| Clone Name | rbags15i11 |
|---|---|
| Clone Library Name | barley_pub |
>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12, complete sequence Length = 27566993 Score = 188 bits (95), Expect = 2e-44 Identities = 215/253 (84%), Gaps = 9/253 (3%) Strand = Plus / Minus Query: 222 tcatcggcacttgggttctgctggaagtctgagggtttgtt---ggagccaactggctgg 278 ||||||| || |||||||||||||||||||| | |||||| ||| |||||||||||| Sbjct: 23305816 tcatcggtacctgggttctgctggaagtctgctgttttgttataggatccaactggctgg 23305757 Query: 279 tattcaagatgagtgctacccctccgcctttctgcatttgcgccatggcttggctgccca 338 ||||| |||||||||| |||||||||||||||||| |||| | ||||||| |||| |||| Sbjct: 23305756 tattcgagatgagtgccacccctccgcctttctgcgtttgtgacatggctgggcttccca 23305697 Query: 339 gcatcataaccccttcccctgtgtgtgccgcttcccctgtgatacctc---ccgttgtgc 395 ||||||||||||||||||||| |||||| | ||| ||||| |||||| || ||||| Sbjct: 23305696 acatcataaccccttcccctgtttgtgccacctcctctgtggtacctcccaccattgtgg 23305637 Query: 396 tgtccctggcgacgggttgcatgattaa---gctgctgctgttctgcattttcatgactc 452 || ||||| || || | |||||| ||| ||||||||||||||||||||||||| ||| Sbjct: 23305636 tggccctgtcggcgtggcgcatgactaagctgctgctgctgttctgcattttcatggctc 23305577 Query: 453 tcgctcttctggt 465 ||||||||||||| Sbjct: 23305576 tcgctcttctggt 23305564
>dbj|AK059568.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-029-H11, full insert sequence Length = 1402 Score = 188 bits (95), Expect = 2e-44 Identities = 215/253 (84%), Gaps = 9/253 (3%) Strand = Plus / Minus Query: 222 tcatcggcacttgggttctgctggaagtctgagggtttgtt---ggagccaactggctgg 278 ||||||| || |||||||||||||||||||| | |||||| ||| |||||||||||| Sbjct: 660 tcatcggtacctgggttctgctggaagtctgctgttttgttataggatccaactggctgg 601 Query: 279 tattcaagatgagtgctacccctccgcctttctgcatttgcgccatggcttggctgccca 338 ||||| |||||||||| |||||||||||||||||| |||| | ||||||| |||| |||| Sbjct: 600 tattcgagatgagtgccacccctccgcctttctgcgtttgtgacatggctgggcttccca 541 Query: 339 gcatcataaccccttcccctgtgtgtgccgcttcccctgtgatacctc---ccgttgtgc 395 ||||||||||||||||||||| |||||| | ||| ||||| |||||| || ||||| Sbjct: 540 acatcataaccccttcccctgtttgtgccacctcctctgtggtacctcccaccattgtgg 481 Query: 396 tgtccctggcgacgggttgcatgattaa---gctgctgctgttctgcattttcatgactc 452 || ||||| || || | |||||| ||| ||||||||||||||||||||||||| ||| Sbjct: 480 tggccctgtcggcgtggcgcatgactaagctgctgctgctgttctgcattttcatggctc 421 Query: 453 tcgctcttctggt 465 ||||||||||||| Sbjct: 420 tcgctcttctggt 408
>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence Length = 27492551 Score = 188 bits (95), Expect = 2e-44 Identities = 215/253 (84%), Gaps = 9/253 (3%) Strand = Plus / Minus Query: 222 tcatcggcacttgggttctgctggaagtctgagggtttgtt---ggagccaactggctgg 278 ||||||| || |||||||||||||||||||| | |||||| ||| |||||||||||| Sbjct: 23234007 tcatcggtacctgggttctgctggaagtctgctgttttgttataggatccaactggctgg 23233948 Query: 279 tattcaagatgagtgctacccctccgcctttctgcatttgcgccatggcttggctgccca 338 ||||| |||||||||| |||||||||||||||||| |||| | ||||||| |||| |||| Sbjct: 23233947 tattcgagatgagtgccacccctccgcctttctgcgtttgtgacatggctgggcttccca 23233888 Query: 339 gcatcataaccccttcccctgtgtgtgccgcttcccctgtgatacctc---ccgttgtgc 395 ||||||||||||||||||||| |||||| | ||| ||||| |||||| || ||||| Sbjct: 23233887 acatcataaccccttcccctgtttgtgccacctcctctgtggtacctcccaccattgtgg 23233828 Query: 396 tgtccctggcgacgggttgcatgattaa---gctgctgctgttctgcattttcatgactc 452 || ||||| || || | |||||| ||| ||||||||||||||||||||||||| ||| Sbjct: 23233827 tggccctgtcggcgtggcgcatgactaagctgctgctgctgttctgcattttcatggctc 23233768 Query: 453 tcgctcttctggt 465 ||||||||||||| Sbjct: 23233767 tcgctcttctggt 23233755
>emb|AL713908.3|CNS07YQ8 Oryza sativa chromosome 12, . BAC OSJNBa0011B18 of library OSJNBa from chromosome 12 of cultivar Nipponbare of ssp. japonica of Oryza sativa (rice), complete sequence Length = 168063 Score = 188 bits (95), Expect = 2e-44 Identities = 215/253 (84%), Gaps = 9/253 (3%) Strand = Plus / Minus Query: 222 tcatcggcacttgggttctgctggaagtctgagggtttgtt---ggagccaactggctgg 278 ||||||| || |||||||||||||||||||| | |||||| ||| |||||||||||| Sbjct: 118934 tcatcggtacctgggttctgctggaagtctgctgttttgttataggatccaactggctgg 118875 Query: 279 tattcaagatgagtgctacccctccgcctttctgcatttgcgccatggcttggctgccca 338 ||||| |||||||||| |||||||||||||||||| |||| | ||||||| |||| |||| Sbjct: 118874 tattcgagatgagtgccacccctccgcctttctgcgtttgtgacatggctgggcttccca 118815 Query: 339 gcatcataaccccttcccctgtgtgtgccgcttcccctgtgatacctc---ccgttgtgc 395 ||||||||||||||||||||| |||||| | ||| ||||| |||||| || ||||| Sbjct: 118814 acatcataaccccttcccctgtttgtgccacctcctctgtggtacctcccaccattgtgg 118755 Query: 396 tgtccctggcgacgggttgcatgattaa---gctgctgctgttctgcattttcatgactc 452 || ||||| || || | |||||| ||| ||||||||||||||||||||||||| ||| Sbjct: 118754 tggccctgtcggcgtggcgcatgactaagctgctgctgctgttctgcattttcatggctc 118695 Query: 453 tcgctcttctggt 465 ||||||||||||| Sbjct: 118694 tcgctcttctggt 118682
>gb|AY108034.1| Zea mays PCO098665 mRNA sequence Length = 733 Score = 58.0 bits (29), Expect = 4e-05 Identities = 97/119 (81%), Gaps = 3/119 (2%) Strand = Plus / Minus Query: 270 actggctggtattcaagatgagtgctacccctccgcctttctgcatttgcgccatggctt 329 |||||||||||||||||||| ||| |||| ||||||| || |||||| | ||||| || Sbjct: 274 actggctggtattcaagatggctgccacccttccgcctctccacatttgtgacatggttt 215 Query: 330 ggctgcccagcatcataa---ccccttcccctgtgtgtgccgcttcccctgtgatacct 385 ||| ||||| |||||| |||||||||||||||| || | ||||||||| ||||| Sbjct: 214 ggcctcccagtgtcataacccccccttcccctgtgtgacccacctcccctgtggtacct 156
>gb|AC011697.9| Drosophila melanogaster clone BACR12J05, complete sequence Length = 203498 Score = 48.1 bits (24), Expect = 0.037 Identities = 24/24 (100%) Strand = Plus / Minus Query: 111 ggagctggagctggggctggggca 134 |||||||||||||||||||||||| Sbjct: 65213 ggagctggagctggggctggggca 65190
>ref|XM_522082.1| PREDICTED: Pan troglodytes similar to calcium binding protein 2 isoform 2 (LOC466683), mRNA Length = 1782 Score = 48.1 bits (24), Expect = 0.037 Identities = 24/24 (100%) Strand = Plus / Minus Query: 114 gctggagctggggctggggcagga 137 |||||||||||||||||||||||| Sbjct: 672 gctggagctggggctggggcagga 649
>gb|BT016021.1| Drosophila melanogaster RE15373 full insert cDNA Length = 2252 Score = 48.1 bits (24), Expect = 0.037 Identities = 24/24 (100%) Strand = Plus / Minus Query: 111 ggagctggagctggggctggggca 134 |||||||||||||||||||||||| Sbjct: 385 ggagctggagctggggctggggca 362
>ref|NM_016366.1| Homo sapiens calcium binding protein 2 (CABP2), transcript variant 1, mRNA Length = 986 Score = 48.1 bits (24), Expect = 0.037 Identities = 24/24 (100%) Strand = Plus / Minus Query: 114 gctggagctggggctggggcagga 137 |||||||||||||||||||||||| Sbjct: 172 gctggagctggggctggggcagga 149
>emb|AL021392.5|HS439F8 Human DNA sequence from clone RP3-439F8 on chromosome 22q13.31-33, complete sequence Length = 120206 Score = 48.1 bits (24), Expect = 0.037 Identities = 27/28 (96%) Strand = Plus / Minus Query: 352 ttcccctgtgtgtgccgcttcccctgtg 379 ||||||||||||||| |||||||||||| Sbjct: 33159 ttcccctgtgtgtgcggcttcccctgtg 33132 Score = 48.1 bits (24), Expect = 0.037 Identities = 27/28 (96%) Strand = Plus / Minus Query: 352 ttcccctgtgtgtgccgcttcccctgtg 379 ||||||||||||||| |||||||||||| Sbjct: 32903 ttcccctgtgtgtgcggcttcccctgtg 32876 Score = 48.1 bits (24), Expect = 0.037 Identities = 27/28 (96%) Strand = Plus / Minus Query: 352 ttcccctgtgtgtgccgcttcccctgtg 379 ||||||||||||||| |||||||||||| Sbjct: 31678 ttcccctgtgtgtgcggcttcccctgtg 31651 Score = 48.1 bits (24), Expect = 0.037 Identities = 27/28 (96%) Strand = Plus / Minus Query: 352 ttcccctgtgtgtgccgcttcccctgtg 379 ||||||||||||||| |||||||||||| Sbjct: 30860 ttcccctgtgtgtgcagcttcccctgtg 30833 Score = 42.1 bits (21), Expect = 2.3 Identities = 27/29 (93%) Strand = Plus / Minus Query: 351 cttcccctgtgtgtgccgcttcccctgtg 379 |||||||||||||||| | |||||||||| Sbjct: 33142 cttcccctgtgtgtgcaggttcccctgtg 33114 Score = 42.1 bits (21), Expect = 2.3 Identities = 27/29 (93%) Strand = Plus / Minus Query: 351 cttcccctgtgtgtgccgcttcccctgtg 379 |||||||||||||||| | |||||||||| Sbjct: 32886 cttcccctgtgtgtgcaggttcccctgtg 32858 Score = 40.1 bits (20), Expect = 9.0 Identities = 26/28 (92%) Strand = Plus / Minus Query: 352 ttcccctgtgtgtgccgcttcccctgtg 379 ||||||||||||||| | |||||||||| Sbjct: 32731 ttcccctgtgtgtgcaggttcccctgtg 32704 Score = 40.1 bits (20), Expect = 9.0 Identities = 26/28 (92%) Strand = Plus / Minus Query: 352 ttcccctgtgtgtgccgcttcccctgtg 379 |||||||||||||| |||||||||||| Sbjct: 31950 ttcccctgtgtgtgtggcttcccctgtg 31923 Score = 40.1 bits (20), Expect = 9.0 Identities = 26/28 (92%) Strand = Plus / Minus Query: 352 ttcccctgtgtgtgccgcttcccctgtg 379 |||||||||||||| |||||||||||| Sbjct: 31488 ttcccctgtgtgtgtggcttcccctgtg 31461
>gb|AY118701.1| Drosophila melanogaster AT20617 full insert cDNA Length = 1645 Score = 48.1 bits (24), Expect = 0.037 Identities = 24/24 (100%) Strand = Plus / Plus Query: 111 ggagctggagctggggctggggca 134 |||||||||||||||||||||||| Sbjct: 1265 ggagctggagctggggctggggca 1288
>ref|NM_132713.1| Drosophila melanogaster CG11584-RB (CG11584), mRNA Length = 2201 Score = 48.1 bits (24), Expect = 0.037 Identities = 24/24 (100%) Strand = Plus / Minus Query: 111 ggagctggagctggggctggggca 134 |||||||||||||||||||||||| Sbjct: 343 ggagctggagctggggctggggca 320
>gb|AC021639.5| Drosophila melanogaster, chromosome X, region 12E-12E, BAC clone BACR02C24, complete sequence Length = 234783 Score = 48.1 bits (24), Expect = 0.037 Identities = 24/24 (100%) Strand = Plus / Plus Query: 111 ggagctggagctggggctggggca 134 |||||||||||||||||||||||| Sbjct: 15168 ggagctggagctggggctggggca 15191
>gb|BC018476.1|BC018476 Homo sapiens, calcium binding protein 2, clone IMAGE:3871426, mRNA Length = 975 Score = 48.1 bits (24), Expect = 0.037 Identities = 24/24 (100%) Strand = Plus / Minus Query: 114 gctggagctggggctggggcagga 137 |||||||||||||||||||||||| Sbjct: 204 gctggagctggggctggggcagga 181
>gb|AF170811.1|AF170811 Homo sapiens CaBP2 (CABP2) gene, complete cds Length = 4777 Score = 48.1 bits (24), Expect = 0.037 Identities = 24/24 (100%) Strand = Plus / Minus Query: 114 gctggagctggggctggggcagga 137 |||||||||||||||||||||||| Sbjct: 1252 gctggagctggggctggggcagga 1229
>gb|AF169154.1|AF169154 Homo sapiens CaBP2 (CABP2) mRNA, complete cds Length = 986 Score = 48.1 bits (24), Expect = 0.037 Identities = 24/24 (100%) Strand = Plus / Minus Query: 114 gctggagctggggctggggcagga 137 |||||||||||||||||||||||| Sbjct: 172 gctggagctggggctggggcagga 149
>gb|AE003495.4| Drosophila melanogaster chromosome X, section 47 of 74 of the complete sequence Length = 314743 Score = 48.1 bits (24), Expect = 0.037 Identities = 24/24 (100%) Strand = Plus / Minus Query: 111 ggagctggagctggggctggggca 134 |||||||||||||||||||||||| Sbjct: 8098 ggagctggagctggggctggggca 8075
>dbj|AP001184.4| Homo sapiens genomic DNA, chromosome 11q clone:RP11-715F10, complete sequences Length = 120186 Score = 48.1 bits (24), Expect = 0.037 Identities = 24/24 (100%) Strand = Plus / Plus Query: 114 gctggagctggggctggggcagga 137 |||||||||||||||||||||||| Sbjct: 39236 gctggagctggggctggggcagga 39259
>gb|AC138359.8| Mus musculus chromosome 1, clone RP24-383H12, complete sequence Length = 217891 Score = 46.1 bits (23), Expect = 0.15 Identities = 23/23 (100%) Strand = Plus / Minus Query: 111 ggagctggagctggggctggggc 133 ||||||||||||||||||||||| Sbjct: 51631 ggagctggagctggggctggggc 51609
>gb|AC069546.6| Homo sapiens chromosome 10 clone RP11-507K13, complete sequence Length = 198402 Score = 46.1 bits (23), Expect = 0.15 Identities = 23/23 (100%) Strand = Plus / Plus Query: 111 ggagctggagctggggctggggc 133 ||||||||||||||||||||||| Sbjct: 154569 ggagctggagctggggctggggc 154591 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 111 ggagctggagctggggctgg 130 |||||||||||||||||||| Sbjct: 154551 ggagctggagctggggctgg 154570 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 111 ggagctggagctggggctgg 130 |||||||||||||||||||| Sbjct: 154533 ggagctggagctggggctgg 154552
>emb|AL591065.17| Mouse DNA sequence from clone RP23-199H17 on chromosome 11 Contains the Myo18a gene for myosin XVIIIa, the Pipox gene for pipecolic acid oxidase, a novel gene (LOC327969), the 5' end of the Sez6 gene for seizure related gene 6 and two CpG islands, complete sequence Length = 220176 Score = 46.1 bits (23), Expect = 0.15 Identities = 23/23 (100%) Strand = Plus / Minus Query: 111 ggagctggagctggggctggggc 133 ||||||||||||||||||||||| Sbjct: 108704 ggagctggagctggggctggggc 108682
>emb|AL512647.14| Mouse DNA sequence from clone RP23-47A2 on chromosome 13 Contains part of a novel gene (6620401C13Rik), complete sequence Length = 199848 Score = 46.1 bits (23), Expect = 0.15 Identities = 23/23 (100%) Strand = Plus / Plus Query: 111 ggagctggagctggggctggggc 133 ||||||||||||||||||||||| Sbjct: 137781 ggagctggagctggggctggggc 137803
>gb|AC116903.3| Homo sapiens chromosome 15, clone RP11-152L20, complete sequence Length = 159893 Score = 46.1 bits (23), Expect = 0.15 Identities = 23/23 (100%) Strand = Plus / Minus Query: 111 ggagctggagctggggctggggc 133 ||||||||||||||||||||||| Sbjct: 147106 ggagctggagctggggctggggc 147084
>gb|AC011448.5| Homo sapiens chromosome 19 clone CTC-260F20, complete sequence Length = 165122 Score = 46.1 bits (23), Expect = 0.15 Identities = 23/23 (100%) Strand = Plus / Minus Query: 110 aggagctggagctggggctgggg 132 ||||||||||||||||||||||| Sbjct: 69693 aggagctggagctggggctgggg 69671
>gb|AC073366.4| Homo sapiens chromosome 10 clone RP11-140C5, complete sequence Length = 176046 Score = 46.1 bits (23), Expect = 0.15 Identities = 23/23 (100%) Strand = Plus / Plus Query: 111 ggagctggagctggggctggggc 133 ||||||||||||||||||||||| Sbjct: 37143 ggagctggagctggggctggggc 37165 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 111 ggagctggagctggggctgg 130 |||||||||||||||||||| Sbjct: 37125 ggagctggagctggggctgg 37144 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 111 ggagctggagctggggctgg 130 |||||||||||||||||||| Sbjct: 37107 ggagctggagctggggctgg 37126
>dbj|AK024670.1| Homo sapiens cDNA: FLJ21017 fis, clone CAE05907 Length = 1827 Score = 46.1 bits (23), Expect = 0.15 Identities = 23/23 (100%) Strand = Plus / Minus Query: 110 aggagctggagctggggctgggg 132 ||||||||||||||||||||||| Sbjct: 483 aggagctggagctggggctgggg 461
>gb|AC005319.1|AC005319 Human Chromosome 15q26.1 PAC clone pDJ430i19, complete sequence Length = 118741 Score = 46.1 bits (23), Expect = 0.15 Identities = 23/23 (100%) Strand = Plus / Minus Query: 111 ggagctggagctggggctggggc 133 ||||||||||||||||||||||| Sbjct: 66314 ggagctggagctggggctggggc 66292
>emb|AL713861.10| Mouse DNA sequence from clone RP23-367H15 on chromosome X, complete sequence Length = 169838 Score = 46.1 bits (23), Expect = 0.15 Identities = 23/23 (100%) Strand = Plus / Plus Query: 111 ggagctggagctggggctggggc 133 ||||||||||||||||||||||| Sbjct: 27049 ggagctggagctggggctggggc 27071
>emb|AL928737.8| Mouse DNA sequence from clone RP23-382O14 on chromosome 2, complete sequence Length = 237175 Score = 46.1 bits (23), Expect = 0.15 Identities = 23/23 (100%) Strand = Plus / Plus Query: 111 ggagctggagctggggctggggc 133 ||||||||||||||||||||||| Sbjct: 116537 ggagctggagctggggctggggc 116559
>ref|XM_511843.1| PREDICTED: Pan troglodytes similar to ubiquitin specific protease 43 (LOC455080), mRNA Length = 2835 Score = 44.1 bits (22), Expect = 0.58 Identities = 22/22 (100%) Strand = Plus / Minus Query: 111 ggagctggagctggggctgggg 132 |||||||||||||||||||||| Sbjct: 268 ggagctggagctggggctgggg 247
>ref|XM_514113.1| PREDICTED: Pan troglodytes similar to ubiquitin specific proteinase 43 (LOC457642), mRNA Length = 1363 Score = 44.1 bits (22), Expect = 0.58 Identities = 22/22 (100%) Strand = Plus / Minus Query: 111 ggagctggagctggggctgggg 132 |||||||||||||||||||||| Sbjct: 217 ggagctggagctggggctgggg 196
>gb|AC118755.7| Homo sapiens chromosome 17, clone RP11-55L4, complete sequence Length = 188765 Score = 44.1 bits (22), Expect = 0.58 Identities = 22/22 (100%) Strand = Plus / Plus Query: 111 ggagctggagctggggctgggg 132 |||||||||||||||||||||| Sbjct: 2191 ggagctggagctggggctgggg 2212
>gb|AC102604.13| Mus musculus chromosome 19, clone RP23-385L22, complete sequence Length = 212387 Score = 44.1 bits (22), Expect = 0.58 Identities = 25/26 (96%) Strand = Plus / Plus Query: 111 ggagctggagctggggctggggcagg 136 ||||||||||||||||| |||||||| Sbjct: 130441 ggagctggagctggggcaggggcagg 130466
>gb|AC157606.5| Mus musculus chromosome 7, clone RP23-466J2, complete sequence Length = 174676 Score = 44.1 bits (22), Expect = 0.58 Identities = 22/22 (100%) Strand = Plus / Plus Query: 111 ggagctggagctggggctgggg 132 |||||||||||||||||||||| Sbjct: 92645 ggagctggagctggggctgggg 92666
>emb|CR860620.1| Pongo pygmaeus mRNA; cDNA DKFZp459A1125 (from clone DKFZp459A1125) Length = 2742 Score = 44.1 bits (22), Expect = 0.58 Identities = 22/22 (100%) Strand = Plus / Minus Query: 111 ggagctggagctggggctgggg 132 |||||||||||||||||||||| Sbjct: 198 ggagctggagctggggctgggg 177
>dbj|AK133162.1| Mus musculus adult male testis cDNA, RIKEN full-length enriched library, clone:4931406O09 product:unclassifiable, full insert sequence Length = 6606 Score = 44.1 bits (22), Expect = 0.58 Identities = 22/22 (100%) Strand = Plus / Plus Query: 110 aggagctggagctggggctggg 131 |||||||||||||||||||||| Sbjct: 6330 aggagctggagctggggctggg 6351
>ref|XM_941955.1| PREDICTED: Homo sapiens ubiquitin specific peptidase 43, transcript variant 5 (USP43), mRNA Length = 4119 Score = 44.1 bits (22), Expect = 0.58 Identities = 22/22 (100%) Strand = Plus / Minus Query: 111 ggagctggagctggggctgggg 132 |||||||||||||||||||||| Sbjct: 317 ggagctggagctggggctgggg 296
>ref|XM_371015.4| PREDICTED: Homo sapiens ubiquitin specific peptidase 43, transcript variant 1 (USP43), mRNA Length = 4119 Score = 44.1 bits (22), Expect = 0.58 Identities = 22/22 (100%) Strand = Plus / Minus Query: 111 ggagctggagctggggctgggg 132 |||||||||||||||||||||| Sbjct: 317 ggagctggagctggggctgggg 296
>gb|AC129563.14| Mus musculus chromosome 15, clone RP23-223M20, complete sequence Length = 175021 Score = 44.1 bits (22), Expect = 0.58 Identities = 22/22 (100%) Strand = Plus / Plus Query: 110 aggagctggagctggggctggg 131 |||||||||||||||||||||| Sbjct: 36031 aggagctggagctggggctggg 36052
>gb|AC027045.21| Homo sapiens chromosome 17, clone RP11-477N12, complete sequence Length = 188646 Score = 44.1 bits (22), Expect = 0.58 Identities = 22/22 (100%) Strand = Plus / Plus Query: 111 ggagctggagctggggctgggg 132 |||||||||||||||||||||| Sbjct: 173105 ggagctggagctggggctgggg 173126
>emb|AJ583817.2| Homo sapiens mRNA for ubiquitin specific proteinase 43 (USP43 gene) Length = 3375 Score = 44.1 bits (22), Expect = 0.58 Identities = 22/22 (100%) Strand = Plus / Minus Query: 111 ggagctggagctggggctgggg 132 |||||||||||||||||||||| Sbjct: 268 ggagctggagctggggctgggg 247
>emb|AJ334224.1|HSA334224 Homo sapiens genomic sequence surrounding NotI site, clone NB1-157C Length = 532 Score = 44.1 bits (22), Expect = 0.58 Identities = 22/22 (100%) Strand = Plus / Plus Query: 111 ggagctggagctggggctgggg 132 |||||||||||||||||||||| Sbjct: 25 ggagctggagctggggctgggg 46
>emb|AJ330758.1|HSA330758 Homo sapiens genomic sequence surrounding NotI site, clone NL1-CK5R Length = 675 Score = 44.1 bits (22), Expect = 0.58 Identities = 22/22 (100%) Strand = Plus / Plus Query: 111 ggagctggagctggggctgggg 132 |||||||||||||||||||||| Sbjct: 25 ggagctggagctggggctgggg 46
>gb|AC162448.10| Mus musculus chromosome 1, clone RP24-405F23, complete sequence Length = 180366 Score = 42.1 bits (21), Expect = 2.3 Identities = 24/25 (96%) Strand = Plus / Plus Query: 109 taggagctggagctggggctggggc 133 |||||||||| |||||||||||||| Sbjct: 97889 taggagctggggctggggctggggc 97913
>ref|NM_001030890.1| Gallus gallus tumor differentially expressed 2-like (TDE2L), mRNA Length = 1839 Score = 42.1 bits (21), Expect = 2.3 Identities = 24/25 (96%) Strand = Plus / Plus Query: 111 ggagctggagctggggctggggcag 135 ||||||||||||||||||| ||||| Sbjct: 1097 ggagctggagctggggctgaggcag 1121
>gb|AY371665.1| Streptococcus pneumoniae strain URSP2 PspA (pspA) gene, partial cds Length = 655 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 108 ttaggagctggagctggggct 128 ||||||||||||||||||||| Sbjct: 588 ttaggagctggagctggggct 568 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 108 ttaggagctggagctggggct 128 ||||||||||||||||||||| Sbjct: 519 ttaggagctggagctggggct 499 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 108 ttaggagctggagctggggct 128 ||||||||||||||||||||| Sbjct: 450 ttaggagctggagctggggct 430 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 111 ggagctggagctggggctgg 130 |||||||||||||||||||| Sbjct: 558 ggagctggagctggggctgg 539 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 111 ggagctggagctggggctgg 130 |||||||||||||||||||| Sbjct: 489 ggagctggagctggggctgg 470 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 111 ggagctggagctggggctgg 130 |||||||||||||||||||| Sbjct: 420 ggagctggagctggggctgg 401
>gb|AC122439.4| Mus musculus BAC clone RP24-222B4 from chromosome 3, complete sequence Length = 159703 Score = 42.1 bits (21), Expect = 2.3 Identities = 24/25 (96%) Strand = Plus / Plus Query: 111 ggagctggagctggggctggggcag 135 |||||||| |||||||||||||||| Sbjct: 120470 ggagctggggctggggctggggcag 120494
>ref|NM_031738.1| Rattus norvegicus solute carrier family 29 (nucleoside transporters), member 2 (Slc29a2), mRNA Length = 1678 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 110 aggagctggagctggggctgg 130 ||||||||||||||||||||| Sbjct: 951 aggagctggagctggggctgg 971
>emb|AL713999.28| Human DNA sequence from clone RP11-263K19 on chromosome 1 Contains the 3' end of the TRIM46 gene for tripartite motif-containing 46, the MUC1 gene for mucin 1 (transmembrane), the THBS3 gene for thrombospondin 3, two novel genes, the MTX1 gene for metaxin 1, the gene for a novel protein similar to glucosidase (beta; acid (includes glucosylceramidase)) (GBA), a metaxin 1 (MTX1) pseudogene, the GBA gene for glucosidase (beta; acid (includes glucosylceramidase)), the C1orf2 gene for chromosome 1 open reading frame 2, the SCAMP3 gene for secretory carrier membrane protein 3, the CLK2 gene for CDC-like kinase 2, the HCN3 gene for hyperpolarization activated cyclic nucleotide-gated potassium channel 3, the PKLR gene for pyruvate kinase (liver and RBC) and three CpG islands, complete sequence Length = 133525 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 113 agctggagctggggctggggc 133 ||||||||||||||||||||| Sbjct: 61738 agctggagctggggctggggc 61758 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 113 agctggagctggggctggggc 133 ||||||||||||||||||||| Sbjct: 41112 agctggagctggggctggggc 41132
>emb|AL645802.11| Mouse DNA sequence from clone RP23-128D9 on chromosome 11 Contains the gene for olfactory receptor MOR275-2, an olfactory receptor (MOR275-3) pseudogene, the gene for olfactory receptor MOR275-5, a novel gene (2210407C18Rik), the gene olfactory receptor MOR107-1, a novel gene (LOC216781), a novel olfactory receptor protein, a novel gene similar to olfactory receptor MOR285-1 (LOC216783), a novel gene similar to olfactory receptor MOR285-2 (LOC216784), a novel gene similar to olfactory receptor MOR285-1 (LOC194664), the gene for olfactory receptor MOR256-47 and a novel gene similar to olfactory receptor MOR285-1 (LOC193147), complete sequence Length = 226520 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 113 agctggagctggggctggggc 133 ||||||||||||||||||||| Sbjct: 116261 agctggagctggggctggggc 116241
>emb|AJ720286.1| Gallus gallus mRNA for hypothetical protein, clone 14b10 Length = 1839 Score = 42.1 bits (21), Expect = 2.3 Identities = 24/25 (96%) Strand = Plus / Plus Query: 111 ggagctggagctggggctggggcag 135 ||||||||||||||||||| ||||| Sbjct: 1097 ggagctggagctggggctgaggcag 1121
>dbj|AK056250.1| Homo sapiens cDNA FLJ31688 fis, clone NT2RI2005520 Length = 2366 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 113 agctggagctggggctggggc 133 ||||||||||||||||||||| Sbjct: 180 agctggagctggggctggggc 160
>emb|CR524250.1| Gallus gallus finished cDNA, clone ChEST910o6 Length = 1046 Score = 42.1 bits (21), Expect = 2.3 Identities = 24/25 (96%) Strand = Plus / Plus Query: 111 ggagctggagctggggctggggcag 135 ||||||||||||||||||| ||||| Sbjct: 314 ggagctggagctggggctgaggcag 338
>gb|AC161454.3| Mus musculus BAC clone RP23-332F10 from chromosome 3, complete sequence Length = 228486 Score = 42.1 bits (21), Expect = 2.3 Identities = 24/25 (96%) Strand = Plus / Plus Query: 111 ggagctggagctggggctggggcag 135 |||||||| |||||||||||||||| Sbjct: 136089 ggagctggggctggggctggggcag 136113
>ref|NG_001160.1| Homo sapiens metaxin 1 pseudogene (MTX1P) on chromosome 1 Length = 3459 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 113 agctggagctggggctggggc 133 ||||||||||||||||||||| Sbjct: 2482 agctggagctggggctggggc 2502
>gb|AF255907.1|AF255907 Streptococcus pneumoniae strain 233 PspA (pspA) gene, partial cds Length = 765 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 108 ttaggagctggagctggggct 128 ||||||||||||||||||||| Sbjct: 594 ttaggagctggagctggggct 574 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 111 ggagctggagctggggctgg 130 |||||||||||||||||||| Sbjct: 564 ggagctggagctggggctgg 545
>gb|AF255906.1|AF255906 Streptococcus pneumoniae strain 152 PspA (pspA) gene, partial cds Length = 731 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 108 ttaggagctggagctggggct 128 ||||||||||||||||||||| Sbjct: 596 ttaggagctggagctggggct 576 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 111 ggagctggagctggggctgg 130 |||||||||||||||||||| Sbjct: 566 ggagctggagctggggctgg 547
>gb|AF255905.1|AF255905 Streptococcus pneumoniae strain 183 PspA (pspA) gene, partial cds Length = 735 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 108 ttaggagctggagctggggct 128 ||||||||||||||||||||| Sbjct: 528 ttaggagctggagctggggct 508 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 111 ggagctggagctggggctgg 130 |||||||||||||||||||| Sbjct: 498 ggagctggagctggggctgg 479
>gb|AF255904.1|AF255904 Streptococcus pneumoniae strain 164 PspA (pspA) gene, partial cds Length = 745 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 108 ttaggagctggagctggggct 128 ||||||||||||||||||||| Sbjct: 592 ttaggagctggagctggggct 572 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 111 ggagctggagctggggctgg 130 |||||||||||||||||||| Sbjct: 562 ggagctggagctggggctgg 543
>gb|AF255903.1|AF255903 Streptococcus pneumoniae strain 90 PspA (pspA) gene, partial cds Length = 731 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 108 ttaggagctggagctggggct 128 ||||||||||||||||||||| Sbjct: 525 ttaggagctggagctggggct 505 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 111 ggagctggagctggggctgg 130 |||||||||||||||||||| Sbjct: 495 ggagctggagctggggctgg 476
>gb|AF255902.1|AF255902 Streptococcus pneumoniae strain 39 PspA (pspA) gene, partial cds Length = 703 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 108 ttaggagctggagctggggct 128 ||||||||||||||||||||| Sbjct: 460 ttaggagctggagctggggct 440 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 111 ggagctggagctggggctgg 130 |||||||||||||||||||| Sbjct: 430 ggagctggagctggggctgg 411
>gb|AF255901.1|AF255901 Streptococcus pneumoniae strain 177 PspA (pspA) gene, partial cds Length = 710 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 108 ttaggagctggagctggggct 128 ||||||||||||||||||||| Sbjct: 521 ttaggagctggagctggggct 501 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 111 ggagctggagctggggctgg 130 |||||||||||||||||||| Sbjct: 491 ggagctggagctggggctgg 472
>gb|AF255900.1|AF255900 Streptococcus pneumoniae strain 137 PspA (pspA) gene, partial cds Length = 749 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 108 ttaggagctggagctggggct 128 ||||||||||||||||||||| Sbjct: 524 ttaggagctggagctggggct 504 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 111 ggagctggagctggggctgg 130 |||||||||||||||||||| Sbjct: 494 ggagctggagctggggctgg 475
>gb|AF253407.1|AF253407 Streptococcus pneumoniae strain SP196 PspA (pspA) gene, partial cds Length = 585 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 108 ttaggagctggagctggggct 128 ||||||||||||||||||||| Sbjct: 541 ttaggagctggagctggggct 521 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 111 ggagctggagctggggctgg 130 |||||||||||||||||||| Sbjct: 511 ggagctggagctggggctgg 492
>gb|AF071803.1|AF071803 Streptococcus pneumoniae strain BG8743 PspA (pspA) gene, partial cds Length = 1269 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 108 ttaggagctggagctggggct 128 ||||||||||||||||||||| Sbjct: 1146 ttaggagctggagctggggct 1126 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 111 ggagctggagctggggctgg 130 |||||||||||||||||||| Sbjct: 1116 ggagctggagctggggctgg 1097
>gb|AC094107.3| Homo sapiens chromosome 5 clone RP11-48L3, complete sequence Length = 99286 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 110 aggagctggagctggggctgg 130 ||||||||||||||||||||| Sbjct: 52175 aggagctggagctggggctgg 52195
>gb|AC005753.1|AC005753 Homo sapiens chromosome 5, P1 clone 254f11 (LBNL H164), complete sequence Length = 120452 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 110 aggagctggagctggggctgg 130 ||||||||||||||||||||| Sbjct: 109399 aggagctggagctggggctgg 109419
>gb|AF023268.1|AF023268 Homo sapiens clk2 kinase (CLK2), propin1, cote1, glucocerebrosidase (GBA), and metaxin genes, complete cds; metaxin pseudogene and glucocerebrosidase pseudogene; and thrombospondin3 (THBS3) gene, partial cds Length = 75270 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 113 agctggagctggggctggggc 133 ||||||||||||||||||||| Sbjct: 60536 agctggagctggggctggggc 60516 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 113 agctggagctggggctggggc 133 ||||||||||||||||||||| Sbjct: 39925 agctggagctggggctggggc 39905
>gb|U46921.1|HSU46921 Human metaxin pseudogene sequence Length = 3459 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 113 agctggagctggggctggggc 133 ||||||||||||||||||||| Sbjct: 2482 agctggagctggggctggggc 2502
>gb|U46920.1|HSU46920 Human metaxin (MTX) gene, complete cds Length = 5935 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 113 agctggagctggggctggggc 133 ||||||||||||||||||||| Sbjct: 4959 agctggagctggggctggggc 4979
>gb|AF015305.1|AF015305 Rattus norvegicus equilbrative nitrobenzylthioinosine-insensitive nucleoside transporter mRNA, complete cds Length = 1678 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 110 aggagctggagctggggctgg 130 ||||||||||||||||||||| Sbjct: 951 aggagctggagctggggctgg 971
>gb|AC123656.9| Mus musculus chromosome 15, clone RP23-188M21, complete sequence Length = 200922 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 114 gctggagctggggctggggc 133 |||||||||||||||||||| Sbjct: 115696 gctggagctggggctggggc 115715
>gb|AC159250.2| Mus musculus BAC clone RP24-196J19 from chromosome 12, complete sequence Length = 193510 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 111 ggagctggagctggggctgg 130 |||||||||||||||||||| Sbjct: 191650 ggagctggagctggggctgg 191631 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 111 ggagctggagctggggctgg 130 |||||||||||||||||||| Sbjct: 191626 ggagctggagctggggctgg 191607 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 111 ggagctggagctggggctgg 130 |||||||||||||||||||| Sbjct: 191602 ggagctggagctggggctgg 191583
>gb|AC166821.2| Mus musculus BAC clone RP24-68F22 from chromosome 17, complete sequence Length = 202649 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 114 gctggagctggggctggggc 133 |||||||||||||||||||| Sbjct: 47361 gctggagctggggctggggc 47380 Score = 40.1 bits (20), Expect = 9.0 Identities = 23/24 (95%) Strand = Plus / Plus Query: 110 aggagctggagctggggctggggc 133 ||||||||| |||||||||||||| Sbjct: 47321 aggagctggggctggggctggggc 47344
>ref|NM_183034.1| Mus musculus pleckstrin homology domain containing, family M (with RUN domain) member 1 (Plekhm1), mRNA Length = 5144 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 111 ggagctggagctggggctgg 130 |||||||||||||||||||| Sbjct: 1666 ggagctggagctggggctgg 1647
>gb|L04961.1|MUSXISTA Mouse nuclear-localized inactive X-specific transcript (Xist) mRNA Length = 14739 Score = 40.1 bits (20), Expect = 9.0 Identities = 26/28 (92%) Strand = Plus / Minus Query: 109 taggagctggagctggggctggggcagg 136 |||| ||||| ||||||||||||||||| Sbjct: 2919 taggggctggggctggggctggggcagg 2892
>gb|AE016822.1| Leifsonia xyli subsp. xyli str. CTCB07, complete genome Length = 2584158 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 38 ctcgacatcagcgagttcct 57 |||||||||||||||||||| Sbjct: 1241700 ctcgacatcagcgagttcct 1241681
>gb|AC118021.13| Mus musculus chromosome 7, clone RP23-459P15, complete sequence Length = 196441 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 111 ggagctggagctggggctgg 130 |||||||||||||||||||| Sbjct: 24941 ggagctggagctggggctgg 24960
>gb|DQ338462.1| Nephila antipodiana clone 145 minor ampullate fibroin 1 mRNA, partial cds Length = 1189 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 114 gctggagctggggctggggc 133 |||||||||||||||||||| Sbjct: 57 gctggagctggggctggggc 76
>ref|XM_598311.2| PREDICTED: Bos taurus similar to gamma-aminobutyric acid A receptor, epsilon (LOC520080), mRNA Length = 4371 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 114 gctggagctggggctggggc 133 |||||||||||||||||||| Sbjct: 2694 gctggagctggggctggggc 2675
>gb|AC140216.3| Mus musculus BAC clone RP23-276B20 from chromosome 5, complete sequence Length = 194560 Score = 40.1 bits (20), Expect = 9.0 Identities = 23/24 (95%) Strand = Plus / Plus Query: 114 gctggagctggggctggggcagga 137 ||||| |||||||||||||||||| Sbjct: 35609 gctggggctggggctggggcagga 35632
>gb|BC053079.1| Mus musculus pleckstrin homology domain containing, family M (with RUN domain) member 1, mRNA (cDNA clone MGC:62451 IMAGE:5702529), complete cds Length = 5144 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 111 ggagctggagctggggctgg 130 |||||||||||||||||||| Sbjct: 1666 ggagctggagctggggctgg 1647
>gb|BC001106.2| Homo sapiens transmembrane protein 9, mRNA (cDNA clone MGC:891 IMAGE:3506442), complete cds Length = 1533 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 114 gctggagctggggctggggc 133 |||||||||||||||||||| Sbjct: 1125 gctggagctggggctggggc 1106
>ref|NR_001463.2| Mus musculus inactive X specific transcripts (Xist) on chromosome X Length = 17919 Score = 40.1 bits (20), Expect = 9.0 Identities = 26/28 (92%) Strand = Plus / Minus Query: 109 taggagctggagctggggctggggcagg 136 |||| ||||| ||||||||||||||||| Sbjct: 2954 taggggctggggctggggctggggcagg 2927
>ref|XM_715351.1| Candida albicans SC5314 hypothetical protein (CaO19_2691), mRNA Length = 723 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 114 gctggagctggggctggggc 133 |||||||||||||||||||| Sbjct: 373 gctggagctggggctggggc 354
>ref|XM_715121.1| Candida albicans SC5314 hypothetical protein (CaO19_10206), mRNA Length = 723 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 114 gctggagctggggctggggc 133 |||||||||||||||||||| Sbjct: 373 gctggagctggggctggggc 354
>ref|NR_001570.1| Mus musculus inactive X specific transcripts (Xist) on chromosome X Length = 12251 Score = 40.1 bits (20), Expect = 9.0 Identities = 26/28 (92%) Strand = Plus / Minus Query: 109 taggagctggagctggggctggggcagg 136 |||| ||||| ||||||||||||||||| Sbjct: 2954 taggggctggggctggggctggggcagg 2927
>gb|AC102312.11| Mus musculus chromosome 10, clone RP24-428L4, complete sequence Length = 182940 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 114 gctggagctggggctggggc 133 |||||||||||||||||||| Sbjct: 101660 gctggagctggggctggggc 101679
>gb|AC166992.2| Mus musculus BAC clone RP24-144F18 from chromosome 9, complete sequence Length = 193799 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 117 ggagctggggctggggcagg 136 |||||||||||||||||||| Sbjct: 52568 ggagctggggctggggcagg 52549
>gb|AC121264.8| Mus musculus chromosome 9, clone RP24-233F22, complete sequence Length = 194261 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 114 gctggagctggggctggggc 133 |||||||||||||||||||| Sbjct: 4503 gctggagctggggctggggc 4522
>gb|AC091283.11| Mus musculus chromosome 18, clone RP23-146P1, complete sequence Length = 220804 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 114 gctggagctggggctggggc 133 |||||||||||||||||||| Sbjct: 90126 gctggagctggggctggggc 90145
>gb|DP000012.1| Macropus eugenii target 1 genomic scaffold Length = 1996640 Score = 40.1 bits (20), Expect = 9.0 Identities = 26/28 (92%) Strand = Plus / Minus Query: 110 aggagctggagctggggctggggcagga 137 ||||||| | |||||||||||||||||| Sbjct: 1203504 aggagctagggctggggctggggcagga 1203477
>gb|AC124604.4| Mus musculus BAC clone RP23-81K14 from chromosome 8, complete sequence Length = 220801 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 231 cttgggttctgctggaagtc 250 |||||||||||||||||||| Sbjct: 66639 cttgggttctgctggaagtc 66658
>ref|XM_755054.1| Ustilago maydis 521 hypothetical protein (UM04000.1) partial mRNA Length = 1203 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 111 ggagctggagctggggctgg 130 |||||||||||||||||||| Sbjct: 679 ggagctggagctggggctgg 698
>ref|XM_756535.1| Ustilago maydis 521 hypothetical protein (UM05481.1) partial mRNA Length = 2424 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 114 gctggagctggggctggggc 133 |||||||||||||||||||| Sbjct: 1726 gctggagctggggctggggc 1745
>emb|CR974572.21| Pig DNA sequence from clone CH242-200F24 on chromosome 17, complete sequence Length = 137431 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 114 gctggagctggggctggggc 133 |||||||||||||||||||| Sbjct: 70569 gctggagctggggctggggc 70588
>ref|XM_822578.1| Trypanosoma brucei TREU927 hypothetical protein (Tb09.244.2660) partial mRNA Length = 4137 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 231 cttgggttctgctggaagtc 250 |||||||||||||||||||| Sbjct: 3026 cttgggttctgctggaagtc 3007
>ref|XM_382703.1| Gibberella zeae PH-1 chromosome 1 hypothetical protein (FG02527.1) partial mRNA Length = 2976 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 114 gctggagctggggctggggc 133 |||||||||||||||||||| Sbjct: 2954 gctggagctggggctggggc 2935
>gb|AC128665.4| Mus musculus BAC clone RP24-141K21 from chromosome 18, complete sequence Length = 183285 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 114 gctggagctggggctggggc 133 |||||||||||||||||||| Sbjct: 20506 gctggagctggggctggggc 20525
>gb|AC123807.4| Mus musculus BAC clone RP24-157J13 from chromosome 13, complete sequence Length = 187710 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 114 gctggagctggggctggggc 133 |||||||||||||||||||| Sbjct: 135812 gctggagctggggctggggc 135831
>gb|AY359012.1| Homo sapiens clone DNA60278 TMEM9 (UNQ631) mRNA, complete cds Length = 1564 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 114 gctggagctggggctggggc 133 |||||||||||||||||||| Sbjct: 1174 gctggagctggggctggggc 1155
>emb|AL591516.9| Human DNA sequence from clone RP11-300D11 on chromosome 6q16.3-21 Contains part of the C6orf210 gene for chromosome 6 open reading frame 210 and a ribosomal protein S24 (RPS24) pseudogene, complete sequence Length = 84281 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 109 taggagctggagctggggct 128 |||||||||||||||||||| Sbjct: 57650 taggagctggagctggggct 57631
>gb|AF490267.1| Streptococcus pneumoniae strain PN124 PspA (pspA) gene, partial cds Length = 672 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 111 ggagctggagctggggctgg 130 |||||||||||||||||||| Sbjct: 380 ggagctggagctggggctgg 361
>emb|AL359741.9| Human DNA sequence from clone RP11-161P17 on chromosome 13 Contains a novel pseudogene, complete sequence Length = 139877 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 114 gctggagctggggctggggc 133 |||||||||||||||||||| Sbjct: 92885 gctggagctggggctggggc 92904
>emb|AL356753.16| Human DNA sequence from clone RP11-481G8 on chromosome 10 Contains the 5'end of a novel gene containing FLJ40930, gene FLJ35875, the RAI17 gene for retinoic acid induced 17, a novel gene and two CpG islands, complete sequence Length = 183460 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 116 tggagctggggctggggcag 135 |||||||||||||||||||| Sbjct: 105840 tggagctggggctggggcag 105821
>emb|AL355305.9| Human DNA sequence from clone RP11-487F23 on chromosome 6 Contains the 5' end of the gene for p53 regulated PA26 nuclear protein (PA26-T1), a novel gene and part of a novel gene, complete sequence Length = 185257 Score = 40.1 bits (20), Expect = 9.0 Identities = 23/24 (95%) Strand = Plus / Plus Query: 1 atgctgaaatatttatttgcctac 24 ||||| |||||||||||||||||| Sbjct: 131859 atgctcaaatatttatttgcctac 131882
>ref|XM_777474.1| PREDICTED: Strongylocentrotus purpuratus similar to Trichohyalin (LOC577233), mRNA Length = 2169 Score = 40.1 bits (20), Expect = 9.0 Identities = 23/24 (95%) Strand = Plus / Minus Query: 451 tctcgctcttctggttctcttcca 474 ||||||||||||| |||||||||| Sbjct: 790 tctcgctcttctgtttctcttcca 767
>gb|AC157558.8| Mus musculus chromosome 8, clone RP24-367D19, complete sequence Length = 142704 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 114 gctggagctggggctggggc 133 |||||||||||||||||||| Sbjct: 104442 gctggagctggggctggggc 104461
>emb|AL136600.1|HSM801574 Homo sapiens mRNA; cDNA DKFZp564I1216 (from clone DKFZp564I1216) Length = 1552 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 114 gctggagctggggctggggc 133 |||||||||||||||||||| Sbjct: 1139 gctggagctggggctggggc 1120
>gb|AC132166.1| Drosophila pseudoobscura FOSMID DPSF1-548A16 (Children's Hospital Oakland Research Institute Drosophila pseudoobscura FOSMID Library) complete sequence Length = 40715 Score = 40.1 bits (20), Expect = 9.0 Identities = 26/28 (92%) Strand = Plus / Minus Query: 110 aggagctggagctggggctggggcagga 137 ||||||||||||||| ||||| |||||| Sbjct: 912 aggagctggagctggagctggagcagga 885
>gb|AC145395.3| Oryza sativa (japonica cultivar-group) chromosome 11 BAC clone OSJNBa0047M04, complete sequence Length = 109523 Score = 40.1 bits (20), Expect = 9.0 Identities = 23/24 (95%) Strand = Plus / Minus Query: 328 ttggctgcccagcatcataacccc 351 |||||| ||||||||||||||||| Sbjct: 86134 ttggctccccagcatcataacccc 86111
>emb|CR615799.1| full-length cDNA clone CS0DF013YC11 of Fetal brain of Homo sapiens (human) Length = 1762 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 114 gctggagctggggctggggc 133 |||||||||||||||||||| Sbjct: 1375 gctggagctggggctggggc 1356
>gb|AC116021.5| Homo sapiens chromosome 11, clone CTD-2589M5, complete sequence Length = 167757 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 118 gagctggggctggggcagga 137 |||||||||||||||||||| Sbjct: 19118 gagctggggctggggcagga 19137
>gb|AC008737.11| Homo sapiens chromosome 19 clone CTD-2538G9, complete sequence Length = 248281 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 114 gctggagctggggctggggc 133 |||||||||||||||||||| Sbjct: 207896 gctggagctggggctggggc 207915
>emb|CR626614.1| full-length cDNA clone CS0DB002YP15 of Neuroblastoma Cot 10-normalized of Homo sapiens (human) Length = 1465 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 114 gctggagctggggctggggc 133 |||||||||||||||||||| Sbjct: 1091 gctggagctggggctggggc 1072
>emb|CR624789.1| full-length cDNA clone CL0BB007ZE02 of Neuroblastoma of Homo sapiens (human) Length = 1477 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 114 gctggagctggggctggggc 133 |||||||||||||||||||| Sbjct: 1091 gctggagctggggctggggc 1072
>emb|CR624691.1| full-length cDNA clone CS0DI081YG19 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 1725 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 114 gctggagctggggctggggc 133 |||||||||||||||||||| Sbjct: 1375 gctggagctggggctggggc 1356
>emb|CR623586.1| full-length cDNA clone CS0DA007YC18 of Neuroblastoma of Homo sapiens (human) Length = 1688 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 114 gctggagctggggctggggc 133 |||||||||||||||||||| Sbjct: 1375 gctggagctggggctggggc 1356
>emb|CR620935.1| full-length cDNA clone CS0DI002YP24 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 1112 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 114 gctggagctggggctggggc 133 |||||||||||||||||||| Sbjct: 1091 gctggagctggggctggggc 1072
>emb|CR619092.1| full-length cDNA clone CS0DK005YG08 of HeLa cells Cot 25-normalized of Homo sapiens (human) Length = 1519 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 114 gctggagctggggctggggc 133 |||||||||||||||||||| Sbjct: 1158 gctggagctggggctggggc 1139
>emb|CR618141.1| full-length cDNA clone CS0DF020YL21 of Fetal brain of Homo sapiens (human) Length = 1501 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 114 gctggagctggggctggggc 133 |||||||||||||||||||| Sbjct: 1091 gctggagctggggctggggc 1072
>emb|CR617609.1| full-length cDNA clone CS0DK009YC01 of HeLa cells Cot 25-normalized of Homo sapiens (human) Length = 1459 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 114 gctggagctggggctggggc 133 |||||||||||||||||||| Sbjct: 1120 gctggagctggggctggggc 1101
>emb|CR613421.1| full-length cDNA clone CS0DB001YC09 of Neuroblastoma Cot 10-normalized of Homo sapiens (human) Length = 1486 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 114 gctggagctggggctggggc 133 |||||||||||||||||||| Sbjct: 1117 gctggagctggggctggggc 1098
>dbj|AK094588.1| Homo sapiens cDNA FLJ37269 fis, clone BRAMY2011679 Length = 2892 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 114 gctggagctggggctggggc 133 |||||||||||||||||||| Sbjct: 2503 gctggagctggggctggggc 2484
>emb|CR606823.1| full-length cDNA clone CS0DD008YO22 of Neuroblastoma Cot 50-normalized of Homo sapiens (human) Length = 1465 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 114 gctggagctggggctggggc 133 |||||||||||||||||||| Sbjct: 1091 gctggagctggggctggggc 1072
>dbj|AK091726.1| Homo sapiens cDNA FLJ34407 fis, clone HEART1000173 Length = 1959 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 114 gctggagctggggctggggc 133 |||||||||||||||||||| Sbjct: 1570 gctggagctggggctggggc 1551
>dbj|AK091643.1| Homo sapiens cDNA FLJ34324 fis, clone FEBRA2008881, highly similar to FIBROBLAST GROWTH FACTOR-17 PRECURSOR Length = 2578 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 114 gctggagctggggctggggc 133 |||||||||||||||||||| Sbjct: 761 gctggagctggggctggggc 742
>emb|CR603168.1| full-length cDNA clone CS0DL003YA08 of B cells (Ramos cell line) Cot 25-normalized of Homo sapiens (human) Length = 1449 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 114 gctggagctggggctggggc 133 |||||||||||||||||||| Sbjct: 1091 gctggagctggggctggggc 1072
>emb|CR600811.1| full-length cDNA clone CS0DM014YK23 of Fetal liver of Homo sapiens (human) Length = 1447 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 114 gctggagctggggctggggc 133 |||||||||||||||||||| Sbjct: 1091 gctggagctggggctggggc 1072
>dbj|AK075335.1| Homo sapiens cDNA PSEC0012 fis, clone NT2RM1000853, highly similar to Transmembrane protein 9 precursor Length = 1499 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 114 gctggagctggggctggggc 133 |||||||||||||||||||| Sbjct: 1110 gctggagctggggctggggc 1091
>emb|CR599281.1| full-length cDNA clone CS0DI016YM23 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 1462 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 114 gctggagctggggctggggc 133 |||||||||||||||||||| Sbjct: 1091 gctggagctggggctggggc 1072
>emb|CR597911.1| full-length cDNA clone CS0DD001YJ01 of Neuroblastoma Cot 50-normalized of Homo sapiens (human) Length = 1486 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 114 gctggagctggggctggggc 133 |||||||||||||||||||| Sbjct: 1120 gctggagctggggctggggc 1101
>dbj|AK054883.1| Homo sapiens cDNA FLJ30321 fis, clone BRACE2006281 Length = 1544 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 114 gctggagctggggctggggc 133 |||||||||||||||||||| Sbjct: 1155 gctggagctggggctggggc 1136
>emb|CR594339.1| full-length cDNA clone CS0DI076YL10 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 1412 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 114 gctggagctggggctggggc 133 |||||||||||||||||||| Sbjct: 1091 gctggagctggggctggggc 1072
>emb|CR594211.1| full-length cDNA clone CS0DI009YN03 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 1449 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 114 gctggagctggggctggggc 133 |||||||||||||||||||| Sbjct: 1095 gctggagctggggctggggc 1076
>emb|CR593584.1| full-length cDNA clone CS0DC014YD23 of Neuroblastoma Cot 25-normalized of Homo sapiens (human) Length = 1487 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 114 gctggagctggggctggggc 133 |||||||||||||||||||| Sbjct: 1112 gctggagctggggctggggc 1093
>gb|AC104365.4| Homo sapiens chromosome 18, clone RP11-108P20, complete sequence Length = 157871 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 297 cccctccgcctttctgcatt 316 |||||||||||||||||||| Sbjct: 88441 cccctccgcctttctgcatt 88460
>gb|AF497475.1| Homo sapiens fibroblast growth factor 17 (FGF17) gene, complete cds Length = 7306 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 114 gctggagctggggctggggc 133 |||||||||||||||||||| Sbjct: 4419 gctggagctggggctggggc 4400
>dbj|AK154703.1| Mus musculus NOD-derived CD11c +ve dendritic cells cDNA, RIKEN full-length enriched library, clone:F630103P03 product:pleckstrin homology domain containing, family M (with RUN domain) member 1, full insert sequence Length = 5060 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 111 ggagctggagctggggctgg 130 |||||||||||||||||||| Sbjct: 1595 ggagctggagctggggctgg 1576
>dbj|AK157752.1| Mus musculus 9.5 days embryo parthenogenote cDNA, RIKEN full-length enriched library, clone:B130017N20 product:pleckstrin homology domain containing, family M (with RUN domain) member 1, full insert sequence Length = 3819 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 111 ggagctggagctggggctgg 130 |||||||||||||||||||| Sbjct: 1310 ggagctggagctggggctgg 1291
>dbj|AK155357.1| Mus musculus NOD-derived CD11c +ve dendritic cells cDNA, RIKEN full-length enriched library, clone:F630221P07 product:pleckstrin homology domain containing, family M (with RUN domain) member 1, full insert sequence Length = 3681 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 111 ggagctggagctggggctgg 130 |||||||||||||||||||| Sbjct: 1690 ggagctggagctggggctgg 1671
>gb|AC069074.11| Mus musculus 10 BAC RP23-243G3 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 190081 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 114 gctggagctggggctggggc 133 |||||||||||||||||||| Sbjct: 149390 gctggagctggggctggggc 149371
>gb|AC159193.2| Mus musculus BAC clone RP24-68E20 from chromosome 12, complete sequence Length = 243976 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 116 tggagctggggctggggcag 135 |||||||||||||||||||| Sbjct: 97563 tggagctggggctggggcag 97582
>gb|AC161058.2| Mus musculus BAC clone RP23-205J6 from chromosome 5, complete sequence Length = 222180 Score = 40.1 bits (20), Expect = 9.0 Identities = 23/24 (95%) Strand = Plus / Minus Query: 114 gctggagctggggctggggcagga 137 ||||| |||||||||||||||||| Sbjct: 56449 gctggggctggggctggggcagga 56426
>gb|AF384819.2|AF384819 Homo sapiens coagulation factor II receptor-like 3 (F2RL3) gene, complete cds Length = 11828 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 114 gctggagctggggctggggc 133 |||||||||||||||||||| Sbjct: 4178 gctggagctggggctggggc 4197
>gb|AF151020.1|AF151020 Homo sapiens HSPC186 mRNA, complete cds Length = 1592 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 114 gctggagctggggctggggc 133 |||||||||||||||||||| Sbjct: 1173 gctggagctggggctggggc 1154
>gb|AF265566.1|AF265566 Maize rayado fino virus isolate Costa Rican, complete genome Length = 6305 Score = 40.1 bits (20), Expect = 9.0 Identities = 23/24 (95%) Strand = Plus / Minus Query: 113 agctggagctggggctggggcagg 136 |||| ||||||||||||||||||| Sbjct: 1869 agctagagctggggctggggcagg 1846
>gb|AF082296.1|AF082296 Ustilago maydis DNA binding protein Ncp1 gene, complete cds Length = 4600 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 111 ggagctggagctggggctgg 130 |||||||||||||||||||| Sbjct: 3203 ggagctggagctggggctgg 3222
>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11, complete sequence Length = 28386948 Score = 40.1 bits (20), Expect = 9.0 Identities = 23/24 (95%) Strand = Plus / Minus Query: 328 ttggctgcccagcatcataacccc 351 |||||| ||||||||||||||||| Sbjct: 27135081 ttggctccccagcatcataacccc 27135058
>gb|AC008403.8| Homo sapiens chromosome 19 clone CTC-273B12, complete sequence Length = 190076 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 114 gctggagctggggctggggc 133 |||||||||||||||||||| Sbjct: 3350 gctggagctggggctggggc 3369
>gb|AC130710.3| Homo sapiens BAC clone RP11-495A22 from 2, complete sequence Length = 33959 Score = 40.1 bits (20), Expect = 9.0 Identities = 23/24 (95%) Strand = Plus / Plus Query: 112 gagctggagctggggctggggcag 135 |||||||||||||||| ||||||| Sbjct: 22842 gagctggagctggggccggggcag 22865
>gb|AF255552.1|AF255552 Streptococcus pneumoniae PspA (pspA) gene, partial cds Length = 749 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 111 ggagctggagctggggctgg 130 |||||||||||||||||||| Sbjct: 551 ggagctggagctggggctgg 532
>gb|AF071815.1|AF071815 Streptococcus pneumoniae strain BG9163 PspA (pspA) gene, partial cds Length = 1296 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 111 ggagctggagctggggctgg 130 |||||||||||||||||||| Sbjct: 1115 ggagctggagctggggctgg 1096 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 111 ggagctggagctggggctgg 130 |||||||||||||||||||| Sbjct: 1085 ggagctggagctggggctgg 1066
>gb|AF071813.1|AF071813 Streptococcus pneumoniae strain EF6796 PspA (pspA) gene, partial cds Length = 1225 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 111 ggagctggagctggggctgg 130 |||||||||||||||||||| Sbjct: 1043 ggagctggagctggggctgg 1024
>gb|AF071809.1|AF071809 Streptococcus pneumoniae strain L81905 PspA (pspA) gene, partial cds Length = 1240 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 111 ggagctggagctggggctgg 130 |||||||||||||||||||| Sbjct: 1030 ggagctggagctggggctgg 1011
>gb|AF071804.1|AF071804 Streptococcus pneumoniae strain BG9739 PspA (pspA) gene, partial cds Length = 1245 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 111 ggagctggagctggggctgg 130 |||||||||||||||||||| Sbjct: 1031 ggagctggagctggggctgg 1012
>ref|NM_016456.2| Homo sapiens transmembrane protein 9 (TMEM9), mRNA Length = 1592 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 114 gctggagctggggctggggc 133 |||||||||||||||||||| Sbjct: 1173 gctggagctggggctggggc 1154
>gb|AC091171.15| Homo sapiens chromosome 8, clone RP11-67H12, complete sequence Length = 158366 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 114 gctggagctggggctggggc 133 |||||||||||||||||||| Sbjct: 95906 gctggagctggggctggggc 95887
>gb|AC108668.5| Homo sapiens 3 BAC CTD-2650N22 (Cal Tech Human BAC Library D) complete sequence Length = 78689 Score = 40.1 bits (20), Expect = 9.0 Identities = 26/28 (92%) Strand = Plus / Minus Query: 10 tatttatttgcctacctgttgtgaatga 37 ||||||||||||||||||| || ||||| Sbjct: 19126 tatttatttgcctacctgtagtaaatga 19099
>gb|AC011527.4|AC011527 Homo sapiens chromosome 19 clone LLNLR-227C10, complete sequence Length = 35438 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 114 gctggagctggggctggggc 133 |||||||||||||||||||| Sbjct: 31464 gctggagctggggctggggc 31483
>gb|AC160764.2| Ornithorhynchus anatinus BAC clone OABb-454A1 from chromosome unknown, complete sequence Length = 125050 Score = 40.1 bits (20), Expect = 9.0 Identities = 23/24 (95%) Strand = Plus / Plus Query: 110 aggagctggagctggggctggggc 133 ||||||||||||||| |||||||| Sbjct: 17128 aggagctggagctggagctggggc 17151
>dbj|AK214417.1| Mus musculus cDNA, clone:Y2G0131L08, strand:minus, reference:ENSEMBL:Mouse-Transcript- ENST:ENSMUST00000041272, based on BLAT search Length = 388 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 111 ggagctggagctggggctgg 130 |||||||||||||||||||| Sbjct: 292 ggagctggagctggggctgg 273
>dbj|AK212548.1| Mus musculus cDNA, clone:Y2G0125F07, strand:minus, reference:ENSEMBL:Mouse-Transcript- ENST:ENSMUST00000041272, based on BLAT search Length = 332 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 111 ggagctggagctggggctgg 130 |||||||||||||||||||| Sbjct: 236 ggagctggagctggggctgg 217
>dbj|AK197598.1| Mus musculus cDNA, clone:Y1G0125J05, strand:minus, reference:ENSEMBL:Mouse-Transcript- ENST:ENSMUST00000041272, based on BLAT search Length = 377 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 111 ggagctggagctggggctgg 130 |||||||||||||||||||| Sbjct: 281 ggagctggagctggggctgg 262
>gb|AC002449.1|AC002449 Human PAC clone RP3-404K21 from Xq23, complete sequence Length = 173767 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 460 tctggttctcttccacatgt 479 |||||||||||||||||||| Sbjct: 75821 tctggttctcttccacatgt 75802
>gb|AC145041.3| Macropus eugenii clone ME_KBa-210M21, complete sequence Length = 137667 Score = 40.1 bits (20), Expect = 9.0 Identities = 26/28 (92%) Strand = Plus / Minus Query: 110 aggagctggagctggggctggggcagga 137 ||||||| | |||||||||||||||||| Sbjct: 33129 aggagctagggctggggctggggcagga 33102
>gb|AC007371.16|AC007371 Homo sapiens, clone 24_A_9, complete sequence Length = 168734 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 109 taggagctggagctggggct 128 |||||||||||||||||||| Sbjct: 122473 taggagctggagctggggct 122492
>gb|AC137764.6| Mus musculus chromosome 3, clone RP24-512E12, complete sequence Length = 148074 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 114 gctggagctggggctggggc 133 |||||||||||||||||||| Sbjct: 69399 gctggagctggggctggggc 69380
>gb|AC120394.10| Mus musculus chromosome 9, clone RP24-325N9, complete sequence Length = 206641 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 114 gctggagctggggctggggc 133 |||||||||||||||||||| Sbjct: 148303 gctggagctggggctggggc 148322
>gb|AC121114.10| Mus musculus chromosome 15, clone RP23-63M19, complete sequence Length = 337658 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 114 gctggagctggggctggggc 133 |||||||||||||||||||| Sbjct: 316393 gctggagctggggctggggc 316374
>gb|AC174644.2| Mus musculus BAC clone RP23-432C18 from chromosome 9, complete sequence Length = 199707 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 114 gctggagctggggctggggc 133 |||||||||||||||||||| Sbjct: 49572 gctggagctggggctggggc 49591
>gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome 11, complete sequence Length = 28369397 Score = 40.1 bits (20), Expect = 9.0 Identities = 23/24 (95%) Strand = Plus / Minus Query: 328 ttggctgcccagcatcataacccc 351 |||||| ||||||||||||||||| Sbjct: 27462134 ttggctccccagcatcataacccc 27462111
>gb|AF055917.1|AF055917 Homo sapiens protease-activated receptor 4 mRNA, complete cds Length = 4895 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 114 gctggagctggggctggggc 133 |||||||||||||||||||| Sbjct: 2873 gctggagctggggctggggc 2892
>emb|AL139159.10| Human DNA sequence from clone RP5-894H24 on chromosome 1 Contains the 5' end of the CACNA1S gene for calcium channel voltage-dependent L type alpha 1S subunit, the TMEM9 gene for transmembrane protein 9 and a CpG island, complete sequence Length = 132131 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 114 gctggagctggggctggggc 133 |||||||||||||||||||| Sbjct: 75947 gctggagctggggctggggc 75966
>gb|AE017222.1| Thermus thermophilus HB27 plasmid pTT27, complete sequence Length = 232605 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 191 tggtcctggagctggaggcc 210 |||||||||||||||||||| Sbjct: 173538 tggtcctggagctggaggcc 173557
>gb|AC148879.2| Chlamydomonas reinhardtii clone cr-36D8, complete sequence Length = 53591 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 196 ctggagctggaggccctgca 215 |||||||||||||||||||| Sbjct: 18000 ctggagctggaggccctgca 17981
>emb|CT030140.12| Mouse DNA sequence from clone RP24-345D17 on chromosome 12, complete sequence Length = 198163 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 114 gctggagctggggctggggc 133 |||||||||||||||||||| Sbjct: 32070 gctggagctggggctggggc 32051
>emb|CT030206.8| Mouse DNA sequence from clone RP23-100I15 on chromosome 12, complete sequence Length = 201135 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 111 ggagctggagctggggctgg 130 |||||||||||||||||||| Sbjct: 81235 ggagctggagctggggctgg 81254 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 111 ggagctggagctggggctgg 130 |||||||||||||||||||| Sbjct: 81211 ggagctggagctggggctgg 81230 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 111 ggagctggagctggggctgg 130 |||||||||||||||||||| Sbjct: 81187 ggagctggagctggggctgg 81206
>gb|AC132382.3| Mus musculus BAC clone RP23-425E9 from 8, complete sequence Length = 218283 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 111 ggagctggagctggggctgg 130 |||||||||||||||||||| Sbjct: 52025 ggagctggagctggggctgg 52044
>emb|AL772325.4| Mouse DNA sequence from clone RP23-17O4 on chromosome 11, complete sequence Length = 42284 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 111 ggagctggagctggggctgg 130 |||||||||||||||||||| Sbjct: 24189 ggagctggagctggggctgg 24208
>emb|AL844882.9| Mouse DNA sequence from clone RP23-360H15 on chromosome 2, complete sequence Length = 167978 Score = 40.1 bits (20), Expect = 9.0 Identities = 23/24 (95%) Strand = Plus / Minus Query: 110 aggagctggagctggggctggggc 133 ||||||||| |||||||||||||| Sbjct: 145357 aggagctggggctggggctggggc 145334
>emb|AJ421479.1| Mus musculus X-inactivation center region; segment 2/3 Length = 252150 Score = 40.1 bits (20), Expect = 9.0 Identities = 26/28 (92%) Strand = Plus / Minus Query: 109 taggagctggagctggggctggggcagg 136 |||| ||||| ||||||||||||||||| Sbjct: 109249 taggggctggggctggggctggggcagg 109222
>emb|AL669964.18| Mouse DNA sequence from clone RP23-11P22 on chromosome X, complete sequence Length = 229724 Score = 40.1 bits (20), Expect = 9.0 Identities = 26/28 (92%) Strand = Plus / Plus Query: 109 taggagctggagctggggctggggcagg 136 |||| ||||| ||||||||||||||||| Sbjct: 174431 taggggctggggctggggctggggcagg 174458
>gb|AC134027.2| Homo sapiens 3 BAC RP11-358B24 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 139300 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 114 gctggagctggggctggggc 133 |||||||||||||||||||| Sbjct: 131542 gctggagctggggctggggc 131561
>emb|AL672231.7| Mouse DNA sequence from clone RP23-54C14 on chromosome X, complete sequence Length = 109110 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 114 gctggagctggggctggggc 133 |||||||||||||||||||| Sbjct: 55590 gctggagctggggctggggc 55609
>emb|AL646049.14| Mouse DNA sequence from clone RP23-63A9 on chromosome X, complete sequence Length = 146105 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 586 aatgtgaagattttggtttc 605 |||||||||||||||||||| Sbjct: 67458 aatgtgaagattttggtttc 67477
>emb|AL672157.5| Mouse DNA sequence from clone RP24-499M12 on chromosome 2, complete sequence Length = 67987 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 114 gctggagctggggctggggc 133 |||||||||||||||||||| Sbjct: 39957 gctggagctggggctggggc 39976 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 6,534,186 Number of Sequences: 3902068 Number of extensions: 6534186 Number of successful extensions: 151802 Number of sequences better than 10.0: 187 Number of HSP's better than 10.0 without gapping: 187 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 150786 Number of HSP's gapped (non-prelim): 975 length of query: 661 length of database: 17,233,045,268 effective HSP length: 23 effective length of query: 638 effective length of database: 17,143,297,704 effective search space: 10937423935152 effective search space used: 10937423935152 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)