ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbags14n10
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1ref|NM_192107.1| Oryza sativa (japonica cultivar-group), predic... 196 7e-47
2dbj|AK073996.1| Oryza sativa (japonica cultivar-group) cDNA clon... 196 7e-47
3dbj|AK061158.1| Oryza sativa (japonica cultivar-group) cDNA clon... 196 7e-47
4dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 123 8e-25
5dbj|AP003455.2| Oryza sativa (japonica cultivar-group) genomic D... 123 8e-25
6dbj|AP001300.1| Arabidopsis thaliana genomic DNA, chromosome 3, ... 46 0.15
7gb|U76670.1|ATU76670 Arabidopsis thaliana recA-like protein (AtD... 46 0.15
8dbj|D45415.1|ATHARLIM15 Arabidopsis thaliana ArLIM15 gene for re... 46 0.15
9ref|NM_202181.1| Arabidopsis thaliana unknown protein AT1G25420 ... 44 0.59
10ref|NM_202182.1| Arabidopsis thaliana unknown protein AT1G25420 ... 44 0.59
11ref|NM_102353.2| Arabidopsis thaliana unknown protein AT1G25420 ... 44 0.59
12gb|AC158619.12| Mus musculus 10 BAC RP23-291O3 (Roswell Park Can... 44 0.59
13gb|AY143866.1| Arabidopsis thaliana At1g25420/F2J7_16 mRNA, comp... 44 0.59
14gb|AY095990.1| Arabidopsis thaliana At1g25420/F2J7_16 mRNA, comp... 44 0.59
15gb|AC159477.9| Mus musculus 10 BAC RP23-95I8 (Roswell Park Cance... 44 0.59
16emb|BX817810.1|CNS0AB5Q Arabidopsis thaliana Full-length cDNA Co... 44 0.59
17gb|AY088569.1| Arabidopsis thaliana clone 7917 mRNA, complete se... 44 0.59
18gb|AY622606.1| Candida dubliniensis MTL alpha 2, OPB alpha, PIK ... 42 2.3
19gb|AC126938.2| Mus musculus BAC clone RP23-50I16 from chromosome... 42 2.3
20gb|AC132392.3| Mus musculus BAC clone RP23-386F15 from chromosom... 42 2.3
21gb|AC129215.3| Mus musculus BAC clone RP24-435H23 from chromosom... 42 2.3
22gb|AC121855.3| Mus musculus BAC clone RP24-97C18 from chromosome... 42 2.3
23gb|BC038396.1| Mus musculus TRAF type zinc finger domain contain... 42 2.3
24gb|BC023072.1| Mus musculus TRAF type zinc finger domain contain... 42 2.3
25gb|BC021421.1| Mus musculus TRAF type zinc finger domain contain... 42 2.3
26dbj|AK150038.1| Mus musculus bone marrow macrophage cDNA, RIKEN ... 42 2.3
27gb|AC019306.10| Homo sapiens chromosome 18, clone RP11-326M20, c... 42 2.3
28gb|AC007768.5| Homo sapiens chromosome 18, clone RP11-540M4, com... 42 2.3
29dbj|AK003586.1| Mus musculus 18-day embryo whole body cDNA, RIKE... 42 2.3
30ref|NM_172275.1| Mus musculus TRAF type zinc finger domain conta... 42 2.3
31dbj|AK042299.1| Mus musculus 3 days neonate thymus cDNA, RIKEN f... 42 2.3
32dbj|AK211451.1| Mus musculus cDNA, clone:Y2G0121M21, strand:minu... 42 2.3
33dbj|AK212088.1| Mus musculus cDNA, clone:Y2G0123N06, strand:minu... 42 2.3
34emb|AM180252.1| Lawsonia intracellularis PHE/MN1-00 42 2.3
35ref|XM_509728.1| PREDICTED: Pan troglodytes similar to KIAA0865 ... 40 9.2
36gb|AC161798.6| Mus musculus chromosome 7, clone RP23-267I20, com... 40 9.2
37ref|NM_177250.2| Mus musculus leucine rich repeat neuronal 6D (L... 40 9.2
38gb|AC135459.3| Oryza sativa (japonica cultivar-group) chromosome... 40 9.2
39gb|AC134572.4| Mus musculus BAC clone RP23-435M15 from chromosom... 40 9.2
40gb|AC132428.3| Mus musculus BAC clone RP23-203K20 from chromosom... 40 9.2
41ref|XM_540117.2| PREDICTED: Canis familiaris similar to Potassiu... 40 9.2
42gb|AC122299.5| Mus musculus BAC clone RP23-270L23 from chromosom... 40 9.2
43gb|AC131726.3| Mus musculus BAC clone RP23-132P9 from 3, complet... 40 9.2
44gb|AC122808.3| Mus musculus BAC clone RP23-298M23 from 3, comple... 40 9.2
45ref|XM_738042.1| Plasmodium chabaudi chabaudi hypothetical prote... 40 9.2
46ref|XM_661388.1| Cryptosporidium hominis TU502 ZW18 protein (Chr... 40 9.2
47gb|AY305378.1| Ralstonia eutropha H16 megaplasmid pHG1, complete... 40 9.2
48emb|AL590083.8| Human DNA sequence from clone RP11-475D8 on chro... 40 9.2
49emb|AL353143.14| Human DNA sequence from clone RP11-383F12 on ch... 40 9.2
50emb|AL033529.25|HS27O5 Human DNA sequence from clone RP1-27O5 on... 40 9.2
51emb|AL606634.2|OSJN00066 Oryza sativa genomic DNA, chromosome 4,... 40 9.2
52emb|AL590146.2| Zebrafish DNA sequence from clone RP71-20I5 in l... 40 9.2
53emb|AL713962.14| Mouse DNA sequence from clone RP23-3D5 on chrom... 40 9.2
54gb|AC154697.2| Mus musculus BAC clone RP23-136A22 from chromosom... 40 9.2
55gb|AC091521.19| Mus musculus chromosome 1 clone rp23-145f9, comp... 40 9.2
56gb|AC105343.4| Homo sapiens BAC clone RP11-423J7 from 4, complet... 40 9.2
57gb|CP000264.1| Jannaschia sp. CCS1, complete genome 40 9.2
58ref|XM_625319.1| Cryptosporidium parvum Iowa II hypothetical pro... 40 9.2
59gb|AC159231.2| Mus musculus BAC clone RP24-387F20 from chromosom... 40 9.2
60gb|AC092243.1|AC092243 Drosophila melanogaster, chromosome 2L, r... 40 9.2
61gb|AC092225.1|AC092225 Drosophila melanogaster, chromosome 2L, r... 40 9.2
62dbj|AK042286.1| Mus musculus 3 days neonate thymus cDNA, RIKEN f... 40 9.2
63dbj|AK040952.1| Mus musculus adult male aorta and vein cDNA, RIK... 40 9.2
64dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic D... 40 9.2
65dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic D... 40 9.2
66ref|NM_015011.1| Homo sapiens myosin heavy chain Myr 8 (MYR8), mRNA 40 9.2
67gb|AC017101.10| Homo sapiens BAC clone RP11-556A11 from 2, compl... 40 9.2
68ref|XM_342474.2| PREDICTED: Rattus norvegicus similar to RIKEN c... 40 9.2
69dbj|AB016885.1| Arabidopsis thaliana genomic DNA, chromosome 5, ... 40 9.2
70dbj|AK120678.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 9.2
71gb|AE003642.3| Drosophila melanogaster chromosome 2L, section 51... 40 9.2
72emb|AL808147.21| Mouse DNA sequence from clone RP23-80N9 on chro... 40 9.2
73dbj|AB020672.2| Homo sapiens mRNA for KIAA0865 protein, partial cds 40 9.2
74gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome... 40 9.2
75emb|X69752.1|CHRCRBCL R.cathartica chloroplast rbcL gene for rib... 40 9.2
76gb|AC167659.7| Mus musculus chromosome 7, clone RP23-165I8, comp... 40 9.2

>ref|NM_192107.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 915

 Score =  196 bits (99), Expect = 7e-47
 Identities = 234/279 (83%)
 Strand = Plus / Minus

                                                                       
Query: 392 cgatggcttatctctggaaatggaagagcctggagagctctcaattttaggtgtttggcc 451
           ||||||| ||||||||||||||||||   |||||||| |||| ||| |||||   |||||
Sbjct: 642 cgatggcatatctctggaaatggaagcaactggagagttctcgattataggtaactggcc 583

                                                                       
Query: 452 ttggcggactgatgatccggaatcgtccagcagatcttcgtatttcttattgaattctgc 511
            |||||  |||| ||||| ||  | ||||||||||||||||||||||| || |  |||||
Sbjct: 582 ctggcgtgctgaggatcctgatccatccagcagatcttcgtatttcttgttaagctctgc 523

                                                                       
Query: 512 ttcggtattagatgaatcccaatcaagattgtactcatgagcaatagctttcaaaacctt 571
           ||| ||||| ||||| ||||| |||||    ||||| |||||||||||||||| ||||||
Sbjct: 522 ttcagtattcgatgagtcccattcaaggccatactcttgagcaatagctttcagaacctt 463

                                                                       
Query: 572 caactttgattccgctgatggagccttaactgaaagcttctcaattatagtgcgattaac 631
           || ||||||||| |||||||| ||||| ||||| |||||||| ||||| || ||||||||
Sbjct: 462 cagctttgattcagctgatggggccttcactgagagcttctcgattattgtacgattaac 403

                                                  
Query: 632 accacaatcagggcgcaattccatagcagcagcaacaaa 670
           ||| |  ||||| |||||||||||||| |||||||||||
Sbjct: 402 accgctgtcaggacgcaattccatagctgcagcaacaaa 364



 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 55/62 (88%)
 Strand = Plus / Minus

                                                                       
Query: 174 gcggcggaggcacgggtggctgcaacaatggcagctcgggccttttctagcacgtctgac 233
           ||||||||||| ||| |||||||| |||||||||||||||| ||||| || ||||| |||
Sbjct: 869 gcggcggaggcgcggttggctgcagcaatggcagctcgggctttttcaagaacgtccgac 810

             
Query: 234 ga 235
           ||
Sbjct: 809 ga 808



to top

>dbj|AK073996.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033071E20, full
           insert sequence
          Length = 1236

 Score =  196 bits (99), Expect = 7e-47
 Identities = 234/279 (83%)
 Strand = Plus / Minus

                                                                       
Query: 392 cgatggcttatctctggaaatggaagagcctggagagctctcaattttaggtgtttggcc 451
           ||||||| ||||||||||||||||||   |||||||| |||| ||| |||||   |||||
Sbjct: 763 cgatggcatatctctggaaatggaagcaactggagagttctcgattataggtaactggcc 704

                                                                       
Query: 452 ttggcggactgatgatccggaatcgtccagcagatcttcgtatttcttattgaattctgc 511
            |||||  |||| ||||| ||  | ||||||||||||||||||||||| || |  |||||
Sbjct: 703 ctggcgtgctgaggatcctgatccatccagcagatcttcgtatttcttgttaagctctgc 644

                                                                       
Query: 512 ttcggtattagatgaatcccaatcaagattgtactcatgagcaatagctttcaaaacctt 571
           ||| ||||| ||||| ||||| |||||    ||||| |||||||||||||||| ||||||
Sbjct: 643 ttcagtattcgatgagtcccattcaaggccatactcttgagcaatagctttcagaacctt 584

                                                                       
Query: 572 caactttgattccgctgatggagccttaactgaaagcttctcaattatagtgcgattaac 631
           || ||||||||| |||||||| ||||| ||||| |||||||| ||||| || ||||||||
Sbjct: 583 cagctttgattcagctgatggggccttcactgagagcttctcgattattgtacgattaac 524

                                                  
Query: 632 accacaatcagggcgcaattccatagcagcagcaacaaa 670
           ||| |  ||||| |||||||||||||| |||||||||||
Sbjct: 523 accgctgtcaggacgcaattccatagctgcagcaacaaa 485



 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 55/62 (88%)
 Strand = Plus / Minus

                                                                       
Query: 174 gcggcggaggcacgggtggctgcaacaatggcagctcgggccttttctagcacgtctgac 233
           ||||||||||| ||| |||||||| |||||||||||||||| ||||| || ||||| |||
Sbjct: 990 gcggcggaggcgcggttggctgcagcaatggcagctcgggctttttcaagaacgtccgac 931

             
Query: 234 ga 235
           ||
Sbjct: 930 ga 929



to top

>dbj|AK061158.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-208-H01, full
           insert sequence
          Length = 1162

 Score =  196 bits (99), Expect = 7e-47
 Identities = 234/279 (83%)
 Strand = Plus / Minus

                                                                       
Query: 392 cgatggcttatctctggaaatggaagagcctggagagctctcaattttaggtgtttggcc 451
           ||||||| ||||||||||||||||||   |||||||| |||| ||| |||||   |||||
Sbjct: 760 cgatggcatatctctggaaatggaagcaactggagagttctcgattataggtaactggcc 701

                                                                       
Query: 452 ttggcggactgatgatccggaatcgtccagcagatcttcgtatttcttattgaattctgc 511
            |||||  |||| ||||| ||  | ||||||||||||||||||||||| || |  |||||
Sbjct: 700 ctggcgtgctgaggatcctgatccatccagcagatcttcgtatttcttgttaagctctgc 641

                                                                       
Query: 512 ttcggtattagatgaatcccaatcaagattgtactcatgagcaatagctttcaaaacctt 571
           ||| ||||| ||||| ||||| |||||    ||||| |||||||||||||||| ||||||
Sbjct: 640 ttcagtattcgatgagtcccattcaaggccatactcttgagcaatagctttcagaacctt 581

                                                                       
Query: 572 caactttgattccgctgatggagccttaactgaaagcttctcaattatagtgcgattaac 631
           || ||||||||| |||||||| ||||| ||||| |||||||| ||||| || ||||||||
Sbjct: 580 cagctttgattcagctgatggggccttcactgagagcttctcgattattgtacgattaac 521

                                                  
Query: 632 accacaatcagggcgcaattccatagcagcagcaacaaa 670
           ||| |  ||||| |||||||||||||| |||||||||||
Sbjct: 520 accgctgtcaggacgcaattccatagctgcagcaacaaa 482



 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 55/62 (88%)
 Strand = Plus / Minus

                                                                       
Query: 174 gcggcggaggcacgggtggctgcaacaatggcagctcgggccttttctagcacgtctgac 233
           ||||||||||| ||| |||||||| |||||||||||||||| ||||| || ||||| |||
Sbjct: 987 gcggcggaggcgcggttggctgcagcaatggcagctcgggctttttcaagaacgtccgac 928

             
Query: 234 ga 235
           ||
Sbjct: 927 ga 926



to top

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score =  123 bits (62), Expect = 8e-25
 Identities = 122/142 (85%)
 Strand = Plus / Plus

                                                                            
Query: 478      ccagcagatcttcgtatttcttattgaattctgcttcggtattagatgaatcccaatcaa 537
                |||||||||||||||||||||| || |  |||||||| ||||| ||||| ||||| ||||
Sbjct: 28365504 ccagcagatcttcgtatttcttgttaagctctgcttcagtattcgatgagtcccattcaa 28365563

                                                                            
Query: 538      gattgtactcatgagcaatagctttcaaaaccttcaactttgattccgctgatggagcct 597
                |    ||||| |||||||||||||||| |||||||| ||||||||| |||||||| ||||
Sbjct: 28365564 ggccatactcttgagcaatagctttcagaaccttcagctttgattcagctgatggggcct 28365623

                                      
Query: 598      taactgaaagcttctcaattat 619
                | ||||| |||||||| |||||
Sbjct: 28365624 tcactgagagcttctcgattat 28365645



 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 55/62 (88%)
 Strand = Plus / Plus

                                                                            
Query: 174      gcggcggaggcacgggtggctgcaacaatggcagctcgggccttttctagcacgtctgac 233
                ||||||||||| ||| |||||||| |||||||||||||||| ||||| || ||||| |||
Sbjct: 28364422 gcggcggaggcgcggttggctgcagcaatggcagctcgggctttttcaagaacgtccgac 28364481

                  
Query: 234      ga 235
                ||
Sbjct: 28364482 ga 28364483



 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                               
Query: 624      cgattaacaccacaatcagggcgcaattccatagcagcagcaacaaa 670
                ||||||||||| |  ||||| |||||||||||||| |||||||||||
Sbjct: 28365778 cgattaacaccgctgtcaggacgcaattccatagctgcagcaacaaa 28365824



 Score = 48.1 bits (24), Expect = 0.038
 Identities = 45/52 (86%)
 Strand = Plus / Plus

                                                                    
Query: 392      cgatggcttatctctggaaatggaagagcctggagagctctcaattttaggt 443
                ||||||| ||||||||||||||||||   |||||||| |||| ||| |||||
Sbjct: 28364649 cgatggcatatctctggaaatggaagcaactggagagttctcgattataggt 28364700



to top

>dbj|AP003455.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0519D04
          Length = 193068

 Score =  123 bits (62), Expect = 8e-25
 Identities = 122/142 (85%)
 Strand = Plus / Plus

                                                                         
Query: 478   ccagcagatcttcgtatttcttattgaattctgcttcggtattagatgaatcccaatcaa 537
             |||||||||||||||||||||| || |  |||||||| ||||| ||||| ||||| ||||
Sbjct: 80604 ccagcagatcttcgtatttcttgttaagctctgcttcagtattcgatgagtcccattcaa 80663

                                                                         
Query: 538   gattgtactcatgagcaatagctttcaaaaccttcaactttgattccgctgatggagcct 597
             |    ||||| |||||||||||||||| |||||||| ||||||||| |||||||| ||||
Sbjct: 80664 ggccatactcttgagcaatagctttcagaaccttcagctttgattcagctgatggggcct 80723

                                   
Query: 598   taactgaaagcttctcaattat 619
             | ||||| |||||||| |||||
Sbjct: 80724 tcactgagagcttctcgattat 80745



 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 55/62 (88%)
 Strand = Plus / Plus

                                                                         
Query: 174   gcggcggaggcacgggtggctgcaacaatggcagctcgggccttttctagcacgtctgac 233
             ||||||||||| ||| |||||||| |||||||||||||||| ||||| || ||||| |||
Sbjct: 79522 gcggcggaggcgcggttggctgcagcaatggcagctcgggctttttcaagaacgtccgac 79581

               
Query: 234   ga 235
             ||
Sbjct: 79582 ga 79583



 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                            
Query: 624   cgattaacaccacaatcagggcgcaattccatagcagcagcaacaaa 670
             ||||||||||| |  ||||| |||||||||||||| |||||||||||
Sbjct: 80878 cgattaacaccgctgtcaggacgcaattccatagctgcagcaacaaa 80924



 Score = 48.1 bits (24), Expect = 0.038
 Identities = 45/52 (86%)
 Strand = Plus / Plus

                                                                 
Query: 392   cgatggcttatctctggaaatggaagagcctggagagctctcaattttaggt 443
             ||||||| ||||||||||||||||||   |||||||| |||| ||| |||||
Sbjct: 79749 cgatggcatatctctggaaatggaagcaactggagagttctcgattataggt 79800



to top

>dbj|AP001300.1| Arabidopsis thaliana genomic DNA, chromosome 3, BAC clone:F5N5
          Length = 71327

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                        
Query: 350   ctcgggagttttatttttgcttgtgtc 376
             ||||||| |||||||||||||||||||
Sbjct: 12026 ctcgggacttttatttttgcttgtgtc 12000



to top

>gb|U76670.1|ATU76670 Arabidopsis thaliana recA-like protein (AtDMC1) gene, complete cds
          Length = 8017

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                       
Query: 350  ctcgggagttttatttttgcttgtgtc 376
            ||||||| |||||||||||||||||||
Sbjct: 5426 ctcgggacttttatttttgcttgtgtc 5452



to top

>dbj|D45415.1|ATHARLIM15 Arabidopsis thaliana ArLIM15 gene for recA-like protein, complete cds
            (exon1-15)
          Length = 5135

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                       
Query: 350  ctcgggagttttatttttgcttgtgtc 376
            ||||||| |||||||||||||||||||
Sbjct: 2074 ctcgggacttttatttttgcttgtgtc 2100



to top

>ref|NM_202181.1| Arabidopsis thaliana unknown protein AT1G25420 transcript variant
           AT1G25420.2 mRNA, complete cds
          Length = 1421

 Score = 44.1 bits (22), Expect = 0.59
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 603 gaaagcttctcaattatagtgcgattaacaccacaatc 640
           |||||||||||||| ||||| ||||| |||||| ||||
Sbjct: 742 gaaagcttctcaatgatagtacgattgacaccagaatc 705



to top

>ref|NM_202182.1| Arabidopsis thaliana unknown protein AT1G25420 transcript variant
           AT1G25420.3 mRNA, complete cds
          Length = 1299

 Score = 44.1 bits (22), Expect = 0.59
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 603 gaaagcttctcaattatagtgcgattaacaccacaatc 640
           |||||||||||||| ||||| ||||| |||||| ||||
Sbjct: 595 gaaagcttctcaatgatagtacgattgacaccagaatc 558



to top

>ref|NM_102353.2| Arabidopsis thaliana unknown protein AT1G25420 transcript variant
           AT1G25420.1 mRNA, complete cds
          Length = 1305

 Score = 44.1 bits (22), Expect = 0.59
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 603 gaaagcttctcaattatagtgcgattaacaccacaatc 640
           |||||||||||||| ||||| ||||| |||||| ||||
Sbjct: 558 gaaagcttctcaatgatagtacgattgacaccagaatc 521



to top

>gb|AC158619.12| Mus musculus 10 BAC RP23-291O3 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 250421

 Score = 44.1 bits (22), Expect = 0.59
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                        
Query: 136    ctttaaccttgttaacaagttctgcc 161
              |||||||||| |||||||||||||||
Sbjct: 203139 ctttaaccttattaacaagttctgcc 203164



to top

>gb|AY143866.1| Arabidopsis thaliana At1g25420/F2J7_16 mRNA, complete cds
          Length = 972

 Score = 44.1 bits (22), Expect = 0.59
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 603 gaaagcttctcaattatagtgcgattaacaccacaatc 640
           |||||||||||||| ||||| ||||| |||||| ||||
Sbjct: 476 gaaagcttctcaatgatagtacgattgacaccagaatc 439



to top

>gb|AY095990.1| Arabidopsis thaliana At1g25420/F2J7_16 mRNA, complete cds
          Length = 1082

 Score = 44.1 bits (22), Expect = 0.59
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 603 gaaagcttctcaattatagtgcgattaacaccacaatc 640
           |||||||||||||| ||||| ||||| |||||| ||||
Sbjct: 512 gaaagcttctcaatgatagtacgattgacaccagaatc 475



to top

>gb|AC159477.9| Mus musculus 10 BAC RP23-95I8 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 222553

 Score = 44.1 bits (22), Expect = 0.59
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                        
Query: 136    ctttaaccttgttaacaagttctgcc 161
              |||||||||| |||||||||||||||
Sbjct: 192475 ctttaaccttattaacaagttctgcc 192450



to top

>emb|BX817810.1|CNS0AB5Q Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL43ZA02 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 1296

 Score = 44.1 bits (22), Expect = 0.59
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 603 gaaagcttctcaattatagtgcgattaacaccacaatc 640
           |||||||||||||| ||||| ||||| |||||| ||||
Sbjct: 592 gaaagcttctcaatgatagtacgattgacaccagaatc 555



to top

>gb|AY088569.1| Arabidopsis thaliana clone 7917 mRNA, complete sequence
          Length = 1306

 Score = 44.1 bits (22), Expect = 0.59
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 603 gaaagcttctcaattatagtgcgattaacaccacaatc 640
           |||||||||||||| ||||| ||||| |||||| ||||
Sbjct: 558 gaaagcttctcaatgatagtacgattgacaccagaatc 521



to top

>gb|AY622606.1| Candida dubliniensis MTL alpha 2, OPB alpha, PIK alpha, and MTL alpha
            1 genes, complete cds; and PAP alpha gene, partial cds
          Length = 8593

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 121  atcattgagttgtaactttaacctt 145
            ||||||||||||||||| |||||||
Sbjct: 6574 atcattgagttgtaactgtaacctt 6550



to top

>gb|AC126938.2| Mus musculus BAC clone RP23-50I16 from chromosome 5, complete sequence
          Length = 187269

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 196   caacaatggcagctcgggcct 216
             |||||||||||||||||||||
Sbjct: 37681 caacaatggcagctcgggcct 37661



to top

>gb|AC132392.3| Mus musculus BAC clone RP23-386F15 from chromosome 7, complete sequence
          Length = 208499

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 404   tctggaaatggaagagcctggagag 428
             ||||||||||| |||||||||||||
Sbjct: 97403 tctggaaatggcagagcctggagag 97427



to top

>gb|AC129215.3| Mus musculus BAC clone RP24-435H23 from chromosome 5, complete
            sequence
          Length = 140936

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 196  caacaatggcagctcgggcct 216
            |||||||||||||||||||||
Sbjct: 5293 caacaatggcagctcgggcct 5313



to top

>gb|AC121855.3| Mus musculus BAC clone RP24-97C18 from chromosome 6, complete sequence
          Length = 192062

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 432    tcaattttaggtgtttggcct 452
              |||||||||||||||||||||
Sbjct: 123122 tcaattttaggtgtttggcct 123102



to top

>gb|BC038396.1| Mus musculus TRAF type zinc finger domain containing 1, mRNA (cDNA
            clone MGC:18969 IMAGE:3987227), complete cds
          Length = 2449

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 196  caacaatggcagctcgggcct 216
            |||||||||||||||||||||
Sbjct: 2014 caacaatggcagctcgggcct 1994



to top

>gb|BC023072.1| Mus musculus TRAF type zinc finger domain containing 1, mRNA (cDNA
            clone IMAGE:5357477), with apparent retained intron
          Length = 2903

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 196  caacaatggcagctcgggcct 216
            |||||||||||||||||||||
Sbjct: 2474 caacaatggcagctcgggcct 2454



to top

>gb|BC021421.1| Mus musculus TRAF type zinc finger domain containing 1, mRNA (cDNA
           clone IMAGE:5012211), containing frame-shift errors
          Length = 1271

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 196 caacaatggcagctcgggcct 216
           |||||||||||||||||||||
Sbjct: 814 caacaatggcagctcgggcct 794



to top

>dbj|AK150038.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length enriched
            library, clone:G530123D08 product:FLN29 gene product,
            full insert sequence
          Length = 2447

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 196  caacaatggcagctcgggcct 216
            |||||||||||||||||||||
Sbjct: 2039 caacaatggcagctcgggcct 2019



to top

>gb|AC019306.10| Homo sapiens chromosome 18, clone RP11-326M20, complete sequence
          Length = 175840

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 304   tggtggcagcatatgttcttg 324
             |||||||||||||||||||||
Sbjct: 40958 tggtggcagcatatgttcttg 40978



to top

>gb|AC007768.5| Homo sapiens chromosome 18, clone RP11-540M4, complete sequence
          Length = 175579

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 304    tggtggcagcatatgttcttg 324
              |||||||||||||||||||||
Sbjct: 128090 tggtggcagcatatgttcttg 128110



to top

>dbj|AK003586.1| Mus musculus 18-day embryo whole body cDNA, RIKEN full-length
           enriched library, clone:1110008K06 product:hypothetical
           protein, full insert sequence
          Length = 933

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 196 caacaatggcagctcgggcct 216
           |||||||||||||||||||||
Sbjct: 523 caacaatggcagctcgggcct 503



to top

>ref|NM_172275.1| Mus musculus TRAF type zinc finger domain containing 1 (Trafd1), mRNA
          Length = 2449

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 196  caacaatggcagctcgggcct 216
            |||||||||||||||||||||
Sbjct: 2014 caacaatggcagctcgggcct 1994



to top

>dbj|AK042299.1| Mus musculus 3 days neonate thymus cDNA, RIKEN full-length enriched
           library, clone:A630079M19 product:hypothetical protein,
           full insert sequence
          Length = 1124

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 196 caacaatggcagctcgggcct 216
           |||||||||||||||||||||
Sbjct: 716 caacaatggcagctcgggcct 696



to top

>dbj|AK211451.1| Mus musculus cDNA, clone:Y2G0121M21, strand:minus,
           reference:ENSEMBL:Mouse-Transcript-
           ENST:ENSMUST00000042312, based on BLAT search
          Length = 405

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 196 caacaatggcagctcgggcct 216
           |||||||||||||||||||||
Sbjct: 164 caacaatggcagctcgggcct 144



to top

>dbj|AK212088.1| Mus musculus cDNA, clone:Y2G0123N06, strand:minus,
           reference:ENSEMBL:Mouse-Transcript-
           ENST:ENSMUST00000042312, based on BLAT search
          Length = 408

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 196 caacaatggcagctcgggcct 216
           |||||||||||||||||||||
Sbjct: 168 caacaatggcagctcgggcct 148



to top

>emb|AM180252.1| Lawsonia intracellularis PHE/MN1-00
          Length = 1457619

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 46     gtcatgcaatgaaagatacat 66
              |||||||||||||||||||||
Sbjct: 421250 gtcatgcaatgaaagatacat 421230



to top

>ref|XM_509728.1| PREDICTED: Pan troglodytes similar to KIAA0865 protein (LOC452655),
           mRNA
          Length = 1065

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 113 aggcacaaatcattgagttg 132
           ||||||||||||||||||||
Sbjct: 401 aggcacaaatcattgagttg 382



to top

>gb|AC161798.6| Mus musculus chromosome 7, clone RP23-267I20, complete sequence
          Length = 182519

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 190   tggctgcaacaatggcagct 209
             ||||||||||||||||||||
Sbjct: 86509 tggctgcaacaatggcagct 86528



to top

>ref|NM_177250.2| Mus musculus leucine rich repeat neuronal 6D (Lrrn6d), mRNA
          Length = 2943

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 165  gtccaggcggcggcggaggc 184
            ||||||||||||||||||||
Sbjct: 1404 gtccaggcggcggcggaggc 1385



to top

>gb|AC135459.3| Oryza sativa (japonica cultivar-group) chromosome 11 clone
             OSJNBa0004P24, complete sequence
          Length = 137721

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 170   ggcggcggcggaggcacggg 189
             ||||||||||||||||||||
Sbjct: 91809 ggcggcggcggaggcacggg 91828



to top

>gb|AC134572.4| Mus musculus BAC clone RP23-435M15 from chromosome 3, complete sequence
          Length = 202037

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 356    agttttatttttgcttgtgt 375
              ||||||||||||||||||||
Sbjct: 175194 agttttatttttgcttgtgt 175175



to top

>gb|AC132428.3| Mus musculus BAC clone RP23-203K20 from chromosome 7, complete sequence
          Length = 194926

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 190   tggctgcaacaatggcagct 209
             ||||||||||||||||||||
Sbjct: 18280 tggctgcaacaatggcagct 18261



to top

>ref|XM_540117.2| PREDICTED: Canis familiaris similar to Potassium channel subfamily
           K member 3 (Acid-sensitive potassium channel protein
           TASK-1) (TWIK-related acid-sensitive K(+) channel 1)
           (Two pore potassium channel KT3.1) (LOC483002), mRNA
          Length = 1188

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 170 ggcggcggcggaggcacgggtggc 193
           ||||||||||| ||||||||||||
Sbjct: 811 ggcggcggcgggggcacgggtggc 834



to top

>gb|AC122299.5| Mus musculus BAC clone RP23-270L23 from chromosome 5, complete sequence
          Length = 209091

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 190    tggctgcaacaatggcagct 209
              ||||||||||||||||||||
Sbjct: 124499 tggctgcaacaatggcagct 124518



to top

>gb|AC131726.3| Mus musculus BAC clone RP23-132P9 from 3, complete sequence
          Length = 190554

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 356   agttttatttttgcttgtgt 375
             ||||||||||||||||||||
Sbjct: 21254 agttttatttttgcttgtgt 21235



to top

>gb|AC122808.3| Mus musculus BAC clone RP23-298M23 from 3, complete sequence
          Length = 190130

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 165    gtccaggcggcggcggaggc 184
              ||||||||||||||||||||
Sbjct: 133691 gtccaggcggcggcggaggc 133710



to top

>ref|XM_738042.1| Plasmodium chabaudi chabaudi hypothetical protein (PC000399.01.0)
           partial mRNA
          Length = 2373

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 358 ttttatttttgcttgtgtcg 377
           ||||||||||||||||||||
Sbjct: 613 ttttatttttgcttgtgtcg 594



to top

>ref|XM_661388.1| Cryptosporidium hominis TU502 ZW18 protein (Chro.30014) partial mRNA
          Length = 3627

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 563  caaaaccttcaactttgatt 582
            ||||||||||||||||||||
Sbjct: 2492 caaaaccttcaactttgatt 2511



to top

>gb|AY305378.1| Ralstonia eutropha H16 megaplasmid pHG1, complete sequence
          Length = 452156

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 473    atcgtccagcagatcttcgt 492
              ||||||||||||||||||||
Sbjct: 145588 atcgtccagcagatcttcgt 145569



to top

>emb|AL590083.8| Human DNA sequence from clone RP11-475D8 on chromosome X Contains a
             novel gene, the GPR23 gene for G protein-coupled receptor
             23 and a 60S ribosomal protein L7 (RPL7) pseudogene,
             complete sequence
          Length = 127780

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 356   agttttatttttgcttgtgt 375
             ||||||||||||||||||||
Sbjct: 72308 agttttatttttgcttgtgt 72289



to top

>emb|AL353143.14| Human DNA sequence from clone RP11-383F12 on chromosome 13 Contains part
              of a novel gene (including KIAA0865), possible ortholog of
              rat myosin heavy chain Myr 8 (Loc192253) and a novel gene,
              complete sequence
          Length = 170276

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 113    aggcacaaatcattgagttg 132
              ||||||||||||||||||||
Sbjct: 146067 aggcacaaatcattgagttg 146048



to top

>emb|AL033529.25|HS27O5 Human DNA sequence from clone RP1-27O5 on chromosome 1p34.1-35.3
             Contains the 3' end of the ZBTB8 gene for zinc finger and
             BTB domain containing 8, the 3' end of the gene for
             archease (ARCH) and two CpG islands, complete sequence
          Length = 147167

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 565   aaaccttcaactttgattcc 584
             ||||||||||||||||||||
Sbjct: 25661 aaaccttcaactttgattcc 25642



to top

>emb|AL606634.2|OSJN00066 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0072N21,
             complete sequence
          Length = 130433

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 170   ggcggcggcggaggcacggg 189
             ||||||||||||||||||||
Sbjct: 86426 ggcggcggcggaggcacggg 86407



to top

>emb|AL590146.2| Zebrafish DNA sequence from clone RP71-20I5 in linkage group 9 Contains
             a gene for a novel protein similar to human FLJ20730
             protein,  a gene for a novel protein similar to rat
             steroid sensitive gene-1 protein (SSG-1), a gene for a
             novel protein similar to vertebrate coagulation factor V
             and VIII, a gene for a novel protein similar to human
             G-protein coupled receptor RE2, a gene for a novel
             transcript and a CpG island, complete sequence
          Length = 121086

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 356   agttttatttttgcttgtgt 375
             ||||||||||||||||||||
Sbjct: 35641 agttttatttttgcttgtgt 35660



to top

>emb|AL713962.14| Mouse DNA sequence from clone RP23-3D5 on chromosome 11, complete
             sequence
          Length = 230198

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 309   gcagcatatgttcttgaact 328
             ||||||||||||||||||||
Sbjct: 55473 gcagcatatgttcttgaact 55454



to top

>gb|AC154697.2| Mus musculus BAC clone RP23-136A22 from chromosome 13, complete
             sequence
          Length = 202379

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 41    taattgtcatgcaatgaaagatacatgt 68
             ||||||| ||||||| ||||||||||||
Sbjct: 11476 taattgtaatgcaattaaagatacatgt 11449



to top

>gb|AC091521.19| Mus musculus chromosome 1 clone rp23-145f9, complete sequence
          Length = 198784

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 190    tggctgcaacaatggcagct 209
              ||||||||||||||||||||
Sbjct: 112961 tggctgcaacaatggcagct 112942



to top

>gb|AC105343.4| Homo sapiens BAC clone RP11-423J7 from 4, complete sequence
          Length = 155217

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 581   ttccgctgatggagccttaactga 604
             |||| |||||||||||||||||||
Sbjct: 87533 ttcctctgatggagccttaactga 87510



to top

>gb|CP000264.1| Jannaschia sp. CCS1, complete genome
          Length = 4317977

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 166     tccaggcggcggcggaggca 185
               ||||||||||||||||||||
Sbjct: 4159906 tccaggcggcggcggaggca 4159887



to top

>ref|XM_625319.1| Cryptosporidium parvum Iowa II hypothetical protein (cgd3_50),
            partial mRNA
          Length = 3627

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 563  caaaaccttcaactttgatt 582
            ||||||||||||||||||||
Sbjct: 2492 caaaaccttcaactttgatt 2511



to top

>gb|AC159231.2| Mus musculus BAC clone RP24-387F20 from chromosome 13, complete
            sequence
          Length = 150809

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                        
Query: 41   taattgtcatgcaatgaaagatacatgt 68
            ||||||| ||||||| ||||||||||||
Sbjct: 9561 taattgtaatgcaattaaagatacatgt 9588



to top

>gb|AC092243.1|AC092243 Drosophila melanogaster, chromosome 2L, region 34D-34E, BAC clone
             BACR09N24, complete sequence
          Length = 158758

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 599   aactgaaagcttctcaatta 618
             ||||||||||||||||||||
Sbjct: 13300 aactgaaagcttctcaatta 13319



to top

>gb|AC092225.1|AC092225 Drosophila melanogaster, chromosome 2L, region 35X-35X, BAC clone
              BACR18J08, complete sequence
          Length = 186803

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 599    aactgaaagcttctcaatta 618
              ||||||||||||||||||||
Sbjct: 158710 aactgaaagcttctcaatta 158729



to top

>dbj|AK042286.1| Mus musculus 3 days neonate thymus cDNA, RIKEN full-length enriched
            library, clone:A630078J04 product:hypothetical
            Cysteine-rich flanking region, C-terminal/Leucine-rich
            repeat/Leucine-rich repeat, typical subtype containing
            protein, full insert sequence
          Length = 2178

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 165  gtccaggcggcggcggaggc 184
            ||||||||||||||||||||
Sbjct: 2105 gtccaggcggcggcggaggc 2086



to top

>dbj|AK040952.1| Mus musculus adult male aorta and vein cDNA, RIKEN full-length
            enriched library, clone:A530050P17 product:hypothetical
            Cysteine-rich flanking region, C-terminal/Cysteine-rich
            flanking region, N-terminal/Leucine-rich
            repeat/Immunoglobulin and major histocompatibility
            complex domain/Immunoglobulin C-2 type/Leucine-rich
            repeat, typical subtype/Immunoglobulin subtype containing
            protein, full insert sequence
          Length = 2943

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 165  gtccaggcggcggcggaggc 184
            ||||||||||||||||||||
Sbjct: 1404 gtccaggcggcggcggaggc 1385



to top

>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete
               sequence
          Length = 35498469

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 170     ggcggcggcggaggcacggg 189
               ||||||||||||||||||||
Sbjct: 8275913 ggcggcggcggaggcacggg 8275894



to top

>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11, complete
               sequence
          Length = 28386948

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 170     ggcggcggcggaggcacggg 189
               ||||||||||||||||||||
Sbjct: 7725146 ggcggcggcggaggcacggg 7725127



to top

>ref|NM_015011.1| Homo sapiens myosin heavy chain Myr 8 (MYR8), mRNA
          Length = 6874

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 113  aggcacaaatcattgagttg 132
            ||||||||||||||||||||
Sbjct: 3560 aggcacaaatcattgagttg 3541



to top

>gb|AC017101.10| Homo sapiens BAC clone RP11-556A11 from 2, complete sequence
          Length = 195635

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 559   ctttcaaaaccttcaacttt 578
             ||||||||||||||||||||
Sbjct: 52761 ctttcaaaaccttcaacttt 52742



to top

>ref|XM_342474.2| PREDICTED: Rattus norvegicus similar to RIKEN cDNA A930018P22
           (LOC362175), mRNA
          Length = 814

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 167 ccaggcggcggcggaggcac 186
           ||||||||||||||||||||
Sbjct: 307 ccaggcggcggcggaggcac 288



to top

>dbj|AB016885.1| Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K19M22
          Length = 77758

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 530   ccaatcaagattgtactcat 549
             ||||||||||||||||||||
Sbjct: 72574 ccaatcaagattgtactcat 72593



to top

>dbj|AK120678.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013162H21, full
           insert sequence
          Length = 1558

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 170 ggcggcggcggaggcacggg 189
           ||||||||||||||||||||
Sbjct: 155 ggcggcggcggaggcacggg 174



to top

>gb|AE003642.3| Drosophila melanogaster chromosome 2L, section 51 of 83 of the complete
              sequence
          Length = 276521

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 599    aactgaaagcttctcaatta 618
              ||||||||||||||||||||
Sbjct: 104935 aactgaaagcttctcaatta 104916



to top

>emb|AL808147.21| Mouse DNA sequence from clone RP23-80N9 on chromosome 4, complete
             sequence
          Length = 233270

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 190   tggctgcaacaatggcagct 209
             ||||||||||||||||||||
Sbjct: 56538 tggctgcaacaatggcagct 56519



to top

>dbj|AB020672.2| Homo sapiens mRNA for KIAA0865 protein, partial cds
          Length = 6864

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 113  aggcacaaatcattgagttg 132
            ||||||||||||||||||||
Sbjct: 3560 aggcacaaatcattgagttg 3541



to top

>gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome 11, complete sequence
          Length = 28369397

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 170     ggcggcggcggaggcacggg 189
               ||||||||||||||||||||
Sbjct: 7795233 ggcggcggcggaggcacggg 7795214



to top

>emb|X69752.1|CHRCRBCL R.cathartica chloroplast rbcL gene for
           ribulose-1,5-biphosphate-carboxylase and promoter region
          Length = 956

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 488 ttcgtatttcttattgaatt 507
           ||||||||||||||||||||
Sbjct: 90  ttcgtatttcttattgaatt 71



to top

>gb|AC167659.7| Mus musculus chromosome 7, clone RP23-165I8, complete sequence
          Length = 248723

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 190   tggctgcaacaatggcagct 209
             ||||||||||||||||||||
Sbjct: 91606 tggctgcaacaatggcagct 91587


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 6,546,186
Number of Sequences: 3902068
Number of extensions: 6546186
Number of successful extensions: 165421
Number of sequences better than 10.0: 76
Number of HSP's better than 10.0 without gapping: 76
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 164932
Number of HSP's gapped (non-prelim): 484
length of query: 672
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 649
effective length of database: 17,143,297,704
effective search space: 11126000209896
effective search space used: 11126000209896
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top