| Clone Name | rbags15e20 |
|---|---|
| Clone Library Name | barley_pub |
>ref|XM_476275.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 654 Score = 482 bits (243), Expect = e-133 Identities = 435/499 (87%) Strand = Plus / Minus Query: 196 gcagcatgccctctttgaattgcccacagtactgtcaacgctgatggttttaccctggga 255 ||||||||||||||||| || || ||| ||||||| |||||| |||||||||||||| Sbjct: 645 gcagcatgccctctttgtgtttcctgcagcgctgtcaatgctgatagttttaccctggga 586 Query: 256 aggcaatggaacagctgctgctgctgcttctttggcggccagtgctttcttgttgacaat 315 ||||| ||| ||| || || ||||||||||||||||||||||||||| |||| ||||| Sbjct: 585 aggcagcggagcagaagcagcagctgcttctttggcggccagtgctttcctgttaacaat 526 Query: 316 accatagacctctgtgatgatagtctgaaacgcttctaccacattcacagcctccatagc 375 ||||||||||||||||||||||||||||| ||||| |||||||||| ||||||||||| Sbjct: 525 gccatagacctctgtgatgatagtctgaaaggcttcctccacattcacggcctccatagc 466 Query: 376 tgatgtctcaaggaaaaacaggccctccttttctgccagtgccttgccttgatcctcaga 435 |||||||||||| |||||||| ||||||||||| |||| |||||| |||| |||||| || Sbjct: 465 tgatgtctcaagaaaaaacagcccctccttttcagccaatgccttaccttcatcctcgga 406 Query: 436 gacagcccttagatgtgtcaggtcggacttgttaccgaccatcatgatgacaatgctgga 495 ||||||||||||||| ||| || ||||| ||||||||||||||||| |||||||| || Sbjct: 405 gacagcccttagatgaatcaaatcagacttattaccgaccatcatgataacaatgctcga 346 Query: 496 gtcagcgtgatcacggagctcatgcagccacctattaacattgtcaaagctctgcttctt 555 ||| || || || ||||||||| | |||||||| | |||||||| ||||||||| |||| Sbjct: 345 gtcggcatggtcgcggagctcacgaagccacctgtggacattgtcgaagctctgcctctt 286 Query: 556 tgtgatgtcatatacaaggagagcccctacagcgccccggtaatatgcgcttgtaattgc 615 ||||||||| || |||||||||||||| |||||||| ||||| || || ||||| || || Sbjct: 285 tgtgatgtcgtaaacaaggagagccccaacagcgccacggtagtaagcacttgtgatggc 226 Query: 616 acgatacctctcctgaccagctgtgtcccagatctgagcctttattgtttttccctccat 675 |||||| |||||||| || |||||||||||||||||||||||||||||||| |||||||| Sbjct: 225 acgatatctctcctgtcctgctgtgtcccagatctgagcctttattgttttgccctccat 166 Query: 676 ctgcaaggacttggtggcg 694 ||||| ||| ||||||||| Sbjct: 165 ctgcagggatttggtggcg 147
>dbj|D13152.1|RICRGP2 Oryza sativa (japonica cultivar-group) rgp2 mRNA for GTP binding protein, complete cds Length = 823 Score = 474 bits (239), Expect = e-130 Identities = 434/499 (86%) Strand = Plus / Minus Query: 196 gcagcatgccctctttgaattgcccacagtactgtcaacgctgatggttttaccctggga 255 ||||||||||||||||| || || ||| ||||||| |||||| |||||||||||||| Sbjct: 709 gcagcatgccctctttgtgtttcctgcagcgctgtcaatgctgatagttttaccctggga 650 Query: 256 aggcaatggaacagctgctgctgctgcttctttggcggccagtgctttcttgttgacaat 315 ||||| ||| || || || ||||||||||||||||||||||||||| |||| ||||| Sbjct: 649 aggcagcggacgagaagcagcagctgcttctttggcggccagtgctttcctgttaacaat 590 Query: 316 accatagacctctgtgatgatagtctgaaacgcttctaccacattcacagcctccatagc 375 ||||||||||||||||||||||||||||| ||||| |||||||||| ||||||||||| Sbjct: 589 gccatagacctctgtgatgatagtctgaaaggcttcctccacattcacggcctccatagc 530 Query: 376 tgatgtctcaaggaaaaacaggccctccttttctgccagtgccttgccttgatcctcaga 435 |||||||||||| |||||||| ||||||||||| |||| |||||| |||| |||||| || Sbjct: 529 tgatgtctcaagaaaaaacagcccctccttttcagccaatgccttaccttcatcctcgga 470 Query: 436 gacagcccttagatgtgtcaggtcggacttgttaccgaccatcatgatgacaatgctgga 495 ||||||||||||||| ||| || ||||| ||||||||||||||||| |||||||| || Sbjct: 469 gacagcccttagatgaatcaaatcagacttattaccgaccatcatgataacaatgctcga 410 Query: 496 gtcagcgtgatcacggagctcatgcagccacctattaacattgtcaaagctctgcttctt 555 ||| || || || ||||||||| | |||||||| | |||||||| ||||||||| |||| Sbjct: 409 gtcggcatggtcgcggagctcacgaagccacctgtggacattgtcgaagctctgcctctt 350 Query: 556 tgtgatgtcatatacaaggagagcccctacagcgccccggtaatatgcgcttgtaattgc 615 ||||||||| || |||||||||||||| |||||||| ||||| || || ||||| || || Sbjct: 349 tgtgatgtcgtaaacaaggagagccccaacagcgccacggtagtaagcacttgtgatggc 290 Query: 616 acgatacctctcctgaccagctgtgtcccagatctgagcctttattgtttttccctccat 675 |||||| |||||||| || |||||||||||||||||||||||||||||||| |||||||| Sbjct: 289 acgatatctctcctgtcctgctgtgtcccagatctgagcctttattgttttgccctccat 230 Query: 676 ctgcaaggacttggtggcg 694 ||||| ||| ||||||||| Sbjct: 229 ctgcagggatttggtggcg 211
>gb|AC130609.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone P0048F12, complete sequence Length = 139627 Score = 468 bits (236), Expect = e-128 Identities = 422/484 (87%) Strand = Plus / Plus Query: 196 gcagcatgccctctttgaattgcccacagtactgtcaacgctgatggttttaccctggga 255 ||||||||||||||||| || || ||| ||||||| |||||| |||||||||||||| Sbjct: 68019 gcagcatgccctctttgtgtttcctgcagcgctgtcaatgctgatagttttaccctggga 68078 Query: 256 aggcaatggaacagctgctgctgctgcttctttggcggccagtgctttcttgttgacaat 315 ||||| ||| ||| || || ||||||||||||||||||||||||||| |||| ||||| Sbjct: 68079 aggcagcggagcagaagcagcagctgcttctttggcggccagtgctttcctgttaacaat 68138 Query: 316 accatagacctctgtgatgatagtctgaaacgcttctaccacattcacagcctccatagc 375 ||||||||||||||||||||||||||||| ||||| |||||||||| ||||||||||| Sbjct: 68139 gccatagacctctgtgatgatagtctgaaaggcttcctccacattcacggcctccatagc 68198 Query: 376 tgatgtctcaaggaaaaacaggccctccttttctgccagtgccttgccttgatcctcaga 435 |||||||||||| |||||||| ||||||||||| |||| |||||| |||| |||||| || Sbjct: 68199 tgatgtctcaagaaaaaacagcccctccttttcagccaatgccttaccttcatcctcgga 68258 Query: 436 gacagcccttagatgtgtcaggtcggacttgttaccgaccatcatgatgacaatgctgga 495 ||||||||||||||| ||| || ||||| ||||||||||||||||| |||||||| || Sbjct: 68259 gacagcccttagatgaatcaaatcagacttattaccgaccatcatgataacaatgctcga 68318 Query: 496 gtcagcgtgatcacggagctcatgcagccacctattaacattgtcaaagctctgcttctt 555 ||| || || || ||||||||| | |||||||| | |||||||| ||||||||| |||| Sbjct: 68319 gtcggcatggtcgcggagctcacgaagccacctgtggacattgtcgaagctctgcctctt 68378 Query: 556 tgtgatgtcatatacaaggagagcccctacagcgccccggtaatatgcgcttgtaattgc 615 ||||||||| || |||||||||||||| |||||||| ||||| || || ||||| || || Sbjct: 68379 tgtgatgtcgtaaacaaggagagccccaacagcgccacggtagtaagcacttgtgatggc 68438 Query: 616 acgatacctctcctgaccagctgtgtcccagatctgagcctttattgtttttccctccat 675 |||||| |||||||| || |||||||||||||||||||||||||||||||| |||||||| Sbjct: 68439 acgatatctctcctgtcctgctgtgtcccagatctgagcctttattgttttgccctccat 68498 Query: 676 ctgc 679 |||| Sbjct: 68499 ctgc 68502
>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete sequence Length = 29737217 Score = 468 bits (236), Expect = e-128 Identities = 422/484 (87%) Strand = Plus / Plus Query: 196 gcagcatgccctctttgaattgcccacagtactgtcaacgctgatggttttaccctggga 255 ||||||||||||||||| || || ||| ||||||| |||||| |||||||||||||| Sbjct: 11623584 gcagcatgccctctttgtgtttcctgcagcgctgtcaatgctgatagttttaccctggga 11623643 Query: 256 aggcaatggaacagctgctgctgctgcttctttggcggccagtgctttcttgttgacaat 315 ||||| ||| ||| || || ||||||||||||||||||||||||||| |||| ||||| Sbjct: 11623644 aggcagcggagcagaagcagcagctgcttctttggcggccagtgctttcctgttaacaat 11623703 Query: 316 accatagacctctgtgatgatagtctgaaacgcttctaccacattcacagcctccatagc 375 ||||||||||||||||||||||||||||| ||||| |||||||||| ||||||||||| Sbjct: 11623704 gccatagacctctgtgatgatagtctgaaaggcttcctccacattcacggcctccatagc 11623763 Query: 376 tgatgtctcaaggaaaaacaggccctccttttctgccagtgccttgccttgatcctcaga 435 |||||||||||| |||||||| ||||||||||| |||| |||||| |||| |||||| || Sbjct: 11623764 tgatgtctcaagaaaaaacagcccctccttttcagccaatgccttaccttcatcctcgga 11623823 Query: 436 gacagcccttagatgtgtcaggtcggacttgttaccgaccatcatgatgacaatgctgga 495 ||||||||||||||| ||| || ||||| ||||||||||||||||| |||||||| || Sbjct: 11623824 gacagcccttagatgaatcaaatcagacttattaccgaccatcatgataacaatgctcga 11623883 Query: 496 gtcagcgtgatcacggagctcatgcagccacctattaacattgtcaaagctctgcttctt 555 ||| || || || ||||||||| | |||||||| | |||||||| ||||||||| |||| Sbjct: 11623884 gtcggcatggtcgcggagctcacgaagccacctgtggacattgtcgaagctctgcctctt 11623943 Query: 556 tgtgatgtcatatacaaggagagcccctacagcgccccggtaatatgcgcttgtaattgc 615 ||||||||| || |||||||||||||| |||||||| ||||| || || ||||| || || Sbjct: 11623944 tgtgatgtcgtaaacaaggagagccccaacagcgccacggtagtaagcacttgtgatggc 11624003 Query: 616 acgatacctctcctgaccagctgtgtcccagatctgagcctttattgtttttccctccat 675 |||||| |||||||| || |||||||||||||||||||||||||||||||| |||||||| Sbjct: 11624004 acgatatctctcctgtcctgctgtgtcccagatctgagcctttattgttttgccctccat 11624063 Query: 676 ctgc 679 |||| Sbjct: 11624064 ctgc 11624067 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 267 cagctgctgctgctgcttctt 287 ||||||||||||||||||||| Sbjct: 21820376 cagctgctgctgctgcttctt 21820396 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 268 agctgctgctgctgcttcttt 288 ||||||||||||||||||||| Sbjct: 64967 agctgctgctgctgcttcttt 64987 Score = 40.1 bits (20), Expect = 9.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 268 agctgctgctgctgcttctt 287 |||||||||||||||||||| Sbjct: 26915277 agctgctgctgctgcttctt 26915296 Score = 40.1 bits (20), Expect = 9.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 475 catcatgatgacaatgctgg 494 |||||||||||||||||||| Sbjct: 9006047 catcatgatgacaatgctgg 9006066
>gb|BT017614.1| Zea mays clone EL01N0433D01.c mRNA sequence Length = 1229 Score = 365 bits (184), Expect = 1e-97 Identities = 422/500 (84%), Gaps = 1/500 (0%) Strand = Plus / Minus Query: 196 gcagcatgccctctttgaattgcccacagtactgtcaacgctgatggttttaccctggga 255 ||||||||||||||||| || || |||| ||||||| |||||| ||||||||||||| Sbjct: 888 gcagcatgccctctttgtgtttcctgcagtgctgtcaatgctgataattttaccctggga 829 Query: 256 aggcaatggaacagctgctgctgctgcttctttggcggccagtgctttcttgttgacaat 315 ||||| | | ||| ||| ||||||||||||||||| ||||| |||||| |||||||||| Sbjct: 828 gggcaacgaagcagttgcagctgctgcttctttggcagccagcgctttcctgttgacaat 769 Query: 316 accatagacctctgtgatgatagtctgaaacgcttctaccacattcacagcctccatagc 375 ||||||||||| || ||||||||||| || |||| |||| || | |||||||||||| Sbjct: 768 gccatagacctccgtcatgatagtctggaaggcttgctccacgtttatagcctccatagc 709 Query: 376 tgatgtctcaaggaaaaacaggccctccttttctgccagtgccttgccttgatcctcaga 435 ||||||||| ||||| |||| |||||||| || |||| || ||||||| ||||||||| Sbjct: 708 tgatgtctcgaggaagaacaacccctccttctcagccaacgctttgccttcatcctcaga 649 Query: 436 gacagcccttagatgtgtcaggtcggacttgttaccgaccatcatgatgacaatgct-gg 494 || ||| || || || | ||||| || |||||||||||||||||||| ||||| || || Sbjct: 648 gatagctctcaggtggattaggtcagatttgttaccgaccatcatgatcacaatactggg 589 Query: 495 agtcagcgtgatcacggagctcatgcagccacctattaacattgtcaaagctctgcttct 554 ||||||| || || ||||| ||| | |||||||| | ||||||||| ||||||||| ||| Sbjct: 588 agtcagcatggtcgcggagttcacgaagccacctgtgaacattgtcgaagctctgcctct 529 Query: 555 ttgtgatgtcatatacaaggagagcccctacagcgccccggtaatatgcgcttgtaattg 614 |||||||||| || |||||||| || || || || || ||||| || || |||||||||| Sbjct: 528 ttgtgatgtcgtacacaaggagggctcccacggctccacggtagtaggcacttgtaattg 469 Query: 615 cacgatacctctcctgaccagctgtgtcccagatctgagcctttattgtttttccctcca 674 |||| ||||| ||||| ||||||||||||||||||||||||||||||||||| || |||| Sbjct: 468 cacggtacctttcctgcccagctgtgtcccagatctgagcctttattgttttgccgtcca 409 Query: 675 tctgcaaggacttggtggcg 694 |||||| ||||||||||||| Sbjct: 408 tctgcagggacttggtggcg 389
>gb|AY105457.1| Zea mays PCO149506 mRNA sequence Length = 1074 Score = 323 bits (163), Expect = 4e-85 Identities = 415/499 (83%) Strand = Plus / Minus Query: 196 gcagcatgccctctttgaattgcccacagtactgtcaacgctgatggttttaccctggga 255 |||||||||| |||||| ||| || || | ||||||| |||||||||||| ||||| || Sbjct: 801 gcagcatgccttctttgtatttcctgcattgctgtcaatgctgatggttttgccctgtga 742 Query: 256 aggcaatggaacagctgctgctgctgcttctttggcggccagtgctttcttgttgacaat 315 ||||||||| |||||| ||||||||||| ||||||||||| |||||| ||||||| || Sbjct: 741 aggcaatggggcagctgtggctgctgcttccttggcggccagcgctttcctgttgacgat 682 Query: 316 accatagacctctgtgatgatagtctgaaacgcttctaccacattcacagcctccatagc 375 ||||| ||||| ||||| |||||||| || ||||| |||| || | ||||||||||| Sbjct: 681 gccatacacctccgtgataatagtctggaaggcttcctccacgttgatggcctccatagc 622 Query: 376 tgatgtctcaaggaaaaacaggccctccttttctgccagtgccttgccttgatcctcaga 435 ||| ||||| ||||| ||||| || ||||| || |||| || ||||||| |||||||| Sbjct: 621 tgacgtctcgaggaagaacagcccttccttctcagccaacgctttgccttcgtcctcaga 562 Query: 436 gacagcccttagatgtgtcaggtcggacttgttaccgaccatcatgatgacaatgctgga 495 || ||| || | || |||||||||| ||||| || ||||||||||| || |||||||| Sbjct: 561 gatagctctcaagtggatcaggtcggatttgttgcccaccatcatgatcacgatgctgga 502 Query: 496 gtcagcgtgatcacggagctcatgcagccacctattaacattgtcaaagctctgcttctt 555 ||||||||| || ||||||||| | |||||||| | ||| ||||| ||||||||| |||| Sbjct: 501 gtcagcgtggtcgcggagctcacgaagccacctgtgaacgttgtcgaagctctgcctctt 442 Query: 556 tgtgatgtcatatacaaggagagcccctacagcgccccggtaatatgcgcttgtaattgc 615 |||||||| || ||||| || || | || ||||| ||||| || ||||||||||| || Sbjct: 441 cgtgatgtcgtacacaagcagggcggccacggcgccacggtagtaggcgcttgtaatcgc 382 Query: 616 acgatacctctcctgaccagctgtgtcccagatctgagcctttattgtttttccctccat 675 ||| ||||| ||||| ||||||||||||||||||||||||||||||||||| || || || Sbjct: 381 acggtacctttcctgcccagctgtgtcccagatctgagcctttattgttttgccgtcaat 322 Query: 676 ctgcaaggacttggtggcg 694 ||| | ||||||||||||| Sbjct: 321 ctgtagggacttggtggcg 303
>dbj|AK120316.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013055N09, full insert sequence Length = 673 Score = 165 bits (83), Expect = 2e-37 Identities = 128/143 (89%) Strand = Plus / Minus Query: 552 tctttgtgatgtcatatacaaggagagcccctacagcgccccggtaatatgcgcttgtaa 611 ||||||||||||| || |||||||||||||| |||||||| ||||| || || ||||| | Sbjct: 382 tctttgtgatgtcgtaaacaaggagagccccaacagcgccacggtagtaagcacttgtga 323 Query: 612 ttgcacgatacctctcctgaccagctgtgtcccagatctgagcctttattgtttttccct 671 | |||||||| |||||||| || |||||||||||||||||||||||||||||||| |||| Sbjct: 322 tggcacgatatctctcctgtcctgctgtgtcccagatctgagcctttattgttttgccct 263 Query: 672 ccatctgcaaggacttggtggcg 694 ||||||||| ||| ||||||||| Sbjct: 262 ccatctgcagggatttggtggcg 240
>gb|AY112323.1| Zea mays CL4152_2 mRNA sequence Length = 685 Score = 147 bits (74), Expect = 6e-32 Identities = 200/242 (82%) Strand = Plus / Plus Query: 196 gcagcatgccctctttgaattgcccacagtactgtcaacgctgatggttttaccctggga 255 ||||||||||||||||| || || |||| ||||||| |||||| ||||||||||||| Sbjct: 353 gcagcatgccctctttgtgtttcctgcagtgctgtcaatgctgataattttaccctggga 412 Query: 256 aggcaatggaacagctgctgctgctgcttctttggcggccagtgctttcttgttgacaat 315 ||||| | | ||| ||| ||||||||||||||||| ||||| |||||| |||||||||| Sbjct: 413 gggcaacgaagcagttgcagctgctgcttctttggcagccagcgctttcctgttgacaat 472 Query: 316 accatagacctctgtgatgatagtctgaaacgcttctaccacattcacagcctccatagc 375 ||||||||||| || ||||||||||| || |||| |||| || | |||||||||| | Sbjct: 473 gccatagacctccgtcatgatagtctggaaggcttgctccacgtttatagcctccataac 532 Query: 376 tgatgtctcaaggaaaaacaggccctccttttctgccagtgccttgccttgatcctcaga 435 ||||| ||| ||||| |||| |||||||| || |||| || |||||| ||||||||| Sbjct: 533 tgatggctcgaggaagaacaacccctccttctcagccaaagctctgccttcatcctcaga 592 Query: 436 ga 437 || Sbjct: 593 ga 594
>ref|NM_185154.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1026 Score = 111 bits (56), Expect = 3e-21 Identities = 164/200 (82%) Strand = Plus / Minus Query: 455 aggtcggacttgttaccgaccatcatgatgacaatgctggagtcagcgtgatcacggagc 514 ||||| || ||||| || |||||||| ||||||||| ||||||| || |||||||| || Sbjct: 521 aggtctgatttgttgcctaccatcataatgacaatgttggagtccgcatgatcacgaagt 462 Query: 515 tcatgcagccacctattaacattgtcaaagctctgcttctttgtgatgtcatatacaagg 574 ||| | |||||||| | | || ||||| ||||||||||||| |||||||| || || Sbjct: 461 tcacgaagccacctctggatgttttcaaacgtctgcttctttgttatgtcatagactaga 402 Query: 575 agagcccctacagcgccccggtaatatgcgcttgtaattgcacgatacctctcctgacca 634 || ||||| ||||| |||||||| || || ||||| |||||||| ||||||||||| ||| Sbjct: 401 agtgcccccacagctccccggtagtaagcacttgtgattgcacggtacctctcctgccca 342 Query: 635 gctgtgtcccagatctgagc 654 || || ||||| |||||||| Sbjct: 341 gcagtatcccatatctgagc 322
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 Length = 36102668 Score = 111 bits (56), Expect = 3e-21 Identities = 164/200 (82%) Strand = Plus / Plus Query: 455 aggtcggacttgttaccgaccatcatgatgacaatgctggagtcagcgtgatcacggagc 514 ||||| || ||||| || |||||||| ||||||||| ||||||| || |||||||| || Sbjct: 34289945 aggtctgatttgttgcctaccatcataatgacaatgttggagtccgcatgatcacgaagt 34290004 Query: 515 tcatgcagccacctattaacattgtcaaagctctgcttctttgtgatgtcatatacaagg 574 ||| | |||||||| | | || ||||| ||||||||||||| |||||||| || || Sbjct: 34290005 tcacgaagccacctctggatgttttcaaacgtctgcttctttgttatgtcatagactaga 34290064 Query: 575 agagcccctacagcgccccggtaatatgcgcttgtaattgcacgatacctctcctgacca 634 || ||||| ||||| |||||||| || || ||||| |||||||| ||||||||||| ||| Sbjct: 34290065 agtgcccccacagctccccggtagtaagcacttgtgattgcacggtacctctcctgccca 34290124 Query: 635 gctgtgtcccagatctgagc 654 || || ||||| |||||||| Sbjct: 34290125 gcagtatcccatatctgagc 34290144 Score = 42.1 bits (21), Expect = 2.4 Identities = 60/73 (82%) Strand = Plus / Plus Query: 587 gcgccccggtaatatgcgcttgtaattgcacgatacctctcctgaccagctgtgtcccag 646 ||||| ||||| ||||||||||| || || || |||| || || || ||||||||||| Sbjct: 35129540 gcgccgcggtagtatgcgcttgtgatggcccggtaccgttcttgcccggctgtgtcccat 35129599 Query: 647 atctgagccttta 659 ||||| ||||||| Sbjct: 35129600 atctgtgccttta 35129612 Score = 40.1 bits (20), Expect = 9.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 266 acagctgctgctgctgcttc 285 |||||||||||||||||||| Sbjct: 31661163 acagctgctgctgctgcttc 31661144 Score = 40.1 bits (20), Expect = 9.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 272 gctgctgctgcttctttggc 291 |||||||||||||||||||| Sbjct: 13106804 gctgctgctgcttctttggc 13106785
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete sequence Length = 36192742 Score = 111 bits (56), Expect = 3e-21 Identities = 164/200 (82%) Strand = Plus / Plus Query: 455 aggtcggacttgttaccgaccatcatgatgacaatgctggagtcagcgtgatcacggagc 514 ||||| || ||||| || |||||||| ||||||||| ||||||| || |||||||| || Sbjct: 34380417 aggtctgatttgttgcctaccatcataatgacaatgttggagtccgcatgatcacgaagt 34380476 Query: 515 tcatgcagccacctattaacattgtcaaagctctgcttctttgtgatgtcatatacaagg 574 ||| | |||||||| | | || ||||| ||||||||||||| |||||||| || || Sbjct: 34380477 tcacgaagccacctctggatgttttcaaacgtctgcttctttgttatgtcatagactaga 34380536 Query: 575 agagcccctacagcgccccggtaatatgcgcttgtaattgcacgatacctctcctgacca 634 || ||||| ||||| |||||||| || || ||||| |||||||| ||||||||||| ||| Sbjct: 34380537 agtgcccccacagctccccggtagtaagcacttgtgattgcacggtacctctcctgccca 34380596 Query: 635 gctgtgtcccagatctgagc 654 || || ||||| |||||||| Sbjct: 34380597 gcagtatcccatatctgagc 34380616 Score = 42.1 bits (21), Expect = 2.4 Identities = 60/73 (82%) Strand = Plus / Plus Query: 587 gcgccccggtaatatgcgcttgtaattgcacgatacctctcctgaccagctgtgtcccag 646 ||||| ||||| ||||||||||| || || || |||| || || || ||||||||||| Sbjct: 35219612 gcgccgcggtagtatgcgcttgtgatggcccggtaccgttcttgcccggctgtgtcccat 35219671 Query: 647 atctgagccttta 659 ||||| ||||||| Sbjct: 35219672 atctgtgccttta 35219684 Score = 40.1 bits (20), Expect = 9.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 266 acagctgctgctgctgcttc 285 |||||||||||||||||||| Sbjct: 31751679 acagctgctgctgctgcttc 31751660 Score = 40.1 bits (20), Expect = 9.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 272 gctgctgctgcttctttggc 291 |||||||||||||||||||| Sbjct: 13103579 gctgctgctgcttctttggc 13103560
>gb|AC093018.4| Oryza sativa chromosome 3 BAC OSJNBb0081B07 genomic sequence, complete sequence Length = 143205 Score = 111 bits (56), Expect = 3e-21 Identities = 164/200 (82%) Strand = Plus / Minus Query: 455 aggtcggacttgttaccgaccatcatgatgacaatgctggagtcagcgtgatcacggagc 514 ||||| || ||||| || |||||||| ||||||||| ||||||| || |||||||| || Sbjct: 45053 aggtctgatttgttgcctaccatcataatgacaatgttggagtccgcatgatcacgaagt 44994 Query: 515 tcatgcagccacctattaacattgtcaaagctctgcttctttgtgatgtcatatacaagg 574 ||| | |||||||| | | || ||||| ||||||||||||| |||||||| || || Sbjct: 44993 tcacgaagccacctctggatgttttcaaacgtctgcttctttgttatgtcatagactaga 44934 Query: 575 agagcccctacagcgccccggtaatatgcgcttgtaattgcacgatacctctcctgacca 634 || ||||| ||||| |||||||| || || ||||| |||||||| ||||||||||| ||| Sbjct: 44933 agtgcccccacagctccccggtagtaagcacttgtgattgcacggtacctctcctgccca 44874 Query: 635 gctgtgtcccagatctgagc 654 || || ||||| |||||||| Sbjct: 44873 gcagtatcccatatctgagc 44854
>dbj|AK067508.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013110L21, full insert sequence Length = 3009 Score = 111 bits (56), Expect = 3e-21 Identities = 164/200 (82%) Strand = Plus / Minus Query: 455 aggtcggacttgttaccgaccatcatgatgacaatgctggagtcagcgtgatcacggagc 514 ||||| || ||||| || |||||||| ||||||||| ||||||| || |||||||| || Sbjct: 2504 aggtctgatttgttgcctaccatcataatgacaatgttggagtccgcatgatcacgaagt 2445 Query: 515 tcatgcagccacctattaacattgtcaaagctctgcttctttgtgatgtcatatacaagg 574 ||| | |||||||| | | || ||||| ||||||||||||| |||||||| || || Sbjct: 2444 tcacgaagccacctctggatgttttcaaacgtctgcttctttgttatgtcatagactaga 2385 Query: 575 agagcccctacagcgccccggtaatatgcgcttgtaattgcacgatacctctcctgacca 634 || ||||| ||||| |||||||| || || ||||| |||||||| ||||||||||| ||| Sbjct: 2384 agtgcccccacagctccccggtagtaagcacttgtgattgcacggtacctctcctgccca 2325 Query: 635 gctgtgtcccagatctgagc 654 || || ||||| |||||||| Sbjct: 2324 gcagtatcccatatctgagc 2305
>dbj|AK061336.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-303-B12, full insert sequence Length = 1217 Score = 111 bits (56), Expect = 3e-21 Identities = 164/200 (82%) Strand = Plus / Minus Query: 455 aggtcggacttgttaccgaccatcatgatgacaatgctggagtcagcgtgatcacggagc 514 ||||| || ||||| || |||||||| ||||||||| ||||||| || |||||||| || Sbjct: 520 aggtctgatttgttgcctaccatcataatgacaatgttggagtccgcatgatcacgaagt 461 Query: 515 tcatgcagccacctattaacattgtcaaagctctgcttctttgtgatgtcatatacaagg 574 ||| | |||||||| | | || ||||| ||||||||||||| |||||||| || || Sbjct: 460 tcacgaagccacctctggatgttttcaaacgtctgcttctttgttatgtcatagactaga 401 Query: 575 agagcccctacagcgccccggtaatatgcgcttgtaattgcacgatacctctcctgacca 634 || ||||| ||||| |||||||| || || ||||| |||||||| ||||||||||| ||| Sbjct: 400 agtgcccccacagctccccggtagtaagcacttgtgattgcacggtacctctcctgccca 341 Query: 635 gctgtgtcccagatctgagc 654 || || ||||| |||||||| Sbjct: 340 gcagtatcccatatctgagc 321
>ref|NM_190607.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 651 Score = 97.6 bits (49), Expect = 5e-17 Identities = 160/197 (81%) Strand = Plus / Minus Query: 461 gacttgttaccgaccatcatgatgacaatgctggagtcagcgtgatcacggagctcatgc 520 |||||||| ||||||||||||| |||||| ||| ||| || || || |||||||| || Sbjct: 380 gacttgtttccgaccatcatgacaacaatgttggcgtctgcatggtcccggagctcccgc 321 Query: 521 agccacctattaacattgtcaaagctctgcttctttgtgatgtcatatacaaggagagcc 580 |||||||| | ||||||||| ||| | ||| ||||||| ||||| ||||||| || || Sbjct: 320 agccacctctgaacattgtcgaaggtttgcctctttgttatgtcgaatacaagaagtgct 261 Query: 581 cctacagcgccccggtaatatgcgcttgtaattgcacgatacctctcctgaccagctgtg 640 || || || |||| |||||| || || || |||||||| || ||||| ||||| || ||| Sbjct: 260 ccaactgcacccctgtaataagcactcgtgattgcacggtatctctcttgacctgccgtg 201 Query: 641 tcccagatctgagcctt 657 ||||| ||||||||||| Sbjct: 200 tcccatatctgagcctt 184
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete sequence Length = 43261740 Score = 97.6 bits (49), Expect = 5e-17 Identities = 160/197 (81%) Strand = Plus / Plus Query: 461 gacttgttaccgaccatcatgatgacaatgctggagtcagcgtgatcacggagctcatgc 520 |||||||| ||||||||||||| |||||| ||| ||| || || || |||||||| || Sbjct: 36461747 gacttgtttccgaccatcatgacaacaatgttggcgtctgcatggtcccggagctcccgc 36461806 Query: 521 agccacctattaacattgtcaaagctctgcttctttgtgatgtcatatacaaggagagcc 580 |||||||| | ||||||||| ||| | ||| ||||||| ||||| ||||||| || || Sbjct: 36461807 agccacctctgaacattgtcgaaggtttgcctctttgttatgtcgaatacaagaagtgct 36461866 Query: 581 cctacagcgccccggtaatatgcgcttgtaattgcacgatacctctcctgaccagctgtg 640 || || || |||| |||||| || || || |||||||| || ||||| ||||| || ||| Sbjct: 36461867 ccaactgcacccctgtaataagcactcgtgattgcacggtatctctcttgacctgccgtg 36461926 Query: 641 tcccagatctgagcctt 657 ||||| ||||||||||| Sbjct: 36461927 tcccatatctgagcctt 36461943 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 267 cagctgctgctgctgcttctt 287 ||||||||||||||||||||| Sbjct: 5131712 cagctgctgctgctgcttctt 5131692 Score = 42.1 bits (21), Expect = 2.4 Identities = 24/25 (96%) Strand = Plus / Minus Query: 268 agctgctgctgctgcttctttggcg 292 |||||||||||||||| |||||||| Sbjct: 4811983 agctgctgctgctgctgctttggcg 4811959 Score = 40.1 bits (20), Expect = 9.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 267 cagctgctgctgctgcttct 286 |||||||||||||||||||| Sbjct: 25505110 cagctgctgctgctgcttct 25505091 Score = 40.1 bits (20), Expect = 9.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 265 aacagctgctgctgctgctt 284 |||||||||||||||||||| Sbjct: 631639 aacagctgctgctgctgctt 631658
>dbj|AP004127.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, clone:P0005H10 Length = 142885 Score = 97.6 bits (49), Expect = 5e-17 Identities = 160/197 (81%) Strand = Plus / Plus Query: 461 gacttgttaccgaccatcatgatgacaatgctggagtcagcgtgatcacggagctcatgc 520 |||||||| ||||||||||||| |||||| ||| ||| || || || |||||||| || Sbjct: 113586 gacttgtttccgaccatcatgacaacaatgttggcgtctgcatggtcccggagctcccgc 113645 Query: 521 agccacctattaacattgtcaaagctctgcttctttgtgatgtcatatacaaggagagcc 580 |||||||| | ||||||||| ||| | ||| ||||||| ||||| ||||||| || || Sbjct: 113646 agccacctctgaacattgtcgaaggtttgcctctttgttatgtcgaatacaagaagtgct 113705 Query: 581 cctacagcgccccggtaatatgcgcttgtaattgcacgatacctctcctgaccagctgtg 640 || || || |||| |||||| || || || |||||||| || ||||| ||||| || ||| Sbjct: 113706 ccaactgcacccctgtaataagcactcgtgattgcacggtatctctcttgacctgccgtg 113765 Query: 641 tcccagatctgagcctt 657 ||||| ||||||||||| Sbjct: 113766 tcccatatctgagcctt 113782
>dbj|AK071303.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023087L18, full insert sequence Length = 1131 Score = 97.6 bits (49), Expect = 5e-17 Identities = 160/197 (81%) Strand = Plus / Minus Query: 461 gacttgttaccgaccatcatgatgacaatgctggagtcagcgtgatcacggagctcatgc 520 |||||||| ||||||||||||| |||||| ||| ||| || || || |||||||| || Sbjct: 562 gacttgtttccgaccatcatgacaacaatgttggcgtctgcatggtcccggagctcccgc 503 Query: 521 agccacctattaacattgtcaaagctctgcttctttgtgatgtcatatacaaggagagcc 580 |||||||| | ||||||||| ||| | ||| ||||||| ||||| ||||||| || || Sbjct: 502 agccacctctgaacattgtcgaaggtttgcctctttgttatgtcgaatacaagaagtgct 443 Query: 581 cctacagcgccccggtaatatgcgcttgtaattgcacgatacctctcctgaccagctgtg 640 || || || |||| |||||| || || || |||||||| || ||||| ||||| || ||| Sbjct: 442 ccaactgcacccctgtaataagcactcgtgattgcacggtatctctcttgacctgccgtg 383 Query: 641 tcccagatctgagcctt 657 ||||| ||||||||||| Sbjct: 382 tcccatatctgagcctt 366
>gb|BT023992.1| Zea mays clone EL01N0409D10 mRNA sequence Length = 1150 Score = 93.7 bits (47), Expect = 7e-16 Identities = 98/115 (85%) Strand = Plus / Minus Query: 453 tcaggtcggacttgttaccgaccatcatgatgacaatgctggagtcagcgtgatcacgga 512 |||||||||||||||| |||||||||||||| |||||| ||||||| ||||| ||||||| Sbjct: 512 tcaggtcggacttgttgccgaccatcatgatcacaatgttggagtccgcgtggtcacgga 453 Query: 513 gctcatgcagccacctattaacattgtcaaagctctgcttctttgtgatgtcata 567 |||| | |||||||| | | || ||||| |||||||||| ||||||||||| Sbjct: 452 gctcgcggagccacctctgtatgttttcaaatgtctgcttcttcgtgatgtcata 398
>emb|Z73951.1|LJRAB11C L.japonicus mRNA for small GTP-binding protein, RAB11C Length = 1031 Score = 85.7 bits (43), Expect = 2e-13 Identities = 115/139 (82%) Strand = Plus / Minus Query: 519 gcagccacctattaacattgtcaaagctctgcttctttgtgatgtcatatacaaggagag 578 |||||||||| | |||||||||||| | ||| |||| || ||||||||||||||||||| Sbjct: 519 gcagccacctctggacattgtcaaaggtttgcctcttagttatgtcatatacaaggagag 460 Query: 579 cccctacagcgccccggtaatatgcgcttgtaattgcacgatacctctcctgaccagctg 638 | || ||||| || | |||||| || || ||||| || ||||| | ||| ||||| |||| Sbjct: 459 caccaacagctcctctgtaataagcactggtaatggcgcgatatcgctcttgacctgctg 400 Query: 639 tgtcccagatctgagcctt 657 | ||||||||||| ||||| Sbjct: 399 tatcccagatctgtgcctt 381
>gb|AY110333.1| Zea mays CL8515_1 mRNA sequence Length = 1118 Score = 85.7 bits (43), Expect = 2e-13 Identities = 97/115 (84%) Strand = Plus / Plus Query: 453 tcaggtcggacttgttaccgaccatcatgatgacaatgctggagtcagcgtgatcacgga 512 |||||||||||||||| |||||||||||||| || ||| ||||||| ||||| ||||||| Sbjct: 613 tcaggtcggacttgttgccgaccatcatgatcacgatgttggagtccgcgtggtcacgga 672 Query: 513 gctcatgcagccacctattaacattgtcaaagctctgcttctttgtgatgtcata 567 |||| | |||||||| | | || ||||| |||||||||| ||||||||||| Sbjct: 673 gctcgcggagccacctctgtatgttttcaaatgtctgcttcttcgtgatgtcata 727
>gb|AY690483.1| Triticum aestivum rab GTP-binding protein mRNA, complete cds Length = 1280 Score = 77.8 bits (39), Expect = 4e-11 Identities = 57/63 (90%) Strand = Plus / Minus Query: 595 gtaatatgcgcttgtaattgcacgatacctctcctgaccagctgtgtcccagatctgagc 654 ||||||||||||||||||||||||||| ||||| || ||||| || ||||||||||| || Sbjct: 491 gtaatatgcgcttgtaattgcacgatatctctcttggccagccgtatcccagatctgcgc 432 Query: 655 ctt 657 ||| Sbjct: 431 ctt 429
>ref|NM_101553.2| Arabidopsis thaliana RAB11; GTP binding AT1G16920 (RAB11) mRNA, complete cds Length = 912 Score = 71.9 bits (36), Expect = 3e-09 Identities = 78/92 (84%) Strand = Plus / Minus Query: 563 tcatatacaaggagagcccctacagcgccccggtaatatgcgcttgtaattgcacgatac 622 |||||||| ||||| || || || || || ||||||||||| || || || ||||| ||| Sbjct: 383 tcatatactaggagtgcacccacggctccacggtaatatgcactagtgatggcacggtac 324 Query: 623 ctctcctgaccagctgtgtcccagatctgagc 654 |||||||||||||| |||||||| |||||||| Sbjct: 323 ctctcctgaccagcagtgtcccaaatctgagc 292
>gb|BT006406.1| Arabidopsis thaliana At1g16920 gene, complete cds Length = 651 Score = 71.9 bits (36), Expect = 3e-09 Identities = 78/92 (84%) Strand = Plus / Minus Query: 563 tcatatacaaggagagcccctacagcgccccggtaatatgcgcttgtaattgcacgatac 622 |||||||| ||||| || || || || || ||||||||||| || || || ||||| ||| Sbjct: 281 tcatatactaggagtgcacccacggctccacggtaatatgcactagtgatggcacggtac 222 Query: 623 ctctcctgaccagctgtgtcccagatctgagc 654 |||||||||||||| |||||||| |||||||| Sbjct: 221 ctctcctgaccagcagtgtcccaaatctgagc 190
>gb|AY086881.1| Arabidopsis thaliana clone 2904 mRNA, complete sequence Length = 895 Score = 71.9 bits (36), Expect = 3e-09 Identities = 78/92 (84%) Strand = Plus / Minus Query: 563 tcatatacaaggagagcccctacagcgccccggtaatatgcgcttgtaattgcacgatac 622 |||||||| ||||| || || || || || ||||||||||| || || || ||||| ||| Sbjct: 384 tcatatactaggagtgcacccacggctccacggtaatatgcactagtgatggcacggtac 325 Query: 623 ctctcctgaccagctgtgtcccagatctgagc 654 |||||||||||||| |||||||| |||||||| Sbjct: 324 ctctcctgaccagcagtgtcccaaatctgagc 293
>gb|L18883.1|ATHSGBP Arabidopsis thaliana small GTP-binding protein (Rab11) mRNA, complete cds Length = 854 Score = 71.9 bits (36), Expect = 3e-09 Identities = 78/92 (84%) Strand = Plus / Minus Query: 563 tcatatacaaggagagcccctacagcgccccggtaatatgcgcttgtaattgcacgatac 622 |||||||| ||||| || || || || || ||||||||||| || || || ||||| ||| Sbjct: 335 tcatatactaggagtgcacccacggctccacggtaatatgcactagtgatggcacggtac 276 Query: 623 ctctcctgaccagctgtgtcccagatctgagc 654 |||||||||||||| |||||||| |||||||| Sbjct: 275 ctctcctgaccagcagtgtcccaaatctgagc 244
>ref|NM_114550.2| Arabidopsis thaliana GTP binding AT3G46830 mRNA, complete cds Length = 1222 Score = 69.9 bits (35), Expect = 1e-08 Identities = 113/139 (81%) Strand = Plus / Minus Query: 519 gcagccacctattaacattgtcaaagctctgcttctttgtgatgtcatatacaaggagag 578 |||||||||| ||||||||||||| |||| |||| || ||||| || ||||| || | Sbjct: 535 gcagccaccttaaaacattgtcaaaggtctgtctcttagtaatgtcgtagacaagaagtg 476 Query: 579 cccctacagcgccccggtaatatgcgcttgtaattgcacgatacctctcctgaccagctg 638 | || || ||||| | |||||| |||||||| || || | |||||||||||||| || | Sbjct: 475 cacccactgcgcctctgtaatacgcgcttgtgatcgccctgtacctctcctgacctgcag 416 Query: 639 tgtcccagatctgagcctt 657 ||||||||||||| ||||| Sbjct: 415 tgtcccagatctgggcctt 397
>emb|Y08904.1|ATRAB11 A.thaliana mRNA for Rab11 protein Length = 1200 Score = 69.9 bits (35), Expect = 1e-08 Identities = 113/139 (81%) Strand = Plus / Minus Query: 519 gcagccacctattaacattgtcaaagctctgcttctttgtgatgtcatatacaaggagag 578 |||||||||| ||||||||||||| |||| |||| || ||||| || ||||| || | Sbjct: 492 gcagccaccttaaaacattgtcaaaggtctgtctcttagtaatgtcgtagacaagaagtg 433 Query: 579 cccctacagcgccccggtaatatgcgcttgtaattgcacgatacctctcctgaccagctg 638 | || || ||||| | |||||| |||||||| || || | |||||||||||||| || | Sbjct: 432 cacccactgcgcctctgtaatacgcgcttgtgatcgccctgtacctctcctgacctgcag 373 Query: 639 tgtcccagatctgagcctt 657 ||||||||||||| ||||| Sbjct: 372 tgtcccagatctgggcctt 354
>gb|AY096545.1| Arabidopsis thaliana putative GTP-binding protein Rab11 (At3g46830) mRNA, complete cds Length = 685 Score = 69.9 bits (35), Expect = 1e-08 Identities = 113/139 (81%) Strand = Plus / Minus Query: 519 gcagccacctattaacattgtcaaagctctgcttctttgtgatgtcatatacaaggagag 578 |||||||||| ||||||||||||| |||| |||| || ||||| || ||||| || | Sbjct: 322 gcagccaccttaaaacattgtcaaaggtctgtctcttagtaatgtcgtagacaagaagtg 263 Query: 579 cccctacagcgccccggtaatatgcgcttgtaattgcacgatacctctcctgaccagctg 638 | || || ||||| | |||||| |||||||| || || | |||||||||||||| || | Sbjct: 262 cacccactgcgcctctgtaatacgcgcttgtgatcgccctgtacctctcctgacctgcag 203 Query: 639 tgtcccagatctgagcctt 657 ||||||||||||| ||||| Sbjct: 202 tgtcccagatctgggcctt 184
>gb|AY065380.1| Arabidopsis thaliana putative GTP-binding protein Rab11 (At3g46830) mRNA, complete cds Length = 1177 Score = 69.9 bits (35), Expect = 1e-08 Identities = 113/139 (81%) Strand = Plus / Minus Query: 519 gcagccacctattaacattgtcaaagctctgcttctttgtgatgtcatatacaaggagag 578 |||||||||| ||||||||||||| |||| |||| || ||||| || ||||| || | Sbjct: 512 gcagccaccttaaaacattgtcaaaggtctgtctcttagtaatgtcgtagacaagaagtg 453 Query: 579 cccctacagcgccccggtaatatgcgcttgtaattgcacgatacctctcctgaccagctg 638 | || || ||||| | |||||| |||||||| || || | |||||||||||||| || | Sbjct: 452 cacccactgcgcctctgtaatacgcgcttgtgatcgccctgtacctctcctgacctgcag 393 Query: 639 tgtcccagatctgagcctt 657 ||||||||||||| ||||| Sbjct: 392 tgtcccagatctgggcctt 374
>emb|AL096859.2|ATT6H20 Arabidopsis thaliana DNA chromosome 3, BAC clone T6H20 Length = 98461 Score = 69.9 bits (35), Expect = 1e-08 Identities = 113/139 (81%) Strand = Plus / Minus Query: 519 gcagccacctattaacattgtcaaagctctgcttctttgtgatgtcatatacaaggagag 578 |||||||||| ||||||||||||| |||| |||| || ||||| || ||||| || | Sbjct: 47283 gcagccaccttaaaacattgtcaaaggtctgtctcttagtaatgtcgtagacaagaagtg 47224 Query: 579 cccctacagcgccccggtaatatgcgcttgtaattgcacgatacctctcctgaccagctg 638 | || || ||||| | |||||| |||||||| || || | |||||||||||||| || | Sbjct: 47223 cacccactgcgcctctgtaatacgcgcttgtgatcgccctgtacctctcctgacctgcag 47164 Query: 639 tgtcccagatctgagcctt 657 ||||||||||||| ||||| Sbjct: 47163 tgtcccagatctgggcctt 47145
>emb|BX822900.1|CNS0A74N Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB71ZA02 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1091 Score = 69.9 bits (35), Expect = 1e-08 Identities = 113/139 (81%) Strand = Plus / Minus Query: 519 gcagccacctattaacattgtcaaagctctgcttctttgtgatgtcatatacaaggagag 578 |||||||||| ||||||||||||| |||| |||| || ||||| || ||||| || | Sbjct: 444 gcagccaccttaaaacattgtcaaaggtctgtctcttagtaatgtcgtagacaagaagtg 385 Query: 579 cccctacagcgccccggtaatatgcgcttgtaattgcacgatacctctcctgaccagctg 638 | || || ||||| | |||||| |||||||| || || | |||||||||||||| || | Sbjct: 384 cacccactgcgcctctgtaatacgcgcttgtgatcgccctgtacctctcctgacctgcag 325 Query: 639 tgtcccagatctgagcctt 657 ||||||||||||| ||||| Sbjct: 324 tgtcccagatctgggcctt 306
>gb|AY087450.1| Arabidopsis thaliana clone 35596 mRNA, complete sequence Length = 1200 Score = 69.9 bits (35), Expect = 1e-08 Identities = 113/139 (81%) Strand = Plus / Minus Query: 519 gcagccacctattaacattgtcaaagctctgcttctttgtgatgtcatatacaaggagag 578 |||||||||| ||||||||||||| |||| |||| || ||||| || ||||| || | Sbjct: 536 gcagccaccttaaaacattgtcaaaggtctgtctcttagtaatgtcgtagacaagaagtg 477 Query: 579 cccctacagcgccccggtaatatgcgcttgtaattgcacgatacctctcctgaccagctg 638 | || || ||||| | |||||| |||||||| || || | |||||||||||||| || | Sbjct: 476 cacccactgcgcctctgtaatacgcgcttgtgatcgccctgtacctctcctgacctgcag 417 Query: 639 tgtcccagatctgagcctt 657 ||||||||||||| ||||| Sbjct: 416 tgtcccagatctgggcctt 398
>gb|BC087498.1| Xenopus laevis hypothetical LOC496163, mRNA (cDNA clone MGC:99345 IMAGE:7204147), complete cds Length = 1043 Score = 69.9 bits (35), Expect = 1e-08 Identities = 44/47 (93%) Strand = Plus / Minus Query: 623 ctctcctgaccagctgtgtcccagatctgagcctttattgtttttcc 669 |||||||| ||||||||||||||||||||||||||||| || ||||| Sbjct: 221 ctctcctgtccagctgtgtcccagatctgagcctttatagtctttcc 175
>gb|BC082421.1| Xenopus laevis hypothetical LOC494642, mRNA (cDNA clone MGC:83288 IMAGE:6863246), complete cds Length = 2003 Score = 69.9 bits (35), Expect = 1e-08 Identities = 44/47 (93%) Strand = Plus / Minus Query: 623 ctctcctgaccagctgtgtcccagatctgagcctttattgtttttcc 669 |||||||| ||||||||||||||||||||||||||||| || ||||| Sbjct: 232 ctctcctgtccagctgtgtcccagatctgagcctttatagtctttcc 186
>emb|CT032436.1| Platynereis dumerilii EST IB0AAA38BB01EM1 Length = 779 Score = 69.9 bits (35), Expect = 1e-08 Identities = 65/75 (86%) Strand = Plus / Minus Query: 595 gtaatatgcgcttgtaattgcacgatacctctcctgaccagctgtgtcccagatctgagc 654 ||||||||||||||| ||||| | ||||| |||||| ||||| || ||||| || ||||| Sbjct: 455 gtaatatgcgcttgttattgctctataccgctcctggccagcggtatcccaaatttgagc 396 Query: 655 ctttattgtttttcc 669 |||||| |||||||| Sbjct: 395 ctttatcgtttttcc 381
>gb|BC078572.1| Xenopus laevis RAB11B, member RAS oncogene family, mRNA (cDNA clone MGC:85466 IMAGE:6937536), complete cds Length = 1328 Score = 67.9 bits (34), Expect = 4e-08 Identities = 37/38 (97%) Strand = Plus / Minus Query: 623 ctctcctgaccagctgtgtcccagatctgagcctttat 660 |||||||| ||||||||||||||||||||||||||||| Sbjct: 288 ctctcctgtccagctgtgtcccagatctgagcctttat 251
>gb|BC041250.1| Xenopus laevis RAB11B, member RAS oncogene family, mRNA (cDNA clone MGC:52793 IMAGE:4724682), complete cds Length = 1563 Score = 67.9 bits (34), Expect = 4e-08 Identities = 37/38 (97%) Strand = Plus / Minus Query: 623 ctctcctgaccagctgtgtcccagatctgagcctttat 660 |||||||| ||||||||||||||||||||||||||||| Sbjct: 340 ctctcctgtccagctgtgtcccagatctgagcctttat 303
>gb|BC106308.1| Xenopus laevis similar to RAB3D, member RAS oncogene family, mRNA (cDNA clone MGC:130815 IMAGE:7983660), complete cds Length = 1582 Score = 65.9 bits (33), Expect = 2e-07 Identities = 57/65 (87%) Strand = Plus / Minus Query: 587 gcgccccggtaatatgcgcttgtaattgcacgatacctctcctgaccagctgtgtcccag 646 ||||| ||||||||||| |||| |||| || |||||||| |||||||||||||||||| Sbjct: 376 gcgccacggtaatatgctgttgtgattgtgcggtacctctcttgaccagctgtgtcccag 317 Query: 647 atctg 651 ||||| Sbjct: 316 atctg 312
>gb|BC043857.1| Xenopus laevis similar to RAB3D, member RAS oncogene family, mRNA (cDNA clone IMAGE:4889024), partial cds Length = 1569 Score = 65.9 bits (33), Expect = 2e-07 Identities = 57/65 (87%) Strand = Plus / Minus Query: 587 gcgccccggtaatatgcgcttgtaattgcacgatacctctcctgaccagctgtgtcccag 646 ||||| ||||||||||| |||| |||| || |||||||| |||||||||||||||||| Sbjct: 372 gcgccacggtaatatgctgttgtgattgtgcggtacctctcttgaccagctgtgtcccag 313 Query: 647 atctg 651 ||||| Sbjct: 312 atctg 308
>gb|AY110177.1| Zea mays CL8907_1 mRNA sequence Length = 659 Score = 65.9 bits (33), Expect = 2e-07 Identities = 75/89 (84%) Strand = Plus / Plus Query: 569 acaaggagagcccctacagcgccccggtaatatgcgcttgtaattgcacgatacctctcc 628 ||||| || |||||||| || || |||||||| || ||||| |||||||| ||||||||| Sbjct: 523 acaagcagtgcccctacggctcctcggtaataggcacttgtgattgcacggtacctctcc 582 Query: 629 tgaccagctgtgtcccagatctgagcctt 657 || || || |||||||| ||||| ||||| Sbjct: 583 tggccggcggtgtcccaaatctgggcctt 611
>gb|AY110109.1| Zea mays CL16448_2 mRNA sequence Length = 958 Score = 65.9 bits (33), Expect = 2e-07 Identities = 48/53 (90%) Strand = Plus / Minus Query: 605 cttgtaattgcacgatacctctcctgaccagctgtgtcccagatctgagcctt 657 ||||||||||| |||||||||||||| || || |||||||||||||| ||||| Sbjct: 308 cttgtaattgcccgatacctctcctggccggcggtgtcccagatctgggcctt 256
>gb|AY107805.1| Zea mays PCO073002 mRNA sequence Length = 1206 Score = 63.9 bits (32), Expect = 7e-07 Identities = 50/56 (89%) Strand = Plus / Minus Query: 605 cttgtaattgcacgatacctctcctgaccagctgtgtcccagatctgagcctttat 660 ||||||||||| || ||||||||||| ||||| ||||||||||| ||||| ||||| Sbjct: 392 cttgtaattgctcggtacctctcctgcccagcagtgtcccagatttgagcttttat 337
>dbj|D12545.1|PEAGTPBP06 Pisum sativum mRNA for GTP-binding protein, complete cds, clone:pra6 Length = 855 Score = 63.9 bits (32), Expect = 7e-07 Identities = 41/44 (93%) Strand = Plus / Minus Query: 614 gcacgatacctctcctgaccagctgtgtcccagatctgagcctt 657 |||||||||||||| |||||||| || ||||||||||||||||| Sbjct: 248 gcacgatacctctcttgaccagcagtatcccagatctgagcctt 205
>ref|XM_450547.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1200 Score = 61.9 bits (31), Expect = 3e-06 Identities = 52/59 (88%) Strand = Plus / Minus Query: 599 tatgcgcttgtaattgcacgatacctctcctgaccagctgtgtcccagatctgagcctt 657 ||||| |||||||| || |||||||||||||| || || |||||||||||||| ||||| Sbjct: 367 tatgcacttgtaatcgcccgatacctctcctggccggcggtgtcccagatctgggcctt 309
>dbj|AK071461.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023092H24, full insert sequence Length = 1200 Score = 61.9 bits (31), Expect = 3e-06 Identities = 52/59 (88%) Strand = Plus / Minus Query: 599 tatgcgcttgtaattgcacgatacctctcctgaccagctgtgtcccagatctgagcctt 657 ||||| |||||||| || |||||||||||||| || || |||||||||||||| ||||| Sbjct: 367 tatgcacttgtaatcgcccgatacctctcctggccggcggtgtcccagatctgggcctt 309
>ref|XM_475714.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 663 Score = 60.0 bits (30), Expect = 1e-05 Identities = 63/74 (85%) Strand = Plus / Minus Query: 584 acagcgccccggtaatatgcgcttgtaattgcacgatacctctcctgaccagctgtgtcc 643 ||||| ||||||||||| || || || || ||||||||||||||||| || || |||||| Sbjct: 272 acagctccccggtaataggcactagtgatagcacgatacctctcctggccggcggtgtcc 213 Query: 644 cagatctgagcctt 657 || ||||| ||||| Sbjct: 212 caaatctgggcctt 199
>gb|BT013111.1| Lycopersicon esculentum clone 114398R, mRNA sequence Length = 946 Score = 60.0 bits (30), Expect = 1e-05 Identities = 48/54 (88%) Strand = Plus / Minus Query: 463 cttgttaccgaccatcatgatgacaatgctggagtcagcgtgatcacggagctc 516 ||||||||| |||| ||| ||||||||||| ||||||| |||||| |||||||| Sbjct: 463 cttgttacccaccagcattatgacaatgctagagtcagtgtgatctcggagctc 410
>emb|Z73952.1|LJRAB11D L.japonicus mRNA for small GTP-binding protein, RAB11D Length = 1319 Score = 60.0 bits (30), Expect = 1e-05 Identities = 45/50 (90%) Strand = Plus / Minus Query: 608 gtaattgcacgatacctctcctgaccagctgtgtcccagatctgagcctt 657 ||||| ||||| ||||| ||||||||||| |||||||| ||||||||||| Sbjct: 483 gtaatggcacggtacctttcctgaccagcagtgtcccaaatctgagcctt 434
>emb|Z73949.1|LJRAB11A L.japonicus mRNA for small GTP-binding protein, RAB11A Length = 1009 Score = 60.0 bits (30), Expect = 1e-05 Identities = 63/74 (85%) Strand = Plus / Minus Query: 584 acagcgccccggtaatatgcgcttgtaattgcacgatacctctcctgaccagctgtgtcc 643 ||||| |||| ||||||||| ||||||| ||| | || || || |||||||| |||||| Sbjct: 333 acagcacccctgtaatatgcacttgtaactgctctgtatctttcttgaccagcagtgtcc 274 Query: 644 cagatctgagcctt 657 |||||||||||||| Sbjct: 273 cagatctgagcctt 260
>gb|AY896291.1| Trichomonas vaginalis strain G3 small Rab GTPase RabX7 gene, complete cds Length = 597 Score = 60.0 bits (30), Expect = 1e-05 Identities = 39/42 (92%) Strand = Plus / Minus Query: 611 attgcacgatacctctcctgaccagctgtgtcccagatctga 652 ||||||||||| ||||||||||||||||| ||||| |||||| Sbjct: 212 attgcacgatatctctcctgaccagctgtatcccaaatctga 171
>dbj|AK061969.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-042-H05, full insert sequence Length = 968 Score = 60.0 bits (30), Expect = 1e-05 Identities = 63/74 (85%) Strand = Plus / Minus Query: 584 acagcgccccggtaatatgcgcttgtaattgcacgatacctctcctgaccagctgtgtcc 643 ||||| ||||||||||| || || || || ||||||||||||||||| || || |||||| Sbjct: 324 acagctccccggtaataggcactagtgatagcacgatacctctcctggccggcggtgtcc 265 Query: 644 cagatctgagcctt 657 || ||||| ||||| Sbjct: 264 caaatctgggcctt 251
>dbj|AK060246.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-003-H10, full insert sequence Length = 1344 Score = 60.0 bits (30), Expect = 1e-05 Identities = 63/74 (85%) Strand = Plus / Minus Query: 584 acagcgccccggtaatatgcgcttgtaattgcacgatacctctcctgaccagctgtgtcc 643 ||||| ||||||||||| || || || || ||||||||||||||||| || || |||||| Sbjct: 315 acagctccccggtaataggcactagtgatagcacgatacctctcctggccggcggtgtcc 256 Query: 644 cagatctgagcctt 657 || ||||| ||||| Sbjct: 255 caaatctgggcctt 242
>emb|X79278.1|MSRAB M.sativa Rab mRNA Length = 894 Score = 58.0 bits (29), Expect = 4e-05 Identities = 47/53 (88%) Strand = Plus / Minus Query: 605 cttgtaattgcacgatacctctcctgaccagctgtgtcccagatctgagcctt 657 |||||||| || |||||||| || |||||||| || ||||||||||||||||| Sbjct: 272 cttgtaatggcgcgatacctttcttgaccagcagtatcccagatctgagcctt 220
>emb|AL116167.1|CNS01CZ3 Botrytis cinerea strain T4 cDNA library Length = 696 Score = 58.0 bits (29), Expect = 4e-05 Identities = 41/45 (91%) Strand = Plus / Minus Query: 463 cttgttaccgaccatcatgatgacaatgctggagtcagcgtgatc 507 |||||| ||||||| ||||||||||||| |||||||||| ||||| Sbjct: 410 cttgtttccgaccagcatgatgacaatgttggagtcagcatgatc 366
>ref|XM_860883.1| PREDICTED: Canis familiaris similar to RAB1B, member RAS oncogene family, transcript variant 5 (LOC610762), mRNA Length = 979 Score = 56.0 bits (28), Expect = 2e-04 Identities = 28/28 (100%) Strand = Plus / Minus Query: 625 ctcctgaccagctgtgtcccagatctga 652 |||||||||||||||||||||||||||| Sbjct: 345 ctcctgaccagctgtgtcccagatctga 318
>ref|XM_860865.1| PREDICTED: Canis familiaris similar to RAB1B, member RAS oncogene family, transcript variant 4 (LOC610762), mRNA Length = 483 Score = 56.0 bits (28), Expect = 2e-04 Identities = 28/28 (100%) Strand = Plus / Minus Query: 625 ctcctgaccagctgtgtcccagatctga 652 |||||||||||||||||||||||||||| Sbjct: 293 ctcctgaccagctgtgtcccagatctga 266
>ref|XM_860855.1| PREDICTED: Canis familiaris similar to RAB1B, member RAS oncogene family, transcript variant 3 (LOC610762), mRNA Length = 837 Score = 56.0 bits (28), Expect = 2e-04 Identities = 28/28 (100%) Strand = Plus / Minus Query: 625 ctcctgaccagctgtgtcccagatctga 652 |||||||||||||||||||||||||||| Sbjct: 293 ctcctgaccagctgtgtcccagatctga 266
>ref|XM_847452.1| PREDICTED: Canis familiaris similar to RAB1B, member RAS oncogene family, transcript variant 1 (LOC610762), mRNA Length = 1986 Score = 56.0 bits (28), Expect = 2e-04 Identities = 28/28 (100%) Strand = Plus / Minus Query: 625 ctcctgaccagctgtgtcccagatctga 652 |||||||||||||||||||||||||||| Sbjct: 345 ctcctgaccagctgtgtcccagatctga 318
>emb|Z29592.1|VFGNRPR3 V.faba mRNA for guanine nucleotide regulatory protein (807bp) Length = 807 Score = 56.0 bits (28), Expect = 2e-04 Identities = 40/44 (90%) Strand = Plus / Minus Query: 614 gcacgatacctctcctgaccagctgtgtcccagatctgagcctt 657 |||||||||||||| ||||| || || ||||||||||||||||| Sbjct: 281 gcacgatacctctcttgacccgcagtatcccagatctgagcctt 238
>ref|NM_112368.2| Arabidopsis thaliana GTP binding AT3G15060 mRNA, complete cds Length = 886 Score = 54.0 bits (27), Expect = 6e-04 Identities = 78/95 (82%) Strand = Plus / Minus Query: 563 tcatatacaaggagagcccctacagcgccccggtaatatgcgcttgtaattgcacgatac 622 ||||| ||||| | |||||| ||||| || || || ||||||||||| ||||| || || Sbjct: 338 tcataaacaagcaaagccccaacagctcctcgatagtatgcgcttgtgattgctcggtat 279 Query: 623 ctctcctgaccagctgtgtcccagatctgagcctt 657 ||||| || || || |||||||| ||||||||||| Sbjct: 278 ctctcttggccggcggtgtcccaaatctgagcctt 244
>ref|XM_510490.1| PREDICTED: Pan troglodytes similar to RAB11a, member RAS oncogene family (LOC453523), mRNA Length = 708 Score = 54.0 bits (27), Expect = 6e-04 Identities = 33/35 (94%) Strand = Plus / Minus Query: 635 gctgtgtcccagatctgagcctttattgtttttcc 669 ||||||||||| ||||| ||||||||||||||||| Sbjct: 260 gctgtgtcccatatctgtgcctttattgtttttcc 226
>ref|XM_526460.1| PREDICTED: Pan troglodytes similar to RAB6B, member RAS oncogene family (LOC471076), mRNA Length = 1107 Score = 54.0 bits (27), Expect = 6e-04 Identities = 27/27 (100%) Strand = Plus / Minus Query: 621 acctctcctgaccagctgtgtcccaga 647 ||||||||||||||||||||||||||| Sbjct: 121 acctctcctgaccagctgtgtcccaga 95
>ref|NM_031152.2| Rattus norvegicus RAB11a, member RAS oncogene family (Rab11a), mRNA Length = 2291 Score = 54.0 bits (27), Expect = 6e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 620 tacctctcctgaccagctgtgtcccagatctgagcctttattgtttt 666 |||| |||||| || ||||||||||| ||||| |||||||||||||| Sbjct: 283 taccgctcctgccctgctgtgtcccatatctgtgcctttattgtttt 237
>gb|BT020156.1| Synthetic construct Homo sapiens RAB11A, member RAS oncogene family mRNA, partial cds Length = 651 Score = 54.0 bits (27), Expect = 6e-04 Identities = 33/35 (94%) Strand = Plus / Minus Query: 635 gctgtgtcccagatctgagcctttattgtttttcc 669 ||||||||||| ||||| ||||||||||||||||| Sbjct: 203 gctgtgtcccatatctgtgcctttattgtttttcc 169
>gb|BT020154.1| Homo sapiens RAB11A, member RAS oncogene family mRNA, complete cds Length = 651 Score = 54.0 bits (27), Expect = 6e-04 Identities = 33/35 (94%) Strand = Plus / Minus Query: 635 gctgtgtcccagatctgagcctttattgtttttcc 669 ||||||||||| ||||| ||||||||||||||||| Sbjct: 203 gctgtgtcccatatctgtgcctttattgtttttcc 169
>gb|BT020153.1| Synthetic construct Homo sapiens RAB11A, member RAS oncogene family mRNA, partial cds Length = 651 Score = 54.0 bits (27), Expect = 6e-04 Identities = 33/35 (94%) Strand = Plus / Minus Query: 635 gctgtgtcccagatctgagcctttattgtttttcc 669 ||||||||||| ||||| ||||||||||||||||| Sbjct: 203 gctgtgtcccatatctgtgcctttattgtttttcc 169
>gb|BT020151.1| Homo sapiens RAB11A, member RAS oncogene family mRNA, complete cds Length = 651 Score = 54.0 bits (27), Expect = 6e-04 Identities = 33/35 (94%) Strand = Plus / Minus Query: 635 gctgtgtcccagatctgagcctttattgtttttcc 669 ||||||||||| ||||| ||||||||||||||||| Sbjct: 203 gctgtgtcccatatctgtgcctttattgtttttcc 169
>gb|BC074589.1| Xenopus tropicalis RAB3A, member RAS oncogene family, mRNA (cDNA clone MGC:69316 IMAGE:5308773), complete cds Length = 1602 Score = 54.0 bits (27), Expect = 6e-04 Identities = 51/59 (86%) Strand = Plus / Minus Query: 590 ccccggtaatatgcgcttgtaattgcacgatacctctcctgaccagctgtgtcccagat 648 |||||||||||||| |||| |||| || |||||||| || ||||||||||||||||| Sbjct: 400 ccccggtaatatgctgttgtgattgtgcggtacctctcttggccagctgtgtcccagat 342
>ref|XM_871338.1| PREDICTED: Bos taurus similar to RAB1, member RAS oncogene family (LOC619025), partial mRNA Length = 275 Score = 54.0 bits (27), Expect = 6e-04 Identities = 27/27 (100%) Strand = Plus / Minus Query: 626 tcctgaccagctgtgtcccagatctga 652 ||||||||||||||||||||||||||| Sbjct: 199 tcctgaccagctgtgtcccagatctga 173
>ref|NM_016577.3| Homo sapiens RAB6B, member RAS oncogene family (RAB6B), mRNA Length = 5561 Score = 54.0 bits (27), Expect = 6e-04 Identities = 27/27 (100%) Strand = Plus / Minus Query: 621 acctctcctgaccagctgtgtcccaga 647 ||||||||||||||||||||||||||| Sbjct: 604 acctctcctgaccagctgtgtcccaga 578
>gb|AY550123.1| Saussurea medusa GTP binding-protein-like mRNA, partial sequence Length = 667 Score = 54.0 bits (27), Expect = 6e-04 Identities = 51/59 (86%) Strand = Plus / Minus Query: 599 tatgcgcttgtaattgcacgatacctctcctgaccagctgtgtcccagatctgagcctt 657 ||||| |||||||||||||| |||| ||||| ||||| |||||||| ||||| ||||| Sbjct: 290 tatgcacttgtaattgcacggtaccgttcctggccagcagtgtcccaaatctgcgcctt 232
>ref|NM_017382.2| Mus musculus RAB11a, member RAS oncogene family (Rab11a), mRNA Length = 1401 Score = 54.0 bits (27), Expect = 6e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 620 tacctctcctgaccagctgtgtcccagatctgagcctttattgtttt 666 |||| |||||| || ||||||||||| ||||| |||||||||||||| Sbjct: 352 taccgctcctgccctgctgtgtcccatatctgtgcctttattgtttt 306
>ref|NM_004663.3| Homo sapiens RAB11A, member RAS oncogene family (RAB11A), mRNA Length = 2393 Score = 54.0 bits (27), Expect = 6e-04 Identities = 33/35 (94%) Strand = Plus / Minus Query: 635 gctgtgtcccagatctgagcctttattgtttttcc 669 ||||||||||| ||||| ||||||||||||||||| Sbjct: 331 gctgtgtcccatatctgtgcctttattgtttttcc 297
>ref|XM_987405.1| PREDICTED: Mus musculus RAB26, member RAS oncogene family (Rab26), mRNA Length = 1576 Score = 54.0 bits (27), Expect = 6e-04 Identities = 27/27 (100%) Strand = Plus / Minus Query: 625 ctcctgaccagctgtgtcccagatctg 651 ||||||||||||||||||||||||||| Sbjct: 690 ctcctgaccagctgtgtcccagatctg 664
>ref|XM_914497.2| PREDICTED: Mus musculus RAB26, member RAS oncogene family, transcript variant 4 (Rab26), mRNA Length = 1578 Score = 54.0 bits (27), Expect = 6e-04 Identities = 27/27 (100%) Strand = Plus / Minus Query: 625 ctcctgaccagctgtgtcccagatctg 651 ||||||||||||||||||||||||||| Sbjct: 690 ctcctgaccagctgtgtcccagatctg 664
>ref|XM_283428.5| PREDICTED: Mus musculus RAB26, member RAS oncogene family, transcript variant 1 (Rab26), mRNA Length = 1576 Score = 54.0 bits (27), Expect = 6e-04 Identities = 27/27 (100%) Strand = Plus / Minus Query: 625 ctcctgaccagctgtgtcccagatctg 651 ||||||||||||||||||||||||||| Sbjct: 690 ctcctgaccagctgtgtcccagatctg 664
>emb|CT025365.2| Xenopus tropicalis finished cDNA, clone TNeu138i16 Length = 1562 Score = 54.0 bits (27), Expect = 6e-04 Identities = 51/59 (86%) Strand = Plus / Minus Query: 590 ccccggtaatatgcgcttgtaattgcacgatacctctcctgaccagctgtgtcccagat 648 |||||||||||||| |||| |||| || |||||||| || ||||||||||||||||| Sbjct: 356 ccccggtaatatgctgttgtgattgtgcggtacctctcttggccagctgtgtcccagat 298
>ref|XM_744876.1| Aspergillus fumigatus Af293 Ras GTPase Rab11 (Afu1g02190) partial mRNA Length = 615 Score = 54.0 bits (27), Expect = 6e-04 Identities = 45/51 (88%) Strand = Plus / Minus Query: 463 cttgttaccgaccatcatgatgacaatgctggagtcagcgtgatcacggag 513 |||||| ||||| | ||||||||| ||| ||||||| |||||||||||||| Sbjct: 351 cttgttcccgacaagcatgatgacgatgttggagtcggcgtgatcacggag 301
>gb|AC132367.3| Mus musculus BAC clone RP23-465K21 from chromosome 17, complete sequence Length = 192971 Score = 54.0 bits (27), Expect = 6e-04 Identities = 27/27 (100%) Strand = Plus / Minus Query: 625 ctcctgaccagctgtgtcccagatctg 651 ||||||||||||||||||||||||||| Sbjct: 113799 ctcctgaccagctgtgtcccagatctg 113773
>gb|BC013348.2| Homo sapiens RAB11A, member RAS oncogene family, mRNA (cDNA clone MGC:1490 IMAGE:3510339), complete cds Length = 2465 Score = 54.0 bits (27), Expect = 6e-04 Identities = 33/35 (94%) Strand = Plus / Minus Query: 635 gctgtgtcccagatctgagcctttattgtttttcc 669 ||||||||||| ||||| ||||||||||||||||| Sbjct: 297 gctgtgtcccatatctgtgcctttattgtttttcc 263
>ref|NM_001005621.1| Xenopus tropicalis RAB3A, member RAS oncogene family (rab3a), mRNA Length = 1602 Score = 54.0 bits (27), Expect = 6e-04 Identities = 51/59 (86%) Strand = Plus / Minus Query: 590 ccccggtaatatgcgcttgtaattgcacgatacctctcctgaccagctgtgtcccagat 648 |||||||||||||| |||| |||| || |||||||| || ||||||||||||||||| Sbjct: 400 ccccggtaatatgctgttgtgattgtgcggtacctctcttggccagctgtgtcccagat 342
>gb|BT007615.1| Synthetic construct Homo sapiens RAB11A, member RAS oncogene family mRNA, partial cds Length = 651 Score = 54.0 bits (27), Expect = 6e-04 Identities = 33/35 (94%) Strand = Plus / Minus Query: 635 gctgtgtcccagatctgagcctttattgtttttcc 669 ||||||||||| ||||| ||||||||||||||||| Sbjct: 203 gctgtgtcccatatctgtgcctttattgtttttcc 169
>gb|BT007263.1| Homo sapiens RAB6B, member RAS oncogene family mRNA, complete cds Length = 627 Score = 54.0 bits (27), Expect = 6e-04 Identities = 27/27 (100%) Strand = Plus / Minus Query: 621 acctctcctgaccagctgtgtcccaga 647 ||||||||||||||||||||||||||| Sbjct: 223 acctctcctgaccagctgtgtcccaga 197
>emb|AJ720402.1| Gallus gallus mRNA for hypothetical protein, clone 16p4 Length = 2311 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 625 ctcctgaccagctgtgtcccagatctgagcctttattgt 663 |||||| || ||||||||||| ||||||||||||||||| Sbjct: 267 ctcctgccctgctgtgtcccatatctgagcctttattgt 229
>emb|CR859359.1| Pongo pygmaeus mRNA; cDNA DKFZp469L0820 (from clone DKFZp469L0820) Length = 2411 Score = 54.0 bits (27), Expect = 6e-04 Identities = 33/35 (94%) Strand = Plus / Minus Query: 635 gctgtgtcccagatctgagcctttattgtttttcc 669 ||||||||||| ||||| ||||||||||||||||| Sbjct: 336 gctgtgtcccatatctgtgcctttattgtttttcc 302
>gb|BC085727.1| Rattus norvegicus RAB11a, member RAS oncogene family, mRNA (cDNA clone MGC:93374 IMAGE:7189729), complete cds Length = 2291 Score = 54.0 bits (27), Expect = 6e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 620 tacctctcctgaccagctgtgtcccagatctgagcctttattgtttt 666 |||| |||||| || ||||||||||| ||||| |||||||||||||| Sbjct: 283 taccgctcctgccctgctgtgtcccatatctgtgcctttattgtttt 237
>gb|AC080128.21| Homo sapiens 3 BAC RP11-404G16 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 181241 Score = 54.0 bits (27), Expect = 6e-04 Identities = 27/27 (100%) Strand = Plus / Minus Query: 621 acctctcctgaccagctgtgtcccaga 647 ||||||||||||||||||||||||||| Sbjct: 97687 acctctcctgaccagctgtgtcccaga 97661
>emb|CR606451.1| full-length cDNA clone CS0DN001YM01 of Adult brain of Homo sapiens (human) Length = 2366 Score = 54.0 bits (27), Expect = 6e-04 Identities = 33/35 (94%) Strand = Plus / Minus Query: 635 gctgtgtcccagatctgagcctttattgtttttcc 669 ||||||||||| ||||| ||||||||||||||||| Sbjct: 324 gctgtgtcccatatctgtgcctttattgtttttcc 290
>gb|AF498946.1| Homo sapiens small GTP binding protein RAB11A (RAB11A) mRNA, complete cds Length = 651 Score = 54.0 bits (27), Expect = 6e-04 Identities = 33/35 (94%) Strand = Plus / Minus Query: 635 gctgtgtcccagatctgagcctttattgtttttcc 669 ||||||||||| ||||| ||||||||||||||||| Sbjct: 203 gctgtgtcccatatctgtgcctttattgtttttcc 169
>gb|AF498940.1| Homo sapiens small GTP binding protein RAB6B (RAB6B) mRNA, complete cds Length = 627 Score = 54.0 bits (27), Expect = 6e-04 Identities = 27/27 (100%) Strand = Plus / Minus Query: 621 acctctcctgaccagctgtgtcccaga 647 ||||||||||||||||||||||||||| Sbjct: 223 acctctcctgaccagctgtgtcccaga 197
>dbj|AK132159.1| Mus musculus 14, 17 days embryo head cDNA, RIKEN full-length enriched library, clone:3230402D22 product:RAB11a, member RAS oncogene family, full insert sequence Length = 2311 Score = 54.0 bits (27), Expect = 6e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 620 tacctctcctgaccagctgtgtcccagatctgagcctttattgtttt 666 |||| |||||| || ||||||||||| ||||| |||||||||||||| Sbjct: 337 taccgctcctgccctgctgtgtcccatatctgtgcctttattgtttt 291
>dbj|AK132072.1| Mus musculus 12 days embryo head cDNA, RIKEN full-length enriched library, clone:3010056K13 product:RAB11a, member RAS oncogene family, full insert sequence Length = 847 Score = 54.0 bits (27), Expect = 6e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 620 tacctctcctgaccagctgtgtcccagatctgagcctttattgtttt 666 |||| |||||| || ||||||||||| ||||| |||||||||||||| Sbjct: 335 taccgctcctgccctgctgtgtcccatatctgtgcctttattgtttt 289
>dbj|AK147122.1| Mus musculus 17 days pregnant adult female amnion cDNA, RIKEN full-length enriched library, clone:I920180J18 product:RAB11a, member RAS oncogene family, full insert sequence Length = 2333 Score = 54.0 bits (27), Expect = 6e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 620 tacctctcctgaccagctgtgtcccagatctgagcctttattgtttt 666 |||| |||||| || ||||||||||| ||||| |||||||||||||| Sbjct: 352 taccgctcctgccctgctgtgtcccatatctgtgcctttattgtttt 306
>gb|BC105393.1| Bos taurus cDNA clone MGC:128300 IMAGE:7960184, complete cds Length = 2022 Score = 54.0 bits (27), Expect = 6e-04 Identities = 27/27 (100%) Strand = Plus / Minus Query: 626 tcctgaccagctgtgtcccagatctga 652 ||||||||||||||||||||||||||| Sbjct: 250 tcctgaccagctgtgtcccagatctga 224
>emb|CR536493.1| Homo sapiens full open reading frame cDNA clone RZPDo834F1017D for gene RAB11A, RAB11A, member RAS oncogene family; complete cds, incl. stopcodon Length = 651 Score = 54.0 bits (27), Expect = 6e-04 Identities = 33/35 (94%) Strand = Plus / Minus Query: 635 gctgtgtcccagatctgagcctttattgtttttcc 669 ||||||||||| ||||| ||||||||||||||||| Sbjct: 203 gctgtgtcccatatctgtgcctttattgtttttcc 169
>emb|CR407669.1| Homo sapiens full open reading frame cDNA clone RZPDo834B053D for gene RAB11A, RAB11A, member RAS oncogene family complete cds, without stopcodon Length = 648 Score = 54.0 bits (27), Expect = 6e-04 Identities = 33/35 (94%) Strand = Plus / Minus Query: 635 gctgtgtcccagatctgagcctttattgtttttcc 669 ||||||||||| ||||| ||||||||||||||||| Sbjct: 203 gctgtgtcccatatctgtgcctttattgtttttcc 169
>dbj|AB169729.1| Macaca fascicularis brain cDNA, clone: QflA-11934, similar to human RAB11A, member RAS oncogene family (RAB11A), mRNA, RefSeq: NM_004663.3 Length = 2386 Score = 54.0 bits (27), Expect = 6e-04 Identities = 33/35 (94%) Strand = Plus / Minus Query: 635 gctgtgtcccagatctgagcctttattgtttttcc 669 ||||||||||| ||||| ||||||||||||||||| Sbjct: 306 gctgtgtcccatatctgtgcctttattgtttttcc 272
>dbj|AK080607.1| Mus musculus 10 days neonate cortex cDNA, RIKEN full-length enriched library, clone:A830020M03 product:hypothetical RAS small GTPases, Rab subfamily containing protein, full insert sequence Length = 1291 Score = 54.0 bits (27), Expect = 6e-04 Identities = 27/27 (100%) Strand = Plus / Minus Query: 625 ctcctgaccagctgtgtcccagatctg 651 ||||||||||||||||||||||||||| Sbjct: 528 ctcctgaccagctgtgtcccagatctg 502
>dbj|AK031143.1| Mus musculus 13 days embryo forelimb cDNA, RIKEN full-length enriched library, clone:5930413N01 product:RAB11a, member RAS oncogene family, full insert sequence Length = 2151 Score = 54.0 bits (27), Expect = 6e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 620 tacctctcctgaccagctgtgtcccagatctgagcctttattgtttt 666 |||| |||||| || ||||||||||| ||||| |||||||||||||| Sbjct: 255 taccgctcctgccctgctgtgtcccatatctgtgcctttattgtttt 209
>dbj|AK043912.1| Mus musculus 10 days neonate cortex cDNA, RIKEN full-length enriched library, clone:A830050A14 product:weakly similar to RAS-RELATED PROTEIN RAB-26 [Rattus norvegicus], full insert sequence Length = 1658 Score = 54.0 bits (27), Expect = 6e-04 Identities = 27/27 (100%) Strand = Plus / Minus Query: 625 ctcctgaccagctgtgtcccagatctg 651 ||||||||||||||||||||||||||| Sbjct: 513 ctcctgaccagctgtgtcccagatctg 487
>dbj|AK014268.1| Mus musculus 13 days embryo head cDNA, RIKEN full-length enriched library, clone:3110082B04 product:RAB11a, member RAS oncogene family, full insert sequence Length = 1401 Score = 54.0 bits (27), Expect = 6e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 620 tacctctcctgaccagctgtgtcccagatctgagcctttattgtttt 666 |||| |||||| || ||||||||||| ||||| |||||||||||||| Sbjct: 352 taccgctcctgccctgctgtgtcccatatctgtgcctttattgtttt 306
>gb|BC094931.1| Mus musculus RAB26, member RAS oncogene family, mRNA (cDNA clone MGC:107516 IMAGE:6436242), complete cds Length = 1366 Score = 54.0 bits (27), Expect = 6e-04 Identities = 27/27 (100%) Strand = Plus / Minus Query: 625 ctcctgaccagctgtgtcccagatctg 651 ||||||||||||||||||||||||||| Sbjct: 456 ctcctgaccagctgtgtcccagatctg 430
>gb|BT005565.1| Arabidopsis thaliana clone U51331 putative Ras family GTP-binding protein (At3g15060) mRNA, complete cds Length = 685 Score = 54.0 bits (27), Expect = 6e-04 Identities = 78/95 (82%) Strand = Plus / Minus Query: 563 tcatatacaaggagagcccctacagcgccccggtaatatgcgcttgtaattgcacgatac 622 ||||| ||||| | |||||| ||||| || || || ||||||||||| ||||| || || Sbjct: 281 tcataaacaagcaaagccccaacagctcctcgatagtatgcgcttgtgattgctcggtat 222 Query: 623 ctctcctgaccagctgtgtcccagatctgagcctt 657 ||||| || || || |||||||| ||||||||||| Sbjct: 221 ctctcttggccggcggtgtcccaaatctgagcctt 187
>gb|AC084854.11| Homo sapiens chromosome 15, clone CTD-3006F8, complete sequence Length = 145201 Score = 54.0 bits (27), Expect = 6e-04 Identities = 33/35 (94%) Strand = Plus / Minus Query: 635 gctgtgtcccagatctgagcctttattgtttttcc 669 ||||||||||| ||||| ||||||||||||||||| Sbjct: 114513 gctgtgtcccatatctgtgcctttattgtttttcc 114479
>gb|AF166492.1|AF166492 Homo sapiens small GTPase RAB6B (RAB6B) mRNA, complete cds Length = 1266 Score = 54.0 bits (27), Expect = 6e-04 Identities = 27/27 (100%) Strand = Plus / Minus Query: 621 acctctcctgaccagctgtgtcccaga 647 ||||||||||||||||||||||||||| Sbjct: 560 acctctcctgaccagctgtgtcccaga 534
>gb|AF127669.1|AF127669 Mus musculus small GTPase (Rab11a) gene, complete cds Length = 29145 Score = 54.0 bits (27), Expect = 6e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 620 tacctctcctgaccagctgtgtcccagatctgagcctttattgtttt 666 |||| |||||| || ||||||||||| ||||| |||||||||||||| Sbjct: 13813 taccgctcctgccctgctgtgtcccatatctgtgcctttattgtttt 13767
>gb|AY892733.1| Synthetic construct Homo sapiens clone FLH024443.01L RAB11A member RAS oncogene family (RAB11A) mRNA, partial cds Length = 651 Score = 54.0 bits (27), Expect = 6e-04 Identities = 33/35 (94%) Strand = Plus / Minus Query: 635 gctgtgtcccagatctgagcctttattgtttttcc 669 ||||||||||| ||||| ||||||||||||||||| Sbjct: 203 gctgtgtcccatatctgtgcctttattgtttttcc 169
>gb|AY889294.1| Synthetic construct Homo sapiens clone FLH110329.01X RAB6B (RAB6B) mRNA, complete cds Length = 627 Score = 54.0 bits (27), Expect = 6e-04 Identities = 27/27 (100%) Strand = Plus / Minus Query: 621 acctctcctgaccagctgtgtcccaga 647 ||||||||||||||||||||||||||| Sbjct: 223 acctctcctgaccagctgtgtcccaga 197
>gb|AY888201.1| Synthetic construct Homo sapiens clone FLH021754.01X RAB11A member RAS oncogene family (RAB11A) mRNA, complete cds Length = 651 Score = 54.0 bits (27), Expect = 6e-04 Identities = 33/35 (94%) Strand = Plus / Minus Query: 635 gctgtgtcccagatctgagcctttattgtttttcc 669 ||||||||||| ||||| ||||||||||||||||| Sbjct: 203 gctgtgtcccatatctgtgcctttattgtttttcc 169
>gb|AY888200.1| Synthetic construct Homo sapiens clone FLH021753.01X RAB11A member RAS oncogene family (RAB11A) mRNA, complete cds Length = 651 Score = 54.0 bits (27), Expect = 6e-04 Identities = 33/35 (94%) Strand = Plus / Minus Query: 635 gctgtgtcccagatctgagcctttattgtttttcc 669 ||||||||||| ||||| ||||||||||||||||| Sbjct: 203 gctgtgtcccatatctgtgcctttattgtttttcc 169
>dbj|AK109344.2| Oryza sativa (japonica cultivar-group) cDNA clone:006-203-A06, full insert sequence Length = 1091 Score = 54.0 bits (27), Expect = 6e-04 Identities = 78/95 (82%) Strand = Plus / Minus Query: 563 tcatatacaaggagagcccctacagcgccccggtaatatgcgcttgtaattgcacgatac 622 ||||| |||| ||| |||||||| || || || || |||||||||||||| || ||||| Sbjct: 457 tcatagacaacgagtgcccctactgctccgcgatagtatgcgcttgtaatagctcgatat 398 Query: 623 ctctcctgaccagctgtgtcccagatctgagcctt 657 || || || || || |||||||||||||| ||||| Sbjct: 397 ctttcttgcccggcggtgtcccagatctgggcctt 363
>gb|AY890779.1| Synthetic construct Homo sapiens clone FLH021751.01L RAB11A member RAS oncogene family (RAB11A) mRNA, partial cds Length = 651 Score = 54.0 bits (27), Expect = 6e-04 Identities = 33/35 (94%) Strand = Plus / Minus Query: 635 gctgtgtcccagatctgagcctttattgtttttcc 669 ||||||||||| ||||| ||||||||||||||||| Sbjct: 203 gctgtgtcccatatctgtgcctttattgtttttcc 169
>gb|AY890778.1| Synthetic construct Homo sapiens clone FLH021750.01L RAB11A member RAS oncogene family (RAB11A) mRNA, partial cds Length = 651 Score = 54.0 bits (27), Expect = 6e-04 Identities = 33/35 (94%) Strand = Plus / Minus Query: 635 gctgtgtcccagatctgagcctttattgtttttcc 669 ||||||||||| ||||| ||||||||||||||||| Sbjct: 203 gctgtgtcccatatctgtgcctttattgtttttcc 169
>dbj|AK118727.1| Arabidopsis thaliana At3g15060 mRNA for putative ras-related GTP-binding protein, complete cds, clone: RAFL21-06-O17 Length = 867 Score = 54.0 bits (27), Expect = 6e-04 Identities = 78/95 (82%) Strand = Plus / Minus Query: 563 tcatatacaaggagagcccctacagcgccccggtaatatgcgcttgtaattgcacgatac 622 ||||| ||||| | |||||| ||||| || || || ||||||||||| ||||| || || Sbjct: 338 tcataaacaagcaaagccccaacagctcctcgatagtatgcgcttgtgattgctcggtat 279 Query: 623 ctctcctgaccagctgtgtcccagatctgagcctt 657 ||||| || || || |||||||| ||||||||||| Sbjct: 278 ctctcttggccggcggtgtcccaaatctgagcctt 244
>dbj|AK073075.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033007H18, full insert sequence Length = 1124 Score = 54.0 bits (27), Expect = 6e-04 Identities = 78/95 (82%) Strand = Plus / Minus Query: 563 tcatatacaaggagagcccctacagcgccccggtaatatgcgcttgtaattgcacgatac 622 ||||| |||| ||| |||||||| || || || || |||||||||||||| || ||||| Sbjct: 463 tcatagacaacgagtgcccctactgctccgcgatagtatgcgcttgtaatagctcgatat 404 Query: 623 ctctcctgaccagctgtgtcccagatctgagcctt 657 || || || || || |||||||||||||| ||||| Sbjct: 403 ctttcttgcccggcggtgtcccagatctgggcctt 369
>gb|BC002510.2| Homo sapiens RAB6B, member RAS oncogene family, mRNA (cDNA clone MGC:829 IMAGE:3050592), complete cds Length = 1261 Score = 54.0 bits (27), Expect = 6e-04 Identities = 27/27 (100%) Strand = Plus / Minus Query: 621 acctctcctgaccagctgtgtcccaga 647 ||||||||||||||||||||||||||| Sbjct: 573 acctctcctgaccagctgtgtcccaga 547
>ref|NM_001005827.1| Gallus gallus RAB11A, member RAS oncogene family (RAB11A), mRNA Length = 2311 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 625 ctcctgaccagctgtgtcccagatctgagcctttattgt 663 |||||| || ||||||||||| ||||||||||||||||| Sbjct: 267 ctcctgccctgctgtgtcccatatctgagcctttattgt 229
>emb|CR848349.2| Xenopus tropicalis finished cDNA, clone TNeu085g12 Length = 2936 Score = 54.0 bits (27), Expect = 6e-04 Identities = 30/31 (96%) Strand = Plus / Minus Query: 621 acctctcctgaccagctgtgtcccagatctg 651 |||||||||| |||||||||||||||||||| Sbjct: 1934 acctctcctggccagctgtgtcccagatctg 1904
>emb|CR926288.2| Xenopus tropicalis finished cDNA, clone TEgg143e20 Length = 2054 Score = 54.0 bits (27), Expect = 6e-04 Identities = 30/31 (96%) Strand = Plus / Minus Query: 621 acctctcctgaccagctgtgtcccagatctg 651 |||||||||| |||||||||||||||||||| Sbjct: 1051 acctctcctggccagctgtgtcccagatctg 1021
>gb|AC092498.8| Mus musculus strain C57BL/6J chromosome 9 clone rp23-21l18, complete sequence Length = 233208 Score = 54.0 bits (27), Expect = 6e-04 Identities = 42/47 (89%) Strand = Plus / Plus Query: 620 tacctctcctgaccagctgtgtcccagatctgagcctttattgtttt 666 |||| |||||| || ||||||||||| ||||| |||||||||||||| Sbjct: 151064 taccgctcctgccctgctgtgtcccatatctgtgcctttattgtttt 151110
>gb|AF000231.1|AF000231 Homo sapiens rab11a GTPase mRNA, complete cds Length = 2333 Score = 54.0 bits (27), Expect = 6e-04 Identities = 33/35 (94%) Strand = Plus / Minus Query: 635 gctgtgtcccagatctgagcctttattgtttttcc 669 ||||||||||| ||||| ||||||||||||||||| Sbjct: 270 gctgtgtcccatatctgtgcctttattgtttttcc 236
>gb|BC078662.1| Homo sapiens RAB6B, member RAS oncogene family, mRNA (cDNA clone MGC:88263 IMAGE:6450986), complete cds Length = 5395 Score = 54.0 bits (27), Expect = 6e-04 Identities = 27/27 (100%) Strand = Plus / Minus Query: 621 acctctcctgaccagctgtgtcccaga 647 ||||||||||||||||||||||||||| Sbjct: 352 acctctcctgaccagctgtgtcccaga 326
>gb|BC010722.1| Mus musculus RAB11a, member RAS oncogene family, mRNA (cDNA clone MGC:6317 IMAGE:2811973), complete cds Length = 903 Score = 54.0 bits (27), Expect = 6e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 620 tacctctcctgaccagctgtgtcccagatctgagcctttattgtttt 666 |||| |||||| || ||||||||||| ||||| |||||||||||||| Sbjct: 340 taccgctcctgccctgctgtgtcccatatctgtgcctttattgtttt 294
>gb|AC147560.3| Mus musculus BAC clone RP23-451A8 from 9, complete sequence Length = 177220 Score = 54.0 bits (27), Expect = 6e-04 Identities = 42/47 (89%) Strand = Plus / Plus Query: 620 tacctctcctgaccagctgtgtcccagatctgagcctttattgtttt 666 |||| |||||| || ||||||||||| ||||| |||||||||||||| Sbjct: 136429 taccgctcctgccctgctgtgtcccatatctgtgcctttattgtttt 136475
>gb|L29269.1|TOBNTRAB Nicotiana tabacum SR1 Nt-rab11b mRNA, complete cds Length = 924 Score = 54.0 bits (27), Expect = 6e-04 Identities = 51/59 (86%) Strand = Plus / Minus Query: 599 tatgcgcttgtaattgcacgatacctctcctgaccagctgtgtcccagatctgagcctt 657 ||||| |||||||||||||| ||||| || || ||||| |||||||| ||||| ||||| Sbjct: 260 tatgcacttgtaattgcacggtacctttcttggccagcagtgtcccaaatctgggcctt 202
>emb|X53143.1|HSRASLP Human YL8 mRNA for ras-like protein Length = 651 Score = 54.0 bits (27), Expect = 6e-04 Identities = 33/35 (94%) Strand = Plus / Minus Query: 635 gctgtgtcccagatctgagcctttattgtttttcc 669 ||||||||||| ||||| ||||||||||||||||| Sbjct: 203 gctgtgtcccatatctgtgcctttattgtttttcc 169
>gb|M75153.1|RATRASP21 R.norvegicus ras p21-like small GTP-binding protein (24KG) mRNA, complete cds Length = 895 Score = 54.0 bits (27), Expect = 6e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 620 tacctctcctgaccagctgtgtcccagatctgagcctttattgtttt 666 |||| |||||| || ||||||||||| ||||| |||||||||||||| Sbjct: 218 taccgctcctgccctgctgtgtcccatatctgtgcctttattgtttt 172
>emb|X56740.1|HSMRAB11 H.sapiens mRNA for Rab11 gene Length = 850 Score = 54.0 bits (27), Expect = 6e-04 Identities = 33/35 (94%) Strand = Plus / Minus Query: 635 gctgtgtcccagatctgagcctttattgtttttcc 669 ||||||||||| ||||| ||||||||||||||||| Sbjct: 256 gctgtgtcccatatctgtgcctttattgtttttcc 222
>ref|NM_111620.3| Arabidopsis thaliana GTP binding AT3G07410 mRNA, complete cds Length = 896 Score = 52.0 bits (26), Expect = 0.002 Identities = 32/34 (94%) Strand = Plus / Minus Query: 621 acctctcctgaccagctgtgtcccagatctgagc 654 ||||||| |||||||| ||||||||||||||||| Sbjct: 294 acctctcttgaccagcagtgtcccagatctgagc 261
>ref|NM_001003276.2| Canis familiaris RAB11A, member RAS oncogene family (RAB11A), mRNA Length = 926 Score = 52.0 bits (26), Expect = 0.002 Identities = 38/42 (90%) Strand = Plus / Minus Query: 625 ctcctgaccagctgtgtcccagatctgagcctttattgtttt 666 |||||| || ||||||||||| ||||| |||||||||||||| Sbjct: 228 ctcctgccctgctgtgtcccatatctgtgcctttattgtttt 187
>ref|XM_513873.1| PREDICTED: Pan troglodytes LOC457382 (LOC457382), mRNA Length = 847 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 632 ccagctgtgtcccagatctgagcctt 657 |||||||||||||||||||||||||| Sbjct: 435 ccagctgtgtcccagatctgagcctt 410
>gb|BC085270.1| Mus musculus RAB11B, member RAS oncogene family, mRNA (cDNA clone MGC:103195 IMAGE:6478784), complete cds Length = 1789 Score = 52.0 bits (26), Expect = 0.002 Identities = 44/50 (88%) Strand = Plus / Minus Query: 608 gtaattgcacgatacctctcctgaccagctgtgtcccagatctgagcctt 657 ||||| ||||| || | |||||| ||||| |||||||||||||||||||| Sbjct: 263 gtaatggcacggtagcgctcctggccagcagtgtcccagatctgagcctt 214
>ref|NM_001016481.2| Xenopus tropicalis hypothetical protein LOC549235 (LOC549235), mRNA Length = 1115 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Minus Query: 625 ctcctgaccagctgtgtcccagatctgagc 654 |||||| ||||||||||||||||||||||| Sbjct: 263 ctcctgtccagctgtgtcccagatctgagc 234
>gb|BC054753.1| Mus musculus RAB11B, member RAS oncogene family, mRNA (cDNA clone MGC:65651 IMAGE:6411651), complete cds Length = 1788 Score = 52.0 bits (26), Expect = 0.002 Identities = 44/50 (88%) Strand = Plus / Minus Query: 608 gtaattgcacgatacctctcctgaccagctgtgtcccagatctgagcctt 657 ||||| ||||| || | |||||| ||||| |||||||||||||||||||| Sbjct: 270 gtaatggcacggtagcgctcctggccagcagtgtcccagatctgagcctt 221
>ref|NM_008997.1| Mus musculus RAB11B, member RAS oncogene family (Rab11b), mRNA Length = 1763 Score = 52.0 bits (26), Expect = 0.002 Identities = 44/50 (88%) Strand = Plus / Minus Query: 608 gtaattgcacgatacctctcctgaccagctgtgtcccagatctgagcctt 657 ||||| ||||| || | |||||| ||||| |||||||||||||||||||| Sbjct: 265 gtaatggcacggtagcgctcctggccagcagtgtcccagatctgagcctt 216
>ref|NM_020387.1| Homo sapiens RAB25, member RAS oncogene family (RAB25), mRNA Length = 1022 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 632 ccagctgtgtcccagatctgagcctt 657 |||||||||||||||||||||||||| Sbjct: 422 ccagctgtgtcccagatctgagcctt 397
>gb|BC084173.1| Xenopus tropicalis RAB11B, member RAS oncogene family, mRNA (cDNA clone MGC:79602 IMAGE:6979289), complete cds Length = 2133 Score = 52.0 bits (26), Expect = 0.002 Identities = 35/38 (92%) Strand = Plus / Minus Query: 623 ctctcctgaccagctgtgtcccagatctgagcctttat 660 ||||| || ||||| ||||||||||||||||||||||| Sbjct: 365 ctctcttgtccagccgtgtcccagatctgagcctttat 328
>ref|XM_978616.1| PREDICTED: Mus musculus similar to Ras-related protein Rab-11B, transcript variant 1 (LOC669667), mRNA Length = 1618 Score = 52.0 bits (26), Expect = 0.002 Identities = 44/50 (88%) Strand = Plus / Minus Query: 608 gtaattgcacgatacctctcctgaccagctgtgtcccagatctgagcctt 657 ||||| ||||| || | |||||| ||||| |||||||||||||||||||| Sbjct: 199 gtaatggcacggtagcgctcctggccagcagtgtcccagatctgagcctt 150
>ref|XM_978657.1| PREDICTED: Mus musculus similar to Ras-related protein Rab-11B, transcript variant 2 (LOC669667), mRNA Length = 1618 Score = 52.0 bits (26), Expect = 0.002 Identities = 44/50 (88%) Strand = Plus / Minus Query: 608 gtaattgcacgatacctctcctgaccagctgtgtcccagatctgagcctt 657 ||||| ||||| || | |||||| ||||| |||||||||||||||||||| Sbjct: 199 gtaatggcacggtagcgctcctggccagcagtgtcccagatctgagcctt 150
>ref|XM_978704.1| PREDICTED: Mus musculus similar to Ras-related protein Rab-11B, transcript variant 3 (LOC669667), mRNA Length = 1750 Score = 52.0 bits (26), Expect = 0.002 Identities = 44/50 (88%) Strand = Plus / Minus Query: 608 gtaattgcacgatacctctcctgaccagctgtgtcccagatctgagcctt 657 ||||| ||||| || | |||||| ||||| |||||||||||||||||||| Sbjct: 331 gtaatggcacggtagcgctcctggccagcagtgtcccagatctgagcctt 282
>ref|XM_979097.1| PREDICTED: Mus musculus similar to Ras-related protein Rab-11B, transcript variant 1 (LOC665419), mRNA Length = 1618 Score = 52.0 bits (26), Expect = 0.002 Identities = 44/50 (88%) Strand = Plus / Minus Query: 608 gtaattgcacgatacctctcctgaccagctgtgtcccagatctgagcctt 657 ||||| ||||| || | |||||| ||||| |||||||||||||||||||| Sbjct: 199 gtaatggcacggtagcgctcctggccagcagtgtcccagatctgagcctt 150
>ref|XM_979126.1| PREDICTED: Mus musculus similar to Ras-related protein Rab-11B, transcript variant 2 (LOC665419), mRNA Length = 1618 Score = 52.0 bits (26), Expect = 0.002 Identities = 44/50 (88%) Strand = Plus / Minus Query: 608 gtaattgcacgatacctctcctgaccagctgtgtcccagatctgagcctt 657 ||||| ||||| || | |||||| ||||| |||||||||||||||||||| Sbjct: 199 gtaatggcacggtagcgctcctggccagcagtgtcccagatctgagcctt 150
>ref|XM_979168.1| PREDICTED: Mus musculus similar to Ras-related protein Rab-11B, transcript variant 3 (LOC665419), mRNA Length = 1750 Score = 52.0 bits (26), Expect = 0.002 Identities = 44/50 (88%) Strand = Plus / Minus Query: 608 gtaattgcacgatacctctcctgaccagctgtgtcccagatctgagcctt 657 ||||| ||||| || | |||||| ||||| |||||||||||||||||||| Sbjct: 331 gtaatggcacggtagcgctcctggccagcagtgtcccagatctgagcctt 282
>ref|XM_538888.2| PREDICTED: Canis familiaris similar to RAS and EF hand domain containing (LOC481767), mRNA Length = 2472 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 620 tacctctcctgaccagctgtgtccca 645 |||||||||||||||||||||||||| Sbjct: 2057 tacctctcctgaccagctgtgtccca 2032
>gb|AC009853.4|ATAC009853 Arabidopsis thaliana chromosome III BAC F21O3 genomic sequence, complete sequence Length = 90112 Score = 52.0 bits (26), Expect = 0.002 Identities = 32/34 (94%) Strand = Plus / Plus Query: 621 acctctcctgaccagctgtgtcccagatctgagc 654 ||||||| |||||||| ||||||||||||||||| Sbjct: 48013 acctctcttgaccagcagtgtcccagatctgagc 48046
>gb|AC129188.3| Mus musculus BAC clone RP23-446G23 from chromosome 19, complete sequence Length = 175245 Score = 52.0 bits (26), Expect = 0.002 Identities = 44/50 (88%) Strand = Plus / Plus Query: 608 gtaattgcacgatacctctcctgaccagctgtgtcccagatctgagcctt 657 ||||| ||||| || | |||||| ||||| |||||||||||||||||||| Sbjct: 112336 gtaatggcacggtagcgctcctggccagcagtgtcccagatctgagcctt 112385
>ref|XM_547540.2| PREDICTED: Canis familiaris similar to Ras-related protein Rab-25 (CATX-8) (LOC490418), mRNA Length = 642 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 632 ccagctgtgtcccagatctgagcctt 657 |||||||||||||||||||||||||| Sbjct: 209 ccagctgtgtcccagatctgagcctt 184
>gb|BC009831.2| Homo sapiens RAB25, member RAS oncogene family, mRNA (cDNA clone MGC:15077 IMAGE:3926839), complete cds Length = 1101 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 632 ccagctgtgtcccagatctgagcctt 657 |||||||||||||||||||||||||| Sbjct: 435 ccagctgtgtcccagatctgagcctt 410
>gb|BC033322.1| Homo sapiens RAB25, member RAS oncogene family, mRNA (cDNA clone MGC:30083 IMAGE:4775725), complete cds Length = 1089 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 632 ccagctgtgtcccagatctgagcctt 657 |||||||||||||||||||||||||| Sbjct: 425 ccagctgtgtcccagatctgagcctt 400
>gb|AC163276.4| Mus musculus chromosome 19, clone RP24-316F20, complete sequence Length = 169300 Score = 52.0 bits (26), Expect = 0.002 Identities = 44/50 (88%) Strand = Plus / Minus Query: 608 gtaattgcacgatacctctcctgaccagctgtgtcccagatctgagcctt 657 ||||| ||||| || | |||||| ||||| |||||||||||||||||||| Sbjct: 143701 gtaatggcacggtagcgctcctggccagcagtgtcccagatctgagcctt 143652
>emb|AL355388.30| Human DNA sequence from clone RP11-336K24 on chromosome 1 Contains the 5' end of the RIT1 gene for Ras-like without CAAX 1, the gene for a novel protein (KIAA0907), the ARHGEF2 gene for rho/rac guanine nucleotide exchange factor (GEF) 2, four novel genes, the SSR2 gene for signal sequence receptor beta (translocon-associated protein beta), the C1orf6 gene for chromosome 1 open reading frame 6, the gene for mitogen-activated protein-binding protein-interacting protein (MAPBPIP), the RAB25 gene for RAB25 (member RAS oncogene family), the 5' end of the LMNA gene for lamin A/C and three CpG islands, complete sequence Length = 205463 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 632 ccagctgtgtcccagatctgagcctt 657 |||||||||||||||||||||||||| Sbjct: 159756 ccagctgtgtcccagatctgagcctt 159731
>ref|NM_001011048.1| Xenopus tropicalis RAB11B, member RAS oncogene family (rab11b), mRNA Length = 2133 Score = 52.0 bits (26), Expect = 0.002 Identities = 35/38 (92%) Strand = Plus / Minus Query: 623 ctctcctgaccagctgtgtcccagatctgagcctttat 660 ||||| || ||||| ||||||||||||||||||||||| Sbjct: 365 ctctcttgtccagccgtgtcccagatctgagcctttat 328
>emb|AL161596.2|ATCHRIV92 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 92 Length = 112067 Score = 52.0 bits (26), Expect = 0.002 Identities = 35/38 (92%) Strand = Plus / Minus Query: 620 tacctctcctgaccagctgtgtcccagatctgagcctt 657 ||||| ||||||||||| || ||||||||||||||||| Sbjct: 69976 tacctttcctgaccagcggtatcccagatctgagcctt 69939
>emb|AL035708.2|ATT5J17 Arabidopsis thaliana DNA chromosome 4, BAC clone T5J17 (ESSA project) Length = 118267 Score = 52.0 bits (26), Expect = 0.002 Identities = 35/38 (92%) Strand = Plus / Minus Query: 620 tacctctcctgaccagctgtgtcccagatctgagcctt 657 ||||| ||||||||||| || ||||||||||||||||| Sbjct: 80543 tacctttcctgaccagcggtatcccagatctgagcctt 80506
>gb|AF532626.1| Glycine max small GTP-binding protein mRNA, complete cds Length = 1263 Score = 52.0 bits (26), Expect = 0.002 Identities = 44/50 (88%) Strand = Plus / Minus Query: 608 gtaattgcacgatacctctcctgaccagctgtgtcccagatctgagcctt 657 ||||| ||||| ||||| ||||| ||||| |||||||| ||||||||||| Sbjct: 366 gtaatggcacggtacctttcctggccagcggtgtcccaaatctgagcctt 317
>gb|AF274025.1| Homo sapiens GTP-binding protein Rab25 mRNA, complete cds Length = 1128 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 632 ccagctgtgtcccagatctgagcctt 657 |||||||||||||||||||||||||| Sbjct: 440 ccagctgtgtcccagatctgagcctt 415
>emb|X56388.1|CFRAB11 Canine rab11 mRNA for ras-related GTP-binding protein Length = 926 Score = 52.0 bits (26), Expect = 0.002 Identities = 38/42 (90%) Strand = Plus / Minus Query: 625 ctcctgaccagctgtgtcccagatctgagcctttattgtttt 666 |||||| || ||||||||||| ||||| |||||||||||||| Sbjct: 228 ctcctgccctgctgtgtcccatatctgtgcctttattgtttt 187
>emb|CR599507.1| full-length cDNA clone CS0DI015YB14 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 1087 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 632 ccagctgtgtcccagatctgagcctt 657 |||||||||||||||||||||||||| Sbjct: 436 ccagctgtgtcccagatctgagcctt 411
>dbj|AK134125.1| Mus musculus adult male thymus cDNA, RIKEN full-length enriched library, clone:5830445A06 product:RAB11B, member RAS oncogene family, full insert sequence Length = 1545 Score = 52.0 bits (26), Expect = 0.002 Identities = 44/50 (88%) Strand = Plus / Minus Query: 608 gtaattgcacgatacctctcctgaccagctgtgtcccagatctgagcctt 657 ||||| ||||| || | |||||| ||||| |||||||||||||||||||| Sbjct: 199 gtaatggcacggtagcgctcctggccagcagtgtcccagatctgagcctt 150
>dbj|AK148106.1| Mus musculus B16 F10Y cells cDNA, RIKEN full-length enriched library, clone:G370018B13 product:RAB11B, member RAS oncogene family, full insert sequence Length = 1650 Score = 52.0 bits (26), Expect = 0.002 Identities = 44/50 (88%) Strand = Plus / Minus Query: 608 gtaattgcacgatacctctcctgaccagctgtgtcccagatctgagcctt 657 ||||| ||||| || | |||||| ||||| |||||||||||||||||||| Sbjct: 253 gtaatggcacggtagcgctcctggccagcagtgtcccagatctgagcctt 204
>dbj|AK147077.1| Mus musculus 17 days pregnant adult female amnion cDNA, RIKEN full-length enriched library, clone:I920098B22 product:RAB11B, member RAS oncogene family, full insert sequence Length = 1782 Score = 52.0 bits (26), Expect = 0.002 Identities = 44/50 (88%) Strand = Plus / Minus Query: 608 gtaattgcacgatacctctcctgaccagctgtgtcccagatctgagcctt 657 ||||| ||||| || | |||||| ||||| |||||||||||||||||||| Sbjct: 285 gtaatggcacggtagcgctcctggccagcagtgtcccagatctgagcctt 236
>dbj|AK146978.1| Mus musculus 17 days embryo kidney cDNA, RIKEN full-length enriched library, clone:I920080M19 product:RAB11B, member RAS oncogene family, full insert sequence Length = 1653 Score = 52.0 bits (26), Expect = 0.002 Identities = 44/50 (88%) Strand = Plus / Minus Query: 608 gtaattgcacgatacctctcctgaccagctgtgtcccagatctgagcctt 657 ||||| ||||| || | |||||| ||||| |||||||||||||||||||| Sbjct: 246 gtaatggcacggtagcgctcctggccagcagtgtcccagatctgagcctt 197
>dbj|AK148022.1| Mus musculus melanocyte cDNA, RIKEN full-length enriched library, clone:G270142I04 product:RAB11B, member RAS oncogene family, full insert sequence Length = 1815 Score = 52.0 bits (26), Expect = 0.002 Identities = 44/50 (88%) Strand = Plus / Minus Query: 608 gtaattgcacgatacctctcctgaccagctgtgtcccagatctgagcctt 657 ||||| ||||| || | |||||| ||||| |||||||||||||||||||| Sbjct: 327 gtaatggcacggtagcgctcctggccagcagtgtcccagatctgagcctt 278
>gb|AY072444.1| Arabidopsis thaliana putative GTP-binding protein (At3g07410) mRNA, complete cds Length = 895 Score = 52.0 bits (26), Expect = 0.002 Identities = 32/34 (94%) Strand = Plus / Minus Query: 621 acctctcctgaccagctgtgtcccagatctgagc 654 ||||||| |||||||| ||||||||||||||||| Sbjct: 294 acctctcttgaccagcagtgtcccagatctgagc 261
>dbj|AK146623.1| Mus musculus 17 days pregnant adult female amnion cDNA, RIKEN full-length enriched library, clone:I920035M11 product:RAB11B, member RAS oncogene family, full insert sequence Length = 2411 Score = 52.0 bits (26), Expect = 0.002 Identities = 44/50 (88%) Strand = Plus / Minus Query: 608 gtaattgcacgatacctctcctgaccagctgtgtcccagatctgagcctt 657 ||||| ||||| || | |||||| ||||| |||||||||||||||||||| Sbjct: 266 gtaatggcacggtagcgctcctggccagcagtgtcccagatctgagcctt 217
>dbj|AK146460.1| Mus musculus 16 days embryo heart cDNA, RIKEN full-length enriched library, clone:I920006I23 product:RAB11B, member RAS oncogene family, full insert sequence Length = 1763 Score = 52.0 bits (26), Expect = 0.002 Identities = 44/50 (88%) Strand = Plus / Minus Query: 608 gtaattgcacgatacctctcctgaccagctgtgtcccagatctgagcctt 657 ||||| ||||| || | |||||| ||||| |||||||||||||||||||| Sbjct: 266 gtaatggcacggtagcgctcctggccagcagtgtcccagatctgagcctt 217
>dbj|AK146452.1| Mus musculus 17 days embryo kidney cDNA, RIKEN full-length enriched library, clone:I920003N23 product:RAB11B, member RAS oncogene family, full insert sequence Length = 1812 Score = 52.0 bits (26), Expect = 0.002 Identities = 44/50 (88%) Strand = Plus / Minus Query: 608 gtaattgcacgatacctctcctgaccagctgtgtcccagatctgagcctt 657 ||||| ||||| || | |||||| ||||| |||||||||||||||||||| Sbjct: 315 gtaatggcacggtagcgctcctggccagcagtgtcccagatctgagcctt 266
>ref|NG_001431.1| Mus musculus RAB11b, member RAS oncogene family, pseudogene 1 (Rab11b-ps1) on chromosome 1 Length = 655 Score = 52.0 bits (26), Expect = 0.002 Identities = 44/50 (88%) Strand = Plus / Minus Query: 608 gtaattgcacgatacctctcctgaccagctgtgtcccagatctgagcctt 657 ||||| ||||| || | |||||| ||||| |||||||||||||||||||| Sbjct: 230 gtaatggcacggtagcgctcctggccagcagtgtcccagatctgagcctt 181
>emb|BX823307.1|CNS0A6J6 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS21ZC05 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 796 Score = 52.0 bits (26), Expect = 0.002 Identities = 32/34 (94%) Strand = Plus / Minus Query: 621 acctctcctgaccagctgtgtcccagatctgagc 654 ||||||| |||||||| ||||||||||||||||| Sbjct: 284 acctctcttgaccagcagtgtcccagatctgagc 251
>emb|BX825812.1|CNS0A6BI Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTSIL64ZD09 of Silique of strain col-0 of Arabidopsis thaliana (thale cress) Length = 714 Score = 52.0 bits (26), Expect = 0.002 Identities = 32/34 (94%) Strand = Plus / Minus Query: 621 acctctcctgaccagctgtgtcccagatctgagc 654 ||||||| |||||||| ||||||||||||||||| Sbjct: 203 acctctcttgaccagcagtgtcccagatctgagc 170
>ref|NM_001004880.1| Xenopus tropicalis MGC88884 protein (MGC88884), mRNA Length = 1035 Score = 52.0 bits (26), Expect = 0.002 Identities = 35/38 (92%) Strand = Plus / Minus Query: 623 ctctcctgaccagctgtgtcccagatctgagcctttat 660 ||||| || ||||| ||||||||||||||||||||||| Sbjct: 229 ctctcttgtccagccgtgtcccagatctgagcctttat 192
>gb|AC026237.4|AC026237 Arabidopsis thaliana chromosome I BAC F17F16 genomic sequence, complete sequence Length = 90498 Score = 52.0 bits (26), Expect = 0.002 Identities = 32/34 (94%) Strand = Plus / Minus Query: 621 acctctcctgaccagctgtgtcccagatctgagc 654 |||||||||||||||| |||||||| |||||||| Sbjct: 12011 acctctcctgaccagcagtgtcccaaatctgagc 11978
>gb|AC051629.3|AC051629 Arabidopsis thaliana chromosome I BAC F6I1 genomic sequence, complete sequence Length = 93677 Score = 52.0 bits (26), Expect = 0.002 Identities = 32/34 (94%) Strand = Plus / Minus Query: 621 acctctcctgaccagctgtgtcccagatctgagc 654 |||||||||||||||| |||||||| |||||||| Sbjct: 58708 acctctcctgaccagcagtgtcccaaatctgagc 58675
>gb|AF083124.1|AF083124 Homo sapiens CATX-8 mRNA, complete cds Length = 1022 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 632 ccagctgtgtcccagatctgagcctt 657 |||||||||||||||||||||||||| Sbjct: 422 ccagctgtgtcccagatctgagcctt 397
>dbj|AK195913.1| Mus musculus cDNA, clone:Y1G0120B01, strand:plus, reference:ENSEMBL:Mouse-Transcript- ENST:ENSMUST00000066020, based on BLAT search Length = 184 Score = 52.0 bits (26), Expect = 0.002 Identities = 44/50 (88%) Strand = Plus / Minus Query: 608 gtaattgcacgatacctctcctgaccagctgtgtcccagatctgagcctt 657 ||||| ||||| || | |||||| ||||| |||||||||||||||||||| Sbjct: 110 gtaatggcacggtagcgctcctggccagcagtgtcccagatctgagcctt 61
>dbj|AK189626.1| Mus musculus cDNA, clone:Y0G0149M24, strand:plus, reference:ENSEMBL:Mouse-Transcript- ENST:ENSMUST00000066020, based on BLAT search Length = 296 Score = 52.0 bits (26), Expect = 0.002 Identities = 44/50 (88%) Strand = Plus / Minus Query: 608 gtaattgcacgatacctctcctgaccagctgtgtcccagatctgagcctt 657 ||||| ||||| || | |||||| ||||| |||||||||||||||||||| Sbjct: 221 gtaatggcacggtagcgctcctggccagcagtgtcccagatctgagcctt 172
>dbj|AK186595.1| Mus musculus cDNA, clone:Y0G0137P06, strand:plus, reference:ENSEMBL:Mouse-Transcript- ENST:ENSMUST00000066020, based on BLAT search Length = 295 Score = 52.0 bits (26), Expect = 0.002 Identities = 44/50 (88%) Strand = Plus / Minus Query: 608 gtaattgcacgatacctctcctgaccagctgtgtcccagatctgagcctt 657 ||||| ||||| || | |||||| ||||| |||||||||||||||||||| Sbjct: 221 gtaatggcacggtagcgctcctggccagcagtgtcccagatctgagcctt 172
>dbj|AK177220.1| Mus musculus cDNA, clone:Y0G0102A22, strand:minus, reference:ENSEMBL:Mouse-Transcript- ENST:ENSMUST00000066020, based on BLAT search Length = 245 Score = 52.0 bits (26), Expect = 0.002 Identities = 44/50 (88%) Strand = Plus / Minus Query: 608 gtaattgcacgatacctctcctgaccagctgtgtcccagatctgagcctt 657 ||||| ||||| || | |||||| ||||| |||||||||||||||||||| Sbjct: 171 gtaatggcacggtagcgctcctggccagcagtgtcccagatctgagcctt 122
>gb|BC075268.1| Xenopus tropicalis MGC88884 protein, mRNA (cDNA clone MGC:88884 IMAGE:6998325), complete cds Length = 1035 Score = 52.0 bits (26), Expect = 0.002 Identities = 35/38 (92%) Strand = Plus / Minus Query: 623 ctctcctgaccagctgtgtcccagatctgagcctttat 660 ||||| || ||||| ||||||||||||||||||||||| Sbjct: 229 ctctcttgtccagccgtgtcccagatctgagcctttat 192
>gb|BT002173.1| Arabidopsis thaliana putative GTP-binding protein (At3g07410) mRNA, complete cds Length = 777 Score = 52.0 bits (26), Expect = 0.002 Identities = 32/34 (94%) Strand = Plus / Minus Query: 621 acctctcctgaccagctgtgtcccagatctgagc 654 ||||||| |||||||| ||||||||||||||||| Sbjct: 220 acctctcttgaccagcagtgtcccagatctgagc 187
>gb|AF127663.1|AF127663 Mus musculus Rab11b pseudogene, partial sequence Length = 655 Score = 52.0 bits (26), Expect = 0.002 Identities = 44/50 (88%) Strand = Plus / Minus Query: 608 gtaattgcacgatacctctcctgaccagctgtgtcccagatctgagcctt 657 ||||| ||||| || | |||||| ||||| |||||||||||||||||||| Sbjct: 230 gtaatggcacggtagcgctcctggccagcagtgtcccagatctgagcctt 181
>emb|CT030732.13| Mouse DNA sequence from clone RP23-27D5 on chromosome 17, complete sequence Length = 220163 Score = 52.0 bits (26), Expect = 0.002 Identities = 44/50 (88%) Strand = Plus / Plus Query: 608 gtaattgcacgatacctctcctgaccagctgtgtcccagatctgagcctt 657 ||||| ||||| || | |||||| ||||| |||||||||||||||||||| Sbjct: 61123 gtaatggcacggtagcgctcctggccagcagtgtcccagatctgagcctt 61172
>emb|CR760887.2| Xenopus tropicalis finished cDNA, clone TTpA022f13 Length = 1115 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Minus Query: 625 ctcctgaccagctgtgtcccagatctgagc 654 |||||| ||||||||||||||||||||||| Sbjct: 263 ctcctgtccagctgtgtcccagatctgagc 234
>emb|CR848203.2| Xenopus tropicalis finished cDNA, clone TGas013h09 Length = 2171 Score = 52.0 bits (26), Expect = 0.002 Identities = 35/38 (92%) Strand = Plus / Minus Query: 623 ctctcctgaccagctgtgtcccagatctgagcctttat 660 ||||| || ||||| ||||||||||||||||||||||| Sbjct: 418 ctctcttgtccagccgtgtcccagatctgagcctttat 381
>emb|CR926356.1| Xenopus tropicalis finished cDNA, clone TGas032a18 Length = 2018 Score = 52.0 bits (26), Expect = 0.002 Identities = 35/38 (92%) Strand = Plus / Minus Query: 623 ctctcctgaccagctgtgtcccagatctgagcctttat 660 ||||| || ||||| ||||||||||||||||||||||| Sbjct: 291 ctctcttgtccagccgtgtcccagatctgagcctttat 254
>gb|L26528.1|MUSRAB11B Mus musculus Rab11b mRNA, complete cds Length = 1763 Score = 52.0 bits (26), Expect = 0.002 Identities = 44/50 (88%) Strand = Plus / Minus Query: 608 gtaattgcacgatacctctcctgaccagctgtgtcccagatctgagcctt 657 ||||| ||||| || | |||||| ||||| |||||||||||||||||||| Sbjct: 265 gtaatggcacggtagcgctcctggccagcagtgtcccagatctgagcctt 216
>ref|NM_100462.4| Arabidopsis thaliana ARA; GTP binding AT1G05810 (ARA) mRNA, complete cds Length = 896 Score = 50.1 bits (25), Expect = 0.010 Identities = 31/33 (93%) Strand = Plus / Minus Query: 625 ctcctgaccagctgtgtcccagatctgagcctt 657 |||||||||||| |||||||| ||||||||||| Sbjct: 345 ctcctgaccagcagtgtcccaaatctgagcctt 313
>ref|XM_511501.1| PREDICTED: Pan troglodytes similar to General control of amino acid synthesis protein 5-like 2 (Histone acetyltransferase GCN5) (mmGCN5) (LOC454678), mRNA Length = 1174 Score = 50.1 bits (25), Expect = 0.010 Identities = 31/33 (93%) Strand = Plus / Minus Query: 618 gatacctctcctgaccagctgtgtcccagatct 650 |||||| |||||| ||||||||||||||||||| Sbjct: 338 gataccgctcctgtccagctgtgtcccagatct 306
>gb|BC106039.1| Homo sapiens RAB5C, member RAS oncogene family, transcript variant 2, mRNA (cDNA clone MGC:117217 IMAGE:4938169), complete cds Length = 1668 Score = 50.1 bits (25), Expect = 0.010 Identities = 31/33 (93%) Strand = Plus / Minus Query: 618 gatacctctcctgaccagctgtgtcccagatct 650 |||||| |||||| ||||||||||||||||||| Sbjct: 449 gataccgctcctgtccagctgtgtcccagatct 417
>ref|NM_001034743.1| Bos taurus RAB5C, member RAS oncogene family isoform b (RAB5C), mRNA Length = 1045 Score = 50.1 bits (25), Expect = 0.010 Identities = 31/33 (93%) Strand = Plus / Minus Query: 618 gatacctctcctgaccagctgtgtcccagatct 650 |||||| |||||| ||||||||||||||||||| Sbjct: 433 gataccgctcctgtccagctgtgtcccagatct 401
>ref|NM_004583.2| Homo sapiens RAB5C, member RAS oncogene family (RAB5C), transcript variant 2, mRNA Length = 1674 Score = 50.1 bits (25), Expect = 0.010 Identities = 31/33 (93%) Strand = Plus / Minus Query: 618 gatacctctcctgaccagctgtgtcccagatct 650 |||||| |||||| ||||||||||||||||||| Sbjct: 450 gataccgctcctgtccagctgtgtcccagatct 418
>ref|NM_201434.1| Homo sapiens RAB5C, member RAS oncogene family (RAB5C), transcript variant 1, mRNA Length = 1791 Score = 50.1 bits (25), Expect = 0.010 Identities = 31/33 (93%) Strand = Plus / Minus Query: 618 gatacctctcctgaccagctgtgtcccagatct 650 |||||| |||||| ||||||||||||||||||| Sbjct: 567 gataccgctcctgtccagctgtgtcccagatct 535
>gb|BT019484.1| Homo sapiens RAB5C, member RAS oncogene family mRNA, complete cds Length = 651 Score = 50.1 bits (25), Expect = 0.010 Identities = 31/33 (93%) Strand = Plus / Minus Query: 618 gatacctctcctgaccagctgtgtcccagatct 650 |||||| |||||| ||||||||||||||||||| Sbjct: 250 gataccgctcctgtccagctgtgtcccagatct 218
>ref|XM_414313.1| PREDICTED: Gallus gallus similar to Ras-related protein Rab (LOC415970), mRNA Length = 667 Score = 50.1 bits (25), Expect = 0.010 Identities = 28/29 (96%) Strand = Plus / Minus Query: 623 ctctcctgaccagctgtgtcccagatctg 651 |||||||| |||||||||||||||||||| Sbjct: 242 ctctcctggccagctgtgtcccagatctg 214
>ref|XM_652859.1| Aspergillus nidulans FGSC A4 hypothetical protein (AN0347.2), mRNA Length = 714 Score = 50.1 bits (25), Expect = 0.010 Identities = 31/33 (93%) Strand = Plus / Minus Query: 625 ctcctgaccagctgtgtcccagatctgagcctt 657 |||||||||||| || ||||||||||||||||| Sbjct: 228 ctcctgaccagcggtatcccagatctgagcctt 196
>gb|AC144486.2| Gasterosteus aculeatus clone CH213-169J23, complete sequence Length = 157502 Score = 50.1 bits (25), Expect = 0.010 Identities = 31/33 (93%) Strand = Plus / Minus Query: 619 atacctctcctgaccagctgtgtcccagatctg 651 |||||||||||| || ||||||||||||||||| Sbjct: 122374 atacctctcctgcccggctgtgtcccagatctg 122342
>gb|AY815497.1| Schistosoma japonicum SJCHGC05511 protein mRNA, complete cds Length = 1203 Score = 50.1 bits (25), Expect = 0.010 Identities = 37/41 (90%) Strand = Plus / Minus Query: 617 cgatacctctcctgaccagctgtgtcccagatctgagcctt 657 |||||||||||||| ||||| |||||||| || |||||||| Sbjct: 257 cgatacctctcctggccagccgtgtcccatatttgagcctt 217
>ref|XM_537327.2| PREDICTED: Canis familiaris Rab12 protein (RAB12), mRNA Length = 1970 Score = 50.1 bits (25), Expect = 0.010 Identities = 28/29 (96%) Strand = Plus / Minus Query: 623 ctctcctgaccagctgtgtcccagatctg 651 ||||||||||| ||||||||||||||||| Sbjct: 446 ctctcctgacctgctgtgtcccagatctg 418
>emb|Z22818.1|CFRAB12A Canis familiaris mRNA for Rab12 protein Length = 660 Score = 50.1 bits (25), Expect = 0.010 Identities = 28/29 (96%) Strand = Plus / Minus Query: 623 ctctcctgaccagctgtgtcccagatctg 651 ||||||||||| ||||||||||||||||| Sbjct: 200 ctctcctgacctgctgtgtcccagatctg 172
>emb|Z27110.1|CFRAB5C C.familiaris mRNA for Rab5c protein Length = 763 Score = 50.1 bits (25), Expect = 0.010 Identities = 31/33 (93%) Strand = Plus / Minus Query: 618 gatacctctcctgaccagctgtgtcccagatct 650 |||||| |||||| ||||||||||||||||||| Sbjct: 352 gataccgctcctgtccagctgtgtcccagatct 320
>gb|AY063847.1| Arabidopsis thaliana putative RAS-related protein ARA-1 (At1g05810) mRNA, complete cds Length = 869 Score = 50.1 bits (25), Expect = 0.010 Identities = 31/33 (93%) Strand = Plus / Minus Query: 625 ctcctgaccagctgtgtcccagatctgagcctt 657 |||||||||||| |||||||| ||||||||||| Sbjct: 302 ctcctgaccagcagtgtcccaaatctgagcctt 270
>gb|AC144487.1| Gasterosteus aculeatus clone CH213-160O9, complete sequence Length = 181162 Score = 50.1 bits (25), Expect = 0.010 Identities = 31/33 (93%) Strand = Plus / Plus Query: 619 atacctctcctgaccagctgtgtcccagatctg 651 |||||||||||| || ||||||||||||||||| Sbjct: 74470 atacctctcctgcccggctgtgtcccagatctg 74502
>emb|CR860097.1| Pongo pygmaeus mRNA; cDNA DKFZp468C168 (from clone DKFZp468C168) Length = 1650 Score = 50.1 bits (25), Expect = 0.010 Identities = 31/33 (93%) Strand = Plus / Minus Query: 618 gatacctctcctgaccagctgtgtcccagatct 650 |||||| |||||| ||||||||||||||||||| Sbjct: 435 gataccgctcctgtccagctgtgtcccagatct 403
>emb|CR626803.1| full-length cDNA clone CS0DI004YB12 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 1558 Score = 50.1 bits (25), Expect = 0.010 Identities = 31/33 (93%) Strand = Plus / Minus Query: 618 gatacctctcctgaccagctgtgtcccagatct 650 |||||| |||||| ||||||||||||||||||| Sbjct: 406 gataccgctcctgtccagctgtgtcccagatct 374
>emb|CR625641.1| full-length cDNA clone CS0DI053YE06 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 1577 Score = 50.1 bits (25), Expect = 0.010 Identities = 31/33 (93%) Strand = Plus / Minus Query: 618 gatacctctcctgaccagctgtgtcccagatct 650 |||||| |||||| ||||||||||||||||||| Sbjct: 408 gataccgctcctgtccagctgtgtcccagatct 376
>dbj|AK127824.1| Homo sapiens cDNA FLJ45927 fis, clone PLACE6019600, moderately similar to Ras-related protein Rab-12 Length = 1737 Score = 50.1 bits (25), Expect = 0.010 Identities = 28/29 (96%) Strand = Plus / Minus Query: 623 ctctcctgaccagctgtgtcccagatctg 651 ||||||||||| ||||||||||||||||| Sbjct: 206 ctctcctgacctgctgtgtcccagatctg 178
>emb|CR625174.1| full-length cDNA clone CS0DI013YF02 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 1531 Score = 50.1 bits (25), Expect = 0.010 Identities = 31/33 (93%) Strand = Plus / Minus Query: 618 gatacctctcctgaccagctgtgtcccagatct 650 |||||| |||||| ||||||||||||||||||| Sbjct: 389 gataccgctcctgtccagctgtgtcccagatct 357
>emb|CR624854.1| full-length cDNA clone CS0DH002YK07 of T cells (Jurkat cell line) of Homo sapiens (human) Length = 1610 Score = 50.1 bits (25), Expect = 0.010 Identities = 31/33 (93%) Strand = Plus / Minus Query: 618 gatacctctcctgaccagctgtgtcccagatct 650 |||||| |||||| ||||||||||||||||||| Sbjct: 429 gataccgctcctgtccagctgtgtcccagatct 397
>emb|CR623581.1| full-length cDNA clone CS0DI044YG15 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 1576 Score = 50.1 bits (25), Expect = 0.010 Identities = 31/33 (93%) Strand = Plus / Minus Query: 618 gatacctctcctgaccagctgtgtcccagatct 650 |||||| |||||| ||||||||||||||||||| Sbjct: 406 gataccgctcctgtccagctgtgtcccagatct 374
>emb|CR622103.1| full-length cDNA clone CS0DI086YP22 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 1568 Score = 50.1 bits (25), Expect = 0.010 Identities = 31/33 (93%) Strand = Plus / Minus Query: 618 gatacctctcctgaccagctgtgtcccagatct 650 |||||| |||||| ||||||||||||||||||| Sbjct: 392 gataccgctcctgtccagctgtgtcccagatct 360
>emb|CR621567.1| full-length cDNA clone CS0DC023YN19 of Neuroblastoma Cot 25-normalized of Homo sapiens (human) Length = 1565 Score = 50.1 bits (25), Expect = 0.010 Identities = 31/33 (93%) Strand = Plus / Minus Query: 618 gatacctctcctgaccagctgtgtcccagatct 650 |||||| |||||| ||||||||||||||||||| Sbjct: 406 gataccgctcctgtccagctgtgtcccagatct 374
>emb|CR620573.1| full-length cDNA clone CS0DE008YO18 of Placenta of Homo sapiens (human) Length = 1661 Score = 50.1 bits (25), Expect = 0.010 Identities = 31/33 (93%) Strand = Plus / Minus Query: 618 gatacctctcctgaccagctgtgtcccagatct 650 |||||| |||||| ||||||||||||||||||| Sbjct: 459 gataccgctcctgtccagctgtgtcccagatct 427
>emb|CR620653.1| full-length cDNA clone CS0DF002YO05 of Fetal brain of Homo sapiens (human) Length = 1721 Score = 50.1 bits (25), Expect = 0.010 Identities = 31/33 (93%) Strand = Plus / Minus Query: 618 gatacctctcctgaccagctgtgtcccagatct 650 |||||| |||||| ||||||||||||||||||| Sbjct: 546 gataccgctcctgtccagctgtgtcccagatct 514
>emb|CR617879.1| full-length cDNA clone CS0DD007YI09 of Neuroblastoma Cot 50-normalized of Homo sapiens (human) Length = 1336 Score = 50.1 bits (25), Expect = 0.010 Identities = 31/33 (93%) Strand = Plus / Minus Query: 618 gatacctctcctgaccagctgtgtcccagatct 650 |||||| |||||| ||||||||||||||||||| Sbjct: 162 gataccgctcctgtccagctgtgtcccagatct 130
>emb|CR617757.1| full-length cDNA clone CS0DI010YH11 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 1598 Score = 50.1 bits (25), Expect = 0.010 Identities = 31/33 (93%) Strand = Plus / Minus Query: 618 gatacctctcctgaccagctgtgtcccagatct 650 |||||| |||||| ||||||||||||||||||| Sbjct: 424 gataccgctcctgtccagctgtgtcccagatct 392
>emb|CR615479.1| full-length cDNA clone CS0DA009YL15 of Neuroblastoma of Homo sapiens (human) Length = 1607 Score = 50.1 bits (25), Expect = 0.010 Identities = 31/33 (93%) Strand = Plus / Minus Query: 618 gatacctctcctgaccagctgtgtcccagatct 650 |||||| |||||| ||||||||||||||||||| Sbjct: 424 gataccgctcctgtccagctgtgtcccagatct 392
>emb|CR613867.1| full-length cDNA clone CS0DC028YA10 of Neuroblastoma Cot 25-normalized of Homo sapiens (human) Length = 1584 Score = 50.1 bits (25), Expect = 0.010 Identities = 31/33 (93%) Strand = Plus / Minus Query: 618 gatacctctcctgaccagctgtgtcccagatct 650 |||||| |||||| ||||||||||||||||||| Sbjct: 424 gataccgctcctgtccagctgtgtcccagatct 392
>emb|CR612483.1| full-length cDNA clone CS0DH005YE20 of T cells (Jurkat cell line) of Homo sapiens (human) Length = 1414 Score = 50.1 bits (25), Expect = 0.010 Identities = 31/33 (93%) Strand = Plus / Minus Query: 618 gatacctctcctgaccagctgtgtcccagatct 650 |||||| |||||| ||||||||||||||||||| Sbjct: 259 gataccgctcctgtccagctgtgtcccagatct 227
>emb|CR612169.1| full-length cDNA clone CS0DI006YD09 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 1500 Score = 50.1 bits (25), Expect = 0.010 Identities = 31/33 (93%) Strand = Plus / Minus Query: 618 gatacctctcctgaccagctgtgtcccagatct 650 |||||| |||||| ||||||||||||||||||| Sbjct: 338 gataccgctcctgtccagctgtgtcccagatct 306
>emb|CR611639.1| full-length cDNA clone CS0DE004YH07 of Placenta of Homo sapiens (human) Length = 1602 Score = 50.1 bits (25), Expect = 0.010 Identities = 31/33 (93%) Strand = Plus / Minus Query: 618 gatacctctcctgaccagctgtgtcccagatct 650 |||||| |||||| ||||||||||||||||||| Sbjct: 416 gataccgctcctgtccagctgtgtcccagatct 384
>emb|CR607787.1| full-length cDNA clone CS0DI010YF11 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 1595 Score = 50.1 bits (25), Expect = 0.010 Identities = 31/33 (93%) Strand = Plus / Minus Query: 618 gatacctctcctgaccagctgtgtcccagatct 650 |||||| |||||| ||||||||||||||||||| Sbjct: 424 gataccgctcctgtccagctgtgtcccagatct 392
>emb|CR607771.1| full-length cDNA clone CS0DI077YG09 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 1620 Score = 50.1 bits (25), Expect = 0.010 Identities = 31/33 (93%) Strand = Plus / Minus Query: 618 gatacctctcctgaccagctgtgtcccagatct 650 |||||| |||||| ||||||||||||||||||| Sbjct: 446 gataccgctcctgtccagctgtgtcccagatct 414
>emb|CR608029.1| full-length cDNA clone CS0DC015YE20 of Neuroblastoma Cot 25-normalized of Homo sapiens (human) Length = 1593 Score = 50.1 bits (25), Expect = 0.010 Identities = 31/33 (93%) Strand = Plus / Minus Query: 618 gatacctctcctgaccagctgtgtcccagatct 650 |||||| |||||| ||||||||||||||||||| Sbjct: 416 gataccgctcctgtccagctgtgtcccagatct 384
>emb|CR603551.1| full-length cDNA clone CS0DM007YF04 of Fetal liver of Homo sapiens (human) Length = 1599 Score = 50.1 bits (25), Expect = 0.010 Identities = 31/33 (93%) Strand = Plus / Minus Query: 618 gatacctctcctgaccagctgtgtcccagatct 650 |||||| |||||| ||||||||||||||||||| Sbjct: 429 gataccgctcctgtccagctgtgtcccagatct 397
>emb|CR601486.1| full-length cDNA clone CS0DA006YF19 of Neuroblastoma of Homo sapiens (human) Length = 1570 Score = 50.1 bits (25), Expect = 0.010 Identities = 31/33 (93%) Strand = Plus / Minus Query: 618 gatacctctcctgaccagctgtgtcccagatct 650 |||||| |||||| ||||||||||||||||||| Sbjct: 408 gataccgctcctgtccagctgtgtcccagatct 376
>emb|CR600565.1| full-length cDNA clone CS0DI075YN07 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 1599 Score = 50.1 bits (25), Expect = 0.010 Identities = 31/33 (93%) Strand = Plus / Minus Query: 618 gatacctctcctgaccagctgtgtcccagatct 650 |||||| |||||| ||||||||||||||||||| Sbjct: 422 gataccgctcctgtccagctgtgtcccagatct 390
>emb|CR600279.1| full-length cDNA clone CS0DB005YK02 of Neuroblastoma Cot 10-normalized of Homo sapiens (human) Length = 1591 Score = 50.1 bits (25), Expect = 0.010 Identities = 31/33 (93%) Strand = Plus / Minus Query: 618 gatacctctcctgaccagctgtgtcccagatct 650 |||||| |||||| ||||||||||||||||||| Sbjct: 418 gataccgctcctgtccagctgtgtcccagatct 386
>emb|CR599091.1| full-length cDNA clone CS0DI081YC13 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 1593 Score = 50.1 bits (25), Expect = 0.010 Identities = 31/33 (93%) Strand = Plus / Minus Query: 618 gatacctctcctgaccagctgtgtcccagatct 650 |||||| |||||| ||||||||||||||||||| Sbjct: 422 gataccgctcctgtccagctgtgtcccagatct 390
>emb|CR595237.1| full-length cDNA clone CL0BA011ZH04 of Placenta of Homo sapiens (human) Length = 1632 Score = 50.1 bits (25), Expect = 0.010 Identities = 31/33 (93%) Strand = Plus / Minus Query: 618 gatacctctcctgaccagctgtgtcccagatct 650 |||||| |||||| ||||||||||||||||||| Sbjct: 424 gataccgctcctgtccagctgtgtcccagatct 392
>emb|CR591906.1| full-length cDNA clone CS0DI042YG22 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 1589 Score = 50.1 bits (25), Expect = 0.010 Identities = 31/33 (93%) Strand = Plus / Minus Query: 618 gatacctctcctgaccagctgtgtcccagatct 650 |||||| |||||| ||||||||||||||||||| Sbjct: 422 gataccgctcctgtccagctgtgtcccagatct 390
>emb|CR591636.1| full-length cDNA clone CS0DI022YM14 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 1590 Score = 50.1 bits (25), Expect = 0.010 Identities = 31/33 (93%) Strand = Plus / Minus Query: 618 gatacctctcctgaccagctgtgtcccagatct 650 |||||| |||||| ||||||||||||||||||| Sbjct: 418 gataccgctcctgtccagctgtgtcccagatct 386
>gb|AF498938.1| Homo sapiens small GTP binding protein RAB5C (RAB5C) mRNA, complete cds Length = 651 Score = 50.1 bits (25), Expect = 0.010 Identities = 31/33 (93%) Strand = Plus / Minus Query: 618 gatacctctcctgaccagctgtgtcccagatct 650 |||||| |||||| ||||||||||||||||||| Sbjct: 250 gataccgctcctgtccagctgtgtcccagatct 218
>gb|AC098595.2| Homo sapiens BAC clone RP11-495L18 from 4, complete sequence Length = 160151 Score = 50.1 bits (25), Expect = 0.010 Identities = 28/29 (96%) Strand = Plus / Minus Query: 269 gctgctgctgctgcttctttggcggccag 297 ||||||||||||||| ||||||||||||| Sbjct: 130081 gctgctgctgctgctgctttggcggccag 130053
>emb|CR541901.1| Homo sapiens full open reading frame cDNA clone RZPDo834B1233D for gene RAB5C, RAB5C, member RAS oncogene family; complete cds, incl. stopcodon Length = 651 Score = 50.1 bits (25), Expect = 0.010 Identities = 31/33 (93%) Strand = Plus / Minus Query: 618 gatacctctcctgaccagctgtgtcccagatct 650 |||||| |||||| ||||||||||||||||||| Sbjct: 250 gataccgctcctgtccagctgtgtcccagatct 218
>gb|AF332457.1| Arabidopsis thaliana clone C00163 putative RAS-related protein ARA-1 (At1g05810) mRNA, partial cds Length = 657 Score = 50.1 bits (25), Expect = 0.010 Identities = 31/33 (93%) Strand = Plus / Minus Query: 625 ctcctgaccagctgtgtcccagatctgagcctt 657 |||||||||||| |||||||| ||||||||||| Sbjct: 216 ctcctgaccagcagtgtcccaaatctgagcctt 184
>emb|CR388820.1| Gallus gallus finished cDNA, clone ChEST687a1 Length = 702 Score = 50.1 bits (25), Expect = 0.010 Identities = 82/101 (81%) Strand = Plus / Minus Query: 560 atgtcatatacaaggagagcccctacagcgccccggtaatatgcgcttgtaattgcacga 619 |||||||| ||||| || ||||| |||||||| |||||||| || ||||| ||||| Sbjct: 269 atgtcatagacaagaagggccccgacagcgccgcggtaatacgctgaagtaatggcacgg 210 Query: 620 tacctctcctgaccagctgtgtcccagatctgagcctttat 660 || |||||||| || || || ||||||||||| || ||||| Sbjct: 209 tatctctcctgtcctgcagtatcccagatctgtgcttttat 169
>gb|BT006190.1| Arabidopsis thaliana clone C00163 (i) putative RAS-related protein ARA-1 (At1g05810) mRNA, complete cds Length = 786 Score = 50.1 bits (25), Expect = 0.010 Identities = 31/33 (93%) Strand = Plus / Minus Query: 625 ctcctgaccagctgtgtcccagatctgagcctt 657 |||||||||||| |||||||| ||||||||||| Sbjct: 345 ctcctgaccagcagtgtcccaaatctgagcctt 313
>gb|BC050338.1| Homo sapiens, clone IMAGE:5766871, mRNA Length = 1806 Score = 50.1 bits (25), Expect = 0.010 Identities = 28/29 (96%) Strand = Plus / Minus Query: 623 ctctcctgaccagctgtgtcccagatctg 651 ||||||||||| ||||||||||||||||| Sbjct: 591 ctctcctgacctgctgtgtcccagatctg 563
>gb|M25471.1|ATHRAS Arabidopsis thaliana ras-related protein (ara) gene, complete cds Length = 1800 Score = 50.1 bits (25), Expect = 0.010 Identities = 31/33 (93%) Strand = Plus / Minus Query: 625 ctcctgaccagctgtgtcccagatctgagcctt 657 |||||||||||| |||||||| ||||||||||| Sbjct: 780 ctcctgaccagcagtgtcccaaatctgagcctt 748
>ref|NM_001003261.1| Canis familiaris RAB5C, member RAS oncogene family (RAB5C), mRNA Length = 763 Score = 50.1 bits (25), Expect = 0.010 Identities = 31/33 (93%) Strand = Plus / Minus Query: 618 gatacctctcctgaccagctgtgtcccagatct 650 |||||| |||||| ||||||||||||||||||| Sbjct: 352 gataccgctcctgtccagctgtgtcccagatct 320
>gb|AC099811.7| Homo sapiens chromosome 17, clone RP11-358B23, complete sequence Length = 174902 Score = 50.1 bits (25), Expect = 0.010 Identities = 31/33 (93%) Strand = Plus / Plus Query: 618 gatacctctcctgaccagctgtgtcccagatct 650 |||||| |||||| ||||||||||||||||||| Sbjct: 454 gataccgctcctgtccagctgtgtcccagatct 486
>ref|XM_227404.3| PREDICTED: Rattus norvegicus RAB25, member RAS oncogene family (predicted) (Rab25_predicted), mRNA Length = 847 Score = 50.1 bits (25), Expect = 0.010 Identities = 31/33 (93%) Strand = Plus / Minus Query: 625 ctcctgaccagctgtgtcccagatctgagcctt 657 |||| |||||||||||||||||||||| ||||| Sbjct: 216 ctccagaccagctgtgtcccagatctgtgcctt 184
>gb|AF141304.1|AF141304 Homo sapiens small GTPase (RAB5C) mRNA, complete cds Length = 729 Score = 50.1 bits (25), Expect = 0.010 Identities = 31/33 (93%) Strand = Plus / Minus Query: 618 gatacctctcctgaccagctgtgtcccagatct 650 |||||| |||||| ||||||||||||||||||| Sbjct: 319 gataccgctcctgtccagctgtgtcccagatct 287
>gb|AY974574.1| Mus musculus RAB11B member RAS oncogene family-like (Rab11b) mRNA, partial sequence Length = 532 Score = 50.1 bits (25), Expect = 0.010 Identities = 43/49 (87%) Strand = Plus / Minus Query: 608 gtaattgcacgatacctctcctgaccagctgtgtcccagatctgagcct 656 ||||| ||||| || | |||||| ||||| ||||||||||||||||||| Sbjct: 230 gtaatggcacggtagcgctcctggccagcagtgtcccagatctgagcct 182
>gb|AY888260.1| Synthetic construct Homo sapiens clone FLH009616.01X RAB5C member RAS oncogene family (RAB5C) mRNA, complete cds Length = 651 Score = 50.1 bits (25), Expect = 0.010 Identities = 31/33 (93%) Strand = Plus / Minus Query: 618 gatacctctcctgaccagctgtgtcccagatct 650 |||||| |||||| ||||||||||||||||||| Sbjct: 250 gataccgctcctgtccagctgtgtcccagatct 218
>gb|BT021518.1| Bos taurus RAB5C, member RAS oncogene family (RAB5C), mRNA, complete cds Length = 1045 Score = 50.1 bits (25), Expect = 0.010 Identities = 31/33 (93%) Strand = Plus / Minus Query: 618 gatacctctcctgaccagctgtgtcccagatct 650 |||||| |||||| ||||||||||||||||||| Sbjct: 433 gataccgctcctgtccagctgtgtcccagatct 401
>dbj|AK025474.1| Homo sapiens cDNA: FLJ21821 fis, clone HEP01311, highly similar to HSU18420 Human ras-related small GTP binding protein Rab5 (rab5) mRNA Length = 2378 Score = 50.1 bits (25), Expect = 0.010 Identities = 31/33 (93%) Strand = Plus / Minus Query: 618 gatacctctcctgaccagctgtgtcccagatct 650 |||||| |||||| ||||||||||||||||||| Sbjct: 1154 gataccgctcctgtccagctgtgtcccagatct 1122
>gb|AC009999.2|T20M3 Sequence of BAC T20M3 from Arabidopsis thaliana chromosome 1, complete sequence Length = 79554 Score = 50.1 bits (25), Expect = 0.010 Identities = 31/33 (93%) Strand = Plus / Minus Query: 625 ctcctgaccagctgtgtcccagatctgagcctt 657 |||||||||||| |||||||| ||||||||||| Sbjct: 27159 ctcctgaccagcagtgtcccaaatctgagcctt 27127
>gb|AY893587.1| Synthetic construct Homo sapiens clone FLH130878.01X RAB5C member RAS oncogene family (RAB5C) mRNA, complete cds Length = 651 Score = 50.1 bits (25), Expect = 0.010 Identities = 31/33 (93%) Strand = Plus / Minus Query: 618 gatacctctcctgaccagctgtgtcccagatct 650 |||||| |||||| ||||||||||||||||||| Sbjct: 250 gataccgctcctgtccagctgtgtcccagatct 218 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 7,595,170 Number of Sequences: 3902068 Number of extensions: 7595170 Number of successful extensions: 379080 Number of sequences better than 10.0: 1083 Number of HSP's better than 10.0 without gapping: 1099 Number of HSP's successfully gapped in prelim test: 6 Number of HSP's that attempted gapping in prelim test: 371670 Number of HSP's gapped (non-prelim): 7385 length of query: 694 length of database: 17,233,045,268 effective HSP length: 23 effective length of query: 671 effective length of database: 17,143,297,704 effective search space: 11503152759384 effective search space used: 11503152759384 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)