| Clone Name | rbags15l05 |
|---|---|
| Clone Library Name | barley_pub |
| No. | Definition | Score (bits) |
E Value |
1 | gb|M74077.1|WHTUBICP T.aestivum ubiquitin carrier protein mRNA | 117 | 5e-24 |
|---|
>gb|M74077.1|WHTUBICP T.aestivum ubiquitin carrier protein mRNA Length = 802 Score = 117 bits (59), Expect = 5e-24 Identities = 73/79 (92%) Strand = Plus / Minus Query: 13 aatggaaaatntacaggggagaagngaaattgctagtgtcggatggacattcggagatcg 72 |||||||||| ||||||||||||| |||||||||||||||||||||||||| ||||||| Sbjct: 678 aatggaaaatatacaggggagaagtgaaattgctagtgtcggatggacatttggagatca 619 Query: 73 acagcananccctccacac 91 |||||| | |||||||||| Sbjct: 618 acagcaaaaccctccacac 600 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 202,337 Number of Sequences: 3902068 Number of extensions: 202337 Number of successful extensions: 7509 Number of sequences better than 10.0: 1 Number of HSP's better than 10.0 without gapping: 1 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 7508 Number of HSP's gapped (non-prelim): 1 length of query: 91 length of database: 17,233,045,268 effective HSP length: 21 effective length of query: 70 effective length of database: 17,151,101,840 effective search space: 1200577128800 effective search space used: 1200577128800 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 19 (38.2 bits)