttgccgatctggccagggtggttcatgatgatcacctggg 1084
>dbj|AK119172.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-037-A11, full insert sequence Length = 1661 Score = 303 bits (153), Expect = 3e-79 Identities = 305/357 (85%) Strand = Plus / Minus Query: 192 ctcatttcttcttgatcgcagccttggtaaccttggcgccggtcggctccttcttctcna 251 |||||||||||||| ||||||||||| |||||||| ||||| || ||||||||||| | Sbjct: 1435 ctcatttcttcttggcggcagccttggtcaccttggcaccggttgggtccttcttctcca 1376 Query: 252 cgctcttgatcacacccacagcaaccgtctgcctnatgtcacgcacggcaaaccgaccca 311 || ||||||| || || ||||| ||||| ||||| ||||| ||||||||||| ||||| | Sbjct: 1375 cgttcttgatgacgccaacagccaccgtttgcctcatgtcccgcacggcaaaacgaccaa 1316 Query: 312 gaggagggtactgggcaaaggtctccaccaccatgggcttggttggaatcatcttgacga 371 |||||||||||| | ||||||||||| |||||||||||||| ||||||||||| || | Sbjct: 1315 gaggagggtactcagagaaggtctccacaaccatgggcttggtgggaatcatcttaacca 1256 Query: 372 acccagcatcaccattcttgagaaacttgggcgctgcctccagctccttgccggaccgcc 431 ||||||||||| |||||||| ||||||||| | |||||||||||| || || || | Sbjct: 1255 taccagcatcaccgttcttgaggaacttgggctccttctccagctccttaccagatcgtc 1196 Query: 432 tgtcgatcttggtctggatctcggcgaacttgacggcnatgtgggatgtgtggcagtcca 491 |||||||||||||| | ||| || ||||||||||| |||||||| ||||||||||||| Sbjct: 1195 tgtcgatcttggtcaccagctcagcaaacttgacggcaatgtgggaggtgtggcagtcca 1136 Query: 492 gcacangggcataaccgttgctgatctggccagggtggttcatgatgatgacctggg 548 |||| |||| || ||||||| ||||||||||||||||||||||||||| ||||||| Sbjct: 1135 gcactggggcgtagccgttgccgatctggccagggtggttcatgatgatcacctggg 1079
>dbj|AK103738.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033138K07, full insert sequence Length = 3222 Score = 303 bits (153), Expect = 3e-79 Identities = 305/357 (85%) Strand = Plus / Minus Query: 192 ctcatttcttcttgatcgcagccttggtaaccttggcgccggtcggctccttcttctcna 251 |||||||||||||| ||||||||||| |||||||| ||||| || ||||||||||| | Sbjct: 3030 ctcatttcttcttggcggcagccttggtcaccttggcaccggttgggtccttcttctcca 2971 Query: 252 cgctcttgatcacacccacagcaaccgtctgcctnatgtcacgcacggcaaaccgaccca 311 || ||||||| || || ||||| ||||| ||||| ||||| ||||||||||| ||||| | Sbjct: 2970 cgttcttgatgacgccaacagccaccgtttgcctcatgtcccgcacggcaaaacgaccaa 2911 Query: 312 gaggagggtactgggcaaaggtctccaccaccatgggcttggttggaatcatcttgacga 371 |||||||||||| | ||||||||||| |||||||||||||| ||||||||||| || | Sbjct: 2910 gaggagggtactcagagaaggtctccacaaccatgggcttggtgggaatcatcttaacca 2851 Query: 372 acccagcatcaccattcttgagaaacttgggcgctgcctccagctccttgccggaccgcc 431 ||||||||||| |||||||| ||||||||| | |||||||||||| || || || | Sbjct: 2850 taccagcatcaccgttcttgaggaacttgggctccttctccagctccttaccagatcgtc 2791 Query: 432 tgtcgatcttggtctggatctcggcgaacttgacggcnatgtgggatgtgtggcagtcca 491 |||||||||||||| | ||| || ||||||||||| |||||||| ||||||||||||| Sbjct: 2790 tgtcgatcttggtcaccagctcagcaaacttgacggcaatgtgggaggtgtggcagtcca 2731 Query: 492 gcacangggcataaccgttgctgatctggccagggtggttcatgatgatgacctggg 548 |||| |||| || ||||||| ||||||||||||||||||||||||||| ||||||| Sbjct: 2730 gcactggggcgtagccgttgccgatctggccagggtggttcatgatgatcacctggg 2674
>dbj|AK073196.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033024M04, full insert sequence Length = 2157 Score = 303 bits (153), Expect = 3e-79 Identities = 305/357 (85%) Strand = Plus / Minus Query: 192 ctcatttcttcttgatcgcagccttggtaaccttggcgccggtcggctccttcttctcna 251 |||||||||||||| ||||||||||| |||||||| ||||| || ||||||||||| | Sbjct: 2001 ctcatttcttcttggcggcagccttggtcaccttggcaccggttgggtccttcttctcca 1942 Query: 252 cgctcttgatcacacccacagcaaccgtctgcctnatgtcacgcacggcaaaccgaccca 311 || ||||||| || || ||||| ||||| ||||| ||||||||||||||||| ||||| | Sbjct: 1941 cgttcttgatgacgccaacagccaccgtttgcctcatgtcacgcacggcaaaacgaccaa 1882 Query: 312 gaggagggtactgggcaaaggtctccaccaccatgggcttggttggaatcatcttgacga 371 |||||||||||| | ||||||||||| |||||||||||||| ||||||||||| || | Sbjct: 1881 gaggagggtactcagagaaggtctccacaaccatgggcttggtgggaatcatcttaacca 1822 Query: 372 acccagcatcaccattcttgagaaacttgggcgctgcctccagctccttgccggaccgcc 431 ||||||||||| |||||||| ||||||||| | |||||||||||||||||| || | Sbjct: 1821 taccagcatcaccgttcttgaggaacttgggctccttctccagctccttgccggatcgtc 1762 Query: 432 tgtcgatcttggtctggatctcggcgaacttgacggcnatgtgggatgtgtggcagtcca 491 |||||||||||||| | ||| || ||||||||||| ||||| || ||||||||||||| Sbjct: 1761 tgtcgatcttggtcaccagctcagcaaacttgacggcaatgtgtgaggtgtggcagtcca 1702 Query: 492 gcacangggcataaccgttgctgatctggccagggtggttcatgatgatgacctggg 548 |||| |||| || || |||| |||||| |||||||||||||||||||| ||||||| Sbjct: 1701 gcactggggcgtagccattgccgatctgcccagggtggttcatgatgatcacctggg 1645
>dbj|AK072648.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023126K23, full insert sequence Length = 1760 Score = 303 bits (153), Expect = 3e-79 Identities = 305/357 (85%) Strand = Plus / Minus Query: 192 ctcatttcttcttgatcgcagccttggtaaccttggcgccggtcggctccttcttctcna 251 |||||||||||||| ||||||||||| |||||||| ||||| || ||||||||||| | Sbjct: 1439 ctcatttcttcttggcggcagccttggtcaccttggcaccggttgggtccttcttctcca 1380 Query: 252 cgctcttgatcacacccacagcaaccgtctgcctnatgtcacgcacggcaaaccgaccca 311 || ||||||| || || ||||| ||||| ||||| ||||| ||||||||||| ||||| | Sbjct: 1379 cgttcttgatgacgccaacagccaccgtttgcctcatgtcccgcacggcaaaacgaccaa 1320 Query: 312 gaggagggtactgggcaaaggtctccaccaccatgggcttggttggaatcatcttgacga 371 |||||||||||| | ||||||||||| |||||||||||||| ||||||||||| || | Sbjct: 1319 gaggagggtactcagagaaggtctccacaaccatgggcttggtgggaatcatcttaacca 1260 Query: 372 acccagcatcaccattcttgagaaacttgggcgctgcctccagctccttgccggaccgcc 431 ||||||||||| |||||||| ||||||||| | |||||||||||| || || || | Sbjct: 1259 taccagcatcaccgttcttgaggaacttgggctccttctccagctccttaccagatcgtc 1200 Query: 432 tgtcgatcttggtctggatctcggcgaacttgacggcnatgtgggatgtgtggcagtcca 491 |||||||||||||| | ||| || ||||||||||| |||||||| ||||||||||||| Sbjct: 1199 tgtcgatcttggtcaccagctcagcaaacttgacggcaatgtgggaggtgtggcagtcca 1140 Query: 492 gcacangggcataaccgttgctgatctggccagggtggttcatgatgatgacctggg 548 |||| |||| || ||||||| ||||||||||||||||||||||||||| ||||||| Sbjct: 1139 gcactggggcgtagccgttgccgatctggccagggtggttcatgatgatcacctggg 1083
>dbj|AK072285.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023016F09, full insert sequence Length = 1653 Score = 303 bits (153), Expect = 3e-79 Identities = 305/357 (85%) Strand = Plus / Minus Query: 192 ctcatttcttcttgatcgcagccttggtaaccttggcgccggtcggctccttcttctcna 251 |||||||||||||| ||||||||||| |||||||| ||||| || ||||||||||| | Sbjct: 1428 ctcatttcttcttggcggcagccttggtcaccttggcaccggttgggtccttcttctcca 1369 Query: 252 cgctcttgatcacacccacagcaaccgtctgcctnatgtcacgcacggcaaaccgaccca 311 || ||||||| || || ||||| ||||| ||||| ||||||||||||||||| ||||| | Sbjct: 1368 cgttcttgatgacgccaacagccaccgtttgcctcatgtcacgcacggcaaaacgaccaa 1309 Query: 312 gaggagggtactgggcaaaggtctccaccaccatgggcttggttggaatcatcttgacga 371 |||||||||||| | ||||||||||| |||||||||||||| ||||||||||| || | Sbjct: 1308 gaggagggtactcagagaaggtctccacaaccatgggcttggtgggaatcatcttaacca 1249 Query: 372 acccagcatcaccattcttgagaaacttgggcgctgcctccagctccttgccggaccgcc 431 ||||||||||| |||||||| ||||||||| | |||||||||||||||||| || | Sbjct: 1248 taccagcatcaccgttcttgaggaacttgggctccttctccagctccttgccggatcgtc 1189 Query: 432 tgtcgatcttggtctggatctcggcgaacttgacggcnatgtgggatgtgtggcagtcca 491 |||||||||||||| | ||| || ||||||||||| ||||| || ||||||||||||| Sbjct: 1188 tgtcgatcttggtcaccagctcagcaaacttgacggcaatgtgtgaggtgtggcagtcca 1129 Query: 492 gcacangggcataaccgttgctgatctggccagggtggttcatgatgatgacctggg 548 |||| |||| || || |||| |||||| |||||||||||||||||||| ||||||| Sbjct: 1128 gcactggggcgtagccattgccgatctgcccagggtggttcatgatgatcacctggg 1072
>dbj|AK062030.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-043-G10, full insert sequence Length = 1357 Score = 303 bits (153), Expect = 3e-79 Identities = 305/357 (85%) Strand = Plus / Minus Query: 192 ctcatttcttcttgatcgcagccttggtaaccttggcgccggtcggctccttcttctcna 251 |||||||||||||| ||||||||||| |||||||| ||||| || ||||||||||| | Sbjct: 1161 ctcatttcttcttggcggcagccttggtcaccttggcaccggttgggtccttcttctcca 1102 Query: 252 cgctcttgatcacacccacagcaaccgtctgcctnatgtcacgcacggcaaaccgaccca 311 || ||||||| || || ||||| ||||| ||||| ||||| ||||||||||| ||||| | Sbjct: 1101 cgttcttgatgacgccaacagccaccgtttgcctcatgtcccgcacggcaaaacgaccaa 1042 Query: 312 gaggagggtactgggcaaaggtctccaccaccatgggcttggttggaatcatcttgacga 371 |||||||||||| | ||||||||||| |||||||||||||| ||||||||||| || | Sbjct: 1041 gaggagggtactcagagaaggtctccacaaccatgggcttggtgggaatcatcttaacca 982 Query: 372 acccagcatcaccattcttgagaaacttgggcgctgcctccagctccttgccggaccgcc 431 ||||||||||| |||||||| ||||||||| | |||||||||||| || || || | Sbjct: 981 taccagcatcaccgttcttgaggaacttgggctccttctccagctccttaccagatcgtc 922 Query: 432 tgtcgatcttggtctggatctcggcgaacttgacggcnatgtgggatgtgtggcagtcca 491 |||||||||||||| | ||| || ||||||||||| |||||||| ||||||||||||| Sbjct: 921 tgtcgatcttggtcaccagctcagcaaacttgacggcaatgtgggaggtgtggcagtcca 862 Query: 492 gcacangggcataaccgttgctgatctggccagggtggttcatgatgatgacctggg 548 |||| |||| || ||||||| ||||||||||||||||||||||||||| ||||||| Sbjct: 861 gcactggggcgtagccgttgccgatctggccagggtggttcatgatgatcacctggg 805
>gb|AF030517.1|AF030517 Oryza sativa translation elongation factor-1 alpha mRNA, complete cds Length = 1562 Score = 303 bits (153), Expect = 3e-79 Identities = 305/357 (85%) Strand = Plus / Minus Query: 192 ctcatttcttcttgatcgcagccttggtaaccttggcgccggtcggctccttcttctcna 251 |||||||||||||| ||||||||||| |||||||| ||||| || ||||||||||| | Sbjct: 1345 ctcatttcttcttgcgggcagccttggtcaccttggcaccggttgggtccttcttctcca 1286 Query: 252 cgctcttgatcacacccacagcaaccgtctgcctnatgtcacgcacggcaaaccgaccca 311 || ||||||| || || ||||| ||||| ||||| ||||||||||| ||||| ||||| | Sbjct: 1285 cgttcttgatgacgccaacagccaccgtttgcctcatgtcacgcaccgcaaaacgaccaa 1226 Query: 312 gaggagggtactgggcaaaggtctccaccaccatgggcttggttggaatcatcttgacga 371 |||||||||||| | ||||||||||| |||||||||||||| ||||||||||| || | Sbjct: 1225 gaggagggtactcagagaaggtctccacaaccatgggcttggtgggaatcatcttaacca 1166 Query: 372 acccagcatcaccattcttgagaaacttgggcgctgcctccagctccttgccggaccgcc 431 ||||||||||| |||||||| ||||||||| | |||||||||||| || || || | Sbjct: 1165 taccagcatcaccgttcttgaggaacttgggctccttctccagctccttaccagatcgtc 1106 Query: 432 tgtcgatcttggtctggatctcggcgaacttgacggcnatgtgggatgtgtggcagtcca 491 |||||||||||||| | ||| || ||||||||||| |||||||| ||||||||||||| Sbjct: 1105 tgtcgatcttggtcaccagctcagcaaacttgacggcaatgtgggaggtgtggcagtcca 1046 Query: 492 gcacangggcataaccgttgctgatctggccagggtggttcatgatgatgacctggg 548 |||| |||| || ||||||| ||||||||||||||||||||||||||| ||||||| Sbjct: 1045 gcactggggcgtagccgttgccgatctggccagggtggttcatgatgatcacctggg 989
>dbj|D63580.1| Oryza sativa mRNA for EF-1 alpha, complete cds Length = 1644 Score = 303 bits (153), Expect = 3e-79 Identities = 305/357 (85%) Strand = Plus / Minus Query: 192 ctcatttcttcttgatcgcagccttggtaaccttggcgccggtcggctccttcttctcna 251 |||||||||||||| ||||||||||| |||||||| ||||| || ||||||||||| | Sbjct: 1418 ctcatttcttcttggcggcagccttggtcaccttggcaccggttgggtccttcttctcca 1359 Query: 252 cgctcttgatcacacccacagcaaccgtctgcctnatgtcacgcacggcaaaccgaccca 311 || ||||||| || || ||||| ||||| ||||| ||||| ||||||||||| ||||| | Sbjct: 1358 cgttcttgatgacgccaacagccaccgtttgcctcatgtcccgcacggcaaaacgaccaa 1299 Query: 312 gaggagggtactgggcaaaggtctccaccaccatgggcttggttggaatcatcttgacga 371 |||||||||||| | ||||||||||| |||||||||||||| ||||||||||| || | Sbjct: 1298 gaggagggtactcagagaaggtctccacaaccatgggcttggtgggaatcatcttaacca 1239 Query: 372 acccagcatcaccattcttgagaaacttgggcgctgcctccagctccttgccggaccgcc 431 ||||||||||| |||||||| ||||||||| | |||||||||||| || || || | Sbjct: 1238 taccagcatcaccgttcttgaggaacttgggctccttctccagctccttaccagatcgtc 1179 Query: 432 tgtcgatcttggtctggatctcggcgaacttgacggcnatgtgggatgtgtggcagtcca 491 |||||||||||||| | ||| || ||||||||||| |||||||| ||||||||||||| Sbjct: 1178 tgtcgatcttggtcaccagctcagcaaacttgacggcaatgtgggaggtgtggcagtcca 1119 Query: 492 gcacangggcataaccgttgctgatctggccagggtggttcatgatgatgacctggg 548 |||| |||| || ||||||| ||||||||||||||||||||||||||| ||||||| Sbjct: 1118 gcactggggcgtagccgttgccgatctggccagggtggttcatgatgatcacctggg 1062
>gb|BT016740.1| Zea mays clone Contig573 mRNA sequence Length = 1712 Score = 301 bits (152), Expect = 1e-78 Identities = 304/356 (85%) Strand = Plus / Minus Query: 193 tcatttcttcttgatcgcagccttggtaaccttggcgccggtcggctccttcttctcnac 252 ||||||||||||| ||||||||||| |||||||| |||||||| ||||||||||| || Sbjct: 1439 tcatttcttcttggcagcagccttggtcaccttggcaccggtcgggtccttcttctccac 1380 Query: 253 gctcttgatcacacccacagcaaccgtctgcctnatgtcacgcacggcaaaccgacccag 312 |||||||| || || |||||||||||||| || |||||||| || ||||||| |||||| Sbjct: 1379 actcttgatgactccaacagcaaccgtctgtctcatgtcacggacagcaaacctacccag 1320 Query: 313 aggagggtactgggcaaaggtctccaccaccatgggcttggttggaatcatcttgacgaa 372 ||||| ||||| | || ||||||||||||||||||||||| ||||||||||| || | Sbjct: 1319 gggaggatactgcgagaatgtctccaccaccatgggcttggtgggaatcatcttcaccat 1260 Query: 373 cccagcatcaccattcttgagaaacttgggcgctgcctccagctccttgccggaccgcct 432 ||||||||||| ||||| | ||||||||| || ||| ||||||||||| || ||||| Sbjct: 1259 accagcatcaccgttcttcaagaacttgggctctttctcaagctccttgccagaacgcct 1200 Query: 433 gtcgatcttggtctggatctcggcgaacttgacggcnatgtgggatgtgtggcagtccag 492 |||||||||||| || ||| || |||||||| || || ||||| |||||||||||||| Sbjct: 1199 gtcgatcttggtaatgagctcagcaaacttgacagcaatatgggaggtgtggcagtccag 1140 Query: 493 cacangggcataaccgttgctgatctggccagggtggttcatgatgatgacctggg 548 ||| ||||||||||||| | |||||| |||||||||||||||||||||||||||| Sbjct: 1139 cactggggcataaccgttaccgatctgcccagggtggttcatgatgatgacctggg 1084
>dbj|D63583.1| Oryza sativa mRNA for EF-1 alpha, complete cds Length = 1599 Score = 301 bits (152), Expect = 1e-78 Identities = 304/356 (85%) Strand = Plus / Minus Query: 193 tcatttcttcttgatcgcagccttggtaaccttggcgccggtcggctccttcttctcnac 252 ||||||||||||| ||||||||||| |||||||| ||||| || ||||||||||| || Sbjct: 1419 tcatttcttcttggcggcagccttggtcaccttggcaccggttgggtccttcttctccac 1360 Query: 253 gctcttgatcacacccacagcaaccgtctgcctnatgtcacgcacggcaaaccgacccag 312 | ||||||| || || ||||| ||||| ||||| ||||||||||||||||| ||||| || Sbjct: 1359 gttcttgatgacgccaacagccaccgtttgcctcatgtcacgcacggcaaaacgaccaag 1300 Query: 313 aggagggtactgggcaaaggtctccaccaccatgggcttggttggaatcatcttgacgaa 372 ||||||||||| | ||||||||||| |||||||||||||| ||||||||||| || | Sbjct: 1299 aggagggtactcagagaaggtctccacaaccatgggcttggtgggaatcatcttaaccat 1240 Query: 373 cccagcatcaccattcttgagaaacttgggcgctgcctccagctccttgccggaccgcct 432 ||||||||||| |||||||| ||||||||| | |||||||||||||||||| || || Sbjct: 1239 accagcatcaccgttcttgaggaacttgggctccttctccagctccttgccggatcgtct 1180 Query: 433 gtcgatcttggtctggatctcggcgaacttgacggcnatgtgggatgtgtggcagtccag 492 ||||||||||||| | ||| || ||||||||||| ||||| || |||||||||||||| Sbjct: 1179 gtcgatcttggtcaccagctcagcaaacttgacggcaatgtgtgaggtgtggcagtccag 1120 Query: 493 cacangggcataaccgttgctgatctggccagggtggttcatgatgatgacctggg 548 ||| |||| || || |||| |||||| |||||||||||||||||||| ||||||| Sbjct: 1119 cactggggcgtagccattgccgatctgcccagggtggttcatgatgatcacctggg 1064
>gb|BT016525.1| Zea mays clone Contig358 mRNA sequence Length = 1705 Score = 293 bits (148), Expect = 3e-76 Identities = 303/356 (85%) Strand = Plus / Minus Query: 193 tcatttcttcttgatcgcagccttggtaaccttggcgccggtcggctccttcttctcnac 252 ||||||||||||| || |||||||| |||||||||||||| || ||||||||||| || Sbjct: 1423 tcatttcttcttggcggccgccttggtcaccttggcgccggttgggtccttcttctccac 1364 Query: 253 gctcttgatcacacccacagcaaccgtctgcctnatgtcacgcacggcaaaccgacccag 312 |||||||| || || ||||||||||||||||| ||||| || |||||||||| |||||| Sbjct: 1363 actcttgatgactccaacagcaaccgtctgcctcatgtcgcggacggcaaacctacccag 1304 Query: 313 aggagggtactgggcaaaggtctccaccaccatgggcttggttggaatcatcttgacgaa 372 ||||| ||| || || |||||||||||||| |||||||| ||||||||||| || | Sbjct: 1303 gggaggatacgcggagaatgtctccaccaccataggcttggtgggaatcatcttcaccat 1244 Query: 373 cccagcatcaccattcttgagaaacttgggcgctgcctccagctccttgccggaccgcct 432 ||||||||||| ||||| || ||||||||| | ||| ||||||||||| || ||||| Sbjct: 1243 accagcatcaccgttcttcaggaacttgggctccttctcgagctccttgccagatcgcct 1184 Query: 433 gtcgatcttggtctggatctcggcgaacttgacggcnatgtgggatgtgtggcagtccag 492 |||||||||||| || ||| || ||||||||||| |||||||| |||||||||||||| Sbjct: 1183 gtcgatcttggtaatgagctcagcaaacttgacggcgatgtgggaggtgtggcagtccag 1124 Query: 493 cacangggcataaccgttgctgatctggccagggtggttcatgatgatgacctggg 548 ||| ||||||| ||||||| ||||| |||||||||||||||||||||||||||| Sbjct: 1123 cactggggcatagccgttgccaatctgcccagggtggttcatgatgatgacctggg 1068
>gb|BT017771.1| Zea mays clone EL01N0502E05.c mRNA sequence Length = 959 Score = 293 bits (148), Expect = 3e-76 Identities = 303/356 (85%) Strand = Plus / Minus Query: 193 tcatttcttcttgatcgcagccttggtaaccttggcgccggtcggctccttcttctcnac 252 |||||||||||| || ||||||||||| |||||||| || || || ||||||||||| || Sbjct: 804 tcatttcttctttattgcagccttggtcaccttggcaccagttgggtccttcttctccac 745 Query: 253 gctcttgatcacacccacagcaaccgtctgcctnatgtcacgcacggcaaaccgacccag 312 ||||||||| || || ||||||||||||||||| |||||||| || ||||| |||||||| Sbjct: 744 gctcttgatgactccaacagcaaccgtctgcctcatgtcacggacagcaaaacgacccag 685 Query: 313 aggagggtactgggcaaaggtctccaccaccatgggcttggttggaatcatcttgacgaa 372 |||||| ||||| | |||||||| |||||||||||||| || ||||||||||| || | Sbjct: 684 aggaggatactgagagaaggtctcaaccaccatgggcttagtgggaatcatcttcaccat 625 Query: 373 cccagcatcaccattcttgagaaacttgggcgctgcctccagctccttgccggaccgcct 432 || |||||||||||||| || ||||||||| | ||| ||||||||||| |||||||| Sbjct: 624 accggcatcaccattcttcaggaacttgggctccttctcaagctccttgccagaccgcct 565 Query: 433 gtcgatcttggtctggatctcggcgaacttgacggcnatgtgggatgtgtggcagtccag 492 ||||||||||| || ||| || |||||||| || |||||||| |||||||||||||| Sbjct: 564 atcgatcttggttatgagctcagcaaacttgacagcaatgtgggaggtgtggcagtccag 505 Query: 493 cacangggcataaccgttgctgatctggccagggtggttcatgatgatgacctggg 548 ||| ||||||| || |||| ||||| ||||||||||||||||||||||| |||| Sbjct: 504 cactggggcatagccattgccaatctgcccagggtggttcatgatgatgacttggg 449
>gb|AF136824.1|AF136824 Zea mays clone b elongation factor 1 alpha mRNA, complete cds Length = 1604 Score = 293 bits (148), Expect = 3e-76 Identities = 303/356 (85%) Strand = Plus / Minus Query: 193 tcatttcttcttgatcgcagccttggtaaccttggcgccggtcggctccttcttctcnac 252 ||||||||||||| || |||||||| |||||||||||||| || ||||||||||| || Sbjct: 1404 tcatttcttcttggcggccgccttggtcaccttggcgccggttgggtccttcttctccac 1345 Query: 253 gctcttgatcacacccacagcaaccgtctgcctnatgtcacgcacggcaaaccgacccag 312 |||||||| || || ||||||||||||||||| ||||| || |||||||||| |||||| Sbjct: 1344 actcttgatgactccaacagcaaccgtctgcctcatgtcgcggacggcaaacctacccag 1285 Query: 313 aggagggtactgggcaaaggtctccaccaccatgggcttggttggaatcatcttgacgaa 372 ||||| ||| || || |||||||||||||| |||||||| ||||||||||| || | Sbjct: 1284 gggaggatacgcggagaatgtctccaccaccataggcttggtgggaatcatcttcaccat 1225 Query: 373 cccagcatcaccattcttgagaaacttgggcgctgcctccagctccttgccggaccgcct 432 ||||||||||| ||||| || ||||||||| | ||| ||||||||||| || ||||| Sbjct: 1224 accagcatcaccgttcttcaggaacttgggctccttctcgagctccttgccagatcgcct 1165 Query: 433 gtcgatcttggtctggatctcggcgaacttgacggcnatgtgggatgtgtggcagtccag 492 |||||||||||| || ||| || ||||||||||| |||||||| |||||||||||||| Sbjct: 1164 gtcgatcttggtaatgagctcagcaaacttgacggcgatgtgggaggtgtggcagtccag 1105 Query: 493 cacangggcataaccgttgctgatctggccagggtggttcatgatgatgacctggg 548 ||| ||||||| ||||||| ||||| |||||||||||||||||||||||||||| Sbjct: 1104 cactggggcatagccgttgccaatctgcccagggtggttcatgatgatgacctggg 1049
>gb|AY109326.1| Zea mays CL1256_1 mRNA sequence Length = 2360 Score = 293 bits (148), Expect = 3e-76 Identities = 303/356 (85%) Strand = Plus / Minus Query: 193 tcatttcttcttgatcgcagccttggtaaccttggcgccggtcggctccttcttctcnac 252 ||||||||||||| || |||||||| |||||||||||||| || ||||||||||| || Sbjct: 2032 tcatttcttcttggcggccgccttggtcaccttggcgccggttgggtccttcttctccac 1973 Query: 253 gctcttgatcacacccacagcaaccgtctgcctnatgtcacgcacggcaaaccgacccag 312 |||||||| || || ||||||||||||||||| ||||| || |||||||||| |||||| Sbjct: 1972 actcttgatgactccaacagcaaccgtctgcctcatgtcgcggacggcaaacctacccag 1913 Query: 313 aggagggtactgggcaaaggtctccaccaccatgggcttggttggaatcatcttgacgaa 372 ||||| ||| || || |||||||||||||| |||||||| ||||||||||| || | Sbjct: 1912 gggaggatacgcggagaatgtctccaccaccataggcttggtgggaatcatcttcaccat 1853 Query: 373 cccagcatcaccattcttgagaaacttgggcgctgcctccagctccttgccggaccgcct 432 ||||||||||| ||||| || ||||||||| | ||| ||||||||||| || ||||| Sbjct: 1852 accagcatcaccgttcttcaggaacttgggctccttctcgagctccttgccagatcgcct 1793 Query: 433 gtcgatcttggtctggatctcggcgaacttgacggcnatgtgggatgtgtggcagtccag 492 |||||||||||| || ||| || ||||||||||| |||||||| |||||||||||||| Sbjct: 1792 gtcgatcttggtaatgagctcagcaaacttgacggcgatgtgggaggtgtggcagtccag 1733 Query: 493 cacangggcataaccgttgctgatctggccagggtggttcatgatgatgacctggg 548 ||| ||||||| ||||||| ||||| |||||||||||||||||||||||||||| Sbjct: 1732 cactggggcatagccgttgccaatctgcccagggtggttcatgatgatgacctggg 1677
>gb|BT016889.1| Zea mays clone Contig722 mRNA sequence Length = 930 Score = 280 bits (141), Expect = 5e-72 Identities = 287/337 (85%) Strand = Plus / Plus Query: 212 gccttggtaaccttggcgccggtcggctccttcttctcnacgctcttgatcacacccaca 271 |||||||||||||||||||||||||| ||||||||||| || |||||||| || || ||| Sbjct: 318 gccttggtaaccttggcgccggtcgggtccttcttctccacactcttgatgactccaaca 377 Query: 272 gcaaccgtctgcctnatgtcacgcacggcaaaccgacccagaggagggtactgggcaaag 331 ||||| |||||||| ||||| || || ||||||| ||| || ||||| ||||| | || Sbjct: 378 gcaactgtctgcctcatgtcgcggacagcaaacctaccaaggggaggatactgcgagaat 437 Query: 332 gtctccaccaccatgggcttggttggaatcatcttgacgaacccagcatcaccattcttg 391 ||||||||||||||||||||||| ||||||||||| || | ||||||||||| ||||| Sbjct: 438 gtctccaccaccatgggcttggtgggaatcatcttcaccataccagcatcaccgttcttc 497 Query: 392 agaaacttgggcgctgcctccagctccttgccggaccgcctgtcgatcttggtctggatc 451 || ||||||||| | ||| ||||||||||| |||||||||||||||||||| || Sbjct: 498 aggaacttgggctccttctcaagctccttgccagaccgcctgtcgatcttggtaatgagt 557 Query: 452 tcggcgaacttgacggcnatgtgggatgtgtggcagtccagcacangggcataaccgttg 511 || || |||||||| || |||||||| ||||||||||||||||| ||||||| || ||| Sbjct: 558 tcagcaaacttgacagcaatgtgggaggtgtggcagtccagcactggggcatagccattg 617 Query: 512 ctgatctggccagggtggttcatgatgatgacctggg 548 | ||||| |||||||||||||||||||||||||||| Sbjct: 618 cctatctgcccagggtggttcatgatgatgacctggg 654
>gb|BT016514.1| Zea mays clone Contig347 mRNA sequence Length = 1687 Score = 278 bits (140), Expect = 2e-71 Identities = 301/356 (84%) Strand = Plus / Minus Query: 193 tcatttcttcttgatcgcagccttggtaaccttggcgccggtcggctccttcttctcnac 252 ||||||||||||| ||||||||||| |||||||||||||| || ||||||||||| || Sbjct: 1424 tcatttcttcttggcagcagccttggtcaccttggcgccggttgggtccttcttctccac 1365 Query: 253 gctcttgatcacacccacagcaaccgtctgcctnatgtcacgcacggcaaaccgacccag 312 |||||||| || || ||||||||||||||||| |||||||| || ||||||| ||| || Sbjct: 1364 actcttgataactccaacagcaaccgtctgcctcatgtcacggacagcaaacctaccaag 1305 Query: 313 aggagggtactgggcaaaggtctccaccaccatgggcttggttggaatcatcttgacgaa 372 ||||| ||| | || ||||||||||||||||||||||| || |||||||| || | Sbjct: 1304 gggaggatacgctgagaatgtctccaccaccatgggcttggtgggtatcatcttcaccat 1245 Query: 373 cccagcatcaccattcttgagaaacttgggcgctgcctccagctccttgccggaccgcct 432 ||||||||||| ||||| || ||||| ||| | ||| ||||||||||| |||||||| Sbjct: 1244 accagcatcaccgttcttcaggaactttggctccttctcaagctccttgccagaccgcct 1185 Query: 433 gtcgatcttggtctggatctcggcgaacttgacggcnatgtgggatgtgtggcagtccag 492 |||||||||||| || ||| || |||||||| || |||||||| |||||||||||||| Sbjct: 1184 gtcgatcttggtaatgagctcagcaaacttgacagcgatgtgggaggtgtggcagtccag 1125 Query: 493 cacangggcataaccgttgctgatctggccagggtggttcatgatgatgacctggg 548 ||| ||||||| ||||||| ||||| |||||||||||||||||||||||||||| Sbjct: 1124 cactggggcatagccgttgccaatctgcccagggtggttcatgatgatgacctggg 1069
>gb|AF136823.1|AF136823 Zea mays clone a elongation factor 1 alpha mRNA, complete cds Length = 1600 Score = 278 bits (140), Expect = 2e-71 Identities = 301/356 (84%) Strand = Plus / Minus Query: 193 tcatttcttcttgatcgcagccttggtaaccttggcgccggtcggctccttcttctcnac 252 ||||||||||||| || |||||||| |||||||||||||| || ||||||||||| || Sbjct: 1415 tcatttcttcttggcggccgccttggtcaccttggcgccggttgggtccttcttctccac 1356 Query: 253 gctcttgatcacacccacagcaaccgtctgcctnatgtcacgcacggcaaaccgacccag 312 |||||||| || || ||||||||||||||||| ||||| || |||||||||| |||||| Sbjct: 1355 actcttgatgactccaacagcaaccgtctgcctcatgtcgcggacggcaaacctacccag 1296 Query: 313 aggagggtactgggcaaaggtctccaccaccatgggcttggttggaatcatcttgacgaa 372 ||||| ||| || || |||||||||||||| |||||||| || |||||||| || | Sbjct: 1295 gggaggatacgcggagaatgtctccaccaccataggcttggtgggtatcatcttcaccat 1236 Query: 373 cccagcatcaccattcttgagaaacttgggcgctgcctccagctccttgccggaccgcct 432 ||||||||||| ||||| || ||||| ||| | ||| ||||||||||| || ||||| Sbjct: 1235 accagcatcaccgttcttcaggaactttggctccttctcaagctccttgccagagcgcct 1176 Query: 433 gtcgatcttggtctggatctcggcgaacttgacggcnatgtgggatgtgtggcagtccag 492 |||||||||||| || ||| || |||||||| || |||||||| |||||||||||||| Sbjct: 1175 gtcgatcttggtaatgagctcagcaaacttgacagcgatgtgggaggtgtggcagtccag 1116 Query: 493 cacangggcataaccgttgctgatctggccagggtggttcatgatgatgacctggg 548 |||| ||||||| ||||||| ||||| |||||||||||||||||||||||||||| Sbjct: 1115 cacaggggcatagccgttgccaatctgcccagggtggttcatgatgatgacctggg 1060
>gb|AF136826.1|AF136826 Zea mays clone d elongation factor 1 alpha mRNA, complete cds Length = 1546 Score = 270 bits (136), Expect = 5e-69 Identities = 300/356 (84%) Strand = Plus / Minus Query: 193 tcatttcttcttgatcgcagccttggtaaccttggcgccggtcggctccttcttctcnac 252 |||||||||||| || ||||||||||| |||||||| || || || ||||||||||| || Sbjct: 1375 tcatttcttctttattgcagccttggtcaccttggcaccagttgggtccttcttctccac 1316 Query: 253 gctcttgatcacacccacagcaaccgtctgcctnatgtcacgcacggcaaaccgacccag 312 ||||||||| || || ||||||||||||||||| ||||| | || ||||| |||||||| Sbjct: 1315 gctcttgatgactccaacagcaaccgtctgcctcatgtcgaggacagcaaaacgacccag 1256 Query: 313 aggagggtactgggcaaaggtctccaccaccatgggcttggttggaatcatcttgacgaa 372 |||||| ||||| | |||||||| |||||||||||||| || ||||||||||| || | Sbjct: 1255 aggaggatactgagagaaggtctcaaccaccatgggcttagtgggaatcatcttcaccat 1196 Query: 373 cccagcatcaccattcttgagaaacttgggcgctgcctccagctccttgccggaccgcct 432 || |||||||||||||| || ||||| ||| | ||| ||||||||||| || ||||| Sbjct: 1195 accggcatcaccattcttcaggaactttggctccttctcaagctccttgccagagcgcct 1136 Query: 433 gtcgatcttggtctggatctcggcgaacttgacggcnatgtgggatgtgtggcagtccag 492 |||||||||||| || ||| || |||||||| || |||||||| |||||||||||||| Sbjct: 1135 gtcgatcttggtaatgagctcagcaaacttgacagcaatgtgggaggtgtggcagtccag 1076 Query: 493 cacangggcataaccgttgctgatctggccagggtggttcatgatgatgacctggg 548 ||| ||||||| || |||| ||||| ||||||||||||||||||||||| |||| Sbjct: 1075 cactggggcatagccattgccaatctgcccagggtggttcatgatgatgacttggg 1020
>dbj|AK119528.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-203-C04, full insert sequence Length = 1818 Score = 264 bits (133), Expect = 3e-67 Identities = 300/357 (84%) Strand = Plus / Minus Query: 192 ctcatttcttcttgatcgcagccttggtaaccttggcgccggtcggctccttcttctcna 251 |||| ||||||||| ||||||||||| |||||||| ||||| || ||||||||||| | Sbjct: 1431 ctcacttcttcttggcggcagccttggtcaccttggcaccggttgggtccttcttctcca 1372 Query: 252 cgctcttgatcacacccacagcaaccgtctgcctnatgtcacgcacggcaaaccgaccca 311 || ||||||| || || ||||| ||||| ||||| ||||||||||| ||||| ||||| | Sbjct: 1371 cgttcttgatgacgccaacagccaccgtttgcctcatgtcacgcaccgcaaaacgaccaa 1312 Query: 312 gaggagggtactgggcaaaggtctccaccaccatgggcttggttggaatcatcttgacga 371 |||||||||||| | ||||||||||| |||||||||||||| |||||||||||||| | Sbjct: 1311 gaggagggtactcagagaaggtctccacaaccatgggcttggtaggaatcatcttgacca 1252 Query: 372 acccagcatcaccattcttgagaaacttgggcgctgcctccagctccttgccggaccgcc 431 ||||||||||| ||||| | ||||||||| | ||||||||||||||| || || | Sbjct: 1251 taccagcatcaccgttcttcaagaacttgggctccttctccagctccttgccagatcgtc 1192 Query: 432 tgtcgatcttggtctggatctcggcgaacttgacggcnatgtgggatgtgtggcagtcca 491 |||| ||||||||| | ||| || |||||||| || |||||||| ||||||||||||| Sbjct: 1191 tgtcaatcttggtcaccagctcagcaaacttgacagcaatgtgggaggtgtggcagtcca 1132 Query: 492 gcacangggcataaccgttgctgatctggccagggtggttcatgatgatgacctggg 548 |||| | ||||| ||||| | |||||| |||||||||||||||||||| ||||||| Sbjct: 1131 gcactggagcatagccgttaccgatctgcccagggtggttcatgatgatcacctggg 1075
>dbj|AK119194.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-041-C03, full insert sequence Length = 1130 Score = 264 bits (133), Expect = 3e-67 Identities = 300/357 (84%) Strand = Plus / Minus Query: 192 ctcatttcttcttgatcgcagccttggtaaccttggcgccggtcggctccttcttctcna 251 |||| ||||||||| ||||||||||| |||||||| ||||| || ||||||||||| | Sbjct: 900 ctcacttcttcttggcggcagccttggtcaccttggcaccggttgggtccttcttctcca 841 Query: 252 cgctcttgatcacacccacagcaaccgtctgcctnatgtcacgcacggcaaaccgaccca 311 || ||||||| || || ||||| ||||| ||||| ||||||||||| ||||| ||||| | Sbjct: 840 cgttcttgatgacgccaacagccaccgtttgcctcatgtcacgcaccgcaaaacgaccaa 781 Query: 312 gaggagggtactgggcaaaggtctccaccaccatgggcttggttggaatcatcttgacga 371 |||||||||||| | ||||||||||| |||||||||||||| |||||||||||||| | Sbjct: 780 gaggagggtactcagagaaggtctccacaaccatgggcttggtaggaatcatcttgacca 721 Query: 372 acccagcatcaccattcttgagaaacttgggcgctgcctccagctccttgccggaccgcc 431 ||||||||||| ||||| | ||||||||| | ||||||||||||||| || || | Sbjct: 720 taccagcatcaccgttcttcaagaacttgggctccttctccagctccttgccagatcgtc 661 Query: 432 tgtcgatcttggtctggatctcggcgaacttgacggcnatgtgggatgtgtggcagtcca 491 |||| ||||||||| | ||| || |||||||| || |||||||| ||||||||||||| Sbjct: 660 tgtcaatcttggtcaccagctcagcaaacttgacagcaatgtgggaggtgtggcagtcca 601 Query: 492 gcacangggcataaccgttgctgatctggccagggtggttcatgatgatgacctggg 548 |||| | ||||| ||||| | |||||| |||||||||||||||||||| ||||||| Sbjct: 600 gcactggagcatagccgttaccgatctgcccagggtggttcatgatgatcacctggg 544
>dbj|AK071619.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023100M05, full insert sequence Length = 1867 Score = 264 bits (133), Expect = 3e-67 Identities = 300/357 (84%) Strand = Plus / Minus Query: 192 ctcatttcttcttgatcgcagccttggtaaccttggcgccggtcggctccttcttctcna 251 |||| ||||||||| ||||||||||| |||||||| ||||| || ||||||||||| | Sbjct: 1706 ctcacttcttcttggcggcagccttggtcaccttggcaccggttgggtccttcttctcca 1647 Query: 252 cgctcttgatcacacccacagcaaccgtctgcctnatgtcacgcacggcaaaccgaccca 311 || ||||||| || || ||||| ||||| ||||| ||||||||||| ||||| ||||| | Sbjct: 1646 cgttcttgatgacgccaacagccaccgtttgcctcatgtcacgcaccgcaaaacgaccaa 1587 Query: 312 gaggagggtactgggcaaaggtctccaccaccatgggcttggttggaatcatcttgacga 371 |||||||||||| | ||||||||||| |||||||||||||| |||||||||||||| | Sbjct: 1586 gaggagggtactcagagaaggtctccacaaccatgggcttggtaggaatcatcttgacca 1527 Query: 372 acccagcatcaccattcttgagaaacttgggcgctgcctccagctccttgccggaccgcc 431 ||||||||||| ||||| | ||||||||| | ||||||||||||||| || || | Sbjct: 1526 taccagcatcaccgttcttcaagaacttgggctccttctccagctccttgccagatcgtc 1467 Query: 432 tgtcgatcttggtctggatctcggcgaacttgacggcnatgtgggatgtgtggcagtcca 491 |||| ||||||||| | ||| || |||||||| || |||||||| ||||||||||||| Sbjct: 1466 tgtcaatcttggtcaccagctcagcaaacttgacagcaatgtgggaggtgtggcagtcca 1407 Query: 492 gcacangggcataaccgttgctgatctggccagggtggttcatgatgatgacctggg 548 |||| | ||||| ||||| | |||||| |||||||||||||||||||| ||||||| Sbjct: 1406 gcactggagcatagccgttaccgatctgcccagggtggttcatgatgatcacctggg 1350
>dbj|AK071343.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023091A02, full insert sequence Length = 1658 Score = 264 bits (133), Expect = 3e-67 Identities = 300/357 (84%) Strand = Plus / Minus Query: 192 ctcatttcttcttgatcgcagccttggtaaccttggcgccggtcggctccttcttctcna 251 |||| ||||||||| ||||||||||| |||||||| ||||| || ||||||||||| | Sbjct: 1431 ctcacttcttcttggcggcagccttggtcaccttggcaccggttgggtccttcttctcca 1372 Query: 252 cgctcttgatcacacccacagcaaccgtctgcctnatgtcacgcacggcaaaccgaccca 311 || ||||||| || || ||||| ||||| ||||| ||||||||||| ||||| ||||| | Sbjct: 1371 cgttcttgatgacgccaacagccaccgtttgcctcatgtcacgcaccgcaaaacgaccaa 1312 Query: 312 gaggagggtactgggcaaaggtctccaccaccatgggcttggttggaatcatcttgacga 371 |||||||||||| | ||||||||||| |||||||||||||| |||||||||||||| | Sbjct: 1311 gaggagggtactcagagaaggtctccacaaccatgggcttggtaggaatcatcttgacca 1252 Query: 372 acccagcatcaccattcttgagaaacttgggcgctgcctccagctccttgccggaccgcc 431 ||||||||||| ||||| | ||||||||| | ||||||||||||||| || || | Sbjct: 1251 taccagcatcaccgttcttcaagaacttgggctccttctccagctccttgccagatcgtc 1192 Query: 432 tgtcgatcttggtctggatctcggcgaacttgacggcnatgtgggatgtgtggcagtcca 491 |||| ||||||||| | ||| || |||||||| || |||||||| ||||||||||||| Sbjct: 1191 tgtcaatcttggtcaccagctcagcaaacttgacagcaatgtgggaggtgtggcagtcca 1132 Query: 492 gcacangggcataaccgttgctgatctggccagggtggttcatgatgatgacctggg 548 |||| | ||||| ||||| | |||||| |||||||||||||||||||| ||||||| Sbjct: 1131 gcactggagcatagccgttaccgatctgcccagggtggttcatgatgatcacctggg 1075
>dbj|D63582.1| Oryza sativa mRNA for EF-1 alpha, complete cds Length = 1637 Score = 264 bits (133), Expect = 3e-67 Identities = 300/357 (84%) Strand = Plus / Minus Query: 192 ctcatttcttcttgatcgcagccttggtaaccttggcgccggtcggctccttcttctcna 251 |||| ||||||||| ||||||||||| |||||||| ||||| || ||||||||||| | Sbjct: 1410 ctcacttcttcttggcggcagccttggtcaccttggcaccggttgggtccttcttctcca 1351 Query: 252 cgctcttgatcacacccacagcaaccgtctgcctnatgtcacgcacggcaaaccgaccca 311 || ||||||| || || ||||| ||||| ||||| ||||||||||| ||||| ||||| | Sbjct: 1350 cgttcttgatgacgccaacagccaccgtttgcctcatgtcacgcaccgcaaaacgaccaa 1291 Query: 312 gaggagggtactgggcaaaggtctccaccaccatgggcttggttggaatcatcttgacga 371 |||||||||||| | ||||||||||| |||||||||||||| |||||||||||||| | Sbjct: 1290 gaggagggtactcagagaaggtctccacaaccatgggcttggtaggaatcatcttgacca 1231 Query: 372 acccagcatcaccattcttgagaaacttgggcgctgcctccagctccttgccggaccgcc 431 ||||||||||| ||||| | ||||||||| | ||||||||||||||| || || | Sbjct: 1230 taccagcatcaccgttcttcaagaacttgggctccttctccagctccttgccagatcgtc 1171 Query: 432 tgtcgatcttggtctggatctcggcgaacttgacggcnatgtgggatgtgtggcagtcca 491 |||| ||||||||| | ||| || |||||||| || |||||||| ||||||||||||| Sbjct: 1170 tgtcaatcttggtcaccagctcagcaaacttgacagcaatgtgggaggtgtggcagtcca 1111 Query: 492 gcacangggcataaccgttgctgatctggccagggtggttcatgatgatgacctggg 548 |||| | ||||| ||||| | |||||| |||||||||||||||||||| ||||||| Sbjct: 1110 gcactggagcatagccgttaccgatctgcccagggtggttcatgatgatcacctggg 1054
>gb|BT016827.1| Zea mays clone Contig660 mRNA sequence Length = 1780 Score = 262 bits (132), Expect = 1e-66 Identities = 299/356 (83%) Strand = Plus / Minus Query: 193 tcatttcttcttgatcgcagccttggtaaccttggcgccggtcggctccttcttctcnac 252 ||||||||||||| |||||||| || |||||||| || || || ||||||||||| || Sbjct: 1477 tcatttcttcttggcagcagccttcgtcaccttggctccagttgggtccttcttctccac 1418 Query: 253 gctcttgatcacacccacagcaaccgtctgcctnatgtcacgcacggcaaaccgacccag 312 |||||||| || || ||||| ||||| ||||| |||||||| || ||||| ||||| || Sbjct: 1417 actcttgatgactccgacagccaccgtttgcctcatgtcacggacagcaaatcgaccaag 1358 Query: 313 aggagggtactgggcaaaggtctccaccaccatgggcttggttggaatcatcttgacgaa 372 |||||| ||||| | |||||||||||||||||||||||| || |||| |||||| || | Sbjct: 1357 aggaggatactgagaaaaggtctccaccaccatgggcttagtgggaaccatcttcaccat 1298 Query: 373 cccagcatcaccattcttgagaaacttgggcgctgcctccagctccttgccggaccgcct 432 ||||||||||| ||||||||||| |||||| | |||||||||||||||||| ||||| Sbjct: 1297 accagcatcaccgttcttgagaaatttgggctccttctccagctccttgccggatcgcct 1238 Query: 433 gtcgatcttggtctggatctcggcgaacttgacggcnatgtgggatgtgtggcagtccag 492 || |||||||| || ||| || |||||||| || ||||| || |||||||||||||| Sbjct: 1237 atcaatcttggtaacgagctcagcaaacttgacagcaatgtgtgaggtgtggcagtccag 1178 Query: 493 cacangggcataaccgttgctgatctggccagggtggttcatgatgatgacctggg 548 || ||||||| || |||| |||||||||||||||||||||||||||||||||| Sbjct: 1177 aactggggcatagccattgccaatctggccagggtggttcatgatgatgacctggg 1122
>gb|BT009129.1| Triticum aestivum clone wl1n.pk0027.f4:fis, full insert mRNA sequence Length = 2565 Score = 262 bits (132), Expect = 1e-66 Identities = 299/356 (83%) Strand = Plus / Minus Query: 193 tcatttcttcttgatcgcagccttggtaaccttggcgccggtcggctccttcttctcnac 252 ||||||||||||| |||||||| || |||||||| || || || ||||||||||| || Sbjct: 2399 tcatttcttcttggcagcagccttcgtcaccttggctccagttgggtccttcttctccac 2340 Query: 253 gctcttgatcacacccacagcaaccgtctgcctnatgtcacgcacggcaaaccgacccag 312 |||||||| || || ||||| ||||| ||||| |||||||| || ||||| ||||| || Sbjct: 2339 actcttgatgactccgacagccaccgtttgcctcatgtcacggacagcaaatcgaccaag 2280 Query: 313 aggagggtactgggcaaaggtctccaccaccatgggcttggttggaatcatcttgacgaa 372 |||||| ||||| | |||||||||||||||||||||||| || |||| |||||| || | Sbjct: 2279 aggaggatactgagaaaaggtctccaccaccatgggcttagtgggaaccatcttcaccat 2220 Query: 373 cccagcatcaccattcttgagaaacttgggcgctgcctccagctccttgccggaccgcct 432 ||||||||||| ||||||||||| |||||| | |||||||||||||||||| ||||| Sbjct: 2219 accagcatcaccgttcttgagaaatttgggctccttctccagctccttgccggatcgcct 2160 Query: 433 gtcgatcttggtctggatctcggcgaacttgacggcnatgtgggatgtgtggcagtccag 492 || |||||||| || ||| || |||||||| || ||||| || |||||||||||||| Sbjct: 2159 atcaatcttggtaacgagctcagcaaacttgacagcaatgtgtgaggtgtggcagtccag 2100 Query: 493 cacangggcataaccgttgctgatctggccagggtggttcatgatgatgacctggg 548 || ||||||| || |||| |||||||||||||||||||||||||||||||||| Sbjct: 2099 aactggggcatagccattgccaatctggccagggtggttcatgatgatgacctggg 2044
>gb|AF136827.1|AF136827 Zea mays clone e elongation factor 1 alpha mRNA, complete cds Length = 1606 Score = 262 bits (132), Expect = 1e-66 Identities = 305/364 (83%) Strand = Plus / Minus Query: 193 tcatttcttcttgatcgcagccttggtaaccttggcgccggtcggctccttcttctcnac 252 ||||||||||||| || |||||||| |||||||||||||| || ||||||||||| || Sbjct: 1432 tcatttcttcttggcggccgccttggtcaccttggcgccggttgggtccttcttctccac 1373 Query: 253 gctcttgatcacacccacagcaaccgtctgcctnatgtcacgcacggcaaaccgacccag 312 ||||||||||| || || |||||||||||||| ||||| || || ||||||| |||||| Sbjct: 1372 actcttgatcacgccgactgcaaccgtctgcctcatgtcgcggaccgcaaacctacccag 1313 Query: 313 aggagggtactgggcaaaggtctccaccaccatgggcttggttggaatcatcttgacgaa 372 ||||| |||| || || |||||||||||||||||||| || || | |||||| ||||| Sbjct: 1312 tggaggatactcggagaaagtctccaccaccatgggcttcgtggggaccatcttcacgaa 1253 Query: 373 cccagcatcaccattcttgagaaacttgggcgctgcctccagctccttgccggaccgcct 432 || || ||||| |||||||||||||| ||| | | | ||||||||||| ||||||| Sbjct: 1252 accggcgtcaccgttcttgagaaactttggctcctctcctagctccttgcccgaccgccg 1193 Query: 433 gtcgatcttggtctggatctcggcgaacttgacggcnatgtgggatgtgtggcagtccag 492 ||| |||||||| || ||| || ||||| ||||| |||||||| |||||||||||||| Sbjct: 1192 gtcaatcttggtaatgagctcagcaaacttcacggcgatgtgggacgtgtggcagtccag 1133 Query: 493 cacangggcataaccgttgctgatctggccagggtggttcatgatgatgacctgggcagt 552 |||| |||| || ||||||| |||||| || ||||||||||||||||| ||||||| ||| Sbjct: 1132 cacaggggcgtagccgttgccgatctgccccgggtggttcatgatgatcacctgggaagt 1073 Query: 553 gaag 556 |||| Sbjct: 1072 gaag 1069
>dbj|D45408.1|MZEEF1A Zea mays elongation factor 1alpha gene, complete cds Length = 3062 Score = 262 bits (132), Expect = 1e-66 Identities = 299/356 (83%) Strand = Plus / Minus Query: 193 tcatttcttcttgatcgcagccttggtaaccttggcgccggtcggctccttcttctcnac 252 ||||||||||||| |||||||| || |||||||| || || || ||||||||||| || Sbjct: 2710 tcatttcttcttggcagcagccttcgtcaccttggctccagttgggtccttcttctccac 2651 Query: 253 gctcttgatcacacccacagcaaccgtctgcctnatgtcacgcacggcaaaccgacccag 312 |||||||| || || ||||| ||||| ||||| |||||||| || ||||| ||||| || Sbjct: 2650 actcttgatgactccgacagccaccgtttgcctcatgtcacggacagcaaatcgaccaag 2591 Query: 313 aggagggtactgggcaaaggtctccaccaccatgggcttggttggaatcatcttgacgaa 372 |||||| ||||| | |||||||||||||||||||||||| || |||| |||||| || | Sbjct: 2590 aggaggatactgagaaaaggtctccaccaccatgggcttagtgggaaccatcttcaccat 2531 Query: 373 cccagcatcaccattcttgagaaacttgggcgctgcctccagctccttgccggaccgcct 432 ||||||||||| ||||||||||| |||||| | |||||||||||||||||| ||||| Sbjct: 2530 accagcatcaccgttcttgagaaatttgggctccttctccagctccttgccggatcgcct 2471 Query: 433 gtcgatcttggtctggatctcggcgaacttgacggcnatgtgggatgtgtggcagtccag 492 || |||||||| || ||| || |||||||| || ||||| || |||||||||||||| Sbjct: 2470 atcaatcttggtaacgagctcagcaaacttgacagcaatgtgtgaggtgtggcagtccag 2411 Query: 493 cacangggcataaccgttgctgatctggccagggtggttcatgatgatgacctggg 548 || ||||||| || |||| |||||||||||||||||||||||||||||||||| Sbjct: 2410 aactggggcatagccattgccaatctggccagggtggttcatgatgatgacctggg 2355
>gb|U76259.1|ZMU76259 Zea mays elongation factor 1-alpha (EF1-A) mRNA, complete cds Length = 1692 Score = 262 bits (132), Expect = 1e-66 Identities = 299/356 (83%) Strand = Plus / Minus Query: 193 tcatttcttcttgatcgcagccttggtaaccttggcgccggtcggctccttcttctcnac 252 ||||||||||||| |||||||| || |||||||| || || || ||||||||||| || Sbjct: 1477 tcatttcttcttggcagcagccttcgtcaccttggctccagttgggtccttcttctccac 1418 Query: 253 gctcttgatcacacccacagcaaccgtctgcctnatgtcacgcacggcaaaccgacccag 312 |||||||| || || ||||| ||||| ||||| |||||||| || ||||| ||||| || Sbjct: 1417 actcttgatgactccgacagccaccgtttgcctcatgtcacggacagcaaatcgaccaag 1358 Query: 313 aggagggtactgggcaaaggtctccaccaccatgggcttggttggaatcatcttgacgaa 372 |||||| ||||| | |||||||||||||||||||||||| || |||| |||||| || | Sbjct: 1357 aggaggatactgagaaaaggtctccaccaccatgggcttagtgggaaccatcttcaccat 1298 Query: 373 cccagcatcaccattcttgagaaacttgggcgctgcctccagctccttgccggaccgcct 432 ||||||||||| ||||||||||| |||||| | |||||||||||||||||| ||||| Sbjct: 1297 accagcatcaccgttcttgagaaatttgggctccttctccagctccttgccggatcgcct 1238 Query: 433 gtcgatcttggtctggatctcggcgaacttgacggcnatgtgggatgtgtggcagtccag 492 || |||||||| || ||| || |||||||| || ||||| || |||||||||||||| Sbjct: 1237 atcaatcttggtaacgagctcagcaaacttgacagcaatgtgtgaggtgtggcagtccag 1178 Query: 493 cacangggcataaccgttgctgatctggccagggtggttcatgatgatgacctggg 548 || ||||||| || |||| |||||||||||||||||||||||||||||||||| Sbjct: 1177 aactggggcatagccattgccaatctggccagggtggttcatgatgatgacctggg 1122
>dbj|D45407.1|MZEEF1AA Corn mRNA for elongation factor 1A Length = 1519 Score = 262 bits (132), Expect = 1e-66 Identities = 299/356 (83%) Strand = Plus / Minus Query: 193 tcatttcttcttgatcgcagccttggtaaccttggcgccggtcggctccttcttctcnac 252 ||||||||||||| |||||||| || |||||||| || || || ||||||||||| || Sbjct: 1328 tcatttcttcttggcagcagccttcgtcaccttggctccagttgggtccttcttctccac 1269 Query: 253 gctcttgatcacacccacagcaaccgtctgcctnatgtcacgcacggcaaaccgacccag 312 |||||||| || || ||||| ||||| ||||| |||||||| || ||||| ||||| || Sbjct: 1268 actcttgatgactccgacagccaccgtttgcctcatgtcacggacagcaaatcgaccaag 1209 Query: 313 aggagggtactgggcaaaggtctccaccaccatgggcttggttggaatcatcttgacgaa 372 |||||| ||||| | |||||||||||||||||||||||| || |||| |||||| || | Sbjct: 1208 aggaggatactgagaaaaggtctccaccaccatgggcttagtgggaaccatcttcaccat 1149 Query: 373 cccagcatcaccattcttgagaaacttgggcgctgcctccagctccttgccggaccgcct 432 ||||||||||| ||||||||||| |||||| | |||||||||||||||||| ||||| Sbjct: 1148 accagcatcaccgttcttgagaaatttgggctccttctccagctccttgccggatcgcct 1089 Query: 433 gtcgatcttggtctggatctcggcgaacttgacggcnatgtgggatgtgtggcagtccag 492 || |||||||| || ||| || |||||||| || ||||| || |||||||||||||| Sbjct: 1088 atcaatcttggtaacgagctcagcaaacttgacagcaatgtgtgaggtgtggcagtccag 1029 Query: 493 cacangggcataaccgttgctgatctggccagggtggttcatgatgatgacctggg 548 || ||||||| || |||| |||||||||||||||||||||||||||||||||| Sbjct: 1028 aactggggcatagccattgccaatctggccagggtggttcatgatgatgacctggg 973
>gb|AF281361.1| Saccharum officinarum elongation factor mRNA, complete cds Length = 1745 Score = 260 bits (131), Expect = 4e-66 Identities = 292/347 (84%) Strand = Plus / Minus Query: 193 tcatttcttcttgatcgcagccttggtaaccttggcgccggtcggctccttcttctcnac 252 ||||||||||||| ||||||||||| ||||||||||||||||| ||||||||||| || Sbjct: 1447 tcatttcttcttggcagcagccttggtcaccttggcgccggtcgggtccttcttctccac 1388 Query: 253 gctcttgatcacacccacagcaaccgtctgcctnatgtcacgcacggcaaaccgacccag 312 |||||||| | || ||||||||||| ||||| ||||| || || ||||||| ||| || Sbjct: 1387 actcttgatgattccaacagcaaccgtttgcctcatgtcgcggacagcaaacctaccaag 1328 Query: 313 aggagggtactgggcaaaggtctccaccaccatgggcttggttggaatcatcttgacgaa 372 ||||| |||| || || |||||||||||||| |||||||| ||||||||||| || | Sbjct: 1327 gggaggatactcggagaatgtctccaccaccatcggcttggtgggaatcatcttcaccat 1268 Query: 373 cccagcatcaccattcttgagaaacttgggcgctgcctccagctccttgccggaccgcct 432 ||||||||||| ||||| || ||||||| | | ||| ||||||||||| |||||||| Sbjct: 1267 accagcatcaccgttcttcaggaacttggcctccttctcaagctccttgccagaccgcct 1208 Query: 433 gtcgatcttggtctggatctcggcgaacttgacggcnatgtgggatgtgtggcagtccag 492 |||||||||||| || ||| || |||||||| || |||||||| |||||||||||||| Sbjct: 1207 gtcgatcttggtaatgagctcagcaaacttgacagcgatgtgggaggtgtggcagtccag 1148 Query: 493 cacangggcataaccgttgctgatctggccagggtggttcatgatga 539 ||| | ||||| ||||||| |||||| ||||||||||||||||||| Sbjct: 1147 cactggagcatagccgttgccgatctgcccagggtggttcatgatga 1101
>gb|AF136828.1|AF136828 Zea mays clone f elongation factor 1 alpha mRNA, complete cds Length = 1596 Score = 256 bits (129), Expect = 7e-65 Identities = 284/337 (84%) Strand = Plus / Minus Query: 212 gccttggtaaccttggcgccggtcggctccttcttctcnacgctcttgatcacacccaca 271 |||||||||||||||||||||||||| ||||||||||| || |||||||| || || ||| Sbjct: 1394 gccttggtaaccttggcgccggtcgggtccttcttctccacactcttgatgactccaaca 1335 Query: 272 gcaaccgtctgcctnatgtcacgcacggcaaaccgacccagaggagggtactgggcaaag 331 |||||||||||||| ||||| || ||||| |||| |||||| ||||| ||| || || Sbjct: 1334 gcaaccgtctgcctcatgtcgcggacggctaacctacccaggggaggatacgcggagaat 1275 Query: 332 gtctccaccaccatgggcttggttggaatcatcttgacgaacccagcatcaccattcttg 391 |||||||||||||| |||||||| || |||||||| || | ||||||||||| ||||| Sbjct: 1274 gtctccaccaccataggcttggtgggtatcatcttcaccataccagcatcaccgttcttc 1215 Query: 392 agaaacttgggcgctgcctccagctccttgccggaccgcctgtcgatcttggtctggatc 451 || ||||| ||| | || ||||||||||| || ||||||||||||||||| || | Sbjct: 1214 aggaactttggctccttttcaagctccttgccagagcgcctgtcgatcttggtaatgagc 1155 Query: 452 tcggcgaacttgacggcnatgtgggatgtgtggcagtccagcacangggcataaccgttg 511 || || |||||||| || |||||||| |||||||||||||||||| || |||| |||||| Sbjct: 1154 tcagcaaacttgacagcgatgtgggaggtgtggcagtccagcacagggccatagccgttg 1095 Query: 512 ctgatctggccagggtggttcatgatgatgacctggg 548 | ||||| ||||||||| |||||||||||||||||| Sbjct: 1094 ccaatctgcccagggtgggtcatgatgatgacctggg 1058
>dbj|AK119647.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-130-G07, full insert sequence Length = 1660 Score = 256 bits (129), Expect = 7e-65 Identities = 299/357 (83%) Strand = Plus / Minus Query: 192 ctcatttcttcttgatcgcagccttggtaaccttggcgccggtcggctccttcttctcna 251 |||| ||||||||| ||||||||||| ||||||| ||||| || ||||||||||| | Sbjct: 1433 ctcacttcttcttggcggcagccttggtcaccttggtaccggttgggtccttcttctcca 1374 Query: 252 cgctcttgatcacacccacagcaaccgtctgcctnatgtcacgcacggcaaaccgaccca 311 || ||||||| || || ||||| ||||| ||||| ||||||||||| ||||| ||||| | Sbjct: 1373 cgttcttgatgacgccaacagccaccgtttgcctcatgtcacgcaccgcaaaacgaccaa 1314 Query: 312 gaggagggtactgggcaaaggtctccaccaccatgggcttggttggaatcatcttgacga 371 |||||||||||| | ||||||||||| |||||||||||||| |||||||||||||| | Sbjct: 1313 gaggagggtactcagagaaggtctccacaaccatgggcttggtaggaatcatcttgacca 1254 Query: 372 acccagcatcaccattcttgagaaacttgggcgctgcctccagctccttgccggaccgcc 431 ||||||||||| ||||| | ||||||||| | ||||||||||||||| || || | Sbjct: 1253 taccagcatcaccgttcttcaagaacttgggctccttctccagctccttgccagatcgtc 1194 Query: 432 tgtcgatcttggtctggatctcggcgaacttgacggcnatgtgggatgtgtggcagtcca 491 |||| ||||||||| | ||| || |||||||| || |||||||| ||||||||||||| Sbjct: 1193 tgtcaatcttggtcaccagctcagcaaacttgacagcaatgtgggaggtgtggcagtcca 1134 Query: 492 gcacangggcataaccgttgctgatctggccagggtggttcatgatgatgacctggg 548 |||| | ||||| ||||| | |||||| |||||||||||||||||||| ||||||| Sbjct: 1133 gcactggagcatagccgttaccgatctgcccagggtggttcatgatgatcacctggg 1077
>gb|BT016906.1| Zea mays clone Contig739 mRNA sequence Length = 687 Score = 254 bits (128), Expect = 3e-64 Identities = 304/364 (83%) Strand = Plus / Plus Query: 193 tcatttcttcttgatcgcagccttggtaaccttggcgccggtcggctccttcttctcnac 252 ||||||||||||| || |||||||| |||||||| || || || ||||||||||| || Sbjct: 196 tcatttcttcttggcagccgccttggtcaccttggctcccgttgggtccttcttctccac 255 Query: 253 gctcttgatcacacccacagcaaccgtctgcctnatgtcacgcacggcaaaccgacccag 312 |||||| ||||| || || |||||||||||||| ||||| || || || || || ||||| Sbjct: 256 gctctttatcacgccgactgcaaccgtctgcctcatgtcgcgaaccgcgaagcgccccag 315 Query: 313 aggagggtactgggcaaaggtctccaccaccatgggcttggttggaatcatcttgacgaa 372 ||||| |||| || || |||||||||||||||||||| || || |||||||||||||| Sbjct: 316 tggaggatactcggagaaagtctccaccaccatgggcttcgtggggatcatcttgacgaa 375 Query: 373 cccagcatcaccattcttgagaaacttgggcgctgcctccagctccttgccggaccgcct 432 || || ||||| ||||||||||||||||| || ||||||||||||||| ||||||| Sbjct: 376 gccggcgtcaccgttcttgagaaacttgggggcgctctccagctccttgcccgaccgccg 435 Query: 433 gtcgatcttggtctggatctcggcgaacttgacggcnatgtgggatgtgtggcagtccag 492 ||| |||||||| | | ||| | |||||| ||||| |||||||| |||||||||||||| Sbjct: 436 gtcaatcttggtgagcagctccgagaacttcacggcgatgtgggacgtgtggcagtccag 495 Query: 493 cacangggcataaccgttgctgatctggccagggtggttcatgatgatgacctgggcagt 552 ||| |||| || ||||||| |||||| || ||||||||||||||||| ||||| || || Sbjct: 496 caccggggcgtagccgttgccgatctgccccgggtggttcatgatgatcacctgcgcggt 555 Query: 553 gaag 556 |||| Sbjct: 556 gaag 559
>dbj|D12709.1|DARELF1A Daucus carota mRNA for elongation factor 1-alpha, complete cds Length = 1700 Score = 248 bits (125), Expect = 2e-62 Identities = 307/367 (83%), Gaps = 4/367 (1%) Strand = Plus / Minus Query: 193 tcatttcttcttgatcgcagccttggtaaccttggcgccggtcggctccttcttctcnac 252 ||||||||||||||| ||||||||||| |||||||| ||||| || ||||||||||| || Sbjct: 1377 tcatttcttcttgattgcagccttggtgaccttggctccggtaggatccttcttctccac 1318 Query: 253 gctcttgatcacacccacagcaaccgtctgcctnatgtcacgcacggcaaaccgacccag 312 |||||||| || ||||||||||| |||||||| |||||||| || ||||||| || || Sbjct: 1317 actcttgatgactcccacagcaacagtctgcctcatgtcacgaacagcaaaccttccaag 1258 Query: 313 aggagggtactgggca--aaggtctccaccaccatgggcttggttggaatcatcttgacg 370 |||||||| || || |||||||| ||||||||||||||||||||||||||||| ||| Sbjct: 1257 tggagggta--ggacatgaaggtctcgaccaccatgggcttggttggaatcatcttaacg 1200 Query: 371 aacccagcatcaccattcttgagaaacttgggcgctgcctccagctccttgccggaccgc 430 || ||||||||||||||||| | |||||||||| | ||| || ||||| || || || Sbjct: 1199 aaaccagcatcaccattcttcaaaaacttgggctccttctcaagttccttaccagatcga 1140 Query: 431 ctgtcgatcttggtctggatctcggcgaacttgacggcnatgtgggatgtgtggcagtcc 490 | || |||||||||||||| || || ||||| || || ||||| || |||||||| || Sbjct: 1139 cgatcaatcttggtctggatttcagcaaacttaacagcaatgtgagaagtgtggcaatca 1080 Query: 491 agcacangggcataaccgttgctgatctggccagggtggttcatgatgatgacctgggca 550 ||||| | |||||||| || | |||||| |||||||||||||||||||| || || ||| Sbjct: 1079 agcactggagcataaccattaccgatctgaccagggtggttcatgatgataacttgagca 1020 Query: 551 gtgaagt 557 ||||||| Sbjct: 1019 gtgaagt 1013
>gb|AF136825.1|AF136825 Zea mays clone c elongation factor 1 alpha mRNA, complete cds Length = 1609 Score = 246 bits (124), Expect = 7e-62 Identities = 297/356 (83%) Strand = Plus / Minus Query: 193 tcatttcttcttgatcgcagccttggtaaccttggcgccggtcggctccttcttctcnac 252 ||||||||||||| |||||||| || |||||||| || || || ||||||||||| || Sbjct: 1420 tcatttcttcttggcagcagccttcgtcaccttggctccagttgggtccttcttctccac 1361 Query: 253 gctcttgatcacacccacagcaaccgtctgcctnatgtcacgcacggcaaaccgacccag 312 |||||||| || || ||||| ||||| ||||| |||||||| |||||||||| |||||| Sbjct: 1360 actcttgatgactccgacagccaccgtttgcctcatgtcacggacggcaaacctacccag 1301 Query: 313 aggagggtactgggcaaaggtctccaccaccatgggcttggttggaatcatcttgacgaa 372 |||||| ||| || || |||||||||||||| ||||||||||| |||||||| || | Sbjct: 1300 aggaggatacgcggagaatgtctccaccaccataggcttggttggtatcatcttcaccat 1241 Query: 373 cccagcatcaccattcttgagaaacttgggcgctgcctccagctccttgccggaccgcct 432 ||||||||||| | ||| || ||||| ||| | ||| ||||| ||||| || ||||| Sbjct: 1240 accagcatcaccgtacttcaggaactttggctccttctcaagctctttgccagagcgcct 1181 Query: 433 gtcgatcttggtctggatctcggcgaacttgacggcnatgtgggatgtgtggcagtccag 492 |||||||||||| || ||| || |||||||| || |||||||| |||||||||||||| Sbjct: 1180 gtcgatcttggtaatgagctcagcaaacttgacagcgatgtgggaggtgtggcagtccag 1121 Query: 493 cacangggcataaccgttgctgatctggccagggtggttcatgatgatgacctggg 548 |||| ||||||| ||||||| ||||| ||||||||||||||||||||||| |||| Sbjct: 1120 cacaggggcatagccgttgccaatctgcccagggtggttcatgatgatgacttggg 1065
>gb|BT018898.1| Zea mays clone EL01T0207D05.d mRNA sequence Length = 1483 Score = 244 bits (123), Expect = 3e-61 Identities = 286/339 (84%), Gaps = 2/339 (0%) Strand = Plus / Minus Query: 212 gccttggtaaccttggcgccggtcggctccttcttctcnac-gctc-ttgatcacaccca 269 |||||||||||||||||||||||||| |||||||||| || | || ||||| || || | Sbjct: 1366 gccttggtaaccttggcgccggtcggggccttcttctccacaggtcattgatgactccaa 1307 Query: 270 cagcaaccgtctgcctnatgtcacgcacggcaaaccgacccagaggagggtactgggcaa 329 ||||||| |||||||| ||||| || || ||||||| ||| || ||||| ||||| | | Sbjct: 1306 cagcaactgtctgcctcatgtcgcggacagcaaacctaccaaggggaggatactgcgaga 1247 Query: 330 aggtctccaccaccatgggcttggttggaatcatcttgacgaacccagcatcaccattct 389 | ||||||||||||||||||||||| ||||||||||| || | ||||||||||| |||| Sbjct: 1246 atgtctccaccaccatgggcttggtgggaatcatcttcaccataccagcatcaccgttct 1187 Query: 390 tgagaaacttgggcgctgcctccagctccttgccggaccgcctgtcgatcttggtctgga 449 | || ||||||||| | ||| ||||||||||| |||||||||||||||||||| || Sbjct: 1186 tcaggaacttgggctccttctcaagctccttgccagaccgcctgtcgatcttggtaatga 1127 Query: 450 tctcggcgaacttgacggcnatgtgggatgtgtggcagtccagcacangggcataaccgt 509 || || |||||||| || |||||||| ||||||||||||||||| ||||||| || | Sbjct: 1126 gttcagcaaacttgacagcaatgtgggaggtgtggcagtccagcactggggcatagccat 1067 Query: 510 tgctgatctggccagggtggttcatgatgatgacctggg 548 ||| ||||| |||||||||||||||||||||||||||| Sbjct: 1066 tgcctatctgcccagggtggttcatgatgatgacctggg 1028
>gb|BT016242.1| Zea mays clone Contig75 mRNA sequence Length = 1421 Score = 242 bits (122), Expect = 1e-60 Identities = 283/338 (83%) Strand = Plus / Minus Query: 211 agccttggtaaccttggcgccggtcggctccttcttctcnacgctcttgatcacacccac 270 ||||||||| |||||||| || || || ||||||||||| || |||||||| || || || Sbjct: 1179 agccttggtcaccttggctccagttgggtccttcttctccacactcttgatgactccgac 1120 Query: 271 agcaaccgtctgcctnatgtcacgcacggcaaaccgacccagaggagggtactgggcaaa 330 ||| ||||| ||||| |||||||| || ||||| ||||| |||||||| || | | ||| Sbjct: 1119 agccaccgtttgcctcatgtcacggacagcaaagcgaccaagaggaggatattcagaaaa 1060 Query: 331 ggtctccaccaccatgggcttggttggaatcatcttgacgaacccagcatcaccattctt 390 ||||||||| ||||||||||| || |||| |||||| || | ||||||||||||||||| Sbjct: 1059 ggtctccactaccatgggcttagtgggaaccatcttcaccataccagcatcaccattctt 1000 Query: 391 gagaaacttgggcgctgcctccagctccttgccggaccgcctgtcgatcttggtctggat 450 |||||| |||||| | ||| ||||||||||| |||||||| || |||||||| || Sbjct: 999 gagaaatttgggctccttctcaagctccttgccagaccgcctatcaatcttggtaatgag 940 Query: 451 ctcggcgaacttgacggcnatgtgggatgtgtggcagtccagcacangggcataaccgtt 510 ||| || |||||||| || ||||| || ||||||||||||||||| ||||||| ||||| Sbjct: 939 ctccgcaaacttgacagcaatgtgcgaggtgtggcagtccagcactggggcatagccgtt 880 Query: 511 gctgatctggccagggtggttcatgatgatgacctggg 548 || ||||| |||||||||||||||||||||||||||| Sbjct: 879 gccaatctgcccagggtggttcatgatgatgacctggg 842
>gb|DQ447160.1| Passiflora edulis translation elongation factor 1a-1 (EF1a1) mRNA, partial cds Length = 358 Score = 242 bits (122), Expect = 1e-60 Identities = 216/248 (87%) Strand = Plus / Minus Query: 299 gcaaaccgacccagaggagggtactgggcaaaggtctccaccaccatgggcttggttgga 358 ||||| ||||| ||||||||||||| || |||||||||||||||||||||||||| ||| Sbjct: 333 gcaaatcgaccaagaggagggtactcggagaaggtctccaccaccatgggcttggtagga 274 Query: 359 atcatcttgacgaacccagcatcaccattcttgagaaacttgggcgctgcctccagctcc 418 |||||||| ||||| ||||||||||| ||||| | || |||||| || |||||||||| Sbjct: 273 atcatcttcacgaatccagcatcaccgttcttcaagaatttgggctctttctccagctcc 214 Query: 419 ttgccggaccgcctgtcgatcttggtctggatctcggcgaacttgacggcnatgtgggat 478 ||||| ||||||||||||||||||||| ||| || | ||||||||||| ||||| ||| Sbjct: 213 ttgccagaccgcctgtcgatcttggtcaagatttcagaaaacttgacggcaatgtgtgat 154 Query: 479 gtgtggcagtccagcacangggcataaccgttgctgatctggccagggtggttcatgatg 538 ||||||||||| ||||| |||| || ||||||| |||||| |||||||||||||||||| Sbjct: 153 gtgtggcagtcgagcactggggcgtatccgttgccgatctgtccagggtggttcatgatg 94 Query: 539 atgacctg 546 |||||||| Sbjct: 93 atgacctg 86
>gb|AF121261.1|AF121261 Lilium longiflorum elongation factor 1-alpha 1 (EF-1-alpha1) mRNA, complete cds Length = 1700 Score = 242 bits (122), Expect = 1e-60 Identities = 304/366 (83%) Strand = Plus / Minus Query: 192 ctcatttcttcttgatcgcagccttggtaaccttggcgccggtcggctccttcttctcna 251 |||| ||||||||||| ||||||||||| |||||||| || || || ||||||||||| | Sbjct: 1420 ctcacttcttcttgatagcagccttggtcaccttggcaccagtgggatccttcttctcaa 1361 Query: 252 cgctcttgatcacacccacagcaaccgtctgcctnatgtcacgcacggcaaaccgaccca 311 | ||||| || || || |||||||| ||||| | ||||| | || ||||| || || | Sbjct: 1360 cactcttaataaccccaacagcaacagtctggcgcatgtccctaacagcaaaacgcccaa 1301 Query: 312 gaggagggtactgggcaaaggtctccaccaccatgggcttggttggaatcatcttgacga 371 ||||||| |||| | || |||||||||||||| |||||||| ||||||||||| |||| Sbjct: 1300 gaggaggatactcagagaatgtctccaccaccataggcttggtcggaatcatcttcacga 1241 Query: 372 acccagcatcaccattcttgagaaacttgggcgctgcctccagctccttgccggaccgcc 431 | ||||||||||||||||| | |||||| ||| | ||| | ||||| || || |||| Sbjct: 1240 aaccagcatcaccattcttcaaaaacttaggctccttctcaatttccttaccagagcgcc 1181 Query: 432 tgtcgatcttggtctggatctcggcgaacttgacggcnatgtgggatgtgtggcagtcca 491 |||||||||||||| ||||||| || |||||||| || |||||||| |||||||| |||| Sbjct: 1180 tgtcgatcttggtcaggatctcagcaaacttgacagcaatgtgggaggtgtggcaatcca 1121 Query: 492 gcacangggcataaccgttgctgatctggccagggtggttcatgatgatgacctgggcag 551 | ||| | |||||||| || | ||||||||||||||||||||||||||| ||||||| || Sbjct: 1120 ggacaggagcataaccattaccgatctggccagggtggttcatgatgataacctgggaag 1061 Query: 552 tgaagt 557 |||||| Sbjct: 1060 tgaagt 1055
>gb|AF331850.1| Saccharum hybrid cultivar CP72-2086 elongation factor 1 alpha (SEF1a) mRNA, partial cds Length = 1578 Score = 232 bits (117), Expect = 1e-57 Identities = 296/357 (82%) Strand = Plus / Minus Query: 192 ctcatttcttcttgatcgcagccttggtaaccttggcgccggtcggctccttcttctcna 251 |||||||||||||| ||||||||||| |||||||| || || || ||||||||||| | Sbjct: 1327 ctcatttcttcttggcggcagccttggtcaccttggctccagttgggtccttcttctcca 1268 Query: 252 cgctcttgatcacacccacagcaaccgtctgcctnatgtcacgcacggcaaaccgaccca 311 | |||||||| || || ||||| ||||| ||||| ||||| ||||| ||||| ||||| | Sbjct: 1267 cactcttgatgactccaacagccaccgtttgcctcatgtcccgcacagcaaagcgaccaa 1208 Query: 312 gaggagggtactgggcaaaggtctccaccaccatgggcttggttggaatcatcttgacga 371 ||||||| || | | ||||||||||||||||||||||| || |||| |||||| || | Sbjct: 1207 gaggaggatattcagagaaggtctccaccaccatgggcttagtgggaaccatcttcacca 1148 Query: 372 acccagcatcaccattcttgagaaacttgggcgctgcctccagctccttgccggaccgcc 431 ||||||||||| |||||||| || |||||| | ||| ||||||||||| ||||||| Sbjct: 1147 taccagcatcaccgttcttgaggaatttgggctccttctcaagctccttgccagaccgcc 1088 Query: 432 tgtcgatcttggtctggatctcggcgaacttgacggcnatgtgggatgtgtggcagtcca 491 | || |||||||| | ||| || |||||||| || ||||| || ||||||||||||| Sbjct: 1087 tatcaatcttggtaacaagctcagcaaacttgacagcaatgtgtgaggtgtggcagtcca 1028 Query: 492 gcacangggcataaccgttgctgatctggccagggtggttcatgatgatgacctggg 548 |||| |||| || ||||||| |||||| |||||||||||||||||||||||||||| Sbjct: 1027 gcactggggcgtagccgttgccgatctgcccagggtggttcatgatgatgacctggg 971
>gb|AF331849.1| Saccharum hybrid cultivar CP65-357 elongation factor 1 alpha (SEF1a) gene, complete cds Length = 4537 Score = 232 bits (117), Expect = 1e-57 Identities = 296/357 (82%) Strand = Plus / Minus Query: 192 ctcatttcttcttgatcgcagccttggtaaccttggcgccggtcggctccttcttctcna 251 |||||||||||||| ||||||||||| |||||||| || || || ||||||||||| | Sbjct: 4090 ctcatttcttcttggcggcagccttggtcaccttggctccagttgggtccttcttctcca 4031 Query: 252 cgctcttgatcacacccacagcaaccgtctgcctnatgtcacgcacggcaaaccgaccca 311 | |||||||| || || ||||| ||||| ||||| ||||| ||||| ||||| ||||| | Sbjct: 4030 cactcttgatgactccgacagccaccgtttgcctcatgtcccgcacagcaaagcgaccaa 3971 Query: 312 gaggagggtactgggcaaaggtctccaccaccatgggcttggttggaatcatcttgacga 371 ||||||| || | | ||||||||||||||||||||||| || |||| |||||| || | Sbjct: 3970 gaggaggatattcagagaaggtctccaccaccatgggctttgtgggaaccatcttcacca 3911 Query: 372 acccagcatcaccattcttgagaaacttgggcgctgcctccagctccttgccggaccgcc 431 ||||||||||| |||||||| || |||||| | ||| ||||||||||| ||||||| Sbjct: 3910 taccagcatcaccgttcttgaggaatttgggctccttctcaagctccttgccagaccgcc 3851 Query: 432 tgtcgatcttggtctggatctcggcgaacttgacggcnatgtgggatgtgtggcagtcca 491 | || |||||||| | ||| || |||||||| || ||||| || ||||||||||||| Sbjct: 3850 tatcaatcttggttacaagctcagcaaacttgacagcaatgtgtgaggtgtggcagtcca 3791 Query: 492 gcacangggcataaccgttgctgatctggccagggtggttcatgatgatgacctggg 548 |||| |||| || ||||||| |||||| |||||||||||||||||||||||||||| Sbjct: 3790 gcactggggcgtagccgttgccgatctgcccagggtggttcatgatgatgacctggg 3734
>gb|DQ407753.1| Gymnadenia conopsea EF-1 alpha mRNA, complete cds Length = 1682 Score = 230 bits (116), Expect = 4e-57 Identities = 286/344 (83%) Strand = Plus / Minus Query: 214 cttggtaaccttggcgccggtcggctccttcttctcnacgctcttgatcacacccacagc 273 |||||| |||||||||||| | |||||||||||||| || |||||||| || || || || Sbjct: 1381 cttggtgaccttggcgccgctgggctccttcttctccacactcttgataacgccgacggc 1322 Query: 274 aaccgtctgcctnatgtcacgcacggcaaaccgacccagaggagggtactgggcaaaggt 333 ||||||||||| ||||| | |||||| || || || || ||||| |||| || ||||| Sbjct: 1321 caccgtctgcctcatgtccctcacggcgaagcggccgagcggaggatactcggagaaggt 1262 Query: 334 ctccaccaccatgggcttggttggaatcatcttgacgaacccagcatcaccattcttgag 393 ||||||||||||||||| | ||||||||||| ||||| || || || || ||||| || Sbjct: 1261 ttccaccaccatgggcttcgacggaatcatcttcacgaaacctgcgtcgccgttcttcag 1202 Query: 394 aaacttgggcgctgcctccagctccttgccggaccgcctgtcgatcttggtctggatctc 453 ||||||||| | ||| ||||||||||| ||||||| |||||||||||| ||||||| Sbjct: 1201 gaacttgggctccttctcgagctccttgccagaccgccggtcgatcttggtgaggatctc 1142 Query: 454 ggcgaacttgacggcnatgtgggatgtgtggcagtccagcacangggcataaccgttgct 513 ||||||||||| || ||||| || ||||||||||| ||||| | || || ||||||| Sbjct: 1141 agcgaacttgacagcgatgtgcgaggtgtggcagtcgagcaccggcgcgtagccgttgcc 1082 Query: 514 gatctggccagggtggttcatgatgatgacctgggcagtgaagt 557 |||||| || ||||||||||||||||||||||||| |||||||| Sbjct: 1081 gatctgcccggggtggttcatgatgatgacctgggaagtgaagt 1038
>gb|AF136829.1|AF136829 Zea mays clone g elongation factor 1 alpha mRNA, complete cds Length = 1592 Score = 230 bits (116), Expect = 4e-57 Identities = 295/356 (82%) Strand = Plus / Minus Query: 193 tcatttcttcttgatcgcagccttggtaaccttggcgccggtcggctccttcttctcnac 252 ||||||||||||| || |||||||| ||||||||||||||||| ||||||||||| || Sbjct: 1444 tcatttcttcttggcggccgccttggtcaccttggcgccggtcgggtccttcttctccac 1385 Query: 253 gctcttgatcacacccacagcaaccgtctgcctnatgtcacgcacggcaaaccgacccag 312 |||||||| || || |||||||| |||||||| ||||| || || ||||||| ||| || Sbjct: 1384 actcttgatgactccaacagcaactgtctgcctcatgtcgcggacagcaaacctaccaag 1325 Query: 313 aggagggtactgggcaaaggtctccaccaccatgggcttggttggaatcatcttgacgaa 372 ||||| || || || |||||||||||||| |||||||| || |||||||| || | Sbjct: 1324 gggaggaaacgcggagaatgtctccaccaccataggcttggtgggtatcatcttcaccat 1265 Query: 373 cccagcatcaccattcttgagaaacttgggcgctgcctccagctccttgccggaccgcct 432 ||||||||||| | ||| || ||||| ||| | ||| ||||||||||| || ||||| Sbjct: 1264 accagcatcaccgtccttcaggaactttggctccttctcaagctccttgccagagcgcct 1205 Query: 433 gtcgatcttggtctggatctcggcgaacttgacggcnatgtgggatgtgtggcagtccag 492 |||||||||||| || ||| || |||||||| || |||||||| |||||||||||||| Sbjct: 1204 gtcgatcttggtaatgagctcagcaaacttgacagcgatgtgggaggtgtggcagtccag 1145 Query: 493 cacangggcataaccgttgctgatctggccagggtggttcatgatgatgacctggg 548 ||| ||||||| || |||| ||||| |||||||||||||||||||||||||||| Sbjct: 1144 cactggggcatagccattgcctatctgcccagggtggttcatgatgatgacctggg 1089
>gb|BT012707.1| Lycopersicon esculentum clone 113585F, mRNA sequence Length = 1768 Score = 220 bits (111), Expect = 4e-54 Identities = 287/347 (82%) Strand = Plus / Minus Query: 209 gcagccttggtaaccttggcgccggtcggctccttcttctcnacgctcttgatcacaccc 268 ||||||||||| |||||||| || || || |||||||| || || |||||| |||||| Sbjct: 1414 gcagccttggtgaccttggcaccagttgggtccttcttgtcaacattcttgacaacaccc 1355 Query: 269 acagcaaccgtctgcctnatgtcacgcacggcaaaccgacccagaggagggtactgggca 328 |||||||| |||||||| ||||| | ||| ||||| ||||||| || ||||| | |||| Sbjct: 1354 acagcaacagtctgcctcatgtccctcacagcaaaacgacccaatggtgggtattcggca 1295 Query: 329 aaggtctccaccaccatgggcttggttggaatcatcttgacgaacccagcatcaccattc 388 |||||||| || |||||||||||||| ||||||||||| || | ||||||||||||||| Sbjct: 1294 aaggtctcaacaaccatgggcttggtgggaatcatcttaaccataccagcatcaccattc 1235 Query: 389 ttgagaaacttgggcgctgcctccagctccttgccggaccgcctgtcgatcttggtctgg 448 || | ||||| ||| | ||| || ||||| || || |||||||| ||||||||| | Sbjct: 1234 ttcaagaacttaggctccttctcaagttccttacctgaacgcctgtcaatcttggtcaag 1175 Query: 449 atctcggcgaacttgacggcnatgtgggatgtgtggcagtccagcacangggcataaccg 508 ||||| || |||||||| || |||||||| ||||||||||| ||||| | ||||| || Sbjct: 1174 atctcagcaaacttgacagcaatgtgggaagtgtggcagtcaagcactggtgcatatcca 1115 Query: 509 ttgctgatctggccagggtggttcatgatgatgacctgggcagtgaa 555 || | ||||||||||| ||||||||||||||||||||||||||||| Sbjct: 1114 tttccaatctggccaggatggttcatgatgatgacctgggcagtgaa 1068
>dbj|AB073630.1| Suaeda japonica sjef-1A mRNA for eukaryotic elongation factor 1A, complete cds Length = 1857 Score = 220 bits (111), Expect = 4e-54 Identities = 299/363 (82%) Strand = Plus / Minus Query: 193 tcatttcttcttgatcgcagccttggtaaccttggcgccggtcggctccttcttctcnac 252 |||||||||||| || ||||||||||| |||||||| | || || |||||||| || || Sbjct: 1439 tcatttcttcttcatggcagccttggtgaccttggcactagttggttccttcttgtcaac 1380 Query: 253 gctcttgatcacacccacagcaaccgtctgcctnatgtcacgcacggcaaaccgacccag 312 |||||||| |||||||||||||| |||||||| ||||| | ||||||||| ||||| || Sbjct: 1379 actcttgatgacacccacagcaacagtctgcctcatgtccctcacggcaaaacgaccaag 1320 Query: 313 aggagggtactgggcaaaggtctccaccaccatgggcttggttggaatcatcttgacgaa 372 ||| | ||||| ||||| ||||||||||||||||||||||| ||||||||||| || | Sbjct: 1319 aggtgagtactctgcaaaagtctccaccaccatgggcttggtgggaatcatcttaaccat 1260 Query: 373 cccagcatcaccattcttgagaaacttgggcgctgcctccagctccttgccggaccgcct 432 ||||||||||||||||| | || |||||| | ||| |||||||| || || || || Sbjct: 1259 accagcatcaccattcttcaagaatttgggctccttctcgagctccttaccagatcgtct 1200 Query: 433 gtcgatcttggtctggatctcggcgaacttgacggcnatgtgggatgtgtggcagtccag 492 ||| |||||||| ||| || || || ||||| || ||||| || ||||| ||||| || Sbjct: 1199 gtcaatcttggtaaggagttcagcaaatttgacagcaatgtgagaggtgtgacagtcaag 1140 Query: 493 cacangggcataaccgttgctgatctggccagggtggttcatgatgatgacctgggcagt 552 |||| | |||||||| || | ||||| ||||||||||||||||| |||||||| ||||| Sbjct: 1139 cacaggtgcataaccatttccaatctgtccagggtggttcatgataatgacctgagcagt 1080 Query: 553 gaa 555 ||| Sbjct: 1079 gaa 1077
>ref|NM_100666.2| Arabidopsis thaliana calmodulin binding / translation elongation factor AT1G07920 mRNA, complete cds Length = 1782 Score = 212 bits (107), Expect = 9e-52 Identities = 295/359 (82%) Strand = Plus / Minus Query: 199 cttcttgatcgcagccttggtaaccttggcgccggtcggctccttcttctcnacgctctt 258 |||||||| |||||||||||||||||||| ||||| || |||||||| || || ||||| Sbjct: 1450 cttcttgacggcagccttggtaaccttggctccggttgggtccttcttgtcaacactctt 1391 Query: 259 gatcacacccacagcaaccgtctgcctnatgtcacgcacggcaaaccgacccagaggagg 318 ||| ||||| || ||||| |||||||| ||||| | ||| || || || || || || || Sbjct: 1390 gataacaccgactgcaacagtctgcctcatgtccctcacagcgaaacgtccaagtggtgg 1331 Query: 319 gtactgggcaaaggtctccaccaccatgggcttggttggaatcatcttgacgaacccagc 378 ||||| | ||||||||||| |||||||||||||||||| ||||||| || | ||||| Sbjct: 1330 gtactcagagaaggtctccacaaccatgggcttggttggagtcatcttcaccataccagc 1271 Query: 379 atcaccattcttgagaaacttgggcgctgcctccagctccttgccggaccgcctgtcgat 438 |||||||||||| | ||||||||| | ||| | |||||| || || |||||||| || Sbjct: 1270 atcaccattcttcaagaacttgggctccttctcaatctccttaccagaacgcctgtcaat 1211 Query: 439 cttggtctggatctcggcgaacttgacggcnatgtgggatgtgtggcagtccagcacang 498 ||||||| |||||| | ||||||||| || ||||| || |||||||| ||||| || | Sbjct: 1210 cttggtcaagatctcagagaacttgactgcaatgtgagaggtgtggcaatccaggactgg 1151 Query: 499 ggcataaccgttgctgatctggccagggtggttcatgatgatgacctgggcagtgaagt 557 ||| |||||||| | ||||| |||||||||||||||||||||||||||| ||||||| Sbjct: 1150 ggcgtaaccgttaccaatctgaccagggtggttcatgatgatgacctgggaggtgaagt 1092
>emb|X16431.1|ATEF1A23 A.thaliana A2 and A3 genes encoding elongation factor 1-alpha Length = 6022 Score = 212 bits (107), Expect = 9e-52 Identities = 295/359 (82%) Strand = Plus / Minus Query: 199 cttcttgatcgcagccttggtaaccttggcgccggtcggctccttcttctcnacgctctt 258 |||||||| |||||||||||||||||||| ||||| || |||||||| || || ||||| Sbjct: 1910 cttcttgacggcagccttggtaaccttggctccggttgggtccttcttgtcaacactctt 1851 Query: 259 gatcacacccacagcaaccgtctgcctnatgtcacgcacggcaaaccgacccagaggagg 318 ||| ||||| || ||||| |||||||| ||||| | ||| || || || || || || || Sbjct: 1850 gataacaccgactgcaacagtctgcctcatgtccctcacagcgaaacgtccaagtggtgg 1791 Query: 319 gtactgggcaaaggtctccaccaccatgggcttggttggaatcatcttgacgaacccagc 378 ||||| | ||||||||||| |||||||||||||||||| ||||||| || | ||||| Sbjct: 1790 gtactcagagaaggtctccacaaccatgggcttggttggagtcatcttcaccataccagc 1731 Query: 379 atcaccattcttgagaaacttgggcgctgcctccagctccttgccggaccgcctgtcgat 438 |||||||||||| | ||||||||| | ||| | |||||| || || |||||||| || Sbjct: 1730 atcaccattcttcaagaacttgggctccttctcaatctccttaccagaacgcctgtcaat 1671 Query: 439 cttggtctggatctcggcgaacttgacggcnatgtgggatgtgtggcagtccagcacang 498 ||||||| |||||| | ||||||||| || ||||| || |||||||| ||||| || | Sbjct: 1670 cttggtcaagatctcagagaacttgactgcaatgtgagaggtgtggcaatccaggactgg 1611 Query: 499 ggcataaccgttgctgatctggccagggtggttcatgatgatgacctgggcagtgaagt 557 ||| |||||||| | ||||| |||||||||||||||||||||||||||| ||||||| Sbjct: 1610 ggcgtaaccgttaccaatctgaccagggtggttcatgatgatgacctgggaggtgaagt 1552 Score = 184 bits (93), Expect = 2e-43 Identities = 284/349 (81%) Strand = Plus / Minus Query: 209 gcagccttggtaaccttggcgccggtcggctccttcttctcnacgctcttgatcacaccc 268 |||||||||||||||||||| ||||| || |||||||| || || |||||||| ||||| Sbjct: 5331 gcagccttggtaaccttggctccggttgggtccttcttgtcaacactcttgataacaccg 5272 Query: 269 acagcaaccgtctgcctnatgtcacgcacggcaaaccgacccagaggagggtactgggca 328 || ||||| |||||||| ||||| | || || || || || || || ||||||| | Sbjct: 5271 actgcaacagtctgcctcatgtccctaacagcgaaacgtccaagtggtgggtactcagag 5212 Query: 329 aaggtctccaccaccatgggcttggttggaatcatcttgacgaacccagcatcaccattc 388 ||||||||||| |||||||||||||||||| ||||||| || | ||||||||||||||| Sbjct: 5211 aaggtctccacaaccatgggcttggttggagtcatcttcaccataccagcatcaccattc 5152 Query: 389 ttgagaaacttgggcgctgcctccagctccttgccggaccgcctgtcgatcttggtctgg 448 || | || |||||| | ||| | |||||| || || |||||||| ||||||||| | Sbjct: 5151 ttcaagaatttgggctccttctcaatctccttaccagaacgcctgtcaatcttggtcaag 5092 Query: 449 atctcggcgaacttgacggcnatgtgggatgtgtggcagtccagcacangggcataaccg 508 ||||| | ||||||||| || ||||| || |||||||| |||| || |||| |||||| Sbjct: 5091 atctcagagaacttgactgcaatgtgagaggtgtggcaatccaagactggggcgtaaccg 5032 Query: 509 ttgctgatctggccagggtggttcatgatgatgacctgggcagtgaagt 557 || | ||||| |||||||||||||||||||||||||||| ||||||| Sbjct: 5031 ttaccaatctgaccagggtggttcatgatgatgacctgggaggtgaagt 4983
>gb|AY088358.1| Arabidopsis thaliana clone 6135 mRNA, complete sequence Length = 1687 Score = 212 bits (107), Expect = 9e-52 Identities = 295/359 (82%) Strand = Plus / Minus Query: 199 cttcttgatcgcagccttggtaaccttggcgccggtcggctccttcttctcnacgctctt 258 |||||||| |||||||||||||||||||| ||||| || |||||||| || || ||||| Sbjct: 1419 cttcttgacggcagccttggtaaccttggctccggttgggtccttcttgtcaacactctt 1360 Query: 259 gatcacacccacagcaaccgtctgcctnatgtcacgcacggcaaaccgacccagaggagg 318 ||| ||||| || ||||| |||||||| ||||| | ||| || || || || || || || Sbjct: 1359 gataacaccgactgcaacagtctgcctcatgtccctcacagcgaaacgtccaagtggtgg 1300 Query: 319 gtactgggcaaaggtctccaccaccatgggcttggttggaatcatcttgacgaacccagc 378 ||||| | ||||||||||| |||||||||||||||||| ||||||| || | ||||| Sbjct: 1299 gtactcagagaaggtctccacaaccatgggcttggttggagtcatcttcaccataccagc 1240 Query: 379 atcaccattcttgagaaacttgggcgctgcctccagctccttgccggaccgcctgtcgat 438 |||||||||||| | ||||||||| | ||| | |||||| || || |||||||| || Sbjct: 1239 atcaccattcttcaagaacttgggctccttctcaatctccttaccagaacgcctgtcaat 1180 Query: 439 cttggtctggatctcggcgaacttgacggcnatgtgggatgtgtggcagtccagcacang 498 ||||||| |||||| | ||||||||| || ||||| || |||||||| ||||| || | Sbjct: 1179 cttggtcaagatctcagagaacttgactgcaatgtgagaggtgtggcaatccaggactgg 1120 Query: 499 ggcataaccgttgctgatctggccagggtggttcatgatgatgacctgggcagtgaagt 557 ||| |||||||| | ||||| |||||||||||||||||||||||||||| ||||||| Sbjct: 1119 ggcgtaaccgttaccaatctgaccagggtggttcatgatgatgacctgggaggtgaagt 1061
>gb|BT002442.1| Arabidopsis thaliana elongation factor 1-alpha (At1g07940) mRNA, complete cds Length = 1704 Score = 212 bits (107), Expect = 9e-52 Identities = 295/359 (82%) Strand = Plus / Minus Query: 199 cttcttgatcgcagccttggtaaccttggcgccggtcggctccttcttctcnacgctctt 258 |||||||| |||||||||||||||||||| ||||| || |||||||| || || ||||| Sbjct: 1418 cttcttgacggcagccttggtaaccttggctccggttgggtccttcttgtcaacactctt 1359 Query: 259 gatcacacccacagcaaccgtctgcctnatgtcacgcacggcaaaccgacccagaggagg 318 ||| ||||| || ||||| |||||||| ||||| | ||| || || || || || || || Sbjct: 1358 gataacaccgactgcaacagtctgcctcatgtccctcacagcgaaacgtccaagtggtgg 1299 Query: 319 gtactgggcaaaggtctccaccaccatgggcttggttggaatcatcttgacgaacccagc 378 ||||| | ||||||||||| |||||||||||||||||| ||||||| || | ||||| Sbjct: 1298 gtactcagagaaggtctccacaaccatgggcttggttggagtcatcttcaccataccagc 1239 Query: 379 atcaccattcttgagaaacttgggcgctgcctccagctccttgccggaccgcctgtcgat 438 |||||||||||| | ||||||||| | ||| | |||||| || || |||||||| || Sbjct: 1238 atcaccattcttcaagaacttgggctccttctcaatctccttaccagaacgcctgtcaat 1179 Query: 439 cttggtctggatctcggcgaacttgacggcnatgtgggatgtgtggcagtccagcacang 498 ||||||| |||||| | ||||||||| || ||||| || |||||||| ||||| || | Sbjct: 1178 cttggtcaagatctcagagaacttgactgcaatgtgagaggtgtggcaatccaggactgg 1119 Query: 499 ggcataaccgttgctgatctggccagggtggttcatgatgatgacctgggcagtgaagt 557 ||| |||||||| | ||||| |||||||||||||||||||||||||||| ||||||| Sbjct: 1118 ggcgtaaccgttaccaatctgaccagggtggttcatgatgatgacctgggaggtgaagt 1060
>gb|BT002423.1| Arabidopsis thaliana elongation factor 1-alpha (At1g07920) mRNA, complete cds Length = 1664 Score = 212 bits (107), Expect = 9e-52 Identities = 295/359 (82%) Strand = Plus / Minus Query: 199 cttcttgatcgcagccttggtaaccttggcgccggtcggctccttcttctcnacgctctt 258 |||||||| |||||||||||||||||||| ||||| || |||||||| || || ||||| Sbjct: 1418 cttcttgacggcagccttggtaaccttggctccggttgggtccttcttgtcaacactctt 1359 Query: 259 gatcacacccacagcaaccgtctgcctnatgtcacgcacggcaaaccgacccagaggagg 318 ||| ||||| || ||||| |||||||| ||||| | ||| || || || || || || || Sbjct: 1358 gataacaccgactgcaacagtctgcctcatgtccctcacagcgaaacgtccaagtggtgg 1299 Query: 319 gtactgggcaaaggtctccaccaccatgggcttggttggaatcatcttgacgaacccagc 378 ||||| | ||||||||||| |||||||||||||||||| ||||||| || | ||||| Sbjct: 1298 gtactcagagaaggtctccacaaccatgggcttggttggagtcatcttcaccataccagc 1239 Query: 379 atcaccattcttgagaaacttgggcgctgcctccagctccttgccggaccgcctgtcgat 438 |||||||||||| | ||||||||| | ||| | |||||| || || |||||||| || Sbjct: 1238 atcaccattcttcaagaacttgggctccttctcaatctccttaccagaacgcctgtcaat 1179 Query: 439 cttggtctggatctcggcgaacttgacggcnatgtgggatgtgtggcagtccagcacang 498 ||||||| |||||| | ||||||||| || ||||| || |||||||| ||||| || | Sbjct: 1178 cttggtcaagatctcagagaacttgactgcaatgtgagaggtgtggcaatccaggactgg 1119 Query: 499 ggcataaccgttgctgatctggccagggtggttcatgatgatgacctgggcagtgaagt 557 ||| |||||||| | ||||| |||||||||||||||||||||||||||| ||||||| Sbjct: 1118 ggcgtaaccgttaccaatctgaccagggtggttcatgatgatgacctgggaggtgaagt 1060
>gb|AC026875.4|AC026875 Genomic sequence for Arabidopsis thaliana BAC T6D22 from chromosome I, complete sequence Length = 120965 Score = 212 bits (107), Expect = 9e-52 Identities = 295/359 (82%) Strand = Plus / Minus Query: 199 cttcttgatcgcagccttggtaaccttggcgccggtcggctccttcttctcnacgctctt 258 |||||||| |||||||||||||||||||| ||||| || |||||||| || || ||||| Sbjct: 12884 cttcttgacggcagccttggtaaccttggctccggttgggtccttcttgtcaacactctt 12825 Query: 259 gatcacacccacagcaaccgtctgcctnatgtcacgcacggcaaaccgacccagaggagg 318 ||| ||||| || ||||| |||||||| ||||| | ||| || || || || || || || Sbjct: 12824 gataacaccgactgcaacagtctgcctcatgtccctcacagcgaaacgtccaagtggtgg 12765 Query: 319 gtactgggcaaaggtctccaccaccatgggcttggttggaatcatcttgacgaacccagc 378 ||||| | ||||||||||| |||||||||||||||||| ||||||| || | ||||| Sbjct: 12764 gtactcagagaaggtctccacaaccatgggcttggttggagtcatcttcaccataccagc 12705 Query: 379 atcaccattcttgagaaacttgggcgctgcctccagctccttgccggaccgcctgtcgat 438 |||||||||||| | ||||||||| | ||| | |||||| || || |||||||| || Sbjct: 12704 atcaccattcttcaagaacttgggctccttctcaatctccttaccagaacgcctgtcaat 12645 Query: 439 cttggtctggatctcggcgaacttgacggcnatgtgggatgtgtggcagtccagcacang 498 ||||||| |||||| | ||||||||| || ||||| || |||||||| ||||| || | Sbjct: 12644 cttggtcaagatctcagagaacttgactgcaatgtgagaggtgtggcaatccaggactgg 12585 Query: 499 ggcataaccgttgctgatctggccagggtggttcatgatgatgacctgggcagtgaagt 557 ||| |||||||| | ||||| |||||||||||||||||||||||||||| ||||||| Sbjct: 12584 ggcgtaaccgttaccaatctgaccagggtggttcatgatgatgacctgggaggtgaagt 12526 Score = 188 bits (95), Expect = 1e-44 Identities = 292/359 (81%) Strand = Plus / Plus Query: 199 cttcttgatcgcagccttggtaaccttggcgccggtcggctccttcttctcnacgctctt 258 |||||||| |||||||||||||||||||| || || || |||||||| || || ||||| Sbjct: 19257 cttcttgactgcagccttggtaaccttggctccagttgggtccttcttgtcaacactctt 19316 Query: 259 gatcacacccacagcaaccgtctgcctnatgtcacgcacggcaaaccgacccagaggagg 318 ||| ||||| || ||||| |||||||| ||||| | ||| || || || || || || || Sbjct: 19317 gataacaccgactgcaacagtctgcctcatgtccctcacagcgaaacgtccaagtggtgg 19376 Query: 319 gtactgggcaaaggtctccaccaccatgggcttggttggaatcatcttgacgaacccagc 378 ||||| | ||||||||||| |||||||||||||||||| ||||||| || | ||||| Sbjct: 19377 gtactcagagaaggtctccacaaccatgggcttggttggagtcatcttcaccataccagc 19436 Query: 379 atcaccattcttgagaaacttgggcgctgcctccagctccttgccggaccgcctgtcgat 438 |||||||||||| | || || ||| | ||| | |||||| || || |||||||| || Sbjct: 19437 atcaccattcttcaagaatttaggctccttctcaatctccttaccagaacgcctgtcaat 19496 Query: 439 cttggtctggatctcggcgaacttgacggcnatgtgggatgtgtggcagtccagcacang 498 ||||||| |||||| | ||||||||| || ||||| || |||||||| ||||| || | Sbjct: 19497 cttggtcaagatctcagagaacttgactgcaatgtgagaggtgtggcaatccaggactgg 19556 Query: 499 ggcataaccgttgctgatctggccagggtggttcatgatgatgacctgggcagtgaagt 557 ||| |||||||| | ||||| |||||||||||||||||||||||||||| ||||||| Sbjct: 19557 ggcgtaaccgttaccaatctgaccagggtggttcatgatgatgacctgggaggtgaagt 19615 Score = 184 bits (93), Expect = 2e-43 Identities = 284/349 (81%) Strand = Plus / Minus Query: 209 gcagccttggtaaccttggcgccggtcggctccttcttctcnacgctcttgatcacaccc 268 |||||||||||||||||||| ||||| || |||||||| || || |||||||| ||||| Sbjct: 16331 gcagccttggtaaccttggctccggttgggtccttcttgtcaacactcttgataacaccg 16272 Query: 269 acagcaaccgtctgcctnatgtcacgcacggcaaaccgacccagaggagggtactgggca 328 || ||||| |||||||| ||||| | || || || || || || || ||||||| | Sbjct: 16271 actgcaacagtctgcctcatgtccctaacagcgaaacgtccaagtggtgggtactcagag 16212 Query: 329 aaggtctccaccaccatgggcttggttggaatcatcttgacgaacccagcatcaccattc 388 ||||||||||| |||||||||||||||||| ||||||| || | ||||||||||||||| Sbjct: 16211 aaggtctccacaaccatgggcttggttggagtcatcttcaccataccagcatcaccattc 16152 Query: 389 ttgagaaacttgggcgctgcctccagctccttgccggaccgcctgtcgatcttggtctgg 448 || | || |||||| | ||| | |||||| || || |||||||| ||||||||| | Sbjct: 16151 ttcaagaatttgggctccttctcaatctccttaccagaacgcctgtcaatcttggtcaag 16092 Query: 449 atctcggcgaacttgacggcnatgtgggatgtgtggcagtccagcacangggcataaccg 508 ||||| | ||||||||| || ||||| || |||||||| |||| || |||| |||||| Sbjct: 16091 atctcagagaacttgactgcaatgtgagaggtgtggcaatccaagactggggcgtaaccg 16032 Query: 509 ttgctgatctggccagggtggttcatgatgatgacctgggcagtgaagt 557 || | ||||| |||||||||||||||||||||||||||| ||||||| Sbjct: 16031 ttaccaatctgaccagggtggttcatgatgatgacctgggaggtgaagt 15983
>gb|U63815.1|ATU63815 Arabidopsis thaliana AT.I.24-1, AT.I.24-2, AT.I.24-3, AT.I.24-4, AT.I.24-5, AT.I.24-6, AT.I.24-9 and AT.I.24-14 genes, partial cds, AT.I.24-7, ascorbate peroxidase (ATHAPX1), EF-1alpha-A1, -A2 and -A3 (EF-1alpha) and AT.I.24-13 genes, complete cds Length = 63093 Score = 212 bits (107), Expect = 9e-52 Identities = 295/359 (82%) Strand = Plus / Plus Query: 199 cttcttgatcgcagccttggtaaccttggcgccggtcggctccttcttctcnacgctctt 258 |||||||| |||||||||||||||||||| ||||| || |||||||| || || ||||| Sbjct: 47828 cttcttgacggcagccttggtaaccttggctccggttgggtccttcttgtcaacactctt 47887 Query: 259 gatcacacccacagcaaccgtctgcctnatgtcacgcacggcaaaccgacccagaggagg 318 ||| ||||| || ||||| |||||||| ||||| | ||| || || || || || || || Sbjct: 47888 gataacaccgactgcaacagtctgcctcatgtccctcacagcgaaacgtccaagtggtgg 47947 Query: 319 gtactgggcaaaggtctccaccaccatgggcttggttggaatcatcttgacgaacccagc 378 ||||| | ||||||||||| |||||||||||||||||| ||||||| || | ||||| Sbjct: 47948 gtactcagagaaggtctccacaaccatgggcttggttggagtcatcttcaccataccagc 48007 Query: 379 atcaccattcttgagaaacttgggcgctgcctccagctccttgccggaccgcctgtcgat 438 |||||||||||| | ||||||||| | ||| | |||||| || || |||||||| || Sbjct: 48008 atcaccattcttcaagaacttgggctccttctcaatctccttaccagaacgcctgtcaat 48067 Query: 439 cttggtctggatctcggcgaacttgacggcnatgtgggatgtgtggcagtccagcacang 498 ||||||| |||||| | ||||||||| || ||||| || |||||||| ||||| || | Sbjct: 48068 cttggtcaagatctcagagaacttgactgcaatgtgagaggtgtggcaatccaggactgg 48127 Query: 499 ggcataaccgttgctgatctggccagggtggttcatgatgatgacctgggcagtgaagt 557 ||| |||||||| | ||||| |||||||||||||||||||||||||||| ||||||| Sbjct: 48128 ggcgtaaccgttaccaatctgaccagggtggttcatgatgatgacctgggaggtgaagt 48186 Score = 188 bits (95), Expect = 1e-44 Identities = 292/359 (81%) Strand = Plus / Minus Query: 199 cttcttgatcgcagccttggtaaccttggcgccggtcggctccttcttctcnacgctctt 258 |||||||| |||||||||||||||||||| || || || |||||||| || || ||||| Sbjct: 41467 cttcttgactgcagccttggtaaccttggctccagttgggtccttcttgtcaacactctt 41408 Query: 259 gatcacacccacagcaaccgtctgcctnatgtcacgcacggcaaaccgacccagaggagg 318 ||| ||||| || ||||| |||||||| ||||| | ||| || || || || || || || Sbjct: 41407 gataacaccgactgcaacagtctgcctcatgtccctcacagcgaaacgtccaagtggtgg 41348 Query: 319 gtactgggcaaaggtctccaccaccatgggcttggttggaatcatcttgacgaacccagc 378 ||||| | ||||||||||| |||||||||||||||||| ||||||| || | ||||| Sbjct: 41347 gtactcagagaaggtctccacaaccatgggcttggttggagtcatcttcaccataccagc 41288 Query: 379 atcaccattcttgagaaacttgggcgctgcctccagctccttgccggaccgcctgtcgat 438 |||||||||||| | || || ||| | ||| | |||||| || || |||||||| || Sbjct: 41287 atcaccattcttcaagaatttaggctccttctcaatctccttaccagaacgcctgtcaat 41228 Query: 439 cttggtctggatctcggcgaacttgacggcnatgtgggatgtgtggcagtccagcacang 498 ||||||| |||||| | ||||||||| || ||||| || |||||||| ||||| || | Sbjct: 41227 cttggtcaagatctcagagaacttgactgcaatgtgagaggtgtggcaatccaggactgg 41168 Query: 499 ggcataaccgttgctgatctggccagggtggttcatgatgatgacctgggcagtgaagt 557 ||| |||||||| | ||||| |||||||||||||||||||||||||||| ||||||| Sbjct: 41167 ggcgtaaccgttaccaatctgaccagggtggttcatgatgatgacctgggaggtgaagt 41109 Score = 184 bits (93), Expect = 2e-43 Identities = 284/349 (81%) Strand = Plus / Plus Query: 209 gcagccttggtaaccttggcgccggtcggctccttcttctcnacgctcttgatcacaccc 268 |||||||||||||||||||| ||||| || |||||||| || || |||||||| ||||| Sbjct: 44398 gcagccttggtaaccttggctccggttgggtccttcttgtcaacactcttgataacaccg 44457 Query: 269 acagcaaccgtctgcctnatgtcacgcacggcaaaccgacccagaggagggtactgggca 328 || ||||| |||||||| ||||| | || || || || || || || ||||||| | Sbjct: 44458 actgcaacagtctgcctcatgtccctaacagcgaaacgtccaagtggtgggtactcagag 44517 Query: 329 aaggtctccaccaccatgggcttggttggaatcatcttgacgaacccagcatcaccattc 388 ||||||||||| |||||||||||||||||| ||||||| || | ||||||||||||||| Sbjct: 44518 aaggtctccacaaccatgggcttggttggagtcatcttcaccataccagcatcaccattc 44577 Query: 389 ttgagaaacttgggcgctgcctccagctccttgccggaccgcctgtcgatcttggtctgg 448 || | || |||||| | ||| | |||||| || || |||||||| ||||||||| | Sbjct: 44578 ttcaagaatttgggctccttctcaatctccttaccagaacgcctgtcaatcttggtcaag 44637 Query: 449 atctcggcgaacttgacggcnatgtgggatgtgtggcagtccagcacangggcataaccg 508 ||||| | ||||||||| || ||||| || |||||||| |||| || |||| |||||| Sbjct: 44638 atctcagagaacttgactgcaatgtgagaggtgtggcaatccaagactggggcgtaaccg 44697 Query: 509 ttgctgatctggccagggtggttcatgatgatgacctgggcagtgaagt 557 || | ||||| |||||||||||||||||||||||||||| ||||||| Sbjct: 44698 ttaccaatctgaccagggtggttcatgatgatgacctgggaggtgaagt 44746
>dbj|AK221085.1| Arabidopsis thaliana mRNA for elongation factor 1-alpha, complete cds, clone: RAFL22-81-H15 Length = 630 Score = 210 bits (106), Expect = 4e-51 Identities = 288/350 (82%) Strand = Plus / Minus Query: 199 cttcttgatcgcagccttggtaaccttggcgccggtcggctccttcttctcnacgctctt 258 |||||||| |||||||||||||||||||| ||||| || |||||||| || || ||||| Sbjct: 358 cttcttgacggcagccttggtaaccttggctccggttgggtccttcttgtcaacactctt 299 Query: 259 gatcacacccacagcaaccgtctgcctnatgtcacgcacggcaaaccgacccagaggagg 318 ||| ||||| || ||||| |||||||| ||||| | ||| || || || || || || || Sbjct: 298 gataacaccgactgcaacagtctgcctcatgtccctcacagcgaaacgtccaagtggtgg 239 Query: 319 gtactgggcaaaggtctccaccaccatgggcttggttggaatcatcttgacgaacccagc 378 ||||| | ||||||||||| |||||||||||||||||| ||||||| || | ||||| Sbjct: 238 gtactcagagaaggtctccacaaccatgggcttggttggagtcatcttcaccataccagc 179 Query: 379 atcaccattcttgagaaacttgggcgctgcctccagctccttgccggaccgcctgtcgat 438 |||||||||||| | ||||||||| | ||| | |||||| || || |||||||| || Sbjct: 178 atcaccattcttcaagaacttgggctccttctcaatctccttaccagaacgcctgtcaat 119 Query: 439 cttggtctggatctcggcgaacttgacggcnatgtgggatgtgtggcagtccagcacang 498 ||||||| |||||| | ||||||||| || ||||| || |||||||| ||||| || | Sbjct: 118 cttggtcaagatctcagagaacttgactgcaatgtgagaggtgtggcaatccaggactgg 59 Query: 499 ggcataaccgttgctgatctggccagggtggttcatgatgatgacctggg 548 ||| |||||||| | ||||| |||||||||||||||||||||||||||| Sbjct: 58 ggcgtaaccgttaccaatctgaccagggtggttcatgatgatgacctggg 9
>gb|AY550990.1| Elaeis guineensis elongation factor 1-alpha 1 (EF1-a1) mRNA, complete cds Length = 1623 Score = 206 bits (104), Expect = 6e-50 Identities = 286/348 (82%) Strand = Plus / Minus Query: 209 gcagccttggtaaccttggcgccggtcggctccttcttctcnacgctcttgatcacaccc 268 |||| |||||| |||||||| || | || ||||||||||| || |||||||| || ||| Sbjct: 1401 gcagacttggtgaccttggcaccactagggtccttcttctcaacactcttgatgactccc 1342 Query: 269 acagcaaccgtctgcctnatgtcacgcacggcaaaccgacccagaggagggtactgggca 328 ||||| |||||||| || ||||| | || ||||| ||||| |||||||| ||||| | Sbjct: 1341 acagccaccgtctgtctcatgtctctgacagcaaaacgaccaagaggaggatactgagag 1282 Query: 329 aaggtctccaccaccatgggcttggttggaatcatcttgacgaacccagcatcaccattc 388 || ||||| |||||||| |||||||| ||||||||||| || || ||||||||||||||| Sbjct: 1281 aaagtctcaaccaccataggcttggtgggaatcatcttcacaaatccagcatcaccattc 1222 Query: 389 ttgagaaacttgggcgctgcctccagctccttgccggaccgcctgtcgatcttggtctgg 448 || || ||||| ||| | ||| ||||||||||| || |||||||| |||||||| || Sbjct: 1221 ttaaggaacttaggctccttctcaagctccttgccagatcgcctgtcaatcttggtgagg 1162 Query: 449 atctcggcgaacttgacggcnatgtgggatgtgtggcagtccagcacangggcataaccg 508 ||||| ||||| ||||| || ||||| || |||||||| || |||||| |||||||||| Sbjct: 1161 atctcagcgaatttgacagcaatgtgagaggtgtggcaatcaagcacaggggcataacca 1102 Query: 509 ttgctgatctggccagggtggttcatgatgatgacctgggcagtgaag 556 || | ||||| || ||||| ||||||||||||||||| | ||||||| Sbjct: 1101 ttaccaatctgacccgggtgattcatgatgatgacctgagaagtgaag 1054
>emb|X96678.1|NPELF N.pseudonarcissu mRNA for elongation factor Length = 988 Score = 206 bits (104), Expect = 6e-50 Identities = 304/372 (81%) Strand = Plus / Minus Query: 186 caccatctcatttcttcttgatcgcagccttggtaaccttggcgccggtcggctccttct 245 ||||| |||||||||||||| |||||||| || |||||||| || || || ||||||| Sbjct: 738 caccacctcatttcttcttggcagcagcctttgtgaccttggcacctgtaggatccttct 679 Query: 246 tctcnacgctcttgatcacacccacagcaaccgtctgcctnatgtcacgcacggcaaacc 305 |||| || |||||||| ||||| |||||||| |||||||| ||||| | || ||||||| Sbjct: 678 tctcaacactcttgataacaccaacagcaacagtctgcctcatgtccctaacagcaaacc 619 Query: 306 gacccagaggagggtactgggcaaaggtctccaccaccatgggcttggttggaatcatct 365 | |||| || ||||||| ||| ||||||||||| ||||| |||||||| |||||||||| Sbjct: 618 gccccatcggtgggtactcggcgaaggtctccacaaccatcggcttggtcggaatcatct 559 Query: 366 tgacgaacccagcatcaccattcttgagaaacttgggcgctgcctccagctccttgccgg 425 | || | |||||||||||||||||| ||||| || ||| | ||| |||||||| || | Sbjct: 558 tcaccatcccagcatcaccattcttcagaaatttcggctccttctcaagctccttacccg 499 Query: 426 accgcctgtcgatcttggtctggatctcggcgaacttgacggcnatgtgggatgtgtggc 485 | |||| |||||||||||| ||| ||||||||| |||| || || || || ||||||| Sbjct: 498 atcgccgatcgatcttggtcaagatttcggcgaacctgaccgcgatatgagaggtgtggc 439 Query: 486 agtccagcacangggcataaccgttgctgatctggccagggtggttcatgatgatgacct 545 ||||||| || | || || ||||| | ||||| || || ||||||||||||||||| | Sbjct: 438 agtccagaaccggagcgtatccgttcccaatctgtcccggatggttcatgatgatgactt 379 Query: 546 gggcagtgaagt 557 |||| ||||||| Sbjct: 378 gggcggtgaagt 367
>gb|AF181492.1|AF181492 Lilium longiflorum elongation factor-1 alpha 3 mRNA, complete cds Length = 1686 Score = 206 bits (104), Expect = 6e-50 Identities = 292/356 (82%) Strand = Plus / Minus Query: 193 tcatttcttcttgatcgcagccttggtaaccttggcgccggtcggctccttcttctcnac 252 |||||||||||| | |||| ||||||||||||||| || || || ||||||||||| || Sbjct: 1383 tcatttcttcttcacagcagacttggtaaccttggctccagtgggatccttcttctcaac 1324 Query: 253 gctcttgatcacacccacagcaaccgtctgcctnatgtcacgcacggcaaaccgacccag 312 ||||||| ||||| |||||||| |||||||| ||||| | ||| ||||||| ||||| Sbjct: 1323 attcttgatgacaccgacagcaacagtctgcctcatgtccctcacagcaaacctccccag 1264 Query: 313 aggagggtactgggcaaaggtctccaccaccatgggcttggttggaatcatcttgacgaa 372 ||||| |||| || |||||||| |||||||| ||||| || ||||||||||| || | Sbjct: 1263 tggaggatactcagcgaaggtctcaaccaccatcggcttagtcggaatcatcttcaccat 1204 Query: 373 cccagcatcaccattcttgagaaacttgggcgctgcctccagctccttgccggaccgcct 432 ||||||||||||||||| |||||||| || | |||||||||||| || || ||||| Sbjct: 1203 accagcatcaccattcttcagaaacttcggttccttctccagctccttaccagatcgcct 1144 Query: 433 gtcgatcttggtctggatctcggcgaacttgacggcnatgtgggatgtgtggcagtccag 492 ||| ||||||||| |||||||||| ||||| || || |||||||| |||||||| || || Sbjct: 1143 gtcaatcttggtcaggatctcggcaaacttaacagctatgtgggaggtgtggcaatcaag 1084 Query: 493 cacangggcataaccgttgctgatctggccagggtggttcatgatgatgacctggg 548 ||| | |||||||| || | || || || || ||||||||||||||||| |||| Sbjct: 1083 gacaggagcataaccattcccaatttgccccggatggttcatgatgatgacttggg 1028
>dbj|AB073631.1| Salsola komarovii skef-1A mRNA for eukaryotic elongation factor 1A, complete cds Length = 1646 Score = 204 bits (103), Expect = 2e-49 Identities = 297/363 (81%) Strand = Plus / Minus Query: 195 atttcttcttgatcgcagccttggtaaccttggcgccggtcggctccttcttctcnacgc 254 |||||||||| | ||||||||||| |||||||| || || || ||||||||||| || Sbjct: 1364 atttcttcttaagggcagccttggtgaccttggcaccagttgggtccttcttctcaacat 1305 Query: 255 tcttgatcacacccacagcaaccgtctgcctnatgtcacgcacggcaaaccgacccagag 314 ||||||| ||||| |||||||| || ||||| ||||| | ||||||||| ||||| || | Sbjct: 1304 tcttgatgacaccaacagcaacagtttgcctcatgtccctcacggcaaaacgaccaaggg 1245 Query: 315 gagggtactgggcaaaggtctccaccaccatgggcttggttggaatcatcttgacgaacc 374 | ||||||| | || |||||||||||||| ||||||||||||| |||||| | | | Sbjct: 1244 gtgggtactccgagaaagtctccaccaccataggcttggttggaaccatcttaatcatac 1185 Query: 375 cagcatcaccattcttgagaaacttgggcgctgcctccagctccttgccggaccgcctgt 434 |||||||||||||||| | || |||||| | ||| |||||||| || || ||||||| Sbjct: 1184 cagcatcaccattcttcaagaatttgggctccttctcaagctccttacctgaacgcctgt 1125 Query: 435 cgatcttggtctggatctcggcgaacttgacggcnatgtgggatgtgtggcagtccagca 494 ||||||||||| | ||| || ||||| || || ||||| || |||||||| |||| || Sbjct: 1124 cgatcttggtcaccaactcagcaaacttaacagcaatgtgagaggtgtggcaatccaaca 1065 Query: 495 cangggcataaccgttgctgatctggccagggtggttcatgatgatgacctgggcagtga 554 | |||| |||||||| | |||||| ||||||||||||||||| |||||||||||||||| Sbjct: 1064 ctggggcgtaaccgtttccgatctgtccagggtggttcatgataatgacctgggcagtga 1005 Query: 555 agt 557 ||| Sbjct: 1004 agt 1002
>gb|DQ284495.1| Solanum tuberosum clone 063G03 elongation factor-1 alpha-like mRNA, complete cds Length = 1621 Score = 198 bits (100), Expect = 1e-47 Identities = 285/348 (81%) Strand = Plus / Minus Query: 209 gcagccttggtaaccttggcgccggtcggctccttcttctcnacgctcttgatcacaccc 268 ||||||||||| || ||||| || || || || ||||| || ||| |||||| |||||| Sbjct: 1378 gcagccttggtgactttggcaccagtagggtctttcttgtcgacgttcttgaccacacca 1319 Query: 269 acagcaaccgtctgcctnatgtcacgcacggcaaaccgacccagaggagggtactgggca 328 |||||||| || || | ||||| | ||| ||||| || |||| || ||||||| |||| Sbjct: 1318 acagcaacagtttgacgcatgtccctcacagcaaaacgtcccaatggtgggtactcggca 1259 Query: 329 aaggtctccaccaccatgggcttggttggaatcatcttgacgaacccagcatcaccattc 388 |||||||| || |||||||||||||| ||||||||||| || | || |||||||||||| Sbjct: 1258 aaggtctcaacaaccatgggcttggtgggaatcatcttaaccataccggcatcaccattc 1199 Query: 389 ttgagaaacttgggcgctgcctccagctccttgccggaccgcctgtcgatcttggtctgg 448 || | |||||||||| | ||| || ||||| || || || ||||| ||||||||| | Sbjct: 1198 ttcaaaaacttgggctccttctcaagttccttaccagaacgtctgtcaatcttggtcaag 1139 Query: 449 atctcggcgaacttgacggcnatgtgggatgtgtggcagtccagcacangggcataaccg 508 ||||| || |||||||| || |||||||| ||||||||||||||||| ||||||| ||| Sbjct: 1138 atctcagcaaacttgacagcgatgtgggaggtgtggcagtccagcactggggcatatccg 1079 Query: 509 ttgctgatctggccagggtggttcatgatgatgacctgggcagtgaag 556 || | ||||| |||||||||||||||||||| || |||||||||||| Sbjct: 1078 tttccaatctgaccagggtggttcatgatgataacttgggcagtgaag 1031
>gb|AF464925.1| Elaeis oleifera elongation factor 1-alpha mRNA, complete cds Length = 1805 Score = 196 bits (99), Expect = 5e-47 Identities = 275/335 (82%) Strand = Plus / Minus Query: 212 gccttggtaaccttggcgccggtcggctccttcttctcnacgctcttgatcacacccaca 271 |||||||| | |||||| || || || ||||||||||| ||||||||||| |||||||| Sbjct: 1381 gccttggtgatcttggcaccagttggatccttcttctccacgctcttgatgacacccact 1322 Query: 272 gcaaccgtctgcctnatgtcacgcacggcaaaccgacccagaggagggtactgggcaaag 331 || || ||||| | ||||| | ||| ||||| ||||| ||||| ||||||| | ||| Sbjct: 1321 gctacggtctggcgcatgtccctcacagcaaatcgaccaagaggggggtactcagagaag 1262 Query: 332 gtctccaccaccatgggcttggttggaatcatcttgacgaacccagcatcaccattcttg 391 ||||| || |||||||||||||| |||| |||||| || || || |||||||||||||| Sbjct: 1261 gtctcaacaaccatgggcttggtgggaagcatcttcacaaaacctgcatcaccattcttt 1202 Query: 392 agaaacttgggcgctgcctccagctccttgccggaccgcctgtcgatcttggtctggatc 451 | |||||||||| || ||| || ||||| || ||||||||||| ||||| || || | Sbjct: 1201 aaaaacttgggctctttctcaagttccttaccagaccgcctgtcaatcttagtaacgagc 1142 Query: 452 tcggcgaacttgacggcnatgtgggatgtgtggcagtccagcacangggcataaccgttg 511 ||||| ||||| || || || ||||| |||||||||||||| || ||||||| || ||| Sbjct: 1141 tcggcaaacttaacagcaatatgggaggtgtggcagtccagaactggggcatagccattg 1082 Query: 512 ctgatctggccagggtggttcatgatgatgacctg 546 | |||||||||||||||||||||||||||||||| Sbjct: 1081 ccaatctggccagggtggttcatgatgatgacctg 1047
>gb|AY300042.1| Solanum tuberosum putative translation elongation factor protein mRNA, partial cds Length = 864 Score = 190 bits (96), Expect = 3e-45 Identities = 284/348 (81%) Strand = Plus / Minus Query: 209 gcagccttggtaaccttggcgccggtcggctccttcttctcnacgctcttgatcacaccc 268 ||||||||||| |||||||| || || || |||||||| || ||| |||||| ||||| Sbjct: 845 gcagccttggtcaccttggcaccagttgggtccttcttgtcaacgttcttgacaacacca 786 Query: 269 acagcaaccgtctgcctnatgtcacgcacggcaaaccgacccagaggagggtactgggca 328 |||||||| || ||||| ||||| | ||| ||||| ||||||| || ||||||| ||| Sbjct: 785 acagcaacagtttgcctcatgtccctcacagcaaaacgacccaatggtgggtactcagca 726 Query: 329 aaggtctccaccaccatgggcttggttggaatcatcttgacgaacccagcatcaccattc 388 |||||||| || ||||| |||||||| ||||||||||| || | || |||||||||||| Sbjct: 725 aaggtctcaacaaccataggcttggtgggaatcatcttaaccatacctgcatcaccattc 666 Query: 389 ttgagaaacttgggcgctgcctccagctccttgccggaccgcctgtcgatcttggtctgg 448 || | ||||| ||| | ||| || ||||| || || |||||||| ||||||||| | Sbjct: 665 ttcaagaacttaggctccttctcaagttccttacctgaacgcctgtcaatcttggtcaag 606 Query: 449 atctcggcgaacttgacggcnatgtgggatgtgtggcagtccagcacangggcataaccg 508 ||||| || ||||| || || |||||||| ||||||||||| ||||| | ||||| || Sbjct: 605 atctcagcaaactttacagcaatgtgggaagtgtggcagtcgagcactggtgcatatcca 546 Query: 509 ttgctgatctggccagggtggttcatgatgatgacctgggcagtgaag 556 || | ||||||||||| |||||||||||||||||||||||||||||| Sbjct: 545 tttccaatctggccaggatggttcatgatgatgacctgggcagtgaag 498
>emb|X53043.1|LEEF1A L.esculentum gene for elongation factor 1-alpha Length = 4565 Score = 190 bits (96), Expect = 3e-45 Identities = 284/348 (81%) Strand = Plus / Minus Query: 209 gcagccttggtaaccttggcgccggtcggctccttcttctcnacgctcttgatcacaccc 268 ||||||||||| |||||||| || || || |||||||| || || |||||| ||||| Sbjct: 3861 gcagccttggtcaccttggcaccagttgggtccttcttgtcaacattcttgacaacacca 3802 Query: 269 acagcaaccgtctgcctnatgtcacgcacggcaaaccgacccagaggagggtactgggca 328 |||||||| |||||||| ||||| | ||| ||||| ||||||| |||||||| | ||| Sbjct: 3801 acagcaacagtctgcctcatgtccctcacagcaaaacgacccaatggagggtattcagca 3742 Query: 329 aaggtctccaccaccatgggcttggttggaatcatcttgacgaacccagcatcaccattc 388 |||||||| || |||||||||||||| ||||||||||| || | ||||||||||| ||| Sbjct: 3741 aaggtctcaacaaccatgggcttggtgggaatcatcttaaccataccagcatcaccgttc 3682 Query: 389 ttgagaaacttgggcgctgcctccagctccttgccggaccgcctgtcgatcttggtctgg 448 || | ||||| ||| | ||| || ||||| || || |||||||| ||||||||| | Sbjct: 3681 ttcaagaacttaggctccttctcaagttccttacctgaacgcctgtcaatcttggtcaag 3622 Query: 449 atctcggcgaacttgacggcnatgtgggatgtgtggcagtccagcacangggcataaccg 508 ||||| || |||||||| || |||||||| ||||| || || ||||| | ||||| || Sbjct: 3621 atctcagcaaacttgacagcaatgtgggaagtgtgacaatcaagcactggagcatatcca 3562 Query: 509 ttgctgatctggccagggtggttcatgatgatgacctgggcagtgaag 556 || | ||||||||||| |||||||||||||||||||||||||||||| Sbjct: 3561 tttccaatctggccaggatggttcatgatgatgacctgggcagtgaag 3514
>emb|X14449.1|LELEEF1 Tomato LeEF-1 mRNA for elongation factor 1 alpha Length = 1692 Score = 190 bits (96), Expect = 3e-45 Identities = 284/348 (81%) Strand = Plus / Minus Query: 209 gcagccttggtaaccttggcgccggtcggctccttcttctcnacgctcttgatcacaccc 268 ||||||||||| |||||||| || || || |||||||| || || |||||| ||||| Sbjct: 1388 gcagccttggtcaccttggcaccagttgggtccttcttgtcaacattcttgacaacacca 1329 Query: 269 acagcaaccgtctgcctnatgtcacgcacggcaaaccgacccagaggagggtactgggca 328 |||||||| |||||||| ||||| | ||| ||||| ||||||| |||||||| | ||| Sbjct: 1328 acagcaacagtctgcctcatgtccctcacagcaaaacgacccaatggagggtattcagca 1269 Query: 329 aaggtctccaccaccatgggcttggttggaatcatcttgacgaacccagcatcaccattc 388 |||||||| || |||||||||||||| ||||||||||| || | ||||||||||| ||| Sbjct: 1268 aaggtctcaacaaccatgggcttggtgggaatcatcttaaccataccagcatcaccgttc 1209 Query: 389 ttgagaaacttgggcgctgcctccagctccttgccggaccgcctgtcgatcttggtctgg 448 || | ||||| ||| | ||| || ||||| || || |||||||| ||||||||| | Sbjct: 1208 ttcaagaacttaggctccttctcaagttccttacctgaacgcctgtcaatcttggtcaag 1149 Query: 449 atctcggcgaacttgacggcnatgtgggatgtgtggcagtccagcacangggcataaccg 508 ||||| || |||||||| || |||||||| ||||| || || ||||| | ||||| || Sbjct: 1148 atctcagcaaacttgacagcaatgtgggaagtgtgacaatcaagcactggagcatatcca 1089 Query: 509 ttgctgatctggccagggtggttcatgatgatgacctgggcagtgaag 556 || | ||||||||||| |||||||||||||||||||||||||||||| Sbjct: 1088 tttccaatctggccaggatggttcatgatgatgacctgggcagtgaag 1041
>ref|NM_001035916.1| Arabidopsis thaliana calmodulin binding / translation elongation factor AT1G07940 transcript variant AT1G07940.2 mRNA, complete cds Length = 1990 Score = 188 bits (95), Expect = 1e-44 Identities = 292/359 (81%) Strand = Plus / Minus Query: 199 cttcttgatcgcagccttggtaaccttggcgccggtcggctccttcttctcnacgctctt 258 |||||||| |||||||||||||||||||| || || || |||||||| || || ||||| Sbjct: 1581 cttcttgactgcagccttggtaaccttggctccagttgggtccttcttgtcaacactctt 1522 Query: 259 gatcacacccacagcaaccgtctgcctnatgtcacgcacggcaaaccgacccagaggagg 318 ||| ||||| || ||||| |||||||| ||||| | ||| || || || || || || || Sbjct: 1521 gataacaccgactgcaacagtctgcctcatgtccctcacagcgaaacgtccaagtggtgg 1462 Query: 319 gtactgggcaaaggtctccaccaccatgggcttggttggaatcatcttgacgaacccagc 378 ||||| | ||||||||||| |||||||||||||||||| ||||||| || | ||||| Sbjct: 1461 gtactcagagaaggtctccacaaccatgggcttggttggagtcatcttcaccataccagc 1402 Query: 379 atcaccattcttgagaaacttgggcgctgcctccagctccttgccggaccgcctgtcgat 438 |||||||||||| | || || ||| | ||| | |||||| || || |||||||| || Sbjct: 1401 atcaccattcttcaagaatttaggctccttctcaatctccttaccagaacgcctgtcaat 1342 Query: 439 cttggtctggatctcggcgaacttgacggcnatgtgggatgtgtggcagtccagcacang 498 ||||||| |||||| | ||||||||| || ||||| || |||||||| ||||| || | Sbjct: 1341 cttggtcaagatctcagagaacttgactgcaatgtgagaggtgtggcaatccaggactgg 1282 Query: 499 ggcataaccgttgctgatctggccagggtggttcatgatgatgacctgggcagtgaagt 557 ||| |||||||| | ||||| |||||||||||||||||||||||||||| ||||||| Sbjct: 1281 ggcgtaaccgttaccaatctgaccagggtggttcatgatgatgacctgggaggtgaagt 1223
>ref|NM_100668.2| Arabidopsis thaliana calmodulin binding / translation elongation factor AT1G07940 transcript variant AT1G07940.1 mRNA, complete cds Length = 1864 Score = 188 bits (95), Expect = 1e-44 Identities = 292/359 (81%) Strand = Plus / Minus Query: 199 cttcttgatcgcagccttggtaaccttggcgccggtcggctccttcttctcnacgctctt 258 |||||||| |||||||||||||||||||| || || || |||||||| || || ||||| Sbjct: 1455 cttcttgactgcagccttggtaaccttggctccagttgggtccttcttgtcaacactctt 1396 Query: 259 gatcacacccacagcaaccgtctgcctnatgtcacgcacggcaaaccgacccagaggagg 318 ||| ||||| || ||||| |||||||| ||||| | ||| || || || || || || || Sbjct: 1395 gataacaccgactgcaacagtctgcctcatgtccctcacagcgaaacgtccaagtggtgg 1336 Query: 319 gtactgggcaaaggtctccaccaccatgggcttggttggaatcatcttgacgaacccagc 378 ||||| | ||||||||||| |||||||||||||||||| ||||||| || | ||||| Sbjct: 1335 gtactcagagaaggtctccacaaccatgggcttggttggagtcatcttcaccataccagc 1276 Query: 379 atcaccattcttgagaaacttgggcgctgcctccagctccttgccggaccgcctgtcgat 438 |||||||||||| | || || ||| | ||| | |||||| || || |||||||| || Sbjct: 1275 atcaccattcttcaagaatttaggctccttctcaatctccttaccagaacgcctgtcaat 1216 Query: 439 cttggtctggatctcggcgaacttgacggcnatgtgggatgtgtggcagtccagcacang 498 ||||||| |||||| | ||||||||| || ||||| || |||||||| ||||| || | Sbjct: 1215 cttggtcaagatctcagagaacttgactgcaatgtgagaggtgtggcaatccaggactgg 1156 Query: 499 ggcataaccgttgctgatctggccagggtggttcatgatgatgacctgggcagtgaagt 557 ||| |||||||| | ||||| |||||||||||||||||||||||||||| ||||||| Sbjct: 1155 ggcgtaaccgttaccaatctgaccagggtggttcatgatgatgacctgggaggtgaagt 1097
>gb|DQ228347.1| Solanum tuberosum clone 149A09 elongation factor 1-alpha-like protein mRNA, complete cds Length = 1691 Score = 188 bits (95), Expect = 1e-44 Identities = 283/347 (81%) Strand = Plus / Minus Query: 209 gcagccttggtaaccttggcgccggtcggctccttcttctcnacgctcttgatcacaccc 268 ||||||||||| |||||||| || || || |||||||| || || |||||| ||||| Sbjct: 1379 gcagccttggtgaccttggcaccagttgggtccttcttgtcaacattcttgacaacaccg 1320 Query: 269 acagcaaccgtctgcctnatgtcacgcacggcaaaccgacccagaggagggtactgggca 328 |||||||| || ||||| ||||| | ||| || || ||||||| || ||||| | |||| Sbjct: 1319 acagcaacagtttgcctcatgtctctcacagcgaaacgacccaatggtgggtattcggca 1260 Query: 329 aaggtctccaccaccatgggcttggttggaatcatcttgacgaacccagcatcaccattc 388 |||||||| || ||||||||||| || ||||||||||| || | ||||||||||||||| Sbjct: 1259 aaggtctcaacaaccatgggcttagtgggaatcatcttaaccataccagcatcaccattc 1200 Query: 389 ttgagaaacttgggcgctgcctccagctccttgccggaccgcctgtcgatcttggtctgg 448 || | ||||| ||| | ||| || ||||| || || |||||||| ||||||||| | Sbjct: 1199 ttcaagaacttaggctccttctcaagttccttacctgaacgcctgtcaatcttggtcaag 1140 Query: 449 atctcggcgaacttgacggcnatgtgggatgtgtggcagtccagcacangggcataaccg 508 ||||| || |||||||| || |||||||| ||||||||||| ||||| | ||||| || Sbjct: 1139 atctcagcaaacttgacagcaatgtgggaagtgtggcagtcgagcactggtgcatatcca 1080 Query: 509 ttgctgatctggccagggtggttcatgatgatgacctgggcagtgaa 555 || | ||||||||||| ||||||||||||||||||||||||||||| Sbjct: 1079 tttccaatctggccaggatggttcatgatgatgacctgggcagtgaa 1033
>gb|BT000595.1| Arabidopsis thaliana elongation factor 1-alpha (At1g07940/T6D22_14) mRNA, complete cds Length = 1350 Score = 188 bits (95), Expect = 1e-44 Identities = 292/359 (81%) Strand = Plus / Minus Query: 199 cttcttgatcgcagccttggtaaccttggcgccggtcggctccttcttctcnacgctctt 258 |||||||| |||||||||||||||||||| || || || |||||||| || || ||||| Sbjct: 1338 cttcttgactgcagccttggtaaccttggctccagttgggtccttcttgtcaacactctt 1279 Query: 259 gatcacacccacagcaaccgtctgcctnatgtcacgcacggcaaaccgacccagaggagg 318 ||| ||||| || ||||| |||||||| ||||| | ||| || || || || || || || Sbjct: 1278 gataacaccgactgcaacagtctgcctcatgtccctcacagcgaaacgtccaagtggtgg 1219 Query: 319 gtactgggcaaaggtctccaccaccatgggcttggttggaatcatcttgacgaacccagc 378 ||||| | ||||||||||| |||||||||||||||||| ||||||| || | ||||| Sbjct: 1218 gtactcagagaaggtctccacaaccatgggcttggttggagtcatcttcaccataccagc 1159 Query: 379 atcaccattcttgagaaacttgggcgctgcctccagctccttgccggaccgcctgtcgat 438 |||||||||||| | || || ||| | ||| | |||||| || || |||||||| || Sbjct: 1158 atcaccattcttcaagaatttaggctccttctcaatctccttaccagaacgcctgtcaat 1099 Query: 439 cttggtctggatctcggcgaacttgacggcnatgtgggatgtgtggcagtccagcacang 498 ||||||| |||||| | ||||||||| || ||||| || |||||||| ||||| || | Sbjct: 1098 cttggtcaagatctcagagaacttgactgcaatgtgagaggtgtggcaatccaggactgg 1039 Query: 499 ggcataaccgttgctgatctggccagggtggttcatgatgatgacctgggcagtgaagt 557 ||| |||||||| | ||||| |||||||||||||||||||||||||||| ||||||| Sbjct: 1038 ggcgtaaccgttaccaatctgaccagggtggttcatgatgatgacctgggaggtgaagt 980
>emb|X16430.1|ATEF1AA1 Arabidopsis thaliana EF-1 alpha A1 gene for elongation factor 1-alpha Length = 3230 Score = 188 bits (95), Expect = 1e-44 Identities = 292/359 (81%) Strand = Plus / Minus Query: 199 cttcttgatcgcagccttggtaaccttggcgccggtcggctccttcttctcnacgctctt 258 |||||||| |||||||||||||||||||| || || || |||||||| || || ||||| Sbjct: 2589 cttcttgactgcagccttggtaaccttggctccagttgggtccttcttgtcaacactctt 2530 Query: 259 gatcacacccacagcaaccgtctgcctnatgtcacgcacggcaaaccgacccagaggagg 318 ||| ||||| || ||||| |||||||| ||||| | ||| || || || || || || || Sbjct: 2529 gataacaccgactgcaacagtctgcctcatgtccctcacagcgaaacgtccaagtggtgg 2470 Query: 319 gtactgggcaaaggtctccaccaccatgggcttggttggaatcatcttgacgaacccagc 378 ||||| | ||||||||||| |||||||||||||||||| ||||||| || | ||||| Sbjct: 2469 gtactcagagaaggtctccacaaccatgggcttggttggagtcatcttcaccataccagc 2410 Query: 379 atcaccattcttgagaaacttgggcgctgcctccagctccttgccggaccgcctgtcgat 438 |||||||||||| | || || ||| | ||| | |||||| || || |||||||| || Sbjct: 2409 atcaccattcttcaagaatttaggctccttctcaatctccttaccagaacgcctgtcaat 2350 Query: 439 cttggtctggatctcggcgaacttgacggcnatgtgggatgtgtggcagtccagcacang 498 ||||||| |||||| | ||||||||| || ||||| || |||||||| ||||| || | Sbjct: 2349 cttggtcaagatctcagagaacttgactgcaatgtgagaggtgtggcaatccaggactgg 2290 Query: 499 ggcataaccgttgctgatctggccagggtggttcatgatgatgacctgggcagtgaagt 557 ||| |||||||| | ||||| |||||||||||||||||||||||||||| ||||||| Sbjct: 2289 ggcgtaaccgttaccaatctgaccagggtggttcatgatgatgacctgggaggtgaagt 2231
>gb|AY039583.1| Arabidopsis thaliana At1g07940/T6D22_14 mRNA, complete cds Length = 1650 Score = 188 bits (95), Expect = 1e-44 Identities = 292/359 (81%) Strand = Plus / Minus Query: 199 cttcttgatcgcagccttggtaaccttggcgccggtcggctccttcttctcnacgctctt 258 |||||||| |||||||||||||||||||| || || || |||||||| || || ||||| Sbjct: 1410 cttcttgactgcagccttggtaaccttggctccagttgggtccttcttgtcaacactctt 1351 Query: 259 gatcacacccacagcaaccgtctgcctnatgtcacgcacggcaaaccgacccagaggagg 318 ||| ||||| || ||||| |||||||| ||||| | ||| || || || || || || || Sbjct: 1350 gataacaccgactgcaacagtctgcctcatgtccctcacagcgaaacgtccaagtggtgg 1291 Query: 319 gtactgggcaaaggtctccaccaccatgggcttggttggaatcatcttgacgaacccagc 378 ||||| | ||||||||||| |||||||||||||||||| ||||||| || | ||||| Sbjct: 1290 gtactcagagaaggtctccacaaccatgggcttggttggagtcatcttcaccataccagc 1231 Query: 379 atcaccattcttgagaaacttgggcgctgcctccagctccttgccggaccgcctgtcgat 438 |||||||||||| | || || ||| | ||| | |||||| || || |||||||| || Sbjct: 1230 atcaccattcttcaagaatttaggctccttctcaatctccttaccagaacgcctgtcaat 1171 Query: 439 cttggtctggatctcggcgaacttgacggcnatgtgggatgtgtggcagtccagcacang 498 ||||||| |||||| | ||||||||| || ||||| || |||||||| ||||| || | Sbjct: 1170 cttggtcaagatctcagagaacttgactgcaatgtgagaggtgtggcaatccaggactgg 1111 Query: 499 ggcataaccgttgctgatctggccagggtggttcatgatgatgacctgggcagtgaagt 557 ||| |||||||| | ||||| |||||||||||||||||||||||||||| ||||||| Sbjct: 1110 ggcgtaaccgttaccaatctgaccagggtggttcatgatgatgacctgggaggtgaagt 1052
>gb|DQ252511.1| Solanum tuberosum clone 087B12 elongation factor 1-alpha-like mRNA, complete cds Length = 1718 Score = 188 bits (95), Expect = 1e-44 Identities = 283/347 (81%) Strand = Plus / Minus Query: 209 gcagccttggtaaccttggcgccggtcggctccttcttctcnacgctcttgatcacaccc 268 ||||||||||| |||||||| || || || |||||||| || || |||||| ||||| Sbjct: 1389 gcagccttggtgaccttggcaccagttgggtccttcttgtcaacattcttgacaacaccg 1330 Query: 269 acagcaaccgtctgcctnatgtcacgcacggcaaaccgacccagaggagggtactgggca 328 |||||||| || ||||| ||||| | ||| || || ||||||| || ||||| | |||| Sbjct: 1329 acagcaacagtttgcctcatgtctctcacagcgaaacgacccaatggtgggtattcggca 1270 Query: 329 aaggtctccaccaccatgggcttggttggaatcatcttgacgaacccagcatcaccattc 388 |||||||| || ||||||||||| || ||||||||||| || | ||||||||||||||| Sbjct: 1269 aaggtctcaacaaccatgggcttagtgggaatcatcttaaccataccagcatcaccattc 1210 Query: 389 ttgagaaacttgggcgctgcctccagctccttgccggaccgcctgtcgatcttggtctgg 448 || | ||||| ||| | ||| || ||||| || || |||||||| ||||||||| | Sbjct: 1209 ttcaagaacttaggctccttctcaagttccttacctgaacgcctgtcaatcttggtcaag 1150 Query: 449 atctcggcgaacttgacggcnatgtgggatgtgtggcagtccagcacangggcataaccg 508 ||||| || |||||||| || |||||||| ||||||||||| ||||| | ||||| || Sbjct: 1149 atctcagcaaacttgacagcaatgtgggaagtgtggcagtcgagcactggtgcatatcca 1090 Query: 509 ttgctgatctggccagggtggttcatgatgatgacctgggcagtgaa 555 || | ||||||||||| ||||||||||||||||||||||||||||| Sbjct: 1089 tttccaatctggccaggatggttcatgatgatgacctgggcagtgaa 1043
>ref|NM_100667.2| Arabidopsis thaliana calmodulin binding / translation elongation factor AT1G07930 mRNA, complete cds Length = 1778 Score = 184 bits (93), Expect = 2e-43 Identities = 284/349 (81%) Strand = Plus / Minus Query: 209 gcagccttggtaaccttggcgccggtcggctccttcttctcnacgctcttgatcacaccc 268 |||||||||||||||||||| ||||| || |||||||| || || |||||||| ||||| Sbjct: 1424 gcagccttggtaaccttggctccggttgggtccttcttgtcaacactcttgataacaccg 1365 Query: 269 acagcaaccgtctgcctnatgtcacgcacggcaaaccgacccagaggagggtactgggca 328 || ||||| |||||||| ||||| | || || || || || || || ||||||| | Sbjct: 1364 actgcaacagtctgcctcatgtccctaacagcgaaacgtccaagtggtgggtactcagag 1305 Query: 329 aaggtctccaccaccatgggcttggttggaatcatcttgacgaacccagcatcaccattc 388 ||||||||||| |||||||||||||||||| ||||||| || | ||||||||||||||| Sbjct: 1304 aaggtctccacaaccatgggcttggttggagtcatcttcaccataccagcatcaccattc 1245 Query: 389 ttgagaaacttgggcgctgcctccagctccttgccggaccgcctgtcgatcttggtctgg 448 || | || |||||| | ||| | |||||| || || |||||||| ||||||||| | Sbjct: 1244 ttcaagaatttgggctccttctcaatctccttaccagaacgcctgtcaatcttggtcaag 1185 Query: 449 atctcggcgaacttgacggcnatgtgggatgtgtggcagtccagcacangggcataaccg 508 ||||| | ||||||||| || ||||| || |||||||| |||| || |||| |||||| Sbjct: 1184 atctcagagaacttgactgcaatgtgagaggtgtggcaatccaagactggggcgtaaccg 1125 Query: 509 ttgctgatctggccagggtggttcatgatgatgacctgggcagtgaagt 557 || | ||||| |||||||||||||||||||||||||||| ||||||| Sbjct: 1124 ttaccaatctgaccagggtggttcatgatgatgacctgggaggtgaagt 1076
>gb|AY123029.1| Arabidopsis thaliana putative elongation factor 1-alpha (At1g07930) mRNA, complete cds Length = 1381 Score = 184 bits (93), Expect = 2e-43 Identities = 284/349 (81%) Strand = Plus / Minus Query: 209 gcagccttggtaaccttggcgccggtcggctccttcttctcnacgctcttgatcacaccc 268 |||||||||||||||||||| ||||| || |||||||| || || |||||||| ||||| Sbjct: 1328 gcagccttggtaaccttggctccggttgggtccttcttgtcaacactcttgataacaccg 1269 Query: 269 acagcaaccgtctgcctnatgtcacgcacggcaaaccgacccagaggagggtactgggca 328 || ||||| |||||||| ||||| | || || || || || || || ||||||| | Sbjct: 1268 actgcaacagtctgcctcatgtccctaacagcgaaacgtccaagtggtgggtactcagag 1209 Query: 329 aaggtctccaccaccatgggcttggttggaatcatcttgacgaacccagcatcaccattc 388 ||||||||||| |||||||||||||||||| ||||||| || | ||||||||||||||| Sbjct: 1208 aaggtctccacaaccatgggcttggttggagtcatcttcaccataccagcatcaccattc 1149 Query: 389 ttgagaaacttgggcgctgcctccagctccttgccggaccgcctgtcgatcttggtctgg 448 || | || |||||| | ||| | |||||| || || |||||||| ||||||||| | Sbjct: 1148 ttcaagaatttgggctccttctcaatctccttaccagaacgcctgtcaatcttggtcaag 1089 Query: 449 atctcggcgaacttgacggcnatgtgggatgtgtggcagtccagcacangggcataaccg 508 ||||| | ||||||||| || ||||| || |||||||| |||| || |||| |||||| Sbjct: 1088 atctcagagaacttgactgcaatgtgagaggtgtggcaatccaagactggggcgtaaccg 1029 Query: 509 ttgctgatctggccagggtggttcatgatgatgacctgggcagtgaagt 557 || | ||||| |||||||||||||||||||||||||||| ||||||| Sbjct: 1028 ttaccaatctgaccagggtggttcatgatgatgacctgggaggtgaagt 980
>gb|AY080660.1| Arabidopsis thaliana putative elongation factor 1-alpha (At1g07930) mRNA, complete cds Length = 1705 Score = 184 bits (93), Expect = 2e-43 Identities = 284/349 (81%) Strand = Plus / Minus Query: 209 gcagccttggtaaccttggcgccggtcggctccttcttctcnacgctcttgatcacaccc 268 |||||||||||||||||||| ||||| || |||||||| || || |||||||| ||||| Sbjct: 1420 gcagccttggtaaccttggctccggttgggtccttcttgtcaacactcttgataacaccg 1361 Query: 269 acagcaaccgtctgcctnatgtcacgcacggcaaaccgacccagaggagggtactgggca 328 || ||||| |||||||| ||||| | || || || || || || || ||||||| | Sbjct: 1360 actgcaacagtctgcctcatgtccctaacagcgaaacgtccaagtggtgggtactcagag 1301 Query: 329 aaggtctccaccaccatgggcttggttggaatcatcttgacgaacccagcatcaccattc 388 ||||||||||| |||||||||||||||||| ||||||| || | ||||||||||||||| Sbjct: 1300 aaggtctccacaaccatgggcttggttggagtcatcttcaccataccagcatcaccattc 1241 Query: 389 ttgagaaacttgggcgctgcctccagctccttgccggaccgcctgtcgatcttggtctgg 448 || | || |||||| | ||| | |||||| || || |||||||| ||||||||| | Sbjct: 1240 ttcaagaatttgggctccttctcaatctccttaccagaacgcctgtcaatcttggtcaag 1181 Query: 449 atctcggcgaacttgacggcnatgtgggatgtgtggcagtccagcacangggcataaccg 508 ||||| | ||||||||| || ||||| || |||||||| |||| || |||| |||||| Sbjct: 1180 atctcagagaacttgactgcaatgtgagaggtgtggcaatccaagactggggcgtaaccg 1121 Query: 509 ttgctgatctggccagggtggttcatgatgatgacctgggcagtgaagt 557 || | ||||| |||||||||||||||||||||||||||| ||||||| Sbjct: 1120 ttaccaatctgaccagggtggttcatgatgatgacctgggaggtgaagt 1072
>emb|X56856.1|GMTEFS1 G.max tefS1 gene for elongation factor EF-1a Length = 1979 Score = 184 bits (93), Expect = 2e-43 Identities = 284/349 (81%) Strand = Plus / Minus Query: 209 gcagccttggtaaccttggcgccggtcggctccttcttctcnacgctcttgatcacaccc 268 ||||||||||| |||||||| ||||| || ||||||||||| ||| ||||||| || ||| Sbjct: 1893 gcagccttggtgaccttggctccggtaggatccttcttctcaacgttcttgatgactccc 1834 Query: 269 acagcaaccgtctgcctnatgtcacgcacggcaaaccgacccagaggagggtactgggca 328 |||||||| || || | ||||| | || ||||||| ||| || ||||| |||| || Sbjct: 1833 acagcaacagtttgacgcatgtccctaacagcaaacctaccaagtggaggatactcggag 1774 Query: 329 aaggtctccaccaccatgggcttggttggaatcatcttgacgaacccagcatcaccattc 388 || || || || |||||||| ||||||||||||||||| || || ||||||||||| ||| Sbjct: 1773 aaagtttcaacaaccatgggtttggttggaatcatcttaacaaaaccagcatcaccgttc 1714 Query: 389 ttgagaaacttgggcgctgcctccagctccttgccggaccgcctgtcgatcttggtctgg 448 || | |||||||||| | ||| ||||| |||||||| |||||||| ||||||||| | Sbjct: 1713 ttcaaaaacttgggctccttctcaagctctttgccggatcgcctgtcaatcttggtcatg 1654 Query: 449 atctcggcgaacttgacggcnatgtgggatgtgtggcagtccagcacangggcataaccg 508 | || || |||||||| || ||||| || ||||||||||| || ||| ||||||| || Sbjct: 1653 agttcagcaaacttgacagcaatgtgagaagtgtggcagtcgaggacaggggcatagcca 1594 Query: 509 ttgctgatctggccagggtggttcatgatgatgacctgggcagtgaagt 557 || | ||||| ||||||||||| ||||||||||| ||||| ||||||| Sbjct: 1593 tttccaatctgaccagggtggttaatgatgatgacttgggctgtgaagt 1545
>gb|AF361822.1| Arabidopsis thaliana At1g07930/T6D22_3 mRNA, complete cds Length = 1679 Score = 184 bits (93), Expect = 2e-43 Identities = 284/349 (81%) Strand = Plus / Minus Query: 209 gcagccttggtaaccttggcgccggtcggctccttcttctcnacgctcttgatcacaccc 268 |||||||||||||||||||| ||||| || |||||||| || || |||||||| ||||| Sbjct: 1420 gcagccttggtaaccttggctccggttgggtccttcttgtcaacactcttgataacaccg 1361 Query: 269 acagcaaccgtctgcctnatgtcacgcacggcaaaccgacccagaggagggtactgggca 328 || ||||| |||||||| ||||| | || || || || || || || ||||||| | Sbjct: 1360 actgcaacagtctgcctcatgtccctaacagcgaaacgtccaagtggtgggtactcagag 1301 Query: 329 aaggtctccaccaccatgggcttggttggaatcatcttgacgaacccagcatcaccattc 388 ||||||||||| |||||||||||||||||| ||||||| || | ||||||||||||||| Sbjct: 1300 aaggtctccacaaccatgggcttggttggagtcatcttcaccataccagcatcaccattc 1241 Query: 389 ttgagaaacttgggcgctgcctccagctccttgccggaccgcctgtcgatcttggtctgg 448 || | || |||||| | ||| | |||||| || || |||||||| ||||||||| | Sbjct: 1240 ttcaagaatttgggctccttctcaatctccttaccagaacgcctgtcaatcttggtcaag 1181 Query: 449 atctcggcgaacttgacggcnatgtgggatgtgtggcagtccagcacangggcataaccg 508 ||||| | ||||||||| || ||||| || |||||||| |||| || |||| |||||| Sbjct: 1180 atctcagagaacttgactgcaatgtgagaggtgtggcaatccaagactggggcgtaaccg 1121 Query: 509 ttgctgatctggccagggtggttcatgatgatgacctgggcagtgaagt 557 || | ||||| |||||||||||||||||||||||||||| ||||||| Sbjct: 1120 ttaccaatctgaccagggtggttcatgatgatgacctgggaggtgaagt 1072
>gb|AY065008.1| Arabidopsis thaliana At1g07930/T6D22_3 mRNA, complete cds Length = 1657 Score = 184 bits (93), Expect = 2e-43 Identities = 284/349 (81%) Strand = Plus / Minus Query: 209 gcagccttggtaaccttggcgccggtcggctccttcttctcnacgctcttgatcacaccc 268 |||||||||||||||||||| ||||| || |||||||| || || |||||||| ||||| Sbjct: 1420 gcagccttggtaaccttggctccggttgggtccttcttgtcaacactcttgataacaccg 1361 Query: 269 acagcaaccgtctgcctnatgtcacgcacggcaaaccgacccagaggagggtactgggca 328 || ||||| |||||||| ||||| | || || || || || || || ||||||| | Sbjct: 1360 actgcaacagtctgcctcatgtccctaacagcgaaacgtccaagtggtgggtactcagag 1301 Query: 329 aaggtctccaccaccatgggcttggttggaatcatcttgacgaacccagcatcaccattc 388 ||||||||||| |||||||||||||||||| ||||||| || | ||||||||||||||| Sbjct: 1300 aaggtctccacaaccatgggcttggttggagtcatcttcaccataccagcatcaccattc 1241 Query: 389 ttgagaaacttgggcgctgcctccagctccttgccggaccgcctgtcgatcttggtctgg 448 || | || |||||| | ||| | |||||| || || |||||||| ||||||||| | Sbjct: 1240 ttcaagaatttgggctccttctcaatctccttaccagaacgcctgtcaatcttggtcaag 1181 Query: 449 atctcggcgaacttgacggcnatgtgggatgtgtggcagtccagcacangggcataaccg 508 ||||| | ||||||||| || ||||| || |||||||| |||| || |||| |||||| Sbjct: 1180 atctcagagaacttgactgcaatgtgagaggtgtggcaatccaagactggggcgtaaccg 1121 Query: 509 ttgctgatctggccagggtggttcatgatgatgacctgggcagtgaagt 557 || | ||||| |||||||||||||||||||||||||||| ||||||| Sbjct: 1120 ttaccaatctgaccagggtggttcatgatgatgacctgggaggtgaagt 1072
>gb|AY059160.1| Arabidopsis thaliana At1g07930/T6D22_3 mRNA, complete cds Length = 1350 Score = 184 bits (93), Expect = 2e-43 Identities = 284/349 (81%) Strand = Plus / Minus Query: 209 gcagccttggtaaccttggcgccggtcggctccttcttctcnacgctcttgatcacaccc 268 |||||||||||||||||||| ||||| || |||||||| || || |||||||| ||||| Sbjct: 1328 gcagccttggtaaccttggctccggttgggtccttcttgtcaacactcttgataacaccg 1269 Query: 269 acagcaaccgtctgcctnatgtcacgcacggcaaaccgacccagaggagggtactgggca 328 || ||||| |||||||| ||||| | || || || || || || || ||||||| | Sbjct: 1268 actgcaacagtctgcctcatgtccctaacagcgaaacgtccaagtggtgggtactcagag 1209 Query: 329 aaggtctccaccaccatgggcttggttggaatcatcttgacgaacccagcatcaccattc 388 ||||||||||| |||||||||||||||||| ||||||| || | ||||||||||||||| Sbjct: 1208 aaggtctccacaaccatgggcttggttggagtcatcttcaccataccagcatcaccattc 1149 Query: 389 ttgagaaacttgggcgctgcctccagctccttgccggaccgcctgtcgatcttggtctgg 448 || | || |||||| | ||| | |||||| || || |||||||| ||||||||| | Sbjct: 1148 ttcaagaatttgggctccttctcaatctccttaccagaacgcctgtcaatcttggtcaag 1089 Query: 449 atctcggcgaacttgacggcnatgtgggatgtgtggcagtccagcacangggcataaccg 508 ||||| | ||||||||| || ||||| || |||||||| |||| || |||| |||||| Sbjct: 1088 atctcagagaacttgactgcaatgtgagaggtgtggcaatccaagactggggcgtaaccg 1029 Query: 509 ttgctgatctggccagggtggttcatgatgatgacctgggcagtgaagt 557 || | ||||| |||||||||||||||||||||||||||| ||||||| Sbjct: 1028 ttaccaatctgaccagggtggttcatgatgatgacctgggaggtgaagt 980
>gb|AY048275.1| Arabidopsis thaliana At1g07930/T6D22_3 mRNA, complete cds Length = 1682 Score = 184 bits (93), Expect = 2e-43 Identities = 284/349 (81%) Strand = Plus / Minus Query: 209 gcagccttggtaaccttggcgccggtcggctccttcttctcnacgctcttgatcacaccc 268 |||||||||||||||||||| ||||| || |||||||| || || |||||||| ||||| Sbjct: 1414 gcagccttggtaaccttggctccggttgggtccttcttgtcaacactcttgataacaccg 1355 Query: 269 acagcaaccgtctgcctnatgtcacgcacggcaaaccgacccagaggagggtactgggca 328 || ||||| |||||||| ||||| | || || || || || || || ||||||| | Sbjct: 1354 actgcaacagtctgcctcatgtccctaacagcgaaacgtccaagtggtgggtactcagag 1295 Query: 329 aaggtctccaccaccatgggcttggttggaatcatcttgacgaacccagcatcaccattc 388 ||||||||||| |||||||||||||||||| ||||||| || | ||||||||||||||| Sbjct: 1294 aaggtctccacaaccatgggcttggttggagtcatcttcaccataccagcatcaccattc 1235 Query: 389 ttgagaaacttgggcgctgcctccagctccttgccggaccgcctgtcgatcttggtctgg 448 || | || |||||| | ||| | |||||| || || |||||||| ||||||||| | Sbjct: 1234 ttcaagaatttgggctccttctcaatctccttaccagaacgcctgtcaatcttggtcaag 1175 Query: 449 atctcggcgaacttgacggcnatgtgggatgtgtggcagtccagcacangggcataaccg 508 ||||| | ||||||||| || ||||| || |||||||| |||| || |||| |||||| Sbjct: 1174 atctcagagaacttgactgcaatgtgagaggtgtggcaatccaagactggggcgtaaccg 1115 Query: 509 ttgctgatctggccagggtggttcatgatgatgacctgggcagtgaagt 557 || | ||||| |||||||||||||||||||||||||||| ||||||| Sbjct: 1114 ttaccaatctgaccagggtggttcatgatgatgacctgggaggtgaagt 1066
>gb|BT003325.1| Arabidopsis thaliana Unknown protein mRNA, complete cds Length = 1677 Score = 184 bits (93), Expect = 2e-43 Identities = 284/349 (81%) Strand = Plus / Minus Query: 209 gcagccttggtaaccttggcgccggtcggctccttcttctcnacgctcttgatcacaccc 268 |||||||||||||||||||| ||||| || |||||||| || || |||||||| ||||| Sbjct: 1420 gcagccttggtaaccttggctccggttgggtccttcttgtcaacactcttgataacaccg 1361 Query: 269 acagcaaccgtctgcctnatgtcacgcacggcaaaccgacccagaggagggtactgggca 328 || ||||| |||||||| ||||| | || || || || || || || ||||||| | Sbjct: 1360 actgcaacagtctgcctcatgtccctaacagcgaaacgtccaagtggtgggtactcagag 1301 Query: 329 aaggtctccaccaccatgggcttggttggaatcatcttgacgaacccagcatcaccattc 388 ||||||||||| |||||||||||||||||| ||||||| || | ||||||||||||||| Sbjct: 1300 aaggtctccacaaccatgggcttggttggagtcatcttcaccataccagcatcaccattc 1241 Query: 389 ttgagaaacttgggcgctgcctccagctccttgccggaccgcctgtcgatcttggtctgg 448 || | || |||||| | ||| | |||||| || || |||||||| ||||||||| | Sbjct: 1240 ttcaagaatttgggctccttctcaatctccttaccagaacgcctgtcaatcttggtcaag 1181 Query: 449 atctcggcgaacttgacggcnatgtgggatgtgtggcagtccagcacangggcataaccg 508 ||||| | ||||||||| || ||||| || |||||||| |||| || |||| |||||| Sbjct: 1180 atctcagagaacttgactgcaatgtgagaggtgtggcaatccaagactggggcgtaaccg 1121 Query: 509 ttgctgatctggccagggtggttcatgatgatgacctgggcagtgaagt 557 || | ||||| |||||||||||||||||||||||||||| ||||||| Sbjct: 1120 ttaccaatctgaccagggtggttcatgatgatgacctgggaggtgaagt 1072
>gb|DQ228328.1| Solanum tuberosum clone 135G05 elongation factor 1-alpha-like protein mRNA, complete cds Length = 1708 Score = 182 bits (92), Expect = 8e-43 Identities = 283/348 (81%) Strand = Plus / Minus Query: 209 gcagccttggtaaccttggcgccggtcggctccttcttctcnacgctcttgatcacaccc 268 ||||||||||| |||||||| || || || |||||||| || || |||||| || || Sbjct: 1390 gcagccttggtgaccttggcaccagttgggtccttcttgtcaacattcttgacaacgcca 1331 Query: 269 acagcaaccgtctgcctnatgtcacgcacggcaaaccgacccagaggagggtactgggca 328 |||||||| || ||||| ||||| | ||| ||||| ||||||| || ||||||| ||| Sbjct: 1330 acagcaacagtttgcctcatgtccctcacagcaaaacgacccaatggtgggtactcagca 1271 Query: 329 aaggtctccaccaccatgggcttggttggaatcatcttgacgaacccagcatcaccattc 388 |||||||| || ||||| |||||||| ||||||||||| || | || |||||||||||| Sbjct: 1270 aaggtctcaacaaccataggcttggtgggaatcatcttaaccatacctgcatcaccattc 1211 Query: 389 ttgagaaacttgggcgctgcctccagctccttgccggaccgcctgtcgatcttggtctgg 448 || | ||||| ||| | ||| || ||||| || || |||||||| ||||||||| | Sbjct: 1210 ttcaagaacttaggctccttctcaagttccttacctgaacgcctgtcaatcttggtcaag 1151 Query: 449 atctcggcgaacttgacggcnatgtgggatgtgtggcagtccagcacangggcataaccg 508 ||||| || |||||||| || |||||||| ||||||||||| ||||| | ||||| || Sbjct: 1150 atctcagcaaacttgacagcaatgtgggaagtgtggcagtcgagcactggtgcatatcca 1091 Query: 509 ttgctgatctggccagggtggttcatgatgatgacctgggcagtgaag 556 || | ||||||||||| |||||||||||||||||||||||||||||| Sbjct: 1090 tttccaatctggccaggatggttcatgatgatgacctgggcagtgaag 1043
>gb|DQ228326.1| Solanum tuberosum clone 135F02 elongation factor 1-alpha-like protein mRNA, complete cds Length = 1753 Score = 182 bits (92), Expect = 8e-43 Identities = 283/348 (81%) Strand = Plus / Minus Query: 209 gcagccttggtaaccttggcgccggtcggctccttcttctcnacgctcttgatcacaccc 268 ||||||||||| |||||||| || || || |||||||| || || |||||| ||||| Sbjct: 1379 gcagccttggtcaccttggcaccagttgggtccttcttgtcaacattcttgacaacacca 1320 Query: 269 acagcaaccgtctgcctnatgtcacgcacggcaaaccgacccagaggagggtactgggca 328 |||||||| || ||||| ||||| | ||| ||||| ||||||| || ||||| | ||| Sbjct: 1319 acagcaacagtttgcctcatgtccctcacagcaaaacgacccaatggtgggtattcagca 1260 Query: 329 aaggtctccaccaccatgggcttggttggaatcatcttgacgaacccagcatcaccattc 388 |||||||| || |||||||||||||| ||||||||||| || | ||||||||||| ||| Sbjct: 1259 aaggtctcaacaaccatgggcttggtgggaatcatcttaaccataccagcatcaccgttc 1200 Query: 389 ttgagaaacttgggcgctgcctccagctccttgccggaccgcctgtcgatcttggtctgg 448 || | ||||| ||| | ||| || ||||| || || |||||||| ||||||||| | Sbjct: 1199 ttcaagaacttaggctccttctcaagttccttacctgaacgcctgtcaatcttggtcaag 1140 Query: 449 atctcggcgaacttgacggcnatgtgggatgtgtggcagtccagcacangggcataaccg 508 ||||| || ||||| || || |||||||| ||||| ||||| ||||| | ||||| ||| Sbjct: 1139 atctcagcaaactttacagcaatgtgggaagtgtgacagtcaagcactggagcatatccg 1080 Query: 509 ttgctgatctggccagggtggttcatgatgatgacctgggcagtgaag 556 || | ||||||||||| |||||||||||||||||||||||||||||| Sbjct: 1079 tttccaatctggccaggatggttcatgatgatgacctgggcagtgaag 1032
>gb|DQ222490.1| Solanum tuberosum clone 098G02 elongation factor 1-alpha-like protein mRNA, complete cds Length = 1723 Score = 182 bits (92), Expect = 8e-43 Identities = 283/348 (81%) Strand = Plus / Minus Query: 209 gcagccttggtaaccttggcgccggtcggctccttcttctcnacgctcttgatcacaccc 268 ||||||||||| |||||||| || || || |||||||| || || |||||| ||||| Sbjct: 1390 gcagccttggtcaccttggcaccagttgggtccttcttgtcaacattcttgacaacacca 1331 Query: 269 acagcaaccgtctgcctnatgtcacgcacggcaaaccgacccagaggagggtactgggca 328 |||||||| || ||||| ||||| | ||| ||||| ||||||| || ||||| | ||| Sbjct: 1330 acagcaacagtttgcctcatgtccctcacagcaaaacgacccaatggtgggtattcagca 1271 Query: 329 aaggtctccaccaccatgggcttggttggaatcatcttgacgaacccagcatcaccattc 388 |||||||| || |||||||||||||| ||||||||||| || | ||||||||||| ||| Sbjct: 1270 aaggtctcaacaaccatgggcttggtgggaatcatcttaaccataccagcatcaccgttc 1211 Query: 389 ttgagaaacttgggcgctgcctccagctccttgccggaccgcctgtcgatcttggtctgg 448 || | ||||| ||| | ||| || ||||| || || |||||||| ||||||||| | Sbjct: 1210 ttcaagaacttaggctccttctcaagttccttacctgaacgcctgtcaatcttggtcaag 1151 Query: 449 atctcggcgaacttgacggcnatgtgggatgtgtggcagtccagcacangggcataaccg 508 ||||| || ||||| || || |||||||| ||||| ||||| ||||| | ||||| ||| Sbjct: 1150 atctcagcaaactttacagcaatgtgggaagtgtgacagtcaagcactggagcatatccg 1091 Query: 509 ttgctgatctggccagggtggttcatgatgatgacctgggcagtgaag 556 || | ||||||||||| |||||||||||||||||||||||||||||| Sbjct: 1090 tttccaatctggccaggatggttcatgatgatgacctgggcagtgaag 1043
>gb|AY496125.1| Capsicum annuum elongation factor 1-alpha mRNA, complete cds Length = 635 Score = 182 bits (92), Expect = 8e-43 Identities = 283/348 (81%) Strand = Plus / Minus Query: 209 gcagccttggtaaccttggcgccggtcggctccttcttctcnacgctcttgatcacaccc 268 ||||||||||| |||||||| || || || |||||||| || || |||||| ||||| Sbjct: 521 gcagccttggtgaccttggcaccagttgggtccttcttgtcaacattcttgacaacacca 462 Query: 269 acagcaaccgtctgcctnatgtcacgcacggcaaaccgacccagaggagggtactgggca 328 |||||||| || ||||| ||||| | ||| ||||| ||||||| || ||||| | ||| Sbjct: 461 acagcaacagtttgcctcatgtctctcacagcaaaacgacccaatggtgggtattcagca 402 Query: 329 aaggtctccaccaccatgggcttggttggaatcatcttgacgaacccagcatcaccattc 388 ||||| || |||||||| |||||||| ||||||||||| || | ||||||||||||||| Sbjct: 401 aaggtttcaaccaccattggcttggtgggaatcatcttaaccatgccagcatcaccattc 342 Query: 389 ttgagaaacttgggcgctgcctccagctccttgccggaccgcctgtcgatcttggtctgg 448 || | ||||| ||| | ||| || ||||| || || |||||||||||||||||| Sbjct: 341 ttcaagaacttaggctccttctcgagttccttacctgaacgcctgtcgatcttggtcaaa 282 Query: 449 atctcggcgaacttgacggcnatgtgggatgtgtggcagtccagcacangggcataaccg 508 ||||| || |||||||| || |||||||| ||||||||||| || || ||||||| || Sbjct: 281 atctcagcaaacttgacagcaatgtgggaagtgtggcagtcgagaactggggcatatcca 222 Query: 509 ttgctgatctggccagggtggttcatgatgatgacctgggcagtgaag 556 || | ||||| ||||| |||||||||||||||||||||||||||||| Sbjct: 221 tttccaatctgtccaggatggttcatgatgatgacctgggcagtgaag 174
>dbj|AB061263.1| Solanum tuberosum EF-1-alpha mRNA for Elongation factor 1-alpha, complete cds Length = 1756 Score = 182 bits (92), Expect = 8e-43 Identities = 283/348 (81%) Strand = Plus / Minus Query: 209 gcagccttggtaaccttggcgccggtcggctccttcttctcnacgctcttgatcacaccc 268 ||||||||||| || ||||| || || || |||||||| || || |||||| ||||| Sbjct: 1379 gcagccttggtcactttggcaccagttgggtccttcttgtcaacattcttgacaacaccg 1320 Query: 269 acagcaaccgtctgcctnatgtcacgcacggcaaaccgacccagaggagggtactgggca 328 |||||||| || ||||| ||||| | ||| ||||| ||||||| || ||||| | ||| Sbjct: 1319 acagcaacagtttgcctcatgtctctcacagcaaaacgacccaatggtgggtattcagca 1260 Query: 329 aaggtctccaccaccatgggcttggttggaatcatcttgacgaacccagcatcaccattc 388 |||||||| || |||||||||||||| ||||||||||| || | ||||||||||| ||| Sbjct: 1259 aaggtctcaacaaccatgggcttggtgggaatcatcttaaccataccagcatcaccgttc 1200 Query: 389 ttgagaaacttgggcgctgcctccagctccttgccggaccgcctgtcgatcttggtctgg 448 || | ||||| ||| | ||| || ||||| || || |||||||| ||||||||| | Sbjct: 1199 ttcaagaacttaggctccttctcaagttccttacctgaacgcctgtcaatcttggtcaag 1140 Query: 449 atctcggcgaacttgacggcnatgtgggatgtgtggcagtccagcacangggcataaccg 508 ||||| || |||||||| || |||||||| ||||| ||||| ||||| | ||||| ||| Sbjct: 1139 atctcagcaaacttgacagcaatgtgggaagtgtgacagtcaagcactggagcatatccg 1080 Query: 509 ttgctgatctggccagggtggttcatgatgatgacctgggcagtgaag 556 || | ||||||||||| |||||||||||||||||||||||||||||| Sbjct: 1079 tttccaatctggccaggatggttcatgatgatgacctgggcagtgaag 1032
>ref|NM_125432.2| Arabidopsis thaliana calmodulin binding / translation elongation factor AT5G60390 transcript variant AT5G60390.1 mRNA, complete cds Length = 1761 Score = 176 bits (89), Expect = 5e-41 Identities = 283/349 (81%) Strand = Plus / Minus Query: 209 gcagccttggtaaccttggcgccggtcggctccttcttctcnacgctcttgatcacaccc 268 ||||||||||| |||||||| || || || |||||||| || |||||||| || ||||| Sbjct: 1394 gcagccttggtgaccttggctccagttgggtccttcttgtccacgctcttaataacacca 1335 Query: 269 acagcaaccgtctgcctnatgtcacgcacggcaaaccgacccagaggagggtactgggca 328 |||||||| |||||||| ||||| | || || || || |||| ||| ||||||| || Sbjct: 1334 acagcaacggtctgcctcatgtccctaacagcgaaacgtcccaaaggtgggtactcggag 1275 Query: 329 aaggtctccaccaccatgggcttggttggaatcatcttgacgaacccagcatcaccattc 388 || ||||| || ||||||||||||||||| ||||||| || | ||||| ||||||||| Sbjct: 1274 aaagtctcaacaaccatgggcttggttggggtcatcttaaccataccagcgtcaccattc 1215 Query: 389 ttgagaaacttgggcgctgcctccagctccttgccggaccgcctgtcgatcttggtctgg 448 || | |||||||||| | ||| | |||||| || || |||||||| ||||||||| | Sbjct: 1214 ttcaaaaacttgggctccttctcaatctccttaccagaacgcctgtcaatcttggtcaag 1155 Query: 449 atctcggcgaacttgacggcnatgtgggatgtgtggcagtccagcacangggcataaccg 508 ||||| | ||||||||| || ||||| || |||||||| || || || |||| |||||| Sbjct: 1154 atctcagagaacttgactgcaatgtgagaggtgtggcaatcgagaactggggcgtaaccg 1095 Query: 509 ttgctgatctggccagggtggttcatgatgatgacctgggcagtgaagt 557 || | ||||| |||||||||||||||||||||||||||| ||||||| Sbjct: 1094 ttaccaatctgaccagggtggttcatgatgatgacctgggaggtgaagt 1046
>gb|BT000688.1| Arabidopsis thaliana clone RAFL08-11-M03 (R11086) putative translation elongation factor eEF-1 alpha chain (gene A4) (At5g60390) mRNA, complete cds Length = 1653 Score = 176 bits (89), Expect = 5e-41 Identities = 283/349 (81%) Strand = Plus / Minus Query: 209 gcagccttggtaaccttggcgccggtcggctccttcttctcnacgctcttgatcacaccc 268 ||||||||||| |||||||| || || || |||||||| || |||||||| || ||||| Sbjct: 1391 gcagccttggtgaccttggctccagttgggtccttcttgtccacgctcttaataacacca 1332 Query: 269 acagcaaccgtctgcctnatgtcacgcacggcaaaccgacccagaggagggtactgggca 328 |||||||| |||||||| ||||| | || || || || |||| ||| ||||||| || Sbjct: 1331 acagcaacggtctgcctcatgtccctaacagcgaaacgtcccaaaggtgggtactcggag 1272 Query: 329 aaggtctccaccaccatgggcttggttggaatcatcttgacgaacccagcatcaccattc 388 || ||||| || ||||||||||||||||| ||||||| || | ||||| ||||||||| Sbjct: 1271 aaagtctcaacaaccatgggcttggttggggtcatcttaaccataccagcgtcaccattc 1212 Query: 389 ttgagaaacttgggcgctgcctccagctccttgccggaccgcctgtcgatcttggtctgg 448 || | |||||||||| | ||| | |||||| || || |||||||| ||||||||| | Sbjct: 1211 ttcaaaaacttgggctccttctcaatctccttaccagaacgcctgtcaatcttggtcaag 1152 Query: 449 atctcggcgaacttgacggcnatgtgggatgtgtggcagtccagcacangggcataaccg 508 ||||| | ||||||||| || ||||| || |||||||| || || || |||| |||||| Sbjct: 1151 atctcagagaacttgactgcaatgtgagaggtgtggcaatcgagaactggggcgtaaccg 1092 Query: 509 ttgctgatctggccagggtggttcatgatgatgacctgggcagtgaagt 557 || | ||||| |||||||||||||||||||||||||||| ||||||| Sbjct: 1091 ttaccaatctgaccagggtggttcatgatgatgacctgggaggtgaagt 1043
>gb|AF360167.1| Arabidopsis thaliana putative translation elongation factor eEF-1 alpha chain A4 (At5g60390) mRNA, complete cds Length = 1597 Score = 176 bits (89), Expect = 5e-41 Identities = 283/349 (81%) Strand = Plus / Minus Query: 209 gcagccttggtaaccttggcgccggtcggctccttcttctcnacgctcttgatcacaccc 268 ||||||||||| |||||||| || || || |||||||| || |||||||| || ||||| Sbjct: 1389 gcagccttggtgaccttggctccagttgggtccttcttgtccacgctcttaataacacca 1330 Query: 269 acagcaaccgtctgcctnatgtcacgcacggcaaaccgacccagaggagggtactgggca 328 |||||||| |||||||| ||||| | || || || || |||| ||| ||||||| || Sbjct: 1329 acagcaacggtctgcctcatgtccctaacagcgaaacgtcccaaaggtgggtactcggag 1270 Query: 329 aaggtctccaccaccatgggcttggttggaatcatcttgacgaacccagcatcaccattc 388 || ||||| || ||||||||||||||||| ||||||| || | ||||| ||||||||| Sbjct: 1269 aaagtctcaacaaccatgggcttggttggggtcatcttaaccataccagcgtcaccattc 1210 Query: 389 ttgagaaacttgggcgctgcctccagctccttgccggaccgcctgtcgatcttggtctgg 448 || | |||||||||| | ||| | |||||| || || |||||||| ||||||||| | Sbjct: 1209 ttcaaaaacttgggctccttctcaatctccttaccagaacgcctgtcaatcttggtcaag 1150 Query: 449 atctcggcgaacttgacggcnatgtgggatgtgtggcagtccagcacangggcataaccg 508 ||||| | ||||||||| || ||||| || |||||||| || || || |||| |||||| Sbjct: 1149 atctcagagaacttgactgcaatgtgagaggtgtggcaatcgagaactggggcgtaaccg 1090 Query: 509 ttgctgatctggccagggtggttcatgatgatgacctgggcagtgaagt 557 || | ||||| |||||||||||||||||||||||||||| ||||||| Sbjct: 1089 ttaccaatctgaccagggtggttcatgatgatgacctgggaggtgaagt 1041
>gb|AY140099.1| Arabidopsis thaliana unknown protein mRNA, complete cds Length = 1601 Score = 176 bits (89), Expect = 5e-41 Identities = 283/349 (81%) Strand = Plus / Minus Query: 209 gcagccttggtaaccttggcgccggtcggctccttcttctcnacgctcttgatcacaccc 268 ||||||||||| |||||||| || || || |||||||| || |||||||| || ||||| Sbjct: 1393 gcagccttggtgaccttggctccagttgggtccttcttgtccacgctcttaataacacca 1334 Query: 269 acagcaaccgtctgcctnatgtcacgcacggcaaaccgacccagaggagggtactgggca 328 |||||||| |||||||| ||||| | || || || || |||| ||| ||||||| || Sbjct: 1333 acagcaacggtctgcctcatgtccctaacagcgaaacgtcccaaaggtgggtactcggag 1274 Query: 329 aaggtctccaccaccatgggcttggttggaatcatcttgacgaacccagcatcaccattc 388 || ||||| || ||||||||||||||||| ||||||| || | ||||| ||||||||| Sbjct: 1273 aaagtctcaacaaccatgggcttggttggggtcatcttaaccataccagcgtcaccattc 1214 Query: 389 ttgagaaacttgggcgctgcctccagctccttgccggaccgcctgtcgatcttggtctgg 448 || | |||||||||| | ||| | |||||| || || |||||||| ||||||||| | Sbjct: 1213 ttcaaaaacttgggctccttctcaatctccttaccagaacgcctgtcaatcttggtcaag 1154 Query: 449 atctcggcgaacttgacggcnatgtgggatgtgtggcagtccagcacangggcataaccg 508 ||||| | ||||||||| || ||||| || |||||||| || || || |||| |||||| Sbjct: 1153 atctcagagaacttgactgcaatgtgagaggtgtggcaatcgagaactggggcgtaaccg 1094 Query: 509 ttgctgatctggccagggtggttcatgatgatgacctgggcagtgaagt 557 || | ||||| |||||||||||||||||||||||||||| ||||||| Sbjct: 1093 ttaccaatctgaccagggtggttcatgatgatgacctgggaggtgaagt 1045
>gb|AY140095.1| Arabidopsis thaliana unknown protein mRNA, complete cds Length = 1615 Score = 176 bits (89), Expect = 5e-41 Identities = 283/349 (81%) Strand = Plus / Minus Query: 209 gcagccttggtaaccttggcgccggtcggctccttcttctcnacgctcttgatcacaccc 268 ||||||||||| |||||||| || || || |||||||| || |||||||| || ||||| Sbjct: 1390 gcagccttggtgaccttggctccagttgggtccttcttgtccacgctcttaataacacca 1331 Query: 269 acagcaaccgtctgcctnatgtcacgcacggcaaaccgacccagaggagggtactgggca 328 |||||||| |||||||| ||||| | || || || || |||| ||| ||||||| || Sbjct: 1330 acagcaacggtctgcctcatgtccctaacagcgaaacgtcccaaaggtgggtactcggag 1271 Query: 329 aaggtctccaccaccatgggcttggttggaatcatcttgacgaacccagcatcaccattc 388 || ||||| || ||||||||||||||||| ||||||| || | ||||| ||||||||| Sbjct: 1270 aaagtctcaacaaccatgggcttggttggggtcatcttaaccataccagcgtcaccattc 1211 Query: 389 ttgagaaacttgggcgctgcctccagctccttgccggaccgcctgtcgatcttggtctgg 448 || | |||||||||| | ||| | |||||| || || |||||||| ||||||||| | Sbjct: 1210 ttcaaaaacttgggctccttctcaatctccttaccagaacgcctgtcaatcttggtcaag 1151 Query: 449 atctcggcgaacttgacggcnatgtgggatgtgtggcagtccagcacangggcataaccg 508 ||||| | ||||||||| || ||||| || |||||||| || || || |||| |||||| Sbjct: 1150 atctcagagaacttgactgcaatgtgagaggtgtggcaatcgagaactggggcgtaaccg 1091 Query: 509 ttgctgatctggccagggtggttcatgatgatgacctgggcagtgaagt 557 || | ||||| |||||||||||||||||||||||||||| ||||||| Sbjct: 1090 ttaccaatctgaccagggtggttcatgatgatgacctgggaggtgaagt 1042
>gb|AY133532.1| Arabidopsis thaliana At5g60390/muf9_40 mRNA, complete cds Length = 1350 Score = 176 bits (89), Expect = 5e-41 Identities = 283/349 (81%) Strand = Plus / Minus Query: 209 gcagccttggtaaccttggcgccggtcggctccttcttctcnacgctcttgatcacaccc 268 ||||||||||| |||||||| || || || |||||||| || |||||||| || ||||| Sbjct: 1328 gcagccttggtgaccttggctccagttgggtccttcttgtccacgctcttaataacacca 1269 Query: 269 acagcaaccgtctgcctnatgtcacgcacggcaaaccgacccagaggagggtactgggca 328 |||||||| |||||||| ||||| | || || || || |||| ||| ||||||| || Sbjct: 1268 acagcaacggtctgcctcatgtccctaacagcgaaacgtcccaaaggtgggtactcggag 1209 Query: 329 aaggtctccaccaccatgggcttggttggaatcatcttgacgaacccagcatcaccattc 388 || ||||| || ||||||||||||||||| ||||||| || | ||||| ||||||||| Sbjct: 1208 aaagtctcaacaaccatgggcttggttggggtcatcttaaccataccagcgtcaccattc 1149 Query: 389 ttgagaaacttgggcgctgcctccagctccttgccggaccgcctgtcgatcttggtctgg 448 || | |||||||||| | ||| | |||||| || || |||||||| ||||||||| | Sbjct: 1148 ttcaaaaacttgggctccttctcaatctccttaccagaacgcctgtcaatcttggtcaag 1089 Query: 449 atctcggcgaacttgacggcnatgtgggatgtgtggcagtccagcacangggcataaccg 508 ||||| | ||||||||| || ||||| || |||||||| || || || |||| |||||| Sbjct: 1088 atctcagagaacttgactgcaatgtgagaggtgtggcaatcgagaactggggcgtaaccg 1029 Query: 509 ttgctgatctggccagggtggttcatgatgatgacctgggcagtgaagt 557 || | ||||| |||||||||||||||||||||||||||| ||||||| Sbjct: 1028 ttaccaatctgaccagggtggttcatgatgatgacctgggaggtgaagt 980
>gb|AY128802.1| Arabidopsis thaliana elongation factor 1-alpha mRNA, complete cds Length = 1526 Score = 176 bits (89), Expect = 5e-41 Identities = 283/349 (81%) Strand = Plus / Minus Query: 209 gcagccttggtaaccttggcgccggtcggctccttcttctcnacgctcttgatcacaccc 268 ||||||||||| |||||||| || || || |||||||| || |||||||| || ||||| Sbjct: 1328 gcagccttggtgaccttggctccagttgggtccttcttgtccacgctcttaataacacca 1269 Query: 269 acagcaaccgtctgcctnatgtcacgcacggcaaaccgacccagaggagggtactgggca 328 |||||||| |||||||| ||||| | || || || || |||| ||| ||||||| || Sbjct: 1268 acagcaacggtctgcctcatgtccctaacagcgaaacgtcccaaaggtgggtactcggag 1209 Query: 329 aaggtctccaccaccatgggcttggttggaatcatcttgacgaacccagcatcaccattc 388 || ||||| || ||||||||||||||||| ||||||| || | ||||| ||||||||| Sbjct: 1208 aaagtctcaacaaccatgggcttggttggggtcatcttaaccataccagcgtcaccattc 1149 Query: 389 ttgagaaacttgggcgctgcctccagctccttgccggaccgcctgtcgatcttggtctgg 448 || | |||||||||| | ||| | |||||| || || |||||||| ||||||||| | Sbjct: 1148 ttcaaaaacttgggctccttctcaatctccttaccagaacgcctgtcaatcttggtcaag 1089 Query: 449 atctcggcgaacttgacggcnatgtgggatgtgtggcagtccagcacangggcataaccg 508 ||||| | ||||||||| || ||||| || |||||||| || || || |||| |||||| Sbjct: 1088 atctcagagaacttgactgcaatgtgagaggtgtggcaatcgagaactggggcgtaaccg 1029 Query: 509 ttgctgatctggccagggtggttcatgatgatgacctgggcagtgaagt 557 || | ||||| |||||||||||||||||||||||||||| ||||||| Sbjct: 1028 ttaccaatctgaccagggtggttcatgatgatgacctgggaggtgaagt 980
>gb|AY060564.1| Arabidopsis thaliana AT5g60390/muf9_40 mRNA, complete cds Length = 1595 Score = 176 bits (89), Expect = 5e-41 Identities = 283/349 (81%) Strand = Plus / Minus Query: 209 gcagccttggtaaccttggcgccggtcggctccttcttctcnacgctcttgatcacaccc 268 ||||||||||| |||||||| || || || |||||||| || |||||||| || ||||| Sbjct: 1391 gcagccttggtgaccttggctccagttgggtccttcttgtccacgctcttaataacacca 1332 Query: 269 acagcaaccgtctgcctnatgtcacgcacggcaaaccgacccagaggagggtactgggca 328 |||||||| |||||||| ||||| | || || || || |||| ||| ||||||| || Sbjct: 1331 acagcaacggtctgcctcatgtccctaacagcgaaacgtcccaaaggtgggtactcggag 1272 Query: 329 aaggtctccaccaccatgggcttggttggaatcatcttgacgaacccagcatcaccattc 388 || ||||| || ||||||||||||||||| ||||||| || | ||||| ||||||||| Sbjct: 1271 aaagtctcaacaaccatgggcttggttggggtcatcttaaccataccagcgtcaccattc 1212 Query: 389 ttgagaaacttgggcgctgcctccagctccttgccggaccgcctgtcgatcttggtctgg 448 || | |||||||||| | ||| | |||||| || || |||||||| ||||||||| | Sbjct: 1211 ttcaaaaacttgggctccttctcaatctccttaccagaacgcctgtcaatcttggtcaag 1152 Query: 449 atctcggcgaacttgacggcnatgtgggatgtgtggcagtccagcacangggcataaccg 508 ||||| | ||||||||| || ||||| || |||||||| || || || |||| |||||| Sbjct: 1151 atctcagagaacttgactgcaatgtgagaggtgtggcaatcgagaactggggcgtaaccg 1092 Query: 509 ttgctgatctggccagggtggttcatgatgatgacctgggcagtgaagt 557 || | ||||| |||||||||||||||||||||||||||| ||||||| Sbjct: 1091 ttaccaatctgaccagggtggttcatgatgatgacctgggaggtgaagt 1043
>gb|AF419586.1|AF419586 Arabidopsis thaliana AT5g60390/muf9_40 mRNA, complete cds Length = 1583 Score = 176 bits (89), Expect = 5e-41 Identities = 283/349 (81%) Strand = Plus / Minus Query: 209 gcagccttggtaaccttggcgccggtcggctccttcttctcnacgctcttgatcacaccc 268 ||||||||||| |||||||| || || || |||||||| || |||||||| || ||||| Sbjct: 1391 gcagccttggtgaccttggctccagttgggtccttcttgtccacgctcttaataacacca 1332 Query: 269 acagcaaccgtctgcctnatgtcacgcacggcaaaccgacccagaggagggtactgggca 328 |||||||| |||||||| ||||| | || || || || |||| ||| ||||||| || Sbjct: 1331 acagcaacggtctgcctcatgtccctaacagcgaaacgtcccaaaggtgggtactcggag 1272 Query: 329 aaggtctccaccaccatgggcttggttggaatcatcttgacgaacccagcatcaccattc 388 || ||||| || ||||||||||||||||| ||||||| || | ||||| ||||||||| Sbjct: 1271 aaagtctcaacaaccatgggcttggttggggtcatcttaaccataccagcgtcaccattc 1212 Query: 389 ttgagaaacttgggcgctgcctccagctccttgccggaccgcctgtcgatcttggtctgg 448 || | |||||||||| | ||| | |||||| || || |||||||| ||||||||| | Sbjct: 1211 ttcaaaaacttgggctccttctcaatctccttaccagaacgcctgtcaatcttggtcaag 1152 Query: 449 atctcggcgaacttgacggcnatgtgggatgtgtggcagtccagcacangggcataaccg 508 ||||| | ||||||||| || ||||| || |||||||| || || || |||| |||||| Sbjct: 1151 atctcagagaacttgactgcaatgtgagaggtgtggcaatcgagaactggggcgtaaccg 1092 Query: 509 ttgctgatctggccagggtggttcatgatgatgacctgggcagtgaagt 557 || | ||||| |||||||||||||||||||||||||||| ||||||| Sbjct: 1091 ttaccaatctgaccagggtggttcatgatgatgacctgggaggtgaagt 1043
>gb|AY059904.1| Arabidopsis thaliana elongation factor 1-alpha (EF-1-alpha) (MUF9.4) mRNA, complete cds Length = 1616 Score = 176 bits (89), Expect = 5e-41 Identities = 283/349 (81%) Strand = Plus / Minus Query: 209 gcagccttggtaaccttggcgccggtcggctccttcttctcnacgctcttgatcacaccc 268 ||||||||||| |||||||| || || || |||||||| || |||||||| || ||||| Sbjct: 1391 gcagccttggtgaccttggctccagttgggtccttcttgtccacgctcttaataacacca 1332 Query: 269 acagcaaccgtctgcctnatgtcacgcacggcaaaccgacccagaggagggtactgggca 328 |||||||| |||||||| ||||| | || || || || |||| ||| ||||||| || Sbjct: 1331 acagcaacggtctgcctcatgtccctaacagcgaaacgtcccaaaggtgggtactcggag 1272 Query: 329 aaggtctccaccaccatgggcttggttggaatcatcttgacgaacccagcatcaccattc 388 || ||||| || ||||||||||||||||| ||||||| || | ||||| ||||||||| Sbjct: 1271 aaagtctcaacaaccatgggcttggttggggtcatcttaaccataccagcgtcaccattc 1212 Query: 389 ttgagaaacttgggcgctgcctccagctccttgccggaccgcctgtcgatcttggtctgg 448 || | |||||||||| | ||| | |||||| || || |||||||| ||||||||| | Sbjct: 1211 ttcaaaaacttgggctccttctcaatctccttaccagaacgcctgtcaatcttggtcaag 1152 Query: 449 atctcggcgaacttgacggcnatgtgggatgtgtggcagtccagcacangggcataaccg 508 ||||| | ||||||||| || ||||| || |||||||| || || || |||| |||||| Sbjct: 1151 atctcagagaacttgactgcaatgtgagaggtgtggcaatcgagaactggggcgtaaccg 1092 Query: 509 ttgctgatctggccagggtggttcatgatgatgacctgggcagtgaagt 557 || | ||||| |||||||||||||||||||||||||||| ||||||| Sbjct: 1091 ttaccaatctgaccagggtggttcatgatgatgacctgggaggtgaagt 1043
>dbj|AK221176.1| Arabidopsis thaliana mRNA for translation elongation factor eEF-1 alpha chain, partial cds, clone: RAFL22-97-N17 Length = 623 Score = 176 bits (89), Expect = 5e-41 Identities = 283/349 (81%) Strand = Plus / Minus Query: 209 gcagccttggtaaccttggcgccggtcggctccttcttctcnacgctcttgatcacaccc 268 ||||||||||| |||||||| || || || |||||||| || |||||||| || ||||| Sbjct: 410 gcagccttggtgaccttggctccagttgggtccttcttgtccacgctcttaataacacca 351 Query: 269 acagcaaccgtctgcctnatgtcacgcacggcaaaccgacccagaggagggtactgggca 328 |||||||| |||||||| ||||| | || || || || |||| ||| ||||||| || Sbjct: 350 acagcaacggtctgcctcatgtccctaacagcgaaacgtcccaaaggtgggtactcggag 291 Query: 329 aaggtctccaccaccatgggcttggttggaatcatcttgacgaacccagcatcaccattc 388 || ||||| || ||||||||||||||||| ||||||| || | ||||| ||||||||| Sbjct: 290 aaagtctcaacaaccatgggcttggttggggtcatcttaaccataccagcgtcaccattc 231 Query: 389 ttgagaaacttgggcgctgcctccagctccttgccggaccgcctgtcgatcttggtctgg 448 || | |||||||||| | ||| | |||||| || || |||||||| ||||||||| | Sbjct: 230 ttcaaaaacttgggctccttctcaatctccttaccagaacgcctgtcaatcttggtcaag 171 Query: 449 atctcggcgaacttgacggcnatgtgggatgtgtggcagtccagcacangggcataaccg 508 ||||| | ||||||||| || ||||| || |||||||| || || || |||| |||||| Sbjct: 170 atctcagagaacttgactgcaatgtgagaggtgtggcaatcgagaactggggcgtaaccg 111 Query: 509 ttgctgatctggccagggtggttcatgatgatgacctgggcagtgaagt 557 || | ||||| |||||||||||||||||||||||||||| ||||||| Sbjct: 110 ttaccaatctgaccagggtggttcatgatgatgacctgggaggtgaagt 62
>gb|BT006369.1| Arabidopsis thaliana At5g60390/muf9_40 gene, complete cds Length = 1350 Score = 176 bits (89), Expect = 5e-41 Identities = 283/349 (81%) Strand = Plus / Minus Query: 209 gcagccttggtaaccttggcgccggtcggctccttcttctcnacgctcttgatcacaccc 268 ||||||||||| |||||||| || || || |||||||| || |||||||| || ||||| Sbjct: 1328 gcagccttggtgaccttggctccagttgggtccttcttgtccacgctcttaataacacca 1269 Query: 269 acagcaaccgtctgcctnatgtcacgcacggcaaaccgacccagaggagggtactgggca 328 |||||||| |||||||| ||||| | || || || || |||| ||| ||||||| || Sbjct: 1268 acagcaacggtctgcctcatgtccctaacagcgaaacgtcccaaaggtgggtactcggag 1209 Query: 329 aaggtctccaccaccatgggcttggttggaatcatcttgacgaacccagcatcaccattc 388 || ||||| || ||||||||||||||||| ||||||| || | ||||| ||||||||| Sbjct: 1208 aaagtctcaacaaccatgggcttggttggggtcatcttaaccataccagcgtcaccattc 1149 Query: 389 ttgagaaacttgggcgctgcctccagctccttgccggaccgcctgtcgatcttggtctgg 448 || | |||||||||| | ||| | |||||| || || |||||||| ||||||||| | Sbjct: 1148 ttcaaaaacttgggctccttctcaatctccttaccagaacgcctgtcaatcttggtcaag 1089 Query: 449 atctcggcgaacttgacggcnatgtgggatgtgtggcagtccagcacangggcataaccg 508 ||||| | ||||||||| || ||||| || |||||||| || || || |||| |||||| Sbjct: 1088 atctcagagaacttgactgcaatgtgagaggtgtggcaatcgagaactggggcgtaaccg 1029 Query: 509 ttgctgatctggccagggtggttcatgatgatgacctgggcagtgaagt 557 || | ||||| |||||||||||||||||||||||||||| ||||||| Sbjct: 1028 ttaccaatctgaccagggtggttcatgatgatgacctgggaggtgaagt 980
>emb|BX829434.1|CNS0A06V Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB13ZG03 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1526 Score = 176 bits (89), Expect = 5e-41 Identities = 283/349 (81%) Strand = Plus / Minus Query: 209 gcagccttggtaaccttggcgccggtcggctccttcttctcnacgctcttgatcacaccc 268 ||||||||||| |||||||| || || || |||||||| || |||||||| || ||||| Sbjct: 1377 gcagccttggtgaccttggctccagttgggtccttcttgtccacgctcttaataacacca 1318 Query: 269 acagcaaccgtctgcctnatgtcacgcacggcaaaccgacccagaggagggtactgggca 328 |||||||| |||||||| ||||| | || || || || |||| ||| ||||||| || Sbjct: 1317 acagcaacggtctgcctcatgtccctaacagcgaaacgtcccaaaggtgggtactcggag 1258 Query: 329 aaggtctccaccaccatgggcttggttggaatcatcttgacgaacccagcatcaccattc 388 || ||||| || ||||||||||||||||| ||||||| || | ||||| ||||||||| Sbjct: 1257 aaagtctcaacaaccatgggcttggttggggtcatcttaaccataccagcgtcaccattc 1198 Query: 389 ttgagaaacttgggcgctgcctccagctccttgccggaccgcctgtcgatcttggtctgg 448 || | |||||||||| | ||| | |||||| || || ||||||| ||||||||| | Sbjct: 1197 ttcaaaaacttgggctccttctcaatctccttaccagaacgcctgtgaatcttggtcaag 1138 Query: 449 atctcggcgaacttgacggcnatgtgggatgtgtggcagtccagcacangggcataaccg 508 ||||| | ||||||||| || ||||| ||||||||||| || || || |||| |||||| Sbjct: 1137 atctcagagaacttgactgcgatgtgagatgtgtggcaatcgagaactggggcgtaaccg 1078 Query: 509 ttgctgatctggccagggtggttcatgatgatgacctgggcagtgaagt 557 || | ||||| |||||||||||||||||||||||||||| ||||||| Sbjct: 1077 ttaccaatctgaccagggtggttcatgatgatgacctgggaggtgaagt 1029
>gb|BT002510.1| Arabidopsis thaliana Unknown protein mRNA, complete cds Length = 1576 Score = 176 bits (89), Expect = 5e-41 Identities = 283/349 (81%) Strand = Plus / Minus Query: 209 gcagccttggtaaccttggcgccggtcggctccttcttctcnacgctcttgatcacaccc 268 ||||||||||| |||||||| || || || |||||||| || |||||||| || ||||| Sbjct: 1393 gcagccttggtgaccttggctccagttgggtccttcttgtccacgctcttaataacacca 1334 Query: 269 acagcaaccgtctgcctnatgtcacgcacggcaaaccgacccagaggagggtactgggca 328 |||||||| |||||||| ||||| | || || || || |||| ||| ||||||| || Sbjct: 1333 acagcaacggtctgcctcatgtccctaacagcgaaacgtcccaaaggtgggtactcggag 1274 Query: 329 aaggtctccaccaccatgggcttggttggaatcatcttgacgaacccagcatcaccattc 388 || ||||| || ||||||||||||||||| ||||||| || | ||||| ||||||||| Sbjct: 1273 aaagtctcaacaaccatgggcttggttggggtcatcttaaccataccagcgtcaccattc 1214 Query: 389 ttgagaaacttgggcgctgcctccagctccttgccggaccgcctgtcgatcttggtctgg 448 || | |||||||||| | ||| | |||||| || || |||||||| ||||||||| | Sbjct: 1213 ttcaaaaacttgggctccttctcaatctccttaccagaacgcctgtcaatcttggtcaag 1154 Query: 449 atctcggcgaacttgacggcnatgtgggatgtgtggcagtccagcacangggcataaccg 508 ||||| | ||||||||| || ||||| || |||||||| || || || |||| |||||| Sbjct: 1153 atctcagagaacttgactgcaatgtgagaggtgtggcaatcgagaactggggcgtaaccg 1094 Query: 509 ttgctgatctggccagggtggttcatgatgatgacctgggcagtgaagt 557 || | ||||| |||||||||||||||||||||||||||| ||||||| Sbjct: 1093 ttaccaatctgaccagggtggttcatgatgatgacctgggaggtgaagt 1045
>dbj|AB011483.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MUF9 Length = 77298 Score = 176 bits (89), Expect = 5e-41 Identities = 283/349 (81%) Strand = Plus / Minus Query: 209 gcagccttggtaaccttggcgccggtcggctccttcttctcnacgctcttgatcacaccc 268 ||||||||||| |||||||| || || || |||||||| || |||||||| || ||||| Sbjct: 11153 gcagccttggtgaccttggctccagttgggtccttcttgtccacgctcttaataacacca 11094 Query: 269 acagcaaccgtctgcctnatgtcacgcacggcaaaccgacccagaggagggtactgggca 328 |||||||| |||||||| ||||| | || || || || |||| ||| ||||||| || Sbjct: 11093 acagcaacggtctgcctcatgtccctaacagcgaaacgtcccaaaggtgggtactcggag 11034 Query: 329 aaggtctccaccaccatgggcttggttggaatcatcttgacgaacccagcatcaccattc 388 || ||||| || ||||||||||||||||| ||||||| || | ||||| ||||||||| Sbjct: 11033 aaagtctcaacaaccatgggcttggttggggtcatcttaaccataccagcgtcaccattc 10974 Query: 389 ttgagaaacttgggcgctgcctccagctccttgccggaccgcctgtcgatcttggtctgg 448 || | |||||||||| | ||| | |||||| || || |||||||| ||||||||| | Sbjct: 10973 ttcaaaaacttgggctccttctcaatctccttaccagaacgcctgtcaatcttggtcaag 10914 Query: 449 atctcggcgaacttgacggcnatgtgggatgtgtggcagtccagcacangggcataaccg 508 ||||| | ||||||||| || ||||| || |||||||| || || || |||| |||||| Sbjct: 10913 atctcagagaacttgactgcaatgtgagaggtgtggcaatcgagaactggggcgtaaccg 10854 Query: 509 ttgctgatctggccagggtggttcatgatgatgacctgggcagtgaagt 557 || | ||||| |||||||||||||||||||||||||||| ||||||| Sbjct: 10853 ttaccaatctgaccagggtggttcatgatgatgacctgggaggtgaagt 10805
>gb|AF181491.1|AF181491 Lilium longiflorum elongation factor-1 alpha 2 mRNA, complete cds Length = 1761 Score = 176 bits (89), Expect = 5e-41 Identities = 274/337 (81%) Strand = Plus / Minus Query: 221 accttggcgccggtcggctccttcttctcnacgctcttgatcacacccacagcaaccgtc 280 |||||||| || ||||| ||||||||||| || ||||||| |||||||||||||| ||| Sbjct: 1378 accttggctccagtcggttccttcttctccacattcttgataacacccacagcaacagtc 1319 Query: 281 tgcctnatgtcacgcacggcaaaccgacccagaggagggtactgggcaaaggtctccacc 340 ||||| |||||||| || |||||||| || || |||||||||| | ||| ||||||||| Sbjct: 1318 tgcctcatgtcacgaacagcaaaccgcccaagtggagggtactcagaaaaagtctccacc 1259 Query: 341 accatgggcttggttggaatcatcttgacgaacccagcatcaccattcttgagaaacttg 400 ||||| |||||||| ||||||||||| | | || ||||| |||||||| |||||||| Sbjct: 1258 accattggcttggtaggaatcatcttaatcatacccgcatctccattcttcagaaacttc 1199 Query: 401 ggcgctgcctccagctccttgccggaccgcctgtcgatcttggtctggatctcggcgaac 460 ||| | ||||| ||||||||| || |||| || ||||||||| |||||| |||| Sbjct: 1198 ggctccttctccaactccttgccagagcgccgatcaatcttggtcaagatctcattgaac 1139 Query: 461 ttgacggcnatgtgggatgtgtggcagtccagcacangggcataaccgttgctgatctgg 520 || || || ||||| || ||||| ||||| || ||| | ||||| || || | |||||| Sbjct: 1138 ttaacagcaatgtgagaggtgtgacagtcgagaacaggagcatagccattaccaatctgg 1079 Query: 521 ccagggtggttcatgatgatgacctgggcagtgaagt 557 || |||||||||||||| |||||||| | |||||||| Sbjct: 1078 ccggggtggttcatgataatgacctgagaagtgaagt 1042
>gb|AF041463.1|AF041463 Manihot esculenta elongation factor 1-alpha (MeEF1) gene, complete cds Length = 4866 Score = 176 bits (89), Expect = 5e-41 Identities = 250/305 (81%) Strand = Plus / Minus Query: 242 ttcttctcnacgctcttgatcacacccacagcaaccgtctgcctnatgtcacgcacggca 301 |||||||| || |||||||||||||| |||||||||||||| | ||||| | || || Sbjct: 4378 ttcttctcaacactcttgatcacaccaacagcaaccgtctggcgcatgtccctaacagcg 4319 Query: 302 aaccgacccagaggagggtactgggcaaaggtctccaccaccatgggcttggttggaatc 361 || | |||||| ||||||||| | || |||||||| |||||||||||||| |||||| Sbjct: 4318 aatctacccagtggagggtacgcagagaaagtctccacaaccatgggcttggtcggaatc 4259 Query: 362 atcttgacgaacccagcatcaccattcttgagaaacttgggcgctgcctccagctccttg 421 ||||| |||||||||||||||||||| || | |||||||||| | ||| ||||| ||| Sbjct: 4258 atcttcacgaacccagcatcaccatttttcaaaaacttgggctccttctcaagctctttg 4199 Query: 422 ccggaccgcctgtcgatcttggtctggatctcggcgaacttgacggcnatgtgggatgtg 481 || |||| | || ||||||||| ||| || || ||||| || || |||||||| ||| Sbjct: 4198 ccagacctacgatcaatcttggtcaagatttcagcaaacttcacagcaatgtgggaggtg 4139 Query: 482 tggcagtccagcacangggcataaccgttgctgatctggccagggtggttcatgatgatg 541 ||||| |||||||| |||||||||| || | ||||| ||||||||||||||||||||| Sbjct: 4138 tggcaatccagcactggggcataaccatttccaatctgaccagggtggttcatgatgatg 4079 Query: 542 acctg 546 ||||| Sbjct: 4078 acctg 4074
>gb|AF242732.1| Capsicum annuum translation elongation factor 1a mRNA, complete cds Length = 1521 Score = 174 bits (88), Expect = 2e-40 Identities = 282/348 (81%) Strand = Plus / Minus Query: 209 gcagccttggtaaccttggcgccggtcggctccttcttctcnacgctcttgatcacaccc 268 ||||||||||| |||||||| || || || |||||||| || || |||||| ||||| Sbjct: 1388 gcagccttggtgaccttggcaccagttgggtccttcttgtcaacattcttgacaacacca 1329 Query: 269 acagcaaccgtctgcctnatgtcacgcacggcaaaccgacccagaggagggtactgggca 328 |||||||| || ||||| ||||| | ||| ||||| ||||||| || |||| | ||| Sbjct: 1328 acagcaacagtttgcctcatgtctctcacagcaaaacgacccaatggtgggttttctgca 1269 Query: 329 aaggtctccaccaccatgggcttggttggaatcatcttgacgaacccagcatcaccattc 388 ||||| || |||||||| |||||||| ||||||||||| || | ||||||||||||||| Sbjct: 1268 aaggtttcaaccaccattggcttggtgggaatcatcttaaccatgccagcatcaccattc 1209 Query: 389 ttgagaaacttgggcgctgcctccagctccttgccggaccgcctgtcgatcttggtctgg 448 || || ||||| ||| | ||| || ||||| || |||| |||||||||||||||| Sbjct: 1208 ttaaggaacttaggctccttctcaagttccttacccgaccacctgtcgatcttggtcaaa 1149 Query: 449 atctcggcgaacttgacggcnatgtgggatgtgtggcagtccagcacangggcataaccg 508 ||||| | |||||||| || |||||||| ||||||||||| || || ||||||| || Sbjct: 1148 atctccccaaacttgacagcaatgtgggaagtgtggcagtcgagaactggggcatatcca 1089 Query: 509 ttgctgatctggccagggtggttcatgatgatgacctgggcagtgaag 556 || | ||||| ||||| |||||||||||||||||||||||||||||| Sbjct: 1088 tttccaatctgtccaggatggttcatgatgatgacctgggcagtgaag 1041
>gb|BT013246.1| Lycopersicon esculentum clone 134556F, mRNA sequence Length = 1728 Score = 174 bits (88), Expect = 2e-40 Identities = 282/348 (81%) Strand = Plus / Minus Query: 209 gcagccttggtaaccttggcgccggtcggctccttcttctcnacgctcttgatcacaccc 268 ||||||||||| || || || || || || || ||||| || ||| |||||| || || Sbjct: 1423 gcagccttggtgactttagcaccagtagggtctttcttgtcgacgttcttgacaactcca 1364 Query: 269 acagcaaccgtctgcctnatgtcacgcacggcaaaccgacccagaggagggtactgggca 328 |||||||| ||||| | ||||| | ||||||||| || |||| || ||||||| ||| Sbjct: 1363 acagcaacagtctgacgcatgtccctcacggcaaaacgtcccaatggtgggtactcagca 1304 Query: 329 aaggtctccaccaccatgggcttggttggaatcatcttgacgaacccagcatcaccattc 388 |||||||| || |||||||||||||| ||||||||||| || | || |||||||||||| Sbjct: 1303 aaggtctcaacaaccatgggcttggtgggaatcatcttaaccataccggcatcaccattc 1244 Query: 389 ttgagaaacttgggcgctgcctccagctccttgccggaccgcctgtcgatcttggtctgg 448 || | |||||||||| | ||| || ||||| || || || ||||| ||||||||| | Sbjct: 1243 ttcaaaaacttgggctccttctcaagttccttaccagaacgtctgtcaatcttggtcaag 1184 Query: 449 atctcggcgaacttgacggcnatgtgggatgtgtggcagtccagcacangggcataaccg 508 ||||| || |||||||| || |||||||| ||||||||||| ||||| ||||||| ||| Sbjct: 1183 atctcagcaaacttgacagcaatgtgggaggtgtggcagtcgagcactggggcatatccg 1124 Query: 509 ttgctgatctggccagggtggttcatgatgatgacctgggcagtgaag 556 || | ||||| |||||||||||||||||||| || |||||||||||| Sbjct: 1123 tttccaatctgaccagggtggttcatgatgataacttgggcagtgaag 1076
>gb|DQ057979.1| Musa acuminata elongation factor-1 alpha mRNA, complete cds Length = 1644 Score = 174 bits (88), Expect = 2e-40 Identities = 223/269 (82%) Strand = Plus / Minus Query: 215 ttggtaaccttggcgccggtcggctccttcttctcnacgctcttgatcacacccacagca 274 |||||||||||||| ||||| || ||||||||||| ||||| ||||| |||||||| ||| Sbjct: 1408 ttggtaaccttggctccggtgggatccttcttctccacgcttttgataacacccacggca 1349 Query: 275 accgtctgcctnatgtcacgcacggcaaaccgacccagaggagggtactgggcaaaggtc 334 |||||||| || ||||| | || ||||||| |||||| || | ||||| ||| || ||| Sbjct: 1348 accgtctgtctcatgtctctaacagcaaacctacccaggggcgagtactcggcgaaagtc 1289 Query: 335 tccaccaccatgggcttggttggaatcatcttgacgaacccagcatcaccattcttgaga 394 || |||||||| ||||| || ||||||||||| || || || ||||| ||||||||||| Sbjct: 1288 tcgaccaccatcggctttgtcggaatcatcttcaccaaacctgcatctccattcttgagg 1229 Query: 395 aacttgggcgctgcctccagctccttgccggaccgcctgtcgatcttggtctggatctcg 454 |||||||| | |||||||||||||||||| |||||||| ||||||||| | | ||| Sbjct: 1228 aacttgggttccttctccagctccttgccggatcgcctgtcaatcttggtcagaagctcc 1169 Query: 455 gcgaacttgacggcnatgtgggatgtgtg 483 || |||||||| || ||||| || ||||| Sbjct: 1168 gcaaacttgacagctatgtgagaagtgtg 1140
>gb|DQ294264.1| Solanum tuberosum clone 131C12 elongation factor 1-alpha-like protein mRNA, complete cds Length = 1685 Score = 174 bits (88), Expect = 2e-40 Identities = 282/348 (81%) Strand = Plus / Minus Query: 209 gcagccttggtaaccttggcgccggtcggctccttcttctcnacgctcttgatcacaccc 268 ||||||||||| || ||||| || || || || ||||| || ||| |||||| ||||| Sbjct: 1399 gcagccttggtgactttggcaccagtagggtctttcttgtcgacgttcttgacaacacca 1340 Query: 269 acagcaaccgtctgcctnatgtcacgcacggcaaaccgacccagaggagggtactgggca 328 |||||||| || || | ||||| | ||| ||||| || |||| || ||||||| ||| Sbjct: 1339 acagcaacagtttgacgcatgtccctcacagcaaaacgtcccaatggtgggtactcagca 1280 Query: 329 aaggtctccaccaccatgggcttggttggaatcatcttgacgaacccagcatcaccattc 388 |||||||| || |||||||||||||| ||||||||||| || | || |||||||| ||| Sbjct: 1279 aaggtctcaacaaccatgggcttggtgggaatcatcttaaccataccggcatcaccgttc 1220 Query: 389 ttgagaaacttgggcgctgcctccagctccttgccggaccgcctgtcgatcttggtctgg 448 || | |||||||||| | ||| || ||||| || || || ||||| ||||||||| | Sbjct: 1219 ttcaaaaacttgggctccttctcaagttccttaccagaacgtctgtcaatcttggtcaag 1160 Query: 449 atctcggcgaacttgacggcnatgtgggatgtgtggcagtccagcacangggcataaccg 508 ||||| ||||||||||| || |||||||| ||||||||||| ||||| ||||||| ||| Sbjct: 1159 atctcagcgaacttgacagcaatgtgggaggtgtggcagtcgagcactggggcatatccg 1100 Query: 509 ttgctgatctggccagggtggttcatgatgatgacctgggcagtgaag 556 || | ||||| |||||||||||||||||||| || |||||||||||| Sbjct: 1099 tttccaatctgaccagggtggttcatgatgataacttgggcagtgaag 1052
>emb|X96555.1|PSEF1ALPH P.sativum mRNA for elongation factor 1-alpha Length = 1670 Score = 172 bits (87), Expect = 8e-40 Identities = 278/343 (81%) Strand = Plus / Minus Query: 215 ttggtaaccttggcgccggtcggctccttcttctcnacgctcttgatcacacccacagca 274 ||||| |||||||| || || || ||||||||||| || |||||||| || || |||||| Sbjct: 1425 ttggtgaccttggctccagttgggtccttcttctccacactcttgatgactccgacagca 1366 Query: 275 accgtctgcctnatgtcacgcacggcaaaccgacccagaggagggtactgggcaaaggtc 334 || || || || ||||| | ||| ||||| ||||| |||||||| |||| ||||| || Sbjct: 1365 acagtttgtctcatgtccctcacagcaaaacgaccaagaggaggatactcagcaaaagtt 1306 Query: 335 tccaccaccatgggcttggttggaatcatcttgacgaacccagcatcaccattcttgaga 394 |||||||||||||||||||||||||||||||| || | || |||||||||||||| | | Sbjct: 1305 tccaccaccatgggcttggttggaatcatcttaaccataccggcatcaccattcttcaaa 1246 Query: 395 aacttgggcgctgcctccagctccttgccggaccgcctgtcgatcttggtctggatctcg 454 ||||||||| | ||| | |||||| || || |||||||| |||||||| | ||| Sbjct: 1245 aacttgggctccttctcaatctccttaccagatcgcctgtcaatcttggtgataagctca 1186 Query: 455 gcgaacttgacggcnatgtgggatgtgtggcagtccagcacangggcataaccgttgctg 514 || |||||||| || ||||| || |||||||| || || || | |||||||| || | Sbjct: 1185 gcaaacttgacagcaatgtgagaggtgtggcaatcaagaactggtgcataaccatttcca 1126 Query: 515 atctggccagggtggttcatgatgatgacctgggcagtgaagt 557 ||||| |||||||||||||||||||||||||||| ||||||| Sbjct: 1125 atctgtccagggtggttcatgatgatgacctgggacgtgaagt 1083
>gb|AY378166.1| Cichorium intybus elongation factor 1-alpha mRNA, complete cds Length = 1582 Score = 168 bits (85), Expect = 1e-38 Identities = 280/347 (80%) Strand = Plus / Minus Query: 209 gcagccttggtaaccttggcgccggtcggctccttcttctcnacgctcttgatcacaccc 268 ||||||||||| ||||| || || ||||| |||||||| || || ||||| | ||||| Sbjct: 1368 gcagccttggtcaccttagctccagtcgggtccttcttgtcaacattcttggtaacacca 1309 Query: 269 acagcaaccgtctgcctnatgtcacgcacggcaaaccgacccagaggagggtactgggca 328 |||||||||||||| | ||||| | ||||||||||| || || || ||||||| ||| Sbjct: 1308 acagcaaccgtctgacgcatgtccctcacggcaaaccttccaagnggggggtactcagca 1249 Query: 329 aaggtctccaccaccatgggcttggttggaatcatcttgacgaacccagcatcaccattc 388 || |||||||||||||| |||||||||||||||||||| || | |||||||| || ||| Sbjct: 1248 aaagtctccaccaccataggcttggttggaatcatcttaaccataccagcatctccgttc 1189 Query: 389 ttgagaaacttgggcgctgcctccagctccttgccggaccgcctgtcgatcttggtctgg 448 || | |||||| ||| | ||| |||||||| || || || ||||| ||||||||| Sbjct: 1188 ttcaaaaacttaggctccttctcaagctcctttccagatcgtctgtcaatcttggtcaac 1129 Query: 449 atctcggcgaacttgacggcnatgtgggatgtgtggcagtccagcacangggcataaccg 508 | || ||| || || || ||||||||||||||||| || ||||| | |||||||| Sbjct: 1128 agntcttggaatttaacagcaatgtgggatgtgtggcaatcgagcaccggagcataacca 1069 Query: 509 ttgctgatctggccagggtggttcatgatgatgacctgggcagtgaa 555 || | |||||| |||||||||||||||||||||||||||| |||||| Sbjct: 1068 tttccgatctgaccagggtggttcatgatgatgacctgggaagtgaa 1022
>gb|AY651886.1| Glycine max elongation factor 1A SMV resistance-related protein mRNA, partial cds Length = 965 Score = 168 bits (85), Expect = 1e-38 Identities = 282/349 (80%) Strand = Plus / Minus Query: 209 gcagccttggtaaccttggcgccggtcggctccttcttctcnacgctcttgatcacaccc 268 ||||||||||| |||||||| || || || ||||||||||| ||| ||||||| || ||| Sbjct: 566 gcagccttggtgaccttggctccagtaggatccttcttctccacgttcttgatgactccc 507 Query: 269 acagcaaccgtctgcctnatgtcacgcacggcaaaccgacccagaggagggtactgggca 328 |||||||| || || | || || | || ||||| ||||| || || ||||||| | Sbjct: 506 acagcaacagtttgacgcatatccctgacagcaaagcgaccaagtggggggtactcagag 447 Query: 329 aaggtctccaccaccatgggcttggttggaatcatcttgacgaacccagcatcaccattc 388 || || || ||||||||||| ||||| ||||||||||| || || ||||||||||||||| Sbjct: 446 aaagtttcaaccaccatgggtttggtcggaatcatcttaacaaaaccagcatcaccattc 387 Query: 389 ttgagaaacttgggcgctgcctccagctccttgccggaccgcctgtcgatcttggtctgg 448 || | ||||||||| | ||| ||||| ||||| || |||||||| ||||||||| | Sbjct: 386 ttcaaaaacttgggttccttctcaagctctttgccagatcgcctgtcaatcttggtcatg 327 Query: 449 atctcggcgaacttgacggcnatgtgggatgtgtggcagtccagcacangggcataaccg 508 | || || |||||||| || |||||||| ||||||||||| || ||| ||||||| || Sbjct: 326 agttcagcaaacttgacagcaatgtgggaagtgtggcagtcaagaacaggggcatagcca 267 Query: 509 ttgctgatctggccagggtggttcatgatgatgacctgggcagtgaagt 557 || | ||||| ||||| |||||||||||||| |||||||||||||||| Sbjct: 266 tttccaatctgaccaggatggttcatgatgataacctgggcagtgaagt 218
>gb|AY114651.1| Arabidopsis thaliana putative elongation factor 1-a (At1g07920) mRNA, complete cds Length = 1463 Score = 168 bits (85), Expect = 1e-38 Identities = 282/349 (80%) Strand = Plus / Minus Query: 209 gcagccttggtaaccttggcgccggtcggctccttcttctcnacgctcttgatcacaccc 268 |||||||||||||||||||| ||||| || |||||||| || || |||||||| |||| Sbjct: 1328 gcagccttggtaaccttggctccggttgggtccttcttgtcaacactcttgataacactg 1269 Query: 269 acagcaaccgtctgcctnatgtcacgcacggcaaaccgacccagaggagggtactgggca 328 || | ||| |||||||| ||||| | || || || || || || || ||||||| | Sbjct: 1268 actgtaacagtctgcctcatgtccctaacagcgaaacgtccaagtggtgggtactcagag 1209 Query: 329 aaggtctccaccaccatgggcttggttggaatcatcttgacgaacccagcatcaccattc 388 ||||||||||| |||||||||||||||||| ||||||| || | ||||||||||||||| Sbjct: 1208 aaggtctccacaaccatgggcttggttggagtcatcttcaccataccagcatcaccattc 1149 Query: 389 ttgagaaacttgggcgctgcctccagctccttgccggaccgcctgtcgatcttggtctgg 448 || | || |||||| | ||| | |||||| || || |||||||| ||||||||| | Sbjct: 1148 ttcaagaatttgggctccttctcaatctccttaccagaacgcctgtcaatcttggtcaag 1089 Query: 449 atctcggcgaacttgacggcnatgtgggatgtgtggcagtccagcacangggcataaccg 508 ||||| | ||||||||| || ||||| || |||||||| |||| || |||| |||||| Sbjct: 1088 atctcagagaacttgactgcaatgtgagaggtgtggcaatccaagactggggcgtaaccg 1029 Query: 509 ttgctgatctggccagggtggttcatgatgatgacctgggcagtgaagt 557 || | ||||| |||||||||||||||||||||||||||| ||||||| Sbjct: 1028 ttaccaatctgaccagggtggttcatgatgatgacctgggaggtgaagt 980
>gb|AY062553.1| Arabidopsis thaliana putative elongation factor 1-a (At1g07920; T6D22.2) mRNA, complete cds Length = 1778 Score = 168 bits (85), Expect = 1e-38 Identities = 282/349 (80%) Strand = Plus / Minus Query: 209 gcagccttggtaaccttggcgccggtcggctccttcttctcnacgctcttgatcacaccc 268 |||||||||||||||||||| ||||| || |||||||| || || |||||||| |||| Sbjct: 1424 gcagccttggtaaccttggctccggttgggtccttcttgtcaacactcttgataacactg 1365 Query: 269 acagcaaccgtctgcctnatgtcacgcacggcaaaccgacccagaggagggtactgggca 328 || | ||| |||||||| ||||| | || || || || || || || ||||||| | Sbjct: 1364 actgtaacagtctgcctcatgtccctaacagcgaaacgtccaagtggtgggtactcagag 1305 Query: 329 aaggtctccaccaccatgggcttggttggaatcatcttgacgaacccagcatcaccattc 388 ||||||||||| |||||||||||||||||| ||||||| || | ||||||||||||||| Sbjct: 1304 aaggtctccacaaccatgggcttggttggagtcatcttcaccataccagcatcaccattc 1245 Query: 389 ttgagaaacttgggcgctgcctccagctccttgccggaccgcctgtcgatcttggtctgg 448 || | || |||||| | ||| | |||||| || || |||||||| ||||||||| | Sbjct: 1244 ttcaagaatttgggctccttctcaatctccttaccagaacgcctgtcaatcttggtcaag 1185 Query: 449 atctcggcgaacttgacggcnatgtgggatgtgtggcagtccagcacangggcataaccg 508 ||||| | ||||||||| || ||||| || |||||||| |||| || |||| |||||| Sbjct: 1184 atctcagagaacttgactgcaatgtgagaggtgtggcaatccaagactggggcgtaaccg 1125 Query: 509 ttgctgatctggccagggtggttcatgatgatgacctgggcagtgaagt 557 || | ||||| |||||||||||||||||||||||||||| ||||||| Sbjct: 1124 ttaccaatctgaccagggtggttcatgatgatgacctgggaggtgaagt 1076
>gb|U80268.1|MDU80268 Malus domestica elongation factor 1 alpha (EF-1alpha) mRNA, partial cds Length = 748 Score = 168 bits (85), Expect = 1e-38 Identities = 282/349 (80%) Strand = Plus / Minus Query: 209 gcagccttggtaaccttggcgccggtcggctccttcttctcnacgctcttgatcacaccc 268 |||| |||||| |||||||| ||| | || ||||||||||| ||||||||||| ||||| Sbjct: 417 gcagacttggtgaccttggcaccgctgggatccttcttctcaacgctcttgataacacca 358 Query: 269 acagcaaccgtctgcctnatgtcacgcacggcaaaccgacccagaggagggtactgggca 328 |||||||| ||||| | |||||||| || ||||| ||||||| || ||||||| | Sbjct: 357 acagcaacagtctggcgcatgtcacgaacagcaaagcgacccaatggtgggtactcagag 298 Query: 329 aaggtctccaccaccatgggcttggttggaatcatcttgacgaacccagcatcaccattc 388 ||||||||||| |||||||||||||| |||| |||||| || | || ||||| || ||| Sbjct: 297 aaggtctccacaaccatgggcttggtgggaagcatcttcaccatacctgcatctccgttc 238 Query: 389 ttgagaaacttgggcgctgcctccagctccttgccggaccgcctgtcgatcttggtctgg 448 || | ||||| ||| | ||| | |||||| || |||| |||||| |||||||| || Sbjct: 237 ttcaagaactttggctccttctcaatctcctttccagacctcctgtcaatcttggtaagg 178 Query: 449 atctcggcgaacttgacggcnatgtgggatgtgtggcagtccagcacangggcataaccg 508 ||||| ||||||| || || ||||| || |||||||| ||||| || ||||||| ||| Sbjct: 177 atctcaccgaacttcacagcaatgtgtgaagtgtggcaatccagaactggggcatatccg 118 Query: 509 ttgctgatctggccagggtggttcatgatgatgacctgggcagtgaagt 557 || | |||||| |||||||||||||||||||| ||||||| ||||||| Sbjct: 117 ttaccgatctgaccagggtggttcatgatgataacctgggatgtgaagt 69
>emb|X16432.1|ATEF1AA4 Arabidopsis thaliana EF-1 alpha-A4 (NAEEFTU 4) gene for elongation factor 1-alpha Length = 2594 Score = 161 bits (81), Expect = 3e-36 Identities = 281/349 (80%) Strand = Plus / Minus Query: 209 gcagccttggtaaccttggcgccggtcggctccttcttctcnacgctcttgatcacaccc 268 ||||||||||| |||||||| || || || |||||||| || |||||||| || ||||| Sbjct: 2009 gcagccttggtgaccttggctccagttgggtccttcttgtccacgctcttaataacacca 1950 Query: 269 acagcaaccgtctgcctnatgtcacgcacggcaaaccgacccagaggagggtactgggca 328 |||||||| |||||||| ||||| | || || || || |||| ||| ||||||| || Sbjct: 1949 acagcaacggtctgcctcatgtccctaacagcgaaacgtcccaaaggtgggtactcggag 1890 Query: 329 aaggtctccaccaccatgggcttggttggaatcatcttgacgaacccagcatcaccattc 388 || ||||| || ||||||||||||||||| ||||||| || | ||||| ||||||||| Sbjct: 1889 aaagtctcaacaaccatgggcttggttggggtcatcttaaccataccagcgtcaccattc 1830 Query: 389 ttgagaaacttgggcgctgcctccagctccttgccggaccgcctgtcgatcttggtctgg 448 || | |||||||||| | ||| | |||||| || || || ||||| ||||||||| | Sbjct: 1829 ttcaaaaacttgggctccttctcaatctccttaccagaacgtctgtcaatcttggtcaag 1770 Query: 449 atctcggcgaacttgacggcnatgtgggatgtgtggcagtccagcacangggcataaccg 508 ||||| | |||||| || || ||||| || |||||||| || || || |||| |||||| Sbjct: 1769 atctcagagaactttactgcaatgtgagaggtgtggcaatcgagaactggggcgtaaccg 1710 Query: 509 ttgctgatctggccagggtggttcatgatgatgacctgggcagtgaagt 557 || | ||||| |||||||||||||||||||||||||||| ||||||| Sbjct: 1709 ttaccaatctgaccagggtggttcatgatgatgacctgggaggtgaagt 1661
>emb|AJ010225.1|CAR010225 Cicer arietinum mRNA for elongation factor 1-alpha (clone CanEF1-a2), partial Length = 626 Score = 161 bits (81), Expect = 3e-36 Identities = 281/349 (80%) Strand = Plus / Minus Query: 209 gcagccttggtaaccttggcgccggtcggctccttcttctcnacgctcttgatcacaccc 268 ||||| ||||| | |||||| || || || ||||||||||| || |||||||| ||||| Sbjct: 378 gcagctttggtgatcttggctccagttggatccttcttctcaacactcttgatgacaccg 319 Query: 269 acagcaaccgtctgcctnatgtcacgcacggcaaaccgacccagaggagggtactgggca 328 |||||||| || || | ||||| | |||||| || ||||| || || || |||| || Sbjct: 318 acagcaacagtttgacgcatgtccctcacggcgaaacgaccaagtggtggatactcggag 259 Query: 329 aaggtctccaccaccatgggcttggttggaatcatcttgacgaacccagcatcaccattc 388 || || ||||| ||||| |||||||||||||||||||| || | ||||||||||||||| Sbjct: 258 aaagtttccacaaccataggcttggttggaatcatcttaacaagaccagcatcaccattc 199 Query: 389 ttgagaaacttgggcgctgcctccagctccttgccggaccgcctgtcgatcttggtctgg 448 || | |||||| ||| | ||| || ||||| || || ||||||||||||||||| | Sbjct: 198 ttcaaaaacttaggctccttctcaagttccttaccagatcgcctgtcgatcttggtgaga 139 Query: 449 atctcggcgaacttgacggcnatgtgggatgtgtggcagtccagcacangggcataaccg 508 | ||| |||||||| || || |||||||| ||||| ||||| || || ||||||||||| Sbjct: 138 agctcagcgaacttaacagcaatgtgggaggtgtgacagtcgaggactggggcataaccg 79 Query: 509 ttgctgatctggccagggtggttcatgatgatgacctgggcagtgaagt 557 || | |||||| || || ||||||||||||||||| |||| |||||||| Sbjct: 78 tttccgatctgtcctggatggttcatgatgatgacttgggaagtgaagt 30
>emb|AJ223969.1|MDAJ39669 Malus domestica mRNA for elongation factor 1 alpha subunit Length = 1715 Score = 159 bits (80), Expect = 1e-35 Identities = 250/308 (81%) Strand = Plus / Minus Query: 239 tccttcttctcnacgctcttgatcacacccacagcaaccgtctgcctnatgtcacgcacg 298 ||||||||||| ||||||||||| ||||| || ||||| ||||| | ||||| | ||| Sbjct: 1392 tccttcttctcaacgctcttgatgacaccaactgcaacagtctggcgcatgtccctcaca 1333 Query: 299 gcaaaccgacccagaggagggtactgggcaaaggtctccaccaccatgggcttggttgga 358 ||||| || || || || ||||||| | |||||||| || |||||||||||||| ||| Sbjct: 1332 gcaaaacgtccgagcggtgggtactcagagaaggtctcaacaaccatgggcttggtggga 1273 Query: 359 atcatcttgacgaacccagcatcaccattcttgagaaacttgggcgctgcctccagctcc 418 | |||||| || || ||||||||||||||||| | |||||||||| | ||| |||||| Sbjct: 1272 agcatcttcacaaatccagcatcaccattctttaaaaacttgggctccttctcaagctcc 1213 Query: 419 ttgccggaccgcctgtcgatcttggtctggatctcggcgaacttgacggcnatgtgggat 478 ||||| || |||||||||||||| || || ||| || ||||||||||| |||||||| Sbjct: 1212 ttgccagatcgcctgtcgatctttgtaacgagctcagcaaacttgacggcaatgtgggag 1153 Query: 479 gtgtggcagtccagcacangggcataaccgttgctgatctggccagggtggttcatgatg 538 ||||| ||||| || || | ||||| || | | |||||||| ||||||||||||||| Sbjct: 1152 gtgtgacagtcgagaactggagcatatccctgtccaatctggccggggtggttcatgatg 1093 Query: 539 atgacctg 546 |||||||| Sbjct: 1092 atgacctg 1085
>gb|DQ399793.1| Phoenix dactylifera elongation factor 1-alpha mRNA, partial cds Length = 736 Score = 157 bits (79), Expect = 5e-35 Identities = 258/319 (80%) Strand = Plus / Minus Query: 239 tccttcttctcnacgctcttgatcacacccacagcaaccgtctgcctnatgtcacgcacg 298 ||||||||||| ||||||||||| ||||| ||||| || ||||| | ||||| | ||| Sbjct: 731 tccttcttctcaacgctcttgatgacaccaacagccactgtctggcgcatgtccctcaca 672 Query: 299 gcaaaccgacccagaggagggtactgggcaaaggtctccaccaccatgggcttggttgga 358 ||||| ||||| ||||| |||||||| | ||||||||| || |||||||||||||| ||| Sbjct: 671 gcaaaacgaccaagaggtgggtactgagaaaaggtctcaacaaccatgggcttggtagga 612 Query: 359 atcatcttgacgaacccagcatcaccattcttgagaaacttgggcgctgcctccagctcc 418 |||||||| || || || ||||||||| | || | ||||||||| | ||| || ||| Sbjct: 611 atcatcttaacaaaacctgcatcaccacttttcaaaaacttgggttccttctcaagttcc 552 Query: 419 ttgccggaccgcctgtcgatcttggtctggatctcggcgaacttgacggcnatgtgggat 478 || || ||||| ||||| |||| ||| ||||||| || ||||| || || ||||| || Sbjct: 551 tttccagaccgtctgtcaatctcggtaaggatctcagcaaacttaacagcaatgtgagag 492 Query: 479 gtgtggcagtccagcacangggcataaccgttgctgatctggccagggtggttcatgatg 538 ||||||||||| |||||| | |||||||| |||| ||||| ||||| || |||||||| Sbjct: 491 gtgtggcagtcaagcacaggagcataaccattgccaatctgaccaggatgattcatgata 432 Query: 539 atgacctgggcagtgaagt 557 || ||||| | |||||||| Sbjct: 431 ataacctgagaagtgaagt 413
>gb|AY832572.1| Pseudotsuga menziesii haplotype Pm-EF1A_18 translation elongation factor-1 alpha (EF1A) gene, partial cds Length = 1072 Score = 155 bits (78), Expect = 2e-34 Identities = 198/239 (82%) Strand = Plus / Minus Query: 269 acagcaaccgtctgcctnatgtcacgcacggcaaaccgacccagaggagggtactgggca 328 |||||||||||||| | ||||| | ||| ||||| ||||||| ||||| |||| |||| Sbjct: 670 acagcaaccgtctgacgcatgtccctcactgcaaaacgacccaatggaggatactcggca 611 Query: 329 aaggtctccaccaccatgggcttggttggaatcatcttgacgaacccagcatcaccattc 388 ||||| ||||| ||||| || |||||||||||||||||||| ||||||||||| || ||| Sbjct: 610 aaggtttccacaaccattggtttggttggaatcatcttgacaaacccagcatctccgttc 551 Query: 389 ttgagaaacttgggcgctgcctccagctccttgccggaccgcctgtcgatcttggtctgg 448 || ||||||||||| | ||||||||||||||| || |||||||| | ||||||| | Sbjct: 550 ttaagaaacttgggttccttctccagctccttgccagaacgcctgtcaaccttggtcatg 491 Query: 449 atctcggcgaacttgacggcnatgtgggatgtgtggcagtccagcacangggcataacc 507 ||||| | |||||||| || |||||| | |||||||| |||| ||| |||||||||| Sbjct: 490 atctcagaaaacttgaccgcaatgtggcaagtgtggcaatccaatacaggggcataacc 432
>gb|AY832560.1| Pseudotsuga menziesii var. menziesii haplotype Pm-EF1A_5 translation elongation factor-1 alpha (EF1A) gene, partial cds Length = 1072 Score = 155 bits (78), Expect = 2e-34 Identities = 198/239 (82%) Strand = Plus / Minus Query: 269 acagcaaccgtctgcctnatgtcacgcacggcaaaccgacccagaggagggtactgggca 328 |||||||||||||| | ||||| | ||| ||||| ||||||| ||||| |||| |||| Sbjct: 670 acagcaaccgtctgacgcatgtccctcactgcaaaacgacccaatggaggatactcggca 611 Query: 329 aaggtctccaccaccatgggcttggttggaatcatcttgacgaacccagcatcaccattc 388 ||||| ||||| ||||| || |||||||||||||||||||| ||||||||||| || ||| Sbjct: 610 aaggtttccacaaccattggtttggttggaatcatcttgacaaacccagcatctccgttc 551 Query: 389 ttgagaaacttgggcgctgcctccagctccttgccggaccgcctgtcgatcttggtctgg 448 || ||||||||||| | ||||||||||||||| || |||||||| | ||||||| | Sbjct: 550 ttaagaaacttgggttccttctccagctccttgccagaacgcctgtcaaccttggtcatg 491 Query: 449 atctcggcgaacttgacggcnatgtgggatgtgtggcagtccagcacangggcataacc 507 ||||| | |||||||| || |||||| | |||||||| |||| ||| |||||||||| Sbjct: 490 atctcagaaaacttgaccgcaatgtggcaagtgtggcaatccaatacaggggcataacc 432
>dbj|AB073629.1| Bruguiera sexangula bsef-1A mRNA for eukaryotic elongation factor 1A, complete cds Length = 1664 Score = 155 bits (78), Expect = 2e-34 Identities = 245/302 (81%) Strand = Plus / Minus Query: 239 tccttcttctcnacgctcttgatcacacccacagcaaccgtctgcctnatgtcacgcacg 298 ||||| ||||| || |||||||| || ||||| ||||| ||||| | ||||| | ||| Sbjct: 1331 tcctttttctcgacactcttgatgactcccactgcaacagtctggcgcatgtccctgacg 1272 Query: 299 gcaaaccgacccagaggagggtactgggcaaaggtctccaccaccatgggcttggttgga 358 ||||| | ||| || ||||| |||| || || || ||||||||||| |||||||| ||| Sbjct: 1271 gcaaatctaccaagcggaggatactcggagaaagtttccaccaccataggcttggtcgga 1212 Query: 359 atcatcttgacgaacccagcatcaccattcttgagaaacttgggcgctgcctccagctcc 418 |||||||| ||||||||||||||||||||||| | ||||||||| | || |||||| Sbjct: 1211 atcatcttcacgaacccagcatcaccattcttcaagaacttgggctccttttcaagctcc 1152 Query: 419 ttgccggaccgcctgtcgatcttggtctggatctcggcgaacttgacggcnatgtgggat 478 ||||| || ||||| || ||||| || ||||||| | |||||||| || ||||| || Sbjct: 1151 ttgccagatcgcctatcaatctttgtgaggatctcagaaaacttgacagcaatgtgagag 1092 Query: 479 gtgtggcagtccagcacangggcataaccgttgctgatctggccagggtggttcatgatg 538 |||||||| ||||| ||| |||||||||| || | ||||| |||||||||||||||||| Sbjct: 1091 gtgtggcaatccagaacaggggcataaccatttccaatctgaccagggtggttcatgatg 1032 Query: 539 at 540 || Sbjct: 1031 at 1030
>emb|AJ234435.1|HVU234435 Hordeum vulgare partial mRNA; clone cMWG0716.rev Length = 325 Score = 153 bits (77), Expect = 7e-34 Identities = 138/159 (86%) Strand = Plus / Plus Query: 195 atttcttcttgatcgcagccttggtaaccttggcgccggtcggctccttcttctcnacgc 254 ||||||||||||| ||||||||||| |||||||| ||||| || ||||||||||| |||| Sbjct: 167 atttcttcttgatggcagccttggtcaccttggctccggtggggtccttcttctccacgc 226 Query: 255 tcttgatcacacccacagcaaccgtctgcctnatgtcacgcacggcaaaccgacccagag 314 |||||| ||||| ||||| || || ||||| |||||||| || ||||| ||||| |||| Sbjct: 227 ccttgatgacaccaacagccacagtttgcctcatgtcacggacagcaaaacgaccaagag 286 Query: 315 gagggtactgggcaaaggtctccaccaccatgggcttgg 353 ||||||| ||||||||||||||| ||||||||||||| Sbjct: 287 gagggtaagtggcaaaggtctccacaaccatgggcttgg 325
>gb|DQ174256.1| Gossypium hirsutum translation elongation factor 1A-7 (EF1A7) mRNA, complete cds Length = 1617 Score = 151 bits (76), Expect = 3e-33 Identities = 267/332 (80%) Strand = Plus / Minus Query: 209 gcagccttggtaaccttggcgccggtcggctccttcttctcnacgctcttgatcacaccc 268 |||| |||||| |||||||| || || || ||||||||||| || |||||||| ||||| Sbjct: 1328 gcagacttggtcaccttggctccagttgggtccttcttctccacactcttgattacacca 1269 Query: 269 acagcaaccgtctgcctnatgtcacgcacggcaaaccgacccagaggagggtactgggca 328 |||||||| ||||| || ||||| | |||||||| || || || |||||||||| || Sbjct: 1268 acagcaacagtctgtctcatgtccctaacggcaaaacgtccaagtggagggtactcggag 1209 Query: 329 aaggtctccaccaccatgggcttggttggaatcatcttgacgaacccagcatcaccattc 388 ||||| ||||| |||||||||||||| |||| |||||| | | ||||||||||||||| Sbjct: 1208 aaggtttccacaaccatgggcttggtcggaaccatcttaatcataccagcatcaccattc 1149 Query: 389 ttgagaaacttgggcgctgcctccagctccttgccggaccgcctgtcgatcttggtctgg 448 || | ||||| ||| | ||| |||||||| || || |||||||| ||||||||| | Sbjct: 1148 ttcaagaacttaggctccttctcaagctccttaccagatcgcctgtcaatcttggtcaag 1089 Query: 449 atctcggcgaacttgacggcnatgtgggatgtgtggcagtccagcacangggcataaccg 508 | ||| || |||||||| || |||||||| |||||||| || || || | ||||| || Sbjct: 1088 agctctgcaaacttgacagcaatgtgggaggtgtggcaatcgaggaccggtgcatagcca 1029 Query: 509 ttgctgatctggccagggtggttcatgatgat 540 || | |||||||| ||||||||||||||||| Sbjct: 1028 tttccaatctggcctgggtggttcatgatgat 997
>emb|AJ536671.1|STU536671 Solanum tuberosum mRNA for elongation factor (ef-1alpha gene) Length = 1753 Score = 149 bits (75), Expect = 1e-32 Identities = 278/347 (80%) Strand = Plus / Minus Query: 209 gcagccttggtaaccttggcgccggtcggctccttcttctcnacgctcttgatcacaccc 268 ||||||||||| |||||||| || | || |||||||| || || |||||||| ||||| Sbjct: 1414 gcagccttggtgaccttggctccagatgggtccttcttgtcaacactcttgataacacca 1355 Query: 269 acagcaaccgtctgcctnatgtcacgcacggcaaaccgacccagaggagggtactgggca 328 |||||||| || || | ||||| | ||| ||||| || |||| || ||||||| || Sbjct: 1354 acagcaacagtttgacgcatgtccctcacagcaaaacgccccaatggtgggtactcggag 1295 Query: 329 aaggtctccaccaccatgggcttggttggaatcatcttgacgaacccagcatcaccattc 388 |||||||| || |||||||||||||| ||||||||||| || | ||||||||||| ||| Sbjct: 1294 aaggtctcaacaaccatgggcttggtgggaatcatcttaaccataccagcatcaccgttc 1235 Query: 389 ttgagaaacttgggcgctgcctccagctccttgccggaccgcctgtcgatcttggtctgg 448 || | ||||| ||| | ||| || ||||| || || |||||||| ||||| ||| | Sbjct: 1234 ttcaagaacttaggctccttctcgagttccttaccagaacgcctgtcaatcttagtcaag 1175 Query: 449 atctcggcgaacttgacggcnatgtgggatgtgtggcagtccagcacangggcataaccg 508 ||||| || |||||||| || || ||||||||||| ||||||||||| | ||||| || Sbjct: 1174 atctcagcaaacttgacagcaatatgggatgtgtgacagtccagcactggagcatatcca 1115 Query: 509 ttgctgatctggccagggtggttcatgatgatgacctgggcagtgaa 555 || | ||||| || || ||||||||||||||||||||||||||||| Sbjct: 1114 tttccaatctgtcctggatggttcatgatgatgacctgggcagtgaa 1068
>gb|AY832581.1| Pseudotsuga menziesii haplotype Pm-EF1A_412m1 translation elongation factor-1 alpha (EF1A) gene, partial cds Length = 1072 Score = 147 bits (74), Expect = 5e-32 Identities = 197/239 (82%) Strand = Plus / Minus Query: 269 acagcaaccgtctgcctnatgtcacgcacggcaaaccgacccagaggagggtactgggca 328 |||||||||||||| | ||||| | ||| ||||| ||||||| ||||| |||| |||| Sbjct: 670 acagcaaccgtctgacgcatgtccctcactgcaaaacgacccaatggaggatactcggca 611 Query: 329 aaggtctccaccaccatgggcttggttggaatcatcttgacgaacccagcatcaccattc 388 ||||| ||||| ||||| || |||||||||||||||||||| ||||||||||| || ||| Sbjct: 610 aaggtttccacaaccattggtttggttggaatcatcttgacaaacccagcatctccgttc 551 Query: 389 ttgagaaacttgggcgctgcctccagctccttgccggaccgcctgtcgatcttggtctgg 448 || || |||||||| | ||||||||||||||| || |||||||| | ||||||| | Sbjct: 550 ttaaggaacttgggttccttctccagctccttgccagaacgcctgtcaaccttggtcatg 491 Query: 449 atctcggcgaacttgacggcnatgtgggatgtgtggcagtccagcacangggcataacc 507 ||||| | |||||||| || |||||| | |||||||| |||| ||| |||||||||| Sbjct: 490 atctcagaaaacttgaccgcaatgtggcaagtgtggcaatccaatacaggggcataacc 432
>gb|AY832580.1| Pseudotsuga menziesii haplotype Pm-EF1A_013d2 translation elongation factor-1 alpha (EF1A) gene, partial cds Length = 1072 Score = 147 bits (74), Expect = 5e-32 Identities = 197/239 (82%) Strand = Plus / Minus Query: 269 acagcaaccgtctgcctnatgtcacgcacggcaaaccgacccagaggagggtactgggca 328 |||||||||||||| | ||||| | ||| ||||| ||||||| ||||| |||| |||| Sbjct: 670 acagcaaccgtctgacgcatgtccctcactgcaaaacgacccaatggaggatactcggca 611 Query: 329 aaggtctccaccaccatgggcttggttggaatcatcttgacgaacccagcatcaccattc 388 ||||| ||||| ||||| || |||||||||||||||||||| ||||||||||| || ||| Sbjct: 610 aaggtttccacaaccattggtttggttggaatcatcttgacaaacccagcatctccgttc 551 Query: 389 ttgagaaacttgggcgctgcctccagctccttgccggaccgcctgtcgatcttggtctgg 448 || || |||||||| | ||||||||||||||| || |||||||| | ||||||| | Sbjct: 550 ttaaggaacttgggttccttctccagctccttgccagaacgcctgtcaaccttggtcatg 491 Query: 449 atctcggcgaacttgacggcnatgtgggatgtgtggcagtccagcacangggcataacc 507 ||||| | |||||||| || |||||| | |||||||| |||| ||| |||||||||| Sbjct: 490 atctcagaaaacttgaccgcaatgtggcaagtgtggcaatccaatacaggggcataacc 432
>gb|AY832578.1| Pseudotsuga menziesii var. menziesii haplotype Pm-EF1A_24 translation elongation factor-1 alpha (EF1A) gene, partial cds Length = 1072 Score = 147 bits (74), Expect = 5e-32 Identities = 197/239 (82%) Strand = Plus / Minus Query: 269 acagcaaccgtctgcctnatgtcacgcacggcaaaccgacccagaggagggtactgggca 328 |||||||||||||| | ||||| | ||| ||||| ||||||| ||||| |||| |||| Sbjct: 670 acagcaaccgtctgacgcatgtccctcactgcaaaacgacccaatggaggatactcggca 611 Query: 329 aaggtctccaccaccatgggcttggttggaatcatcttgacgaacccagcatcaccattc 388 ||||| ||||| ||||| || |||||||||||||||||||| ||||||||||| || ||| Sbjct: 610 aaggtttccacaaccattggtttggttggaatcatcttgacaaacccagcatctccgttc 551 Query: 389 ttgagaaacttgggcgctgcctccagctccttgccggaccgcctgtcgatcttggtctgg 448 || || |||||||| | ||||||||||||||| || |||||||| | ||||||| | Sbjct: 550 ttaaggaacttgggttccttctccagctccttgccagaacgcctgtcaaccttggtcatg 491 Query: 449 atctcggcgaacttgacggcnatgtgggatgtgtggcagtccagcacangggcataacc 507 ||||| | |||||||| || |||||| | |||||||| |||| ||| |||||||||| Sbjct: 490 atctcagaaaacttgaccgcaatgtggcaagtgtggcaatccaatacaggggcataacc 432
>gb|AY832576.1| Pseudotsuga menziesii var. menziesii haplotype Pm-EF1A_22 translation elongation factor-1 alpha (EF1A) gene, partial cds Length = 1072 Score = 147 bits (74), Expect = 5e-32 Identities = 197/239 (82%) Strand = Plus / Minus Query: 269 acagcaaccgtctgcctnatgtcacgcacggcaaaccgacccagaggagggtactgggca 328 |||||||||||||| | ||||| | ||| ||||| ||||||| ||||| |||| |||| Sbjct: 670 acagcaaccgtctgacgcatgtccctcactgcaaaacgacccaatggaggatactcggca 611 Query: 329 aaggtctccaccaccatgggcttggttggaatcatcttgacgaacccagcatcaccattc 388 ||||| ||||| ||||| || |||||||||||||||||||| ||||||||||| || ||| Sbjct: 610 aaggtttccacaaccattggtttggttggaatcatcttgacaaacccagcatctccgttc 551 Query: 389 ttgagaaacttgggcgctgcctccagctccttgccggaccgcctgtcgatcttggtctgg 448 || || |||||||| | ||||||||||||||| || |||||||| | ||||||| | Sbjct: 550 ttaaggaacttgggttccttctccagctccttgccagaacgcctgtcaaccttggtcatg 491 Query: 449 atctcggcgaacttgacggcnatgtgggatgtgtggcagtccagcacangggcataacc 507 ||||| | |||||||| || |||||| | |||||||| |||| ||| |||||||||| Sbjct: 490 atctcagaaaacttgaccgcaatgtggcaagtgtggcaatccaatacaggggcataacc 432
>gb|AY832573.1| Pseudotsuga menziesii var. menziesii haplotype Pm-EF1A_19 translation elongation factor-1 alpha (EF1A) gene, partial cds Length = 1072 Score = 147 bits (74), Expect = 5e-32 Identities = 197/239 (82%) Strand = Plus / Minus Query: 269 acagcaaccgtctgcctnatgtcacgcacggcaaaccgacccagaggagggtactgggca 328 |||||||||||||| | ||||| | ||| ||||| ||||||| ||||| |||| |||| Sbjct: 670 acagcaaccgtctgacgcatgtccctcactgcaaaacgacccaatggaggatactcggca 611 Query: 329 aaggtctccaccaccatgggcttggttggaatcatcttgacgaacccagcatcaccattc 388 ||||| ||||| ||||| || |||||||||||||||||||| ||||||||||| || ||| Sbjct: 610 aaggtttccacaaccattggtttggttggaatcatcttgacaaacccagcatctccgttc 551 Query: 389 ttgagaaacttgggcgctgcctccagctccttgccggaccgcctgtcgatcttggtctgg 448 || || |||||||| | ||||||||||||||| || |||||||| | ||||||| | Sbjct: 550 ttaaggaacttgggttccttctccagctccttgccagaacgcctgtcaaccttggtcatg 491 Query: 449 atctcggcgaacttgacggcnatgtgggatgtgtggcagtccagcacangggcataacc 507 ||||| | |||||||| || |||||| | |||||||| |||| ||| |||||||||| Sbjct: 490 atctcagaaaacttgaccgcaatgtggcaagtgtggcaatccaatacaggggcataacc 432
>gb|AY832571.1| Pseudotsuga menziesii var. menziesii haplotype Pm-EF1A_17 translation elongation factor-1 alpha (EF1A) gene, partial cds Length = 1072 Score = 147 bits (74), Expect = 5e-32 Identities = 197/239 (82%) Strand = Plus / Minus Query: 269 acagcaaccgtctgcctnatgtcacgcacggcaaaccgacccagaggagggtactgggca 328 |||||||||||||| | ||||| | ||| ||||| ||||||| ||||| |||| |||| Sbjct: 670 acagcaaccgtctgacgcatgtccctcactgcaaaacgacccaatggaggatactcggca 611 Query: 329 aaggtctccaccaccatgggcttggttggaatcatcttgacgaacccagcatcaccattc 388 ||||| ||||| ||||| || |||||||||||||||||||| ||||||||||| || ||| Sbjct: 610 aaggtttccacaaccattggtttggttggaatcatcttgacaaacccagcatctccgttc 551 Query: 389 ttgagaaacttgggcgctgcctccagctccttgccggaccgcctgtcgatcttggtctgg 448 || || |||||||| | ||||||||||||||| || |||||||| | ||||||| | Sbjct: 550 ttaaggaacttgggttccttctccagctccttgccagaacgcctgtcaaccttggtcatg 491 Query: 449 atctcggcgaacttgacggcnatgtgggatgtgtggcagtccagcacangggcataacc 507 ||||| | |||||||| || |||||| | |||||||| |||| ||| |||||||||| Sbjct: 490 atctcagaaaacttgaccgcaatgtggcaagtgtggcaatccaatacaggggcataacc 432
>gb|AY832570.1| Pseudotsuga menziesii var. menziesii haplotype Pm-EF1A_16 translation elongation factor-1 alpha (EF1A) gene, partial cds Length = 1072 Score = 147 bits (74), Expect = 5e-32 Identities = 197/239 (82%) Strand = Plus / Minus Query: 269 acagcaaccgtctgcctnatgtcacgcacggcaaaccgacccagaggagggtactgggca 328 |||||||||||||| | ||||| | ||| ||||| ||||||| ||||| |||| |||| Sbjct: 670 acagcaaccgtctgacgcatgtccctcactgcaaaacgacccaatggaggatactcggca 611 Query: 329 aaggtctccaccaccatgggcttggttggaatcatcttgacgaacccagcatcaccattc 388 ||||| ||||| ||||| || |||||||||||||||||||| ||||||||||| || ||| Sbjct: 610 aaggtttccacaaccattggtttggttggaatcatcttgacaaacccagcatctccgttc 551 Query: 389 ttgagaaacttgggcgctgcctccagctccttgccggaccgcctgtcgatcttggtctgg 448 || || |||||||| | ||||||||||||||| || |||||||| | ||||||| | Sbjct: 550 ttaaggaacttgggttccttctccagctccttgccagaacgcctgtcaaccttggtcatg 491 Query: 449 atctcggcgaacttgacggcnatgtgggatgtgtggcagtccagcacangggcataacc 507 ||||| | |||||||| || |||||| | |||||||| |||| ||| |||||||||| Sbjct: 490 atctcagaaaacttgaccgcaatgtggcaagtgtggcaatccaatacaggggcataacc 432
>gb|AY832567.1| Pseudotsuga menziesii var. menziesii haplotype Pm-EF1A_12 translation elongation factor-1 alpha (EF1A) gene, partial cds Length = 1072 Score = 147 bits (74), Expect = 5e-32 Identities = 197/239 (82%) Strand = Plus / Minus Query: 269 acagcaaccgtctgcctnatgtcacgcacggcaaaccgacccagaggagggtactgggca 328 |||||||||||||| | ||||| | ||| ||||| ||||||| ||||| |||| |||| Sbjct: 670 acagcaaccgtctgacgcatgtccctcactgcaaaacgacccaatggaggatactcggca 611 Query: 329 aaggtctccaccaccatgggcttggttggaatcatcttgacgaacccagcatcaccattc 388 ||||| ||||| ||||| || |||||||||||||||||||| ||||||||||| || ||| Sbjct: 610 aaggtttccacaaccattggtttggttggaatcatcttgacaaacccagcatctccgttc 551 Query: 389 ttgagaaacttgggcgctgcctccagctccttgccggaccgcctgtcgatcttggtctgg 448 || || |||||||| | ||||||||||||||| || |||||||| | ||||||| | Sbjct: 550 ttaaggaacttgggttccttctccagctccttgccagaacgcctgtcaaccttggtcatg 491 Query: 449 atctcggcgaacttgacggcnatgtgggatgtgtggcagtccagcacangggcataacc 507 ||||| | |||||||| || |||||| | |||||||| |||| ||| |||||||||| Sbjct: 490 atctcagaaaacttgaccgcaatgtggcaagtgtggcaatccaatacaggggcataacc 432
>gb|AY832565.1| Pseudotsuga menziesii var. menziesii haplotype Pm-EF1A_10 translation elongation factor-1 alpha (EF1A) gene, partial cds Length = 1072 Score = 147 bits (74), Expect = 5e-32 Identities = 197/239 (82%) Strand = Plus / Minus Query: 269 acagcaaccgtctgcctnatgtcacgcacggcaaaccgacccagaggagggtactgggca 328 |||||||||||||| | ||||| | ||| ||||| ||||||| ||||| |||| |||| Sbjct: 670 acagcaaccgtctgacgcatgtccctcactgcaaaacgacccaatggaggatactcggca 611 Query: 329 aaggtctccaccaccatgggcttggttggaatcatcttgacgaacccagcatcaccattc 388 ||||| ||||| ||||| || |||||||||||||||||||| ||||||||||| || ||| Sbjct: 610 aaggtttccacaaccattggtttggttggaatcatcttgacaaacccagcatctccgttc 551 Query: 389 ttgagaaacttgggcgctgcctccagctccttgccggaccgcctgtcgatcttggtctgg 448 || || |||||||| | ||||||||||||||| || |||||||| | ||||||| | Sbjct: 550 ttaaggaacttgggttccttctccagctccttgccagaacgcctgtcaaccttggtcatg 491 Query: 449 atctcggcgaacttgacggcnatgtgggatgtgtggcagtccagcacangggcataacc 507 ||||| | |||||||| || |||||| | |||||||| |||| ||| |||||||||| Sbjct: 490 atctcagaaaacttgaccgcaatgtggcaagtgtggcaatccaatacaggggcataacc 432
>gb|AY832564.1| Pseudotsuga menziesii var. menziesii haplotype Pm-EF1A_9 translation elongation factor-1 alpha (EF1A) gene, partial cds Length = 1072 Score = 147 bits (74), Expect = 5e-32 Identities = 197/239 (82%) Strand = Plus / Minus Query: 269 acagcaaccgtctgcctnatgtcacgcacggcaaaccgacccagaggagggtactgggca 328 |||||||||||||| | ||||| | ||| ||||| ||||||| ||||| |||| |||| Sbjct: 670 acagcaaccgtctgacgcatgtccctcactgcaaaacgacccaatggaggatactcggca 611 Query: 329 aaggtctccaccaccatgggcttggttggaatcatcttgacgaacccagcatcaccattc 388 ||||| ||||| ||||| || |||||||||||||||||||| ||||||||||| || ||| Sbjct: 610 aaggtttccacaaccattggtttggttggaatcatcttgacaaacccagcatctccgttc 551 Query: 389 ttgagaaacttgggcgctgcctccagctccttgccggaccgcctgtcgatcttggtctgg 448 || || |||||||| | ||||||||||||||| || |||||||| | ||||||| | Sbjct: 550 ttaaggaacttgggttccttctccagctccttgccagaacgcctgtcaaccttggtcatg 491 Query: 449 atctcggcgaacttgacggcnatgtgggatgtgtggcagtccagcacangggcataacc 507 ||||| | |||||||| || |||||| | |||||||| |||| ||| |||||||||| Sbjct: 490 atctcagaaaacttgaccgcaatgtggcaagtgtggcaatccaatacaggggcataacc 432
>gb|AY832563.1| Pseudotsuga menziesii var. menziesii haplotype Pm-EF1A_8 translation elongation factor-1 alpha (EF1A) gene, partial cds Length = 1072 Score = 147 bits (74), Expect = 5e-32 Identities = 197/239 (82%) Strand = Plus / Minus Query: 269 acagcaaccgtctgcctnatgtcacgcacggcaaaccgacccagaggagggtactgggca 328 |||||||||||||| | ||||| | ||| ||||| ||||||| ||||| |||| |||| Sbjct: 670 acagcaaccgtctgacgcatgtccctcactgcaaaacgacccaatggaggatactcggca 611 Query: 329 aaggtctccaccaccatgggcttggttggaatcatcttgacgaacccagcatcaccattc 388 ||||| ||||| ||||| || |||||||||||||||||||| ||||||||||| || ||| Sbjct: 610 aaggtttccacaaccattggtttggttggaatcatcttgacaaacccagcatctccgttc 551 Query: 389 ttgagaaacttgggcgctgcctccagctccttgccggaccgcctgtcgatcttggtctgg 448 || || |||||||| | ||||||||||||||| || |||||||| | ||||||| | Sbjct: 550 ttaaggaacttgggttccttctccagctccttgccagaacgcctgtcaaccttggtcatg 491 Query: 449 atctcggcgaacttgacggcnatgtgggatgtgtggcagtccagcacangggcataacc 507 ||||| | |||||||| || |||||| | |||||||| |||| ||| |||||||||| Sbjct: 490 atctcagaaaacttgaccgcaatgtggcaagtgtggcaatccaatacaggggcataacc 432
>gb|AY832562.1| Pseudotsuga menziesii var. menziesii haplotype Pm-EF1A_7 translation elongation factor-1 alpha (EF1A) gene, partial cds Length = 1072 Score = 147 bits (74), Expect = 5e-32 Identities = 197/239 (82%) Strand = Plus / Minus Query: 269 acagcaaccgtctgcctnatgtcacgcacggcaaaccgacccagaggagggtactgggca 328 |||||||||||||| | ||||| | ||| ||||| ||||||| ||||| |||| |||| Sbjct: 670 acagcaaccgtctgacgcatgtccctcactgcaaaacgacccaatggaggatactcggca 611 Query: 329 aaggtctccaccaccatgggcttggttggaatcatcttgacgaacccagcatcaccattc 388 ||||| ||||| ||||| || |||||||||||||||||||| ||||||||||| || ||| Sbjct: 610 aaggtttccacaaccattggtttggttggaatcatcttgacaaacccagcatctccgttc 551 Query: 389 ttgagaaacttgggcgctgcctccagctccttgccggaccgcctgtcgatcttggtctgg 448 || || |||||||| | ||||||||||||||| || |||||||| | ||||||| | Sbjct: 550 ttaaggaacttgggttccttctccagctccttgccagaacgcctgtcaaccttggtcatg 491 Query: 449 atctcggcgaacttgacggcnatgtgggatgtgtggcagtccagcacangggcataacc 507 ||||| | |||||||| || |||||| | |||||||| |||| ||| |||||||||| Sbjct: 490 atctcagaaaacttgaccgcaatgtggcaagtgtggcaatccaatacaggggcataacc 432
>gb|DQ174253.1| Gossypium hirsutum translation elongation factor 1A-4 (EF1A4) mRNA, complete cds Length = 1565 Score = 145 bits (73), Expect = 2e-31 Identities = 285/357 (79%) Strand = Plus / Minus Query: 190 atctcatttcttcttgatcgcagccttggtaaccttggcgccggtcggctccttcttctc 249 |||||||||||||||| |||| ||||| ||||| || ||||| || ||||||||||| Sbjct: 1347 atctcatttcttcttggcagcagatttggtgaccttagcaccggttggatccttcttctc 1288 Query: 250 nacgctcttgatcacacccacagcaaccgtctgcctnatgtcacgcacggcaaaccgacc 309 ||||||||||| ||||| ||||| || ||||| | ||||| | || |||||||| || Sbjct: 1287 aacgctcttgatgacaccaacagccacagtctgacgcatgtccctgacagcaaaccgtcc 1228 Query: 310 cagaggagggtactgggcaaaggtctccaccaccatgggcttggttggaatcatcttgac 369 || || ||||||| | || |||||||| ||||| |||||||| |||| |||||| | Sbjct: 1227 aaggggtgggtactcagagaaagtctccacaaccataggcttggtgggaaccatctttat 1168 Query: 370 gaacccagcatcaccattcttgagaaacttgggcgctgcctccagctccttgccggaccg 429 | ||| |||||||||||||| | ||||||||| | ||| |||||||| || || || Sbjct: 1167 catccctgcatcaccattcttcaagaacttgggctccttctcaagctcctttccagatcg 1108 Query: 430 cctgtcgatcttggtctggatctcggcgaacttgacggcnatgtgggatgtgtggcagtc 489 |||||||||||||||| | | || | ||||| || || |||||||| || |||||||| Sbjct: 1107 cctgtcgatcttggtcagcaattcagaaaacttcacagcaatgtgggaggtatggcagtc 1048 Query: 490 cagcacangggcataaccgttgctgatctggccagggtggttcatgatgatgacctg 546 || || ||||||| ||||| | ||||| |||||||||||||||||||||||||| Sbjct: 1047 aaggactggggcatatccgtttccaatctgcccagggtggttcatgatgatgacctg 991
>gb|DQ174251.1| Gossypium hirsutum translation elongation factor 1A-2 (EF1A2) mRNA, complete cds Length = 1566 Score = 145 bits (73), Expect = 2e-31 Identities = 279/349 (79%) Strand = Plus / Minus Query: 209 gcagccttggtaaccttggcgccggtcggctccttcttctcnacgctcttgatcacaccc 268 |||| |||||| |||||||| ||||| || ||||||||||| || |||||||| ||||| Sbjct: 1328 gcagacttggtgaccttggcaccggttgggtccttcttctcgacactcttgataacacca 1269 Query: 269 acagcaaccgtctgcctnatgtcacgcacggcaaaccgacccagaggagggtactgggca 328 ||||| || ||||| | ||||| | ||| ||||| |||||||| || ||||||| | Sbjct: 1268 acagccacggtctgacgcatgtccctcacagcaaaacgacccaggggtgggtactcagag 1209 Query: 329 aaggtctccaccaccatgggcttggttggaatcatcttgacgaacccagcatcaccattc 388 ||||||||||| |||||||||||||| ||||||||||| | | ||||||||||| ||| Sbjct: 1208 aaggtctccacaaccatgggcttggtaggaatcatcttaatcataccagcatcaccgttc 1149 Query: 389 ttgagaaacttgggcgctgcctccagctccttgccggaccgcctgtcgatcttggtctgg 448 || | |||||||| | ||| |||||||| || || |||||||| ||||||||| Sbjct: 1148 ttcaagaacttgggttccttctcaagctccttaccagatcgcctgtcaatcttggtcaaa 1089 Query: 449 atctcggcgaacttgacggcnatgtgggatgtgtggcagtccagcacangggcataaccg 508 | ||| || ||||| || || ||||| || ||||||||||| || || ||||||| || Sbjct: 1088 agctcagcaaacttaacagcaatgtgtgacgtgtggcagtcaaggactggggcatatcca 1029 Query: 509 ttgctgatctggccagggtggttcatgatgatgacctgggcagtgaagt 557 || | || || |||||||||||||| ||||||||||| | |||||||| Sbjct: 1028 tttccaatttgtccagggtggttcataatgatgacctgagaagtgaagt 980
>gb|DQ174250.1| Gossypium hirsutum translation elongation factor 1A-1 (EF1A1) mRNA, complete cds Length = 1567 Score = 145 bits (73), Expect = 2e-31 Identities = 285/357 (79%) Strand = Plus / Minus Query: 190 atctcatttcttcttgatcgcagccttggtaaccttggcgccggtcggctccttcttctc 249 |||||||||||||||| |||| ||||| ||||| || ||||| || ||||||||||| Sbjct: 1347 atctcatttcttcttggcagcagatttggtgaccttagcaccggttggatccttcttctc 1288 Query: 250 nacgctcttgatcacacccacagcaaccgtctgcctnatgtcacgcacggcaaaccgacc 309 ||||||||||| ||||| ||||| || ||||| | ||||| | || |||||||| || Sbjct: 1287 aacgctcttgatgacaccaacagccacagtctgacgcatgtccctgacagcaaaccgtcc 1228 Query: 310 cagaggagggtactgggcaaaggtctccaccaccatgggcttggttggaatcatcttgac 369 || || ||||||| | || |||||||| ||||| |||||||| |||| |||||| | Sbjct: 1227 aaggggtgggtactcagagaaagtctccacaaccataggcttggtgggaaccatctttat 1168 Query: 370 gaacccagcatcaccattcttgagaaacttgggcgctgcctccagctccttgccggaccg 429 | ||| |||||||||||||| | ||||||||| | ||| |||||||| || || || Sbjct: 1167 catccctgcatcaccattcttcaagaacttgggctccttctcaagctcctttccagatcg 1108 Query: 430 cctgtcgatcttggtctggatctcggcgaacttgacggcnatgtgggatgtgtggcagtc 489 |||||||||||||||| | | || | ||||| || || |||||||| || |||||||| Sbjct: 1107 cctgtcgatcttggtcagcaattcagaaaacttcacagcaatgtgggaggtatggcagtc 1048 Query: 490 cagcacangggcataaccgttgctgatctggccagggtggttcatgatgatgacctg 546 || || ||||||| ||||| | ||||| |||||||||||||||||||||||||| Sbjct: 1047 aaggactggggcatatccgtttccaatctgcccagggtggttcatgatgatgacctg 991
>gb|DQ268854.1| Solanum tuberosum clone 171A01 elongation factor 1-alpha-like protein mRNA, complete cds Length = 1678 Score = 143 bits (72), Expect = 7e-31 Identities = 280/348 (80%), Gaps = 2/348 (0%) Strand = Plus / Minus Query: 209 gcagccttggtaaccttggcgccggtcggctccttcttctcnacgctcttgatcacaccc 268 ||||||||||| |||||||| || || || |||||||| || || |||||| ||||| Sbjct: 1354 gcagccttggtgaccttggcaccagttgggtccttcttgtcaacattcttgacaacacca 1295 Query: 269 acagcaaccgtctgcctnatgtcacgcacggcaaaccgacccagaggagggtactgggca 328 |||||||| || ||||| ||||| || || || || ||||||| || ||||| | |||| Sbjct: 1294 acagcaacagtttgcctcatgtctcgaacagcgaaacgacccaatggtgggtattcggca 1235 Query: 329 aaggtctccaccaccatgggcttggttggaatcatcttgacgaacccagcatcaccattc 388 |||||||| || ||||||||||| || ||||||||||| || | ||||||||||||||| Sbjct: 1234 aaggtctcaacaaccatgggcttagtgggaatcatcttaaccataccagcatcaccattc 1175 Query: 389 ttgagaaacttgggcgctgcctccagctccttgccggaccgcctgtcgatcttggtctgg 448 || | ||||| | | ||| || ||||| || || |||||||| ||||||||| | Sbjct: 1174 ttcaagaacttagcttccttctcaagttccttacctgaacgcctgtcaatcttggtcaag 1115 Query: 449 atctcggcgaacttgacggcnatgtggg-atgtgtggcagtccagcacangggcataacc 507 ||||| || |||||||| || ||||||| | |||| |||||| ||||| | ||||| || Sbjct: 1114 atctcagcaaacttgacagcaatgtgggaaagtgt-gcagtcgagcactggtgcatatcc 1056 Query: 508 gttgctgatctggccagggtggttcatgatgatgacctgggcagtgaa 555 || | ||||||||||| ||||||||||||||||||||||||||||| Sbjct: 1055 atttccaatctggccaggatggttcatgatgatgacctgggcagtgaa 1008
>gb|U04632.1|NTU04632 Nicotiana tabacum Wisconsin 38 vitronectin-like adhesion protein mRNA, complete cds Length = 1776 Score = 143 bits (72), Expect = 7e-31 Identities = 272/340 (80%) Strand = Plus / Minus Query: 209 gcagccttggtaaccttggcgccggtcggctccttcttctcnacgctcttgatcacaccc 268 ||||||||||| |||||||| || || || |||||||| || ||| ||||||| ||||| Sbjct: 1423 gcagccttggtgaccttggcaccagttgggtccttcttgtcaacgttcttgataacacca 1364 Query: 269 acagcaaccgtctgcctnatgtcacgcacggcaaaccgacccagaggagggtactgggca 328 |||||||| || || | ||||| | ||| ||||| || |||| || ||||||| | Sbjct: 1363 acagcaacagtttgacgcatgtccctcacagcaaaacgtcccaatggtgggtactcagag 1304 Query: 329 aaggtctccaccaccatgggcttggttggaatcatcttgacgaacccagcatcaccattc 388 |||||||| || |||||||||||||| ||||||||||| || | ||||||||||||||| Sbjct: 1303 aaggtctcaacaaccatgggcttggtgggaatcatcttaaccataccagcatcaccattc 1244 Query: 389 ttgagaaacttgggcgctgcctccagctccttgccggaccgcctgtcgatcttggtctgg 448 || | ||||||||| | ||| | |||||| || || |||||||||||||||||| Sbjct: 1243 ttcaagaacttgggctccttctcaatctccttaccagaacgcctgtcgatcttggtcaaa 1184 Query: 449 atctcggcgaacttgacggcnatgtgggatgtgtggcagtccagcacangggcataaccg 508 || || || |||||||| || |||||||| ||||||||||| ||||| | ||||| || Sbjct: 1183 atttctgcaaacttgacagcaatgtgggaggtgtggcagtcaagcactggagcatatcca 1124 Query: 509 ttgctgatctggccagggtggttcatgatgatgacctggg 548 || | ||||| || || ||||||||||||||||| |||| Sbjct: 1123 tttccaatctgtcctggatggttcatgatgatgacttggg 1084
>dbj|D63396.1|TOBBY2A Nicotiana tabacum mRNA for elongation factor-1 alpha, complete cds Length = 1671 Score = 143 bits (72), Expect = 7e-31 Identities = 272/340 (80%) Strand = Plus / Minus Query: 209 gcagccttggtaaccttggcgccggtcggctccttcttctcnacgctcttgatcacaccc 268 ||||||||||| |||||||| || || || |||||||| || ||| ||||||| ||||| Sbjct: 1355 gcagccttggtgaccttggcaccagttgggtccttcttgtcaacgttcttgataacacca 1296 Query: 269 acagcaaccgtctgcctnatgtcacgcacggcaaaccgacccagaggagggtactgggca 328 |||||||| || || | ||||| | ||| ||||| || |||| || ||||||| | Sbjct: 1295 acagcaacagtttgacgcatgtccctcacagcaaaacgtcccaatggtgggtactcagag 1236 Query: 329 aaggtctccaccaccatgggcttggttggaatcatcttgacgaacccagcatcaccattc 388 |||||||| || |||||||||||||| ||||||||||| || | ||||||||||||||| Sbjct: 1235 aaggtctcaacaaccatgggcttggtgggaatcatcttaaccataccagcatcaccattc 1176 Query: 389 ttgagaaacttgggcgctgcctccagctccttgccggaccgcctgtcgatcttggtctgg 448 || | ||||||||| | ||| | |||||| || || |||||||||||||||||| Sbjct: 1175 ttcaagaacttgggctccttctcaatctccttaccagaacgcctgtcgatcttggtcaaa 1116 Query: 449 atctcggcgaacttgacggcnatgtgggatgtgtggcagtccagcacangggcataaccg 508 || || || |||||||| || |||||||| ||||||||||| ||||| | ||||| || Sbjct: 1115 atttctgcaaacttgacagcaatgtgggaggtgtggcagtcaagcactggagcatatcca 1056 Query: 509 ttgctgatctggccagggtggttcatgatgatgacctggg 548 || | ||||| || || ||||||||||||||||| |||| Sbjct: 1055 tttccaatctgtcctggatggttcatgatgatgacttggg 1016
>gb|AY832582.1| Pseudotsuga menziesii haplotype Pm-EF1A_412m2 translation elongation factor-1 alpha (EF1A) gene, partial cds Length = 1072 Score = 139 bits (70), Expect = 1e-29 Identities = 196/239 (82%) Strand = Plus / Minus Query: 269 acagcaaccgtctgcctnatgtcacgcacggcaaaccgacccagaggagggtactgggca 328 |||||||||||||| | || || | ||| ||||| ||||||| ||||| |||| |||| Sbjct: 670 acagcaaccgtctgacgcatatccctcactgcaaaacgacccaatggaggatactcggca 611 Query: 329 aaggtctccaccaccatgggcttggttggaatcatcttgacgaacccagcatcaccattc 388 ||||| ||||| ||||| || |||||||||||||||||||| ||||||||||| || ||| Sbjct: 610 aaggtttccacaaccattggtttggttggaatcatcttgacaaacccagcatctccgttc 551 Query: 389 ttgagaaacttgggcgctgcctccagctccttgccggaccgcctgtcgatcttggtctgg 448 || || |||||||| | ||||||||||||||| || |||||||| | ||||||| | Sbjct: 550 ttaaggaacttgggttccttctccagctccttgccagaacgcctgtcaaccttggtcatg 491 Query: 449 atctcggcgaacttgacggcnatgtgggatgtgtggcagtccagcacangggcataacc 507 ||||| | |||||||| || |||||| | |||||||| |||| ||| |||||||||| Sbjct: 490 atctcagaaaacttgaccgcaatgtggcaagtgtggcaatccaatacaggggcataacc 432
>gb|AY832579.1| Pseudotsuga menziesii haplotype Pm-EF1A_013d1 translation elongation factor-1 alpha (EF1A) gene, partial cds Length = 1072 Score = 139 bits (70), Expect = 1e-29 Identities = 196/239 (82%) Strand = Plus / Minus Query: 269 acagcaaccgtctgcctnatgtcacgcacggcaaaccgacccagaggagggtactgggca 328 |||||||||||||| | || || | ||| ||||| ||||||| ||||| |||| |||| Sbjct: 670 acagcaaccgtctgacgcatatccctcactgcaaaacgacccaatggaggatactcggca 611 Query: 329 aaggtctccaccaccatgggcttggttggaatcatcttgacgaacccagcatcaccattc 388 ||||| ||||| ||||| || |||||||||||||||||||| ||||||||||| || ||| Sbjct: 610 aaggtttccacaaccattggtttggttggaatcatcttgacaaacccagcatctccgttc 551 Query: 389 ttgagaaacttgggcgctgcctccagctccttgccggaccgcctgtcgatcttggtctgg 448 || || |||||||| | ||||||||||||||| || |||||||| | ||||||| | Sbjct: 550 ttaaggaacttgggttccttctccagctccttgccagaacgcctgtcaaccttggtcatg 491 Query: 449 atctcggcgaacttgacggcnatgtgggatgtgtggcagtccagcacangggcataacc 507 ||||| | |||||||| || |||||| | |||||||| |||| ||| |||||||||| Sbjct: 490 atctcagaaaacttgaccgcaatgtggcaagtgtggcaatccaatacaggggcataacc 432
>gb|AY832577.1| Pseudotsuga menziesii var. menziesii haplotype Pm-EF1A_23 translation elongation factor-1 alpha (EF1A) gene, partial cds Length = 1072 Score = 139 bits (70), Expect = 1e-29 Identities = 196/239 (82%) Strand = Plus / Minus Query: 269 acagcaaccgtctgcctnatgtcacgcacggcaaaccgacccagaggagggtactgggca 328 |||||||||||||| | ||||| | ||| ||||| ||||||| ||||| |||| |||| Sbjct: 670 acagcaaccgtctgacgcatgtccctcactgcaaaacgacccaatggaggatactcggca 611 Query: 329 aaggtctccaccaccatgggcttggttggaatcatcttgacgaacccagcatcaccattc 388 ||||| ||||| ||||| || |||||||||||||||||||| ||||||||||| || ||| Sbjct: 610 aaggtttccacaaccattggtttggttggaatcatcttgacaaacccagcatctccgttc 551 Query: 389 ttgagaaacttgggcgctgcctccagctccttgccggaccgcctgtcgatcttggtctgg 448 || || |||||||| | ||||||||||||||| || |||||||| | ||||||| | Sbjct: 550 ttaaggaacttgggttccttctccagctccttgccagaacgcctgtcaaccttggtcatg 491 Query: 449 atctcggcgaacttgacggcnatgtgggatgtgtggcagtccagcacangggcataacc 507 ||||| | |||||||| || |||||| | |||||||| |||| ||| | |||||||| Sbjct: 490 atctcagaaaacttgaccgcaatgtggcaagtgtggcaatccaatacaggagcataacc 432
>gb|AY832575.1| Pseudotsuga menziesii var. menziesii haplotype Pm-EF1A_21 translation elongation factor-1 alpha (EF1A) gene, partial cds Length = 1072 Score = 139 bits (70), Expect = 1e-29 Identities = 196/239 (82%) Strand = Plus / Minus Query: 269 acagcaaccgtctgcctnatgtcacgcacggcaaaccgacccagaggagggtactgggca 328 |||||||||||||| | || || | ||| ||||| ||||||| ||||| |||| |||| Sbjct: 670 acagcaaccgtctgacgcatatccctcactgcaaaacgacccaatggaggatactcggca 611 Query: 329 aaggtctccaccaccatgggcttggttggaatcatcttgacgaacccagcatcaccattc 388 ||||| ||||| ||||| || |||||||||||||||||||| ||||||||||| || ||| Sbjct: 610 aaggtttccacaaccattggtttggttggaatcatcttgacaaacccagcatctccgttc 551 Query: 389 ttgagaaacttgggcgctgcctccagctccttgccggaccgcctgtcgatcttggtctgg 448 || || |||||||| | ||||||||||||||| || |||||||| | ||||||| | Sbjct: 550 ttaaggaacttgggttccttctccagctccttgccagaacgcctgtcaaccttggtcatg 491 Query: 449 atctcggcgaacttgacggcnatgtgggatgtgtggcagtccagcacangggcataacc 507 ||||| | |||||||| || |||||| | |||||||| |||| ||| |||||||||| Sbjct: 490 atctcagaaaacttgaccgcaatgtggcaagtgtggcaatccaatacaggggcataacc 432
>gb|AY832574.1| Pseudotsuga menziesii var. menziesii haplotype Pm-EF1A_20 translation elongation factor-1 alpha (EF1A) gene, partial cds Length = 1072 Score = 139 bits (70), Expect = 1e-29 Identities = 196/239 (82%) Strand = Plus / Minus Query: 269 acagcaaccgtctgcctnatgtcacgcacggcaaaccgacccagaggagggtactgggca 328 |||||||||||||| | ||||| | ||| ||||| ||||||| ||||| |||| |||| Sbjct: 670 acagcaaccgtctgacgcatgtccctcactgcaaaacgacccaatggaggatactcggca 611 Query: 329 aaggtctccaccaccatgggcttggttggaatcatcttgacgaacccagcatcaccattc 388 ||||| ||||| ||||| || |||||||||||||||||||| ||||||||||| || ||| Sbjct: 610 aaggtttccacaaccattggtttggttggaatcatcttgacaaacccagcatctccgttc 551 Query: 389 ttgagaaacttgggcgctgcctccagctccttgccggaccgcctgtcgatcttggtctgg 448 || || |||||||| | ||||||||||||||| || |||||||| | ||||||| | Sbjct: 550 ttaaggaacttgggttccttctccagctccttgccagaacgcctgtcaaccttggtcatg 491 Query: 449 atctcggcgaacttgacggcnatgtgggatgtgtggcagtccagcacangggcataacc 507 ||||| | |||||||| || |||||| | |||||||| |||| ||| | |||||||| Sbjct: 490 atctcagaaaacttgaccgcaatgtggcaagtgtggcaatccaatacaggagcataacc 432
>gb|AY832569.1| Pseudotsuga menziesii var. menziesii haplotype Pm-EF1A_15 translation elongation factor-1 alpha (EF1A) gene, partial cds Length = 1072 Score = 139 bits (70), Expect = 1e-29 Identities = 196/239 (82%) Strand = Plus / Minus Query: 269 acagcaaccgtctgcctnatgtcacgcacggcaaaccgacccagaggagggtactgggca 328 |||||||||||||| | || || | ||| ||||| ||||||| ||||| |||| |||| Sbjct: 670 acagcaaccgtctgacgcatatccctcactgcaaaacgacccaatggaggatactcggca 611 Query: 329 aaggtctccaccaccatgggcttggttggaatcatcttgacgaacccagcatcaccattc 388 ||||| ||||| ||||| || |||||||||||||||||||| ||||||||||| || ||| Sbjct: 610 aaggtttccacaaccattggtttggttggaatcatcttgacaaacccagcatctccgttc 551 Query: 389 ttgagaaacttgggcgctgcctccagctccttgccggaccgcctgtcgatcttggtctgg 448 || || |||||||| | ||||||||||||||| || |||||||| | ||||||| | Sbjct: 550 ttaaggaacttgggttccttctccagctccttgccagaacgcctgtcaaccttggtcatg 491 Query: 449 atctcggcgaacttgacggcnatgtgggatgtgtggcagtccagcacangggcataacc 507 ||||| | |||||||| || |||||| | |||||||| |||| ||| |||||||||| Sbjct: 490 atctcagaaaacttgaccgcaatgtggcaagtgtggcaatccaatacaggggcataacc 432
>gb|AY832566.1| Pseudotsuga menziesii var. menziesii haplotype Pm-EF1A_11 translation elongation factor-1 alpha (EF1A) gene, partial cds Length = 1072 Score = 139 bits (70), Expect = 1e-29 Identities = 196/239 (82%) Strand = Plus / Minus Query: 269 acagcaaccgtctgcctnatgtcacgcacggcaaaccgacccagaggagggtactgggca 328 |||||||||||||| | || || | ||| ||||| ||||||| ||||| |||| |||| Sbjct: 670 acagcaaccgtctgacgcatatccctcactgcaaaacgacccaatggaggatactcggca 611 Query: 329 aaggtctccaccaccatgggcttggttggaatcatcttgacgaacccagcatcaccattc 388 ||||| ||||| ||||| || |||||||||||||||||||| ||||||||||| || ||| Sbjct: 610 aaggtttccacaaccattggtttggttggaatcatcttgacaaacccagcatctccgttc 551 Query: 389 ttgagaaacttgggcgctgcctccagctccttgccggaccgcctgtcgatcttggtctgg 448 || || |||||||| | ||||||||||||||| || |||||||| | ||||||| | Sbjct: 550 ttaaggaacttgggttccttctccagctccttgccagaacgcctgtcaaccttggtcatg 491 Query: 449 atctcggcgaacttgacggcnatgtgggatgtgtggcagtccagcacangggcataacc 507 ||||| | |||||||| || |||||| | |||||||| |||| ||| |||||||||| Sbjct: 490 atctcagaaaacttgaccgcaatgtggcaagtgtggcaatccaatacaggggcataacc 432
>gb|AY832561.1| Pseudotsuga menziesii var. menziesii haplotype Pm-EF1A_6 translation elongation factor-1 alpha (EF1A) gene, partial cds Length = 1072 Score = 139 bits (70), Expect = 1e-29 Identities = 196/239 (82%) Strand = Plus / Minus Query: 269 acagcaaccgtctgcctnatgtcacgcacggcaaaccgacccagaggagggtactgggca 328 |||||||||||||| | ||||| | ||| ||||| ||||||| ||||| |||| |||| Sbjct: 670 acagcaaccgtctgacgcatgtccctcactgcaaaacgacccaatggaggatactcggca 611 Query: 329 aaggtctccaccaccatgggcttggttggaatcatcttgacgaacccagcatcaccattc 388 ||||| ||||| ||||| || |||||||||||||||||||| ||||||||||| || ||| Sbjct: 610 aaggtttccacaaccattggtttggttggaatcatcttgacaaacccagcatctccgttc 551 Query: 389 ttgagaaacttgggcgctgcctccagctccttgccggaccgcctgtcgatcttggtctgg 448 || || |||||||| | ||||||||||||||| || |||||||| | ||||||| | Sbjct: 550 ttaaggaacttgggttccttctccagctccttgccagaacgcctgtcaaccttggtcatg 491 Query: 449 atctcggcgaacttgacggcnatgtgggatgtgtggcagtccagcacangggcataacc 507 ||||| | |||||||| || |||||| | |||||||| |||| ||| | |||||||| Sbjct: 490 atctcagaaaacttgaccgcaatgtggcaagtgtggcaatccaatacaggagcataacc 432
>gb|AY832559.1| Pseudotsuga menziesii var. menziesii haplotype Pm-EF1A_4 translation elongation factor-1 alpha (EF1A) gene, partial cds Length = 1072 Score = 139 bits (70), Expect = 1e-29 Identities = 196/239 (82%) Strand = Plus / Minus Query: 269 acagcaaccgtctgcctnatgtcacgcacggcaaaccgacccagaggagggtactgggca 328 |||||||||||||| | || || | ||| ||||| ||||||| ||||| |||| |||| Sbjct: 670 acagcaaccgtctgacgcatatccctcactgcaaaacgacccaatggaggatactcggca 611 Query: 329 aaggtctccaccaccatgggcttggttggaatcatcttgacgaacccagcatcaccattc 388 ||||| ||||| ||||| || |||||||||||||||||||| ||||||||||| || ||| Sbjct: 610 aaggtttccacaaccattggtttggttggaatcatcttgacaaacccagcatctccgttc 551 Query: 389 ttgagaaacttgggcgctgcctccagctccttgccggaccgcctgtcgatcttggtctgg 448 || || |||||||| | ||||||||||||||| || |||||||| | ||||||| | Sbjct: 550 ttaaggaacttgggttccttctccagctccttgccagaacgcctgtcaaccttggtcatg 491 Query: 449 atctcggcgaacttgacggcnatgtgggatgtgtggcagtccagcacangggcataacc 507 ||||| | |||||||| || |||||| | |||||||| |||| ||| |||||||||| Sbjct: 490 atctcagaaaacttgaccgcaatgtggcaagtgtggcaatccaatacaggggcataacc 432
>gb|AY832558.1| Pseudotsuga menziesii var. menziesii haplotype Pm-EF1A_3 translation elongation factor-1 alpha (EF1A) gene, partial cds Length = 1072 Score = 139 bits (70), Expect = 1e-29 Identities = 196/239 (82%) Strand = Plus / Minus Query: 269 acagcaaccgtctgcctnatgtcacgcacggcaaaccgacccagaggagggtactgggca 328 |||||||||||||| | || || | ||| ||||| ||||||| ||||| |||| |||| Sbjct: 670 acagcaaccgtctgacgcatatccctcactgcaaaacgacccaatggaggatactcggca 611 Query: 329 aaggtctccaccaccatgggcttggttggaatcatcttgacgaacccagcatcaccattc 388 ||||| ||||| ||||| || |||||||||||||||||||| ||||||||||| || ||| Sbjct: 610 aaggtttccacaaccattggtttggttggaatcatcttgacaaacccagcatctccgttc 551 Query: 389 ttgagaaacttgggcgctgcctccagctccttgccggaccgcctgtcgatcttggtctgg 448 || || |||||||| | ||||||||||||||| || |||||||| | ||||||| | Sbjct: 550 ttaaggaacttgggttccttctccagctccttgccagaacgcctgtcaaccttggtcatg 491 Query: 449 atctcggcgaacttgacggcnatgtgggatgtgtggcagtccagcacangggcataacc 507 ||||| | |||||||| || |||||| | |||||||| |||| ||| |||||||||| Sbjct: 490 atctcagaaaacttgaccgcaatgtggcaagtgtggcaatccaatacaggggcataacc 432
>gb|AY832557.1| Pseudotsuga menziesii var. menziesii haplotype Pm-EF1A_2 translation elongation factor-1 alpha (EF1A) gene, partial cds Length = 1072 Score = 139 bits (70), Expect = 1e-29 Identities = 196/239 (82%) Strand = Plus / Minus Query: 269 acagcaaccgtctgcctnatgtcacgcacggcaaaccgacccagaggagggtactgggca 328 |||||||||||||| | ||||| | ||| ||||| ||||||| ||||| |||| |||| Sbjct: 670 acagcaaccgtctgacgcatgtccctcactgcaaaacgacccaatggaggatactcggca 611 Query: 329 aaggtctccaccaccatgggcttggttggaatcatcttgacgaacccagcatcaccattc 388 ||||| ||||| ||||| || |||||||||||||||||||| ||||||||||| || ||| Sbjct: 610 aaggtttccacaaccattggtttggttggaatcatcttgacaaacccagcatctccgttc 551 Query: 389 ttgagaaacttgggcgctgcctccagctccttgccggaccgcctgtcgatcttggtctgg 448 || || |||||||| | ||||||||||||||| || |||||||| | ||||||| | Sbjct: 550 ttaaggaacttgggttccttctccagctccttgccagaacgcctgtcaaccttggtcatg 491 Query: 449 atctcggcgaacttgacggcnatgtgggatgtgtggcagtccagcacangggcataacc 507 ||||| | |||||||| || |||||| | |||||||| |||| ||| | |||||||| Sbjct: 490 atctcagaaaacttgaccgcaatgtggcaagtgtggcaatccaatacaggagcataacc 432
>gb|AY832556.1| Pseudotsuga menziesii var. menziesii haplotype Pm-EF1A_1 translation elongation factor-1 alpha (EF1A) gene, partial cds Length = 1072 Score = 139 bits (70), Expect = 1e-29 Identities = 196/239 (82%) Strand = Plus / Minus Query: 269 acagcaaccgtctgcctnatgtcacgcacggcaaaccgacccagaggagggtactgggca 328 |||||||||||||| | || || | ||| ||||| ||||||| ||||| |||| |||| Sbjct: 670 acagcaaccgtctgacgcatatccctcactgcaaaacgacccaatggaggatactcggca 611 Query: 329 aaggtctccaccaccatgggcttggttggaatcatcttgacgaacccagcatcaccattc 388 ||||| ||||| ||||| || |||||||||||||||||||| ||||||||||| || ||| Sbjct: 610 aaggtttccacaaccattggtttggttggaatcatcttgacaaacccagcatctccgttc 551 Query: 389 ttgagaaacttgggcgctgcctccagctccttgccggaccgcctgtcgatcttggtctgg 448 || || |||||||| | ||||||||||||||| || |||||||| | ||||||| | Sbjct: 550 ttaaggaacttgggttccttctccagctccttgccagaacgcctgtcaaccttggtcatg 491 Query: 449 atctcggcgaacttgacggcnatgtgggatgtgtggcagtccagcacangggcataacc 507 ||||| | |||||||| || |||||| | |||||||| |||| ||| |||||||||| Sbjct: 490 atctcagaaaacttgaccgcaatgtggcaagtgtggcaatccaatacaggggcataacc 432
>emb|AJ004960.1|CAA004960 Cicer arietinum mRNA for elongation factor 1-alpha (EF1-a) Length = 1304 Score = 139 bits (70), Expect = 1e-29 Identities = 291/366 (79%) Strand = Plus / Minus Query: 192 ctcatttcttcttgatcgcagccttggtaaccttggcgccggtcggctccttcttctcna 251 |||| |||||||||| ||||||||||| | |||||| || || || ||||||||||| | Sbjct: 984 ctcacttcttcttgactgcagccttggtgatcttggctccagttggatccttcttctcaa 925 Query: 252 cgctcttgatcacacccacagcaaccgtctgcctnatgtcacgcacggcaaaccgaccca 311 | ||||| || ||||| |||||||| || || | ||||| | ||| ||||| ||||| | Sbjct: 924 cactcttaatgacaccgacagcaacagtttgacgcatgtccctcacagcaaaacgaccaa 865 Query: 312 gaggagggtactgggcaaaggtctccaccaccatgggcttggttggaatcatcttgacga 371 | || || |||| || || || ||||| ||||| ||||| |||||||||||||| || | Sbjct: 864 gtggtggatactcggagaaagtttccacaaccataggctttgttggaatcatcttaacaa 805 Query: 372 acccagcatcaccattcttgagaaacttgggcgctgcctccagctccttgccggaccgcc 431 ||||||||||||||||| | |||||| ||| | ||| || ||||| || || || | Sbjct: 804 gaccagcatcaccattcttcaaaaacttaggctccttctcgagttccttaccagatcgtc 745 Query: 432 tgtcgatcttggtctggatctcggcgaacttgacggcnatgtgggatgtgtggcagtcca 491 |||| |||||||| | | ||| |||||||| || || |||||||| ||||| ||||| | Sbjct: 744 tgtcaatcttggtgagaagctcagcgaacttaacagcaatgtgggaggtgtgacagtcga 685 Query: 492 gcacangggcataaccgttgctgatctggccagggtggttcatgatgatgacctgggcag 551 | || ||||||||||||| | ||||| || || ||||||||||||||||| |||| || Sbjct: 684 ggactggggcataaccgtttccaatctgtcctggatggttcatgatgatgacttgggaag 625 Query: 552 tgaagt 557 |||||| Sbjct: 624 tgaagt 619
>gb|DQ442392.1| Striga asiatica clone St460 elongation factor 1 alpha subunit mRNA, partial cds Length = 568 Score = 139 bits (70), Expect = 1e-29 Identities = 176/212 (83%) Strand = Plus / Minus Query: 326 gcaaaggtctccaccaccatgggcttggttggaatcatcttgacgaacccagcatcacca 385 ||||| |||||||| |||||||||||||| ||||||||||| || ||||||||||||||| Sbjct: 563 gcaaaagtctccacaaccatgggcttggtcggaatcatcttaacaaacccagcatcacca 504 Query: 386 ttcttgagaaacttgggcgctgcctccagctccttgccggaccgcctgtcgatcttggtc 445 ||||| | ||||||||| | |||||||||||| || |||||||| || ||||| ||| Sbjct: 503 ttcttcaagaacttgggctccttctccagctccttaccagaccgcctatcaatcttagtc 444 Query: 446 tggatctcggcgaacttgacggcnatgtgggatgtgtggcagtccagcacangggcataa 505 || |||| | || ||||| || |||||||| ||||||||||| ||||| ||||||| Sbjct: 443 acgagctcgacaaatttgacagcaatgtgggaagtgtggcagtcgagcacgggggcatag 384 Query: 506 ccgttgctgatctggccagggtggttcatgat 537 || | | ||||| ||||||||||||||||| Sbjct: 383 ccctgaccaatctgcccagggtggttcatgat 352
>emb|AJ132534.1|PAB132534 Picea abies mRNA for translation elongation factor-1 alpha, partial Length = 1747 Score = 139 bits (70), Expect = 1e-29 Identities = 196/239 (82%) Strand = Plus / Minus Query: 269 acagcaaccgtctgcctnatgtcacgcacggcaaaccgacccagaggagggtactgggca 328 |||||||||||||| | ||||| | ||| ||||| ||||||| ||||| |||| || Sbjct: 1259 acagcaaccgtctgacgcatgtccctcacagcaaaacgacccaatggaggatactcagcg 1200 Query: 329 aaggtctccaccaccatgggcttggttggaatcatcttgacgaacccagcatcaccattc 388 ||||| ||||| |||||||| |||||||| |||||||| || ||||| ||||| |||||| Sbjct: 1199 aaggtttccacaaccatgggtttggttggtatcatcttaacaaacccggcatctccattc 1140 Query: 389 ttgagaaacttgggcgctgcctccagctccttgccggaccgcctgtcgatcttggtctgg 448 || ||||||||||| | |||||| |||||||| || |||||||| | ||||||| | Sbjct: 1139 ttaagaaacttgggttccttctccagttccttgccagaacgcctgtcaaccttggtcatg 1080 Query: 449 atctcggcgaacttgacggcnatgtgggatgtgtggcagtccagcacangggcataacc 507 ||||| | ||||||||||| |||||| | |||||||| |||| |||| |||||||||| Sbjct: 1079 atctcagaaaacttgacggcaatgtggcaagtgtggcaatccaacacaggggcataacc 1021
>emb|AJ222579.1|VFEF1A Vicia faba mRNA for elongation factor 1-alpha (EF1-a) Length = 1599 Score = 137 bits (69), Expect = 4e-29 Identities = 278/349 (79%) Strand = Plus / Minus Query: 209 gcagccttggtaaccttggcgccggtcggctccttcttctcnacgctcttgatcacaccc 268 ||||| ||||| |||||||| || || || ||||||||||| || |||||||| || || Sbjct: 1369 gcagctttggtgaccttggctccagttgggtccttcttctccacactcttgatgactccg 1310 Query: 269 acagcaaccgtctgcctnatgtcacgcacggcaaaccgacccagaggagggtactgggca 328 |||||||| || || || ||||| | || ||||| ||||| || ||||| |||| |||| Sbjct: 1309 acagcaacagtttgtctcatgtccctaacagcaaaacgaccaagtggaggatactcggca 1250 Query: 329 aaggtctccaccaccatgggcttggttggaatcatcttgacgaacccagcatcaccattc 388 || || ||||| |||||||||||||| ||||||||||| || | || |||||||||||| Sbjct: 1249 aaagtttccacaaccatgggcttggtgggaatcatcttaaccatacctgcatcaccattc 1190 Query: 389 ttgagaaacttgggcgctgcctccagctccttgccggaccgcctgtcgatcttggtctgg 448 || | |||||||||| | ||| | |||||| || || |||||||| |||||||| Sbjct: 1189 ttcaaaaacttgggctccttctcaatctccttaccagatcgcctgtcaatcttggtgata 1130 Query: 449 atctcggcgaacttgacggcnatgtgggatgtgtggcagtccagcacangggcataaccg 508 | || || ||||| || || ||||| || || ||||| || ||||| | ||||||||| Sbjct: 1129 agttcagcaaacttcacagcaatgtgagaggtatggcaatctagcactggtgcataaccg 1070 Query: 509 ttgctgatctggccagggtggttcatgatgatgacctgggcagtgaagt 557 || | |||||| ||||| ||||||||||||||||| |||| ||||||| Sbjct: 1069 tttccgatctgtccaggatggttcatgatgatgacttgggaggtgaagt 1021
>gb|DQ226919.1| Boechera divaricarpa isolate SLW-E-A06 mRNA sequence Length = 281 Score = 135 bits (68), Expect = 2e-28 Identities = 186/226 (82%) Strand = Plus / Minus Query: 332 gtctccaccaccatgggcttggttggaatcatcttgacgaacccagcatcaccattcttg 391 ||||| ||||||||||||||||| ||| ||||||| || | || |||||||||||||| Sbjct: 270 gtctcgaccaccatgggcttggtcggagtcatcttcaccataccggcatcaccattcttc 211 Query: 392 agaaacttgggcgctgcctccagctccttgccggaccgcctgtcgatcttggtctggatc 451 | |||||||||| | ||| | |||||| || || |||||||| ||||||||| |||| Sbjct: 210 aaaaacttgggctccttctcaatctccttaccagaacgcctgtcaatcttggtcgagatc 151 Query: 452 tcggcgaacttgacggcnatgtgggatgtgtggcagtccagcacangggcataaccgttg 511 || | ||||||||| || ||||| || |||||||| || || || ||||||||||||| Sbjct: 150 tcagagaacttgactgcaatgtgagaggtgtggcaatcgaggactggggcataaccgtta 91 Query: 512 ctgatctggccagggtggttcatgatgatgacctgggcagtgaagt 557 | ||||| |||||||||||||||||||| ||||||| ||||||| Sbjct: 90 ccaatctgaccagggtggttcatgatgataacctgggaggtgaagt 45
>dbj|AB019427.1| Nicotiana paniculata mRNA for elongation factor-1 alpha, complete cds Length = 1734 Score = 135 bits (68), Expect = 2e-28 Identities = 271/340 (79%) Strand = Plus / Minus Query: 209 gcagccttggtaaccttggcgccggtcggctccttcttctcnacgctcttgatcacaccc 268 ||||||||||| ||||| || || || || |||||||| || ||| ||||||| ||||| Sbjct: 1396 gcagccttggtgaccttagcaccagttgggtccttcttgtcaacgttcttgataacacca 1337 Query: 269 acagcaaccgtctgcctnatgtcacgcacggcaaaccgacccagaggagggtactgggca 328 |||||||| || || | ||||| | ||| ||||| || |||| || || |||| | Sbjct: 1336 acagcaacagtttgacgcatgtccctcacagcaaaacgtcccaatggtggatactcagag 1277 Query: 329 aaggtctccaccaccatgggcttggttggaatcatcttgacgaacccagcatcaccattc 388 |||||||| || |||||||||||||| ||||||||||| || | ||||||||||||||| Sbjct: 1276 aaggtctcaacaaccatgggcttggtgggaatcatcttaaccataccagcatcaccattc 1217 Query: 389 ttgagaaacttgggcgctgcctccagctccttgccggaccgcctgtcgatcttggtctgg 448 || | ||||||||| | ||| |||||||| || || |||||||||||||||||| Sbjct: 1216 ttcaagaacttgggctccttctcaagctccttaccagaacgcctgtcgatcttggtcaaa 1157 Query: 449 atctcggcgaacttgacggcnatgtgggatgtgtggcagtccagcacangggcataaccg 508 || || || |||||||| || |||||||| ||||||||||| ||||| | ||||| || Sbjct: 1156 atttctgcaaacttgacagcaatgtgggaggtgtggcagtcaagcactggagcatatcca 1097 Query: 509 ttgctgatctggccagggtggttcatgatgatgacctggg 548 || | ||||| || || ||||||||||||||||| |||| Sbjct: 1096 tttccaatctgtcctggatggttcatgatgatgacttggg 1057
>gb|AY832568.1| Pseudotsuga menziesii var. menziesii haplotype Pm-EF1A_14 translation elongation factor-1 alpha (EF1A) gene, partial cds Length = 1072 Score = 131 bits (66), Expect = 3e-27 Identities = 195/239 (81%) Strand = Plus / Minus Query: 269 acagcaaccgtctgcctnatgtcacgcacggcaaaccgacccagaggagggtactgggca 328 |||||||||||||| | || || | ||| ||||| ||||||| ||||| |||| |||| Sbjct: 670 acagcaaccgtctgacgcatatccctcactgcaaaacgacccaatggaggatactcggca 611 Query: 329 aaggtctccaccaccatgggcttggttggaatcatcttgacgaacccagcatcaccattc 388 ||||| ||||| ||||| || |||||||||||||||||||| ||||||||||| || ||| Sbjct: 610 aaggtttccacaaccattggtttggttggaatcatcttgacaaacccagcatctccgttc 551 Query: 389 ttgagaaacttgggcgctgcctccagctccttgccggaccgcctgtcgatcttggtctgg 448 || || |||||||| | ||||||||||||||| || |||||||| | |||||| | Sbjct: 550 ttaaggaacttgggttccttctccagctccttgccagaacgcctgtcaactttggtcatg 491 Query: 449 atctcggcgaacttgacggcnatgtgggatgtgtggcagtccagcacangggcataacc 507 ||||| | |||||||| || |||||| | |||||||| |||| ||| |||||||||| Sbjct: 490 atctcagaaaacttgaccgcaatgtggcaagtgtggcaatccaatacaggggcataacc 432
>emb|X60302.1|DCEF1A D.carota gene for elongation factor 1A Length = 1785 Score = 131 bits (66), Expect = 3e-27 Identities = 269/338 (79%) Strand = Plus / Minus Query: 209 gcagccttggtaaccttggcgccggtcggctccttcttctcnacgctcttgatcacaccc 268 ||||||||||| ||||||||||| || || ||||||||||| || |||||| || || Sbjct: 1539 gcagccttggtgaccttggcgccagttggatccttcttctcaacagccttgatgactcca 1480 Query: 269 acagcaaccgtctgcctnatgtcacgcacggcaaaccgacccagaggagggtactgggca 328 || ||||| ||||| || ||| |||| || || |||| ||| || || ||||||| ||| Sbjct: 1479 actgcaacagtctgtctcatgacacgaacagcgaacctaccgaggggcgggtactcagca 1420 Query: 329 aaggtctccaccaccatgggcttggttggaatcatcttgacgaacccagcatcaccattc 388 || ||||| |||||||| |||||||| |||| |||||| || | |||||||||||||| Sbjct: 1419 aatgtctcaaccaccataggcttggtgggaagcatcttaaccattccagcatcaccattt 1360 Query: 389 ttgagaaacttgggcgctgcctccagctccttgccggaccgcctgtcgatcttggtctgg 448 || | ||||||||| | ||| ||||||||||| || | | ||| ||||| ||| | Sbjct: 1359 ttcaagaacttgggctccttctcaagctccttgccagatcttcggtcaatctttgtcaag 1300 Query: 449 atctcggcgaacttgacggcnatgtgggatgtgtggcagtccagcacangggcataaccg 508 | ||| || |||||||| || ||||| || |||||||| || || || ||||||||||| Sbjct: 1299 agctcagcaaacttgacagcaatgtgagaggtgtggcaatcaagtaccggggcataaccg 1240 Query: 509 ttgctgatctggccagggtggttcatgatgatgacctg 546 || | ||||| ||||||||||||||||| |||||||| Sbjct: 1239 tttccaatctgaccagggtggttcatgataatgacctg 1202
>gb|AY946009.1| Actinidia deliciosa elongation factor 1 alpha mRNA, complete cds Length = 1738 Score = 131 bits (66), Expect = 3e-27 Identities = 290/366 (79%) Strand = Plus / Minus Query: 192 ctcatttcttcttgatcgcagccttggtaaccttggcgccggtcggctccttcttctcna 251 |||| |||||||| | ||||||||||| |||||||| |||||||| ||||||||||| | Sbjct: 1442 ctcacttcttcttcagagcagccttggtgaccttggcaccggtcggatccttcttctcca 1383 Query: 252 cgctcttgatcacacccacagcaaccgtctgcctnatgtcacgcacggcaaaccgaccca 311 |||||||||| ||||| || || || || || | ||||| | ||| ||||| ||||| | Sbjct: 1382 cgctcttgatgacaccaaccgccacagtttgacgcatgtctctcacagcaaaacgaccga 1323 Query: 312 gaggagggtactgggcaaaggtctccaccaccatgggcttggttggaatcatcttgacga 371 | || ||||||| | || ||||||||||||||||| ||||| ||||||||||| || | Sbjct: 1322 gcggtgggtactccgagaaagtctccaccaccatgggtttggtgggaatcatcttcacca 1263 Query: 372 acccagcatcaccattcttgagaaacttgggcgctgcctccagctccttgccggaccgcc 431 ||||| ||||||||||| | ||||||||| | ||| ||||| ||||| |||| || Sbjct: 1262 tcccagagtcaccattcttcaagaacttgggctccttctcgagctctttgccagacctcc 1203 Query: 432 tgtcgatcttggtctggatctcggcgaacttgacggcnatgtgggatgtgtggcagtcca 491 | || ||||||||| | ||| || ||||| || || |||||||| |||||||| |||| Sbjct: 1202 tatcaatcttggtcaaaagctcagcaaacttaactgcgatgtgggaggtgtggcaatcca 1143 Query: 492 gcacangggcataaccgttgctgatctggccagggtggttcatgatgatgacctgggcag 551 || ||||||| || || | || || || || ||||||||||| || ||||||| || Sbjct: 1142 aaaccggggcatacccatttccaatttgacctggatggttcatgataataacctgggaag 1083 Query: 552 tgaagt 557 |||||| Sbjct: 1082 tgaagt 1077
>gb|AY574951.1| Solanum nigrum elongation factor 1 alpha mRNA, partial cds Length = 215 Score = 129 bits (65), Expect = 1e-26 Identities = 174/211 (82%) Strand = Plus / Minus Query: 345 tgggcttggttggaatcatcttgacgaacccagcatcaccattcttgagaaacttgggcg 404 |||||||||| ||||||||||| || | ||||||||||||||||| | ||||| ||| Sbjct: 214 tgggcttggtgggaatcatcttaaccataccagcatcaccattcttcaagaacttaggct 155 Query: 405 ctgcctccagctccttgccggaccgcctgtcgatcttggtctggatctcggcgaacttga 464 | ||| || ||||| || || |||||||| ||||||||| |||||| || ||||||| Sbjct: 154 ccttctcaagttccttaccagaacgcctgtcaatcttggtcaagatctcagcaaacttga 95 Query: 465 cggcnatgtgggatgtgtggcagtccagcacangggcataaccgttgctgatctggccag 524 | || |||||||| ||||||||||| ||||| | ||||| || || | ||||| |||| Sbjct: 94 cagcaatgtgggaagtgtggcagtcgagcactggtgcatatccatttccaatctgaccag 35 Query: 525 ggtggttcatgatgatgacctgggcagtgaa 555 | ||||||||||||||||||||||||||||| Sbjct: 34 gatggttcatgatgatgacctgggcagtgaa 4
>gb|DQ174254.1| Gossypium hirsutum translation elongation factor 1A-5 (EF1A5) mRNA, complete cds Length = 1738 Score = 129 bits (65), Expect = 1e-26 Identities = 268/337 (79%) Strand = Plus / Minus Query: 221 accttggcgccggtcggctccttcttctcnacgctcttgatcacacccacagcaaccgtc 280 |||||||| || || || ||||||||||| || |||||||||||||| |||||||| ||| Sbjct: 1316 accttggctccagttgggtccttcttctccacactcttgatcacaccaacagcaacagtc 1257 Query: 281 tgcctnatgtcacgcacggcaaaccgacccagaggagggtactgggcaaaggtctccacc 340 || || ||||| | |||||||| || || || |||||||||| || || || ||||| Sbjct: 1256 tgtctcatgtccctaacggcaaaacgtccaagtggagggtactcggagaaagtttccaca 1197 Query: 341 accatgggcttggttggaatcatcttgacgaacccagcatcaccattcttgagaaacttg 400 |||||||||||||| |||| |||||| | | ||||||||||||||||| | ||||| Sbjct: 1196 accatgggcttggtcggaaccatcttaatcataccagcatcaccattcttcaagaactta 1137 Query: 401 ggcgctgcctccagctccttgccggaccgcctgtcgatcttggtctggatctcggcgaac 460 ||| | ||| |||||||| || || |||||||| ||||||||| || ||| || ||| Sbjct: 1136 ggctccttctcaagctccttaccagatcgcctgtcaatcttggtcaagagctctgcaaac 1077 Query: 461 ttgacggcnatgtgggatgtgtggcagtccagcacangggcataaccgttgctgatctgg 520 ||||| || || ||||| |||||||| || || || | ||||| || || | ||||| Sbjct: 1076 ttgacagcaatatgggaggtgtggcaatcgaggaccggtgcatagccatttccaatctgt 1017 Query: 521 ccagggtggttcatgatgatgacctgggcagtgaagt 557 || ||||||||||||||||| || |||| ||||||| Sbjct: 1016 cctgggtggttcatgatgataacttgggaggtgaagt 980
>gb|DQ174252.1| Gossypium hirsutum translation elongation factor 1A-3 (EF1A3) mRNA, complete cds Length = 1711 Score = 129 bits (65), Expect = 1e-26 Identities = 277/349 (79%) Strand = Plus / Minus Query: 209 gcagccttggtaaccttggcgccggtcggctccttcttctcnacgctcttgatcacaccc 268 |||| |||||| |||||||| || || || ||||||||||| || |||||||||||||| Sbjct: 1328 gcagacttggtcaccttggctccagttgggtccttcttctccacactcttgatcacacca 1269 Query: 269 acagcaaccgtctgcctnatgtcacgcacggcaaaccgacccagaggagggtactgggca 328 |||||||| ||||| || ||||| | |||||||| || || || ||||||||| || Sbjct: 1268 acagcaacagtctgtctcatgtccctaacggcaaaacgtccaagtggagggtacgcggag 1209 Query: 329 aaggtctccaccaccatgggcttggttggaatcatcttgacgaacccagcatcaccattc 388 ||||| || || |||||||||||||| |||| |||||| | | ||||||||||||||| Sbjct: 1208 aaggtttctacaaccatgggcttggtcggaaccatcttaatcataccagcatcaccattc 1149 Query: 389 ttgagaaacttgggcgctgcctccagctccttgccggaccgcctgtcgatcttggtctgg 448 || | ||||| ||| | ||| |||||||| || || |||||||| ||||||||| | Sbjct: 1148 ttcaagaacttaggctccttctcaagctccttaccagatcgcctgtcaatcttggtcaag 1089 Query: 449 atctcggcgaacttgacggcnatgtgggatgtgtggcagtccagcacangggcataaccg 508 | ||| || |||||||| || || ||||| |||||||| || || || | ||||| || Sbjct: 1088 agctctgcaaacttgacagcaatatgggaggtgtggcaatctaggaccggtgcatagcca 1029 Query: 509 ttgctgatctggccagggtggttcatgatgatgacctgggcagtgaagt 557 || | ||||| || ||||||||||||||||| || |||| ||||||| Sbjct: 1028 tttccaatctgccctgggtggttcatgatgataacttgggaggtgaagt 980
>emb|CT010481.8| M.truncatula DNA sequence from clone MTH2-62G7 on chromosome 3, complete sequence Length = 113400 Score = 129 bits (65), Expect = 1e-26 Identities = 277/349 (79%) Strand = Plus / Plus Query: 209 gcagccttggtaaccttggcgccggtcggctccttcttctcnacgctcttgatcacaccc 268 ||||||||||| |||||||| ||||| || ||||||||||| || |||||| ||||| Sbjct: 72737 gcagccttggtgaccttggctccggtaggatccttcttctccacagccttgatgacacca 72796 Query: 269 acagcaaccgtctgcctnatgtcacgcacggcaaaccgacccagaggagggtactgggca 328 |||||||| || || | ||||| | || ||||| || || |||||||| || | ||| Sbjct: 72797 acagcaacagtttgacgcatgtccctgacagcaaaacgtccaagaggaggatattcagca 72856 Query: 329 aaggtctccaccaccatgggcttggttggaatcatcttgacgaacccagcatcaccattc 388 |||||||| ||||||||||||||||| |||| |||||| | || ||||||||||||||| Sbjct: 72857 aaggtctcaaccaccatgggcttggtgggaaccatcttaatgataccagcatcaccattc 72916 Query: 389 ttgagaaacttgggcgctgcctccagctccttgccggaccgcctgtcgatcttggtctgg 448 || | ||||||||| | ||| | |||||| || || |||||||| |||||||| Sbjct: 72917 ttcaagaacttgggctccttctcaatctccttaccagatcgcctgtcaatcttggtaaca 72976 Query: 449 atctcggcgaacttgacggcnatgtgggatgtgtggcagtccagcacangggcataaccg 508 | || || ||||| || || ||||| || |||||||| || ||||| | ||||| || Sbjct: 72977 agttcagcaaacttcacagcaatgtgagaggtgtggcaatcgagcactggtgcatatcca 73036 Query: 509 ttgctgatctggccagggtggttcatgatgatgacctgggcagtgaagt 557 || | ||||| ||||||||||||||||||||||| |||| |||||||| Sbjct: 73037 tttccaatctgtccagggtggttcatgatgatgacttgggaagtgaagt 73085 Score = 105 bits (53), Expect = 2e-19 Identities = 274/349 (78%) Strand = Plus / Plus Query: 209 gcagccttggtaaccttggcgccggtcggctccttcttctcnacgctcttgatcacaccc 268 ||||| ||||| || ||||| ||||| || ||||||||||| || |||||| ||||| Sbjct: 82274 gcagctttggtgactttggctccggtgggatccttcttctccacagccttgatgacacca 82333 Query: 269 acagcaaccgtctgcctnatgtcacgcacggcaaaccgacccagaggagggtactgggca 328 |||||||| || || | ||||| | |||||||| || || |||||||| || | || Sbjct: 82334 acagcaacagtttgacgcatgtccctgacggcaaaacgtccaagaggaggatattcagcg 82393 Query: 329 aaggtctccaccaccatgggcttggttggaatcatcttgacgaacccagcatcaccattc 388 |||||||| ||||||||||||||||| |||| |||||| | || ||||||||||| ||| Sbjct: 82394 aaggtctcaaccaccatgggcttggtgggaaccatcttaatgataccagcatcaccgttc 82453 Query: 389 ttgagaaacttgggcgctgcctccagctccttgccggaccgcctgtcgatcttggtctgg 448 || | ||||||||| | ||| | |||||| || || |||||||| |||||||| Sbjct: 82454 ttcaagaacttgggctccttctcaatctccttaccagatcgcctgtcaatcttggtaaca 82513 Query: 449 atctcggcgaacttgacggcnatgtgggatgtgtggcagtccagcacangggcataaccg 508 | || || ||||| || || ||||| || |||||||| || ||||| | ||||| || Sbjct: 82514 agttcagcaaacttcacagcaatgtgagaggtgtggcaatcgagcactggtgcatatcca 82573 Query: 509 ttgctgatctggccagggtggttcatgatgatgacctgggcagtgaagt 557 || | ||||| ||||||||||||||||||||||| |||| |||||||| Sbjct: 82574 tttccaatctgtccagggtggttcatgatgatgacttgggaagtgaagt 82622
>dbj|AK221032.1| Arabidopsis thaliana mRNA for elongation factor 1-alpha, partial cds, clone: RAFL22-71-O21 Length = 599 Score = 123 bits (62), Expect = 7e-25 Identities = 159/192 (82%) Strand = Plus / Minus Query: 199 cttcttgatcgcagccttggtaaccttggcgccggtcggctccttcttctcnacgctctt 258 |||||||| |||||||||||||||||||| || || || |||||||| || || ||||| Sbjct: 273 cttcttgactgcagccttggtaaccttggctccagttgggtccttcttgtcaacactctt 214 Query: 259 gatcacacccacagcaaccgtctgcctnatgtcacgcacggcaaaccgacccagaggagg 318 ||| ||||| || ||||| |||||||| ||||| | ||| || || || || || || || Sbjct: 213 gataacaccgactgcaacagtctgcctcatgtccctcacagcgaaacgtccaagtggtgg 154 Query: 319 gtactgggcaaaggtctccaccaccatgggcttggttggaatcatcttgacgaacccagc 378 ||||| | ||||||||||| |||||||||||||||||| ||||||| || | ||||| Sbjct: 153 gtactcagagaaggtctccacaaccatgggcttggttggagtcatcttcaccataccagc 94 Query: 379 atcaccattctt 390 |||||||||||| Sbjct: 93 atcaccattctt 82
>emb|BX814695.1|CNS0ADQC Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB8ZA02 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1593 Score = 123 bits (62), Expect = 7e-25 Identities = 159/192 (82%) Strand = Plus / Minus Query: 199 cttcttgatcgcagccttggtaaccttggcgccggtcggctccttcttctcnacgctctt 258 |||||||| |||||||||||||||||||| || || || |||||||| || || ||||| Sbjct: 1359 cttcttgactgcagccttggtaaccttggctccagttgggtccttcttgtcaacactctt 1300 Query: 259 gatcacacccacagcaaccgtctgcctnatgtcacgcacggcaaaccgacccagaggagg 318 ||| ||||| || ||||| |||||||| ||||| | ||| || || || || || || || Sbjct: 1299 gataacaccgactgcaacagtctgcctcatgtccctcacagcgaaacgtccaagtggtgg 1240 Query: 319 gtactgggcaaaggtctccaccaccatgggcttggttggaatcatcttgacgaacccagc 378 ||||| | ||||||||||| |||||||||||||||||| ||||||| || | ||||| Sbjct: 1239 gtactcagagaaggtctccacaaccatgggcttggttggagtcatcttcaccataccagc 1180 Query: 379 atcaccattctt 390 |||||||||||| Sbjct: 1179 atcaccattctt 1168 Score = 83.8 bits (42), Expect = 6e-13 Identities = 85/100 (85%) Strand = Plus / Minus Query: 458 aacttgacggcnatgtgggatgtgtggcagtccagcacangggcataaccgttgctgatc 517 |||||||| || ||||| || |||||||| ||||| || |||| |||||||| | ||| Sbjct: 1100 aacttgactgcaatgtgagaggtgtggcaatccaggactggggcgtaaccgttaccaatc 1041 Query: 518 tggccagggtggttcatgatgatgacctgggcagtgaagt 557 || |||||||||||||||||||||||||||| ||||||| Sbjct: 1040 tgaccagggtggttcatgatgatgacctgggaggtgaagt 1001
>gb|DQ174258.1| Gossypium hirsutum translation elongation factor 1A-9 (EF1A9) mRNA, complete cds Length = 1734 Score = 121 bits (61), Expect = 3e-24 Identities = 267/337 (79%) Strand = Plus / Minus Query: 221 accttggcgccggtcggctccttcttctcnacgctcttgatcacacccacagcaaccgtc 280 |||||||| || || || ||||||||||| || |||||||||||||| |||||||| ||| Sbjct: 1316 accttggctccagttgggtccttcttctccacactcttgatcacaccaacagcaacagtc 1257 Query: 281 tgcctnatgtcacgcacggcaaaccgacccagaggagggtactgggcaaaggtctccacc 340 || || ||||| | |||||||| || || || |||||||||| || || || ||||| Sbjct: 1256 tgtctcatgtccctaacggcaaaacgtccaagtggagggtactcggagaaagtttccaca 1197 Query: 341 accatgggcttggttggaatcatcttgacgaacccagcatcaccattcttgagaaacttg 400 | |||||||||||| |||| |||||| | | ||||||||||||||||| | ||||| Sbjct: 1196 agcatgggcttggtcggaaccatcttaatcataccagcatcaccattcttcaagaactta 1137 Query: 401 ggcgctgcctccagctccttgccggaccgcctgtcgatcttggtctggatctcggcgaac 460 ||| | ||| |||||||| || || |||||||| ||||||||| || ||| || ||| Sbjct: 1136 ggctccttctcaagctccttaccagatcgcctgtcaatcttggtcaagagctctgcaaac 1077 Query: 461 ttgacggcnatgtgggatgtgtggcagtccagcacangggcataaccgttgctgatctgg 520 ||||| || || ||||| |||||||| || || || | ||||| || || | ||||| Sbjct: 1076 ttgacagcaatatgggaggtgtggcaatcgaggaccggtgcatagccatttccaatctgt 1017 Query: 521 ccagggtggttcatgatgatgacctgggcagtgaagt 557 || ||||||||||||||||| || |||| ||||||| Sbjct: 1016 cctgggtggttcatgatgataacttgggaggtgaagt 980
>gb|DQ174257.1| Gossypium hirsutum translation elongation factor 1A-8 (EF1A8) mRNA, complete cds Length = 1555 Score = 121 bits (61), Expect = 3e-24 Identities = 276/349 (79%) Strand = Plus / Minus Query: 209 gcagccttggtaaccttggcgccggtcggctccttcttctcnacgctcttgatcacaccc 268 |||| |||||| |||||||| || | || ||||||||||| || |||||||||||||| Sbjct: 1328 gcagacttggtcaccttggctccagatgggtccttcttctccacactcttgatcacacca 1269 Query: 269 acagcaaccgtctgcctnatgtcacgcacggcaaaccgacccagaggagggtactgggca 328 |||||||| ||||| || ||||| | |||||||| || || || ||||||||| || Sbjct: 1268 acagcaacagtctgtctcatgtccctaacggcaaaacgtccaagtggagggtacgcggag 1209 Query: 329 aaggtctccaccaccatgggcttggttggaatcatcttgacgaacccagcatcaccattc 388 ||||| || || |||||||||||||| |||| |||||| | | ||||||||||||||| Sbjct: 1208 aaggtttcgacaaccatgggcttggtcggaaccatcttaatcataccagcatcaccattc 1149 Query: 389 ttgagaaacttgggcgctgcctccagctccttgccggaccgcctgtcgatcttggtctgg 448 || | ||||| ||| | ||| |||||||| || || |||||||| ||||||||| | Sbjct: 1148 ttcaagaacttaggctccttctcaagctccttaccagatcgcctgtcaatcttggtcaag 1089 Query: 449 atctcggcgaacttgacggcnatgtgggatgtgtggcagtccagcacangggcataaccg 508 | ||| || |||||||| || || ||||| |||||||| || || || | ||||| || Sbjct: 1088 agctctgcaaacttgacagcaatatgggaggtgtggcaatctaggaccggtgcatagcca 1029 Query: 509 ttgctgatctggccagggtggttcatgatgatgacctgggcagtgaagt 557 || | ||||| || ||||||||||||||||| || |||| ||||||| Sbjct: 1028 tttccaatctgccctgggtggttcatgatgataacttgggaggtgaagt 980
>gb|AY039764.1| Sinapis arvensis elongation factor-1 alpha mRNA, partial cds Length = 523 Score = 121 bits (61), Expect = 3e-24 Identities = 206/255 (80%) Strand = Plus / Minus Query: 199 cttcttgatcgcagccttggtaaccttggcgccggtcggctccttcttctcnacgctctt 258 |||||||| ||||||||||| |||||||| ||||| || |||||||| || |||||||| Sbjct: 258 cttcttgacggcagccttggtcaccttggctccggttgggtccttcttgtccacgctctt 199 Query: 259 gatcacacccacagcaaccgtctgcctnatgtcacgcacggcaaaccgacccagaggagg 318 ||| ||||| || ||||| |||||||| ||||| | ||| || || || || || || || Sbjct: 198 gatgacaccgactgcaacagtctgcctcatgtcccccacagcgaaacgtccaaggggtgg 139 Query: 319 gtactgggcaaaggtctccaccaccatgggcttggttggaatcatcttgacgaacccagc 378 ||||| | || ||||| || |||||||||||||| ||| ||||||| || | ||||| Sbjct: 138 gtactcagagaatgtctcgacaaccatgggcttggtcggagtcatcttcaccataccagc 79 Query: 379 atcaccattcttgagaaacttgggcgctgcctccagctccttgccggaccgcctgtcgat 438 |||||| ||||| | |||||||||| | ||| | |||||| ||||| |||||||| || Sbjct: 78 atcaccgttcttcaaaaacttgggctccttctcaatctccttaccggaacgcctgtcaat 19 Query: 439 cttggtctggatctc 453 |||||| ||||||| Sbjct: 18 cttggtgaggatctc 4
>dbj|AB106676.1| Avicennia marina EF1-A mRNA for elongation factor 1A, complete cds Length = 1809 Score = 121 bits (61), Expect = 3e-24 Identities = 255/321 (79%) Strand = Plus / Minus Query: 236 ggctccttcttctcnacgctcttgatcacacccacagcaaccgtctgcctnatgtcacgc 295 ||||||||||| || |||||||| || ||||| |||||||| ||||| | || ||||| Sbjct: 1454 ggctccttcttttccacgctctttatgacaccaacagcaactgtctgacgcatatcacga 1395 Query: 296 acggcaaaccgacccagaggagggtactgggcaaaggtctccaccaccatgggcttggtt 355 || ||||| |||||||| || ||||| | | ||||| ||||| ||||||||||||||| Sbjct: 1394 acagcaaaacgacccagtggtgggtattcagagaaggtttccacaaccatgggcttggtt 1335 Query: 356 ggaatcatcttgacgaacccagcatcaccattcttgagaaacttgggcgctgcctccagc 415 ||||||||||| || || ||||||||||| ||||| | ||||| || | ||| || Sbjct: 1334 ggaatcatcttcacaaatccagcatcaccgttcttcaagaacttaggttccttctcgagt 1275 Query: 416 tccttgccggaccgcctgtcgatcttggtctggatctcggcgaacttgacggcnatgtgg 475 ||||| || || |||||||| |||||||| || ||| || ||||| || || |||||| Sbjct: 1274 tccttaccagatcgcctgtcaatcttggtgacgagctcagcaaacttaacagcaatgtgg 1215 Query: 476 gatgtgtggcagtccagcacangggcataaccgttgctgatctggccagggtggttcatg 535 || ||||||||||| ||||| | || || || || | ||||| ||||| ||||||||| Sbjct: 1214 gaggtgtggcagtcaagcactggtgcgtagccattaccaatctgaccaggatggttcatg 1155 Query: 536 atgatgacctgggcagtgaag 556 || |||||||| | ||||||| Sbjct: 1154 ataatgacctgtgaagtgaag 1134
>ref|XM_799615.1| Trypanosoma cruzi strain CL Brener elongation factor 1-alpha (EF-1-alpha) (Tc00.1047053511369.10) partial mRNA Length = 1329 Score = 119 bits (60), Expect = 1e-23 Identities = 124/146 (84%) Strand = Plus / Minus Query: 413 agctccttgccggaccgcctgtcgatcttggtctggatctcggcgaacttgacggcnatg 472 |||||||||||||| || | ||||||||||| || |||||||||||||||| || ||| Sbjct: 1103 agctccttgccggagcggcggtcgatcttggactcgatctcggcgaacttgcacgcgatg 1044 Query: 473 tgggatgtgtggcagtccagcacangggcataaccgttgctgatctggccagggtggttc 532 ||| | ||||||||||| ||||| | ||||| ||||||| ||||||||| ||||||||| Sbjct: 1043 tggcaggtgtggcagtcgagcaccggcgcatagccgttgccgatctggccggggtggttc 984 Query: 533 atgatgatgacctgggcagtgaagtc 558 | |||||| ||||| || |||||||| Sbjct: 983 aggatgatcacctgcgccgtgaagtc 958 Score = 40.1 bits (20), Expect = 7.6 Identities = 37/43 (86%) Strand = Plus / Minus Query: 275 accgtctgcctnatgtcacgcacggcaaaccgacccagaggag 317 |||||||| | ||||||||||||||||| || || ||||||| Sbjct: 1241 accgtctggcgcatgtcacgcacggcaaagcggccaagaggag 1199
>ref|XM_799616.1| Trypanosoma cruzi strain CL Brener elongation factor 1-alpha (EF-1-alpha) (Tc00.1047053511369.20) partial mRNA Length = 1350 Score = 119 bits (60), Expect = 1e-23 Identities = 124/146 (84%) Strand = Plus / Minus Query: 413 agctccttgccggaccgcctgtcgatcttggtctggatctcggcgaacttgacggcnatg 472 |||||||||||||| || | ||||||||||| || |||||||||||||||| || ||| Sbjct: 1124 agctccttgccggagcggcggtcgatcttggactcgatctcggcgaacttgcacgcgatg 1065 Query: 473 tgggatgtgtggcagtccagcacangggcataaccgttgctgatctggccagggtggttc 532 ||| | ||||||||||| ||||| | ||||| ||||||| ||||||||| ||||||||| Sbjct: 1064 tggcaggtgtggcagtcgagcaccggcgcatagccgttgccgatctggccggggtggttc 1005 Query: 533 atgatgatgacctgggcagtgaagtc 558 | |||||| ||||| || |||||||| Sbjct: 1004 aggatgatcacctgcgccgtgaagtc 979 Score = 40.1 bits (20), Expect = 7.6 Identities = 37/43 (86%) Strand = Plus / Minus Query: 275 accgtctgcctnatgtcacgcacggcaaaccgacccagaggag 317 |||||||| | ||||||||||||||||| || || ||||||| Sbjct: 1262 accgtctggcgcatgtcacgcacggcaaagcggccaagaggag 1220
>ref|XM_801736.1| Trypanosoma cruzi strain CL Brener elongation factor 1-alpha (EF-1-alpha) (Tc00.1047053510119.20) partial mRNA Length = 1350 Score = 119 bits (60), Expect = 1e-23 Identities = 124/146 (84%) Strand = Plus / Minus Query: 413 agctccttgccggaccgcctgtcgatcttggtctggatctcggcgaacttgacggcnatg 472 |||||||||||||| || | ||||||||||| || |||||||||||||||| || ||| Sbjct: 1124 agctccttgccggagcggcggtcgatcttggactcgatctcggcgaacttgcacgcgatg 1065 Query: 473 tgggatgtgtggcagtccagcacangggcataaccgttgctgatctggccagggtggttc 532 ||| | ||||||||||| ||||| | ||||| ||||||| ||||||||| ||||||||| Sbjct: 1064 tggcaggtgtggcagtcaagcaccggcgcatagccgttgccgatctggccggggtggttc 1005 Query: 533 atgatgatgacctgggcagtgaagtc 558 | |||||| ||||| || |||||||| Sbjct: 1004 aggatgatcacctgcgccgtgaagtc 979 Score = 40.1 bits (20), Expect = 7.6 Identities = 37/43 (86%) Strand = Plus / Minus Query: 275 accgtctgcctnatgtcacgcacggcaaaccgacccagaggag 317 |||||||| | ||||||||||||||||| || || ||||||| Sbjct: 1262 accgtctggcgcatgtcacgcacggcaaagcggccaagaggag 1220
>ref|XM_814346.1| Trypanosoma cruzi strain CL Brener elongation factor 1-alpha (EF-1-alpha) (Tc00.1047053511367.360) partial mRNA Length = 1350 Score = 119 bits (60), Expect = 1e-23 Identities = 124/146 (84%) Strand = Plus / Minus Query: 413 agctccttgccggaccgcctgtcgatcttggtctggatctcggcgaacttgacggcnatg 472 |||||||||||||| || | ||||||||||| || |||||||||||||||| || ||| Sbjct: 1124 agctccttgccggagcggcggtcgatcttggactcgatctcggcgaacttgcacgcgatg 1065 Query: 473 tgggatgtgtggcagtccagcacangggcataaccgttgctgatctggccagggtggttc 532 ||| | ||||||||||| ||||| | ||||| ||||||| ||||||||| ||||||||| Sbjct: 1064 tggcaggtgtggcagtcaagcaccggcgcatagccgttgccgatctggccggggtggttc 1005 Query: 533 atgatgatgacctgggcagtgaagtc 558 | |||||| ||||| || |||||||| Sbjct: 1004 aggatgatcacctgcgccgtgaagtc 979 Score = 40.1 bits (20), Expect = 7.6 Identities = 37/43 (86%) Strand = Plus / Minus Query: 275 accgtctgcctnatgtcacgcacggcaaaccgacccagaggag 317 |||||||| | ||||||||||||||||| || || ||||||| Sbjct: 1262 accgtctggcgcatgtcacgcacggcaaagcggccaagaggag 1220
>ref|XM_814347.1| Trypanosoma cruzi strain CL Brener elongation factor 1-alpha (EF-1-alpha) (Tc00.1047053511367.370) partial mRNA Length = 1350 Score = 119 bits (60), Expect = 1e-23 Identities = 124/146 (84%) Strand = Plus / Minus Query: 413 agctccttgccggaccgcctgtcgatcttggtctggatctcggcgaacttgacggcnatg 472 |||||||||||||| || | ||||||||||| || |||||||||||||||| || ||| Sbjct: 1124 agctccttgccggagcggcggtcgatcttggactcgatctcggcgaacttgcacgcgatg 1065 Query: 473 tgggatgtgtggcagtccagcacangggcataaccgttgctgatctggccagggtggttc 532 ||| | ||||||||||| ||||| | ||||| ||||||| ||||||||| ||||||||| Sbjct: 1064 tggcaggtgtggcagtcgagcaccggcgcatagccgttgccgatctggccggggtggttc 1005 Query: 533 atgatgatgacctgggcagtgaagtc 558 | |||||| ||||| || |||||||| Sbjct: 1004 aggatgatcacctgcgccgtgaagtc 979 Score = 40.1 bits (20), Expect = 7.6 Identities = 37/43 (86%) Strand = Plus / Minus Query: 275 accgtctgcctnatgtcacgcacggcaaaccgacccagaggag 317 |||||||| | ||||||||||||||||| || || ||||||| Sbjct: 1262 accgtctggcgcatgtcacgcacggcaaagcggccaagaggag 1220
>ref|XM_799617.1| Trypanosoma cruzi strain CL Brener elongation factor 1-alpha (EF-1-alpha) (Tc00.1047053511369.30) partial mRNA Length = 851 Score = 119 bits (60), Expect = 1e-23 Identities = 124/146 (84%) Strand = Plus / Minus Query: 413 agctccttgccggaccgcctgtcgatcttggtctggatctcggcgaacttgacggcnatg 472 |||||||||||||| || | ||||||||||| || |||||||||||||||| || ||| Sbjct: 625 agctccttgccggagcggcggtcgatcttggactcgatctcggcgaacttgcacgcgatg 566 Query: 473 tgggatgtgtggcagtccagcacangggcataaccgttgctgatctggccagggtggttc 532 ||| | ||||||||||| ||||| | ||||| ||||||| ||||||||| ||||||||| Sbjct: 565 tggcaggtgtggcagtcgagcaccggcgcatagccgttgccgatctggccggggtggttc 506 Query: 533 atgatgatgacctgggcagtgaagtc 558 | |||||| ||||| || |||||||| Sbjct: 505 aggatgatcacctgcgccgtgaagtc 480 Score = 40.1 bits (20), Expect = 7.6 Identities = 37/43 (86%) Strand = Plus / Minus Query: 275 accgtctgcctnatgtcacgcacggcaaaccgacccagaggag 317 |||||||| | ||||||||||||||||| || || ||||||| Sbjct: 763 accgtctggcgcatgtcacgcacggcaaagcggccaagaggag 721
>ref|XM_801742.1| Trypanosoma cruzi strain CL Brener elongation factor 1-alpha (EF-1-alpha) (Tc00.1047053510119.9) partial mRNA Length = 1167 Score = 119 bits (60), Expect = 1e-23 Identities = 124/146 (84%) Strand = Plus / Minus Query: 413 agctccttgccggaccgcctgtcgatcttggtctggatctcggcgaacttgacggcnatg 472 |||||||||||||| || | ||||||||||| || |||||||||||||||| || ||| Sbjct: 1124 agctccttgccggagcggcggtcgatcttggactcgatctcggcgaacttgcacgcgatg 1065 Query: 473 tgggatgtgtggcagtccagcacangggcataaccgttgctgatctggccagggtggttc 532 ||| | ||||||||||| ||||| | ||||| ||||||| ||||||||| ||||||||| Sbjct: 1064 tggcaggtgtggcagtcaagcaccggcgcatagccgttgccgatctggccggggtggttc 1005 Query: 533 atgatgatgacctgggcagtgaagtc 558 | |||||| ||||| || |||||||| Sbjct: 1004 aggatgatcacctgcgccgtgaagtc 979
>gb|L76077.1|TRBEF1AE Trypanosoma cruzi elongation factor 1-alpha (EF-1alpha) gene, complete cds Length = 1964 Score = 119 bits (60), Expect = 1e-23 Identities = 124/146 (84%) Strand = Plus / Minus Query: 413 agctccttgccggaccgcctgtcgatcttggtctggatctcggcgaacttgacggcnatg 472 |||||||||||||| || | ||||||||||| || |||||||||||||||| || ||| Sbjct: 1540 agctccttgccggagcggcggtcgatcttggactcgatctcggcgaacttgcacgcgatg 1481 Query: 473 tgggatgtgtggcagtccagcacangggcataaccgttgctgatctggccagggtggttc 532 ||| | ||||||||||| ||||| | ||||||||||||| ||||||||| ||||||||| Sbjct: 1480 tggcaggtgtggcagtcaagcaccggcgcataaccgttgccgatctggccggggtggttc 1421 Query: 533 atgatgatgacctgggcagtgaagtc 558 | |||||| || || || |||||||| Sbjct: 1420 aggatgatcacttgcgccgtgaagtc 1395 Score = 40.1 bits (20), Expect = 7.6 Identities = 37/43 (86%) Strand = Plus / Minus Query: 275 accgtctgcctnatgtcacgcacggcaaaccgacccagaggag 317 |||||||| | ||||||||||||||||| || || ||||||| Sbjct: 1678 accgtctggcgcatgtcacgcacggcaaagcggccaagaggag 1636
>gb|AY157315.1| Stevia rebaudiana elongation factor 1 alpha mRNA, complete cds Length = 1544 Score = 119 bits (60), Expect = 1e-23 Identities = 275/348 (79%) Strand = Plus / Minus Query: 199 cttcttgatcgcagccttggtaaccttggcgccggtcggctccttcttctcnacgctctt 258 |||||||| ||||||||||| |||||||| ||||| || |||||||| || || ||||| Sbjct: 1370 cttcttgacagcagccttggtcaccttggctccggttgggtccttcttgtcaacactctt 1311 Query: 259 gatcacacccacagcaaccgtctgcctnatgtcacgcacggcaaaccgacccagaggagg 318 ||| ||||| || ||||||||||| | ||||| | ||| |||||||| || || || || Sbjct: 1310 gataacaccgactgcaaccgtctgacgcatgtccctcacagcaaaccgtccaagcggtgg 1251 Query: 319 gtactgggcaaaggtctccaccaccatgggcttggttggaatcatcttgacgaacccagc 378 ||||| ||||| ||||| || ||||| || || || |||| |||||| || | || || Sbjct: 1250 gtactcagcaaaagtctcaacaaccataggtttagtcggaagcatcttaaccatacctgc 1191 Query: 379 atcaccattcttgagaaacttgggcgctgcctccagctccttgccggaccgcctgtcgat 438 ||| |||||||| | |||||||| | || |||||||| || ||||| ||||| || Sbjct: 1190 atctccattctttaagaacttgggttccttttcaagctccttaccagaccgtctgtcaat 1131 Query: 439 cttggtctggatctcggcgaacttgacggcnatgtgggatgtgtggcagtccagcacang 498 ||||||| ||||| | |||||||| || |||||||| ||||| || || || || | Sbjct: 1130 cttggtcaaaatctcagaaaacttgacagcaatgtgggaggtgtgacaatcgagaaccgg 1071 Query: 499 ggcataaccgttgctgatctggccagggtggttcatgatgatgacctg 546 |||||||||||| | |||||| ||||| ||||||||||| || ||||| Sbjct: 1070 ggcataaccgttaccgatctgaccaggatggttcatgataataacctg 1023
>gb|AY727921.1| Trypanosoma cruzi elongation factor alpha G5 mRNA, complete cds Length = 1427 Score = 119 bits (60), Expect = 1e-23 Identities = 124/146 (84%) Strand = Plus / Minus Query: 413 agctccttgccggaccgcctgtcgatcttggtctggatctcggcgaacttgacggcnatg 472 |||||||||||||| || | ||||||||||| || |||||||||||||||| || ||| Sbjct: 1201 agctccttgccggagcggcggtcgatcttggactcgatctcggcgaacttgcacgcgatg 1142 Query: 473 tgggatgtgtggcagtccagcacangggcataaccgttgctgatctggccagggtggttc 532 ||| | ||||||||||| ||||| | ||||||||||||| ||||||||| ||||||||| Sbjct: 1141 tggcaggtgtggcagtcaagcaccggcgcataaccgttgccgatctggccggggtggttc 1082 Query: 533 atgatgatgacctgggcagtgaagtc 558 | |||||| || || || |||||||| Sbjct: 1081 aggatgatcacttgcgccgtgaagtc 1056 Score = 40.1 bits (20), Expect = 7.6 Identities = 37/43 (86%) Strand = Plus / Minus Query: 275 accgtctgcctnatgtcacgcacggcaaaccgacccagaggag 317 |||||||| | ||||||||||||||||| || || ||||||| Sbjct: 1339 accgtctggcgcatgtcacgcacggcaaagcggccaagaggag 1297
>dbj|D29834.1| Trypanosoma cruzi mRNA for elongation factor 1 alpha, partial cds Length = 1185 Score = 119 bits (60), Expect = 1e-23 Identities = 124/146 (84%) Strand = Plus / Minus Query: 413 agctccttgccggaccgcctgtcgatcttggtctggatctcggcgaacttgacggcnatg 472 |||||||||||||| || | ||||||||||| || |||||||||||||||| || ||| Sbjct: 1064 agctccttgccggagcggcggtcgatcttggactcgatctcggcgaacttgcacgcgatg 1005 Query: 473 tgggatgtgtggcagtccagcacangggcataaccgttgctgatctggccagggtggttc 532 ||| | ||||||||||| ||||| | ||||| ||||||| ||||||||| ||||||||| Sbjct: 1004 tggcaggtgtggcagtcaagcaccggcgcatagccgttgccgatctggccggggtggttc 945 Query: 533 atgatgatgacctgggcagtgaagtc 558 | |||||| ||||| || |||||||| Sbjct: 944 aggatgatcacctgcgccgtgaagtc 919
>gb|DQ447161.1| Passiflora edulis translation elongation factor 1a-2 (EF1a2) mRNA, partial cds Length = 358 Score = 117 bits (59), Expect = 4e-23 Identities = 204/253 (80%) Strand = Plus / Minus Query: 305 cgacccagaggagggtactgggcaaaggtctccaccaccatgggcttggttggaatcatc 364 ||||| || |||||||||| | ||| ||||||||||||||||||||||| ||||||||| Sbjct: 327 cgaccaagtggagggtactcagaaaaagtctccaccaccatgggcttggtgggaatcatc 268 Query: 365 ttgacgaacccagcatcaccattcttgagaaacttgggcgctgcctccagctccttgccg 424 || || || || |||||||| ||||| | ||||||||| | ||| |||||||| || Sbjct: 267 ttcacaaatccggcatcaccgttctttaagaacttgggctccttctcaagctccttacca 208 Query: 425 gaccgcctgtcgatcttggtctggatctcggcgaacttgacggcnatgtgggatgtgtgg 484 || || || || ||||||||| | || || | || || || || ||||||||||||||| Sbjct: 207 gatcgtctatcaatcttggtcagaatttcagaaaatttcacagcaatgtgggatgtgtgg 148 Query: 485 cagtccagcacangggcataaccgttgctgatctggccagggtggttcatgatgatgacc 544 ||||| || || |||||||||| || | |||||||| ||||| ||||||||||| || Sbjct: 147 cagtcgaggactggggcataaccatttccaatctggccggggtgattcatgatgataact 88 Query: 545 tgggcagtgaagt 557 ||||| ||||||| Sbjct: 87 tgggctgtgaagt 75
>gb|BT012812.1| Lycopersicon esculentum clone 113856R, mRNA sequence Length = 2059 Score = 111 bits (56), Expect = 2e-21 Identities = 274/348 (78%) Strand = Plus / Minus Query: 209 gcagccttggtaaccttggcgccggtcggctccttcttctcnacgctcttgatcacaccc 268 ||||||||||| |||||||| || | || |||||||| || || ||||||| ||||| Sbjct: 1710 gcagccttggtgaccttggctccagatgggtccttcttgtcaacattcttgataacacca 1651 Query: 269 acagcaaccgtctgcctnatgtcacgcacggcaaaccgacccagaggagggtactgggca 328 |||||||| || || | ||||| | ||| ||||| || |||| || ||||||| || Sbjct: 1650 acagcaacagtttgacgcatgtccctcacagcaaaacgtcccaatggtgggtactcggag 1591 Query: 329 aaggtctccaccaccatgggcttggttggaatcatcttgacgaacccagcatcaccattc 388 || ||||| || |||||||||||||| ||||||||||| || | ||||||||||| ||| Sbjct: 1590 aatgtctcaacaaccatgggcttggtgggaatcatcttaaccataccagcatcaccgttc 1531 Query: 389 ttgagaaacttgggcgctgcctccagctccttgccggaccgcctgtcgatcttggtctgg 448 || | ||||| ||| | ||| || ||||| || || |||||||| ||||| ||| | Sbjct: 1530 ttcaagaacttaggctccttctcgagttccttaccagaacgcctgtcaatcttagtcaag 1471 Query: 449 atctcggcgaacttgacggcnatgtgggatgtgtggcagtccagcacangggcataaccg 508 ||||| || |||||||| || || ||||| ||||| ||||||||||| | ||||| || Sbjct: 1470 atctcagcaaacttgacagcaatatgggaggtgtgacagtccagcactggagcatatcca 1411 Query: 509 ttgctgatctggccagggtggttcatgatgatgacctgggcagtgaag 556 || | ||||| || || |||||||||||||||||||| || |||||| Sbjct: 1410 tttccaatctgtcctggatggttcatgatgatgacctgagcggtgaag 1363
>ref|XM_817373.1| Trypanosoma brucei TREU927 elongation factor 1-alpha (Tb10.70.5650) partial mRNA Length = 1350 Score = 111 bits (56), Expect = 2e-21 Identities = 126/150 (84%) Strand = Plus / Minus Query: 409 ctccagctccttgccggaccgcctgtcgatcttggtctggatctcggcgaacttgacggc 468 ||||||||||||||| || || | ||||||||| | || |||||| ||||||||| ||| Sbjct: 1128 ctccagctccttgccagagcgacggtcgatcttcgactcgatctccgcgaacttgcaggc 1069 Query: 469 natgtgggatgtgtggcagtccagcacangggcataaccgttgctgatctggccagggtg 528 ||||| |||||||||||||||||||| | ||||||||||| | ||||| || ||||| Sbjct: 1068 aatgtgcgatgtgtggcagtccagcacgggcgcataaccgtttccaatctgtccggggtg 1009 Query: 529 gttcatgatgatgacctgggcagtgaagtc 558 ||||| |||||| ||||| || |||||||| Sbjct: 1008 gttcaggatgatcacctgtgccgtgaagtc 979
>ref|XM_817372.1| Trypanosoma brucei TREU927 elongation factor 1-alpha (Tb10.70.5670) partial mRNA Length = 1350 Score = 111 bits (56), Expect = 2e-21 Identities = 126/150 (84%) Strand = Plus / Minus Query: 409 ctccagctccttgccggaccgcctgtcgatcttggtctggatctcggcgaacttgacggc 468 ||||||||||||||| || || | ||||||||| | || |||||| ||||||||| ||| Sbjct: 1128 ctccagctccttgccagagcgacggtcgatcttcgactcgatctccgcgaacttgcaggc 1069 Query: 469 natgtgggatgtgtggcagtccagcacangggcataaccgttgctgatctggccagggtg 528 ||||| |||||||||||||||||||| | ||||||||||| | ||||| || ||||| Sbjct: 1068 aatgtgcgatgtgtggcagtccagcacgggcgcataaccgtttccaatctgtccggggtg 1009 Query: 529 gttcatgatgatgacctgggcagtgaagtc 558 ||||| |||||| ||||| || |||||||| Sbjct: 1008 gttcaggatgatcacctgtgccgtgaagtc 979
>ref|XM_817371.1| Trypanosoma brucei TREU927 elongation factor 1-alpha (Tb10.70.5680) partial mRNA Length = 1047 Score = 111 bits (56), Expect = 2e-21 Identities = 126/150 (84%) Strand = Plus / Minus Query: 409 ctccagctccttgccggaccgcctgtcgatcttggtctggatctcggcgaacttgacggc 468 ||||||||||||||| || || | ||||||||| | || |||||| ||||||||| ||| Sbjct: 825 ctccagctccttgccagagcgacggtcgatcttcgactcgatctccgcgaacttgcaggc 766 Query: 469 natgtgggatgtgtggcagtccagcacangggcataaccgttgctgatctggccagggtg 528 ||||| |||||||||||||||||||| | ||||||||||| | ||||| || ||||| Sbjct: 765 aatgtgcgatgtgtggcagtccagcacgggcgcataaccgtttccaatctgtccggggtg 706 Query: 529 gttcatgatgatgacctgggcagtgaagtc 558 ||||| |||||| ||||| || |||||||| Sbjct: 705 gttcaggatgatcacctgtgccgtgaagtc 676
>gb|U10562.1|TBU10562 Trypanosoma brucei elongation factor-1 alpha mRNA, complete cds Length = 2024 Score = 111 bits (56), Expect = 2e-21 Identities = 126/150 (84%) Strand = Plus / Minus Query: 409 ctccagctccttgccggaccgcctgtcgatcttggtctggatctcggcgaacttgacggc 468 ||||||||||||||| || || | ||||||||| | || |||||| ||||||||| ||| Sbjct: 1182 ctccagctccttgccagagcgacggtcgatcttcgactcgatctccgcgaacttgcaggc 1123 Query: 469 natgtgggatgtgtggcagtccagcacangggcataaccgttgctgatctggccagggtg 528 ||||| |||||||||||||||||||| | ||||||||||| | ||||| || ||||| Sbjct: 1122 aatgtgcgatgtgtggcagtccagcacgggcgcataaccgtttccaatctgtccggggtg 1063 Query: 529 gttcatgatgatgacctgggcagtgaagtc 558 ||||| |||||| ||||| || |||||||| Sbjct: 1062 gttcaggatgatcacctgtgccgtgaagtc 1033
>gb|L25868.1|TRBTEF1A Trypanosoma brucei elongation factor 1-alpha (tef1) gene, partial cds Length = 1195 Score = 111 bits (56), Expect = 2e-21 Identities = 126/150 (84%) Strand = Plus / Minus Query: 409 ctccagctccttgccggaccgcctgtcgatcttggtctggatctcggcgaacttgacggc 468 ||||||||||||||| || || | ||||||||| | || |||||| ||||||||| ||| Sbjct: 1078 ctccagctccttgccagagcgacggtcgatcttcgactcgatctccgcgaacttgcaggc 1019 Query: 469 natgtgggatgtgtggcagtccagcacangggcataaccgttgctgatctggccagggtg 528 ||||| |||||||||||||||||||| | ||||||||||| | ||||| || ||||| Sbjct: 1018 aatgtgcgatgtgtggcagtccagcacgggcgcataaccgtttccaatctgtccggggtg 959 Query: 529 gttcatgatgatgacctgggcagtgaagtc 558 ||||| |||||| ||||| || |||||||| Sbjct: 958 gttcaggatgatcacctgtgccgtgaagtc 929
>gb|AY172630.1| Escovopsis sp. Esc8 elongation factor 1-alpha (EF1a) gene, exon 6 and partial cds Length = 987 Score = 99.6 bits (50), Expect = 9e-18 Identities = 84/96 (87%) Strand = Plus / Minus Query: 454 ggcgaacttgacggcnatgtgggatgtgtggcagtccagcacangggcataaccgttgct 513 |||||||||| ||| ||||||| ||||||||||| || || ||||||| ||||||| Sbjct: 816 ggcgaacttgcaggcaatgtgggcggtgtggcagtcgaggacgggggcatagccgttgcc 757 Query: 514 gatctggccagggtggttcatgatgatgacctgggc 549 ||||||||| |||||||||||||||||||||||||| Sbjct: 756 gatctggccggggtggttcatgatgatgacctgggc 721 Score = 42.1 bits (21), Expect = 1.9 Identities = 33/37 (89%) Strand = Plus / Minus Query: 287 atgtcacgcacggcaaaccgacccagaggagggtact 323 |||||||| ||||| || ||||| ||||||||||||| Sbjct: 983 atgtcacggacggcgaaacgaccaagaggagggtact 947
>dbj|AB056104.1| Carassius auratus mRNA for elongation factor-1 alpha, complete cds Length = 1704 Score = 99.6 bits (50), Expect = 9e-18 Identities = 72/80 (90%) Strand = Plus / Minus Query: 242 ttcttctcnacgctcttgatcacacccacagcaaccgtctgcctnatgtcacgcacggca 301 |||||||| ||||||||||| ||||| |||||||| |||||||| ||||||||||| ||| Sbjct: 1366 ttcttctcaacgctcttgatgacaccaacagcaacggtctgcctcatgtcacgcacagca 1307 Query: 302 aaccgacccagaggagggta 321 || ||||| ||||||||||| Sbjct: 1306 aagcgaccaagaggagggta 1287 Score = 77.8 bits (39), Expect = 3e-11 Identities = 68/78 (87%) Strand = Plus / Minus Query: 479 gtgtggcagtccagcacangggcataaccgttgctgatctggccagggtggttcatgatg 538 |||||||||||||||||| ||||||| || | | |||||| ||||||||||||| |||| Sbjct: 1129 gtgtggcagtccagcacaggggcatagccctgggagatctgaccagggtggttcaggatg 1070 Query: 539 atgacctgggcagtgaag 556 |||||||| ||| ||||| Sbjct: 1069 atgacctgagcattgaag 1052
>ref|NM_001037030.1| Arabidopsis thaliana calmodulin binding / translation elongation factor AT5G60390 transcript variant AT5G60390.2 mRNA, complete cds Length = 1715 Score = 97.6 bits (49), Expect = 4e-17 Identities = 119/143 (83%) Strand = Plus / Minus Query: 415 ctccttgccggaccgcctgtcgatcttggtctggatctcggcgaacttgacggcnatgtg 474 |||||| || || |||||||| ||||||||| |||||| | ||||||||| || ||||| Sbjct: 1191 ctccttaccagaacgcctgtcaatcttggtcaagatctcagagaacttgactgcaatgtg 1132 Query: 475 ggatgtgtggcagtccagcacangggcataaccgttgctgatctggccagggtggttcat 534 || |||||||| || || || |||| |||||||| | ||||| |||||||||||||| Sbjct: 1131 agaggtgtggcaatcgagaactggggcgtaaccgttaccaatctgaccagggtggttcat 1072 Query: 535 gatgatgacctgggcagtgaagt 557 |||||||||||||| ||||||| Sbjct: 1071 gatgatgacctgggaggtgaagt 1049 Score = 73.8 bits (37), Expect = 5e-10 Identities = 71/83 (85%) Strand = Plus / Minus Query: 209 gcagccttggtaaccttggcgccggtcggctccttcttctcnacgctcttgatcacaccc 268 ||||||||||| |||||||| || || || |||||||| || |||||||| || ||||| Sbjct: 1348 gcagccttggtgaccttggctccagttgggtccttcttgtccacgctcttaataacacca 1289 Query: 269 acagcaaccgtctgcctnatgtc 291 |||||||| |||||||| ||||| Sbjct: 1288 acagcaacggtctgcctcatgtc 1266
>dbj|AB003709.1| Owenia fusiformis mRNA for elongation factor-1alpha, partial cds Length = 1122 Score = 97.6 bits (49), Expect = 4e-17 Identities = 116/139 (83%) Strand = Plus / Minus Query: 408 cctccagctccttgccggaccgcctgtcgatcttggtctggatctcggcgaacttgacgg 467 ||||||||||||| || || || | |||||||| ||||||||||| ||||||| || Sbjct: 1027 cctccagctcctttccagatcgtcgatcgatcttcttctggatctcgctgaacttgcagg 968 Query: 468 cnatgtgggatgtgtggcagtccagcacangggcataaccgttgctgatctggccagggt 527 | || || | ||||||||| |||| |||| |||||||||| ||||||||||| ||||||| Sbjct: 967 caatatgtgctgtgtggcaatccaacacaggggcataaccattgctgatctgtccagggt 908 Query: 528 ggttcatgatgatgacctg 546 |||||| |||||| ||||| Sbjct: 907 ggttcaggatgattacctg 889
>gb|AF063412.1| Limnadia lenticularis elongation factor 1-alpha mRNA, partial cds Length = 1093 Score = 95.6 bits (48), Expect = 1e-16 Identities = 88/102 (86%) Strand = Plus / Minus Query: 448 gatctcggcgaacttgacggcnatgtgggatgtgtggcagtccagcacangggcataacc 507 |||||||||||||||| || ||||||| ||||||||||||||||| | | ||||| Sbjct: 949 gatctcggcgaacttgcaagcgatgtgggcagtgtggcagtccagcacgggagtgtaacc 890 Query: 508 gttgctgatctggccagggtggttcatgatgatgacctgggc 549 |||||||||||| ||||||||||||| || |||||||||||| Sbjct: 889 gttgctgatctgaccagggtggttcaagacgatgacctgggc 848
>gb|AY264212.1| Orinocodoras eigenmanni elongation factor-1 alpha gene, exons 4 through 8 and partial cds Length = 1126 Score = 95.6 bits (48), Expect = 1e-16 Identities = 64/70 (91%) Strand = Plus / Minus Query: 240 ccttcttctcnacgctcttgatcacacccacagcaaccgtctgcctnatgtcacgcacgg 299 |||||||||| ||||||||||| ||||| |||||||| |||||||| ||||||||||||| Sbjct: 1126 ccttcttctcaacgctcttgatgacaccaacagcaacggtctgcctcatgtcacgcacgg 1067 Query: 300 caaaccgacc 309 |||| ||||| Sbjct: 1066 caaaacgacc 1057 Score = 58.0 bits (29), Expect = 3e-05 Identities = 75/91 (82%) Strand = Plus / Minus Query: 455 gcgaacttgacggcnatgtgggatgtgtggcagtccagcacangggcataaccgttgctg 514 ||||||||| ||| ||||| | ||||| || ||||||||| ||||||| || | | | Sbjct: 828 gcgaacttgcaggcaatgtgagcagtgtgacaatccagcacaggggcatagccctggaag 769 Query: 515 atctggccagggtggttcatgatgatgacct 545 ||||| ||||||||||||| ||||||||||| Sbjct: 768 atctgaccagggtggttcaggatgatgacct 738
>gb|AY490176.1| Capsicum annuum U-Lim mRNA, partial sequence Length = 709 Score = 95.6 bits (48), Expect = 1e-16 Identities = 272/348 (78%) Strand = Plus / Minus Query: 209 gcagccttggtaaccttggcgccggtcggctccttcttctcnacgctcttgatcacaccc 268 ||||||||||| | ||| || || || || |||||||| || || |||||||| ||||| Sbjct: 681 gcagccttggtgatctttgcaccagttgggtccttcttgtcaacactcttgataacacca 622 Query: 269 acagcaaccgtctgcctnatgtcacgcacggcaaaccgacccagaggagggtactgggca 328 |||||||| || || | ||||| | || ||||| || |||| || ||||| | || Sbjct: 621 acagcaacagtttgacgcatgtccctaacagcaaaacgtcccaatggtgggtaatcggag 562 Query: 329 aaggtctccaccaccatgggcttggttggaatcatcttgacgaacccagcatcaccattc 388 || ||||| |||||||| |||||||| || |||||||| || | |||| |||||| ||| Sbjct: 561 aatgtctctaccaccataggcttggtggggatcatcttaaccataccagaatcaccgttc 502 Query: 389 ttgagaaacttgggcgctgcctccagctccttgccggaccgcctgtcgatcttggtctgg 448 || | ||||| ||| | ||| || ||||| || || |||||||| || |||||| | Sbjct: 501 ttcaagaacttaggctccttctcgagttccttaccagaacgcctgtcaattttggtcaag 442 Query: 449 atctcggcgaacttgacggcnatgtgggatgtgtggcagtccagcacangggcataaccg 508 || || || |||||||| || |||||||| ||||| ||||||||||| ||||||| || Sbjct: 441 atttcagcaaacttgacagcaatgtgggaggtgtgacagtccagcactggggcatatcca 382 Query: 509 ttgctgatctggccagggtggttcatgatgatgacctgggcagtgaag 556 || | ||||| || || |||||||||||||||||||||| ||||||| Sbjct: 381 tttccaatctgtcctggatggttcatgatgatgacctgggaagtgaag 334
>gb|AY962821.1| Prunus armeniaca elongation factor 1 alpha mRNA, partial cds Length = 314 Score = 95.6 bits (48), Expect = 1e-16 Identities = 130/158 (82%) Strand = Plus / Minus Query: 209 gcagccttggtaaccttggcgccggtcggctccttcttctcnacgctcttgatcacaccc 268 |||| |||||| |||||||| || | || ||||||||||| ||||||||||| ||||| Sbjct: 243 gcagacttggtgaccttggcaccactgggatccttcttctccacgctcttgataacacca 184 Query: 269 acagcaaccgtctgcctnatgtcacgcacggcaaaccgacccagaggagggtactgggca 328 |||||||| ||||| | |||||||| || ||||| ||||||| |||||||||| | Sbjct: 183 acagcaacagtctgacgcatgtcacggacagcaaaacgacccaatggagggtactcagag 124 Query: 329 aaggtctccaccaccatgggcttggttggaatcatctt 366 || || ||||| |||||||||||||| |||| |||||| Sbjct: 123 aaagtttccacaaccatgggcttggtgggaagcatctt 86
>gb|AF398148.1|AF398148 Brassica rapa subsp. pekinensis translation elongation factor 1 alpha chain (eEF-1) mRNA, partial cds Length = 460 Score = 95.6 bits (48), Expect = 1e-16 Identities = 130/158 (82%) Strand = Plus / Minus Query: 209 gcagccttggtaaccttggcgccggtcggctccttcttctcnacgctcttgatcacaccc 268 ||||||||||| ||||| || ||||| || |||||||| || ||||||||||| ||||| Sbjct: 273 gcagccttggtgaccttagcaccggttgggtccttcttgtcgacgctcttgataacacca 214 Query: 269 acagcaaccgtctgcctnatgtcacgcacggcaaaccgacccagaggagggtactgggca 328 ||||| ||||||||||| ||||| | || || || ||||||| || ||||||| | Sbjct: 213 acagccaccgtctgcctcatgtccctaacagcgaaacgacccaatggtgggtactcagag 154 Query: 329 aaggtctccaccaccatgggcttggttggaatcatctt 366 || ||||| || |||||||||||||||||| ||||||| Sbjct: 153 aaagtctcaacaaccatgggcttggttggagtcatctt 116
>emb|AJ866727.1| Dicentrarchus labrax partial mRNA for elongation factor 1-alpha (ef1-alpha gene) Length = 955 Score = 93.7 bits (47), Expect = 6e-16 Identities = 81/93 (87%) Strand = Plus / Minus Query: 457 gaacttgacggcnatgtgggatgtgtggcagtccagcacangggcataaccgttgctgat 516 ||||||| ||| ||||||| ||||||||| ||||||||| |||| ||||| | |||| Sbjct: 901 gaacttgcaggcgatgtgggctgtgtggcaatccagcacaggggcgtaacctgcgttgat 842 Query: 517 ctggccagggtggttcatgatgatgacctgggc 549 ||||||||||||||||| ||||||||||||||| Sbjct: 841 ctggccagggtggttcaggatgatgacctgggc 809
>dbj|AB193485.1| Takifugu rubripes EF-1a mRNA for elongation factor 1 alpha, complete cds Length = 1765 Score = 93.7 bits (47), Expect = 6e-16 Identities = 87/101 (86%) Strand = Plus / Minus Query: 457 gaacttgacggcnatgtgggatgtgtggcagtccagcacangggcataaccgttgctgat 516 ||||||| ||| ||||| | ||||||||| ||||||||| ||||||| || | |||| Sbjct: 1175 gaacttgcaggcaatgtgagctgtgtggcaatccagcacaggggcatatccagcgttgat 1116 Query: 517 ctggccagggtggttcatgatgatgacctgggcagtgaagt 557 ||||||||||||||||| |||||||||||||||| |||||| Sbjct: 1115 ctggccagggtggttcaggatgatgacctgggcattgaagt 1075 Score = 67.9 bits (34), Expect = 3e-08 Identities = 78/93 (83%) Strand = Plus / Minus Query: 256 cttgatcacacccacagcaaccgtctgcctnatgtcacgcacggcaaaccgacccagagg 315 |||||| ||||| |||||||| |||||||| ||||||||||| || || ||||| || || Sbjct: 1376 cttgatgacaccgacagcaacagtctgcctcatgtcacgcacagcgaagcgaccaagggg 1317 Query: 316 agggtactgggcaaaggtctccaccaccatggg 348 |||||| | || |||| |||||| |||||||| Sbjct: 1316 agggtagttggagaagggctccacaaccatggg 1284
>ref|NM_001037873.1| Takifugu rubripes elongation factor 1 alpha (ef-1a), mRNA Length = 1765 Score = 93.7 bits (47), Expect = 6e-16 Identities = 87/101 (86%) Strand = Plus / Minus Query: 457 gaacttgacggcnatgtgggatgtgtggcagtccagcacangggcataaccgttgctgat 516 ||||||| ||| ||||| | ||||||||| ||||||||| ||||||| || | |||| Sbjct: 1175 gaacttgcaggcaatgtgagctgtgtggcaatccagcacaggggcatatccagcgttgat 1116 Query: 517 ctggccagggtggttcatgatgatgacctgggcagtgaagt 557 ||||||||||||||||| |||||||||||||||| |||||| Sbjct: 1115 ctggccagggtggttcaggatgatgacctgggcattgaagt 1075 Score = 67.9 bits (34), Expect = 3e-08 Identities = 78/93 (83%) Strand = Plus / Minus Query: 256 cttgatcacacccacagcaaccgtctgcctnatgtcacgcacggcaaaccgacccagagg 315 |||||| ||||| |||||||| |||||||| ||||||||||| || || ||||| || || Sbjct: 1376 cttgatgacaccgacagcaacagtctgcctcatgtcacgcacagcgaagcgaccaagggg 1317 Query: 316 agggtactgggcaaaggtctccaccaccatggg 348 |||||| | || |||| |||||| |||||||| Sbjct: 1316 agggtagttggagaagggctccacaaccatggg 1284
>gb|AY422992.1| Danio rerio eukaryotic translation elongation factor 1 alpha 1 (EEF1A1) mRNA, complete cds Length = 1721 Score = 91.7 bits (46), Expect = 2e-15 Identities = 71/80 (88%) Strand = Plus / Minus Query: 242 ttcttctcnacgctcttgatcacacccacagcaaccgtctgcctnatgtcacgcacggca 301 |||||||| ||||||||||| || || |||||||| |||||||| ||||||||||| ||| Sbjct: 1363 ttcttctcaacgctcttgatgacgccgacagcaacggtctgcctcatgtcacgcacagca 1304 Query: 302 aaccgacccagaggagggta 321 || ||||| ||||||||||| Sbjct: 1303 aagcgaccaagaggagggta 1284 Score = 50.1 bits (25), Expect = 0.008 Identities = 31/33 (93%) Strand = Plus / Minus Query: 514 gatctggccagggtggttcatgatgatgacctg 546 |||||| ||||||||||||| |||||||||||| Sbjct: 1091 gatctgaccagggtggttcaggatgatgacctg 1059
>gb|BC064291.1| Danio rerio elongation factor 1-alpha, mRNA (cDNA clone MGC:77644 IMAGE:6996963), complete cds Length = 1760 Score = 91.7 bits (46), Expect = 2e-15 Identities = 71/80 (88%) Strand = Plus / Minus Query: 242 ttcttctcnacgctcttgatcacacccacagcaaccgtctgcctnatgtcacgcacggca 301 |||||||| ||||||||||| || || |||||||| |||||||| ||||||||||| ||| Sbjct: 1384 ttcttctcaacgctcttgatgacgccgacagcaacggtctgcctcatgtcacgcacagca 1325 Query: 302 aaccgacccagaggagggta 321 || ||||| ||||||||||| Sbjct: 1324 aagcgaccaagaggagggta 1305 Score = 50.1 bits (25), Expect = 0.008 Identities = 31/33 (93%) Strand = Plus / Minus Query: 514 gatctggccagggtggttcatgatgatgacctg 546 |||||| ||||||||||||| |||||||||||| Sbjct: 1112 gatctgaccagggtggttcaggatgatgacctg 1080
>ref|NM_131263.1| Danio rerio elongation factor 1-alpha (ef1a), mRNA Length = 1753 Score = 91.7 bits (46), Expect = 2e-15 Identities = 71/80 (88%) Strand = Plus / Minus Query: 242 ttcttctcnacgctcttgatcacacccacagcaaccgtctgcctnatgtcacgcacggca 301 |||||||| ||||||||||| || || |||||||| |||||||| ||||||||||| ||| Sbjct: 1405 ttcttctcaacgctcttgatgacgccgacagcaacggtctgcctcatgtcacgcacagca 1346 Query: 302 aaccgacccagaggagggta 321 || ||||| ||||||||||| Sbjct: 1345 aagcgaccaagaggagggta 1326 Score = 50.1 bits (25), Expect = 0.008 Identities = 31/33 (93%) Strand = Plus / Minus Query: 514 gatctggccagggtggttcatgatgatgacctg 546 |||||| ||||||||||||| |||||||||||| Sbjct: 1133 gatctgaccagggtggttcaggatgatgacctg 1101
>emb|X77689.1|BREF1MRN B.rerio ef-1 alpha mRNA Length = 1729 Score = 91.7 bits (46), Expect = 2e-15 Identities = 71/80 (88%) Strand = Plus / Minus Query: 242 ttcttctcnacgctcttgatcacacccacagcaaccgtctgcctnatgtcacgcacggca 301 |||||||| ||||||||||| || || |||||||| |||||||| ||||||||||| ||| Sbjct: 1372 ttcttctcaacgctcttgatgacgccgacagcaacggtctgcctcatgtcacgcacagca 1313 Query: 302 aaccgacccagaggagggta 321 || ||||| ||||||||||| Sbjct: 1312 aagcgaccaagaggagggta 1293 Score = 42.1 bits (21), Expect = 1.9 Identities = 30/33 (90%) Strand = Plus / Minus Query: 514 gatctggccagggtggttcatgatgatgacctg 546 |||||| ||||||||||| | |||||||||||| Sbjct: 1100 gatctgaccagggtggtttaggatgatgacctg 1068
>gb|DQ083545.1| Danio rerio eukaryotic translation elongation factor 1 alpha 1 mRNA, complete cds Length = 1455 Score = 91.7 bits (46), Expect = 2e-15 Identities = 71/80 (88%) Strand = Plus / Minus Query: 242 ttcttctcnacgctcttgatcacacccacagcaaccgtctgcctnatgtcacgcacggca 301 |||||||| ||||||||||| || || |||||||| |||||||| ||||||||||| ||| Sbjct: 1397 ttcttctcaacgctcttgatgacgccgacagcaacggtctgcctcatgtcacgcacagca 1338 Query: 302 aaccgacccagaggagggta 321 || ||||| ||||||||||| Sbjct: 1337 aagcgaccaagaggagggta 1318 Score = 50.1 bits (25), Expect = 0.008 Identities = 31/33 (93%) Strand = Plus / Minus Query: 514 gatctggccagggtggttcatgatgatgacctg 546 |||||| ||||||||||||| |||||||||||| Sbjct: 1125 gatctgaccagggtggttcaggatgatgacctg 1093
>gb|AY643400.1| Pimephales promelas elongation factor 1-alpha mRNA, complete cds Length = 1748 Score = 91.7 bits (46), Expect = 2e-15 Identities = 71/80 (88%) Strand = Plus / Minus Query: 242 ttcttctcnacgctcttgatcacacccacagcaaccgtctgcctnatgtcacgcacggca 301 |||||||| ||||||||||| ||||| |||||||| |||||||| ||||||||||| ||| Sbjct: 1402 ttcttctcaacgctcttgatgacaccaacagcaacggtctgcctcatgtcacgcacagca 1343 Query: 302 aaccgacccagaggagggta 321 || ||||| ||||| ||||| Sbjct: 1342 aagcgaccaagaggggggta 1323 Score = 50.1 bits (25), Expect = 0.008 Identities = 31/33 (93%) Strand = Plus / Minus Query: 514 gatctggccagggtggttcatgatgatgacctg 546 |||||| ||||||||||||| |||||||||||| Sbjct: 1130 gatctgaccagggtggttcaggatgatgacctg 1098
>gb|L23807.1|ZEFEF1AL Danio rerio elongation factor 1 alpha (EFL1-alpha) mRNA, complete cds Length = 1739 Score = 91.7 bits (46), Expect = 2e-15 Identities = 71/80 (88%) Strand = Plus / Minus Query: 242 ttcttctcnacgctcttgatcacacccacagcaaccgtctgcctnatgtcacgcacggca 301 |||||||| ||||||||||| || || |||||||| |||||||| ||||||||||| ||| Sbjct: 1391 ttcttctcaacgctcttgatgacgccgacagcaacggtctgcctcatgtcacgcacagca 1332 Query: 302 aaccgacccagaggagggta 321 || ||||| ||||||||||| Sbjct: 1331 aagcgaccaagaggagggta 1312 Score = 50.1 bits (25), Expect = 0.008 Identities = 31/33 (93%) Strand = Plus / Minus Query: 514 gatctggccagggtggttcatgatgatgacctg 546 |||||| ||||||||||||| |||||||||||| Sbjct: 1119 gatctgaccagggtggttcaggatgatgacctg 1087
>gb|DQ353797.1| Ictalurus punctatus isolate C94SB10 elongation factor 1-alpha mRNA, partial cds Length = 651 Score = 89.7 bits (45), Expect = 9e-15 Identities = 70/79 (88%) Strand = Plus / Minus Query: 240 ccttcttctcnacgctcttgatcacacccacagcaaccgtctgcctnatgtcacgcacgg 299 |||||||||| || |||||||| ||||| |||||||| |||||||| ||||||||||| | Sbjct: 406 ccttcttctcaacactcttgatgacaccaacagcaacggtctgcctcatgtcacgcacag 347 Query: 300 caaaccgacccagaggagg 318 |||| ||||| |||||||| Sbjct: 346 caaaacgaccaagaggagg 328 Score = 61.9 bits (31), Expect = 2e-06 Identities = 40/43 (93%) Strand = Plus / Minus Query: 514 gatctggccagggtggttcatgatgatgacctgggcagtgaag 556 |||||| ||||||||||||| |||||||||||| ||||||||| Sbjct: 132 gatctgaccagggtggttcaggatgatgacctgagcagtgaag 90
>gb|AY264256.1| Synodontis sp. GM-2003 elongation factor-1 alpha gene, exons 4 through 8 and partial cds Length = 1142 Score = 87.7 bits (44), Expect = 4e-14 Identities = 63/70 (90%) Strand = Plus / Minus Query: 240 ccttcttctcnacgctcttgatcacacccacagcaaccgtctgcctnatgtcacgcacgg 299 |||||||||| ||||||||||| ||||| |||||||| |||||||| ||||||||||| | Sbjct: 1142 ccttcttctcaacgctcttgatgacaccgacagcaacggtctgcctcatgtcacgcacag 1083 Query: 300 caaaccgacc 309 |||| ||||| Sbjct: 1082 caaaacgacc 1073 Score = 42.1 bits (21), Expect = 1.9 Identities = 24/25 (96%) Strand = Plus / Minus Query: 521 ccagggtggttcatgatgatgacct 545 ||||||||||||| ||||||||||| Sbjct: 765 ccagggtggttcaggatgatgacct 741
>gb|AY264255.1| Centromochlus heckelii elongation factor-1 alpha gene, exons 4 through 8 and partial cds Length = 1072 Score = 87.7 bits (44), Expect = 4e-14 Identities = 63/70 (90%) Strand = Plus / Minus Query: 240 ccttcttctcnacgctcttgatcacacccacagcaaccgtctgcctnatgtcacgcacgg 299 |||||||||| ||||||||||| ||||| |||||||| |||||||| ||||||||||| | Sbjct: 1072 ccttcttctcaacgctcttgatgacaccaacagcaacggtctgcctcatgtcacgcacag 1013 Query: 300 caaaccgacc 309 |||| ||||| Sbjct: 1012 caaaacgacc 1003 Score = 42.1 bits (21), Expect = 1.9 Identities = 53/64 (82%) Strand = Plus / Minus Query: 482 tggcagtccagcacangggcataaccgttgctgatctggccagggtggttcatgatgatg 541 ||||| ||||||||| ||||||| || | | || ||| || |||||||||| ||||||| Sbjct: 719 tggcaatccagcacaggggcatagccctgggagacctgaccggggtggttcaggatgatg 660 Query: 542 acct 545 |||| Sbjct: 659 acct 656
>gb|AY264253.1| Tatia intermedia elongation factor-1 alpha gene, exons 4 through 8 and partial cds Length = 1118 Score = 87.7 bits (44), Expect = 4e-14 Identities = 63/70 (90%) Strand = Plus / Minus Query: 240 ccttcttctcnacgctcttgatcacacccacagcaaccgtctgcctnatgtcacgcacgg 299 |||||||||| ||||||||||| ||||| |||||||| |||||||| ||||||||||| | Sbjct: 1118 ccttcttctcgacgctcttgatgacaccaacagcaacggtctgcctcatgtcacgcacag 1059 Query: 300 caaaccgacc 309 |||| ||||| Sbjct: 1058 caaaacgacc 1049 Score = 50.1 bits (25), Expect = 0.008 Identities = 74/91 (81%) Strand = Plus / Minus Query: 455 gcgaacttgacggcnatgtgggatgtgtggcagtccagcacangggcataaccgttgctg 514 ||||||||| ||| || |||| |||||||| ||||||||| | ||||| || | | Sbjct: 815 gcgaacttgcaggcaatatgggcagtgtggcaatccagcacaggagcatagccctgagag 756 Query: 515 atctggccagggtggttcatgatgatgacct 545 ||||| ||||||||||||| ||||||||||| Sbjct: 755 atctgaccagggtggttcaggatgatgacct 725
>gb|AY264252.1| Auchenipterichthys thoracatus elongation factor-1 alpha gene, exons 4 through 8 and partial cds Length = 1140 Score = 87.7 bits (44), Expect = 4e-14 Identities = 63/70 (90%) Strand = Plus / Minus Query: 240 ccttcttctcnacgctcttgatcacacccacagcaaccgtctgcctnatgtcacgcacgg 299 |||||||||| ||||||||||| ||||| |||||||| |||||||| ||||||||||| | Sbjct: 1140 ccttcttctcaacgctcttgatgacaccaacagcaacggtctgcctcatgtcacgcacag 1081 Query: 300 caaaccgacc 309 |||| ||||| Sbjct: 1080 caaaacgacc 1071 Score = 56.0 bits (28), Expect = 1e-04 Identities = 57/67 (85%) Strand = Plus / Minus Query: 479 gtgtggcagtccagcacangggcataaccgttgctgatctggccagggtggttcatgatg 538 |||||||| ||||||||| | ||||| || | | |||||| ||||||||||||| |||| Sbjct: 790 gtgtggcaatccagcacaggagcatagccctgggagatctgaccagggtggttcaggatg 731 Query: 539 atgacct 545 ||||||| Sbjct: 730 atgacct 724
>gb|AY264249.1| Parauchenipterus cf. galeatus elongation factor-1 alpha gene, exons 4 through 8 and partial cds Length = 1074 Score = 87.7 bits (44), Expect = 4e-14 Identities = 63/70 (90%) Strand = Plus / Minus Query: 240 ccttcttctcnacgctcttgatcacacccacagcaaccgtctgcctnatgtcacgcacgg 299 |||||||||| ||||||||||| ||||| |||||||| |||||||| ||||||||||| | Sbjct: 1074 ccttcttctcgacgctcttgatgacaccaacagcaacggtctgcctcatgtcacgcacag 1015 Query: 300 caaaccgacc 309 |||| ||||| Sbjct: 1014 caaaacgacc 1005 Score = 50.1 bits (25), Expect = 0.008 Identities = 54/64 (84%) Strand = Plus / Minus Query: 482 tggcagtccagcacangggcataaccgttgctgatctggccagggtggttcatgatgatg 541 ||||| ||||||||| | ||||| || | | |||||| ||||||||||||| ||||||| Sbjct: 791 tggcaatccagcacaggagcatagccctgggagatctgaccagggtggttcaggatgatg 732 Query: 542 acct 545 |||| Sbjct: 731 acct 728
>gb|AY264248.1| Acanthodoras cataphractus truncated elongation factor-1 alpha gene, exons 4 through 8 and partial cds Length = 1131 Score = 87.7 bits (44), Expect = 4e-14 Identities = 63/70 (90%) Strand = Plus / Minus Query: 240 ccttcttctcnacgctcttgatcacacccacagcaaccgtctgcctnatgtcacgcacgg 299 |||||||||| ||||||||||| ||||| |||||||| |||||||| ||||||||||| | Sbjct: 1131 ccttcttctcgacgctcttgatgacaccaacagcaacggtctgcctcatgtcacgcacag 1072 Query: 300 caaaccgacc 309 |||| ||||| Sbjct: 1071 caaaacgacc 1062 Score = 48.1 bits (24), Expect = 0.031 Identities = 30/32 (93%) Strand = Plus / Minus Query: 514 gatctggccagggtggttcatgatgatgacct 545 ||||||||| |||||||||| ||||||||||| Sbjct: 747 gatctggcctgggtggttcaagatgatgacct 716
>gb|AY264247.1| Acanthodoras spinosissimus elongation factor-1 alpha gene, exons 4 through 8 and partial cds Length = 1077 Score = 87.7 bits (44), Expect = 4e-14 Identities = 63/70 (90%) Strand = Plus / Minus Query: 240 ccttcttctcnacgctcttgatcacacccacagcaaccgtctgcctnatgtcacgcacgg 299 |||||||||| ||||||||||| ||||| |||||||| |||||||| ||||||||||| | Sbjct: 1077 ccttcttctcgacgctcttgatgacaccaacagcaacggtctgcctcatgtcacgcacag 1018 Query: 300 caaaccgacc 309 |||| ||||| Sbjct: 1017 caaaacgacc 1008 Score = 63.9 bits (32), Expect = 5e-07 Identities = 58/67 (86%) Strand = Plus / Minus Query: 479 gtgtggcagtccagcacangggcataaccgttgctgatctggccagggtggttcatgatg 538 |||||||||||||||||| | ||||| || | | ||||||||| |||||||||| |||| Sbjct: 781 gtgtggcagtccagcacaggagcatagccctgggagatctggcctgggtggttcaggatg 722 Query: 539 atgacct 545 ||||||| Sbjct: 721 atgacct 715
>gb|AY264245.1| Trachydoras cf. microstomus elongation factor-1 alpha gene, exons 4 through 8 and partial cds Length = 1118 Score = 87.7 bits (44), Expect = 4e-14 Identities = 63/70 (90%) Strand = Plus / Minus Query: 240 ccttcttctcnacgctcttgatcacacccacagcaaccgtctgcctnatgtcacgcacgg 299 |||||||||| ||||||||||| ||||| |||||||| |||||||| ||||||||||| | Sbjct: 1118 ccttcttctcaacgctcttgatgacaccaacagcaacggtctgcctcatgtcacgcacag 1059 Query: 300 caaaccgacc 309 |||| ||||| Sbjct: 1058 caaaacgacc 1049 Score = 63.9 bits (32), Expect = 5e-07 Identities = 58/67 (86%) Strand = Plus / Minus Query: 479 gtgtggcagtccagcacangggcataaccgttgctgatctggccagggtggttcatgatg 538 |||||||| ||||||||| ||||||| || | | |||||| ||||||||||||| |||| Sbjct: 792 gtgtggcaatccagcacaggggcatagccctgggagatctgaccagggtggttcaggatg 733 Query: 539 atgacct 545 ||||||| Sbjct: 732 atgacct 726
>gb|AY264243.1| Trachydoras steindachneri elongation factor-1 alpha gene, exons 4 through 8 and partial cds Length = 1120 Score = 87.7 bits (44), Expect = 4e-14 Identities = 63/70 (90%) Strand = Plus / Minus Query: 240 ccttcttctcnacgctcttgatcacacccacagcaaccgtctgcctnatgtcacgcacgg 299 |||||||||| ||||||||||| ||||| |||||||| |||||||| ||||||||||| | Sbjct: 1120 ccttcttctcgacgctcttgatgacaccaacagcaacggtctgcctcatgtcacgcacag 1061 Query: 300 caaaccgacc 309 |||| ||||| Sbjct: 1060 caaaacgacc 1051 Score = 48.1 bits (24), Expect = 0.031 Identities = 53/63 (84%) Strand = Plus / Minus Query: 483 ggcagtccagcacangggcataaccgttgctgatctggccagggtggttcatgatgatga 542 |||| ||||||||| ||||||| || | | |||||| ||||||||||||| ||| |||| Sbjct: 789 ggcaatccagcacaggggcatagccctgggagatctgaccagggtggttcaggataatga 730 Query: 543 cct 545 ||| Sbjct: 729 cct 727
>gb|AY264241.1| Leptodoras cf. copei elongation factor-1 alpha gene, exons 4 through 8 and partial cds Length = 1109 Score = 87.7 bits (44), Expect = 4e-14 Identities = 63/70 (90%) Strand = Plus / Minus Query: 240 ccttcttctcnacgctcttgatcacacccacagcaaccgtctgcctnatgtcacgcacgg 299 |||||||||| ||||||||||| ||||| |||||||| |||||||| ||||||||||| | Sbjct: 1109 ccttcttctcaacgctcttgatgacaccaacagcaacggtctgcctcatgtcacgcacag 1050 Query: 300 caaaccgacc 309 |||| ||||| Sbjct: 1049 caaaacgacc 1040 Score = 65.9 bits (33), Expect = 1e-07 Identities = 79/95 (83%) Strand = Plus / Minus Query: 451 ctcggcgaacttgacggcnatgtgggatgtgtggcagtccagcacangggcataaccgtt 510 |||||| |||||| ||| ||||| | |||||||| ||||||||| ||||||| || | Sbjct: 813 ctcggcaaacttgcaggcaatgtgagcagtgtggcaatccagcacaggggcatagccctg 754 Query: 511 gctgatctggccagggtggttcatgatgatgacct 545 | |||||| ||||||||||||| ||||||||||| Sbjct: 753 ggagatctgaccagggtggttcaggatgatgacct 719
>gb|AY264240.1| Leptodoras linnelli elongation factor-1 alpha gene, exons 4 through 8 and partial cds Length = 1111 Score = 87.7 bits (44), Expect = 4e-14 Identities = 63/70 (90%) Strand = Plus / Minus Query: 240 ccttcttctcnacgctcttgatcacacccacagcaaccgtctgcctnatgtcacgcacgg 299 |||||||||| ||||||||||| ||||| |||||||| |||||||| ||||||||||| | Sbjct: 1111 ccttcttctcaacgctcttgatgacaccaacagcaacggtctgcctcatgtcacgcacag 1052 Query: 300 caaaccgacc 309 |||| ||||| Sbjct: 1051 caaaacgacc 1042 Score = 63.9 bits (32), Expect = 5e-07 Identities = 58/67 (86%) Strand = Plus / Minus Query: 479 gtgtggcagtccagcacangggcataaccgttgctgatctggccagggtggttcatgatg 538 |||||||| ||||||||| ||||||| || | | |||||| ||||||||||||| |||| Sbjct: 788 gtgtggcaatccagcacaggggcatagccctgggagatctgaccagggtggttcaggatg 729 Query: 539 atgacct 545 ||||||| Sbjct: 728 atgacct 722
>gb|AY264236.1| Leptodoras sp. 3-GM-2003 elongation factor-1 alpha gene, exons 4 through 8 and partial cds Length = 1083 Score = 87.7 bits (44), Expect = 4e-14 Identities = 63/70 (90%) Strand = Plus / Minus Query: 240 ccttcttctcnacgctcttgatcacacccacagcaaccgtctgcctnatgtcacgcacgg 299 |||||||||| ||||||||||| ||||| |||||||| |||||||| ||||||||||| | Sbjct: 1083 ccttcttctcaacgctcttgatgacaccaacagcaacggtctgcctcatgtcacgcacag 1024 Query: 300 caaaccgacc 309 |||| ||||| Sbjct: 1023 caaaacgacc 1014 Score = 63.9 bits (32), Expect = 5e-07 Identities = 58/67 (86%) Strand = Plus / Minus Query: 479 gtgtggcagtccagcacangggcataaccgttgctgatctggccagggtggttcatgatg 538 |||||||| ||||||||| ||||||| || | | |||||| ||||||||||||| |||| Sbjct: 785 gtgtggcaatccagcacaggggcatagccctgggagatctgaccagggtggttcaggatg 726 Query: 539 atgacct 545 ||||||| Sbjct: 725 atgacct 719
>gb|AY264225.1| Hassar sp. GM-2003 elongation factor-1 alpha gene, exons 4 through 8 and partial cds Length = 1112 Score = 87.7 bits (44), Expect = 4e-14 Identities = 63/70 (90%) Strand = Plus / Minus Query: 240 ccttcttctcnacgctcttgatcacacccacagcaaccgtctgcctnatgtcacgcacgg 299 |||||||||| ||||||||||| ||||| |||||||| |||||||| ||||||||||| | Sbjct: 1112 ccttcttctcaacgctcttgatgacaccaacagcaacggtctgcctcatgtcacgcacag 1053 Query: 300 caaaccgacc 309 |||| ||||| Sbjct: 1052 caaaacgacc 1043 Score = 63.9 bits (32), Expect = 5e-07 Identities = 58/67 (86%) Strand = Plus / Minus Query: 479 gtgtggcagtccagcacangggcataaccgttgctgatctggccagggtggttcatgatg 538 |||||||| ||||||||| ||||||| || | | |||||| ||||||||||||| |||| Sbjct: 788 gtgtggcaatccagcacaggggcatagccctgggagatctgaccagggtggttcaggatg 729 Query: 539 atgacct 545 ||||||| Sbjct: 728 atgacct 722
>gb|AY264224.1| Hassar sp. GM-2003 elongation factor-1 alpha gene, exons 4 through 8 and partial cds Length = 1112 Score = 87.7 bits (44), Expect = 4e-14 Identities = 63/70 (90%) Strand = Plus / Minus Query: 240 ccttcttctcnacgctcttgatcacacccacagcaaccgtctgcctnatgtcacgcacgg 299 |||||||||| ||||||||||| ||||| |||||||| |||||||| ||||||||||| | Sbjct: 1112 ccttcttctcaacgctcttgatgacaccaacagcaacggtctgcctcatgtcacgcacag 1053 Query: 300 caaaccgacc 309 |||| ||||| Sbjct: 1052 caaaacgacc 1043 Score = 63.9 bits (32), Expect = 5e-07 Identities = 58/67 (86%) Strand = Plus / Minus Query: 479 gtgtggcagtccagcacangggcataaccgttgctgatctggccagggtggttcatgatg 538 |||||||| ||||||||| ||||||| || | | |||||| ||||||||||||| |||| Sbjct: 788 gtgtggcaatccagcacaggggcatagccctgggagatctgaccagggtggttcaggatg 729 Query: 539 atgacct 545 ||||||| Sbjct: 728 atgacct 722
>gb|AY264223.1| Opsodoras sp. GM-2003 elongation factor-1 alpha gene, exons 4 through 8 and partial cds Length = 1113 Score = 87.7 bits (44), Expect = 4e-14 Identities = 63/70 (90%) Strand = Plus / Minus Query: 240 ccttcttctcnacgctcttgatcacacccacagcaaccgtctgcctnatgtcacgcacgg 299 |||||||||| ||||||||||| ||||| |||||||| |||||||| ||||||||||| | Sbjct: 1113 ccttcttctcaacgctcttgatgacaccaacagcaacggtctgcctcatgtcacgcacag 1054 Query: 300 caaaccgacc 309 |||| ||||| Sbjct: 1053 caaaacgacc 1044 Score = 63.9 bits (32), Expect = 5e-07 Identities = 58/67 (86%) Strand = Plus / Minus Query: 479 gtgtggcagtccagcacangggcataaccgttgctgatctggccagggtggttcatgatg 538 |||||||| ||||||||| ||||||| || | | |||||| ||||||||||||| |||| Sbjct: 789 gtgtggcaatccagcacaggggcatagccctgggagatctgaccagggtggttcaggatg 730 Query: 539 atgacct 545 ||||||| Sbjct: 729 atgacct 723
>gb|AY264222.1| Opsodoras ternetzi haplotype I elongation factor-1 alpha gene, exons 4 through 8 and partial cds Length = 1107 Score = 87.7 bits (44), Expect = 4e-14 Identities = 63/70 (90%) Strand = Plus / Minus Query: 240 ccttcttctcnacgctcttgatcacacccacagcaaccgtctgcctnatgtcacgcacgg 299 |||||||||| ||||||||||| ||||| |||||||| |||||||| ||||||||||| | Sbjct: 1107 ccttcttctcaacgctcttgatgacaccaacagcaacggtctgcctcatgtcacgcacag 1048 Query: 300 caaaccgacc 309 |||| ||||| Sbjct: 1047 caaaacgacc 1038 Score = 63.9 bits (32), Expect = 5e-07 Identities = 58/67 (86%) Strand = Plus / Minus Query: 479 gtgtggcagtccagcacangggcataaccgttgctgatctggccagggtggttcatgatg 538 |||||||| ||||||||| ||||||| || | | |||||| ||||||||||||| |||| Sbjct: 784 gtgtggcaatccagcacaggggcatagccctgggagatctgaccagggtggttcaggatg 725 Query: 539 atgacct 545 ||||||| Sbjct: 724 atgacct 718
>gb|AY264221.1| Nemadoras hemipeltis elongation factor-1 alpha gene, exons 4 through 8 and partial cds Length = 1114 Score = 87.7 bits (44), Expect = 4e-14 Identities = 63/70 (90%) Strand = Plus / Minus Query: 240 ccttcttctcnacgctcttgatcacacccacagcaaccgtctgcctnatgtcacgcacgg 299 |||||||||| ||||||||||| ||||| |||||||| |||||||| ||||||||||| | Sbjct: 1114 ccttcttctcgacgctcttgatgacaccaacagcaacggtctgcctcatgtcacgcacag 1055 Query: 300 caaaccgacc 309 |||| ||||| Sbjct: 1054 caaaacgacc 1045 Score = 63.9 bits (32), Expect = 5e-07 Identities = 58/67 (86%) Strand = Plus / Minus Query: 479 gtgtggcagtccagcacangggcataaccgttgctgatctggccagggtggttcatgatg 538 |||||||| ||||||||| ||||||| || | | |||||| ||||||||||||| |||| Sbjct: 790 gtgtggcaatccagcacaggggcatagccctgggagatctgaccagggtggttcaggatg 731 Query: 539 atgacct 545 ||||||| Sbjct: 730 atgacct 724
>gb|AY264219.1| Doras micropoeus elongation factor-1 alpha gene, exons 4 through 8 and partial cds Length = 1112 Score = 87.7 bits (44), Expect = 4e-14 Identities = 63/70 (90%) Strand = Plus / Minus Query: 240 ccttcttctcnacgctcttgatcacacccacagcaaccgtctgcctnatgtcacgcacgg 299 |||||||||| ||||||||||| ||||| |||||||| |||||||| ||||||||||| | Sbjct: 1112 ccttcttctcaacgctcttgatgacaccaacagcaacggtctgcctcatgtcacgcacag 1053 Query: 300 caaaccgacc 309 |||| ||||| Sbjct: 1052 caaaacgacc 1043 Score = 65.9 bits (33), Expect = 1e-07 Identities = 79/95 (83%) Strand = Plus / Minus Query: 451 ctcggcgaacttgacggcnatgtgggatgtgtggcagtccagcacangggcataaccgtt 510 |||||| |||||| ||| ||||| | |||||||| ||||||||| ||||||| || | Sbjct: 814 ctcggcaaacttgcaggcaatgtgagcagtgtggcaatccagcacaggggcatagccctg 755 Query: 511 gctgatctggccagggtggttcatgatgatgacct 545 | |||||| ||||||||||||| ||||||||||| Sbjct: 754 ggagatctgaccagggtggttcaggatgatgacct 720
>gb|AY264217.1| Doraops zuloagai elongation factor-1 alpha gene, exons 4 through 8 and partial cds Length = 1120 Score = 87.7 bits (44), Expect = 4e-14 Identities = 63/70 (90%) Strand = Plus / Minus Query: 240 ccttcttctcnacgctcttgatcacacccacagcaaccgtctgcctnatgtcacgcacgg 299 |||||||||| ||||||||||| ||||| |||||||| |||||||| ||||||||||| | Sbjct: 1120 ccttcttctcaacgctcttgatgacaccaacagcaacggtctgcctcatgtcacgcacag 1061 Query: 300 caaaccgacc 309 |||| ||||| Sbjct: 1060 caaaacgacc 1051 Score = 50.1 bits (25), Expect = 0.008 Identities = 77/95 (81%) Strand = Plus / Minus Query: 451 ctcggcgaacttgacggcnatgtgggatgtgtggcagtccagcacangggcataaccgtt 510 |||||| |||||| ||| ||||| | |||||||| || |||||| |||| || || | Sbjct: 817 ctcggcaaacttgcaggcaatgtgagcagtgtggcaatcaagcacaggggcgtagccctg 758 Query: 511 gctgatctggccagggtggttcatgatgatgacct 545 | |||||| ||||||||||||| ||||||||||| Sbjct: 757 ggagatctgaccagggtggttcaggatgatgacct 723
>gb|AY264214.1| Oxydoras niger haplotype II elongation factor-1 alpha gene, exons 4 through 8 and partial cds Length = 1116 Score = 87.7 bits (44), Expect = 4e-14 Identities = 63/70 (90%) Strand = Plus / Minus Query: 240 ccttcttctcnacgctcttgatcacacccacagcaaccgtctgcctnatgtcacgcacgg 299 |||||||||| ||||||||||| ||||| |||||||| |||||||| ||||||||||| | Sbjct: 1116 ccttcttctcaacgctcttgatgacaccaacagcaacggtctgcctcatgtcacgcacag 1057 Query: 300 caaaccgacc 309 |||| ||||| Sbjct: 1056 caaaacgacc 1047 Score = 63.9 bits (32), Expect = 5e-07 Identities = 58/67 (86%) Strand = Plus / Minus Query: 479 gtgtggcagtccagcacangggcataaccgttgctgatctggccagggtggttcatgatg 538 |||||||| ||||||||| ||||||| || | | |||||| ||||||||||||| |||| Sbjct: 792 gtgtggcaatccagcacaggggcatagccctgggagatctgaccagggtggttcaggatg 733 Query: 539 atgacct 545 ||||||| Sbjct: 732 atgacct 726
>gb|AY264210.1| Rhinodoras cf. boehlkei elongation factor-1 alpha gene, exons 4 through 8 and partial cds Length = 1117 Score = 87.7 bits (44), Expect = 4e-14 Identities = 63/70 (90%) Strand = Plus / Minus Query: 240 ccttcttctcnacgctcttgatcacacccacagcaaccgtctgcctnatgtcacgcacgg 299 |||||||||| ||||||||||| ||||| |||||||| |||||||| ||||||||||| | Sbjct: 1117 ccttcttctcaacgctcttgatgacaccaacagcaacggtctgcctcatgtcacgcacag 1058 Query: 300 caaaccgacc 309 |||| ||||| Sbjct: 1057 caaaacgacc 1048 Score = 48.1 bits (24), Expect = 0.031 Identities = 56/67 (83%) Strand = Plus / Minus Query: 479 gtgtggcagtccagcacangggcataaccgttgctgatctggccagggtggttcatgatg 538 ||||| || ||||||||| ||||||| || | | ||||| ||||||||||||| |||| Sbjct: 794 gtgtgacaatccagcacaggggcatagccctgggagatcttaccagggtggttcaggatg 735 Query: 539 atgacct 545 ||||||| Sbjct: 734 atgacct 728
>gb|AY264209.1| Rhinodoras boehlkei elongation factor-1 alpha gene, exons 4 through 8 and partial cds Length = 1088 Score = 87.7 bits (44), Expect = 4e-14 Identities = 63/70 (90%) Strand = Plus / Minus Query: 240 ccttcttctcnacgctcttgatcacacccacagcaaccgtctgcctnatgtcacgcacgg 299 |||||||||| ||||||||||| ||||| |||||||| |||||||| ||||||||||| | Sbjct: 1088 ccttcttctcaacgctcttgatgacaccaacagcaacggtctgcctcatgtcacgcacag 1029 Query: 300 caaaccgacc 309 |||| ||||| Sbjct: 1028 caaaacgacc 1019 Score = 48.1 bits (24), Expect = 0.031 Identities = 30/32 (93%) Strand = Plus / Minus Query: 514 gatctggccagggtggttcatgatgatgacct 545 |||||| ||||||||||||| ||||||||||| Sbjct: 755 gatctgaccagggtggttcaggatgatgacct 724
>gb|AY264208.1| Platydoras costatus elongation factor-1 alpha gene, exons 4 through 8 and partial cds Length = 1108 Score = 87.7 bits (44), Expect = 4e-14 Identities = 63/70 (90%) Strand = Plus / Minus Query: 240 ccttcttctcnacgctcttgatcacacccacagcaaccgtctgcctnatgtcacgcacgg 299 |||||||||| ||||||||||| ||||| |||||||| |||||||| ||||||||||| | Sbjct: 1108 ccttcttctcaacgctcttgatgacaccaacagcaacggtctgcctcatgtcacgcacag 1049 Query: 300 caaaccgacc 309 |||| ||||| Sbjct: 1048 caaaacgacc 1039 Score = 56.0 bits (28), Expect = 1e-04 Identities = 57/67 (85%) Strand = Plus / Minus Query: 479 gtgtggcagtccagcacangggcataaccgttgctgatctggccagggtggttcatgatg 538 ||||| |||||||||||| |||| || || | | |||||| ||||||||||||| |||| Sbjct: 784 gtgtgacagtccagcacaggggcgtagccctgggagatctgaccagggtggttcaggatg 725 Query: 539 atgacct 545 ||||||| Sbjct: 724 atgacct 718
>gb|AY264206.1| Lithodoras dorsalis elongation factor-1 alpha gene, exons 4 through 8 and partial cds Length = 1110 Score = 87.7 bits (44), Expect = 4e-14 Identities = 63/70 (90%) Strand = Plus / Minus Query: 240 ccttcttctcnacgctcttgatcacacccacagcaaccgtctgcctnatgtcacgcacgg 299 |||||||||| ||||||||||| ||||| |||||||| |||||||| ||||||||||| | Sbjct: 1110 ccttcttctcaacgctcttgatgacaccaacagcaacggtctgcctcatgtcacgcacag 1051 Query: 300 caaaccgacc 309 |||| ||||| Sbjct: 1050 caaaacgacc 1041 Score = 63.9 bits (32), Expect = 5e-07 Identities = 58/67 (86%) Strand = Plus / Minus Query: 479 gtgtggcagtccagcacangggcataaccgttgctgatctggccagggtggttcatgatg 538 ||||| |||||||||||| ||||||| || | | |||||| ||||||||||||| |||| Sbjct: 787 gtgtgacagtccagcacaggggcatagccctgggagatctgaccagggtggttcaggatg 728 Query: 539 atgacct 545 ||||||| Sbjct: 727 atgacct 721
>gb|AY264205.1| Megalodoras uranoscopus elongation factor-1 alpha gene, exons 4 through 8 and partial cds Length = 1084 Score = 87.7 bits (44), Expect = 4e-14 Identities = 63/70 (90%) Strand = Plus / Minus Query: 240 ccttcttctcnacgctcttgatcacacccacagcaaccgtctgcctnatgtcacgcacgg 299 |||||||||| ||||||||||| ||||| |||||||| |||||||| ||||||||||| | Sbjct: 1084 ccttcttctcaacgctcttgatgacaccaacagcaacggtctgcctcatgtcacgcacag 1025 Query: 300 caaaccgacc 309 |||| ||||| Sbjct: 1024 caaaacgacc 1015 Score = 56.0 bits (28), Expect = 1e-04 Identities = 57/67 (85%) Strand = Plus / Minus Query: 479 gtgtggcagtccagcacangggcataaccgttgctgatctggccagggtggttcatgatg 538 ||||| ||||||| |||| ||||||| || | | |||||| ||||||||||||| |||| Sbjct: 786 gtgtgacagtccaacacaggggcatagccctgggagatctgaccagggtggttcaggatg 727 Query: 539 atgacct 545 ||||||| Sbjct: 726 atgacct 720
>gb|AY264203.1| Physopyxis lyra elongation factor-1 alpha gene, exons 4 through 8 and partial cds Length = 1105 Score = 87.7 bits (44), Expect = 4e-14 Identities = 63/70 (90%) Strand = Plus / Minus Query: 240 ccttcttctcnacgctcttgatcacacccacagcaaccgtctgcctnatgtcacgcacgg 299 |||||||||| ||||||||||| ||||| |||||||| |||||||| ||||||||||| | Sbjct: 1105 ccttcttctcgacgctcttgatgacaccgacagcaacagtctgcctcatgtcacgcacag 1046 Query: 300 caaaccgacc 309 |||| ||||| Sbjct: 1045 caaaacgacc 1036 Score = 58.0 bits (29), Expect = 3e-05 Identities = 58/68 (85%) Strand = Plus / Minus Query: 479 gtgtggcagtccagcacangggcataaccgttgctgatctggccagggtggttcatgatg 538 |||||||||||||||||| | ||||| || | | |||||| ||||||||||||| ||| Sbjct: 777 gtgtggcagtccagcacaggagcatagccctgggagatctgaccagggtggttcaggata 718 Query: 539 atgacctg 546 |||||||| Sbjct: 717 atgacctg 710
>gb|AY264202.1| Hypodoras forficulatus elongation factor-1 alpha gene, exons 4 through 8 and partial cds Length = 1124 Score = 87.7 bits (44), Expect = 4e-14 Identities = 63/70 (90%) Strand = Plus / Minus Query: 240 ccttcttctcnacgctcttgatcacacccacagcaaccgtctgcctnatgtcacgcacgg 299 |||||||||| ||||||||||| ||||| |||||||| |||||||| ||||||||||| | Sbjct: 1124 ccttcttctcgacgctcttgatgacaccaacagcaacggtctgcctcatgtcacgcacag 1065 Query: 300 caaaccgacc 309 |||| ||||| Sbjct: 1064 caaaacgacc 1055 Score = 75.8 bits (38), Expect = 1e-10 Identities = 78/92 (84%) Strand = Plus / Minus Query: 455 gcgaacttgacggcnatgtgggatgtgtggcagtccagcacangggcataaccgttgctg 514 ||||||||| ||| ||||||| |||||||||||||||||| | ||||| || | | | Sbjct: 816 gcgaacttgcaggcaatgtgggcagtgtggcagtccagcacaggagcatagccctgggag 757 Query: 515 atctggccagggtggttcatgatgatgacctg 546 ||||| ||||||||||||| |||||||||||| Sbjct: 756 atctgaccagggtggttcaggatgatgacctg 725
>gb|AY264196.1| Hypophthalmus edentatus elongation factor-1 alpha gene, exons 4 through 8 and partial cds Length = 1115 Score = 87.7 bits (44), Expect = 4e-14 Identities = 63/70 (90%) Strand = Plus / Minus Query: 240 ccttcttctcnacgctcttgatcacacccacagcaaccgtctgcctnatgtcacgcacgg 299 |||||||||| ||||||||||| ||||| |||||||| |||||||| ||||||||||| | Sbjct: 1115 ccttcttctcgacgctcttgatgacaccaacagcaacggtctgcctcatgtcacgcacag 1056 Query: 300 caaaccgacc 309 |||| ||||| Sbjct: 1055 caaaacgacc 1046 Score = 40.1 bits (20), Expect = 7.6 Identities = 55/67 (82%) Strand = Plus / Minus Query: 479 gtgtggcagtccagcacangggcataaccgttgctgatctggccagggtggttcatgatg 538 ||||||||||||| |||| | ||||| || | |||||| ||||||||||||| |||| Sbjct: 795 gtgtggcagtccaacacaggcgcatagccctgagagatctgaccagggtggttcaggatg 736 Query: 539 atgacct 545 || |||| Sbjct: 735 ataacct 729
>ref|XM_751978.1| Ustilago maydis 521 elongation factor 1-alpha (UM00924.1) partial mRNA Length = 1380 Score = 87.7 bits (44), Expect = 4e-14 Identities = 87/102 (85%) Strand = Plus / Minus Query: 448 gatctcggcgaacttgacggcnatgtgggatgtgtggcagtccagcacangggcataacc 507 |||||||||||||||| || ||||||| ||||||||||| || || |||| ||||| Sbjct: 1119 gatctcggcgaacttgcaagcaatgtgggcggtgtggcagtcgagaacgggggcgtaacc 1060 Query: 508 gttgctgatctggccagggtggttcatgatgatgacctgggc 549 ||| | |||||| |||||||||||||||| |||||||||||| Sbjct: 1059 gttaccgatctgaccagggtggttcatgacgatgacctgggc 1018 Score = 42.1 bits (21), Expect = 1.9 Identities = 27/29 (93%) Strand = Plus / Minus Query: 343 catgggcttggttggaatcatcttgacga 371 |||||||||||| || ||||||||||||| Sbjct: 1224 catgggcttggtggggatcatcttgacga 1196
>gb|AF526289.1| Imnadia yeyetta elongation factor-1 alpha gene, partial cds Length = 1010 Score = 87.7 bits (44), Expect = 4e-14 Identities = 87/102 (85%) Strand = Plus / Minus Query: 448 gatctcggcgaacttgacggcnatgtgggatgtgtggcagtccagcacangggcataacc 507 |||||||||||||||| || ||||||| ||||||||||||||||| ||| || || Sbjct: 907 gatctcggcgaacttgcaagcgatgtgggcagtgtggcagtccagcacgggggtgtagcc 848 Query: 508 gttgctgatctggccagggtggttcatgatgatgacctgggc 549 |||||||||||| ||||||||||||| | |||||||||||| Sbjct: 847 gttgctgatctgaccagggtggttcaaaacgatgacctgggc 806 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 4,415,310 Number of Sequences: 3902068 Number of extensions: 4415310 Number of successful extensions: 91895 Number of sequences better than 10.0: 2287 Number of HSP's better than 10.0 without gapping: 2253 Number of HSP's successfully gapped in prelim test: 34 Number of HSP's that attempted gapping in prelim test: 87670 Number of HSP's gapped (non-prelim): 3774 length of query: 558 length of database: 17,233,045,268 effective HSP length: 23 effective length of query: 535 effective length of database: 17,143,297,704 effective search space: 9171664271640 effective search space used: 9171664271640 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)