ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbags15g12
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1emb|X05576.1|HVTHIOR1 Barley mRNA for leaf-specific thionin (clo... 611 e-172
2emb|X05587.1|HVTHIOR2 Barley mRNA for leaf-specific thionin (clo... 607 e-170
3emb|X05588.1|HVTHIOR3 Barley mRNA for leaf-specific thionin (clo... 533 e-148
4emb|X05590.1|HVTHIOR5 Barley mRNA for leaf-specific thionin (clo... 440 e-120
5emb|X05589.1|HVTHIOR4 Barley mRNA for leaf-specific thionin (clo... 440 e-120
6gb|M19048.1|BLYTHNC Barley leaf specific thionin mRNA, complete ... 440 e-120
7gb|M19047.1|BLYTHNB Barley leaf specific thionin mRNA, complete ... 440 e-120
8gb|M19046.1|BLYTHNA Barley leaf specific thionin mRNA, complete ... 440 e-120
9emb|AJ508712.1|HVU508712 Hordeum vulgare mRNA for putative thionin 357 2e-95
10gb|L36882.1|BLYBTH6T Hordeum vulgare thionin (bth6) gene, comple... 351 1e-93
11gb|L36883.1|BLYBTH7T Hordeum vulgare thionin (BTH7) gene, comple... 252 7e-64
12dbj|AB072342.1| Avena sativa mRNA for thionin Asthi5, complete cds 157 3e-35
13dbj|AB072341.1| Avena sativa mRNA for thionin Asthi4, complete cds 74 4e-10
14emb|Z11873.1|SSGTFJKG S.salivarius gtfJ and gtfK genes for gluco... 40 5.1
15emb|BX322615.6| Zebrafish DNA sequence from clone DKEY-81L20 in ... 40 5.1
16tpg|BK000650.1| TPA: TPA_exp: Mus musculus otopetrin 1 isoform a... 40 5.1
17gb|AC084071.20| Mus musculus strain C57BL/6J chromosome 5 clone ... 40 5.1
18gb|M64111.1|STRGTFJA Streptococcus salivarius glucosyltransferas... 40 5.1

>emb|X05576.1|HVTHIOR1 Barley mRNA for leaf-specific thionin (clone DB4)
          Length = 637

 Score =  611 bits (308), Expect = e-172
 Identities = 362/383 (94%)
 Strand = Plus / Minus

                                                                       
Query: 1   ggcttccatacagctgatggtatcaagattattcaagacaaaatgactatacgaccttgg 60
           ||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||
Sbjct: 521 ggcttccatacagctgatggtatcaagattattcaagacaaaatgacaatacgaccatgg 462

                                                                       
Query: 61  ccatagaaatcatgcacaagaacgcatgattaggcttcaacagactgaatgactgcacca 120
           |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||
Sbjct: 461 ccatagaaatcatgcacaagaaggcatgattaggcttcaacagactgaatgactgcacca 402

                                                                       
Query: 121 tcattacagaaacgggcncatgcgttgctgcanagtcccatgtcgaatttcatctcttgg 180
           ||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||
Sbjct: 401 tcattacagaaacgggcacatgcgttgctgcagagtcccatgtcgaatttcatctcttgg 342

                                                                       
Query: 181 ccacggaaaacattgtccacgttgtcacagacagaattcctgcntccaatggtgcagtac 240
           ||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||
Sbjct: 341 ccacggaaaacattgtccatgttgtcacagacagaattcctgcatccaatggtgcagtac 282

                                                                       
Query: 241 tgagtgacatntggttcaccggattcagggagaagattcagtttaggatagtcactanga 300
           || ||||||| |||||||||||||||||||||||||||||||||||||||||||||| | 
Sbjct: 281 tgcgtgacatctggttcaccggattcagggagaagattcagtttaggatagtcactaggg 222

                                                                       
Query: 301 cattttgaaccgcttatgattttacaaccacaancacctgcacanactgnacgggaacca 360
           ||||||| ||| |||||||||||||||| |||| ||||||| || |||| ||||||||||
Sbjct: 221 cattttggaccacttatgattttacaacgacaagcacctgcgcagactggacgggaacca 162

                                  
Query: 361 ccggcgaaacngcaagtgttgta 383
           || ||||||  ||||||||||||
Sbjct: 161 cccgcgaaatggcaagtgttgta 139



to top

>emb|X05587.1|HVTHIOR2 Barley mRNA for leaf-specific thionin (clone DC4)
          Length = 658

 Score =  607 bits (306), Expect = e-170
 Identities = 360/381 (94%)
 Strand = Plus / Minus

                                                                       
Query: 3   cttccatacagctgatggtatcaagattattcaagacaaaatgactatacgaccttggcc 62
           |||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||
Sbjct: 526 cttcgatacagctgatggtatcaagattattcaagacaaaatgacaatacgaccttggcc 467

                                                                       
Query: 63  atagaaatcatgcacaagaacgcatgattaggcttcaacagactgaatgactgcaccatc 122
           |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||
Sbjct: 466 atagaaatcatgcacaagaaggcatgattaggcttcaacagactgaatgactgcaccatc 407

                                                                       
Query: 123 attacagaaacgggcncatgcgttgctgcanagtcccatgtcgaatttcatctcttggcc 182
           |||||| |||||||| |||||||||||||| |||||||||||||||||||||||||||||
Sbjct: 406 attacaaaaacgggcacatgcgttgctgcagagtcccatgtcgaatttcatctcttggcc 347

                                                                       
Query: 183 acggaaaacattgtccacgttgtcacagacagaattcctgcntccaatggtgcagtactg 242
           ||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||
Sbjct: 346 acggaaaacattgtccatgttgtcacagacagaattcctgcatccaatggtgcagtactg 287

                                                                       
Query: 243 agtgacatntggttcaccggattcagggagaagattcagtttaggatagtcactangaca 302
           |||||||| ||||||||||||||||||||||||||| |||||||||||||||||| | ||
Sbjct: 286 agtgacatctggttcaccggattcagggagaagattaagtttaggatagtcactagggca 227

                                                                       
Query: 303 ttttgaaccgcttatgattttacaaccacaancacctgcacanactgnacgggaaccacc 362
           ||||| ||| |||||||||||||||| |||| ||||||| || |||| ||||||||||||
Sbjct: 226 ttttggaccacttatgattttacaacgacaagcacctgcgcagactggacgggaaccacc 167

                                
Query: 363 ggcgaaacngcaagtgttgta 383
            ||||||| ||||||||||||
Sbjct: 166 cgcgaaacggcaagtgttgta 146



to top

>emb|X05588.1|HVTHIOR3 Barley mRNA for leaf-specific thionin (clone DF2)
          Length = 453

 Score =  533 bits (269), Expect = e-148
 Identities = 320/339 (94%)
 Strand = Plus / Minus

                                                                       
Query: 3   cttccatacagctgatggtatcaagattattcaagacaaaatgactatacgaccttggcc 62
           |||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||
Sbjct: 346 cttcgatacagctgatggtatcaagattattcaagacaaaatgacaatacgaccttggcc 287

                                                                       
Query: 63  atagaaatcatgcacaagaacgcatgattaggcttcaacagactgaatgactgcaccatc 122
           |||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||
Sbjct: 286 atagaaatcatgcacaagaaggcatgattaggattcaacagactgaatgactgcaccatc 227

                                                                       
Query: 123 attacagaaacgggcncatgcgttgctgcanagtcccatgtcgaatttcatctcttggcc 182
           |||||| |||||||| |||||||||||||| |||||||||||||||||||||||||||||
Sbjct: 226 attacaaaaacgggcacatgcgttgctgcagagtcccatgtcgaatttcatctcttggcc 167

                                                                       
Query: 183 acggaaaacattgtccacgttgtcacagacagaattcctgcntccaatggtgcagtactg 242
           | ||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||
Sbjct: 166 atggaaaacattgtccatgttgtcacagacagaattcctgcatccaatggtgcagtactg 107

                                                                       
Query: 243 agtgacatntggttcaccggattcagggagaagattcagtttaggatagtcactangaca 302
           ||||||||  |||||||||||||||||||||||||| |||||||||||||||||| | ||
Sbjct: 106 agtgacatcgggttcaccggattcagggagaagattaagtttaggatagtcactagggca 47

                                                  
Query: 303 ttttgaaccgcttatgattttacaaccacaancacctgc 341
           ||||| ||| |||||||||||||||| |||| |||||||
Sbjct: 46  ttttggaccacttatgattttacaacgacaagcacctgc 8



to top

>emb|X05590.1|HVTHIOR5 Barley mRNA for leaf-specific thionin (clone DD3)
          Length = 491

 Score =  440 bits (222), Expect = e-120
 Identities = 330/369 (89%)
 Strand = Plus / Minus

                                                                       
Query: 15  tgatggtatcaagattattcaagacaaaatgactatacgaccttggccatagaaatcatg 74
           |||||||||||||||| || || | |||||||  | ||||||||||||||||||||||||
Sbjct: 373 tgatggtatcaagattgttgaacagaaaatgaaaaaacgaccttggccatagaaatcatg 314

                                                                       
Query: 75  cacaagaacgcatgattaggcttcaacagactgaatgactgcaccatcattacagaaacg 134
           | |||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||
Sbjct: 313 cccaagaaggcatgattaggcttcaacagactgaatgacttcaccatcattacagaaacg 254

                                                                       
Query: 135 ggcncatgcgttgctgcanagtcccatgtcgaatttcatctcttggccacggaaaacatt 194
           ||| |||||||||||||| ||||||||||||||||||||||||||||||||| |||||||
Sbjct: 253 ggcacatgcgttgctgcagagtcccatgtcgaatttcatctcttggccacgggaaacatt 194

                                                                       
Query: 195 gtccacgttgtcacagacagaattcctgcntccaatggtgcagtactgagtgacatntgg 254
           ||||| |||||||||||| ||| |||||| |||||| |||||||||| |||  ||| |||
Sbjct: 193 gtccaggttgtcacagacggaagtcctgcatccaattgtgcagtactcagtcgcatttgg 134

                                                                       
Query: 255 ttcaccggattcagggagaagattcagtttaggatagtcactangacattttgaaccgct 314
           ||||||||||||||||||||||||||| ||||||||||| ||| ||||  |||  |||||
Sbjct: 133 ttcaccggattcagggagaagattcagcttaggatagtccctaggacaggttgggccgct 74

                                                                       
Query: 315 tatgattttacaaccacaancacctgcacanactgnacgggaaccaccggcgaaacngca 374
           ||||||||||||||||||| ||  ||| || ||||  ||||||||||||||||||| |||
Sbjct: 73  tatgattttacaaccacaagcagttgcgcagactggtcgggaaccaccggcgaaacggca 14

                    
Query: 375 agtgttgta 383
            | ||||||
Sbjct: 13  ggcgttgta 5



to top

>emb|X05589.1|HVTHIOR4 Barley mRNA for leaf-specific thionin (clone DG3)
          Length = 544

 Score =  440 bits (222), Expect = e-120
 Identities = 330/369 (89%)
 Strand = Plus / Minus

                                                                       
Query: 15  tgatggtatcaagattattcaagacaaaatgactatacgaccttggccatagaaatcatg 74
           |||||||||||||||| || || | |||||||| | ||||||||||||||||||||||||
Sbjct: 459 tgatggtatcaagattgttgaacagaaaatgacaaaacgaccttggccatagaaatcatg 400

                                                                       
Query: 75  cacaagaacgcatgattaggcttcaacagactgaatgactgcaccatcattacagaaacg 134
           | |||||| ||||||||||||||||| ||||||||||||| |||||||||||||||||||
Sbjct: 399 cccaagaaggcatgattaggcttcaagagactgaatgacttcaccatcattacagaaacg 340

                                                                       
Query: 135 ggcncatgcgttgctgcanagtcccatgtcgaatttcatctcttggccacggaaaacatt 194
           ||| |||||||||||||| ||||||||||||||||||||||||||||||||| |||||||
Sbjct: 339 ggcacatgcgttgctgcagagtcccatgtcgaatttcatctcttggccacgggaaacatt 280

                                                                       
Query: 195 gtccacgttgtcacagacagaattcctgcntccaatggtgcagtactgagtgacatntgg 254
           ||||| |||||||||||| ||| |||||| |||||| |||||||||| |||  ||| |||
Sbjct: 279 gtccatgttgtcacagacggaagtcctgcatccaattgtgcagtactcagtcgcatttgg 220

                                                                       
Query: 255 ttcaccggattcagggagaagattcagtttaggatagtcactangacattttgaaccgct 314
           ||||||||||||||||||||||||||| ||||||||||| ||| ||||| |||  |||||
Sbjct: 219 ttcaccggattcagggagaagattcagcttaggatagtccctaggacatgttgggccgct 160

                                                                       
Query: 315 tatgattttacaaccacaancacctgcacanactgnacgggaaccaccggcgaaacngca 374
           ||||||||||||||||||| ||  ||| || ||||  ||||||||||| ||||||| |||
Sbjct: 159 tatgattttacaaccacaagcagttgcgcagactggtcgggaaccaccagcgaaacggca 100

                    
Query: 375 agtgttgta 383
            | ||||||
Sbjct: 99  ggcgttgta 91



to top

>gb|M19048.1|BLYTHNC Barley leaf specific thionin mRNA, complete cds, clone pKG1940
          Length = 663

 Score =  440 bits (222), Expect = e-120
 Identities = 330/369 (89%)
 Strand = Plus / Minus

                                                                       
Query: 15  tgatggtatcaagattattcaagacaaaatgactatacgaccttggccatagaaatcatg 74
           |||||||||||||||| || || | |||||||| | ||||||||||||||||||||||||
Sbjct: 532 tgatggtatcaagattgttgaacagaaaatgacaaaacgaccttggccatagaaatcatg 473

                                                                       
Query: 75  cacaagaacgcatgattaggcttcaacagactgaatgactgcaccatcattacagaaacg 134
           | |||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||
Sbjct: 472 cccaagaaggcatgattaggcttcaacagactgaatgacttcaccatcattacagaaacg 413

                                                                       
Query: 135 ggcncatgcgttgctgcanagtcccatgtcgaatttcatctcttggccacggaaaacatt 194
           ||| |||||||||||||| ||||||||||||||||||||||||||||||||| |||||||
Sbjct: 412 ggcacatgcgttgctgcagagtcccatgtcgaatttcatctcttggccacgggaaacatt 353

                                                                       
Query: 195 gtccacgttgtcacagacagaattcctgcntccaatggtgcagtactgagtgacatntgg 254
           ||||| |||||||||||| ||| ||| || |||||| |||||||||| |||  ||| |||
Sbjct: 352 gtccatgttgtcacagacggaagtccggcatccaattgtgcagtactcagtcgcatttgg 293

                                                                       
Query: 255 ttcaccggattcagggagaagattcagtttaggatagtcactangacattttgaaccgct 314
           ||||||||||||||||||||||||||| ||||||||||| ||| ||||| |||  |||||
Sbjct: 292 ttcaccggattcagggagaagattcagcttaggatagtccctaggacatgttgggccgct 233

                                                                       
Query: 315 tatgattttacaaccacaancacctgcacanactgnacgggaaccaccggcgaaacngca 374
           ||||||||||||||||||| ||  ||| || ||||  ||||||||||| ||||||| |||
Sbjct: 232 tatgattttacaaccacaagcagttgcgcagactggtcgggaaccaccagcgaaacggca 173

                    
Query: 375 agtgttgta 383
            | ||||||
Sbjct: 172 ggcgttgta 164



to top

>gb|M19047.1|BLYTHNB Barley leaf specific thionin mRNA, complete cds, clone pKG1348
          Length = 608

 Score =  440 bits (222), Expect = e-120
 Identities = 330/369 (89%)
 Strand = Plus / Minus

                                                                       
Query: 15  tgatggtatcaagattattcaagacaaaatgactatacgaccttggccatagaaatcatg 74
           |||||||||||||||| || || | |||||||| | ||||||||||||||||||||||||
Sbjct: 532 tgatggtatcaagattgttgaacagaaaatgacaaaacgaccttggccatagaaatcatg 473

                                                                       
Query: 75  cacaagaacgcatgattaggcttcaacagactgaatgactgcaccatcattacagaaacg 134
           | |||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||
Sbjct: 472 cccaagaaggcatgattaggcttcaacagactgaatgacttcaccatcattacagaaacg 413

                                                                       
Query: 135 ggcncatgcgttgctgcanagtcccatgtcgaatttcatctcttggccacggaaaacatt 194
           ||| |||||||||||||| ||||||||||||||||||||||||||||||||| |||||||
Sbjct: 412 ggcacatgcgttgctgcagagtcccatgtcgaatttcatctcttggccacgggaaacatt 353

                                                                       
Query: 195 gtccacgttgtcacagacagaattcctgcntccaatggtgcagtactgagtgacatntgg 254
           ||||| |||||||||||| ||| ||| || |||||| |||||||||| |||  ||| |||
Sbjct: 352 gtccatgttgtcacagacggaagtccggcatccaattgtgcagtactcagtcgcatttgg 293

                                                                       
Query: 255 ttcaccggattcagggagaagattcagtttaggatagtcactangacattttgaaccgct 314
           ||||||||||||||||||||||||||| ||||||||||| ||| ||||| |||  |||||
Sbjct: 292 ttcaccggattcagggagaagattcagcttaggatagtccctaggacatgttgggccgct 233

                                                                       
Query: 315 tatgattttacaaccacaancacctgcacanactgnacgggaaccaccggcgaaacngca 374
           ||||||||||||||||||| ||  ||| || ||||  ||||||||||| ||||||| |||
Sbjct: 232 tatgattttacaaccacaagcagttgcgcagactggtcgggaaccaccagcgaaacggca 173

                    
Query: 375 agtgttgta 383
            | ||||||
Sbjct: 172 ggcgttgta 164



to top

>gb|M19046.1|BLYTHNA Barley leaf specific thionin mRNA, complete cds, clone pKG2872
          Length = 540

 Score =  440 bits (222), Expect = e-120
 Identities = 330/369 (89%)
 Strand = Plus / Minus

                                                                       
Query: 15  tgatggtatcaagattattcaagacaaaatgactatacgaccttggccatagaaatcatg 74
           |||||||||||||||| || || | |||||||| | ||||||||||||||||||||||||
Sbjct: 532 tgatggtatcaagattgttgaacagaaaatgacaaaacgaccttggccatagaaatcatg 473

                                                                       
Query: 75  cacaagaacgcatgattaggcttcaacagactgaatgactgcaccatcattacagaaacg 134
           | |||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||
Sbjct: 472 cccaagaaggcatgattaggcttcaacagactgaatgacttcaccatcattacagaaacg 413

                                                                       
Query: 135 ggcncatgcgttgctgcanagtcccatgtcgaatttcatctcttggccacggaaaacatt 194
           ||| |||||||||||||| ||||||||||||||||||||||||||||||||| |||||||
Sbjct: 412 ggcacatgcgttgctgcagagtcccatgtcgaatttcatctcttggccacgggaaacatt 353

                                                                       
Query: 195 gtccacgttgtcacagacagaattcctgcntccaatggtgcagtactgagtgacatntgg 254
           ||||| |||||||||||| ||| ||| || |||||| |||||||||| |||  ||| |||
Sbjct: 352 gtccatgttgtcacagacggaagtccggcatccaattgtgcagtactcagtcgcatttgg 293

                                                                       
Query: 255 ttcaccggattcagggagaagattcagtttaggatagtcactangacattttgaaccgct 314
           ||||||||||||||||||||||||||| ||||||||||| ||| ||||| |||  |||||
Sbjct: 292 ttcaccggattcagggagaagattcagcttaggatagtccctaggacatgttgggccgct 233

                                                                       
Query: 315 tatgattttacaaccacaancacctgcacanactgnacgggaaccaccggcgaaacngca 374
           ||||||||||||||||||| ||  ||| || ||||  ||||||||||| ||||||| |||
Sbjct: 232 tatgattttacaaccacaagcagttgcgcagactggtcgggaaccaccagcgaaacggca 173

                    
Query: 375 agtgttgta 383
            | ||||||
Sbjct: 172 ggcgttgta 164



to top

>emb|AJ508712.1|HVU508712 Hordeum vulgare mRNA for putative thionin
          Length = 414

 Score =  357 bits (180), Expect = 2e-95
 Identities = 253/280 (90%)
 Strand = Plus / Minus

                                                                       
Query: 90  ttaggcttcaacagactgaatgactgcaccatcattacagaaacgggcncatgcgttgct 149
           ||||||||||||||||||||||||  |||||||||||||||||||||| |||||||||||
Sbjct: 414 ttaggcttcaacagactgaatgacatcaccatcattacagaaacgggcacatgcgttgct 355

                                                                       
Query: 150 gcanagtcccatgtcgaatttcatctcttggccacggaaaacattgtccacgttgtcaca 209
           ||| ||||||||||||||||||||||||||||||||| |||||||||||| |||||||||
Sbjct: 354 gcagagtcccatgtcgaatttcatctcttggccacgggaaacattgtccatgttgtcaca 295

                                                                       
Query: 210 gacagaattcctgcntccaatggtgcagtactgagtgacatntggttcaccggattcagg 269
           ||| ||| |||||| |||||| |||||||||| |||  ||| ||||||||||||||||||
Sbjct: 294 gacggaagtcctgcatccaattgtgcagtactcagtcgcatttggttcaccggattcagg 235

                                                                       
Query: 270 gagaagattcagtttaggatagtcactangacattttgaaccgcttatgattttacaacc 329
           |||||||||||| ||||||||||| ||| ||||| |||  ||||||||||||||||||||
Sbjct: 234 gagaagattcagcttaggatagtccctaggacatgttgggccgcttatgattttacaacc 175

                                                   
Query: 330 acaancacctgcacanactgnacgggaaccaccggcgaaa 369
           |||| ||  ||| || ||||  ||||||||||||||||||
Sbjct: 174 acaagcagttgcgcagactggtcgggaaccaccggcgaaa 135



to top

>gb|L36882.1|BLYBTH6T Hordeum vulgare thionin (bth6) gene, complete cds
          Length = 2406

 Score =  351 bits (177), Expect = 1e-93
 Identities = 187/191 (97%)
 Strand = Plus / Minus

                                                                        
Query: 1    ggcttccatacagctgatggtatcaagattattcaagacaaaatgactatacgaccttgg 60
            ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||
Sbjct: 2221 ggcttccatacagctgatggtatcaagattattcaagacaaaatgacaatacgaccttgg 2162

                                                                        
Query: 61   ccatagaaatcatgcacaagaacgcatgattaggcttcaacagactgaatgactgcacca 120
            |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||
Sbjct: 2161 ccatagaaatcatgcacaagaaggcatgattaggcttcaacagactgaatgactgcacca 2102

                                                                        
Query: 121  tcattacagaaacgggcncatgcgttgctgcanagtcccatgtcgaatttcatctcttgg 180
            ||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||
Sbjct: 2101 tcattacagaaacgggcacatgcgttgctgcagagtcccatgtcgaatttcatctcttgg 2042

                       
Query: 181  ccacggaaaac 191
            |||||||||||
Sbjct: 2041 ccacggaaaac 2031



 Score =  172 bits (87), Expect = 5e-40
 Identities = 115/126 (91%)
 Strand = Plus / Minus

                                                                        
Query: 258  accggattcagggagaagattcagtttaggatagtcactangacattttgaaccgcttat 317
            |||||||||||||||||||||||||||||||||||||||| | ||||||| ||| |||||
Sbjct: 1776 accggattcagggagaagattcagtttaggatagtcactagggcattttggaccacttat 1717

                                                                        
Query: 318  gattttacaaccacaancacctgcacanactgnacgggaaccaccggcgaaacngcaagt 377
            ||||||||||| |||| ||||||| || |||| |||||||||||| ||||||| ||||||
Sbjct: 1716 gattttacaacgacaagcacctgcgcagactggacgggaaccacccgcgaaacggcaagt 1657

                  
Query: 378  gttgta 383
            ||||||
Sbjct: 1656 gttgta 1651



 Score =  111 bits (56), Expect = 2e-21
 Identities = 66/70 (94%)
 Strand = Plus / Minus

                                                                        
Query: 191  cattgtccacgttgtcacagacagaattcctgcntccaatggtgcagtactgagtgacat 250
            ||||||||| ||||||||||||||||||| ||| ||||||||||||||||||||||||||
Sbjct: 1937 cattgtccatgttgtcacagacagaattcgtgcatccaatggtgcagtactgagtgacat 1878

                      
Query: 251  ntggttcacc 260
             |||||||||
Sbjct: 1877 ctggttcacc 1868



to top

>gb|L36883.1|BLYBTH7T Hordeum vulgare thionin (BTH7) gene, complete cds
          Length = 2259

 Score =  252 bits (127), Expect = 7e-64
 Identities = 164/177 (92%)
 Strand = Plus / Minus

                                                                        
Query: 15   tgatggtatcaagattattcaagacaaaatgactatacgaccttggccatagaaatcatg 74
            |||||||||||||||| || || | |||||||| | ||||||||||||||||||||||||
Sbjct: 2230 tgatggtatcaagattgttgaacagaaaatgacaaaacgaccttggccatagaaatcatg 2171

                                                                        
Query: 75   cacaagaacgcatgattaggcttcaacagactgaatgactgcaccatcattacagaaacg 134
            | |||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||
Sbjct: 2170 cccaagaaggcatgattaggcttcaacagactgaatgacttcaccatcattacagaaacg 2111

                                                                     
Query: 135  ggcncatgcgttgctgcanagtcccatgtcgaatttcatctcttggccacggaaaac 191
            ||| |||||||||||||| ||||||||||| ||||||||||||||||||||| ||||
Sbjct: 2110 ggcacatgcgttgctgcagagtcccatgtcaaatttcatctcttggccacgggaaac 2054



 Score =  125 bits (63), Expect = 1e-25
 Identities = 109/126 (86%)
 Strand = Plus / Minus

                                                                        
Query: 258  accggattcagggagaagattcagtttaggatagtcactangacattttgaaccgcttat 317
            |||||||||||||||||||||||| ||||||||||| ||| ||||  |||  ||||||||
Sbjct: 1797 accggattcagggagaagattcagcttaggatagtccctaggacaggttgggccgcttat 1738

                                                                        
Query: 318  gattttacaaccacaancacctgcacanactgnacgggaaccaccggcgaaacngcaagt 377
            |||||||||||||||| ||  ||| || ||||  ||||||||||||||||||| ||| | 
Sbjct: 1737 gattttacaaccacaagcagttgcgcagactggtcgggaaccaccggcgaaacggcaggc 1678

                  
Query: 378  gttgta 383
            ||||||
Sbjct: 1677 gttgta 1672



to top

>dbj|AB072342.1| Avena sativa mRNA for thionin Asthi5, complete cds
          Length = 641

 Score =  157 bits (79), Expect = 3e-35
 Identities = 198/239 (82%)
 Strand = Plus / Minus

                                                                       
Query: 53  gaccttggccatagaaatcatgcacaagaacgcatgattaggcttcaacagactgaatga 112
           ||||| ||||| |||||||||||||||||  ||||||||| ||||  | |||  ||||||
Sbjct: 496 gacctcggccaaagaaatcatgcacaagagtgcatgattaagcttggaaagatggaatga 437

                                                                       
Query: 113 ctgcaccatcattacagaaacgggcncatgcgttgctgcanagtcccatgtcgaatttca 172
           | ||||| |  |||||||||||  | ||| | ||| |||| |||  |||||||| |||||
Sbjct: 436 cggcacccttgttacagaaacgaacacattctttgttgcagagtagcatgtcgattttca 377

                                                                       
Query: 173 tctcttggccacggaaaacattgtccacgttgtcacagacagaattcctgcntccaatgg 232
           ||||||||||| | | ||||||||||| ||||||||| || ||| || ||| ||| ||||
Sbjct: 376 tctcttggccatgaataacattgtccatgttgtcacaaacggaagtcatgcatcctatgg 317

                                                                      
Query: 233 tgcagtactgagtgacatntggttcaccggattcagggagaagattcagtttaggatag 291
           ||||||||| ||||||||  ||||||||||||||| | ||||||| |||||||| ||||
Sbjct: 316 tgcagtactcagtgacatccggttcaccggattcaagtagaagatgcagtttagaatag 258



to top

>dbj|AB072341.1| Avena sativa mRNA for thionin Asthi4, complete cds
          Length = 678

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 110/135 (81%)
 Strand = Plus / Minus

                                                                       
Query: 51  acgaccttggccatagaaatcatgcacaagaacgcatgattaggcttcaacagactgaat 110
           |||||| ||||||||||||| | |||| |||  ||||||||||||  | |||||  || |
Sbjct: 549 acgaccatggccatagaaataaggcacgagagtgcatgattaggccccgacagatggatt 490

                                                                       
Query: 111 gactgcaccatcattacagaaacgggcncatgcgttgctgcanagtcccatgtcgaattt 170
           ||| ||||| |  |||||||||||| | ||||||||| |||| | |  ||||||||  ||
Sbjct: 489 gacggcacccttgttacagaaacggacacatgcgttgttgcagacttgcatgtcgatgtt 430

                          
Query: 171 catctcttggccacg 185
           |||||||||||||||
Sbjct: 429 catctcttggccacg 415



to top

>emb|Z11873.1|SSGTFJKG S.salivarius gtfJ and gtfK genes for glucosyltransferase I and
            glucosyltransferase S
          Length = 10125

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 9    tacagctgatggtatcaaga 28
            ||||||||||||||||||||
Sbjct: 2450 tacagctgatggtatcaaga 2469



to top

>emb|BX322615.6| Zebrafish DNA sequence from clone DKEY-81L20 in linkage group 17,
             complete sequence
          Length = 120315

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 99    aacagactgaatgactgcac 118
             ||||||||||||||||||||
Sbjct: 61583 aacagactgaatgactgcac 61602



to top

>tpg|BK000650.1| TPA: TPA_exp: Mus musculus otopetrin 1 isoform a and isoform b (Otop1)
             gene, complete cds; alternatively spliced
          Length = 28272

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 193   ttgtccacgttgtcacagac 212
             ||||||||||||||||||||
Sbjct: 14605 ttgtccacgttgtcacagac 14624



to top

>gb|AC084071.20| Mus musculus strain C57BL/6J chromosome 5 clone rp23-426e16, complete
             sequence
          Length = 194175

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 193   ttgtccacgttgtcacagac 212
             ||||||||||||||||||||
Sbjct: 78067 ttgtccacgttgtcacagac 78086



to top

>gb|M64111.1|STRGTFJA Streptococcus salivarius glucosyltransferase I (gtfJ) gene, complete
            cds, and gtfK gene, 5' end
          Length = 4941

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 9    tacagctgatggtatcaaga 28
            ||||||||||||||||||||
Sbjct: 2450 tacagctgatggtatcaaga 2469


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,252,329
Number of Sequences: 3902068
Number of extensions: 2252329
Number of successful extensions: 36227
Number of sequences better than 10.0: 18
Number of HSP's better than 10.0 without gapping: 18
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 36204
Number of HSP's gapped (non-prelim): 22
length of query: 383
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 361
effective length of database: 17,147,199,772
effective search space: 6190139117692
effective search space used: 6190139117692
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top