ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbags15e08
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1gb|AC161484.4| Mus musculus chromosome 5, clone RP23-6C10, compl... 46 0.14
2gb|AC119215.6| Mus musculus chromosome 5, clone RP24-199K22, com... 46 0.14
3gb|AC120416.11| Mus musculus chromosome 1, clone RP24-472N18, co... 44 0.57
4gb|AY693637.1| Lassa virus strain Nig04-010 polymerase (L) gene,... 44 0.57
5gb|AC113456.9| Mus musculus chromosome 1, clone RP23-257E16, com... 44 0.57
6emb|AL358073.24| Human DNA sequence from clone RP11-458I7 on chr... 42 2.3
7emb|Z98745.1|HS29K1 Human DNA sequence from clone RP1-29K1 on ch... 42 2.3
8gb|AC092803.2| Homo sapiens chromosome 1 clone RP11-61J19, compl... 42 2.3
9gb|AC005678.1|AC005678 Homo sapiens PAC clone RP11-569I24 from 7... 42 2.3
10ref|XM_470871.1| Oryza sativa (japonica cultivar-group), mRNA 40 8.9
11gb|AC091787.6| Oryza sativa (japonica cultivar-group) chromosome... 40 8.9
12gb|AY625267.1| Mus musculus l-arginine:glycine amidinotransferas... 40 8.9
13gb|AC116107.10| Mus musculus chromosome 1, clone RP23-28F18, com... 40 8.9
14gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 40 8.9
15ref|XM_543369.2| PREDICTED: Canis familiaris similar to CG1842-P... 40 8.9
16emb|BX927368.13| Zebrafish DNA sequence from clone CH211-15J16 i... 40 8.9
17gb|AC146757.19| Medicago truncatula clone mth2-16n21, complete s... 40 8.9
18gb|AC147536.12| Medicago truncatula clone mth2-9l3, complete seq... 40 8.9
19gb|AC096035.6| Rattus norvegicus 4 BAC CH230-16M16 (Children's H... 40 8.9
20emb|AL356968.41| Human DNA sequence from clone RP11-329A14 on ch... 40 8.9
21emb|AL109659.20|HSJ1024N4 Human DNA sequence from clone RP5-1024... 40 8.9
22emb|AL008722.16|HS732E4 Human DNA sequence from clone CTA-732E4 ... 40 8.9
23emb|CR391977.5| Zebrafish DNA sequence from clone DKEYP-73B11 in... 40 8.9
24emb|CR932807.1| Mus musculus chromosome 2, clone ResGen-172B22 s... 40 8.9
25gb|BC003879.1| Mus musculus glycine amidinotransferase (L-argini... 40 8.9
26gb|AC093549.1| Drosophila melanogaster 3L BAC RP98-14L10 (Roswel... 40 8.9
27ref|NM_025961.2| Mus musculus glycine amidinotransferase (L-argi... 40 8.9
28gb|AC117383.4| Homo sapiens 3 BAC RP11-789L4 (Roswell Park Cance... 40 8.9
29gb|AC114757.3| Homo sapiens BAC clone RP11-328N19 from 4, comple... 40 8.9
30gb|AC013452.9| Homo sapiens chromosome 15 clone RP11-325E5 map 1... 40 8.9
31gb|AC100845.2| Homo sapiens chromosome 18, clone RP11-680N20, co... 40 8.9
32dbj|AK152069.1| Mus musculus bone marrow macrophage cDNA, RIKEN ... 40 8.9
33dbj|AK146111.1| Mus musculus 14 days pregnant adult female place... 40 8.9
34dbj|AK146052.1| Mus musculus 11 days pregnant adult female place... 40 8.9
35gb|AC025187.6| Homo sapiens chromosome 5 clone CTD-2383I20, comp... 40 8.9
36dbj|AK145914.1| Mus musculus 14 days pregnant adult female place... 40 8.9
37dbj|AK145862.1| Mus musculus 12 days pregnant adult female place... 40 8.9
38dbj|AK151313.1| Mus musculus bone marrow macrophage cDNA, RIKEN ... 40 8.9
39dbj|AK153450.1| Mus musculus bone marrow macrophage cDNA, RIKEN ... 40 8.9
40gb|AC121223.5| Rattus norvegicus BAC CH230-70M4 (Children's Hos... 40 8.9
41gb|AY029112.1| Escherichia coli isolate M1339_B12 virulence plas... 40 8.9
42gb|AC161625.5| Pan troglodytes BAC clone CH251-98N20 from chromo... 40 8.9
43dbj|AK007325.1| Mus musculus 10 day old male pancreas cDNA, RIKE... 40 8.9
44gb|AF111848.1|AF111848 Homo sapiens PRO0529 mRNA, complete cds 40 8.9
45dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 40 8.9
46gb|AC154807.2| Mus musculus BAC clone RP23-79E7 from chromosome ... 40 8.9
47gb|AC009158.7| Homo sapiens chromosome 16 clone RP11-67I10, comp... 40 8.9
48gb|AC093511.4| Homo sapiens chromosome 16 clone CTD-2507C6, comp... 40 8.9
49gb|AC068919.4| Homo sapiens BAC clone RP11-340I19 from 2, comple... 40 8.9
50gb|AC098824.3| Homo sapiens BAC clone RP11-489G24 from 2, comple... 40 8.9
51gb|AC022215.4|AC022215 Homo sapiens BAC clone RP11-764I5 from 3,... 40 8.9
52emb|BX293537.10| Mouse DNA sequence from clone RP23-240M8 on chr... 40 8.9
53emb|BX648602.1|HSM808753 Homo sapiens mRNA; cDNA DKFZp686E05213 ... 40 8.9
54gb|AC155931.2| Mus musculus BAC clone RP23-289D4 from 9, complet... 40 8.9
55emb|BX663522.8| Zebrafish DNA sequence from clone CH211-261E11 i... 40 8.9
56emb|BX510959.9| Zebrafish DNA sequence from clone CH211-51A19 in... 40 8.9
57gb|AE003561.3| Drosophila melanogaster chromosome 3L, section 24... 40 8.9
58gb|AC169088.2| Gallus gallus BAC clone CH261-100B3 from chromoso... 40 8.9
59gb|AC110118.8| Rattus norvegicus BAC CH230-310N6 (Children's Ho... 40 8.9
60gb|AC004715.1|AC004715 Drosophila melanogaster DNA sequence (P1 ... 40 8.9
61gb|CP000155.1| Hahella chejuensis KCTC 2396, complete genome 40 8.9
62emb|AL928877.6| Mouse DNA sequence from clone RP23-52D18 on chro... 40 8.9
63emb|AL772253.12| Mouse DNA sequence from clone RP23-101F14 on ch... 40 8.9 
>gb|AC161484.4| Mus musculus chromosome 5, clone RP23-6C10, complete sequence
          Length = 249620

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                     
Query: 332    tcttcctcttctttagctcctgc 354
              |||||||||||||||||||||||
Sbjct: 103852 tcttcctcttctttagctcctgc 103830
to top
>gb|AC119215.6| Mus musculus chromosome 5, clone RP24-199K22, complete sequence
          Length = 186611

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 332   tcttcctcttctttagctcctgc 354
             |||||||||||||||||||||||
Sbjct: 45972 tcttcctcttctttagctcctgc 45950
to top
>gb|AC120416.11| Mus musculus chromosome 1, clone RP24-472N18, complete sequence
          Length = 199727

 Score = 44.1 bits (22), Expect = 0.57
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 357   cattttgtcttttgttttctcgtcca 382
             ||||||||||||||||||||| ||||
Sbjct: 39102 cattttgtcttttgttttctcttcca 39077
to top
>gb|AY693637.1| Lassa virus strain Nig04-010 polymerase (L) gene, partial cds
          Length = 781

 Score = 44.1 bits (22), Expect = 0.57
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 317 aacatcatcagccaatcttcct 338
           ||||||||||||||||||||||
Sbjct: 253 aacatcatcagccaatcttcct 232
to top
>gb|AC113456.9| Mus musculus chromosome 1, clone RP23-257E16, complete sequence
          Length = 174902

 Score = 44.1 bits (22), Expect = 0.57
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 357   cattttgtcttttgttttctcgtcca 382
             ||||||||||||||||||||| ||||
Sbjct: 84633 cattttgtcttttgttttctcttcca 84658
to top
>emb|AL358073.24| Human DNA sequence from clone RP11-458I7 on chromosome 1 Contains the
             5' end of the ZA20D1 gene for zinc finger, A20 domain
             containing 1, a ribosomal protein L6 (RPL6) pseudogene,
             the VPS45A gene for vacuolar protein sorting 45A (yeast),
             the gene for CK2 interacting protein 1; HQ0024c protein
             (CKIP-1), a novel gene and a CpG island, complete sequence
          Length = 188211

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 353   gcagcattttgtcttttgttt 373
             |||||||||||||||||||||
Sbjct: 18020 gcagcattttgtcttttgttt 18040
to top
>emb|Z98745.1|HS29K1 Human DNA sequence from clone RP1-29K1 on chromosome 6p21.3-22.2.
             Contains the gene for KIAA0426 (C2H2 type zinc finger
             protein), the gene for a novel C2H2 type zinc finger
             protein, a COX11 (COX11 (yeast) homolog, cytochrome c
             oxidase assembly protein) pseudogene, the olfactory
             receptor 2E1 pseudogene OR2E1P, the 3' end of a glutathion
             peroxidase pseudogene, ESTs, STSs, GSS and three CpG
             islands, complete sequence
          Length = 128779

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 241   tttcagagaaagaactggttg 261
             |||||||||||||||||||||
Sbjct: 13293 tttcagagaaagaactggttg 13313
to top
>gb|AC092803.2| Homo sapiens chromosome 1 clone RP11-61J19, complete sequence
          Length = 188345

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 358    attttgtcttttgttttctcg 378
              |||||||||||||||||||||
Sbjct: 139935 attttgtcttttgttttctcg 139915
to top
>gb|AC005678.1|AC005678 Homo sapiens PAC clone RP11-569I24 from 7, complete sequence
          Length = 187543

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 241   tttcagagaaagaactggttg 261
             |||||||||||||||||||||
Sbjct: 58322 tttcagagaaagaactggttg 58342
to top
>ref|XM_470871.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1722

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 340 ttctttagctcctgcagcat 359
           ||||||||||||||||||||
Sbjct: 744 ttctttagctcctgcagcat 725
to top
>gb|AC091787.6| Oryza sativa (japonica cultivar-group) chromosome 3 clone OSJNBa0087G11,
              complete sequence
          Length = 169728

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 340    ttctttagctcctgcagcat 359
              ||||||||||||||||||||
Sbjct: 156466 ttctttagctcctgcagcat 156485
to top
>gb|AY625267.1| Mus musculus l-arginine:glycine amidinotransferase mRNA, partial
           cds
          Length = 718

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 113 gacaacagcacccaagccca 132
           ||||||||||||||||||||
Sbjct: 274 gacaacagcacccaagccca 293
to top
>gb|AC116107.10| Mus musculus chromosome 1, clone RP23-28F18, complete sequence
          Length = 262581

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 42     aacaactgacacaacaatgt 61
              ||||||||||||||||||||
Sbjct: 196678 aacaactgacacaacaatgt 196659
to top
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 340      ttctttagctcctgcagcat 359
                ||||||||||||||||||||
Sbjct: 15893951 ttctttagctcctgcagcat 15893932
to top
>ref|XM_543369.2| PREDICTED: Canis familiaris similar to CG1842-PA (LOC486244), mRNA
          Length = 13452

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 244  cagagaaagaactggttgac 263
            ||||||||||||||||||||
Sbjct: 3464 cagagaaagaactggttgac 3483
to top
>emb|BX927368.13| Zebrafish DNA sequence from clone CH211-15J16 in linkage group 23,
              complete sequence
          Length = 176438

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 631    acagcatcacttttgcatat 650
              ||||||||||||||||||||
Sbjct: 148831 acagcatcacttttgcatat 148812
to top
>gb|AC146757.19| Medicago truncatula clone mth2-16n21, complete sequence
          Length = 135915

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 28     tcatctatggaaacaacaac 47
              ||||||||||||||||||||
Sbjct: 107134 tcatctatggaaacaacaac 107115
to top
>gb|AC147536.12| Medicago truncatula clone mth2-9l3, complete sequence
          Length = 111486

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 28    tcatctatggaaacaacaac 47
             ||||||||||||||||||||
Sbjct: 82702 tcatctatggaaacaacaac 82683
to top
>gb|AC096035.6| Rattus norvegicus 4 BAC CH230-16M16 (Children's Hospital Oakland
             Research Institute) complete sequence
          Length = 228433

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 567   ttgtttcagtggaccatcctgtgt 590
             |||||||||||| |||||||||||
Sbjct: 33969 ttgtttcagtgggccatcctgtgt 33946
to top
>emb|AL356968.41| Human DNA sequence from clone RP11-329A14 on chromosome 1 Contains the 5'
              end of the SPATA6 gene for spermatogenesis associated 6, an
              amyotrophic lateral sclerosis 2 (juvenile) chromosome
              region, candidate 2 (ALS2CR2) pseudogene, a ribosomal
              protein L21 (RPL21) pseudogene and a CpG island, complete
              sequence
          Length = 173373

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 357    cattttgtcttttgttttct 376
              ||||||||||||||||||||
Sbjct: 131918 cattttgtcttttgttttct 131899
to top
>emb|AL109659.20|HSJ1024N4 Human DNA sequence from clone RP5-1024N4 on chromosome 1p32.1-33 Contains
              two novel genes, a novel pseudogene, a novel gene
              (LOC200010), a novel gene similar to connexin and one CpG
              island, complete sequence
          Length = 181678

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 616    ggtgtatcctcattcacagc 635
              ||||||||||||||||||||
Sbjct: 179584 ggtgtatcctcattcacagc 179565
to top
>emb|AL008722.16|HS732E4 Human DNA sequence from clone CTA-732E4 on chromosome 22q12.1 Contains
             ESTs, STSs and GSSs, complete sequence
          Length = 90497

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 357   cattttgtcttttgttttctcgtc 380
             ||||||||| ||||||||||||||
Sbjct: 43031 cattttgtcatttgttttctcgtc 43008
to top
>emb|CR391977.5| Zebrafish DNA sequence from clone DKEYP-73B11 in linkage group 25,
             complete sequence
          Length = 189510

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 612   agatggtgtatcctcattca 631
             ||||||||||||||||||||
Sbjct: 55608 agatggtgtatcctcattca 55627
to top
>emb|CR932807.1| Mus musculus chromosome 2, clone ResGen-172B22 strain 129/Sv, complete
             sequence
          Length = 138840

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 27/28 (96%), Gaps = 1/28 (3%)
 Strand = Plus / Minus

                                         
Query: 349   tcctgcagcattttgtcttttgttttct 376
             ||||||||||||||| ||||||||||||
Sbjct: 76712 tcctgcagcattttg-cttttgttttct 76686
to top
>gb|BC003879.1| Mus musculus glycine amidinotransferase (L-arginine:glycine
           amidinotransferase), mRNA (cDNA clone MGC:6646
           IMAGE:3495871), complete cds
          Length = 2419

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 113 gacaacagcacccaagccca 132
           ||||||||||||||||||||
Sbjct: 696 gacaacagcacccaagccca 715
to top
>gb|AC093549.1| Drosophila melanogaster 3L BAC RP98-14L10 (Roswell Park Cancer
             Institute Drosophila BAC Library) complete sequence
          Length = 180633

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 31    tctatggaaacaacaactgacacaacaa 58
             ||||||| ||||||||||| ||||||||
Sbjct: 69006 tctatggcaacaacaactgccacaacaa 69033
to top
>ref|NM_025961.2| Mus musculus glycine amidinotransferase (L-arginine:glycine
           amidinotransferase) (Gatm), mRNA
          Length = 2419

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 113 gacaacagcacccaagccca 132
           ||||||||||||||||||||
Sbjct: 696 gacaacagcacccaagccca 715
to top
>gb|AC117383.4| Homo sapiens 3 BAC RP11-789L4 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 194991

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 514   ctttcactgctattttgagggctg 537
             |||||||||||||||| |||||||
Sbjct: 53968 ctttcactgctattttcagggctg 53945
to top
>gb|AC114757.3| Homo sapiens BAC clone RP11-328N19 from 4, complete sequence
          Length = 61528

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 293   aaattcaaagggtcattagc 312
             ||||||||||||||||||||
Sbjct: 47108 aaattcaaagggtcattagc 47127
to top
>gb|AC013452.9| Homo sapiens chromosome 15 clone RP11-325E5 map 15q21.1, complete
             sequence
          Length = 204745

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 357   cattttgtcttttgttttct 376
             ||||||||||||||||||||
Sbjct: 88819 cattttgtcttttgttttct 88838
to top
>gb|AC100845.2| Homo sapiens chromosome 18, clone RP11-680N20, complete sequence
          Length = 174328

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 293   aaattcaaagggtcattagc 312
             ||||||||||||||||||||
Sbjct: 83696 aaattcaaagggtcattagc 83677
to top
>dbj|AK152069.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length
           enriched library, clone:I830047A18 product:glycine
           amidinotransferase (L-arginine:glycine
           amidinotransferase), full insert sequence
          Length = 2351

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 113 gacaacagcacccaagccca 132
           ||||||||||||||||||||
Sbjct: 692 gacaacagcacccaagccca 711
to top
>dbj|AK146111.1| Mus musculus 14 days pregnant adult female placenta cDNA, RIKEN
           full-length enriched library, clone:I530030O12
           product:glycine amidinotransferase (L-arginine:glycine
           amidinotransferase), full insert sequence
          Length = 2358

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 113 gacaacagcacccaagccca 132
           ||||||||||||||||||||
Sbjct: 692 gacaacagcacccaagccca 711
to top
>dbj|AK146052.1| Mus musculus 11 days pregnant adult female placenta cDNA, RIKEN
           full-length enriched library, clone:I530026P04
           product:glycine amidinotransferase (L-arginine:glycine
           amidinotransferase), full insert sequence
          Length = 2357

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 113 gacaacagcacccaagccca 132
           ||||||||||||||||||||
Sbjct: 690 gacaacagcacccaagccca 709
to top
>gb|AC025187.6| Homo sapiens chromosome 5 clone CTD-2383I20, complete sequence
          Length = 137219

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 463   tgattctctctggactcacctttt 486
             |||||||||||||| |||||||||
Sbjct: 70745 tgattctctctggattcacctttt 70722
to top
>dbj|AK145914.1| Mus musculus 14 days pregnant adult female placenta cDNA, RIKEN
           full-length enriched library, clone:I530014H16
           product:glycine amidinotransferase (L-arginine:glycine
           amidinotransferase), full insert sequence
          Length = 2362

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 113 gacaacagcacccaagccca 132
           ||||||||||||||||||||
Sbjct: 693 gacaacagcacccaagccca 712
to top
>dbj|AK145862.1| Mus musculus 12 days pregnant adult female placenta cDNA, RIKEN
           full-length enriched library, clone:I530009G08
           product:glycine amidinotransferase (L-arginine:glycine
           amidinotransferase), full insert sequence
          Length = 2353

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 113 gacaacagcacccaagccca 132
           ||||||||||||||||||||
Sbjct: 693 gacaacagcacccaagccca 712
to top
>dbj|AK151313.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length
           enriched library, clone:I830027P09 product:glycine
           amidinotransferase (L-arginine:glycine
           amidinotransferase), full insert sequence
          Length = 1951

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 113 gacaacagcacccaagccca 132
           ||||||||||||||||||||
Sbjct: 690 gacaacagcacccaagccca 709
to top
>dbj|AK153450.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length
           enriched library, clone:I830162M15 product:glycine
           amidinotransferase (L-arginine:glycine
           amidinotransferase), full insert sequence
          Length = 1937

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 113 gacaacagcacccaagccca 132
           ||||||||||||||||||||
Sbjct: 676 gacaacagcacccaagccca 695
to top
>gb|AC121223.5| Rattus norvegicus  BAC CH230-70M4 (Children's Hospital Oakland Research
              Institute Rat (BN/SsNHsd/MCW) BAC library) complete
              sequence
          Length = 263147

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 358    attttgtcttttgttttctc 377
              ||||||||||||||||||||
Sbjct: 157035 attttgtcttttgttttctc 157016
to top
>gb|AY029112.1| Escherichia coli isolate M1339_B12 virulence plasmid MxiA (mxiA)
           gene, partial cds
          Length = 1947

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 340 ttctttagctcctgcagcat 359
           ||||||||||||||||||||
Sbjct: 484 ttctttagctcctgcagcat 465
to top
>gb|AC161625.5| Pan troglodytes BAC clone CH251-98N20 from chromosome unknown,
            complete sequence
          Length = 179977

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 293  aaattcaaagggtcattagc 312
            ||||||||||||||||||||
Sbjct: 1016 aaattcaaagggtcattagc 1035
to top
>dbj|AK007325.1| Mus musculus 10 day old male pancreas cDNA, RIKEN full-length
           enriched library, clone:1810003P21 product:glycine
           amidinotransferase (L-arginine:glycine
           amidinotransferase), full insert sequence
          Length = 1955

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 113 gacaacagcacccaagccca 132
           ||||||||||||||||||||
Sbjct: 691 gacaacagcacccaagccca 710
to top
>gb|AF111848.1|AF111848 Homo sapiens PRO0529 mRNA, complete cds
          Length = 3115

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 616  ggtgtatcctcattcacagc 635
            ||||||||||||||||||||
Sbjct: 1811 ggtgtatcctcattcacagc 1830
to top
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
                sequence
          Length = 36192742

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 340      ttctttagctcctgcagcat 359
                ||||||||||||||||||||
Sbjct: 15888485 ttctttagctcctgcagcat 15888466
to top
>gb|AC154807.2| Mus musculus BAC clone RP23-79E7 from chromosome 16, complete sequence
          Length = 256130

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 357    cattttgtcttttgttttct 376
              ||||||||||||||||||||
Sbjct: 178938 cattttgtcttttgttttct 178957
to top
>gb|AC009158.7| Homo sapiens chromosome 16 clone RP11-67I10, complete sequence
          Length = 161248

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 293   aaattcaaagggtcattagc 312
             ||||||||||||||||||||
Sbjct: 54292 aaattcaaagggtcattagc 54311
to top
>gb|AC093511.4| Homo sapiens chromosome 16 clone CTD-2507C6, complete sequence
          Length = 189250

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 293  aaattcaaagggtcattagc 312
            ||||||||||||||||||||
Sbjct: 7202 aaattcaaagggtcattagc 7183
to top
>gb|AC068919.4| Homo sapiens BAC clone RP11-340I19 from 2, complete sequence
          Length = 164350

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 200    agattttccaggagtaaaac 219
              ||||||||||||||||||||
Sbjct: 135664 agattttccaggagtaaaac 135645
to top
>gb|AC098824.3| Homo sapiens BAC clone RP11-489G24 from 2, complete sequence
          Length = 157758

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 293    aaattcaaagggtcattagc 312
              ||||||||||||||||||||
Sbjct: 128843 aaattcaaagggtcattagc 128824
to top
>gb|AC022215.4|AC022215 Homo sapiens BAC clone RP11-764I5 from 3, complete sequence
          Length = 180068

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 514   ctttcactgctattttgagggctg 537
             |||||||||||||||| |||||||
Sbjct: 74747 ctttcactgctattttcagggctg 74770
to top
>emb|BX293537.10| Mouse DNA sequence from clone RP23-240M8 on chromosome X, complete
             sequence
          Length = 163726

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 140   atgaaatgttcaatgtcttc 159
             ||||||||||||||||||||
Sbjct: 17395 atgaaatgttcaatgtcttc 17376
to top
>emb|BX648602.1|HSM808753 Homo sapiens mRNA; cDNA DKFZp686E05213 (from clone DKFZp686E05213)
          Length = 2446

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 357  cattttgtcttttgttttct 376
            ||||||||||||||||||||
Sbjct: 1448 cattttgtcttttgttttct 1429
to top
>gb|AC155931.2| Mus musculus BAC clone RP23-289D4 from 9, complete sequence
          Length = 189845

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 575   gtggaccatcctgtgtgatacctt 598
             ||||||||| ||||||||||||||
Sbjct: 96784 gtggaccatgctgtgtgatacctt 96807
to top
>emb|BX663522.8| Zebrafish DNA sequence from clone CH211-261E11 in linkage group 18,
             complete sequence
          Length = 107305

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 631   acagcatcacttttgcatat 650
             ||||||||||||||||||||
Sbjct: 38379 acagcatcacttttgcatat 38360
to top
>emb|BX510959.9| Zebrafish DNA sequence from clone CH211-51A19 in linkage group 20,
              complete sequence
          Length = 179085

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 631    acagcatcacttttgcatat 650
              ||||||||||||||||||||
Sbjct: 140961 acagcatcacttttgcatat 140980
to top
>gb|AE003561.3| Drosophila melanogaster chromosome 3L, section 24 of 83 of the complete
              sequence
          Length = 274289

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                          
Query: 31     tctatggaaacaacaactgacacaacaa 58
              ||||||| ||||||||||| ||||||||
Sbjct: 218175 tctatggcaacaacaactgccacaacaa 218202
to top
>gb|AC169088.2| Gallus gallus BAC clone CH261-100B3 from chromosome ul, complete sequence
          Length = 214859

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 31     tctatggaaacaacaactga 50
              ||||||||||||||||||||
Sbjct: 181935 tctatggaaacaacaactga 181954
to top
>gb|AC110118.8| Rattus norvegicus  BAC CH230-310N6 (Children's Hospital Oakland
             Research Institute Rat (BN/SsNHsd/MCW) BAC library)
             complete sequence
          Length = 175663

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 358   attttgtcttttgttttctc 377
             ||||||||||||||||||||
Sbjct: 68215 attttgtcttttgttttctc 68196
to top
>gb|AC004715.1|AC004715 Drosophila melanogaster DNA sequence (P1 DS00374 (D264)), complete
             sequence
          Length = 72732

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 31    tctatggaaacaacaactgacacaacaa 58
             ||||||| ||||||||||| ||||||||
Sbjct: 60079 tctatggcaacaacaactgccacaacaa 60106
to top
>gb|CP000155.1| Hahella chejuensis KCTC 2396, complete genome
          Length = 7215267

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 428     gccttccagcaccgcttgag 447
               ||||||||||||||||||||
Sbjct: 5790532 gccttccagcaccgcttgag 5790551
to top
>emb|AL928877.6| Mouse DNA sequence from clone RP23-52D18 on chromosome 2, complete
             sequence
          Length = 201120

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 27/28 (96%), Gaps = 1/28 (3%)
 Strand = Plus / Minus

                                         
Query: 349   tcctgcagcattttgtcttttgttttct 376
             ||||||||||||||| ||||||||||||
Sbjct: 50887 tcctgcagcattttg-cttttgttttct 50861
to top
>emb|AL772253.12| Mouse DNA sequence from clone RP23-101F14 on chromosome 2, complete
             sequence
          Length = 156657

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 113   gacaacagcacccaagccca 132
             ||||||||||||||||||||
Sbjct: 38246 gacaacagcacccaagccca 38227


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 7,042,047
Number of Sequences: 3902068
Number of extensions: 7042047
Number of successful extensions: 155006
Number of sequences better than 10.0: 63
Number of HSP's better than 10.0 without gapping: 61
Number of HSP's successfully gapped in prelim test: 2
Number of HSP's that attempted gapping in prelim test: 154802
Number of HSP's gapped (non-prelim): 206
length of query: 653
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 630
effective length of database: 17,143,297,704
effective search space: 10800277553520
effective search space used: 10800277553520
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top