| Clone Name | rbags15j16 |
|---|---|
| Clone Library Name | barley_pub |
>ref|XM_474305.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 1164 Score = 252 bits (127), Expect = 1e-63 Identities = 367/447 (82%) Strand = Plus / Minus Query: 217 gaaggagaccttgatgccgagcagggccatgagctgggccacgaactccgggtgcgcggg 276 |||||||||||||||||| |||| ||||||||||||| | |||||||||||| | || Sbjct: 1161 gaaggagaccttgatgccaagcaatgccatgagctgggagatgaactccgggtggccagg 1102 Query: 277 ccacgccgcgcccgtcaccaggttgccgtcggtgaagcaacggtggatcgggtccggctc 336 ||| |||||||| ||||| |||||||||||||||||||| |||| || || | ||||| Sbjct: 1101 ccatgccgcgccggtcacaaggttgccgtcggtgaagcagcggtcaatgggattgggctc 1042 Query: 337 cagccacgtccccccgcccagcaccacgttcagcttcaccgccgggtacgccgtgcacct 396 |||||| ||| ||||||| ||||||||||||||||||||||| || ||||||||||| | Sbjct: 1041 cagccatgtcgccccgccaagcaccacgttcagcttcaccgcaggatacgccgtgcattt 982 Query: 397 ccggccctgaagaaccccagcagcagccaggatctgctgcccgtggcagatcgacgcgac 456 || |||||||| || |||||||||| | ||||| || || ||||| || || ||||| Sbjct: 981 ccttccctgaaggactccagcagcagataaaatctgttggccatggcaaattgaggcgac 922 Query: 457 cggctttccgttgtccatgaaccccttggccaggctaaggaccttctcgttcaaggcaag 516 |||||| | || |||||||| ||||| | ||||||| ||| || ||||||| ||||| Sbjct: 921 tggctttgctttatccatgaagcccttcacaaggctaatgactttatcgttcagtgcaag 862 Query: 517 gtactcgggggcacgcccaccggggatcacaagcgcgtcgtagcttgaagcgtccacgcc 576 |||||| || || || ||||| || || ||||| || || |||||||| || ||||| Sbjct: 861 gtactcaggagcccgtccaccaggaattacaagtgcatcatagcttgatgcatccacatt 802 Query: 577 gtcaaacgacgcgttcagagcgaaatcatgaccaggcttctcgctgtatgtctggtcgcc 636 |||||| || || ||| ||| ||||| ||||||||||||||||||||||| ||||| || Sbjct: 801 gtcaaatgatgctgtcaaagcaaaatcgtgaccaggcttctcgctgtatgtttggtcacc 742 Query: 637 ctcaaagtcatggatggcggttgggca 663 ||||||||||| ||||| |||||||| Sbjct: 741 ttcaaagtcatgtatggcagttgggca 715
>dbj|AK100753.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023118M23, full insert sequence Length = 1368 Score = 252 bits (127), Expect = 1e-63 Identities = 367/447 (82%) Strand = Plus / Minus Query: 217 gaaggagaccttgatgccgagcagggccatgagctgggccacgaactccgggtgcgcggg 276 |||||||||||||||||| |||| ||||||||||||| | |||||||||||| | || Sbjct: 1221 gaaggagaccttgatgccaagcaatgccatgagctgggagatgaactccgggtggccagg 1162 Query: 277 ccacgccgcgcccgtcaccaggttgccgtcggtgaagcaacggtggatcgggtccggctc 336 ||| |||||||| ||||| |||||||||||||||||||| |||| || || | ||||| Sbjct: 1161 ccatgccgcgccggtcacaaggttgccgtcggtgaagcagcggtcaatgggattgggctc 1102 Query: 337 cagccacgtccccccgcccagcaccacgttcagcttcaccgccgggtacgccgtgcacct 396 |||||| ||| ||||||| ||||||||||||||||||||||| || ||||||||||| | Sbjct: 1101 cagccatgtcgccccgccaagcaccacgttcagcttcaccgcaggatacgccgtgcattt 1042 Query: 397 ccggccctgaagaaccccagcagcagccaggatctgctgcccgtggcagatcgacgcgac 456 || |||||||| || |||||||||| | ||||| || || ||||| || || ||||| Sbjct: 1041 ccttccctgaaggactccagcagcagataaaatctgttggccatggcaaattgaggcgac 982 Query: 457 cggctttccgttgtccatgaaccccttggccaggctaaggaccttctcgttcaaggcaag 516 |||||| | || |||||||| ||||| | ||||||| ||| || ||||||| ||||| Sbjct: 981 tggctttgctttatccatgaagcccttcacaaggctaatgactttatcgttcagtgcaag 922 Query: 517 gtactcgggggcacgcccaccggggatcacaagcgcgtcgtagcttgaagcgtccacgcc 576 |||||| || || || ||||| || || ||||| || || |||||||| || ||||| Sbjct: 921 gtactcaggagcccgtccaccaggaattacaagtgcatcatagcttgatgcatccacatt 862 Query: 577 gtcaaacgacgcgttcagagcgaaatcatgaccaggcttctcgctgtatgtctggtcgcc 636 |||||| || || ||| ||| ||||| ||||||||||||||||||||||| ||||| || Sbjct: 861 gtcaaatgatgctgtcaaagcaaaatcgtgaccaggcttctcgctgtatgtttggtcacc 802 Query: 637 ctcaaagtcatggatggcggttgggca 663 ||||||||||| ||||| |||||||| Sbjct: 801 ttcaaagtcatgtatggcagttgggca 775
>gb|BT016784.1| Zea mays clone Contig617 mRNA sequence Length = 1616 Score = 214 bits (108), Expect = 3e-52 Identities = 363/448 (81%) Strand = Plus / Minus Query: 217 gaaggagaccttgatgccgagcagggccatgagctgggccacgaactccgggtgcgcggg 276 |||||| ||||||| |||||||| ||||||||||||| ||||||||| ||||| | || Sbjct: 1285 gaaggaaaccttgacgccgagcaacgccatgagctgggacacgaactctgggtggcctgg 1226 Query: 277 ccacgccgcgcccgtcaccaggttgccgtcggtgaagcaacggtggatcgggtccggctc 336 ||| || ||||| ||||| |||||||| ||||||||||| |||||||||||||| ||||| Sbjct: 1225 ccaggctgcgccggtcacaaggttgccatcggtgaagcagcggtggatcgggtcaggctc 1166 Query: 337 cagccacgtccccccgcccagcaccacgttcagcttcaccgccgggtacgccgtgcacct 396 |||||| ||||| || || |||| ||||||||||||||| || ||||| || |||||| | Sbjct: 1165 cagccaggtcccgccaccgagcaacacgttcagcttcacggctgggtatgcggtgcactt 1106 Query: 397 ccggccctgaagaaccccagcagcagccaggatctgctgcccgtggcagatcgacgcgac 456 | |||| || || || ||||| | | |||||||| ||||||||||||||||||| Sbjct: 1105 cttccccttgaggactccggcagcggataatatctgctggccgtggcagatcgacgcgat 1046 Query: 457 cggctttccgttgtccatgaaccccttggccaggctaaggaccttctcgttcaaggcaag 516 ||||||||| | ||| ||| |||| ||| ||| | |||||| ||||||| || || Sbjct: 1045 tggctttccgctctccgcgaaggccttcaccaagctgatgaccttatcgttcagagccag 986 Query: 517 gtactcgggggcacgcccaccggggatcacaagcgcgtcgtagcttgaagcgtccacgcc 576 |||||| || || || || || || | |||||||||||||||||| ||||| ||||| | Sbjct: 985 gtactctggagcccgtccgccaggaaccacaagcgcgtcgtagctcgaagcatccacact 926 Query: 577 gtcaaacgacgcgttcagagcgaaatcatgaccaggcttctcgctgtatgtctggtcgcc 636 |||||||||| |||||| ||||| || ||||||||||||||||| |||||||| || Sbjct: 925 tccaaacgacgctgtcagagtaaaatcgtggccaggcttctcgctgtaggtctggtcacc 866 Query: 637 ctcaaagtcatggatggcggttgggcac 664 || || ||||| ||||| || |||||| Sbjct: 865 ttcgaaatcatgaatggctgtcgggcac 838
>gb|AY104354.1| Zea mays PCO108571 mRNA sequence Length = 1633 Score = 214 bits (108), Expect = 3e-52 Identities = 363/448 (81%) Strand = Plus / Minus Query: 217 gaaggagaccttgatgccgagcagggccatgagctgggccacgaactccgggtgcgcggg 276 |||||| ||||||| |||||||| ||||||||||||| ||||||||| ||||| | || Sbjct: 1259 gaaggaaaccttgacgccgagcaacgccatgagctgggacacgaactctgggtggcctgg 1200 Query: 277 ccacgccgcgcccgtcaccaggttgccgtcggtgaagcaacggtggatcgggtccggctc 336 ||| || ||||| ||||| |||||||| ||||||||||| |||||||||||||| ||||| Sbjct: 1199 ccaggctgcgccggtcacaaggttgccatcggtgaagcagcggtggatcgggtcaggctc 1140 Query: 337 cagccacgtccccccgcccagcaccacgttcagcttcaccgccgggtacgccgtgcacct 396 |||||| ||||| || || |||| ||||||||||||||| || ||||| || |||||| | Sbjct: 1139 cagccaggtcccgccaccgagcaacacgttcagcttcacggctgggtatgcggtgcactt 1080 Query: 397 ccggccctgaagaaccccagcagcagccaggatctgctgcccgtggcagatcgacgcgac 456 | |||| || || || ||||| | | |||||||| ||||||||||||||||||| Sbjct: 1079 cttccccttgaggactccggcagcggataatatctgctggccgtggcagatcgacgcgat 1020 Query: 457 cggctttccgttgtccatgaaccccttggccaggctaaggaccttctcgttcaaggcaag 516 ||||||||| | ||| ||| |||| ||| ||| | |||||| ||||||| || || Sbjct: 1019 tggctttccgctctccgcgaaggccttcaccaagctgatgaccttatcgttcagagccag 960 Query: 517 gtactcgggggcacgcccaccggggatcacaagcgcgtcgtagcttgaagcgtccacgcc 576 |||||| || || || || || || | |||||||||||||||||| ||||| ||||| | Sbjct: 959 gtactctggagcccgtccgccaggaaccacaagcgcgtcgtagctcgaagcatccacact 900 Query: 577 gtcaaacgacgcgttcagagcgaaatcatgaccaggcttctcgctgtatgtctggtcgcc 636 |||||||||| |||||| ||||| || ||||||||||||||||| |||||||| || Sbjct: 899 tccaaacgacgctgtcagagtaaaatcgtggccaggcttctcgctgtaggtctggtcacc 840 Query: 637 ctcaaagtcatggatggcggttgggcac 664 || || ||||| ||||| || |||||| Sbjct: 839 ttcgaaatcatgaatggctgtcgggcac 812
>emb|AL606652.4| Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0004A17, complete sequence Length = 159894 Score = 161 bits (81), Expect = 4e-36 Identities = 153/177 (86%) Strand = Plus / Plus Query: 217 gaaggagaccttgatgccgagcagggccatgagctgggccacgaactccgggtgcgcggg 276 |||||||||||||||||| |||| ||||||||||||| | |||||||||||| | || Sbjct: 26311 gaaggagaccttgatgccaagcaatgccatgagctgggagatgaactccgggtggccagg 26370 Query: 277 ccacgccgcgcccgtcaccaggttgccgtcggtgaagcaacggtggatcgggtccggctc 336 ||| |||||||| ||||| |||||||||||||||||||| |||| || || | ||||| Sbjct: 26371 ccatgccgcgccggtcacaaggttgccgtcggtgaagcagcggtcaatgggattgggctc 26430 Query: 337 cagccacgtccccccgcccagcaccacgttcagcttcaccgccgggtacgccgtgca 393 |||||| ||| ||||||| ||||||||||||||||||||||| || ||||||||||| Sbjct: 26431 cagccatgtcgccccgccaagcaccacgttcagcttcaccgcaggatacgccgtgca 26487 Score = 107 bits (54), Expect = 5e-20 Identities = 210/262 (80%) Strand = Plus / Plus Query: 402 cctgaagaaccccagcagcagccaggatctgctgcccgtggcagatcgacgcgaccggct 461 ||||||| || |||||||||| | ||||| || || ||||| || || ||||| |||| Sbjct: 26951 cctgaaggactccagcagcagataaaatctgttggccatggcaaattgaggcgactggct 27010 Query: 462 ttccgttgtccatgaaccccttggccaggctaaggaccttctcgttcaaggcaaggtact 521 || | || |||||||| ||||| | ||||||| ||| || ||||||| |||||||||| Sbjct: 27011 ttgctttatccatgaagcccttcacaaggctaatgactttatcgttcagtgcaaggtact 27070 Query: 522 cgggggcacgcccaccggggatcacaagcgcgtcgtagcttgaagcgtccacgccgtcaa 581 | || || || ||||| || || ||||| || || |||||||| || ||||| ||||| Sbjct: 27071 caggagcccgtccaccaggaattacaagtgcatcatagcttgatgcatccacattgtcaa 27130 Query: 582 acgacgcgttcagagcgaaatcatgaccaggcttctcgctgtatgtctggtcgccctcaa 641 | || || ||| ||| ||||| ||||||||||||||||||||||| ||||| || |||| Sbjct: 27131 atgatgctgtcaaagcaaaatcgtgaccaggcttctcgctgtatgtttggtcaccttcaa 27190 Query: 642 agtcatggatggcggttgggca 663 ||||||| ||||| |||||||| Sbjct: 27191 agtcatgtatggcagttgggca 27212
>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete sequence Length = 35498469 Score = 161 bits (81), Expect = 4e-36 Identities = 153/177 (86%) Strand = Plus / Plus Query: 217 gaaggagaccttgatgccgagcagggccatgagctgggccacgaactccgggtgcgcggg 276 |||||||||||||||||| |||| ||||||||||||| | |||||||||||| | || Sbjct: 34301908 gaaggagaccttgatgccaagcaatgccatgagctgggagatgaactccgggtggccagg 34301967 Query: 277 ccacgccgcgcccgtcaccaggttgccgtcggtgaagcaacggtggatcgggtccggctc 336 ||| |||||||| ||||| |||||||||||||||||||| |||| || || | ||||| Sbjct: 34301968 ccatgccgcgccggtcacaaggttgccgtcggtgaagcagcggtcaatgggattgggctc 34302027 Query: 337 cagccacgtccccccgcccagcaccacgttcagcttcaccgccgggtacgccgtgca 393 |||||| ||| ||||||| ||||||||||||||||||||||| || ||||||||||| Sbjct: 34302028 cagccatgtcgccccgccaagcaccacgttcagcttcaccgcaggatacgccgtgca 34302084 Score = 107 bits (54), Expect = 5e-20 Identities = 210/262 (80%) Strand = Plus / Plus Query: 402 cctgaagaaccccagcagcagccaggatctgctgcccgtggcagatcgacgcgaccggct 461 ||||||| || |||||||||| | ||||| || || ||||| || || ||||| |||| Sbjct: 34302548 cctgaaggactccagcagcagataaaatctgttggccatggcaaattgaggcgactggct 34302607 Query: 462 ttccgttgtccatgaaccccttggccaggctaaggaccttctcgttcaaggcaaggtact 521 || | || |||||||| ||||| | ||||||| ||| || ||||||| |||||||||| Sbjct: 34302608 ttgctttatccatgaagcccttcacaaggctaatgactttatcgttcagtgcaaggtact 34302667 Query: 522 cgggggcacgcccaccggggatcacaagcgcgtcgtagcttgaagcgtccacgccgtcaa 581 | || || || ||||| || || ||||| || || |||||||| || ||||| ||||| Sbjct: 34302668 caggagcccgtccaccaggaattacaagtgcatcatagcttgatgcatccacattgtcaa 34302727 Query: 582 acgacgcgttcagagcgaaatcatgaccaggcttctcgctgtatgtctggtcgccctcaa 641 | || || ||| ||| ||||| ||||||||||||||||||||||| ||||| || |||| Sbjct: 34302728 atgatgctgtcaaagcaaaatcgtgaccaggcttctcgctgtatgtttggtcaccttcaa 34302787 Query: 642 agtcatggatggcggttgggca 663 ||||||| ||||| |||||||| Sbjct: 34302788 agtcatgtatggcagttgggca 34302809
>emb|AL732356.2| Oryza sativa genomic DNA, chromosome 4, BAC clone: H0624F09, complete sequence Length = 95419 Score = 161 bits (81), Expect = 4e-36 Identities = 153/177 (86%) Strand = Plus / Plus Query: 217 gaaggagaccttgatgccgagcagggccatgagctgggccacgaactccgggtgcgcggg 276 |||||||||||||||||| |||| ||||||||||||| | |||||||||||| | || Sbjct: 74231 gaaggagaccttgatgcctagcaatgccatgagctgggagatgaactccgggtggccagg 74290 Query: 277 ccacgccgcgcccgtcaccaggttgccgtcggtgaagcaacggtggatcgggtccggctc 336 ||| |||||||| ||||| |||||||||||||||||||| |||| || || | ||||| Sbjct: 74291 ccatgccgcgccggtcacaaggttgccgtcggtgaagcagcggtcaatgggattgggctc 74350 Query: 337 cagccacgtccccccgcccagcaccacgttcagcttcaccgccgggtacgccgtgca 393 |||||| ||| ||||||| ||||||||||||||||||||||| || ||||||||||| Sbjct: 74351 cagccatgtcgccccgccaagcaccacgttcagcttcaccgcaggatacgccgtgca 74407 Score = 107 bits (54), Expect = 5e-20 Identities = 210/262 (80%) Strand = Plus / Plus Query: 402 cctgaagaaccccagcagcagccaggatctgctgcccgtggcagatcgacgcgaccggct 461 ||||||| || |||||||||| | ||||| || || ||||| || || ||||| |||| Sbjct: 74871 cctgaaggactccagcagcagataaaatctgttggccatggcaaattgaggcgactggct 74930 Query: 462 ttccgttgtccatgaaccccttggccaggctaaggaccttctcgttcaaggcaaggtact 521 || | || |||||||| ||||| | ||||||| ||| || ||||||| |||||||||| Sbjct: 74931 ttgctttatccatgaagcccttcacaaggctaatgactttatcgttcagtgcaaggtact 74990 Query: 522 cgggggcacgcccaccggggatcacaagcgcgtcgtagcttgaagcgtccacgccgtcaa 581 | || || || ||||| || || ||||| || || |||||||| || ||||| ||||| Sbjct: 74991 caggagcccgtccaccaggaattacaagtgcatcatagcttgatgcatccacattgtcaa 75050 Query: 582 acgacgcgttcagagcgaaatcatgaccaggcttctcgctgtatgtctggtcgccctcaa 641 | || || ||| ||| ||||| ||||||||||||||||||||||| ||||| || |||| Sbjct: 75051 atgatgctgtcaaagcaaaatcgtgaccaggcttctcgctgtatgtttggtcaccttcaa 75110 Query: 642 agtcatggatggcggttgggca 663 ||||||| ||||| |||||||| Sbjct: 75111 agtcatgtatggcagttgggca 75132
>gb|DQ351282.1| Oryza rufipogon unknown gene Length = 14907 Score = 153 bits (77), Expect = 9e-34 Identities = 152/177 (85%) Strand = Plus / Plus Query: 217 gaaggagaccttgatgccgagcagggccatgagctgggccacgaactccgggtgcgcggg 276 |||||||||||||||||| |||| ||||||||||||| | |||||||||||| | || Sbjct: 9500 gaaggagaccttgatgccaagcaatgccatgagctgggagatgaactccgggtggccagg 9559 Query: 277 ccacgccgcgcccgtcaccaggttgccgtcggtgaagcaacggtggatcgggtccggctc 336 ||| |||||||| ||||| |||||||||||||||||||| |||| || || | ||||| Sbjct: 9560 ccatgccgcgccggtcacaaggttgccgtcggtgaagcagcggtcaatgggattgggctc 9619 Query: 337 cagccacgtccccccgcccagcaccacgttcagcttcaccgccgggtacgccgtgca 393 |||||| ||| ||||||| ||||||||||| ||||||||||| || ||||||||||| Sbjct: 9620 cagccatgtcgccccgccaagcaccacgttgagcttcaccgcaggatacgccgtgca 9676 Score = 107 bits (54), Expect = 5e-20 Identities = 210/262 (80%) Strand = Plus / Plus Query: 402 cctgaagaaccccagcagcagccaggatctgctgcccgtggcagatcgacgcgaccggct 461 ||||||| || |||||||||| | ||||| || || ||||| || || ||||| |||| Sbjct: 10136 cctgaaggactccagcagcagataaaatctgttggccatggcaaattgaggcgactggct 10195 Query: 462 ttccgttgtccatgaaccccttggccaggctaaggaccttctcgttcaaggcaaggtact 521 || | || |||||||| ||||| | ||||||| ||| || ||||||| |||||||||| Sbjct: 10196 ttgctttatccatgaagcccttcacaaggctaatgactttatcgttcagtgcaaggtact 10255 Query: 522 cgggggcacgcccaccggggatcacaagcgcgtcgtagcttgaagcgtccacgccgtcaa 581 | || || || ||||| || || ||||| || || |||||||| || ||||| ||||| Sbjct: 10256 caggagcccgtccaccaggaattacaagtgcatcatagcttgatgcatccacattgtcaa 10315 Query: 582 acgacgcgttcagagcgaaatcatgaccaggcttctcgctgtatgtctggtcgccctcaa 641 | || || ||| ||| ||||| ||||||||||||||||||||||| ||||| || |||| Sbjct: 10316 atgatgctgtcaaagcaaaatcgtgaccaggcttctcgctgtatgtttggtcaccttcaa 10375 Query: 642 agtcatggatggcggttgggca 663 ||||||| ||||| |||||||| Sbjct: 10376 agtcatgtatggcagttgggca 10397
>gb|CP000151.1| Burkholderia sp. 383 chromosome 1, complete sequence Length = 3694126 Score = 69.9 bits (35), Expect = 1e-08 Identities = 116/143 (81%) Strand = Plus / Minus Query: 515 aggtactcgggggcacgcccaccggggatcacaagcgcgtcgtagcttgaagcgtccacg 574 ||||| ||||||||||| || || | |||| | ||||||||||||| || ||||| ||| Sbjct: 3214235 aggtattcgggggcacggccgcccgcgatcgcgagcgcgtcgtagcgcgatgcgtcgacg 3214176 Query: 575 ccgtcaaacgacgcgttcagagcgaaatcatgaccaggcttctcgctgtatgtctggtcg 634 |||| |||| ||||||||| | ||| | || || ||||||||| |||| ||||||||| Sbjct: 3214175 tcgtcgaacgccgcgttcagcgtgaactggtggccgggcttctcggtgtaggtctggtcg 3214116 Query: 635 ccctcaaagtcatggatggcggt 657 || || || |||||||| ||||| Sbjct: 3214115 ccttcgaaatcatggatcgcggt 3214093
>gb|CP000089.1| Dechloromonas aromatica RCB, complete genome Length = 4501104 Score = 69.9 bits (35), Expect = 1e-08 Identities = 44/47 (93%) Strand = Plus / Plus Query: 611 ggcttctcgctgtatgtctggtcgccctcaaagtcatggatggcggt 657 |||||||||||||| ||||||||||| ||||| |||||||||||||| Sbjct: 30204 ggcttctcgctgtaggtctggtcgccttcaaaatcatggatggcggt 30250
>dbj|AP006840.1| Symbiobacterium thermophilum IAM 14863 DNA, complete genome Length = 3566135 Score = 63.9 bits (32), Expect = 6e-07 Identities = 41/44 (93%) Strand = Plus / Minus Query: 611 ggcttctcgctgtatgtctggtcgccctcaaagtcatggatggc 654 |||||||||||||| ||||||||||| |||||||| |||||||| Sbjct: 1539023 ggcttctcgctgtaggtctggtcgccttcaaagtcgtggatggc 1538980 Score = 40.1 bits (20), Expect = 9.3 Identities = 38/44 (86%) Strand = Plus / Minus Query: 515 aggtactcgggggcacgcccaccggggatcacaagcgcgtcgta 558 ||||||||||| || || || || |||||||| ||||||||||| Sbjct: 1539119 aggtactcgggcgcccgtccgccagggatcaccagcgcgtcgta 1539076
>gb|CP000251.1| Anaeromyxobacter dehalogenans 2CP-C, complete genome Length = 5013479 Score = 60.0 bits (30), Expect = 1e-05 Identities = 42/46 (91%) Strand = Plus / Minus Query: 612 gcttctcgctgtatgtctggtcgccctcaaagtcatggatggcggt 657 ||||||||||||| |||||||||||||| ||||| ||||| ||||| Sbjct: 407560 gcttctcgctgtacgtctggtcgccctcgaagtcgtggatcgcggt 407515 Score = 40.1 bits (20), Expect = 9.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 358 caccacgttcagcttcaccg 377 |||||||||||||||||||| Sbjct: 2092513 caccacgttcagcttcaccg 2092494 Score = 40.1 bits (20), Expect = 9.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 349 cccgcccagcaccacgttca 368 |||||||||||||||||||| Sbjct: 348392 cccgcccagcaccacgttca 348411
>gb|CP000094.1| Pseudomonas fluorescens PfO-1, complete genome Length = 6438405 Score = 58.0 bits (29), Expect = 4e-05 Identities = 47/53 (88%) Strand = Plus / Minus Query: 605 tgaccaggcttctcgctgtatgtctggtcgccctcaaagtcatggatggcggt 657 ||||| || ||||||||||| ||||| ||||| |||||||||||||| ||||| Sbjct: 1479972 tgaccgggtttctcgctgtaggtctgatcgccttcaaagtcatggatcgcggt 1479920
>gb|AY658425.1| Synthetic construct Peudomonas aeruginosa clone FLH036066.01F PA4336 gene, partial cds Length = 585 Score = 54.0 bits (27), Expect = 6e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 611 ggcttctcgctgtatgtctggtcgccctcaaagtcatggatggcggt 657 |||||||||||||| ||||||||||| || || || ||||||||||| Sbjct: 191 ggcttctcgctgtaggtctggtcgccttcgaaatcgtggatggcggt 145
>gb|AE004850.1| Pseudomonas aeruginosa PAO1, section 411 of 529 of the complete genome Length = 10036 Score = 54.0 bits (27), Expect = 6e-04 Identities = 42/47 (89%) Strand = Plus / Plus Query: 611 ggcttctcgctgtatgtctggtcgccctcaaagtcatggatggcggt 657 |||||||||||||| ||||||||||| || || || ||||||||||| Sbjct: 822 ggcttctcgctgtaggtctggtcgccttcgaaatcgtggatggcggt 868
>gb|CP000159.1| Salinibacter ruber DSM 13855, complete genome Length = 3551823 Score = 54.0 bits (27), Expect = 6e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 611 ggcttctcgctgtatgtctggtcgccctcaaagtcatggatggcggt 657 ||||| ||| |||| |||||||||||||||||||| ||||| ||||| Sbjct: 576180 ggcttttcggtgtaggtctggtcgccctcaaagtcgtggatcgcggt 576134
>ref|NM_111140.4| Arabidopsis thaliana hydrolase, acting on glycosyl bonds AT3G02720 mRNA, complete cds Length = 1415 Score = 52.0 bits (26), Expect = 0.002 Identities = 44/50 (88%) Strand = Plus / Minus Query: 614 ttctcgctgtatgtctggtcgccctcaaagtcatggatggcggttgggca 663 ||||| ||||| || ||||| ||||||||||||||||| || |||||||| Sbjct: 840 ttctcactgtaagtttggtcaccctcaaagtcatggattgcagttgggca 791
>gb|CP000352.1| Ralstonia metallidurans CH34, complete genome Length = 3928089 Score = 52.0 bits (26), Expect = 0.002 Identities = 41/46 (89%) Strand = Plus / Plus Query: 612 gcttctcgctgtatgtctggtcgccctcaaagtcatggatggcggt 657 ||||||| |||| ||||||||||| || ||||||||||||||||| Sbjct: 326359 gcttctccgtgtaggtctggtcgccttcgaagtcatggatggcggt 326404
>gb|AC018363.8|ATAC018363 Arabidopsis thaliana chromosome III BAC F13E7 genomic sequence, complete sequence Length = 100559 Score = 52.0 bits (26), Expect = 0.002 Identities = 44/50 (88%) Strand = Plus / Plus Query: 614 ttctcgctgtatgtctggtcgccctcaaagtcatggatggcggttgggca 663 ||||| ||||| || ||||| ||||||||||||||||| || |||||||| Sbjct: 98737 ttctcactgtaagtttggtcaccctcaaagtcatggattgcagttgggca 98786
>gb|AC021640.7|ATAC021640 Arabidopsis thaliana chromosome III BAC F16B3 genomic sequence, complete sequence Length = 103904 Score = 52.0 bits (26), Expect = 0.002 Identities = 44/50 (88%) Strand = Plus / Minus Query: 614 ttctcgctgtatgtctggtcgccctcaaagtcatggatggcggttgggca 663 ||||| ||||| || ||||| ||||||||||||||||| || |||||||| Sbjct: 103215 ttctcactgtaagtttggtcaccctcaaagtcatggattgcagttgggca 103166
>gb|BT000947.1| Arabidopsis thaliana clone C104919 unknown protein (At3g02720) mRNA, complete cds Length = 1198 Score = 52.0 bits (26), Expect = 0.002 Identities = 44/50 (88%) Strand = Plus / Minus Query: 614 ttctcgctgtatgtctggtcgccctcaaagtcatggatggcggttgggca 663 ||||| ||||| || ||||| ||||||||||||||||| || |||||||| Sbjct: 767 ttctcactgtaagtttggtcaccctcaaagtcatggattgcagttgggca 718
>gb|AF360323.1| Arabidopsis thaliana unknown protein (At3g02720) mRNA, partial cds Length = 1269 Score = 52.0 bits (26), Expect = 0.002 Identities = 44/50 (88%) Strand = Plus / Minus Query: 614 ttctcgctgtatgtctggtcgccctcaaagtcatggatggcggttgggca 663 ||||| ||||| || ||||| ||||||||||||||||| || |||||||| Sbjct: 576 ttctcactgtaagtttggtcaccctcaaagtcatggattgcagttgggca 527
>emb|BX640415.1| Bordetella pertussis strain Tohama I, complete genome; segment 5/12 Length = 347071 Score = 52.0 bits (26), Expect = 0.002 Identities = 41/46 (89%) Strand = Plus / Minus Query: 264 ccgggtgcgcgggccacgccgcgcccgtcaccaggttgccgtcggt 309 |||| |||||||||||||||| | | || ||||||||||||||||| Sbjct: 229168 ccggatgcgcgggccacgccggggcggtgaccaggttgccgtcggt 229123
>emb|BX822658.1|CNS0A5YZ Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB56ZG12 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1427 Score = 52.0 bits (26), Expect = 0.002 Identities = 44/50 (88%) Strand = Plus / Minus Query: 614 ttctcgctgtatgtctggtcgccctcaaagtcatggatggcggttgggca 663 ||||| ||||| || ||||| ||||||||||||||||| || |||||||| Sbjct: 837 ttctcactgtaagtttggtcaccctcaaagtcatggattgcagttgggca 788
>emb|BX824747.1|CNS0A5KB Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH6ZD07 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1415 Score = 52.0 bits (26), Expect = 0.002 Identities = 44/50 (88%) Strand = Plus / Minus Query: 614 ttctcgctgtatgtctggtcgccctcaaagtcatggatggcggttgggca 663 ||||| ||||| || ||||| ||||||||||||||||| || |||||||| Sbjct: 821 ttctcactgtaagtttggtcaccctcaaagtcatggattgcagttgggca 772
>emb|BX824730.1|CNS0A5RJ Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH68ZF02 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1386 Score = 52.0 bits (26), Expect = 0.002 Identities = 44/50 (88%) Strand = Plus / Minus Query: 614 ttctcgctgtatgtctggtcgccctcaaagtcatggatggcggttgggca 663 ||||| ||||| || ||||| ||||||||||||||||| || |||||||| Sbjct: 840 ttctcactgtaagtttggtcaccctcaaagtcatggattgcagttgggca 791
>emb|BX823752.1|CNS0A5AU Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS72ZB03 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1376 Score = 52.0 bits (26), Expect = 0.002 Identities = 44/50 (88%) Strand = Plus / Minus Query: 614 ttctcgctgtatgtctggtcgccctcaaagtcatggatggcggttgggca 663 ||||| ||||| || ||||| ||||||||||||||||| || |||||||| Sbjct: 834 ttctcactgtaagtttggtcaccctcaaagtcatggattgcagttgggca 785
>emb|BX823263.1|CNS0A5CL Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS18ZD04 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1365 Score = 52.0 bits (26), Expect = 0.002 Identities = 44/50 (88%) Strand = Plus / Minus Query: 614 ttctcgctgtatgtctggtcgccctcaaagtcatggatggcggttgggca 663 ||||| ||||| || ||||| ||||||||||||||||| || |||||||| Sbjct: 792 ttctcactgtaagtttggtcaccctcaaagtcatggattgcagttgggca 743
>emb|BX822838.1|CNS0A4PN Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB68ZA03 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1382 Score = 52.0 bits (26), Expect = 0.002 Identities = 44/50 (88%) Strand = Plus / Minus Query: 614 ttctcgctgtatgtctggtcgccctcaaagtcatggatggcggttgggca 663 ||||| ||||| || ||||| ||||||||||||||||| || |||||||| Sbjct: 822 ttctcactgtaagtttggtcaccctcaaagtcatggattgcagttgggca 773
>gb|AF158699.1|AF158699 Burkholderia cepacia D-serine deaminase (dsd), marR homolog, and major facilitator superfamily transporter homolog (ORFD) genes, complete cds; and unknown gene Length = 5527 Score = 52.0 bits (26), Expect = 0.002 Identities = 89/110 (80%) Strand = Plus / Minus Query: 548 agcgcgtcgtagcttgaagcgtccacgccgtcaaacgacgcgttcagagcgaaatcatga 607 ||||||||||||| || ||||| ||| |||| |||| ||| ||||| | ||| | || Sbjct: 2243 agcgcgtcgtagcgcgacgcgtcgacgtcgtcgaacgtcgcattcagcgtgaactggtgg 2184 Query: 608 ccaggcttctcgctgtatgtctggtcgccctcaaagtcatggatggcggt 657 || ||||||||| |||| |||||||||||||| || || ||||| ||||| Sbjct: 2183 ccgggcttctcggtgtaggtctggtcgccctcgaaatcgtggatcgcggt 2134
>gb|CP000076.1| Pseudomonas fluorescens Pf-5, complete genome Length = 7074893 Score = 50.1 bits (25), Expect = 0.010 Identities = 37/41 (90%) Strand = Plus / Minus Query: 611 ggcttctcgctgtatgtctggtcgccctcaaagtcatggat 651 ||||| |||||||| |||||||||||||| ||||| ||||| Sbjct: 1536710 ggcttttcgctgtaggtctggtcgccctcgaagtcgtggat 1536670 Score = 42.1 bits (21), Expect = 2.4 Identities = 54/65 (83%) Strand = Plus / Minus Query: 494 aggaccttctcgttcaaggcaaggtactcgggggcacgcccaccggggatcacaagcgcg 553 |||||||| ||||||| | ||||| || |||||||| ||||||||||||| || ||| Sbjct: 1536827 aggaccttttcgttcaggcgcaggtattccggggcacggccaccggggatcagcagggcg 1536768 Query: 554 tcgta 558 ||||| Sbjct: 1536767 tcgta 1536763
>gb|CP000285.1| Chromohalobacter salexigens DSM 3043, complete genome Length = 3696649 Score = 48.1 bits (24), Expect = 0.038 Identities = 39/44 (88%) Strand = Plus / Minus Query: 605 tgaccaggcttctcgctgtatgtctggtcgccctcaaagtcatg 648 ||||||||||||||| |||||||| |||||||| |||||||| Sbjct: 1043891 tgaccaggcttctcggaatatgtctgatcgccctcgaagtcatg 1043848
>emb|CT573326.1| Pseudomonas entomophila str. L48 chromosome,complete sequence Length = 5888780 Score = 46.1 bits (23), Expect = 0.15 Identities = 41/47 (87%) Strand = Plus / Minus Query: 611 ggcttctcgctgtatgtctggtcgccctcaaagtcatggatggcggt 657 |||||||||||||| ||||| ||||| ||||| || ||||| ||||| Sbjct: 1193832 ggcttctcgctgtaggtctgttcgccttcaaaatcgtggatcgcggt 1193786 Score = 40.1 bits (20), Expect = 9.3 Identities = 41/48 (85%) Strand = Plus / Minus Query: 515 aggtactcgggggcacgcccaccggggatcacaagcgcgtcgtagctt 562 ||||| ||||| || || ||||| ||||||| ||||||||||||||| Sbjct: 1193928 aggtattcgggcgcccggccacctgggatcaacagcgcgtcgtagctt 1193881
>gb|CP000086.1| Burkholderia thailandensis E264 chromosome I, complete sequence Length = 3809201 Score = 46.1 bits (23), Expect = 0.15 Identities = 95/119 (79%) Strand = Plus / Plus Query: 518 tactcgggggcacgcccaccggggatcacaagcgcgtcgtagcttgaagcgtccacgccg 577 |||||||| ||||| || || | |||| | ||||||||||||| || ||||| ||| || Sbjct: 617990 tactcgggcgcacggccgcccgcgatcgcgagcgcgtcgtagcctgtcgcgtcgacgtcg 618049 Query: 578 tcaaacgacgcgttcagagcgaaatcatgaccaggcttctcgctgtatgtctggtcgcc 636 || |||| ||||||||| | ||| | || || ||||| ||| |||| ||||||||||| Sbjct: 618050 tcgaacgtcgcgttcagcgtgaactggtggccgggcttttcggtgtaggtctggtcgcc 618108
>ref|XM_368328.1| Magnaporthe grisea 70-15 chromosome VI predicted protein (MG00916.4) partial mRNA Length = 378 Score = 44.1 bits (22), Expect = 0.60 Identities = 22/22 (100%) Strand = Plus / Minus Query: 234 cgagcagggccatgagctgggc 255 |||||||||||||||||||||| Sbjct: 40 cgagcagggccatgagctgggc 19
>emb|BX640441.1| Bordetella bronchiseptica strain RB50, complete genome; segment 5/16 Length = 348624 Score = 44.1 bits (22), Expect = 0.60 Identities = 40/46 (86%) Strand = Plus / Minus Query: 264 ccgggtgcgcgggccacgccgcgcccgtcaccaggttgccgtcggt 309 |||| ||||||||||| |||| | | || ||||||||||||||||| Sbjct: 133200 ccggatgcgcgggccatgccggggcggtgaccaggttgccgtcggt 133155
>emb|BX640426.1| Bordetella parapertussis strain 12822, complete genome; segment 4/14 Length = 348866 Score = 44.1 bits (22), Expect = 0.60 Identities = 40/46 (86%) Strand = Plus / Minus Query: 264 ccgggtgcgcgggccacgccgcgcccgtcaccaggttgccgtcggt 309 |||| ||||||||||| |||| | | || ||||||||||||||||| Sbjct: 245570 ccggatgcgcgggccatgccggggcggtgaccaggttgccgtcggt 245525
>gb|AE014291.4| Brucella suis 1330 chromosome I, complete sequence Length = 2107794 Score = 42.1 bits (21), Expect = 2.4 Identities = 42/49 (85%) Strand = Plus / Minus Query: 611 ggcttctcgctgtatgtctggtcgccctcaaagtcatggatggcggttg 659 ||||||||| | || ||||| | |||||||||||| || |||||||||| Sbjct: 1173057 ggcttctcggtataggtctgatggccctcaaagtcgtgaatggcggttg 1173009
>gb|AE009373.1| Agrobacterium tumefaciens str. C58 linear chromosome, section 143 of 187 of the complete sequence Length = 13358 Score = 42.1 bits (21), Expect = 2.4 Identities = 27/29 (93%) Strand = Plus / Minus Query: 626 gtctggtcgccctcaaagtcatggatggc 654 |||||||||||||| || ||||||||||| Sbjct: 3613 gtctggtcgccctcgaaatcatggatggc 3585
>gb|AE009024.1| Agrobacterium tumefaciens str. C58 circular chromosome, section 50 of 256 of the complete sequence Length = 10029 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 288 ccgtcaccaggttgccgtcgg 308 ||||||||||||||||||||| Sbjct: 4752 ccgtcaccaggttgccgtcgg 4772
>gb|AE008241.1| Agrobacterium tumefaciens str. C58 linear chromosome, section 45 of 187 of the complete sequence Length = 10465 Score = 42.1 bits (21), Expect = 2.4 Identities = 27/29 (93%) Strand = Plus / Plus Query: 626 gtctggtcgccctcaaagtcatggatggc 654 |||||||||||||| || ||||||||||| Sbjct: 6853 gtctggtcgccctcgaaatcatggatggc 6881
>gb|AC165279.3| Mus musculus chromosome 15, clone RP23-259J10, complete sequence Length = 176055 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 647 tggatggcggttgggcacttg 667 ||||||||||||||||||||| Sbjct: 61567 tggatggcggttgggcacttg 61547
>gb|AC129541.15| Mus musculus chromosome 15, clone RP23-248M12, complete sequence Length = 197803 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 647 tggatggcggttgggcacttg 667 ||||||||||||||||||||| Sbjct: 2567 tggatggcggttgggcacttg 2547
>gb|CP000090.1| Ralstonia eutropha JMP134 chromosome 1, complete sequence Length = 3806533 Score = 42.1 bits (21), Expect = 2.4 Identities = 51/61 (83%) Strand = Plus / Plus Query: 612 gcttctcgctgtatgtctggtcgccctcaaagtcatggatggcggttgggcacttgtcgc 671 |||| ||| |||| ||||||||||| || ||||| |||||||| || | ||| ||||||| Sbjct: 392364 gcttttcggtgtaggtctggtcgccttcgaagtcgtggatggccgtggcgcagttgtcgc 392423 Query: 672 c 672 | Sbjct: 392424 c 392424
>gb|AE007869.1| Agrobacterium tumefaciens str. C58, complete genome Length = 2841581 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 288 ccgtcaccaggttgccgtcgg 308 ||||||||||||||||||||| Sbjct: 540114 ccgtcaccaggttgccgtcgg 540134
>gb|CP000230.1| Rhodospirillum rubrum ATCC 11170, complete genome Length = 4352825 Score = 42.1 bits (21), Expect = 2.4 Identities = 27/29 (93%) Strand = Plus / Minus Query: 626 gtctggtcgccctcaaagtcatggatggc 654 ||||||||||||||||| || |||||||| Sbjct: 1077764 gtctggtcgccctcaaaatcgtggatggc 1077736
>gb|AE009520.1| Brucella melitensis 16M chromosome I, section 77 of 195 of the complete sequence Length = 10543 Score = 42.1 bits (21), Expect = 2.4 Identities = 42/49 (85%) Strand = Plus / Plus Query: 611 ggcttctcgctgtatgtctggtcgccctcaaagtcatggatggcggttg 659 ||||||||| | || ||||| | |||||||||||| || |||||||||| Sbjct: 8414 ggcttctcggtataggtctgatggccctcaaagtcgtgaatggcggttg 8462
>dbj|BA000030.2| Streptomyces avermitilis MA-4680 genomic DNA, complete genome Length = 9025608 Score = 42.1 bits (21), Expect = 2.4 Identities = 36/41 (87%) Strand = Plus / Plus Query: 437 ccgtggcagatcgacgcgaccggctttccgttgtccatgaa 477 |||||||||||||| |||||||| || ||| || ||||||| Sbjct: 8623003 ccgtggcagatcgatgcgaccggtttcccgctggccatgaa 8623043
>gb|AE017223.1| Brucella abortus biovar 1 str. 9-941 chromosome I, complete sequence Length = 2124241 Score = 42.1 bits (21), Expect = 2.4 Identities = 42/49 (85%) Strand = Plus / Minus Query: 611 ggcttctcgctgtatgtctggtcgccctcaaagtcatggatggcggttg 659 ||||||||| | || ||||| | |||||||||||| || |||||||||| Sbjct: 1191165 ggcttctcggtataggtctgatggccctcaaagtcgtgaatggcggttg 1191117
>gb|U95165.1|ATU95165 Agrobacterium tumefaciens FlaD (flaD), FlhB (flhB), FliG (fliG), FliN (fliN), FliM (fliM), MotA (motA), FlgF (flgF), FliI (fliI), FlgB (flgB), FlgC (flgC), FliE (fliE), FlgG (flgG), FlgA (flgA), FlgI (flgI), FlgH (flgH), FliL (fliL), FliP (fliP), FlaA (flaA), FlaB (flaB) and FlaC (flaC) genes, complete cds Length = 21846 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 288 ccgtcaccaggttgccgtcgg 308 ||||||||||||||||||||| Sbjct: 12891 ccgtcaccaggttgccgtcgg 12871
>gb|U39941.1|ATU39941 Agrobacterium tumefaciens flagellar gene region, flagellar basal body components (flgB, flgC, fliE, flgG), P-ring subunit (flgI), L-ring subunit (flgH), and FliP (fliP) genes, complete cds Length = 7205 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 288 ccgtcaccaggttgccgtcgg 308 ||||||||||||||||||||| Sbjct: 2299 ccgtcaccaggttgccgtcgg 2279
>emb|AM040264.1| Brucella melitensis biovar Abortus chromosome I, complete sequence, strain 2308 Length = 2121359 Score = 42.1 bits (21), Expect = 2.4 Identities = 42/49 (85%) Strand = Plus / Minus Query: 611 ggcttctcgctgtatgtctggtcgccctcaaagtcatggatggcggttg 659 ||||||||| | || ||||| | |||||||||||| || |||||||||| Sbjct: 1188316 ggcttctcggtataggtctgatggccctcaaagtcgtgaatggcggttg 1188268
>ref|NM_188637.1| Oryza sativa (japonica cultivar-group), Ozsa8240 predicted mRNA Length = 1671 Score = 40.1 bits (20), Expect = 9.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 271 cgcgggccacgccgcgcccg 290 |||||||||||||||||||| Sbjct: 186 cgcgggccacgccgcgcccg 167
>gb|AC162528.5| Mus musculus BAC clone RP23-4P1 from chromosome 5, complete sequence Length = 219218 Score = 40.1 bits (20), Expect = 9.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 238 cagggccatgagctgggcca 257 |||||||||||||||||||| Sbjct: 123528 cagggccatgagctgggcca 123509
>gb|AC151577.2| Mus musculus BAC clone RP23-371D23 from chromosome 5, complete sequence Length = 206735 Score = 40.1 bits (20), Expect = 9.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 238 cagggccatgagctgggcca 257 |||||||||||||||||||| Sbjct: 149931 cagggccatgagctgggcca 149950
>gb|CP000125.1| Burkholderia pseudomallei 1710b chromosome II, complete sequence Length = 3181762 Score = 40.1 bits (20), Expect = 9.3 Identities = 23/24 (95%) Strand = Plus / Minus Query: 279 acgccgcgcccgtcaccaggttgc 302 |||||||||||||||| ||||||| Sbjct: 2199666 acgccgcgcccgtcacgaggttgc 2199643
>emb|BX571966.1| Burkholderia pseudomallei strain K96243, chromosome 2, complete sequence Length = 3173005 Score = 40.1 bits (20), Expect = 9.3 Identities = 23/24 (95%) Strand = Plus / Minus Query: 279 acgccgcgcccgtcaccaggttgc 302 |||||||||||||||| ||||||| Sbjct: 361289 acgccgcgcccgtcacgaggttgc 361266
>gb|CP000301.1| Rhodopseudomonas palustris BisB18, complete genome Length = 5513844 Score = 40.1 bits (20), Expect = 9.3 Identities = 23/24 (95%) Strand = Plus / Plus Query: 234 cgagcagggccatgagctgggcca 257 ||||||||||| |||||||||||| Sbjct: 206260 cgagcagggccttgagctgggcca 206283
>dbj|AB244625.1| Hexagrammos octogrammus genes for 18S rRNA, ITS1, 5.8S rRNA, ITS2, 28S rRNA Length = 1217 Score = 40.1 bits (20), Expect = 9.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 266 gggtgcgcgggccacgccgc 285 |||||||||||||||||||| Sbjct: 1125 gggtgcgcgggccacgccgc 1144
>gb|AC026443.4| Homo sapiens chromosome 5 clone CTD-2296H22, complete sequence Length = 118562 Score = 40.1 bits (20), Expect = 9.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 157 gttgcatctgtgttgtatat 176 |||||||||||||||||||| Sbjct: 42582 gttgcatctgtgttgtatat 42563
>gb|AY129331.1| Mycobacteriophage CJW1, complete genome Length = 75931 Score = 40.1 bits (20), Expect = 9.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 246 tgagctgggccacgaactcc 265 |||||||||||||||||||| Sbjct: 28815 tgagctgggccacgaactcc 28796
>dbj|AK019523.1| Mus musculus 0 day neonate head cDNA, RIKEN full-length enriched library, clone:4833439F03 product:unclassifiable, full insert sequence Length = 2472 Score = 40.1 bits (20), Expect = 9.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 238 cagggccatgagctgggcca 257 |||||||||||||||||||| Sbjct: 1144 cagggccatgagctgggcca 1125
>gb|CP000011.2| Burkholderia mallei ATCC 23344 chromosome 2, complete sequence Length = 2325379 Score = 40.1 bits (20), Expect = 9.3 Identities = 23/24 (95%) Strand = Plus / Plus Query: 279 acgccgcgcccgtcaccaggttgc 302 |||||||||||||||| ||||||| Sbjct: 1626998 acgccgcgcccgtcacgaggttgc 1627021
>gb|AF377927.1|AF377927 Sclerotinia sclerotiorum clone 113-4 microsatellite sequence Length = 394 Score = 40.1 bits (20), Expect = 9.3 Identities = 23/24 (95%) Strand = Plus / Minus Query: 165 tgtgttgtatatcatgtgatgaaa 188 ||||||||||||||||||| |||| Sbjct: 238 tgtgttgtatatcatgtgaagaaa 215
>emb|BX465227.3| Zebrafish DNA sequence from clone RP71-40K24 in linkage group 17, complete sequence Length = 161395 Score = 40.1 bits (20), Expect = 9.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 154 tatgttgcatctgtgttgta 173 |||||||||||||||||||| Sbjct: 93637 tatgttgcatctgtgttgta 93656
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete sequence Length = 43261740 Score = 40.1 bits (20), Expect = 9.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 271 cgcgggccacgccgcgcccg 290 |||||||||||||||||||| Sbjct: 7356392 cgcgggccacgccgcgcccg 7356411
>dbj|AP002481.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, clone:P0702F03 Length = 141111 Score = 40.1 bits (20), Expect = 9.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 271 cgcgggccacgccgcgcccg 290 |||||||||||||||||||| Sbjct: 17420 cgcgggccacgccgcgcccg 17439
>emb|AL646052.1| Ralstonia solanacearum GMI1000 chromosome complete sequence Length = 3716413 Score = 40.1 bits (20), Expect = 9.3 Identities = 26/28 (92%) Strand = Plus / Minus Query: 336 ccagccacgtccccccgcccagcaccac 363 ||||||||||| || ||||||||||||| Sbjct: 1928249 ccagccacgtcaccgcgcccagcaccac 1928222 Score = 40.1 bits (20), Expect = 9.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 290 gtcaccaggttgccgtcggt 309 |||||||||||||||||||| Sbjct: 443688 gtcaccaggttgccgtcggt 443707
>gb|AE015451.1| Pseudomonas putida KT2440 complete genome Length = 6181863 Score = 40.1 bits (20), Expect = 9.3 Identities = 35/40 (87%) Strand = Plus / Minus Query: 264 ccgggtgcgcgggccacgccgcgcccgtcaccaggttgcc 303 |||||||||||||||| |||| | |||||||||||||| Sbjct: 1035702 ccgggtgcgcgggccatgccggtgcggtcaccaggttgcc 1035663 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 4,743,828 Number of Sequences: 3902068 Number of extensions: 4743828 Number of successful extensions: 86046 Number of sequences better than 10.0: 69 Number of HSP's better than 10.0 without gapping: 68 Number of HSP's successfully gapped in prelim test: 1 Number of HSP's that attempted gapping in prelim test: 84050 Number of HSP's gapped (non-prelim): 2004 length of query: 681 length of database: 17,233,045,268 effective HSP length: 23 effective length of query: 658 effective length of database: 17,143,297,704 effective search space: 11280289889232 effective search space used: 11280289889232 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)