>gb|AC102790.7| Mus musculus chromosome 19, clone RP23-321D22, complete sequence
          Length = 242249

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 197   aaaaataaccttcacatgtaa 217
             |||||||||||||||||||||
Sbjct: 85235 aaaaataaccttcacatgtaa 85255

>gb|AC147558.3| Mus musculus BAC clone RP23-470N2 from 8, complete sequence
          Length = 212626

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 110    catatctgtgttcagtatttg 130
              |||||||||||||||||||||
Sbjct: 113101 catatctgtgttcagtatttg 113121

>gb|AC002546.1|AC002546 Homo sapiens chromosome 17, clone 193h18, complete sequence
          Length = 106420

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 188   agaagtngaaaaaataaccttcacatgt 215
             |||||| || ||||||||||||||||||
Sbjct: 97077 agaagtggataaaataaccttcacatgt 97050

>gb|AC091719.3| Pan troglodytes clone RP43-26K2, complete sequence
          Length = 189864

 Score = 40.1 bits (20), Expect = 3.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 197    aaaaataaccttcacatgta 216
              ||||||||||||||||||||
Sbjct: 162382 aaaaataaccttcacatgta 162401

>gb|AC004976.1|AC004976 Homo sapiens PAC clone RP5-1143H19 from 7p14-p15, complete sequence
          Length = 127425

 Score = 40.1 bits (20), Expect = 3.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 197  aaaaataaccttcacatgta 216
            ||||||||||||||||||||
Sbjct: 1385 aaaaataaccttcacatgta 1404


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,425,699
Number of Sequences: 3902068
Number of extensions: 1425699
Number of successful extensions: 19739
Number of sequences better than 10.0: 5
Number of HSP's better than 10.0 without gapping: 5
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 19733
Number of HSP's gapped (non-prelim): 6
length of query: 247
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 225
effective length of database: 17,147,199,772
effective search space: 3858119948700
effective search space used: 3858119948700
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)