ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbags14i18
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1dbj|D37943.1|WHTPH2B8B Triticum aestivum mRNA for protein H2B-8,... 418 e-114
2dbj|D37945.1|WHTPH2B15D Triticum aestivum gene for protein H2B15... 410 e-111
3gb|BT016429.1| Zea mays clone Contig262 mRNA sequence 408 e-111
4emb|X57313.1|ZMH2B221 Z.mays mRNA for H2B histone (clone cH2B221) 408 e-111
5dbj|D37942.1|WHTPH2B6A Triticum aestivum mRNA for protein H2B-6,... 408 e-111
6ref|XM_483094.1| Oryza sativa (japonica cultivar-group), mRNA 406 e-110
7dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic D... 406 e-110
8dbj|AP004620.3| Oryza sativa (japonica cultivar-group) genomic D... 406 e-110
9emb|X59873.1|TAHISTH2B T.aestivum L mRNA for histone H2B 402 e-109
10gb|BT009535.1| Triticum aestivum clone wr1.pk0136.c2:fis, full i... 400 e-108
11ref|NM_184399.1| Oryza sativa (japonica cultivar-group), mRNA 394 e-107
12dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 394 e-107
13dbj|AP003045.2| Oryza sativa (japonica cultivar-group) genomic D... 394 e-107
14dbj|AP002522.1| Oryza sativa (japonica cultivar-group) genomic D... 394 e-107
15gb|BT017477.1| Zea mays clone EL01N0408F05.c mRNA sequence 391 e-105
16ref|NM_184371.1| Oryza sativa (japonica cultivar-group), mRNA 387 e-104
17ref|XM_475912.1| Oryza sativa (japonica cultivar-group), predic... 387 e-104
18gb|AC104284.2| Oryza sativa (japonica cultivar-group) chromosome... 387 e-104
19gb|AC098832.3| Oryza sativa (japonica cultivar-group) chromosome... 387 e-104
20dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic D... 387 e-104
21dbj|AP002540.2| Oryza sativa (japonica cultivar-group) genomic D... 387 e-104
22ref|NM_184403.1| Oryza sativa (japonica cultivar-group), mRNA 385 e-104
23ref|NM_184405.1| Oryza sativa (japonica cultivar-group), mRNA 383 e-103
24dbj|AB075378.1| Oryza sativa OsH2B mRNA for histone H2B, complet... 383 e-103
25ref|NM_184407.1| Oryza sativa (japonica cultivar-group), mRNA 381 e-102
26ref|NM_184374.1| Oryza sativa (japonica cultivar-group), mRNA 379 e-102
27gb|BT009118.1| Triticum aestivum clone wl1n.pk0003.e12:fis, full... 377 e-101
28ref|NM_184409.1| Oryza sativa (japonica cultivar-group), mRNA 371 1e-99
29gb|U08226.1|ZMU08226 Zea mays W-22 histone H2B mRNA, complete cds 369 4e-99
30gb|BT016519.1| Zea mays clone Contig352 mRNA sequence 351 1e-93
31emb|X69960.1|ZMH2B3A Z.mays gene for H2B histone (gH2B3) 347 2e-92
32emb|X57312.1|ZMH2B214 Z.mays mRNA for H2B histone (clone cH2B214) 345 6e-92
33gb|BT016478.1| Zea mays clone Contig311 mRNA sequence 337 1e-89
34gb|BT016350.1| Zea mays clone Contig183 mRNA sequence 329 4e-87
35gb|BT016885.1| Zea mays clone Contig718 mRNA sequence 327 1e-86
36gb|BT017438.1| Zea mays clone EL01N0404D07.c mRNA sequence 321 9e-85
37gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 319 3e-84
38emb|X69961.1|SMH2B4A Z.mays gene for H2B histone (gH2B4) 319 3e-84
39gb|AC083942.8| Genomic sequence for Oryza sativa, Nipponbare str... 319 3e-84
40dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 319 3e-84
41gb|AF356817.1|AF356817 Lolium perenne histone H2B-1 mRNA, partia... 317 1e-83
42dbj|AP003144.1| Oryza sativa (japonica cultivar-group) genomic D... 311 8e-82
43ref|XM_475367.1| Oryza sativa (japonica cultivar-group), predic... 287 1e-74
44gb|AC117265.2| Oryza sativa (japonica cultivar-group) chromosome... 287 1e-74
45ref|NM_190523.1| Oryza sativa (japonica cultivar-group), predic... 266 4e-68
46dbj|AP003241.3| Oryza sativa (japonica cultivar-group) genomic D... 266 4e-68
47dbj|AP003231.3| Oryza sativa (japonica cultivar-group) genomic D... 266 4e-68
48gb|AY389709.1| Hyacinthus orientalis histone H2B mRNA, partial cds 232 6e-58
49emb|X82362.1|AOHIS2B A.officinalis mRNA for histone 2B 232 6e-58
50dbj|AK059159.1| Oryza sativa (japonica cultivar-group) cDNA clon... 218 9e-54
51dbj|D37944.1|WHTPH2B12C Triticum aestivum gene for protein H2B12... 216 4e-53
52gb|AY581839.1| Cynodon dactylon putative histone H2B mRNA, parti... 198 9e-48
53gb|U16726.1|CRU16726 Chlamydomonas reinhardtii histone H1 (ch1),... 194 1e-46
54gb|L41841.1|CREHIH3G Chlamydomonas reinhardtii histone H3, histo... 180 2e-42
55gb|U16725.1|CRU16725 Chlamydomonas reinhardtii histone H3 (ch3-I... 180 2e-42
56gb|U16724.1|CRU16724 Chlamydomonas reinhardtii histone H3 (ch3-I... 170 2e-39
57gb|AF048824.1|AF048824 Malus domestica histone H2B mRNA, partial... 168 8e-39
58gb|AF356818.1|AF356818 Lolium perenne histone H2B-2 mRNA, partia... 155 1e-34
59gb|AF356821.1|AF356821 Lolium perenne histone H2B-5 mRNA, partia... 147 3e-32
60gb|AF356819.1|AF356819 Lolium perenne histone H2B-3 mRNA, partia... 147 3e-32
61ref|XM_391802.1| Gibberella zeae PH-1 H2B_NEUCR Histone H2B (FG1... 141 2e-30
62emb|BX088700.1|CNS09S4S DNA centromeric region sequence from BAC... 141 2e-30
63dbj|AB124798.1| Rhacophorus schlegelii histh2b mRNA for histone ... 141 2e-30
64emb|AL590462.1|CNS07EGJ DNA centromeric region sequence BAC 34F0... 141 2e-30
65gb|M31922.1|VVCH4AB V.carteri histone H2A-IV and H2B-IV genes, c... 135 1e-28
66ref|XM_540291.2| PREDICTED: Canis familiaris similar to H2B hist... 133 4e-28
67ref|XM_540282.2| PREDICTED: Canis familiaris similar to Histone ... 133 4e-28
68ref|XM_540287.2| PREDICTED: Canis familiaris similar to H2B hist... 133 4e-28
69ref|XM_844635.1| PREDICTED: Canis familiaris similar to H2B hist... 133 4e-28
70ref|XM_854499.1| PREDICTED: Canis familiaris similar to H2B hist... 133 4e-28
71ref|XM_540288.2| PREDICTED: Canis familiaris similar to H2B hist... 133 4e-28
72ref|XM_789621.1| PREDICTED: Strongylocentrotus purpuratus simila... 127 3e-26
73emb|X03018.1|XLHISH3A Xenopus laevis histone gene cluster XlH3-A... 125 1e-25
74gb|BC077399.1| Xenopus laevis histone H2B, mRNA (cDNA clone MGC:... 125 1e-25
75gb|M21287.1|XELHX1H3 X.laevis histone H1B, H2A, H2B, and H4 gene... 125 1e-25
76ref|XM_782648.1| PREDICTED: Strongylocentrotus purpuratus simila... 121 2e-24
77ref|XM_785670.1| PREDICTED: Strongylocentrotus purpuratus simila... 121 2e-24
78gb|DQ215263.1| Taeniopygia guttata clone 0058P0013D11 histone 1 ... 117 3e-23
79ref|XM_513763.1| PREDICTED: Pan troglodytes LOC457260 (LOC457260... 117 3e-23
80ref|XM_427116.1| PREDICTED: Gallus gallus similar to histone H2B... 117 3e-23
81ref|XM_427013.1| PREDICTED: Gallus gallus similar to histone H2B... 117 3e-23
82ref|XM_954347.1| Neurospora crassa OR74A hypothetical protein (N... 117 3e-23
83ref|XM_331210.1| Neurospora crassa OR74A hypothetical protein (N... 117 3e-23
84emb|CR855675.2| Xenopus tropicalis finished cDNA, clone TGas058p09 117 3e-23
85ref|XM_787146.1| PREDICTED: Strongylocentrotus purpuratus simila... 113 4e-22
86ref|XM_781061.1| PREDICTED: Strongylocentrotus purpuratus simila... 113 4e-22
87ref|XM_786200.1| PREDICTED: Strongylocentrotus purpuratus simila... 111 2e-21
88ref|XM_786178.1| PREDICTED: Strongylocentrotus purpuratus simila... 111 2e-21
89emb|X06643.1|SPH2BL4 Strongylocentrotus purpuratus late histone ... 111 2e-21
90emb|X06640.1|SPH2BL1 Strongylocentrotus purpuratus late histone ... 111 2e-21
91ref|NM_214552.1| Strongylocentrotus purpuratus late histone L1 H... 111 2e-21
92gb|M14142.1|SUPH2B1 P.miliaris histone H2B-2.1 gene, complete cds 111 2e-21
93gb|BC077692.1| Xenopus tropicalis histone 1, H2bk, mRNA (cDNA cl... 109 6e-21
94gb|BC107084.1| Homo sapiens histone 2, H2be, mRNA (cDNA clone MG... 109 6e-21
95gb|BC107085.1| Homo sapiens histone 2, H2be, mRNA (cDNA clone MG... 109 6e-21
96gb|BC069193.1| Homo sapiens histone 2, H2be, mRNA (cDNA clone MG... 109 6e-21
97gb|BC005827.2| Homo sapiens histone 2, H2be, mRNA (cDNA clone IM... 109 6e-21
98ref|NM_003528.2| Homo sapiens histone 2, H2be (HIST2H2BE), mRNA 109 6e-21
99emb|AL591493.14| Human DNA sequence from clone RP11-196G18 on ch... 109 6e-21
100emb|AL357493.8| Human DNA sequence from clone RP11-439A17 on chr... 109 6e-21
101emb|AL109948.9|HSJ998N21 Human DNA sequence from clone RP5-998N2... 109 6e-21
102emb|BX072512.1|CNS09S44 Single read from an extremity of a full-... 109 6e-21
103emb|BX072414.1|CNS09S1E Single read from an extremity of a full-... 109 6e-21
104emb|BX051496.1|CNS09BWC Single read from an extremity of a full-... 109 6e-21
105emb|BX051495.1|CNS09BWB Single read from an extremity of a full-... 109 6e-21
106emb|BX047440.1|CNS098RO Single read from an extremity of a full-... 109 6e-21
107emb|BX038423.1|CNS091T7 Single read from an extremity of a full-... 109 6e-21
108emb|BX032827.1|CNS08XHR Single read from an extremity of a full-... 109 6e-21
109emb|BX031663.1|CNS08WLF Single read from an extremity of a full-... 109 6e-21
110emb|BX021771.1|CNS08OYN Single read from an extremity of a full-... 109 6e-21
111emb|BX013307.1|CNS08IFJ Single read from an extremity of a full-... 109 6e-21
112emb|BX012776.1|CNS08I0S Single read from an extremity of a full-... 109 6e-21
113emb|BX012380.1|CNS08HPS Single read from an extremity of a full-... 109 6e-21
114emb|BX009211.1|CNS08F9R Single read from an extremity of a full-... 109 6e-21
115emb|X98185.1|AGH2B A.gambiae mRNA for histone H2B 109 6e-21
116emb|X57985.1|HSHIST H.sapiens genes for histones H2B.1 and H2A 109 6e-21
117emb|CR541895.1| Homo sapiens full open reading frame cDNA clone ... 109 6e-21
118ref|NM_001006890.1| Xenopus tropicalis histone 1, H2bk (hist1h2b... 109 6e-21
119gb|BC096121.1| Homo sapiens histone 2, H2be, mRNA (cDNA clone MG... 109 6e-21
120emb|CR858221.1| Pongo pygmaeus mRNA; cDNA DKFZp469C0528 (from cl... 109 6e-21
121ref|NG_002621.1| Homo sapiens histone 2, H2ba (HIST2H2BA) pseudo... 109 6e-21
122ref|NG_002652.1| Homo sapiens histone 2, H2bb (HIST2H2BB) pseudo... 109 6e-21
123gb|AY131975.1| Homo sapiens histone H2B (HIST2H2BA) pseudogene, ... 109 6e-21
124gb|AY131976.1| Homo sapiens histone H2B (HIST2H2BB) pseudogene, ... 109 6e-21
125gb|AY131979.1| Homo sapiens histone H2B (HIST2H2BE) gene, comple... 109 6e-21
126ref|XM_558160.1| Anopheles gambiae str. PEST ENSANGP00000027582 ... 109 6e-21
127ref|XM_320334.2| Anopheles gambiae str. PEST ENSANGP00000014097 ... 109 6e-21
128ref|XM_320329.2| Anopheles gambiae str. PEST ENSANGP00000014080 ... 109 6e-21
129ref|XM_314450.2| Anopheles gambiae str. PEST ENSANGP00000000674 ... 109 6e-21
130ref|XM_314448.2| Anopheles gambiae str. PEST ENSANGP00000016043 ... 109 6e-21
131ref|XM_306853.2| Anopheles gambiae str. PEST ENSANGP00000000106 ... 109 6e-21
132ref|XM_306255.2| Anopheles gambiae str. PEST ENSANGP00000000003 ... 109 6e-21
133gb|AY893641.1| Synthetic construct Homo sapiens clone FLH130870.... 109 6e-21
134gb|BC098289.1| Homo sapiens histone 1, H2bn, mRNA (cDNA clone MG... 109 6e-21
135gb|BC098112.1| Homo sapiens histone 1, H2bn, mRNA (cDNA clone MG... 109 6e-21
136ref|NM_001024599.2| Homo sapiens histone 2, H2bf (HIST2H2BF), mRNA 109 6e-21
137dbj|AB085854.1| Rosellinia necatrix hh2b gene for histone H2B, c... 109 6e-21
138gb|BC110793.1| Homo sapiens histone 2, H2bf, mRNA (cDNA clone MG... 109 6e-21
139gb|BC106916.1| Homo sapiens similar to histone H2B histone famil... 109 6e-21
140gb|BC073925.1| Homo sapiens similar to histone H2B histone famil... 109 6e-21
141gb|M60756.1|HUMHISH2BA Human histone H2B.1 mRNA, 3' end 109 6e-21
142emb|BX008531.1|CNS08EQV Single read from an extremity of a full-... 107 2e-20
143emb|Z59559.1|HS163A6R H.sapiens CpG island DNA genomic Mse1 frag... 107 2e-20
144gb|BC051872.1| Homo sapiens histone 1, H2bk, mRNA (cDNA clone MG... 105 1e-19
145gb|BC106899.1| Homo sapiens histone 1, H2bg, mRNA (cDNA clone IM... 105 1e-19
146ref|XM_518302.1| PREDICTED: Pan troglodytes similar to H2B histo... 105 1e-19
147ref|XM_518301.1| PREDICTED: Pan troglodytes similar to histone H... 105 1e-19
148ref|XM_518294.1| PREDICTED: Pan troglodytes similar to H2B histo... 105 1e-19
149gb|BC106720.1| Homo sapiens histone 1, H2bo, mRNA (cDNA clone MG... 105 1e-19
150ref|NM_017445.1| Homo sapiens H2B histone family, member S (H2BF... 105 1e-19
151ref|NM_003527.4| Homo sapiens histone 1, H2bo (HIST1H2BO), mRNA 105 1e-19
152gb|BC000893.1| Homo sapiens histone 1, H2bk, mRNA (cDNA clone MG... 105 1e-19
153ref|XM_607722.1| PREDICTED: Bos taurus similar to Histone H2B 29... 105 1e-19
154ref|XM_866738.1| PREDICTED: Bos taurus similar to Histone H2B 29... 105 1e-19
155ref|XM_618175.2| PREDICTED: Bos taurus similar to H2B histone fa... 105 1e-19
156ref|NG_001335.1| Homo sapiens genomic large histone family clust... 105 1e-19
157ref|NG_000009.2| Homo sapiens small histone family cluster (HFS@... 105 1e-19
158ref|NM_080593.1| Homo sapiens histone 1, H2bk (HIST1H2BK), mRNA 105 1e-19
159ref|NM_003526.2| Homo sapiens histone 1, H2bc (HIST1H2BC), mRNA 105 1e-19
160gb|BC009612.1| Homo sapiens histone 1, H2bc, mRNA (cDNA clone IM... 105 1e-19
161ref|XM_535910.2| PREDICTED: Canis familiaris similar to Histone ... 105 1e-19
162ref|XM_843136.1| PREDICTED: Canis familiaris similar to Histone ... 105 1e-19
163ref|XM_849151.1| PREDICTED: Canis familiaris similar to Histone ... 105 1e-19
164ref|XM_849134.1| PREDICTED: Canis familiaris similar to Histone ... 105 1e-19
165ref|XM_545412.2| PREDICTED: Canis familiaris similar to H2B hist... 105 1e-19
166ref|XM_545410.2| PREDICTED: Canis familiaris similar to H2B hist... 105 1e-19
167ref|XM_545401.2| PREDICTED: Canis familiaris similar to H2B hist... 105 1e-19
168ref|XM_545398.2| PREDICTED: Canis familiaris similar to Histone ... 105 1e-19
169ref|XM_848802.1| PREDICTED: Canis familiaris similar to H2B hist... 105 1e-19
170ref|XM_545418.1| PREDICTED: Canis familiaris similar to Histone ... 105 1e-19
171ref|XM_848724.1| PREDICTED: Canis familiaris similar to H2B hist... 105 1e-19
172ref|XM_545375.1| PREDICTED: Canis familiaris similar to testis-s... 105 1e-19
173ref|XM_545374.2| PREDICTED: Canis familiaris similar to testis-s... 105 1e-19
174ref|XM_844623.1| PREDICTED: Canis familiaris similar to Histone ... 105 1e-19
175ref|XM_854475.1| PREDICTED: Canis familiaris similar to Histone ... 105 1e-19
176ref|XM_854447.1| PREDICTED: Canis familiaris similar to H2B hist... 105 1e-19
177ref|XM_545425.2| PREDICTED: Canis familiaris similar to H2B hist... 105 1e-19
178ref|XM_854265.1| PREDICTED: Canis familiaris similar to Histone ... 105 1e-19
179ref|XM_545389.2| PREDICTED: Canis familiaris similar to Histone ... 105 1e-19
180ref|XM_854155.1| PREDICTED: Canis familiaris similar to histone ... 105 1e-19
181ref|XM_854116.1| PREDICTED: Canis familiaris similar to histone ... 105 1e-19
182ref|XM_537880.2| PREDICTED: Canis familiaris similar to histone ... 105 1e-19
183gb|BC038854.1| Homo sapiens SECIS binding protein 2, mRNA (cDNA ... 105 1e-19
184gb|AF531298.1| Homo sapiens histone H2B (HIST1H2BO) gene, comple... 105 1e-19
185gb|AF531294.1| Homo sapiens histone H2B (HIST1H2BK) gene, comple... 105 1e-19
186gb|AF531286.1| Homo sapiens histone H2B (HIST1H2BC) gene, comple... 105 1e-19
187emb|Z98744.2|HS193B12 Human DNA sequence from clone RP1-193B12 o... 105 1e-19
188emb|AL353759.8| Human DNA sequence from clone RP1-221C16 on chro... 105 1e-19
189emb|AL021807.2|HS86C11 Human DNA sequence from clone RP1-86C11 o... 105 1e-19
190emb|X57138.1|HSH2B2H2 Human H2B.2 and H2A.1 genes for Histone H2... 105 1e-19
191emb|AJ223352.1|HSAJ3352 Homo sapiens mRNA for for histone H2B, c... 105 1e-19
192gb|BC064959.1| Homo sapiens histone 1, H2bk, mRNA (cDNA clone MG... 105 1e-19
193gb|U91328.1|HSU91328 Human hereditary haemochromatosis region, h... 105 1e-19
194ref|XM_220506.2| PREDICTED: Rattus norvegicus histone 3, H2ba (p... 105 1e-19
195dbj|AB041017.1| Homo sapiens H2BFS gene for H2B histone family p... 105 1e-19
196emb|BX647290.1|HSM807434 Homo sapiens mRNA; cDNA DKFZp781B2436 (... 105 1e-19
197emb|Z57636.1|HS187F7F H.sapiens CpG island DNA genomic Mse1 frag... 105 1e-19
198dbj|AP001751.1| Homo sapiens genomic DNA, chromosome 21q, sectio... 105 1e-19
199ref|NG_000827.2| Homo sapiens genomic histone family microcluste... 105 1e-19
200gb|BC108737.1| Homo sapiens histone 1, H2bk, mRNA (cDNA clone MG... 105 1e-19
201emb|Z80783.1|HSH2BL H.sapiens H2B/l gene 105 1e-19
202dbj|AP001051.1| Homo sapiens genomic DNA, chromosome 21, clone:K... 105 1e-19
203dbj|AP001050.1| Homo sapiens genomic DNA, chromosome 21, clone:K... 105 1e-19
204ref|XM_524860.1| PREDICTED: Pan troglodytes LOC469477 (LOC469477... 103 4e-19
205ref|XM_792924.1| PREDICTED: Strongylocentrotus purpuratus simila... 103 4e-19
206ref|NM_003522.3| Homo sapiens histone 1, H2bf (HIST1H2BF), mRNA 101 2e-18
207ref|XM_545431.2| PREDICTED: Canis familiaris similar to Histone ... 101 2e-18
208gb|AF531289.1| Homo sapiens histone H2B (HIST1H2BF) gene, comple... 101 2e-18
209emb|CR669650.2|CNS0FFO8 Tetraodon nigroviridis full-length cDNA 101 2e-18
210gb|BC056264.1| Homo sapiens histone 1, H2bg, mRNA (cDNA clone IM... 101 2e-18
211emb|AL031777.5|HS34B20 Human DNA sequence from clone RP1-34B20 o... 101 2e-18
212emb|BX068880.1|CNS09PB8 Single read from an extremity of a full-... 101 2e-18
213emb|BX053939.1|CNS09DS7 Single read from an extremity of a full-... 101 2e-18
214emb|BX053938.1|CNS09DS6 Single read from an extremity of a full-... 101 2e-18
215emb|BX034441.1|CNS08YQL Single read from an extremity of a full-... 101 2e-18
216emb|BX014617.1|CNS08JFX Single read from an extremity of a full-... 101 2e-18
217emb|BX008532.1|CNS08EQW Single read from an extremity of a full-... 101 2e-18
218emb|X02916.1|SGH4H2B Rainbow trout histone H4 and H2B genes 101 2e-18
219gb|BC096123.1| Homo sapiens histone 1, H2bf, mRNA (cDNA clone MG... 101 2e-18
220gb|BC096120.1| Homo sapiens histone 1, H2bf, mRNA (cDNA clone MG... 101 2e-18
221dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic D... 101 2e-18
222dbj|AP006162.2| Oryza sativa (japonica cultivar-group) genomic D... 101 2e-18
223dbj|AK106505.1| Oryza sativa (japonica cultivar-group) cDNA clon... 101 2e-18
224emb|Z80779.1|HSH2BG H.sapiens H2B/g gene 101 2e-18
225gb|M31921.1|VVCH2AB V.carteri histone H2A-III and H2B-III genes,... 101 2e-18
226ref|XM_518295.1| PREDICTED: Pan troglodytes similar to H2B histo... 100 6e-18
227ref|XM_513764.1| PREDICTED: Pan troglodytes LOC457261 (LOC457261... 100 6e-18
228gb|AY656810.1| Homo sapiens H2B/t variant gene, complete cds 100 6e-18
229gb|AY648853.1| Homo sapiens histone H2B/s (HIST2H2BD) gene, comp... 100 6e-18
230ref|XM_868991.1| PREDICTED: Bos taurus similar to Histone H2B 29... 100 6e-18
231gb|BC071638.1| Homo sapiens cDNA clone IMAGE:4390105, containing... 100 6e-18
232gb|BC068044.1| Homo sapiens cDNA clone IMAGE:6380649, containing... 100 6e-18
233emb|BX038797.1|CNS0923L Single read from an extremity of a full-... 100 6e-18
234emb|X14731.1|CMHIST2B Duck H2B histone gene 100 6e-18
235gb|DQ118972.1| Toxoplasma gondii histone 2B variant 2 mRNA, comp... 100 6e-18
236gb|BC108143.1| Bos taurus similar to Histone H2B 291B, mRNA (cDN... 100 6e-18
237ref|NM_001037469.1| Bos taurus similar to Histone H2B 291B (MGC1... 100 6e-18
238ref|XM_936779.1| PREDICTED: Homo sapiens similar to H2B histone ... 100 6e-18
239ref|NG_002619.1| Homo sapiens histone 2, H2bc (HIST2H2BC) pseudo... 100 6e-18
240ref|NG_002620.1| Homo sapiens histone 2, H2bd (HIST2H2BD) pseudo... 100 6e-18
241gb|AY131977.1| Homo sapiens histone H2B (HIST2H2BC) pseudogene, ... 100 6e-18
242gb|AY131978.1| Homo sapiens histone H2B (HIST2H2BD) pseudogene, ... 100 6e-18
243gb|BC107301.1| Mus musculus histone 3, H2bb, mRNA (cDNA clone MG... 98 2e-17
244ref|XM_527280.1| PREDICTED: Pan troglodytes similar to ribosomal... 98 2e-17
245ref|XM_527258.1| PREDICTED: Pan troglodytes similar to histone H... 98 2e-17
246ref|XM_518287.1| PREDICTED: Pan troglodytes similar to Histone H... 98 2e-17
247gb|BC107302.1| Mus musculus histone 3, H2bb, mRNA (cDNA clone MG... 98 2e-17
248ref|XM_525086.1| PREDICTED: Pan troglodytes similar to Histone H... 98 2e-17
249ref|XM_525085.1| PREDICTED: Pan troglodytes similar to histone 3... 98 2e-17
250ref|NM_023422.2| Mus musculus histone 1, H2bc (Hist1h2bc), mRNA 98 2e-17
251ref|NM_175664.1| Mus musculus histone 1, H2bb (Hist1h2bb), mRNA 98 2e-17
252gb|BC082774.1| Mus musculus histone 1, H2bg, mRNA (cDNA clone IM... 98 2e-17
253ref|XM_425468.1| PREDICTED: Gallus gallus similar to H2B histone... 98 2e-17
254ref|XM_425462.1| PREDICTED: Gallus gallus similar to H2B histone... 98 2e-17
255ref|XM_425457.1| PREDICTED: Gallus gallus similar to H2B histone... 98 2e-17
256ref|XM_416196.1| PREDICTED: Gallus gallus similar to H2B histone... 98 2e-17
257ref|XM_416195.1| PREDICTED: Gallus gallus similar to histone 2, ... 98 2e-17
258ref|XM_608099.2| PREDICTED: Bos taurus similar to Histone H2B 29... 98 2e-17
259gb|BC051921.1| Mus musculus histone 3, H2ba, mRNA (cDNA clone MG... 98 2e-17
260ref|XM_868693.1| PREDICTED: Bos taurus similar to H2B histone fa... 98 2e-17
261ref|XM_868885.1| PREDICTED: Bos taurus similar to Histone H2B 29... 98 2e-17
262ref|XM_582734.2| PREDICTED: Bos taurus similar to Histone H2B 29... 98 2e-17
263ref|NM_175055.2| Homo sapiens histone 3, H2bb (HIST3H2BB), mRNA 98 2e-17
264ref|NM_021063.2| Homo sapiens histone 1, H2bd (HIST1H2BD), trans... 98 2e-17
265ref|NM_138720.1| Homo sapiens histone 1, H2bd (HIST1H2BD), trans... 98 2e-17
266ref|NM_003519.3| Homo sapiens histone 1, H2bl (HIST1H2BL), mRNA 98 2e-17
267gb|AC034285.6| Mus musculus chromosome 13, clone RP23-220G21, co... 98 2e-17
268ref|XM_848767.1| PREDICTED: Canis familiaris similar to Histone ... 98 2e-17
269ref|XM_988254.1| PREDICTED: Mus musculus similar to Histone H2B ... 98 2e-17
270ref|XM_978232.1| PREDICTED: Mus musculus similar to Histone H2B ... 98 2e-17
271ref|XM_978035.1| PREDICTED: Mus musculus similar to Histone H2B ... 98 2e-17
272gb|AF531295.1| Homo sapiens histone H2B (HIST1H2BL) gene, comple... 98 2e-17
273gb|AF531287.1| Homo sapiens histone H2B (HIST1H2BD) gene, comple... 98 2e-17
274gb|BC100857.1| Homo sapiens cDNA clone IMAGE:40002416, partial cds 98 2e-17
275ref|NM_022643.1| Rattus norvegicus histone 1, H2ba (Hist1h2ba), ... 98 2e-17
276emb|AL139288.15| Human DNA sequence from clone RP5-915N17 on chr... 98 2e-17
277emb|AL009179.1|HS97D16 Human DNA sequence from clone RP1-97D16 o... 98 2e-17
278emb|Z83740.1|HSZ83740 H.sapiens hH2B/c gene 98 2e-17
279emb|X90778.1|MMTSHIS2B M.musculus H2B gene 98 2e-17
280emb|X80328.1|MMH2B143 M.musculus genes H2b-143, H3-143 98 2e-17
281emb|X59962.1|RNTH2AB R.norvegicus genes for TH2A and TH2B histones 98 2e-17
282emb|X59961.1|RNH2AB R.norvegicus genes for H2A and H2B histones 98 2e-17
283emb|X07766.1|GGH2AB11 Chicken DNA for CH1-10 histone H2A/H2B seq... 98 2e-17
284emb|X06642.1|SPH2BAL3 Strongylocentrotus purpuratus late histone... 98 2e-17
285emb|X02621.1|MMHISH2B Mouse gene for histone H2b 98 2e-17
286emb|AL592149.8| Mouse DNA sequence from clone RP23-283N14 on chr... 98 2e-17
287emb|AL606464.11| Mouse DNA sequence from clone RP23-462P2 on chr... 98 2e-17
288emb|AL589879.21| Mouse DNA sequence from clone RP23-38E20 on chr... 98 2e-17
289emb|AL590614.8| Mouse DNA sequence from clone RP23-9O16 on chrom... 98 2e-17
290emb|AL589651.8| Mouse DNA sequence from clone RP23-138F20 on chr... 98 2e-17
291emb|AL590388.4| Mouse DNA sequence from clone RP23-480B19 on chr... 98 2e-17
292emb|AJ223353.1|HSAJ3353 Homo sapiens mRNA for histone H2B, clone... 98 2e-17
293emb|CR859861.1| Pongo pygmaeus mRNA; cDNA DKFZp469M064 (from clo... 98 2e-17
294gb|BC096122.1| Homo sapiens histone 1, H2bd, transcript variant ... 98 2e-17
295gb|BC002842.2| Homo sapiens histone 1, H2bd, transcript variant ... 98 2e-17
296dbj|AK093747.1| Homo sapiens cDNA FLJ36428 fis, clone THYMU20115... 98 2e-17
297dbj|AK091220.1| Homo sapiens cDNA FLJ33901 fis, clone CTONG20083... 98 2e-17
298dbj|AK036389.1| Mus musculus adult male bone cDNA, RIKEN full-le... 98 2e-17
299dbj|AK005191.1| Mus musculus adult male cerebellum cDNA, RIKEN f... 98 2e-17
300gb|U62669.1|MMU62669 Mus musculus histone H3.2-F (H3-F), histone... 98 2e-17
301dbj|AK005407.1| Mus musculus adult female placenta cDNA, RIKEN f... 98 2e-17
302ref|NG_002618.1| Homo sapiens histone 3, H2ba (HIST3H2BA) pseudo... 98 2e-17
303dbj|AK011516.1| Mus musculus 10 days embryo whole body cDNA, RIK... 98 2e-17
304dbj|AK018765.1| Mus musculus adult male cerebellum cDNA, RIKEN f... 98 2e-17
305emb|CR353801.1| Gallus gallus finished cDNA, clone ChEST919h3 98 2e-17
306gb|BC093761.1| Homo sapiens histone 1, H2bl, mRNA (cDNA clone MG... 98 2e-17
307gb|BC093759.1| Homo sapiens histone 1, H2bl, mRNA (cDNA clone MG... 98 2e-17
308ref|NM_022647.1| Rattus norvegicus histone 1, H2bl (Hist1h2bl), ... 98 2e-17
309gb|BC092138.1| Mus musculus histone 1, H2bh, mRNA (cDNA clone MG... 98 2e-17
310ref|NM_175663.1| Mus musculus histone 1, H2ba (Hist1h2ba), mRNA 98 2e-17
311ref|NM_178195.1| Mus musculus histone 1, H2bf (Hist1h2bf), mRNA 98 2e-17
312ref|NM_178198.1| Mus musculus histone 1, H2bj (Hist1h2bj), mRNA 98 2e-17
313ref|NM_178201.1| Mus musculus histone 1, H2bn (Hist1h2bn), mRNA 98 2e-17
314ref|NM_030082.1| Mus musculus histone 3, H2ba (Hist3h2ba), mRNA 98 2e-17
315ref|XM_214483.3| PREDICTED: Rattus norvegicus histone 1, H2bn (p... 98 2e-17
316gb|AY131980.1| Homo sapiens histone H2B (HIST3H2BA) pseudogene, ... 98 2e-17
317gb|AY131981.1| Homo sapiens histone H2B (HIST3H2BB) gene, comple... 98 2e-17
318gb|AY158942.1| Mus musculus histone protein Hist3h2ba gene, comp... 98 2e-17
319gb|AY158939.1| Mus musculus histone protein Hist1h2ba gene, comp... 98 2e-17
320gb|AY158938.1| Mus musculus histone protein Hist1h2bb gene, comp... 98 2e-17
321gb|AY158937.1| Mus musculus histone protein Hist1h2bc gene, comp... 98 2e-17
322gb|AY158935.1| Mus musculus histone protein Hist1h2bf gene, comp... 98 2e-17
323gb|AY158933.1| Mus musculus histone protein Hist1h2bh gene, comp... 98 2e-17
324gb|AY158932.1| Mus musculus histone protein Hist1h2bj gene, comp... 98 2e-17
325gb|AY158929.1| Mus musculus histone protein Hist1h2bn gene, comp... 98 2e-17
326gb|AY158907.1| Mus musculus histone protein Hist1h1e gene, compl... 98 2e-17
327ref|NM_214554.1| Strongylocentrotus purpuratus late histone L3 H... 98 2e-17
328emb|X05099.1|GGH2B6 Chicken histone H2B gene (pBRA-5.4) 98 2e-17
329emb|X57263.1|GGH2B4G Chicken gene for histone H2B-IV 98 2e-17
330emb|AJ329611.1|HSA329611 Homo sapiens genomic sequence surroundi... 98 2e-17
331gb|BC111653.1| Bos taurus cDNA clone MGC:137516 IMAGE:8026091, c... 98 2e-17
332gb|U37575.1|GGU37575 Gallus gallus histones H4-VI, H2B-VII and H... 98 2e-17
333ref|NM_178197.1| Mus musculus histone 1, H2bh (Hist1h2bh), mRNA 98 2e-17
334emb|AL662809.14| Mouse DNA sequence from clone RP23-441I8 on chr... 98 2e-17
335gb|M18046.1|RATHISTSA Rat testis-specific histone H2B mRNA, comp... 98 2e-17
336gb|M18045.1|RATHISTS Rat testis-specific histone TH2B mRNA, comp... 98 2e-17
337gb|M60751.1|HUMHISAF Human histone H2B.1 (H2B) gene, complete cds 98 2e-17
338gb|M57901.1|CHKH2BB Chicken histone H2B gene, complete cds 98 2e-17
339emb|AJ343028.1|HSA343028 Homo sapiens genomic sequence surroundi... 98 2e-17
340gb|M14143.1|SUPH2A1 P.miliaris histone H2B-2.2 gene, complete cds 98 2e-17
341ref|XM_527282.1| PREDICTED: Pan troglodytes similar to HIST1H2BM... 96 9e-17
342emb|BX014618.1|CNS08JFY Single read from an extremity of a full-... 96 9e-17
343emb|Z46225.1|HTHISH2B H.tubulosa gene encoding histone H2B 96 9e-17
344emb|X03017.1|XLHISH1 Xenopus laevis histone gene cluster Xlh1 wi... 96 9e-17
345gb|AY158931.1| Mus musculus histone protein Hist1h2bk gene, comp... 96 9e-17
346emb|X05100.1|GGH2B7 Chicken histone H2B gene (pPP2d-4.0) 96 9e-17
347ref|NM_175665.1| Mus musculus histone 1, H2bk (Hist1h2bk), mRNA 96 9e-17
348emb|Z58592.1|HS45C9F H.sapiens CpG island DNA genomic Mse1 fragm... 96 9e-17
349gb|M21286.1|XELHX1H1 X.laevis histone H1B, H2A, H2B, and H4 gene... 96 9e-17
350emb|BX047441.1|CNS098RP Single read from an extremity of a full-... 94 4e-16
351emb|BX026873.1|CNS08SWD Single read from an extremity of a full-... 94 4e-16
352emb|BX013308.1|CNS08IFK Single read from an extremity of a full-... 94 4e-16
353emb|AJ556871.1|XLA556871 Expression vector pET3-H2B H2B gene for... 94 4e-16
354dbj|AK108119.1| Oryza sativa (japonica cultivar-group) cDNA clon... 94 4e-16
355gb|J00981.1|XELHIS2BL xenopus laevis h2b histone gene & flanks 94 4e-16
356ref|XM_539321.2| PREDICTED: Canis familiaris similar to histone ... 92 1e-15
357gb|BC095697.1| Danio rerio zgc:112234, mRNA (cDNA clone MGC:1122... 92 1e-15
358ref|XM_686839.1| PREDICTED: Danio rerio similar to histone 2, H2... 92 1e-15
359ref|XM_693375.1| PREDICTED: Danio rerio similar to histone 2, H2... 92 1e-15
360dbj|AK158416.1| Mus musculus adult inner ear cDNA, RIKEN full-le... 92 1e-15
361gb|U62673.1|MMU62673 Mus musculus histone H2a(A)-613, histone H2... 92 1e-15
362ref|NM_001024398.1| Danio rerio zgc:112234 (zgc:112234), mRNA 92 1e-15
363emb|X05094.1|GGH2B1 Chicken histone H2B gene (pKR1a-1.3) 92 1e-15
364emb|Z57637.1|HS187F7R H.sapiens CpG island DNA genomic Mse1 frag... 92 1e-15
365gb|J00865.1|CHKH2B Chicken histone H2B gene and flanks 92 1e-15
366ref|XM_518889.1| PREDICTED: Pan troglodytes similar to histone H... 90 6e-15
367ref|XM_518288.1| PREDICTED: Pan troglodytes similar to Histone H... 90 6e-15
368ref|NM_206882.1| Mus musculus histone 3, H2bb (Hist3h2bb), mRNA 90 6e-15
369ref|NM_178194.2| Mus musculus histone 1, H2be (Hist1h2be), mRNA 90 6e-15
370gb|BC101411.1| Homo sapiens histone 1, H2bn, mRNA (cDNA clone MG... 90 6e-15
371gb|BC101413.1| Homo sapiens histone 1, H2bn, mRNA (cDNA clone MG... 90 6e-15
372gb|BC101412.1| Homo sapiens histone 1, H2bn, mRNA (cDNA clone MG... 90 6e-15
373ref|XM_416197.1| PREDICTED: Gallus gallus similar to H2B histone... 90 6e-15
374gb|BC060304.1| Mus musculus histone 1, H2bg, mRNA (cDNA clone MG... 90 6e-15
375ref|XM_865948.1| PREDICTED: Bos taurus similar to Histone H2B 29... 90 6e-15
376ref|NM_003524.2| Homo sapiens histone 1, H2bh (HIST1H2BH), mRNA 90 6e-15
377ref|NM_003520.3| Homo sapiens histone 1, H2bn (HIST1H2BN), mRNA 90 6e-15
378gb|BC011372.1| Homo sapiens histone 1, H2bn, mRNA (cDNA clone IM... 90 6e-15
379gb|BC061044.1| Mus musculus histone 1, H2bp, mRNA (cDNA clone MG... 90 6e-15
380gb|AF531297.1| Homo sapiens histone H2B (HIST1H2BN) gene, comple... 90 6e-15
381gb|AF531291.1| Homo sapiens histone H2B (HIST1H2BH) gene, comple... 90 6e-15
382gb|AF531288.1| Homo sapiens histone H2B (HIST1H2BE) gene, comple... 90 6e-15
383emb|CR708520.2|CNS0G9N8 Tetraodon nigroviridis full-length cDNA 90 6e-15
384gb|BC011440.1| Mus musculus histone 1, H2bc, mRNA (cDNA clone MG... 90 6e-15
385gb|BC009783.1| Homo sapiens histone 1, H2bn, mRNA (cDNA clone MG... 90 6e-15
386emb|Z83336.1|HSZ83336 H.sapiens hH2B/d gene 90 6e-15
387emb|Z80780.1|HSH2BH H.sapiens H2B/h gene 90 6e-15
388ref|NM_001031481.1| Gallus gallus histone H2B (LOC427886), mRNA 90 6e-15
389emb|X07763.1|GGH2AB8 Chicken DNA for pCH3.5E histone H2A/H2B seq... 90 6e-15
390emb|X07762.1|GGH2AB7 Chicken DNA for pCH22.0B histone H2A/H2B se... 90 6e-15
391emb|X05863.1|MMHIS2BB Mouse H2B and H2A-pseudo histone genes (291B) 90 6e-15
392emb|X05862.1|MMHIS2BA Mouse H2B and H2A histone genes (291A) 90 6e-15
393gb|BC096116.1| Homo sapiens histone 1, H2bh, mRNA (cDNA clone MG... 90 6e-15
394gb|BC096119.1| Homo sapiens histone 1, H2bh, mRNA (cDNA clone MG... 90 6e-15
395emb|V00415.1|GGHI02 Gallus gallus gene coding for histone H2b 90 6e-15
396gb|BC096117.1| Homo sapiens histone 1, H2bh, mRNA (cDNA clone MG... 90 6e-15
397gb|BC096118.1| Homo sapiens histone 1, H2bh, mRNA (cDNA clone MG... 90 6e-15
398gb|BC069889.1| Mus musculus histone 1, H2be, mRNA (cDNA clone MG... 90 6e-15
399gb|BC019673.1| Mus musculus histone 1, H2bc, mRNA (cDNA clone MG... 90 6e-15
400dbj|AB220463.1| Macaca fascicularis mRNA, clone QflA-14990: simi... 90 6e-15
401dbj|AB168579.1| Macaca fascicularis testis cDNA clone: QtsA-1317... 90 6e-15
402dbj|AK049948.1| Mus musculus adult male hippocampus cDNA, RIKEN ... 90 6e-15
403gb|BC109769.1| Bos taurus cDNA clone MGC:133753 IMAGE:8062200, c... 90 6e-15
404dbj|AK030546.1| Mus musculus adult male pituitary gland cDNA, RI... 90 6e-15
405ref|NM_178196.2| Mus musculus histone 1, H2bg (Hist1h2bg), mRNA 90 6e-15
406ref|NM_178199.1| Mus musculus histone 1, H2bl (Hist1h2bl), mRNA 90 6e-15
407ref|NM_178200.1| Mus musculus histone 1, H2bm (Hist1h2bm), mRNA 90 6e-15
408ref|NM_178202.1| Mus musculus histone 1, H2bp (Hist1h2bp), mRNA 90 6e-15
409ref|XM_341530.2| PREDICTED: Rattus norvegicus histone 1, H2bm (p... 90 6e-15
410gb|AY158943.1| Mus musculus histone protein Hist3h2bb gene, comp... 90 6e-15
411gb|AY158936.1| Mus musculus histone protein Hist1h2be gene, comp... 90 6e-15
412gb|AY158934.1| Mus musculus histone protein Hist1h2bg gene, comp... 90 6e-15
413gb|AY158930.1| Mus musculus histone protein Hist1h2bp gene, comp... 90 6e-15
414gb|AY158928.1| Mus musculus histone protein Hist1h2bm gene, comp... 90 6e-15
415gb|AY158927.1| Mus musculus histone protein Hist1h2bl gene, comp... 90 6e-15
416gb|AY158926.1| Mus musculus histone protein Hist3h2a gene, compl... 90 6e-15
417gb|AY158911.1| Mus musculus histone protein Hist1h2ak gene, comp... 90 6e-15
418gb|AY158909.1| Mus musculus histone protein Hist1h2ai gene, comp... 90 6e-15
419emb|X05098.1|GGH2B5 Chicken histone H2B gene (pBBA-3.0) 90 6e-15
420emb|X05097.1|GGH2B4 Chicken histone H2B gene (pPP2d-2.3) 90 6e-15
421emb|X05096.1|GGH2B3 Chicken histone H2B gene (pRR3c-3.5) 90 6e-15
422emb|X05095.1|GGH2B2 Chicken histone H2B gene (pRR2e-3.5) 90 6e-15
423dbj|AK130106.1| Homo sapiens cDNA FLJ26596 fis, clone LNF08501 90 6e-15
424gb|BC079458.1| Rattus norvegicus histone 1, H2bh, mRNA (cDNA clo... 90 6e-15
425gb|BC101750.1| Homo sapiens histone 1, H2be, mRNA (cDNA clone MG... 90 6e-15
426gb|BC101748.1| Homo sapiens histone 1, H2be, mRNA (cDNA clone MG... 90 6e-15
427ref|NM_003523.2| Homo sapiens histone 1, H2be (HIST1H2BE), mRNA 90 6e-15
428gb|M25487.1|MUSHIS2B Mus musculus histone H2b mRNA, 3' end 90 6e-15
429gb|J00864.1|CHKH2A2B Chicken histone H2A/H2B gene pair and flanks 90 6e-15
430dbj|D70896.1| Gallus gallus DNA for histone H2B, complete cds 90 6e-15
431ref|XM_532763.2| PREDICTED: Canis familiaris similar to testis-s... 88 2e-14
432ref|XM_504425.1| Yarrowia lipolytica CLIB122, YALI0E26455g predi... 88 2e-14
433dbj|D10396.1|RICT20 Oryza sativa mRNA for histone H2B (T20 gene)... 88 2e-14
434emb|Z61298.1|HS4B6F H.sapiens CpG island DNA genomic Mse1 fragme... 88 2e-14
435gb|U93852.1|ECU93852 Euplotes crassus histone H2B (H2B(1)) gene,... 88 2e-14
436emb|CR382131.1| Yarrowia lipolytica chromosome E of strain CLIB ... 88 2e-14
437ref|XM_868522.1| PREDICTED: Bos taurus similar to Histone H2B 29... 86 9e-14
438gb|AY769467.1| Stylonychia lemnae macronuclear development prote... 86 9e-14
439emb|AL136219.17| Human DNA sequence from clone RP11-149B7 on chr... 86 9e-14
440emb|BX032828.1|CNS08XHS Single read from an extremity of a full-... 86 9e-14
441emb|BX009212.1|CNS08F9S Single read from an extremity of a full-... 86 9e-14
442ref|XM_683203.1| PREDICTED: Danio rerio similar to histone 1, H2... 86 9e-14
443gb|S49144.1| histone H2B-1, histone H2A [Tigriopus californicus,... 86 9e-14
444gb|M84798.1|TIGH2B2A Tigriopus californicus histone H2B-2 gene, ... 86 9e-14
445gb|M84797.1|TIGH1234A Tigriopus californicus histone H1 gene, co... 86 9e-14
446emb|CR354435.20| Zebrafish DNA sequence from clone CH211-113A14 ... 86 9e-14
447ref|XM_482672.1| Oryza sativa (japonica cultivar-group), mRNA 84 4e-13
448ref|XM_581429.2| PREDICTED: Bos taurus similar to Histone H2B 29... 84 4e-13
449emb|CR719344.2|CNS0GHZQ Tetraodon nigroviridis full-length cDNA 84 4e-13
450emb|CR698920.2|CNS0G28K Tetraodon nigroviridis full-length cDNA 84 4e-13
451emb|CR689567.2|CNS0FV0R Tetraodon nigroviridis full-length cDNA 84 4e-13
452emb|CR686222.2|CNS0FSFU Tetraodon nigroviridis full-length cDNA 84 4e-13
453gb|AY271238.1| Homo sapiens clone RM2-A03 putative promoter sequ... 84 4e-13
454gb|BC058562.1| Mus musculus cDNA clone IMAGE:6389884 84 4e-13
455gb|BC047137.1| Mus musculus histone 2, H2be, mRNA (cDNA clone MG... 84 4e-13
456dbj|AK143398.1| Mus musculus 2 days pregnant adult female ovary ... 84 4e-13
457dbj|AK162494.1| Mus musculus adult male urinary bladder cDNA, RI... 84 4e-13
458dbj|AK168767.1| Mus musculus 16 days embryo kidney cDNA, RIKEN f... 84 4e-13
459dbj|AK167546.1| Mus musculus 14 days embryo liver cDNA, RIKEN fu... 84 4e-13
460dbj|AK170749.1| Mus musculus NOD-derived CD11c +ve dendritic cel... 84 4e-13
461dbj|AK090189.1| Mus musculus 14 days embryo lung cDNA, RIKEN ful... 84 4e-13
462dbj|AK078533.1| Mus musculus 12 days embryo female mullerian duc... 84 4e-13
463gb|AY158940.1| Mus musculus histone protein Hist2h2be gene, comp... 84 4e-13
464dbj|AP004665.4| Oryza sativa (japonica cultivar-group) genomic D... 84 4e-13
465dbj|AP004558.3| Oryza sativa (japonica cultivar-group) genomic D... 84 4e-13
466emb|Z61710.1|HS57C4R H.sapiens CpG island DNA genomic Mse1 fragm... 84 4e-13
467gb|AC093350.15| Mus musculus chromosome 3, clone RP23-16G3, comp... 84 4e-13
468gb|AC125099.3| Mus musculus BAC clone RP24-201C14 from 3, comple... 84 4e-13
469ref|NM_178214.2| Mus musculus histone 2, H2be (Hist2h2be), mRNA 84 4e-13
470gb|K01888.1|HUMH2BPS2 Human histone H2B pseudogene (lambda-HHG55) 84 4e-13
471ref|NM_100653.2| Arabidopsis thaliana DNA binding AT1G07790 mRNA... 82 1e-12
472ref|XM_608871.1| PREDICTED: Bos taurus similar to Histone H2B 29... 82 1e-12
473ref|XM_867420.1| PREDICTED: Bos taurus similar to Histone H2B 29... 82 1e-12
474ref|XM_604423.1| PREDICTED: Bos taurus similar to H2B histone fa... 82 1e-12
475ref|XM_609153.2| PREDICTED: Bos taurus similar to Histone H2B 29... 82 1e-12
476ref|XM_605634.1| PREDICTED: Bos taurus similar to Histone H2B 29... 82 1e-12
477ref|XM_598166.2| PREDICTED: Bos taurus similar to Histone H2B 29... 82 1e-12
478ref|NM_021058.3| Homo sapiens histone 1, H2bj (HIST1H2BJ), mRNA 82 1e-12
479gb|AF531293.1| Homo sapiens histone H2B (HIST1H2BJ) gene, comple... 82 1e-12
480gb|BC112625.1| Bos taurus MGC133641 protein, mRNA (cDNA clone MG... 82 1e-12
481emb|BX022107.1|CNS08P7Z Single read from an extremity of a full-... 82 1e-12
482emb|BX021770.1|CNS08OYM Single read from an extremity of a full-... 82 1e-12
483emb|Z80781.1|HSH2BJ H.sapiens H2B/j gene 82 1e-12
484emb|X00088.1|HSHISH2B Human histone H2b gene 82 1e-12
485gb|AY133638.1| Arabidopsis thaliana At1g07790/F24B9_10 mRNA, com... 82 1e-12
486gb|AY070760.1| Arabidopsis thaliana At1g07790/F24B9_10 mRNA, com... 82 1e-12
487ref|XM_684372.1| PREDICTED: Danio rerio similar to histone 2, H2... 82 1e-12
488ref|XM_686687.1| PREDICTED: Danio rerio similar to histone 2, H2... 82 1e-12
489ref|XM_685927.1| PREDICTED: Danio rerio similar to histone 1, H2... 82 1e-12
490gb|AF332446.1| Arabidopsis thaliana clone C00142 (p) putative hi... 82 1e-12
491gb|AY088636.1| Arabidopsis thaliana clone 8711 mRNA, complete se... 82 1e-12
492ref|XM_227459.1| PREDICTED: Rattus norvegicus similar to histone... 82 1e-12
493gb|AY158918.1| Mus musculus histone protein Hist1h2ad gene, comp... 82 1e-12
494gb|AC007583.2|F24B9 Arabidopsis thaliana chromosome 1 BAC F24B9 ... 82 1e-12
495gb|AF130878.1|AF130878 Arabidopsis thaliana phosphoribosylanthra... 82 1e-12
496gb|U34757.2|ATU34757 Arabidopsis thaliana phosphoribosylanthrani... 82 1e-12
497ref|XM_870058.1| PREDICTED: Bos taurus similar to Histone H2B 29... 80 6e-12
498gb|BC067486.1| Homo sapiens histone 1, H2bm, mRNA (cDNA clone MG... 80 6e-12
499gb|BC067489.1| Homo sapiens histone 1, H2bm, mRNA (cDNA clone MG... 80 6e-12
500gb|BC067488.1| Homo sapiens histone 1, H2bm, mRNA (cDNA clone MG... 80 6e-12

>dbj|D37943.1|WHTPH2B8B Triticum aestivum mRNA for protein H2B-8, complete cds
          Length = 592

 Score =  418 bits (211), Expect = e-114
 Identities = 235/244 (96%)
 Strand = Plus / Minus

                                                                       
Query: 118 gaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccg 177
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 472 gaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccg 413

                                                                       
Query: 178 gggaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttg 237
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 412 gggaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttg 353

                                                                       
Query: 238 tacctcgcgagcttggcggactcgccggcaagcttntcgaagatgtcgttgatgaaggag 297
           || |  ||||||||||||||||||||||| ||||| ||||||||||||||||||||||||
Sbjct: 352 tagcgggcgagcttggcggactcgccggcgagcttctcgaagatgtcgttgatgaaggag 293

                                                                       
Query: 298 ttcatgatggacatggccttggaggagatgccgatgtccggntgcacctgcttgancacc 357
           |||||||||||||||||||||||||||||||||||||| || ||||||||||| | ||||
Sbjct: 292 ttcatgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcacc 233

               
Query: 358 ttga 361
           ||||
Sbjct: 232 ttga 229



to top

>dbj|D37945.1|WHTPH2B15D Triticum aestivum gene for protein H2B153, complete cds
          Length = 3209

 Score =  410 bits (207), Expect = e-111
 Identities = 234/244 (95%)
 Strand = Plus / Minus

                                                                        
Query: 118  gaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccg 177
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| 
Sbjct: 1698 gaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgcct 1639

                                                                        
Query: 178  gggaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttg 237
            |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||
Sbjct: 1638 gggaggacgaggcggacggaggtctggatctcccgggatgtgatggtgggcttcttgttg 1579

                                                                        
Query: 238  tacctcgcgagcttggcggactcgccggcaagcttntcgaagatgtcgttgatgaaggag 297
            |||| ||| |||||||||||||||||||| ||||| ||||||||||||||||||||||||
Sbjct: 1578 taccgcgccagcttggcggactcgccggcgagcttctcgaagatgtcgttgatgaaggag 1519

                                                                        
Query: 298  ttcatgatggacatggccttggaggagatgccgatgtccggntgcacctgcttgancacc 357
            ||| ||||||||||||||||||||||||||||||||||||| ||||||||||| | ||||
Sbjct: 1518 ttcgtgatggacatggccttggaggagatgccgatgtccgggtgcacctgcttcagcacc 1459

                
Query: 358  ttga 361
            ||||
Sbjct: 1458 ttga 1455



to top

>gb|BT016429.1| Zea mays clone Contig262 mRNA sequence
          Length = 564

 Score =  408 bits (206), Expect = e-111
 Identities = 239/251 (95%)
 Strand = Plus / Minus

                                                                       
Query: 111 ctaggacgaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgag 170
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 404 ctaggacgaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgag 345

                                                                       
Query: 171 ctcgccggggaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggctt 230
           ||| ||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||
Sbjct: 344 ctccccggggaggacgaggcgcacggaggtctggatctcacgggaggtgatggtgggctt 285

                                                                       
Query: 231 cttgttgtacctcgcgagcttggcggactcgccggcaagcttntcgaagatgtcgttgat 290
           ||||||||||| |||||||||||||| |||| |||| ||||| |||||||||||||||||
Sbjct: 284 cttgttgtaccgcgcgagcttggcggcctcggcggcgagcttctcgaagatgtcgttgat 225

                                                                       
Query: 291 gaaggagttcatgatggacatggccttggaggagatgccgatgtccggntgcacctgctt 350
           ||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||
Sbjct: 224 gaaggagttcatgatggacatggccttagaggagatgccgatgtccgggtgcacctgctt 165

                      
Query: 351 gancaccttga 361
            | ||||||||
Sbjct: 164 cagcaccttga 154



to top

>emb|X57313.1|ZMH2B221 Z.mays mRNA for H2B histone (clone cH2B221)
          Length = 653

 Score =  408 bits (206), Expect = e-111
 Identities = 239/251 (95%)
 Strand = Plus / Minus

                                                                       
Query: 111 ctaggacgaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgag 170
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 470 ctaggacgaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgag 411

                                                                       
Query: 171 ctcgccggggaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggctt 230
           ||| ||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||
Sbjct: 410 ctccccggggaggacgaggcgcacggaggtctggatctcacgggaggtgatggtgggctt 351

                                                                       
Query: 231 cttgttgtacctcgcgagcttggcggactcgccggcaagcttntcgaagatgtcgttgat 290
           ||||||||||| |||||||||||||| |||| |||| ||||| |||||||||||||||||
Sbjct: 350 cttgttgtaccgcgcgagcttggcggcctcggcggcgagcttctcgaagatgtcgttgat 291

                                                                       
Query: 291 gaaggagttcatgatggacatggccttggaggagatgccgatgtccggntgcacctgctt 350
           ||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||
Sbjct: 290 gaaggagttcatgatggacatggccttagaggagatgccgatgtccgggtgcacctgctt 231

                      
Query: 351 gancaccttga 361
            | ||||||||
Sbjct: 230 cagcaccttga 220



to top

>dbj|D37942.1|WHTPH2B6A Triticum aestivum mRNA for protein H2B-6, complete cds
          Length = 564

 Score =  408 bits (206), Expect = e-111
 Identities = 239/251 (95%)
 Strand = Plus / Minus

                                                                       
Query: 111 ctaggacgaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgag 170
           |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 414 ctaggaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgag 355

                                                                       
Query: 171 ctcgccggggaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggctt 230
           ||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||
Sbjct: 354 ctcgccggggaggacgaggcgcacggcggtctggatctcccgggaggtgatggtgggctt 295

                                                                       
Query: 231 cttgttgtacctcgcgagcttggcggactcgccggcaagcttntcgaagatgtcgttgat 290
           ||||||||| | ||| |||||||| ||||||||||| ||||| |||||||||||||||||
Sbjct: 294 cttgttgtagcgcgccagcttggccgactcgccggcgagcttctcgaagatgtcgttgat 235

                                                                       
Query: 291 gaaggagttcatgatggacatggccttggaggagatgccgatgtccggntgcacctgctt 350
           ||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||
Sbjct: 234 gaaggagttcatgatggacatggccttggaggagatgccgatgtcggggtgcacctgctt 175

                      
Query: 351 gancaccttga 361
           || ||||||||
Sbjct: 174 gagcaccttga 164



to top

>ref|XM_483094.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 453

 Score =  406 bits (205), Expect = e-110
 Identities = 232/242 (95%)
 Strand = Plus / Minus

                                                                       
Query: 120 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 179
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 444 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 385

                                                                       
Query: 180 gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgta 239
           |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||
Sbjct: 384 gaggacgaggcggacggaggtctggatctccctggaggtgatggtgggcttcttgttgta 325

                                                                       
Query: 240 cctcgcgagcttggcggactcgccggcaagcttntcgaagatgtcgttgatgaaggagtt 299
           ||| ||||||||||||| ||||||||| ||||| |||||||||||||||||||| |||||
Sbjct: 324 cctggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaacgagtt 265

                                                                       
Query: 300 catgatggacatggccttggaggagatgccgatgtccggntgcacctgcttgancacctt 359
           |||||| |||||||||||||||||||| ||||||||||| ||||||||||||| ||||||
Sbjct: 264 catgattgacatggccttggaggagatcccgatgtccgggtgcacctgcttgagcacctt 205

             
Query: 360 ga 361
           ||
Sbjct: 204 ga 203



to top

>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete
                sequence
          Length = 28434780

 Score =  406 bits (205), Expect = e-110
 Identities = 232/242 (95%)
 Strand = Plus / Minus

                                                                            
Query: 120      ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 179
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 24254615 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 24254556

                                                                            
Query: 180      gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgta 239
                |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||
Sbjct: 24254555 gaggacgaggcggacggaggtctggatctccctggaggtgatggtgggcttcttgttgta 24254496

                                                                            
Query: 240      cctcgcgagcttggcggactcgccggcaagcttntcgaagatgtcgttgatgaaggagtt 299
                ||| ||||||||||||| ||||||||| ||||| |||||||||||||||||||| |||||
Sbjct: 24254495 cctggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaacgagtt 24254436

                                                                            
Query: 300      catgatggacatggccttggaggagatgccgatgtccggntgcacctgcttgancacctt 359
                |||||| |||||||||||||||||||| ||||||||||| ||||||||||||| ||||||
Sbjct: 24254435 catgattgacatggccttggaggagatcccgatgtccgggtgcacctgcttgagcacctt 24254376

                  
Query: 360      ga 361
                ||
Sbjct: 24254375 ga 24254374



 Score =  206 bits (104), Expect = 4e-50
 Identities = 140/152 (92%)
 Strand = Plus / Minus

                                                                            
Query: 121      gtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccgggg 180
                |||||||||||||||||||| |  |||||||||||||| |||||||||||||||||| ||
Sbjct: 24251113 gtgaacttggtgacggccttagcaccctcggagacggcatgcttggcgagctcgccgagg 24251054

                                                                            
Query: 181      aggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgtac 240
                |||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||
Sbjct: 24251053 aggacgaggcggacagaggtctggatctccctggaggtgatggtgggcttcttgttgtac 24250994

                                                
Query: 241      ctcgcgagcttggcggactcgccggcaagctt 272
                |  ||||||||||||| ||| ||| |||||||
Sbjct: 24250993 cgggcgagcttggcggcctcaccgacaagctt 24250962



 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 62/69 (89%)
 Strand = Plus / Minus

                                                                            
Query: 266      caagcttntcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggaga 325
                ||||||| | ||||||| ||||||||||||||||||| |||||||||||||| ||||| |
Sbjct: 21802133 caagcttcttgaagatgccgttgatgaaggagttcataatggacatggccttagaggata 21802074

                         
Query: 326      tgccgatgt 334
                |||| ||||
Sbjct: 21802073 tgccaatgt 21802065



 Score = 63.9 bits (32), Expect = 3e-07
 Identities = 41/44 (93%)
 Strand = Plus / Plus

                                                            
Query: 286      ttgatgaaggagttcatgatggacatggccttggaggagatgcc 329
                ||||||||||||||||||||||||||| ||||||| || |||||
Sbjct: 11770145 ttgatgaaggagttcatgatggacatgaccttggacgatatgcc 11770188



 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 45/51 (88%)
 Strand = Plus / Plus

                                                                   
Query: 286      ttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtcc 336
                |||||||||||||||||||||||| |  |||||| ||| |||| |||||||
Sbjct: 17523219 ttgatgaaggagttcatgatggacgtaaccttgggggatatgctgatgtcc 17523269



 Score = 42.1 bits (21), Expect = 1.2
 Identities = 32/36 (88%)
 Strand = Plus / Plus

                                                    
Query: 268      agcttntcgaagatgtcgttgatgaaggagttcatg 303
                ||||| |||||||||| | ||| |||||||||||||
Sbjct: 11729270 agcttctcgaagatgttgatgaagaaggagttcatg 11729305



to top

>dbj|AP004620.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC
              clone:P0605H02
          Length = 175547

 Score =  406 bits (205), Expect = e-110
 Identities = 232/242 (95%)
 Strand = Plus / Minus

                                                                          
Query: 120    ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 179
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 120954 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 120895

                                                                          
Query: 180    gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgta 239
              |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||
Sbjct: 120894 gaggacgaggcggacggaggtctggatctccctggaggtgatggtgggcttcttgttgta 120835

                                                                          
Query: 240    cctcgcgagcttggcggactcgccggcaagcttntcgaagatgtcgttgatgaaggagtt 299
              ||| ||||||||||||| ||||||||| ||||| |||||||||||||||||||| |||||
Sbjct: 120834 cctggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaacgagtt 120775

                                                                          
Query: 300    catgatggacatggccttggaggagatgccgatgtccggntgcacctgcttgancacctt 359
              |||||| |||||||||||||||||||| ||||||||||| ||||||||||||| ||||||
Sbjct: 120774 catgattgacatggccttggaggagatcccgatgtccgggtgcacctgcttgagcacctt 120715

                
Query: 360    ga 361
              ||
Sbjct: 120714 ga 120713



 Score =  206 bits (104), Expect = 4e-50
 Identities = 140/152 (92%)
 Strand = Plus / Minus

                                                                          
Query: 121    gtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccgggg 180
              |||||||||||||||||||| |  |||||||||||||| |||||||||||||||||| ||
Sbjct: 117452 gtgaacttggtgacggccttagcaccctcggagacggcatgcttggcgagctcgccgagg 117393

                                                                          
Query: 181    aggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgtac 240
              |||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||
Sbjct: 117392 aggacgaggcggacagaggtctggatctccctggaggtgatggtgggcttcttgttgtac 117333

                                              
Query: 241    ctcgcgagcttggcggactcgccggcaagctt 272
              |  ||||||||||||| ||| ||| |||||||
Sbjct: 117332 cgggcgagcttggcggcctcaccgacaagctt 117301



to top

>emb|X59873.1|TAHISTH2B T.aestivum L mRNA for histone H2B
          Length = 712

 Score =  402 bits (203), Expect = e-109
 Identities = 233/244 (95%)
 Strand = Plus / Minus

                                                                       
Query: 118 gaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccg 177
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 516 gaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccg 457

                                                                       
Query: 178 gggaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttg 237
           |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||
Sbjct: 456 gggaggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttg 397

                                                                       
Query: 238 tacctcgcgagcttggcggactcgccggcaagcttntcgaagatgtcgttgatgaaggag 297
           |||| ||| |||||||||| ||||||||| ||||| ||||||||||||||||||||||||
Sbjct: 396 taccgcgccagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggag 337

                                                                       
Query: 298 ttcatgatggacatggccttggaggagatgccgatgtccggntgcacctgcttgancacc 357
           |||||||||||||||||||||||||||||||||||||| || || |||||||| | ||||
Sbjct: 336 ttcatgatggacatggccttggaggagatgccgatgtcggggtgaacctgcttcagcacc 277

               
Query: 358 ttga 361
           ||||
Sbjct: 276 ttga 273



to top

>gb|BT009535.1| Triticum aestivum clone wr1.pk0136.c2:fis, full insert mRNA
           sequence
          Length = 940

 Score =  400 bits (202), Expect = e-108
 Identities = 238/251 (94%)
 Strand = Plus / Minus

                                                                       
Query: 111 ctaggacgaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgag 170
           |||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||
Sbjct: 779 ctaggatgaggtgaacttggtgacggccttggtgccctctgagacggcgtgcttggcgag 720

                                                                       
Query: 171 ctcgccggggaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggctt 230
           ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||
Sbjct: 719 ctcgccggggaggacgaggcggacggaggtctggatctcccgggacgtgatggtgggctt 660

                                                                       
Query: 231 cttgttgtacctcgcgagcttggcggactcgccggcaagcttntcgaagatgtcgttgat 290
           ||||||||| |  ||||||||||||||||| || || ||||| |||||||||||||||||
Sbjct: 659 cttgttgtagcgggcgagcttggcggactccccagcgagcttctcgaagatgtcgttgat 600

                                                                       
Query: 291 gaaggagttcatgatggacatggccttggaggagatgccgatgtccggntgcacctgctt 350
           ||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||
Sbjct: 599 gaaggagttcatgatggacatggccttggaggagatgccgatgtcggggtgcacctgctt 540

                      
Query: 351 gancaccttga 361
           || ||||||||
Sbjct: 539 gagcaccttga 529



to top

>ref|NM_184399.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 462

 Score =  394 bits (199), Expect = e-107
 Identities = 232/244 (95%)
 Strand = Plus / Minus

                                                                       
Query: 118 gaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccg 177
           |||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||
Sbjct: 455 gaggtgaacttggtcacagccttggtgccctcggagacggcgtgcttggcgagctcgccg 396

                                                                       
Query: 178 gggaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttg 237
           ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||
Sbjct: 395 gggaggacgaggcggacggaggtctggatctcccgtgaggtgatggtgggcttcttgttg 336

                                                                       
Query: 238 tacctcgcgagcttggcggactcgccggcaagcttntcgaagatgtcgttgatgaaggag 297
           || | |||||||||||||||||| ||||| ||||| ||||||||||||||||||||||||
Sbjct: 335 tagcgcgcgagcttggcggactccccggcgagcttctcgaagatgtcgttgatgaaggag 276

                                                                       
Query: 298 ttcatgatggacatggccttggaggagatgccgatgtccggntgcacctgcttgancacc 357
           |||||||||||||||||||||||||||||||||||||| || || |||||||||| ||||
Sbjct: 275 ttcatgatggacatggccttggaggagatgccgatgtcggggtggacctgcttgagcacc 216

               
Query: 358 ttga 361
           ||||
Sbjct: 215 ttga 212



to top

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
               sequence
          Length = 43261740

 Score =  394 bits (199), Expect = e-107
 Identities = 232/244 (95%)
 Strand = Plus / Plus

                                                                           
Query: 118     gaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccg 177
               |||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2819242 gaggtgaacttggtcacagccttggtgccctcggagacggcgtgcttggcgagctcgccg 2819301

                                                                           
Query: 178     gggaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttg 237
               ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||
Sbjct: 2819302 gggaggacgaggcggacggaggtctggatctcccgtgaggtgatggtgggcttcttgttg 2819361

                                                                           
Query: 238     tacctcgcgagcttggcggactcgccggcaagcttntcgaagatgtcgttgatgaaggag 297
               || | |||||||||||||||||| ||||| ||||| ||||||||||||||||||||||||
Sbjct: 2819362 tagcgcgcgagcttggcggactccccggcgagcttctcgaagatgtcgttgatgaaggag 2819421

                                                                           
Query: 298     ttcatgatggacatggccttggaggagatgccgatgtccggntgcacctgcttgancacc 357
               |||||||||||||||||||||||||||||||||||||| || || |||||||||| ||||
Sbjct: 2819422 ttcatgatggacatggccttggaggagatgccgatgtcggggtggacctgcttgagcacc 2819481

                   
Query: 358     ttga 361
               ||||
Sbjct: 2819482 ttga 2819485



 Score =  387 bits (195), Expect = e-104
 Identities = 231/244 (94%)
 Strand = Plus / Minus

                                                                           
Query: 118     gaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccg 177
               |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2673933 gaggtgaatttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccg 2673874

                                                                           
Query: 178     gggaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttg 237
               |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||
Sbjct: 2673873 gggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttg 2673814

                                                                           
Query: 238     tacctcgcgagcttggcggactcgccggcaagcttntcgaagatgtcgttgatgaaggag 297
               || |  ||||||||||||||||| ||||| ||||| ||||||||||||||||||||||||
Sbjct: 2673813 tagcgggcgagcttggcggactccccggcgagcttctcgaagatgtcgttgatgaaggag 2673754

                                                                           
Query: 298     ttcatgatggacatggccttggaggagatgccgatgtccggntgcacctgcttgancacc 357
               ||||||||||||||||||||||||||||||||||| || || || |||||||||| ||||
Sbjct: 2673753 ttcatgatggacatggccttggaggagatgccgatatcggggtggacctgcttgagcacc 2673694

                   
Query: 358     ttga 361
               ||||
Sbjct: 2673693 ttga 2673690



 Score =  385 bits (194), Expect = e-104
 Identities = 236/251 (94%)
 Strand = Plus / Plus

                                                                           
Query: 111     ctaggacgaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgag 170
               |||||| || ||||||||||| ||||||||||||||||||||||||||||||||||||||
Sbjct: 2837046 ctaggaggaagtgaacttggtaacggccttggtgccctcggagacggcgtgcttggcgag 2837105

                                                                           
Query: 171     ctcgccggggaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggctt 230
               |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||
Sbjct: 2837106 ctcgccggggaggacgaggcggacggcggtctggatctcccgggaggtgatggtgggctt 2837165

                                                                           
Query: 231     cttgttgtacctcgcgagcttggcggactcgccggcaagcttntcgaagatgtcgttgat 290
               ||||||||| | |||||||||||||||||| ||||| ||||| |||||||| || |||||
Sbjct: 2837166 cttgttgtagcgcgcgagcttggcggactctccggcgagcttctcgaagatatcattgat 2837225

                                                                           
Query: 291     gaaggagttcatgatggacatggccttggaggagatgccgatgtccggntgcacctgctt 350
               ||||||||||||||||||||||||||||||||||||||||||||| || || ||||||||
Sbjct: 2837226 gaaggagttcatgatggacatggccttggaggagatgccgatgtcggggtggacctgctt 2837285

                          
Query: 351     gancaccttga 361
               || ||||||||
Sbjct: 2837286 gagcaccttga 2837296



 Score =  383 bits (193), Expect = e-103
 Identities = 226/238 (94%)
 Strand = Plus / Plus

                                                                           
Query: 124     aacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggagg 183
               ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2843672 aacttggtgacggccttcgtgccctcggagacggcgtgcttggcgagctcgccggggagg 2843731

                                                                           
Query: 184     acgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgtacctc 243
               |||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |  
Sbjct: 2843732 acgaggcggacggaggtctgaatctcccgggaggtgatggtgggcttcttgttgtagcgg 2843791

                                                                           
Query: 244     gcgagcttggcggactcgccggcaagcttntcgaagatgtcgttgatgaaggagttcatg 303
               ||||||||||||||||| ||||| ||||| ||||||||||||||||||||||||||||||
Sbjct: 2843792 gcgagcttggcggactccccggcgagcttctcgaagatgtcgttgatgaaggagttcatg 2843851

                                                                         
Query: 304     atggacatggccttggaggagatgccgatgtccggntgcacctgcttgancaccttga 361
               |||||||||||||||||||||||||||||||| || || |||||||||| ||||||||
Sbjct: 2843852 atggacatggccttggaggagatgccgatgtcggggtgaacctgcttgagcaccttga 2843909



 Score =  381 bits (192), Expect = e-102
 Identities = 228/241 (94%)
 Strand = Plus / Plus

                                                                           
Query: 121     gtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccgggg 180
               ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||
Sbjct: 2856608 gtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccgggg 2856667

                                                                           
Query: 181     aggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgtac 240
               |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| 
Sbjct: 2856668 aggacgaggcggacggcggtctggatctcccgggaggtgatggtgggcttcttgttgtag 2856727

                                                                           
Query: 241     ctcgcgagcttggcggactcgccggcaagcttntcgaagatgtcgttgatgaaggagttc 300
               |  ||||||||||||| |||| |||| ||||| |||||||||||||||||||||||||||
Sbjct: 2856728 cgggcgagcttggcggcctcggcggcgagcttctcgaagatgtcgttgatgaaggagttc 2856787

                                                                           
Query: 301     atgatggacatggccttggaggagatgccgatgtccggntgcacctgcttgancaccttg 360
               ||||||||||||||||||||||||||||||||||| || || |||||||||| |||||||
Sbjct: 2856788 atgatggacatggccttggaggagatgccgatgtcggggtggacctgcttgagcaccttg 2856847

                
Query: 361     a 361
               |
Sbjct: 2856848 a 2856848



 Score =  379 bits (191), Expect = e-102
 Identities = 230/244 (94%)
 Strand = Plus / Minus

                                                                           
Query: 118     gaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccg 177
               |||||||| || |||||||||||||||||||| |||||||||||||||||||||||||||
Sbjct: 2686256 gaggtgaatttagtgacggccttggtgccctcagagacggcgtgcttggcgagctcgccg 2686197

                                                                           
Query: 178     gggaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttg 237
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2686196 gggaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttg 2686137

                                                                           
Query: 238     tacctcgcgagcttggcggactcgccggcaagcttntcgaagatgtcgttgatgaaggag 297
               || |  ||||||||||||||||| ||||| ||||| ||||||||||| ||||||||||||
Sbjct: 2686136 tagcgggcgagcttggcggactctccggcgagcttctcgaagatgtcattgatgaaggag 2686077

                                                                           
Query: 298     ttcatgatggacatggccttggaggagatgccgatgtccggntgcacctgcttgancacc 357
               |||||||||||||||||||||||||||||||||||||| || || |||||||||| ||||
Sbjct: 2686076 ttcatgatggacatggccttggaggagatgccgatgtcggggtgaacctgcttgagcacc 2686017

                   
Query: 358     ttga 361
               ||||
Sbjct: 2686016 ttga 2686013



 Score =  371 bits (187), Expect = 1e-99
 Identities = 229/244 (93%)
 Strand = Plus / Minus

                                                                           
Query: 118     gaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccg 177
               |||||||||||||| || |||||||||||||||||||||||||||||||| |||||||||
Sbjct: 2871648 gaggtgaacttggtcacagccttggtgccctcggagacggcgtgcttggcaagctcgccg 2871589

                                                                           
Query: 178     gggaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttg 237
               |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||
Sbjct: 2871588 gggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttg 2871529

                                                                           
Query: 238     tacctcgcgagcttggcggactcgccggcaagcttntcgaagatgtcgttgatgaaggag 297
               || |  ||||||||||||| |||| |||| ||||| ||||||||||||||||||||||||
Sbjct: 2871528 tagcgggcgagcttggcggcctcggcggcgagcttctcgaagatgtcgttgatgaaggag 2871469

                                                                           
Query: 298     ttcatgatggacatggccttggaggagatgccgatgtccggntgcacctgcttgancacc 357
               |||||||||||||||||||||||||||||||||||||| || || |||||||||| ||||
Sbjct: 2871468 ttcatgatggacatggccttggaggagatgccgatgtcggggtggacctgcttgagcacc 2871409

                   
Query: 358     ttga 361
               ||||
Sbjct: 2871408 ttga 2871405



 Score =  311 bits (157), Expect = 8e-82
 Identities = 212/231 (91%)
 Strand = Plus / Plus

                                                                            
Query: 120      ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 179
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 17421734 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 17421793

                                                                            
Query: 180      gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgta 239
                ||||||||||||||||||||||| |||||| |||||||||  | ||||||||||||||||
Sbjct: 17421794 gaggacgaggcggacggaggtctagatctcgcgggaggtggcgatgggcttcttgttgta 17421853

                                                                            
Query: 240      cctcgcgagcttggcggactcgccggcaagcttntcgaagatgtcgttgatgaaggagtt 299
                 |  ||||| | ||||| |||    || ||||| ||||||||||||||||||||||||||
Sbjct: 17421854 gcgggcgaggtgggcggcctcctgcgcgagcttctcgaagatgtcgttgatgaaggagtt 17421913

                                                                   
Query: 300      catgatggacatggccttggaggagatgccgatgtccggntgcacctgctt 350
                |||||| |||||||||||||||||||||||||||||||| |||||||||||
Sbjct: 17421914 catgatcgacatggccttggaggagatgccgatgtccgggtgcacctgctt 17421964



 Score =  266 bits (134), Expect = 4e-68
 Identities = 218/247 (88%)
 Strand = Plus / Plus

                                                                            
Query: 115      gacgaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcg 174
                ||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||
Sbjct: 36007436 gacgacgtgaacttggtgacggccttggtgccctcagagacggcgtgcttggcgagctcg 36007495

                                                                            
Query: 175      ccggggaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttg 234
                ||||||||||||||||| || |||||||||||||| |||||||||||||| |||||||||
Sbjct: 36007496 ccggggaggacgaggcgcaccgaggtctggatctcgcgggaggtgatggtcggcttcttg 36007555

                                                                            
Query: 235      ttgtacctcgcgagcttggcggactcgccggcaagcttntcgaagatgtcgttgatgaag 294
                ||||| |  |||||   ||||| |||   ||| ||||| |||||||| ||||||||||| 
Sbjct: 36007556 ttgtagcgggcgagacgggcggcctcctgggcgagcttctcgaagatatcgttgatgaac 36007615

                                                                            
Query: 295      gagttcatgatggacatggccttggaggagatgccgatgtccggntgcacctgcttganc 354
                ||||||||||| |||||||||||||| || || ||||| || || |||||||||||||  
Sbjct: 36007616 gagttcatgatcgacatggccttggacgatatcccgatatcgggatgcacctgcttgagg 36007675

                       
Query: 355      accttga 361
                |||||||
Sbjct: 36007676 accttga 36007682



 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                                  
Query: 267      aagcttntcgaagatgtcgttgatgaaggagttcatgatggacatggcct 316
                |||||| ||||| | ||||||||||||||| |||||||| ||||||||||
Sbjct: 30942126 aagcttctcgaaaacgtcgttgatgaaggatttcatgatagacatggcct 30942175



 Score = 40.1 bits (20), Expect = 4.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 276   gaagatgtcgttgatgaaggagtt 299
             |||||||||||||||||| |||||
Sbjct: 80264 gaagatgtcgttgatgaatgagtt 80287



to top

>dbj|AP003045.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0030H07
          Length = 168253

 Score =  394 bits (199), Expect = e-107
 Identities = 232/244 (95%)
 Strand = Plus / Plus

                                                                         
Query: 118   gaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccg 177
             |||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||
Sbjct: 26240 gaggtgaacttggtcacagccttggtgccctcggagacggcgtgcttggcgagctcgccg 26299

                                                                         
Query: 178   gggaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttg 237
             ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||
Sbjct: 26300 gggaggacgaggcggacggaggtctggatctcccgtgaggtgatggtgggcttcttgttg 26359

                                                                         
Query: 238   tacctcgcgagcttggcggactcgccggcaagcttntcgaagatgtcgttgatgaaggag 297
             || | |||||||||||||||||| ||||| ||||| ||||||||||||||||||||||||
Sbjct: 26360 tagcgcgcgagcttggcggactccccggcgagcttctcgaagatgtcgttgatgaaggag 26419

                                                                         
Query: 298   ttcatgatggacatggccttggaggagatgccgatgtccggntgcacctgcttgancacc 357
             |||||||||||||||||||||||||||||||||||||| || || |||||||||| ||||
Sbjct: 26420 ttcatgatggacatggccttggaggagatgccgatgtcggggtggacctgcttgagcacc 26479

                 
Query: 358   ttga 361
             ||||
Sbjct: 26480 ttga 26483



 Score =  385 bits (194), Expect = e-104
 Identities = 236/251 (94%)
 Strand = Plus / Plus

                                                                         
Query: 111   ctaggacgaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgag 170
             |||||| || ||||||||||| ||||||||||||||||||||||||||||||||||||||
Sbjct: 44044 ctaggaggaagtgaacttggtaacggccttggtgccctcggagacggcgtgcttggcgag 44103

                                                                         
Query: 171   ctcgccggggaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggctt 230
             |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||
Sbjct: 44104 ctcgccggggaggacgaggcggacggcggtctggatctcccgggaggtgatggtgggctt 44163

                                                                         
Query: 231   cttgttgtacctcgcgagcttggcggactcgccggcaagcttntcgaagatgtcgttgat 290
             ||||||||| | |||||||||||||||||| ||||| ||||| |||||||| || |||||
Sbjct: 44164 cttgttgtagcgcgcgagcttggcggactctccggcgagcttctcgaagatatcattgat 44223

                                                                         
Query: 291   gaaggagttcatgatggacatggccttggaggagatgccgatgtccggntgcacctgctt 350
             ||||||||||||||||||||||||||||||||||||||||||||| || || ||||||||
Sbjct: 44224 gaaggagttcatgatggacatggccttggaggagatgccgatgtcggggtggacctgctt 44283

                        
Query: 351   gancaccttga 361
             || ||||||||
Sbjct: 44284 gagcaccttga 44294



 Score =  383 bits (193), Expect = e-103
 Identities = 226/238 (94%)
 Strand = Plus / Plus

                                                                         
Query: 124   aacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggagg 183
             ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||
Sbjct: 50670 aacttggtgacggccttcgtgccctcggagacggcgtgcttggcgagctcgccggggagg 50729

                                                                         
Query: 184   acgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgtacctc 243
             |||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |  
Sbjct: 50730 acgaggcggacggaggtctgaatctcccgggaggtgatggtgggcttcttgttgtagcgg 50789

                                                                         
Query: 244   gcgagcttggcggactcgccggcaagcttntcgaagatgtcgttgatgaaggagttcatg 303
             ||||||||||||||||| ||||| ||||| ||||||||||||||||||||||||||||||
Sbjct: 50790 gcgagcttggcggactccccggcgagcttctcgaagatgtcgttgatgaaggagttcatg 50849

                                                                       
Query: 304   atggacatggccttggaggagatgccgatgtccggntgcacctgcttgancaccttga 361
             |||||||||||||||||||||||||||||||| || || |||||||||| ||||||||
Sbjct: 50850 atggacatggccttggaggagatgccgatgtcggggtgaacctgcttgagcaccttga 50907



 Score =  381 bits (192), Expect = e-102
 Identities = 228/241 (94%)
 Strand = Plus / Plus

                                                                         
Query: 121   gtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccgggg 180
             ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||
Sbjct: 63606 gtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccgggg 63665

                                                                         
Query: 181   aggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgtac 240
             |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| 
Sbjct: 63666 aggacgaggcggacggcggtctggatctcccgggaggtgatggtgggcttcttgttgtag 63725

                                                                         
Query: 241   ctcgcgagcttggcggactcgccggcaagcttntcgaagatgtcgttgatgaaggagttc 300
             |  ||||||||||||| |||| |||| ||||| |||||||||||||||||||||||||||
Sbjct: 63726 cgggcgagcttggcggcctcggcggcgagcttctcgaagatgtcgttgatgaaggagttc 63785

                                                                         
Query: 301   atgatggacatggccttggaggagatgccgatgtccggntgcacctgcttgancaccttg 360
             ||||||||||||||||||||||||||||||||||| || || |||||||||| |||||||
Sbjct: 63786 atgatggacatggccttggaggagatgccgatgtcggggtggacctgcttgagcaccttg 63845

              
Query: 361   a 361
             |
Sbjct: 63846 a 63846



 Score =  371 bits (187), Expect = 1e-99
 Identities = 229/244 (93%)
 Strand = Plus / Minus

                                                                         
Query: 118   gaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccg 177
             |||||||||||||| || |||||||||||||||||||||||||||||||| |||||||||
Sbjct: 78646 gaggtgaacttggtcacagccttggtgccctcggagacggcgtgcttggcaagctcgccg 78587

                                                                         
Query: 178   gggaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttg 237
             |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||
Sbjct: 78586 gggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttg 78527

                                                                         
Query: 238   tacctcgcgagcttggcggactcgccggcaagcttntcgaagatgtcgttgatgaaggag 297
             || |  ||||||||||||| |||| |||| ||||| ||||||||||||||||||||||||
Sbjct: 78526 tagcgggcgagcttggcggcctcggcggcgagcttctcgaagatgtcgttgatgaaggag 78467

                                                                         
Query: 298   ttcatgatggacatggccttggaggagatgccgatgtccggntgcacctgcttgancacc 357
             |||||||||||||||||||||||||||||||||||||| || || |||||||||| ||||
Sbjct: 78466 ttcatgatggacatggccttggaggagatgccgatgtcggggtggacctgcttgagcacc 78407

                 
Query: 358   ttga 361
             ||||
Sbjct: 78406 ttga 78403



to top

>dbj|AP002522.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
              clone:P0009G03
          Length = 163526

 Score =  394 bits (199), Expect = e-107
 Identities = 232/244 (95%)
 Strand = Plus / Plus

                                                                          
Query: 118    gaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccg 177
              |||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||
Sbjct: 124919 gaggtgaacttggtcacagccttggtgccctcggagacggcgtgcttggcgagctcgccg 124978

                                                                          
Query: 178    gggaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttg 237
              ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||
Sbjct: 124979 gggaggacgaggcggacggaggtctggatctcccgtgaggtgatggtgggcttcttgttg 125038

                                                                          
Query: 238    tacctcgcgagcttggcggactcgccggcaagcttntcgaagatgtcgttgatgaaggag 297
              || | |||||||||||||||||| ||||| ||||| ||||||||||||||||||||||||
Sbjct: 125039 tagcgcgcgagcttggcggactccccggcgagcttctcgaagatgtcgttgatgaaggag 125098

                                                                          
Query: 298    ttcatgatggacatggccttggaggagatgccgatgtccggntgcacctgcttgancacc 357
              |||||||||||||||||||||||||||||||||||||| || || |||||||||| ||||
Sbjct: 125099 ttcatgatggacatggccttggaggagatgccgatgtcggggtggacctgcttgagcacc 125158

                  
Query: 358    ttga 361
              ||||
Sbjct: 125159 ttga 125162



 Score =  385 bits (194), Expect = e-104
 Identities = 236/251 (94%)
 Strand = Plus / Plus

                                                                          
Query: 111    ctaggacgaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgag 170
              |||||| || ||||||||||| ||||||||||||||||||||||||||||||||||||||
Sbjct: 142723 ctaggaggaagtgaacttggtaacggccttggtgccctcggagacggcgtgcttggcgag 142782

                                                                          
Query: 171    ctcgccggggaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggctt 230
              |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||
Sbjct: 142783 ctcgccggggaggacgaggcggacggcggtctggatctcccgggaggtgatggtgggctt 142842

                                                                          
Query: 231    cttgttgtacctcgcgagcttggcggactcgccggcaagcttntcgaagatgtcgttgat 290
              ||||||||| | |||||||||||||||||| ||||| ||||| |||||||| || |||||
Sbjct: 142843 cttgttgtagcgcgcgagcttggcggactctccggcgagcttctcgaagatatcattgat 142902

                                                                          
Query: 291    gaaggagttcatgatggacatggccttggaggagatgccgatgtccggntgcacctgctt 350
              ||||||||||||||||||||||||||||||||||||||||||||| || || ||||||||
Sbjct: 142903 gaaggagttcatgatggacatggccttggaggagatgccgatgtcggggtggacctgctt 142962

                         
Query: 351    gancaccttga 361
              || ||||||||
Sbjct: 142963 gagcaccttga 142973



 Score =  383 bits (193), Expect = e-103
 Identities = 226/238 (94%)
 Strand = Plus / Plus

                                                                          
Query: 124    aacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggagg 183
              ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||
Sbjct: 149349 aacttggtgacggccttcgtgccctcggagacggcgtgcttggcgagctcgccggggagg 149408

                                                                          
Query: 184    acgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgtacctc 243
              |||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |  
Sbjct: 149409 acgaggcggacggaggtctgaatctcccgggaggtgatggtgggcttcttgttgtagcgg 149468

                                                                          
Query: 244    gcgagcttggcggactcgccggcaagcttntcgaagatgtcgttgatgaaggagttcatg 303
              ||||||||||||||||| ||||| ||||| ||||||||||||||||||||||||||||||
Sbjct: 149469 gcgagcttggcggactccccggcgagcttctcgaagatgtcgttgatgaaggagttcatg 149528

                                                                        
Query: 304    atggacatggccttggaggagatgccgatgtccggntgcacctgcttgancaccttga 361
              |||||||||||||||||||||||||||||||| || || |||||||||| ||||||||
Sbjct: 149529 atggacatggccttggaggagatgccgatgtcggggtgaacctgcttgagcaccttga 149586



 Score =  381 bits (192), Expect = e-102
 Identities = 228/241 (94%)
 Strand = Plus / Plus

                                                                          
Query: 121    gtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccgggg 180
              ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||
Sbjct: 162285 gtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccgggg 162344

                                                                          
Query: 181    aggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgtac 240
              |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| 
Sbjct: 162345 aggacgaggcggacggcggtctggatctcccgggaggtgatggtgggcttcttgttgtag 162404

                                                                          
Query: 241    ctcgcgagcttggcggactcgccggcaagcttntcgaagatgtcgttgatgaaggagttc 300
              |  ||||||||||||| |||| |||| ||||| |||||||||||||||||||||||||||
Sbjct: 162405 cgggcgagcttggcggcctcggcggcgagcttctcgaagatgtcgttgatgaaggagttc 162464

                                                                          
Query: 301    atgatggacatggccttggaggagatgccgatgtccggntgcacctgcttgancaccttg 360
              ||||||||||||||||||||||||||||||||||| || || |||||||||| |||||||
Sbjct: 162465 atgatggacatggccttggaggagatgccgatgtcggggtggacctgcttgagcaccttg 162524

               
Query: 361    a 361
              |
Sbjct: 162525 a 162525



to top

>gb|BT017477.1| Zea mays clone EL01N0408F05.c mRNA sequence
          Length = 574

 Score =  391 bits (197), Expect = e-105
 Identities = 236/250 (94%)
 Strand = Plus / Minus

                                                                       
Query: 112 taggacgaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagc 171
           |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||
Sbjct: 525 taggacgaggtgaacttggtgacggccttggtgccctccgagacggcgtgcttggcgagc 466

                                                                       
Query: 172 tcgccggggaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttc 231
           |||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 465 tcgccgggtagaacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttc 406

                                                                       
Query: 232 ttgttgtacctcgcgagcttggcggactcgccggcaagcttntcgaagatgtcgttgatg 291
           |||||||| |  ||||||||||| | ||||||||| ||||| ||||||||||||||||||
Sbjct: 405 ttgttgtagcgggcgagcttggccgcctcgccggcgagcttctcgaagatgtcgttgatg 346

                                                                       
Query: 292 aaggagttcatgatggacatggccttggaggagatgccgatgtccggntgcacctgcttg 351
           || |||||||||||||||||||||||||||||||||||||||||||| ||||||||||| 
Sbjct: 345 aatgagttcatgatggacatggccttggaggagatgccgatgtccgggtgcacctgcttc 286

                     
Query: 352 ancaccttga 361
           | ||||||||
Sbjct: 285 agcaccttga 276



to top

>ref|NM_184371.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 462

 Score =  387 bits (195), Expect = e-104
 Identities = 231/244 (94%)
 Strand = Plus / Minus

                                                                       
Query: 118 gaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccg 177
           |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 455 gaggtgaatttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccg 396

                                                                       
Query: 178 gggaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttg 237
           |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||
Sbjct: 395 gggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttg 336

                                                                       
Query: 238 tacctcgcgagcttggcggactcgccggcaagcttntcgaagatgtcgttgatgaaggag 297
           || |  ||||||||||||||||| ||||| ||||| ||||||||||||||||||||||||
Sbjct: 335 tagcgggcgagcttggcggactccccggcgagcttctcgaagatgtcgttgatgaaggag 276

                                                                       
Query: 298 ttcatgatggacatggccttggaggagatgccgatgtccggntgcacctgcttgancacc 357
           ||||||||||||||||||||||||||||||||||| || || || |||||||||| ||||
Sbjct: 275 ttcatgatggacatggccttggaggagatgccgatatcggggtggacctgcttgagcacc 216

               
Query: 358 ttga 361
           ||||
Sbjct: 215 ttga 212



to top

>ref|XM_475912.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 459

 Score =  387 bits (195), Expect = e-104
 Identities = 231/244 (94%)
 Strand = Plus / Minus

                                                                       
Query: 118 gaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccg 177
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 452 gaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccg 393

                                                                       
Query: 178 gggaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttg 237
           |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||
Sbjct: 392 gggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttg 333

                                                                       
Query: 238 tacctcgcgagcttggcggactcgccggcaagcttntcgaagatgtcgttgatgaaggag 297
           || |  ||||||||||||| |||| |||| ||||| ||||||||||||||||||||||||
Sbjct: 332 tagcgggcgagcttggcggcctcggcggcgagcttctcgaagatgtcgttgatgaaggag 273

                                                                       
Query: 298 ttcatgatggacatggccttggaggagatgccgatgtccggntgcacctgcttgancacc 357
           |||||||||||||||||||||||||||||||||||||| || || ||||||||||  |||
Sbjct: 272 ttcatgatggacatggccttggaggagatgccgatgtcggggtggacctgcttgagaacc 213

               
Query: 358 ttga 361
           ||||
Sbjct: 212 ttga 209



to top

>gb|AC104284.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1735_C10,
              complete sequence
          Length = 187034

 Score =  387 bits (195), Expect = e-104
 Identities = 231/244 (94%)
 Strand = Plus / Minus

                                                                          
Query: 118    gaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccg 177
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 176400 gaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccg 176341

                                                                          
Query: 178    gggaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttg 237
              |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||
Sbjct: 176340 gggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttg 176281

                                                                          
Query: 238    tacctcgcgagcttggcggactcgccggcaagcttntcgaagatgtcgttgatgaaggag 297
              || |  ||||||||||||| |||| |||| ||||| ||||||||||||||||||||||||
Sbjct: 176280 tagcgggcgagcttggcggcctcggcggcgagcttctcgaagatgtcgttgatgaaggag 176221

                                                                          
Query: 298    ttcatgatggacatggccttggaggagatgccgatgtccggntgcacctgcttgancacc 357
              |||||||||||||||||||||||||||||||||||||| || || ||||||||||  |||
Sbjct: 176220 ttcatgatggacatggccttggaggagatgccgatgtcggggtggacctgcttgagaacc 176161

                  
Query: 358    ttga 361
              ||||
Sbjct: 176160 ttga 176157



to top

>gb|AC098832.3| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1268_B08,
             complete sequence
          Length = 119500

 Score =  387 bits (195), Expect = e-104
 Identities = 231/244 (94%)
 Strand = Plus / Minus

                                                                         
Query: 118   gaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccg 177
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 27082 gaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccg 27023

                                                                         
Query: 178   gggaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttg 237
             |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||
Sbjct: 27022 gggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttg 26963

                                                                         
Query: 238   tacctcgcgagcttggcggactcgccggcaagcttntcgaagatgtcgttgatgaaggag 297
             || |  ||||||||||||| |||| |||| ||||| ||||||||||||||||||||||||
Sbjct: 26962 tagcgggcgagcttggcggcctcggcggcgagcttctcgaagatgtcgttgatgaaggag 26903

                                                                         
Query: 298   ttcatgatggacatggccttggaggagatgccgatgtccggntgcacctgcttgancacc 357
             |||||||||||||||||||||||||||||||||||||| || || ||||||||||  |||
Sbjct: 26902 ttcatgatggacatggccttggaggagatgccgatgtcggggtggacctgcttgagaacc 26843

                 
Query: 358   ttga 361
             ||||
Sbjct: 26842 ttga 26839



to top

>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete
                sequence
          Length = 29737217

 Score =  387 bits (195), Expect = e-104
 Identities = 231/244 (94%)
 Strand = Plus / Minus

                                                                            
Query: 118      gaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccg 177
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 28392158 gaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccg 28392099

                                                                            
Query: 178      gggaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttg 237
                |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||
Sbjct: 28392098 gggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttg 28392039

                                                                            
Query: 238      tacctcgcgagcttggcggactcgccggcaagcttntcgaagatgtcgttgatgaaggag 297
                || |  ||||||||||||| |||| |||| ||||| ||||||||||||||||||||||||
Sbjct: 28392038 tagcgggcgagcttggcggcctcggcggcgagcttctcgaagatgtcgttgatgaaggag 28391979

                                                                            
Query: 298      ttcatgatggacatggccttggaggagatgccgatgtccggntgcacctgcttgancacc 357
                |||||||||||||||||||||||||||||||||||||| || || ||||||||||  |||
Sbjct: 28391978 ttcatgatggacatggccttggaggagatgccgatgtcggggtggacctgcttgagaacc 28391919

                    
Query: 358      ttga 361
                ||||
Sbjct: 28391918 ttga 28391915



 Score =  287 bits (145), Expect = 1e-74
 Identities = 223/250 (89%)
 Strand = Plus / Minus

                                                                            
Query: 112      taggacgaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagc 171
                ||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||
Sbjct: 22480470 taggaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagc 22480411

                                                                            
Query: 172      tcgccggggaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttc 231
                ||||||||||||||||| || || |||||||||||||| ||||||||||| |||||||||
Sbjct: 22480410 tcgccggggaggacgagacgaacagaggtctggatctcgcgggaggtgattgtgggcttc 22480351

                                                                            
Query: 232      ttgttgtacctcgcgagcttggcggactcgccggcaagcttntcgaagatgtcgttgatg 291
                ||||||||||| || ||| | |||| |||     | ||||| ||||| |||||||||| |
Sbjct: 22480350 ttgttgtacctggcaagcctcgcggcctcctgctcgagcttctcgaaaatgtcgttgacg 22480291

                                                                            
Query: 292      aaggagttcatgatggacatggccttggaggagatgccgatgtccggntgcacctgcttg 351
                ||||| ||||||||||||||||||||||||||||| || ||||| || ||||||||||||
Sbjct: 22480290 aaggaattcatgatggacatggccttggaggagattcctatgtctggatgcacctgcttg 22480231

                          
Query: 352      ancaccttga 361
                | ||||||||
Sbjct: 22480230 agcaccttga 22480221



 Score = 46.1 bits (23), Expect = 0.078
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                         
Query: 268     agcttntcgaagatgtcgttgatgaa 293
               ||||| ||||||||||||||||||||
Sbjct: 3720744 agcttctcgaagatgtcgttgatgaa 3720769



 Score = 42.1 bits (21), Expect = 1.2
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                           
Query: 266     caagcttntcgaagatgtcgttgatgaa 293
               ||||||| ||||||||||| ||||||||
Sbjct: 6238960 caagcttctcgaagatgtctttgatgaa 6238933



to top

>dbj|AP002540.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
              clone:P0434B04
          Length = 167029

 Score =  387 bits (195), Expect = e-104
 Identities = 231/244 (94%)
 Strand = Plus / Minus

                                                                          
Query: 118    gaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccg 177
              |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 123708 gaggtgaatttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccg 123649

                                                                          
Query: 178    gggaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttg 237
              |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||
Sbjct: 123648 gggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttg 123589

                                                                          
Query: 238    tacctcgcgagcttggcggactcgccggcaagcttntcgaagatgtcgttgatgaaggag 297
              || |  ||||||||||||||||| ||||| ||||| ||||||||||||||||||||||||
Sbjct: 123588 tagcgggcgagcttggcggactccccggcgagcttctcgaagatgtcgttgatgaaggag 123529

                                                                          
Query: 298    ttcatgatggacatggccttggaggagatgccgatgtccggntgcacctgcttgancacc 357
              ||||||||||||||||||||||||||||||||||| || || || |||||||||| ||||
Sbjct: 123528 ttcatgatggacatggccttggaggagatgccgatatcggggtggacctgcttgagcacc 123469

                  
Query: 358    ttga 361
              ||||
Sbjct: 123468 ttga 123465



 Score =  379 bits (191), Expect = e-102
 Identities = 230/244 (94%)
 Strand = Plus / Minus

                                                                          
Query: 118    gaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccg 177
              |||||||| || |||||||||||||||||||| |||||||||||||||||||||||||||
Sbjct: 136031 gaggtgaatttagtgacggccttggtgccctcagagacggcgtgcttggcgagctcgccg 135972

                                                                          
Query: 178    gggaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttg 237
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 135971 gggaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttg 135912

                                                                          
Query: 238    tacctcgcgagcttggcggactcgccggcaagcttntcgaagatgtcgttgatgaaggag 297
              || |  ||||||||||||||||| ||||| ||||| ||||||||||| ||||||||||||
Sbjct: 135911 tagcgggcgagcttggcggactctccggcgagcttctcgaagatgtcattgatgaaggag 135852

                                                                          
Query: 298    ttcatgatggacatggccttggaggagatgccgatgtccggntgcacctgcttgancacc 357
              |||||||||||||||||||||||||||||||||||||| || || |||||||||| ||||
Sbjct: 135851 ttcatgatggacatggccttggaggagatgccgatgtcggggtgaacctgcttgagcacc 135792

                  
Query: 358    ttga 361
              ||||
Sbjct: 135791 ttga 135788



to top

>ref|NM_184403.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 462

 Score =  385 bits (194), Expect = e-104
 Identities = 236/251 (94%)
 Strand = Plus / Minus

                                                                       
Query: 111 ctaggacgaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgag 170
           |||||| || ||||||||||| ||||||||||||||||||||||||||||||||||||||
Sbjct: 462 ctaggaggaagtgaacttggtaacggccttggtgccctcggagacggcgtgcttggcgag 403

                                                                       
Query: 171 ctcgccggggaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggctt 230
           |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||
Sbjct: 402 ctcgccggggaggacgaggcggacggcggtctggatctcccgggaggtgatggtgggctt 343

                                                                       
Query: 231 cttgttgtacctcgcgagcttggcggactcgccggcaagcttntcgaagatgtcgttgat 290
           ||||||||| | |||||||||||||||||| ||||| ||||| |||||||| || |||||
Sbjct: 342 cttgttgtagcgcgcgagcttggcggactctccggcgagcttctcgaagatatcattgat 283

                                                                       
Query: 291 gaaggagttcatgatggacatggccttggaggagatgccgatgtccggntgcacctgctt 350
           ||||||||||||||||||||||||||||||||||||||||||||| || || ||||||||
Sbjct: 282 gaaggagttcatgatggacatggccttggaggagatgccgatgtcggggtggacctgctt 223

                      
Query: 351 gancaccttga 361
           || ||||||||
Sbjct: 222 gagcaccttga 212



to top

>ref|NM_184405.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 462

 Score =  383 bits (193), Expect = e-103
 Identities = 226/238 (94%)
 Strand = Plus / Minus

                                                                       
Query: 124 aacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggagg 183
           ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||
Sbjct: 449 aacttggtgacggccttcgtgccctcggagacggcgtgcttggcgagctcgccggggagg 390

                                                                       
Query: 184 acgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgtacctc 243
           |||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |  
Sbjct: 389 acgaggcggacggaggtctgaatctcccgggaggtgatggtgggcttcttgttgtagcgg 330

                                                                       
Query: 244 gcgagcttggcggactcgccggcaagcttntcgaagatgtcgttgatgaaggagttcatg 303
           ||||||||||||||||| ||||| ||||| ||||||||||||||||||||||||||||||
Sbjct: 329 gcgagcttggcggactccccggcgagcttctcgaagatgtcgttgatgaaggagttcatg 270

                                                                     
Query: 304 atggacatggccttggaggagatgccgatgtccggntgcacctgcttgancaccttga 361
           |||||||||||||||||||||||||||||||| || || |||||||||| ||||||||
Sbjct: 269 atggacatggccttggaggagatgccgatgtcggggtgaacctgcttgagcaccttga 212



to top

>dbj|AB075378.1| Oryza sativa OsH2B mRNA for histone H2B, complete cds
          Length = 552

 Score =  383 bits (193), Expect = e-103
 Identities = 226/238 (94%)
 Strand = Plus / Minus

                                                                       
Query: 124 aacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggagg 183
           ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||
Sbjct: 465 aacttggtgacggccttcgtgccctcggagacggcgtgcttggcgagctcgccggggagg 406

                                                                       
Query: 184 acgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgtacctc 243
           |||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |  
Sbjct: 405 acgaggcggacggaggtctgaatctcccgggaggtgatggtgggcttcttgttgtagcgg 346

                                                                       
Query: 244 gcgagcttggcggactcgccggcaagcttntcgaagatgtcgttgatgaaggagttcatg 303
           ||||||||||||||||| ||||| ||||| ||||||||||||||||||||||||||||||
Sbjct: 345 gcgagcttggcggactccccggcgagcttctcgaagatgtcgttgatgaaggagttcatg 286

                                                                     
Query: 304 atggacatggccttggaggagatgccgatgtccggntgcacctgcttgancaccttga 361
           |||||||||||||||||||||||||||||||| || || |||||||||| ||||||||
Sbjct: 285 atggacatggccttggaggagatgccgatgtcggggtgaacctgcttgagcaccttga 228



to top

>ref|NM_184407.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 462

 Score =  381 bits (192), Expect = e-102
 Identities = 228/241 (94%)
 Strand = Plus / Minus

                                                                       
Query: 121 gtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccgggg 180
           ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||
Sbjct: 452 gtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccgggg 393

                                                                       
Query: 181 aggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgtac 240
           |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| 
Sbjct: 392 aggacgaggcggacggcggtctggatctcccgggaggtgatggtgggcttcttgttgtag 333

                                                                       
Query: 241 ctcgcgagcttggcggactcgccggcaagcttntcgaagatgtcgttgatgaaggagttc 300
           |  ||||||||||||| |||| |||| ||||| |||||||||||||||||||||||||||
Sbjct: 332 cgggcgagcttggcggcctcggcggcgagcttctcgaagatgtcgttgatgaaggagttc 273

                                                                       
Query: 301 atgatggacatggccttggaggagatgccgatgtccggntgcacctgcttgancaccttg 360
           ||||||||||||||||||||||||||||||||||| || || |||||||||| |||||||
Sbjct: 272 atgatggacatggccttggaggagatgccgatgtcggggtggacctgcttgagcaccttg 213

            
Query: 361 a 361
           |
Sbjct: 212 a 212



to top

>ref|NM_184374.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 462

 Score =  379 bits (191), Expect = e-102
 Identities = 230/244 (94%)
 Strand = Plus / Minus

                                                                       
Query: 118 gaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccg 177
           |||||||| || |||||||||||||||||||| |||||||||||||||||||||||||||
Sbjct: 455 gaggtgaatttagtgacggccttggtgccctcagagacggcgtgcttggcgagctcgccg 396

                                                                       
Query: 178 gggaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttg 237
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 395 gggaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttg 336

                                                                       
Query: 238 tacctcgcgagcttggcggactcgccggcaagcttntcgaagatgtcgttgatgaaggag 297
           || |  ||||||||||||||||| ||||| ||||| ||||||||||| ||||||||||||
Sbjct: 335 tagcgggcgagcttggcggactctccggcgagcttctcgaagatgtcattgatgaaggag 276

                                                                       
Query: 298 ttcatgatggacatggccttggaggagatgccgatgtccggntgcacctgcttgancacc 357
           |||||||||||||||||||||||||||||||||||||| || || |||||||||| ||||
Sbjct: 275 ttcatgatggacatggccttggaggagatgccgatgtcggggtgaacctgcttgagcacc 216

               
Query: 358 ttga 361
           ||||
Sbjct: 215 ttga 212



to top

>gb|BT009118.1| Triticum aestivum clone wl1n.pk0003.e12:fis, full insert mRNA
           sequence
          Length = 764

 Score =  377 bits (190), Expect = e-101
 Identities = 224/236 (94%)
 Strand = Plus / Minus

                                                                       
Query: 115 gacgaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcg 174
           ||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||
Sbjct: 548 gacgaggtgaacttggtgacggccttggtaccctccgagacggcgtgcttggcgagctcg 489

                                                                       
Query: 175 ccggggaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttg 234
           ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||
Sbjct: 488 ccggggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttg 429

                                                                       
Query: 235 ttgtacctcgcgagcttggcggactcgccggcaagcttntcgaagatgtcgttgatgaag 294
           |||||||  ||||||||||||| |||  |||| ||||| |||||||||||||||||||||
Sbjct: 428 ttgtaccgggcgagcttggcggcctccgcggcgagcttctcgaagatgtcgttgatgaag 369

                                                                   
Query: 295 gagttcatgatggacatggccttggaggagatgccgatgtccggntgcacctgctt 350
           ||||||||||||||||||||||||||||||||||||||||| || |||||||||||
Sbjct: 368 gagttcatgatggacatggccttggaggagatgccgatgtcggggtgcacctgctt 313



to top

>ref|NM_184409.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 468

 Score =  371 bits (187), Expect = 1e-99
 Identities = 229/244 (93%)
 Strand = Plus / Minus

                                                                       
Query: 118 gaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccg 177
           |||||||||||||| || |||||||||||||||||||||||||||||||| |||||||||
Sbjct: 461 gaggtgaacttggtcacagccttggtgccctcggagacggcgtgcttggcaagctcgccg 402

                                                                       
Query: 178 gggaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttg 237
           |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||
Sbjct: 401 gggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttg 342

                                                                       
Query: 238 tacctcgcgagcttggcggactcgccggcaagcttntcgaagatgtcgttgatgaaggag 297
           || |  ||||||||||||| |||| |||| ||||| ||||||||||||||||||||||||
Sbjct: 341 tagcgggcgagcttggcggcctcggcggcgagcttctcgaagatgtcgttgatgaaggag 282

                                                                       
Query: 298 ttcatgatggacatggccttggaggagatgccgatgtccggntgcacctgcttgancacc 357
           |||||||||||||||||||||||||||||||||||||| || || |||||||||| ||||
Sbjct: 281 ttcatgatggacatggccttggaggagatgccgatgtcggggtggacctgcttgagcacc 222

               
Query: 358 ttga 361
           ||||
Sbjct: 221 ttga 218



to top

>gb|U08226.1|ZMU08226 Zea mays W-22 histone H2B mRNA, complete cds
          Length = 678

 Score =  369 bits (186), Expect = 4e-99
 Identities = 223/236 (94%)
 Strand = Plus / Minus

                                                                       
Query: 115 gacgaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcg 174
           ||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||
Sbjct: 481 gacgaggtgaacttggtgacggccttggtaccctccgagacggcgtgcttggcgagctcg 422

                                                                       
Query: 175 ccggggaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttg 234
           ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||
Sbjct: 421 ccggggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttg 362

                                                                       
Query: 235 ttgtacctcgcgagcttggcggactcgccggcaagcttntcgaagatgtcgttgatgaag 294
           |||||||  ||||||||||||| |||  |||| ||||| |||||||||||||||||||||
Sbjct: 361 ttgtaccgggcgagcttggcggcctccgcggcgagcttctcgaagatgtcgttgatgaag 302

                                                                   
Query: 295 gagttcatgatggacatggccttggaggagatgccgatgtccggntgcacctgctt 350
           ||||||||||||||||||||||||||||||||||||||||| || || ||||||||
Sbjct: 301 gagttcatgatggacatggccttggaggagatgccgatgtcggggtgaacctgctt 246



to top

>gb|BT016519.1| Zea mays clone Contig352 mRNA sequence
          Length = 789

 Score =  351 bits (177), Expect = 1e-93
 Identities = 217/231 (93%)
 Strand = Plus / Minus

                                                                       
Query: 120 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 179
           |||||||||||||||||||||||| ||||||||||||||||| ||||||||||| || ||
Sbjct: 522 ggtgaacttggtgacggccttggttccctcggagacggcgtgtttggcgagctctcctgg 463

                                                                       
Query: 180 gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgta 239
           |||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||
Sbjct: 462 gaggacgaggcgcacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 403

                                                                       
Query: 240 cctcgcgagcttggcggactcgccggcaagcttntcgaagatgtcgttgatgaaggagtt 299
           ||  |||||||| |||| ||||||||| ||||| ||||||||||||||||||||||||||
Sbjct: 402 ccgggcgagcttagcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 343

                                                              
Query: 300 catgatggacatggccttggaggagatgccgatgtccggntgcacctgctt 350
           |||||||||||||||||||||||||||||||||||| || |||||||||||
Sbjct: 342 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgctt 292



to top

>emb|X69960.1|ZMH2B3A Z.mays gene for H2B histone (gH2B3)
          Length = 1728

 Score =  347 bits (175), Expect = 2e-92
 Identities = 226/244 (92%)
 Strand = Plus / Minus

                                                                       
Query: 118 gaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccg 177
           |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||
Sbjct: 489 gaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccg 430

                                                                       
Query: 178 gggaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttg 237
           |||||||||||||| || |||||||||||||| |||||||||| ||||||||||||||| 
Sbjct: 429 gggaggacgaggcgcaccgaggtctggatctcgcgggaggtgacggtgggcttcttgtta 370

                                                                       
Query: 238 tacctcgcgagcttggcggactcgccggcaagcttntcgaagatgtcgttgatgaaggag 297
           || | ||| ||||||||||||||| | || ||||| ||||||||||||||||||||||||
Sbjct: 369 tagcgcgccagcttggcggactcggccgcgagcttctcgaagatgtcgttgatgaaggag 310

                                                                       
Query: 298 ttcatgatggacatggccttggaggagatgccgatgtccggntgcacctgcttgancacc 357
           ||||||||||||||||||||||| |||||||||||||| || ||||||||||| | ||||
Sbjct: 309 ttcatgatggacatggccttggacgagatgccgatgtcggggtgcacctgcttcagcacc 250

               
Query: 358 ttga 361
           ||||
Sbjct: 249 ttga 246



to top

>emb|X57312.1|ZMH2B214 Z.mays mRNA for H2B histone (clone cH2B214)
          Length = 580

 Score =  345 bits (174), Expect = 6e-92
 Identities = 228/247 (92%)
 Strand = Plus / Minus

                                                                       
Query: 115 gacgaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcg 174
           |||||||||||||| || |||||||| |||||||||||||||||||||||||||||||| 
Sbjct: 455 gacgaggtgaacttcgtaacggccttagtgccctcggagacggcgtgcttggcgagctcc 396

                                                                       
Query: 175 ccggggaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttg 234
           ||||||||||||||||| || |||||||||||||| ||||||||||||||||||||||||
Sbjct: 395 ccggggaggacgaggcgcaccgaggtctggatctcgcgggaggtgatggtgggcttcttg 336

                                                                       
Query: 235 ttgtacctcgcgagcttggcggactcgccggcaagcttntcgaagatgtcgttgatgaag 294
           ||||| | ||| ||||||||||||||| | || ||||| |||||||||||||||||||||
Sbjct: 335 ttgtagcgcgccagcttggcggactcggccgcgagcttctcgaagatgtcgttgatgaag 276

                                                                       
Query: 295 gagttcatgatggacatggccttggaggagatgccgatgtccggntgcacctgcttganc 354
           |||||||||||||||||||||||||| |||||||||||||| || ||||||||||| | |
Sbjct: 275 gagttcatgatggacatggccttggacgagatgccgatgtcggggtgcacctgcttcagc 216

                  
Query: 355 accttga 361
           |||||||
Sbjct: 215 accttga 209



to top

>gb|BT016478.1| Zea mays clone Contig311 mRNA sequence
          Length = 836

 Score =  337 bits (170), Expect = 1e-89
 Identities = 227/247 (91%)
 Strand = Plus / Minus

                                                                       
Query: 115 gacgaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcg 174
           ||||| |||||||||||||| ||||| ||||| || ||||||||||||||||||||||||
Sbjct: 548 gacgaagtgaacttggtgaccgcctttgtgccttcagagacggcgtgcttggcgagctcg 489

                                                                       
Query: 175 ccggggaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttg 234
           ||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||
Sbjct: 488 ccgggtaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttg 429

                                                                       
Query: 235 ttgtacctcgcgagcttggcggactcgccggcaagcttntcgaagatgtcgttgatgaag 294
           ||||| |  ||||||||||||| |||  |||| ||||| |||||||||||||||||||||
Sbjct: 428 ttgtagcgggcgagcttggcggcctccgcggcgagcttctcgaagatgtcgttgatgaag 369

                                                                       
Query: 295 gagttcatgatggacatggccttggaggagatgccgatgtccggntgcacctgcttganc 354
           || ||||||||||||||||||||||| |||||||||||||| || ||||||||||||| |
Sbjct: 368 gaattcatgatggacatggccttggacgagatgccgatgtcggggtgcacctgcttgagc 309

                  
Query: 355 accttga 361
           |||||||
Sbjct: 308 accttga 302



to top

>gb|BT016350.1| Zea mays clone Contig183 mRNA sequence
          Length = 706

 Score =  329 bits (166), Expect = 4e-87
 Identities = 229/251 (91%)
 Strand = Plus / Minus

                                                                       
Query: 111 ctaggacgaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgag 170
           ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 514 ctaggccgaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgag 455

                                                                       
Query: 171 ctcgccggggaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggctt 230
           ||| ||||| ||||||||||| ||||||||||||||||| |||||||||||||| |||||
Sbjct: 454 ctccccgggaaggacgaggcgcacggaggtctggatctcacgggaggtgatggtaggctt 395

                                                                       
Query: 231 cttgttgtacctcgcgagcttggcggactcgccggcaagcttntcgaagatgtcgttgat 290
           |||||| || | |||||||||||||| |||  | || ||||| |||||||| ||||| ||
Sbjct: 394 cttgttatagcgcgcgagcttggcggcctcagcagcgagcttctcgaagatatcgttaat 335

                                                                       
Query: 291 gaaggagttcatgatggacatggccttggaggagatgccgatgtccggntgcacctgctt 350
           ||||||||||||||| ||||||||||||||||||||||| |||||||| |||||||||||
Sbjct: 334 gaaggagttcatgatcgacatggccttggaggagatgccaatgtccgggtgcacctgctt 275

                      
Query: 351 gancaccttga 361
            | ||||||||
Sbjct: 274 cagcaccttga 264



to top

>gb|BT016885.1| Zea mays clone Contig718 mRNA sequence
          Length = 568

 Score =  327 bits (165), Expect = 1e-86
 Identities = 222/242 (91%)
 Strand = Plus / Minus

                                                                       
Query: 120 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 179
           |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||
Sbjct: 326 ggtgaacttggtgacggctttggtgccctcggagacggcgtgcttggcgagctcgccggg 267

                                                                       
Query: 180 gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgta 239
           |||||||||||| ||||||||||||||||| ||||| || ||||| ||||||||||||||
Sbjct: 266 gaggacgaggcgaacggaggtctggatctcgcgggacgtaatggtaggcttcttgttgta 207

                                                                       
Query: 240 cctcgcgagcttggcggactcgccggcaagcttntcgaagatgtcgttgatgaaggagtt 299
           || ||| |||||||| | |||  | || ||||| ||||||||||||||||||||||||||
Sbjct: 206 ccgcgccagcttggccgcctccgccgccagcttctcgaagatgtcgttgatgaaggagtt 147

                                                                       
Query: 300 catgatggacatggccttggaggagatgccgatgtccggntgcacctgcttgancacctt 359
           ||||||||||||||||||||| |||||||| |||||||| ||||||||||| | ||||||
Sbjct: 146 catgatggacatggccttggacgagatgccaatgtccgggtgcacctgcttcagcacctt 87

             
Query: 360 ga 361
           ||
Sbjct: 86  ga 85



to top

>gb|BT017438.1| Zea mays clone EL01N0404D07.c mRNA sequence
          Length = 574

 Score =  321 bits (162), Expect = 9e-85
 Identities = 228/251 (90%)
 Strand = Plus / Minus

                                                                       
Query: 111 ctaggacgaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgag 170
           ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 306 ctaggccgaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgag 247

                                                                       
Query: 171 ctcgccggggaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggctt 230
           ||| ||||| ||||||||||| ||||||||||||||||| |||||||||||||| |||||
Sbjct: 246 ctccccgggaaggacgaggcgcacggaggtctggatctcacgggaggtgatggtaggctt 187

                                                                       
Query: 231 cttgttgtacctcgcgagcttggcggactcgccggcaagcttntcgaagatgtcgttgat 290
           |||||| || | ||| |||||||||| |||  | || ||||| |||||||| ||||| ||
Sbjct: 186 cttgttatagcgcgccagcttggcggcctcagcagcgagcttctcgaagatatcgttaat 127

                                                                       
Query: 291 gaaggagttcatgatggacatggccttggaggagatgccgatgtccggntgcacctgctt 350
           ||||||||||||||| ||||||||||||||||||||||| |||||||| |||||||||||
Sbjct: 126 gaaggagttcatgatcgacatggccttggaggagatgccaatgtccgggtgcacctgctt 67

                      
Query: 351 gancaccttga 361
            | ||||||||
Sbjct: 66  cagcaccttga 56



to top

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score =  319 bits (161), Expect = 3e-84
 Identities = 213/231 (92%)
 Strand = Plus / Minus

                                                                           
Query: 120     ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 179
               ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 9465324 ggtgaacttggtgaccgccttggtgccctcggagacggcgtgcttggcgagctcgccggg 9465265

                                                                           
Query: 180     gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgta 239
               |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||
Sbjct: 9465264 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 9465205

                                                                           
Query: 240     cctcgcgagcttggcggactcgccggcaagcttntcgaagatgtcgttgatgaaggagtt 299
                |  |||||   ||||| |||    || ||||| ||||||||||||||||||||||||||
Sbjct: 9465204 gcgggcgaggcgggcggcctcctgcgcgagcttctcgaagatgtcgttgatgaaggagtt 9465145

                                                                  
Query: 300     catgatggacatggccttggaggagatgccgatgtccggntgcacctgctt 350
               |||||| |||||||||||||||||||| ||||||||||| |||||||||||
Sbjct: 9465144 catgatcgacatggccttggaggagattccgatgtccgggtgcacctgctt 9465094



 Score = 73.8 bits (37), Expect = 3e-10
 Identities = 55/61 (90%)
 Strand = Plus / Plus

                                                                            
Query: 276      gaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtc 335
                |||||| ||||||||||||||||| ||||||| ||||||||| ||||| ||||| |||||
Sbjct: 11567068 gaagatatcgttgatgaaggagttgatgatggtcatggccttagaggatatgccaatgtc 11567127

                 
Query: 336      c 336
                |
Sbjct: 11567128 c 11567128



 Score = 50.1 bits (25), Expect = 0.005
 Identities = 33/36 (91%)
 Strand = Plus / Plus

                                                    
Query: 268      agcttntcgaagatgtcgttgatgaaggagttcatg 303
                ||||| ||||||||||||  ||||||||||||||||
Sbjct: 25627559 agcttctcgaagatgtcgaggatgaaggagttcatg 25627594



to top

>emb|X69961.1|SMH2B4A Z.mays gene for H2B histone (gH2B4)
          Length = 2361

 Score =  319 bits (161), Expect = 3e-84
 Identities = 218/238 (91%)
 Strand = Plus / Minus

                                                                        
Query: 124  aacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggagg 183
            |||||||| |||||||||||||||||||||||||||||||||||||||||||| || |||
Sbjct: 1365 aacttggtaacggccttggtgccctcggagacggcgtgcttggcgagctcgccaggaagg 1306

                                                                        
Query: 184  acgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgtacctc 243
            |||||||| || || |||||||||||||||||||| |||||||||||||||||||| |  
Sbjct: 1305 acgaggcgcaccgaagtctggatctcccgggaggttatggtgggcttcttgttgtagcgg 1246

                                                                        
Query: 244  gcgagcttggcggactcgccggcaagcttntcgaagatgtcgttgatgaaggagttcatg 303
            ||||||||||||| |||| | || ||||| ||||||||||||||||||||||||||||||
Sbjct: 1245 gcgagcttggcggcctcggcagccagcttctcgaagatgtcgttgatgaaggagttcatg 1186

                                                                      
Query: 304  atggacatggccttggaggagatgccgatgtccggntgcacctgcttgancaccttga 361
            ||||||||||||||||| ||||| || |||||||| ||||||||||||| ||||||||
Sbjct: 1185 atggacatggccttggacgagataccaatgtccgggtgcacctgcttgagcaccttga 1128



to top

>gb|AC083942.8| Genomic sequence for Oryza sativa, Nipponbare strain, clone
              OSJNBa0002D01, from chromosome 3, complete sequence
          Length = 187589

 Score =  319 bits (161), Expect = 3e-84
 Identities = 213/231 (92%)
 Strand = Plus / Minus

                                                                          
Query: 120    ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 179
              ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 162724 ggtgaacttggtgaccgccttggtgccctcggagacggcgtgcttggcgagctcgccggg 162665

                                                                          
Query: 180    gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgta 239
              |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||
Sbjct: 162664 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 162605

                                                                          
Query: 240    cctcgcgagcttggcggactcgccggcaagcttntcgaagatgtcgttgatgaaggagtt 299
               |  |||||   ||||| |||    || ||||| ||||||||||||||||||||||||||
Sbjct: 162604 gcgggcgaggcgggcggcctcctgcgcgagcttctcgaagatgtcgttgatgaaggagtt 162545

                                                                 
Query: 300    catgatggacatggccttggaggagatgccgatgtccggntgcacctgctt 350
              |||||| |||||||||||||||||||| ||||||||||| |||||||||||
Sbjct: 162544 catgatcgacatggccttggaggagattccgatgtccgggtgcacctgctt 162494



to top

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
               sequence
          Length = 36192742

 Score =  319 bits (161), Expect = 3e-84
 Identities = 213/231 (92%)
 Strand = Plus / Minus

                                                                           
Query: 120     ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 179
               ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 9463445 ggtgaacttggtgaccgccttggtgccctcggagacggcgtgcttggcgagctcgccggg 9463386

                                                                           
Query: 180     gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgta 239
               |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||
Sbjct: 9463385 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 9463326

                                                                           
Query: 240     cctcgcgagcttggcggactcgccggcaagcttntcgaagatgtcgttgatgaaggagtt 299
                |  |||||   ||||| |||    || ||||| ||||||||||||||||||||||||||
Sbjct: 9463325 gcgggcgaggcgggcggcctcctgcgcgagcttctcgaagatgtcgttgatgaaggagtt 9463266

                                                                  
Query: 300     catgatggacatggccttggaggagatgccgatgtccggntgcacctgctt 350
               |||||| |||||||||||||||||||| ||||||||||| |||||||||||
Sbjct: 9463265 catgatcgacatggccttggaggagattccgatgtccgggtgcacctgctt 9463215



 Score = 73.8 bits (37), Expect = 3e-10
 Identities = 55/61 (90%)
 Strand = Plus / Plus

                                                                            
Query: 276      gaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtc 335
                |||||| ||||||||||||||||| ||||||| ||||||||| ||||| ||||| |||||
Sbjct: 11563831 gaagatatcgttgatgaaggagttgatgatggtcatggccttagaggatatgccaatgtc 11563890

                 
Query: 336      c 336
                |
Sbjct: 11563891 c 11563891



 Score = 50.1 bits (25), Expect = 0.005
 Identities = 33/36 (91%)
 Strand = Plus / Plus

                                                    
Query: 268      agcttntcgaagatgtcgttgatgaaggagttcatg 303
                ||||| ||||||||||||  ||||||||||||||||
Sbjct: 25718868 agcttctcgaagatgtcgaggatgaaggagttcatg 25718903



to top

>gb|AF356817.1|AF356817 Lolium perenne histone H2B-1 mRNA, partial cds
          Length = 410

 Score =  317 bits (160), Expect = 1e-83
 Identities = 192/203 (94%)
 Strand = Plus / Minus

                                                                       
Query: 121 gtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccgggg 180
           ||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||
Sbjct: 203 gtgaacttggtgacggccttggtgccctcagacacggcgtgcttggcgagctcgccgggg 144

                                                                       
Query: 181 aggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgtac 240
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 143 aggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgtac 84

                                                                       
Query: 241 ctcgcgagcttggcggactcgccggcaagcttntcgaagatgtcgttgatgaaggagttc 300
           || ||||||||||||||||| || || |  || |||||||||||| ||||||||||||||
Sbjct: 83  ctggcgagcttggcggactcaccagccaatttctcgaagatgtcgctgatgaaggagttc 24

                                  
Query: 301 atgatggacatggccttggagga 323
           ||||||||||||||| |||||||
Sbjct: 23  atgatggacatggccctggagga 1



to top

>dbj|AP003144.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0507H06
          Length = 136351

 Score =  311 bits (157), Expect = 8e-82
 Identities = 212/231 (91%)
 Strand = Plus / Plus

                                                                         
Query: 120   ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 179
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 75126 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 75185

                                                                         
Query: 180   gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgta 239
             ||||||||||||||||||||||| |||||| |||||||||  | ||||||||||||||||
Sbjct: 75186 gaggacgaggcggacggaggtctagatctcgcgggaggtggcgatgggcttcttgttgta 75245

                                                                         
Query: 240   cctcgcgagcttggcggactcgccggcaagcttntcgaagatgtcgttgatgaaggagtt 299
              |  ||||| | ||||| |||    || ||||| ||||||||||||||||||||||||||
Sbjct: 75246 gcgggcgaggtgggcggcctcctgcgcgagcttctcgaagatgtcgttgatgaaggagtt 75305

                                                                
Query: 300   catgatggacatggccttggaggagatgccgatgtccggntgcacctgctt 350
             |||||| |||||||||||||||||||||||||||||||| |||||||||||
Sbjct: 75306 catgatcgacatggccttggaggagatgccgatgtccgggtgcacctgctt 75356



to top

>ref|XM_475367.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 375

 Score =  287 bits (145), Expect = 1e-74
 Identities = 223/250 (89%)
 Strand = Plus / Minus

                                                                       
Query: 112 taggacgaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagc 171
           ||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||
Sbjct: 374 taggaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagc 315

                                                                       
Query: 172 tcgccggggaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttc 231
           ||||||||||||||||| || || |||||||||||||| ||||||||||| |||||||||
Sbjct: 314 tcgccggggaggacgagacgaacagaggtctggatctcgcgggaggtgattgtgggcttc 255

                                                                       
Query: 232 ttgttgtacctcgcgagcttggcggactcgccggcaagcttntcgaagatgtcgttgatg 291
           ||||||||||| || ||| | |||| |||     | ||||| ||||| |||||||||| |
Sbjct: 254 ttgttgtacctggcaagcctcgcggcctcctgctcgagcttctcgaaaatgtcgttgacg 195

                                                                       
Query: 292 aaggagttcatgatggacatggccttggaggagatgccgatgtccggntgcacctgcttg 351
           ||||| ||||||||||||||||||||||||||||| || ||||| || ||||||||||||
Sbjct: 194 aaggaattcatgatggacatggccttggaggagattcctatgtctggatgcacctgcttg 135

                     
Query: 352 ancaccttga 361
           | ||||||||
Sbjct: 134 agcaccttga 125



to top

>gb|AC117265.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1281_H05,
             complete sequence
          Length = 163130

 Score =  287 bits (145), Expect = 1e-74
 Identities = 223/250 (89%)
 Strand = Plus / Minus

                                                                         
Query: 112   taggacgaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagc 171
             ||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||
Sbjct: 69877 taggaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagc 69818

                                                                         
Query: 172   tcgccggggaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttc 231
             ||||||||||||||||| || || |||||||||||||| ||||||||||| |||||||||
Sbjct: 69817 tcgccggggaggacgagacgaacagaggtctggatctcgcgggaggtgattgtgggcttc 69758

                                                                         
Query: 232   ttgttgtacctcgcgagcttggcggactcgccggcaagcttntcgaagatgtcgttgatg 291
             ||||||||||| || ||| | |||| |||     | ||||| ||||| |||||||||| |
Sbjct: 69757 ttgttgtacctggcaagcctcgcggcctcctgctcgagcttctcgaaaatgtcgttgacg 69698

                                                                         
Query: 292   aaggagttcatgatggacatggccttggaggagatgccgatgtccggntgcacctgcttg 351
             ||||| ||||||||||||||||||||||||||||| || ||||| || ||||||||||||
Sbjct: 69697 aaggaattcatgatggacatggccttggaggagattcctatgtctggatgcacctgcttg 69638

                       
Query: 352   ancaccttga 361
             | ||||||||
Sbjct: 69637 agcaccttga 69628



to top

>ref|NM_190523.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 420

 Score =  266 bits (134), Expect = 4e-68
 Identities = 218/247 (88%)
 Strand = Plus / Minus

                                                                       
Query: 115 gacgaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcg 174
           ||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||
Sbjct: 416 gacgacgtgaacttggtgacggccttggtgccctcagagacggcgtgcttggcgagctcg 357

                                                                       
Query: 175 ccggggaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttg 234
           ||||||||||||||||| || |||||||||||||| |||||||||||||| |||||||||
Sbjct: 356 ccggggaggacgaggcgcaccgaggtctggatctcgcgggaggtgatggtcggcttcttg 297

                                                                       
Query: 235 ttgtacctcgcgagcttggcggactcgccggcaagcttntcgaagatgtcgttgatgaag 294
           ||||| |  |||||   ||||| |||   ||| ||||| |||||||| ||||||||||| 
Sbjct: 296 ttgtagcgggcgagacgggcggcctcctgggcgagcttctcgaagatatcgttgatgaac 237

                                                                       
Query: 295 gagttcatgatggacatggccttggaggagatgccgatgtccggntgcacctgcttganc 354
           ||||||||||| |||||||||||||| || || ||||| || || |||||||||||||  
Sbjct: 236 gagttcatgatcgacatggccttggacgatatcccgatatcgggatgcacctgcttgagg 177

                  
Query: 355 accttga 361
           |||||||
Sbjct: 176 accttga 170



to top

>dbj|AP003241.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0408C03
          Length = 141273

 Score =  266 bits (134), Expect = 4e-68
 Identities = 218/247 (88%)
 Strand = Plus / Plus

                                                                         
Query: 115   gacgaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcg 174
             ||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||
Sbjct: 20161 gacgacgtgaacttggtgacggccttggtgccctcagagacggcgtgcttggcgagctcg 20220

                                                                         
Query: 175   ccggggaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttg 234
             ||||||||||||||||| || |||||||||||||| |||||||||||||| |||||||||
Sbjct: 20221 ccggggaggacgaggcgcaccgaggtctggatctcgcgggaggtgatggtcggcttcttg 20280

                                                                         
Query: 235   ttgtacctcgcgagcttggcggactcgccggcaagcttntcgaagatgtcgttgatgaag 294
             ||||| |  |||||   ||||| |||   ||| ||||| |||||||| ||||||||||| 
Sbjct: 20281 ttgtagcgggcgagacgggcggcctcctgggcgagcttctcgaagatatcgttgatgaac 20340

                                                                         
Query: 295   gagttcatgatggacatggccttggaggagatgccgatgtccggntgcacctgcttganc 354
             ||||||||||| |||||||||||||| || || ||||| || || |||||||||||||  
Sbjct: 20341 gagttcatgatcgacatggccttggacgatatcccgatatcgggatgcacctgcttgagg 20400

                    
Query: 355   accttga 361
             |||||||
Sbjct: 20401 accttga 20407



to top

>dbj|AP003231.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
              clone:P0031D11
          Length = 138108

 Score =  266 bits (134), Expect = 4e-68
 Identities = 218/247 (88%)
 Strand = Plus / Plus

                                                                          
Query: 115    gacgaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcg 174
              ||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||
Sbjct: 106114 gacgacgtgaacttggtgacggccttggtgccctcagagacggcgtgcttggcgagctcg 106173

                                                                          
Query: 175    ccggggaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttg 234
              ||||||||||||||||| || |||||||||||||| |||||||||||||| |||||||||
Sbjct: 106174 ccggggaggacgaggcgcaccgaggtctggatctcgcgggaggtgatggtcggcttcttg 106233

                                                                          
Query: 235    ttgtacctcgcgagcttggcggactcgccggcaagcttntcgaagatgtcgttgatgaag 294
              ||||| |  |||||   ||||| |||   ||| ||||| |||||||| ||||||||||| 
Sbjct: 106234 ttgtagcgggcgagacgggcggcctcctgggcgagcttctcgaagatatcgttgatgaac 106293

                                                                          
Query: 295    gagttcatgatggacatggccttggaggagatgccgatgtccggntgcacctgcttganc 354
              ||||||||||| |||||||||||||| || || ||||| || || |||||||||||||  
Sbjct: 106294 gagttcatgatcgacatggccttggacgatatcccgatatcgggatgcacctgcttgagg 106353

                     
Query: 355    accttga 361
              |||||||
Sbjct: 106354 accttga 106360



to top

>gb|AY389709.1| Hyacinthus orientalis histone H2B mRNA, partial cds
          Length = 627

 Score =  232 bits (117), Expect = 6e-58
 Identities = 210/242 (86%)
 Strand = Plus / Minus

                                                                       
Query: 120 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 179
           |||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||
Sbjct: 519 ggtgaacttggtcacggccttggtgccgtcggagacggcgtgcttggcgagctcgccggg 460

                                                                       
Query: 180 gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgta 239
           ||| ||||| | |||||||||||||||||| |||||||||||||||||||||||||||||
Sbjct: 459 gagcacgagcctgacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 400

                                                                       
Query: 240 cctcgcgagcttggcggactcgccggcaagcttntcgaagatgtcgttgatgaaggagtt 299
            |  || ||    | ||||||   ||| ||||| ||||||||||||||||||||||||||
Sbjct: 399 gcgggccaggcgagaggactcctgggcgagcttctcgaagatgtcgttgatgaaggagtt 340

                                                                       
Query: 300 catgatggacatggccttggaggagatgccgatgtccggntgcacctgcttgancacctt 359
           ||||||   ||||||||||   ||||| || |||||||| || |||||||| | ||||||
Sbjct: 339 catgatccccatggccttgctcgagatccctatgtccgggtggacctgcttcagcacctt 280

             
Query: 360 ga 361
           ||
Sbjct: 279 ga 278



to top

>emb|X82362.1|AOHIS2B A.officinalis mRNA for histone 2B
          Length = 492

 Score =  232 bits (117), Expect = 6e-58
 Identities = 202/231 (87%)
 Strand = Plus / Minus

                                                                       
Query: 120 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 179
           |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||
Sbjct: 452 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccggg 393

                                                                       
Query: 180 gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgta 239
           ||||||||| | |||||||||||||||||| |||||||||||||||||||||||||||||
Sbjct: 392 gaggacgagcctgacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 333

                                                                       
Query: 240 cctcgcgagcttggcggactcgccggcaagcttntcgaagatgtcgttgatgaaggagtt 299
            |  || ||   || || |||   ||| ||||| |||||||||||||||||||| |||||
Sbjct: 332 gcgggccaggcgggaggcctcctgggccagcttctcgaagatgtcgttgatgaacgagtt 273

                                                              
Query: 300 catgatggacatggccttggaggagatgccgatgtccggntgcacctgctt 350
           ||||||   ||| ||||||   ||||| ||||||||||| || ||||||||
Sbjct: 272 catgatccccatcgccttgctcgagatcccgatgtccgggtggacctgctt 222



to top

>dbj|AK059159.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-023-D03, full
           insert sequence
          Length = 288

 Score =  218 bits (110), Expect = 9e-54
 Identities = 122/126 (96%)
 Strand = Plus / Minus

                                                                       
Query: 111 ctaggacgaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgag 170
           |||||| || ||||||||||| ||||||||||||||||||||||||||||||||||||||
Sbjct: 134 ctaggaggaagtgaacttggtaacggccttggtgccctcggagacggcgtgcttggcgag 75

                                                                       
Query: 171 ctcgccggggaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggctt 230
           |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||
Sbjct: 74  ctcgccggggaggacgaggcggacggcggtctggatctcccgggaggtgatggtgggctt 15

                 
Query: 231 cttgtt 236
           ||||||
Sbjct: 14  cttgtt 9



to top

>dbj|D37944.1|WHTPH2B12C Triticum aestivum gene for protein H2B123, complete cds
          Length = 2901

 Score =  216 bits (109), Expect = 4e-53
 Identities = 202/234 (86%)
 Strand = Plus / Minus

                                                                        
Query: 128  tggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggaggacga 187
            |||| ||||||||||| ||||||||||||||||||||||| |||||||| || | ||| |
Sbjct: 1985 tggtaacggccttggttccctcggagacggcgtgcttggcaagctcgcctggaaagacaa 1926

                                                                        
Query: 188  ggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgtacctcgcga 247
            |||| ||||  |||||||||||||| |||||||||||||||||||||||||| |  ||||
Sbjct: 1925 ggcgcacggcagtctggatctcccgagaggtgatggtgggcttcttgttgtagcgtgcga 1866

                                                                        
Query: 248  gcttggcggactcgccggcaagcttntcgaagatgtcgttgatgaaggagttcatgatgg 307
            |||| || ||||| ||||| ||||| ||||||||||||||||||| |||||| |||||||
Sbjct: 1865 gctttgccgactctccggcgagcttctcgaagatgtcgttgatgatggagttgatgatgg 1806

                                                                  
Query: 308  acatggccttggaggagatgccgatgtccggntgcacctgcttgancaccttga 361
            |||| |  ||||||||||| || |||| ||| |  | |||||||| ||||||||
Sbjct: 1805 acattgatttggaggagatacccatgttcgggtcaatctgcttgagcaccttga 1752



to top

>gb|AY581839.1| Cynodon dactylon putative histone H2B mRNA, partial cds
          Length = 427

 Score =  198 bits (100), Expect = 9e-48
 Identities = 115/120 (95%)
 Strand = Plus / Minus

                                                                       
Query: 120 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 179
           ||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||
Sbjct: 289 ggtgaacttggtgacggccttagttccctcggagacggcgtgcttggcgagctcgccggg 230

                                                                       
Query: 180 gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgta 239
           |||||||||||| || |||||||||||||| |||||||||||||||||||||||||||||
Sbjct: 229 gaggacgaggcgcaccgaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 170



 Score =  161 bits (81), Expect = 2e-36
 Identities = 90/94 (95%)
 Strand = Plus / Minus

                                                                       
Query: 268 agcttntcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatg 327
           ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 141 agcttctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatg 82

                                             
Query: 328 ccgatgtccggntgcacctgcttgancaccttga 361
           |||||||| || ||||||||||||| ||||||||
Sbjct: 81  ccgatgtcggggtgcacctgcttgagcaccttga 48



to top

>gb|U16726.1|CRU16726 Chlamydomonas reinhardtii histone H1 (ch1), histone H2A (ch2a-IV),
            and histone H2B (ch2b-IV) genes, complete cds
          Length = 4502

 Score =  194 bits (98), Expect = 1e-46
 Identities = 206/243 (84%)
 Strand = Plus / Minus

                                                                        
Query: 118  gaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccg 177
            |||||||||||||| ||||||||||||||||| || || ||||||||||| |||||||||
Sbjct: 4211 gaggtgaacttggtcacggccttggtgccctccgacaccgcgtgcttggccagctcgccg 4152

                                                                        
Query: 178  gggaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttg 237
            || || || ||||| |||| |||||||||||| |||||||| | ||||||||||||||||
Sbjct: 4151 ggcagcaccaggcgcacggcggtctggatctcgcgggaggtcacggtgggcttcttgttg 4092

                                                                        
Query: 238  tacctcgcgagcttggcggactcgccggcaagcttntcgaagatgtcgttgatgaaggag 297
            || |     ||||||| || ||||  ||| | ||| || ||||||||||||||||||  |
Sbjct: 4091 tagcggctcagcttggaggcctcggtggccaccttctcaaagatgtcgttgatgaagctg 4032

                                                                        
Query: 298  ttcatgatggacatggccttggaggagatgccgatgtccggntgcacctgcttgancacc 357
            |||||||||||||||||||||  |  ||||||| |||| || ||||||||||||| ||||
Sbjct: 4031 ttcatgatggacatggccttgctgctgatgccggtgtcggggtgcacctgcttgagcacc 3972

               
Query: 358  ttg 360
            |||
Sbjct: 3971 ttg 3969



to top

>gb|L41841.1|CREHIH3G Chlamydomonas reinhardtii histone H3, histone H4, histone H2B, and
            histone H2A genes, complete cds
          Length = 4358

 Score =  180 bits (91), Expect = 2e-42
 Identities = 205/244 (84%)
 Strand = Plus / Plus

                                                                        
Query: 117  cgaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgcc 176
            ||||||||||||||| ||||||||||||||||| || || ||||||||||| ||||||||
Sbjct: 3039 cgaggtgaacttggtcacggccttggtgccctccgacaccgcgtgcttggccagctcgcc 3098

                                                                        
Query: 177  ggggaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgtt 236
             || || || ||||| |||| |||||||||||| |||||||| | |||||||||||||||
Sbjct: 3099 aggcagcaccaggcgcacggcggtctggatctcacgggaggtcacggtgggcttcttgtt 3158

                                                                        
Query: 237  gtacctcgcgagcttggcggactcgccggcaagcttntcgaagatgtcgttgatgaagga 296
            ||| |     ||||||| || ||||  ||| | ||| || ||||||||||||||||||  
Sbjct: 3159 gtagcggctcagcttggaggcctcggtggccaccttctcaaagatgtcgttgatgaagct 3218

                                                                        
Query: 297  gttcatgatggacatggccttggaggagatgccgatgtccggntgcacctgcttgancac 356
            ||||||||| ||||||||||||  |  ||||||| |||| || ||||||||||||| |||
Sbjct: 3219 gttcatgatagacatggccttgctgctgatgccggtgtcggggtgcacctgcttgagcac 3278

                
Query: 357  cttg 360
            ||||
Sbjct: 3279 cttg 3282



to top

>gb|U16725.1|CRU16725 Chlamydomonas reinhardtii histone H3 (ch3-III), histone H4 (ch4-III),
            histone H2B (ch2b-III) and histone H2A (ch2a-III) genes,
            complete cds
          Length = 4582

 Score =  180 bits (91), Expect = 2e-42
 Identities = 205/244 (84%)
 Strand = Plus / Plus

                                                                        
Query: 117  cgaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgcc 176
            ||||||||||||||| ||||||||||||||||| || || ||||||||||| ||||||||
Sbjct: 2337 cgaggtgaacttggtcacggccttggtgccctccgacaccgcgtgcttggccagctcgcc 2396

                                                                        
Query: 177  ggggaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgtt 236
            ||| || || ||||| || | |||||||||||| |||||||| | |||||||||||||||
Sbjct: 2397 gggcagcaccaggcgcaccgcggtctggatctcgcgggaggtcacggtgggcttcttgtt 2456

                                                                        
Query: 237  gtacctcgcgagcttggcggactcgccggcaagcttntcgaagatgtcgttgatgaagga 296
            ||| |     ||||||| || |||   ||| | ||| || ||||||||||||||||||  
Sbjct: 2457 gtagcggctcagcttggaggcctcagtggccaccttctcaaagatgtcgttgatgaagct 2516

                                                                        
Query: 297  gttcatgatggacatggccttggaggagatgccgatgtccggntgcacctgcttgancac 356
            ||||||||||||||||||||||  |  ||||||| |||| || ||||||||||||| |||
Sbjct: 2517 gttcatgatggacatggccttgctgctgatgccggtgtcggggtgcacctgcttgagcac 2576

                
Query: 357  cttg 360
            ||||
Sbjct: 2577 cttg 2580



to top

>gb|U16724.1|CRU16724 Chlamydomonas reinhardtii histone H3 (ch3-II), histone H4 (ch4-II),
            histone H2B (ch2b-II) and histone H2A (ch2a-II) genes,
            complete cds
          Length = 3777

 Score =  170 bits (86), Expect = 2e-39
 Identities = 203/243 (83%)
 Strand = Plus / Plus

                                                                        
Query: 118  gaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccg 177
            |||||||||||||| ||||||||||||||||| || || |||||||| || ||||| |||
Sbjct: 2456 gaggtgaacttggtcacggccttggtgccctctgacaccgcgtgcttagccagctcaccg 2515

                                                                        
Query: 178  gggaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttg 237
            || || || ||||| |||| |||||||||||| || ||||| | ||||||||||||||||
Sbjct: 2516 ggcagcaccaggcgcacggcggtctggatctcgcgagaggtcacggtgggcttcttgttg 2575

                                                                        
Query: 238  tacctcgcgagcttggcggactcgccggcaagcttntcgaagatgtcgttgatgaaggag 297
            || |     ||||||| || ||||  ||| | ||| || ||||||||||||||||||  |
Sbjct: 2576 tagcggctcagcttggaggcctcggtggccaccttctcaaagatgtcgttgatgaagctg 2635

                                                                        
Query: 298  ttcatgatggacatggccttggaggagatgccgatgtccggntgcacctgcttgancacc 357
            |||||||||||||||||||||  |  ||||||| |||| || ||||||||||||| ||||
Sbjct: 2636 ttcatgatggacatggccttgctgctgatgccggtgtcggggtgcacctgcttgagcacc 2695

               
Query: 358  ttg 360
            |||
Sbjct: 2696 ttg 2698



to top

>gb|AF048824.1|AF048824 Malus domestica histone H2B mRNA, partial cds
          Length = 478

 Score =  168 bits (85), Expect = 8e-39
 Identities = 202/242 (83%)
 Strand = Plus / Minus

                                                                       
Query: 120 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 179
           ||||||||| || ||||||||||| || || || || ||||||||||||||||| || ||
Sbjct: 274 ggtgaacttagtcacggccttggtcccttccgaaacagcgtgcttggcgagctcaccagg 215

                                                                       
Query: 180 gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgta 239
           ||| ||||| |  |||||||||||||| |||||||| ||||| || || |||||||||||
Sbjct: 214 gagcacgagcctcacggaggtctggatttcccgggaagtgatcgtcggtttcttgttgta 155

                                                                       
Query: 240 cctcgcgagcttggcggactcgccggcaagcttntcgaagatgtcgttgatgaaggagtt 299
           |||||||||| |||  |||||   ||| ||||| ||||| |||||||||||||||  |||
Sbjct: 154 cctcgcgagcctggacgactcctgggcgagcttctcgaaaatgtcgttgatgaagctgtt 95

                                                                       
Query: 300 catgatggacatggccttggaggagatgccgatgtccggntgcacctgcttgancacctt 359
           ||||||   ||||||||||  |||||| |||||||| || || |||||||| | ||||||
Sbjct: 94  catgattcccatggccttgctggagatcccgatgtcagggtggacctgcttcagcacctt 35

             
Query: 360 ga 361
           ||
Sbjct: 34  ga 33



to top

>gb|AF356818.1|AF356818 Lolium perenne histone H2B-2 mRNA, partial cds
          Length = 402

 Score =  155 bits (78), Expect = 1e-34
 Identities = 85/88 (96%)
 Strand = Plus / Minus

                                                                       
Query: 274 tcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatg 333
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 383 tcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatg 324

                                       
Query: 334 tccggntgcacctgcttgancaccttga 361
           || || ||||||||||||| ||||||||
Sbjct: 323 tcggggtgcacctgcttgagcaccttga 296



to top

>gb|AF356821.1|AF356821 Lolium perenne histone H2B-5 mRNA, partial cds
          Length = 375

 Score =  147 bits (74), Expect = 3e-32
 Identities = 84/88 (95%)
 Strand = Plus / Minus

                                                                       
Query: 274 tcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatg 333
           |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||
Sbjct: 356 tcgaagatgtcgttgatgaaggagctcatgatggacatggccttggaggagatgccgatg 297

                                       
Query: 334 tccggntgcacctgcttgancaccttga 361
           || || ||||||||||||| ||||||||
Sbjct: 296 tcggggtgcacctgcttgagcaccttga 269



to top

>gb|AF356819.1|AF356819 Lolium perenne histone H2B-3 mRNA, partial cds
          Length = 397

 Score =  147 bits (74), Expect = 3e-32
 Identities = 84/88 (95%)
 Strand = Plus / Minus

                                                                       
Query: 274 tcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatg 333
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 378 tcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatg 319

                                       
Query: 334 tccggntgcacctgcttgancaccttga 361
           || || || |||||||||| ||||||||
Sbjct: 318 tcggggtggacctgcttgagcaccttga 291



to top

>ref|XM_391802.1| Gibberella zeae PH-1 H2B_NEUCR Histone H2B (FG11626.1) partial mRNA
          Length = 414

 Score =  141 bits (71), Expect = 2e-30
 Identities = 104/115 (90%)
 Strand = Plus / Minus

                                                                       
Query: 125 acttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggagga 184
           ||||||| ||||||||||| ||||||||||||||||||||||| ||||| ||||||||||
Sbjct: 394 acttggtaacggccttggtaccctcggagacggcgtgcttggcaagctcaccggggagga 335

                                                                  
Query: 185 cgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgta 239
            ||||||||| |||||||| ||||| ||||| | |||||||| ||||||||||||
Sbjct: 334 tgaggcggacagaggtctgaatctctcgggaagagatggtggacttcttgttgta 280



 Score = 50.1 bits (25), Expect = 0.005
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                    
Query: 274 tcgaagatgtcgttgatgaaggagttcatgatggacatggc 314
           ||||| |||||||||| ||| ||||||| ||||||||||||
Sbjct: 245 tcgaaaatgtcgttgacgaaagagttcaggatggacatggc 205



to top

>emb|BX088700.1|CNS09S4S DNA centromeric region sequence from BAC DP26B06, DP34F04, DP16D11,
             DP09G08, DP35C12 of chromosome 5  of Podospora anserina
          Length = 322194

 Score =  141 bits (71), Expect = 2e-30
 Identities = 104/115 (90%)
 Strand = Plus / Minus

                                                                         
Query: 125   acttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggagga 184
             |||||||||||||||||||||| || || |||||||||||||| ||||||||||| ||||
Sbjct: 23470 acttggtgacggccttggtgccttcagacacggcgtgcttggcaagctcgccgggaagga 23411

                                                                    
Query: 185   cgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgta 239
              |||||| ||||||||||||||||| ||||| | |||||||| ||||||||||||
Sbjct: 23410 tgaggcgcacggaggtctggatctcacgggatgagatggtggacttcttgttgta 23356



to top

>dbj|AB124798.1| Rhacophorus schlegelii histh2b mRNA for histone H2B, complete cds
          Length = 425

 Score =  141 bits (71), Expect = 2e-30
 Identities = 98/107 (91%)
 Strand = Plus / Minus

                                                                       
Query: 120 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 179
           |||| ||||||||||||| ||||||||||||||||||||||||||||| ||||| |||||
Sbjct: 369 ggtgtacttggtgacggctttggtgccctcggagacggcgtgcttggccagctctccggg 310

                                                          
Query: 180 gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgg 226
            || |  |||||||||| |||||||||||||||||||||||||||||
Sbjct: 309 cagcagcaggcggacggcggtctggatctcccgggaggtgatggtgg 263



 Score =  113 bits (57), Expect = 4e-22
 Identities = 79/87 (90%)
 Strand = Plus / Minus

                                                                       
Query: 274 tcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatg 333
           |||||||||||||||| ||||||||||||||||  |||||||||||||||||||||| ||
Sbjct: 215 tcgaagatgtcgttgacgaaggagttcatgatgctcatggccttggaggagatgccggtg 156

                                      
Query: 334 tccggntgcacctgcttgancaccttg 360
           || || || |||||||||| |||||||
Sbjct: 155 tcggggtggacctgcttgagcaccttg 129



to top

>emb|AL590462.1|CNS07EGJ DNA centromeric region sequence BAC 34F04 of chromosome 5 of Podospora
             anserina
          Length = 103568

 Score =  141 bits (71), Expect = 2e-30
 Identities = 104/115 (90%)
 Strand = Plus / Plus

                                                                         
Query: 125   acttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggagga 184
             |||||||||||||||||||||| || || |||||||||||||| ||||||||||| ||||
Sbjct: 81641 acttggtgacggccttggtgccttcagacacggcgtgcttggcaagctcgccgggaagga 81700

                                                                    
Query: 185   cgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgta 239
              |||||| ||||||||||||||||| ||||| | |||||||| ||||||||||||
Sbjct: 81701 tgaggcgcacggaggtctggatctcacgggatgagatggtggacttcttgttgta 81755



to top

>gb|M31922.1|VVCH4AB V.carteri histone H2A-IV and H2B-IV genes, complete cds
          Length = 2132

 Score =  135 bits (68), Expect = 1e-28
 Identities = 203/249 (81%)
 Strand = Plus / Minus

                                                                        
Query: 112  taggacgaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagc 171
            |||| ||| |||||||||||||| ||||||||||||||||| |||||||||||||| |||
Sbjct: 1592 taggccgacgtgaacttggtgacagccttggtgccctcggacacggcgtgcttggccagc 1533

                                                                        
Query: 172  tcgccggggaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttc 231
            ||||| || || || ||||| || |  ||||| || || || || || | ||||||||||
Sbjct: 1532 tcgcccggaagaaccaggcgcacagcagtctgaatttcgcgcgacgtcacggtgggcttc 1473

                                                                        
Query: 232  ttgttgtacctcgcgagcttggcggactcgccggcaagcttntcgaagatgtcgttgatg 291
            |||||||| |     ||||||| || ||||  ||||| ||| || |||||||||||||||
Sbjct: 1472 ttgttgtagcggctcagcttggaggcctcggtggcaaccttctcaaagatgtcgttgatg 1413

                                                                        
Query: 292  aaggagttcatgatggacatggccttggaggagatgccgatgtccggntgcacctgcttg 351
            |||  |||||| || ||||||||||| |||  ||||||| | || || ||||||||||| 
Sbjct: 1412 aagctgttcataatcgacatggccttcgagctgatgccggtatcggggtgcacctgcttc 1353

                     
Query: 352  ancaccttg 360
            | |||||||
Sbjct: 1352 aacaccttg 1344



to top

>ref|XM_540291.2| PREDICTED: Canis familiaris similar to H2B histone family, member F
           (LOC483173), mRNA
          Length = 2193

 Score =  133 bits (67), Expect = 4e-28
 Identities = 97/107 (90%)
 Strand = Plus / Minus

                                                                       
Query: 120 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 179
           |||| |||||||||||||||||||||||||||| |||||||||||||| |||||||||||
Sbjct: 385 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctcgccggg 326

                                                          
Query: 180 gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgg 226
            || |  ||||| ||||  ||||||||||||||||||||||||||||
Sbjct: 325 cagcagcaggcgcacggccgtctggatctcccgggaggtgatggtgg 279



 Score = 97.6 bits (49), Expect = 2e-17
 Identities = 77/87 (88%)
 Strand = Plus / Minus

                                                                       
Query: 274 tcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatg 333
           |||||||||||||||| ||| ||||||||||||  |||||||||||| ||||||||| ||
Sbjct: 231 tcgaagatgtcgttgacgaacgagttcatgatgcccatggccttggacgagatgccggtg 172

                                      
Query: 334 tccggntgcacctgcttgancaccttg 360
           || || ||||||||||| | |||||||
Sbjct: 171 tcggggtgcacctgcttcagcaccttg 145



to top

>ref|XM_540282.2| PREDICTED: Canis familiaris similar to Histone H2B 291B
           (LOC483164), mRNA
          Length = 659

 Score =  133 bits (67), Expect = 4e-28
 Identities = 97/107 (90%)
 Strand = Plus / Minus

                                                                       
Query: 120 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 179
           |||| |||||||||||||||||||||||||||| |||||||||||||| |||||||||||
Sbjct: 392 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctcgccggg 333

                                                          
Query: 180 gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgg 226
            || |  ||||| ||||  ||||||||||||||||||||||||||||
Sbjct: 332 cagcagcaggcgcacggccgtctggatctcccgggaggtgatggtgg 286



 Score = 97.6 bits (49), Expect = 2e-17
 Identities = 77/87 (88%)
 Strand = Plus / Minus

                                                                       
Query: 274 tcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatg 333
           |||||||||||||||| ||| ||||||||||||  |||||||||||| ||||||||| ||
Sbjct: 238 tcgaagatgtcgttgacgaacgagttcatgatgcccatggccttggacgagatgccggtg 179

                                      
Query: 334 tccggntgcacctgcttgancaccttg 360
           || || ||||||||||| | |||||||
Sbjct: 178 tcggggtgcacctgcttcagcaccttg 152



to top

>ref|XM_540287.2| PREDICTED: Canis familiaris similar to H2B histone family, member
           F, transcript variant 1 (LOC483169), mRNA
          Length = 432

 Score =  133 bits (67), Expect = 4e-28
 Identities = 97/107 (90%)
 Strand = Plus / Minus

                                                                       
Query: 120 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 179
           |||| |||||||||||||||||||||||||||| |||||||||||||| |||||||||||
Sbjct: 379 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctcgccggg 320

                                                          
Query: 180 gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgg 226
            || |  ||||| ||||  ||||||||||||||||||||||||||||
Sbjct: 319 cagcagcaggcgcacggccgtctggatctcccgggaggtgatggtgg 273



 Score = 97.6 bits (49), Expect = 2e-17
 Identities = 77/87 (88%)
 Strand = Plus / Minus

                                                                       
Query: 274 tcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatg 333
           |||||||||||||||| ||| ||||||||||||  |||||||||||| ||||||||| ||
Sbjct: 225 tcgaagatgtcgttgacgaacgagttcatgatgcccatggccttggacgagatgccggtg 166

                                      
Query: 334 tccggntgcacctgcttgancaccttg 360
           || || ||||||||||| | |||||||
Sbjct: 165 tcggggtgcacctgcttcagcaccttg 139



to top

>ref|XM_844635.1| PREDICTED: Canis familiaris similar to H2B histone family, member
           F, transcript variant 2 (LOC483169), mRNA
          Length = 516

 Score =  133 bits (67), Expect = 4e-28
 Identities = 97/107 (90%)
 Strand = Plus / Minus

                                                                       
Query: 120 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 179
           |||| |||||||||||||||||||||||||||| |||||||||||||| |||||||||||
Sbjct: 417 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctcgccggg 358

                                                          
Query: 180 gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgg 226
            || |  ||||| ||||  ||||||||||||||||||||||||||||
Sbjct: 357 cagcagcaggcgcacggccgtctggatctcccgggaggtgatggtgg 311



 Score = 97.6 bits (49), Expect = 2e-17
 Identities = 77/87 (88%)
 Strand = Plus / Minus

                                                                       
Query: 274 tcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatg 333
           |||||||||||||||| ||| ||||||||||||  |||||||||||| ||||||||| ||
Sbjct: 263 tcgaagatgtcgttgacgaacgagttcatgatgcccatggccttggacgagatgccggtg 204

                                      
Query: 334 tccggntgcacctgcttgancaccttg 360
           || || ||||||||||| | |||||||
Sbjct: 203 tcggggtgcacctgcttcagcaccttg 177



to top

>ref|XM_854499.1| PREDICTED: Canis familiaris similar to H2B histone family, member
           F, transcript variant 5 (LOC483170), mRNA
          Length = 415

 Score =  133 bits (67), Expect = 4e-28
 Identities = 97/107 (90%)
 Strand = Plus / Minus

                                                                       
Query: 120 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 179
           |||| |||||||||||||||||||||||||||| |||||||||||||| |||||||||||
Sbjct: 369 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctcgccggg 310

                                                          
Query: 180 gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgg 226
            || |  ||||| ||||  ||||||||||||||||||||||||||||
Sbjct: 309 cagcagcaggcgcacggccgtctggatctcccgggaggtgatggtgg 263



 Score = 97.6 bits (49), Expect = 2e-17
 Identities = 77/87 (88%)
 Strand = Plus / Minus

                                                                       
Query: 274 tcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatg 333
           |||||||||||||||| ||| ||||||||||||  |||||||||||| ||||||||| ||
Sbjct: 215 tcgaagatgtcgttgacgaacgagttcatgatgcccatggccttggacgagatgccggtg 156

                                      
Query: 334 tccggntgcacctgcttgancaccttg 360
           || || ||||||||||| | |||||||
Sbjct: 155 tcggggtgcacctgcttcagcaccttg 129



to top

>ref|XM_540288.2| PREDICTED: Canis familiaris similar to H2B histone family, member
           F, transcript variant 4 (LOC483170), mRNA
          Length = 597

 Score =  133 bits (67), Expect = 4e-28
 Identities = 97/107 (90%)
 Strand = Plus / Minus

                                                                       
Query: 120 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 179
           |||| |||||||||||||||||||||||||||| |||||||||||||| |||||||||||
Sbjct: 417 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctcgccggg 358

                                                          
Query: 180 gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgg 226
            || |  ||||| ||||  ||||||||||||||||||||||||||||
Sbjct: 357 cagcagcaggcgcacggccgtctggatctcccgggaggtgatggtgg 311



 Score = 97.6 bits (49), Expect = 2e-17
 Identities = 77/87 (88%)
 Strand = Plus / Minus

                                                                       
Query: 274 tcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatg 333
           |||||||||||||||| ||| ||||||||||||  |||||||||||| ||||||||| ||
Sbjct: 263 tcgaagatgtcgttgacgaacgagttcatgatgcccatggccttggacgagatgccggtg 204

                                      
Query: 334 tccggntgcacctgcttgancaccttg 360
           || || ||||||||||| | |||||||
Sbjct: 203 tcggggtgcacctgcttcagcaccttg 177



to top

>ref|XM_789621.1| PREDICTED: Strongylocentrotus purpuratus similar to testis-specific
           histone 2b (LOC589998), mRNA
          Length = 372

 Score =  127 bits (64), Expect = 3e-26
 Identities = 106/120 (88%)
 Strand = Plus / Minus

                                                                       
Query: 120 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 179
           |||| |||||||||| |||||||||||||| ||||||||||||||||| ||||| |||||
Sbjct: 360 ggtgtacttggtgacagccttggtgccctcagagacggcgtgcttggccagctctccggg 301

                                                                       
Query: 180 gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgta 239
           ||||| ||| ||||| | |||||||||||| |||  | ||||||||| ||||||||||||
Sbjct: 300 gaggaggagacggacagcggtctggatctctcggctgctgatggtggccttcttgttgta 241



 Score = 50.1 bits (25), Expect = 0.005
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 274 tcgaagatgtcgttgatgaaggagttcatgatggacatggccttg 318
           |||||||  ||||||| ||||  ||||||||||||||||||||||
Sbjct: 206 tcgaagacatcgttgacgaagctgttcatgatggacatggccttg 162



to top

>emb|X03018.1|XLHISH3A Xenopus laevis histone gene cluster XlH3-A with genes H1A, H2B, H3
            and H4
          Length = 8592

 Score =  125 bits (63), Expect = 1e-25
 Identities = 96/107 (89%)
 Strand = Plus / Minus

                                                                        
Query: 120  ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 179
            |||| |||||||||||||||||||||||||||| |||||||||||||| ||||| || ||
Sbjct: 2063 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctccccagg 2004

                                                           
Query: 180  gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgg 226
             | ||  |||||||| | |||||||||||||||||||||||||||||
Sbjct: 2003 caagagcaggcggaccgcggtctggatctcccgggaggtgatggtgg 1957



 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 57/65 (87%)
 Strand = Plus / Minus

                                                                        
Query: 292  aaggagttcatgatggacatggccttggaggagatgccgatgtccggntgcacctgcttg 351
            |||||||||||||||  |||||||||||| ||||||||| | || || ||||||||||||
Sbjct: 1891 aaggagttcatgatgctcatggccttggaagagatgccggtatcggggtgcacctgcttg 1832

                 
Query: 352  ancac 356
            | |||
Sbjct: 1831 agcac 1827



to top

>gb|BC077399.1| Xenopus laevis histone H2B, mRNA (cDNA clone MGC:81709
           IMAGE:6865010), complete cds
          Length = 1379

 Score =  125 bits (63), Expect = 1e-25
 Identities = 96/107 (89%)
 Strand = Plus / Minus

                                                                       
Query: 120 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 179
           |||| |||||||||||||||||||||||||||| |||||||||||||| ||||| || ||
Sbjct: 392 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctccccagg 333

                                                          
Query: 180 gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgg 226
            | ||  |||||||| | |||||||||||||||||||||||||||||
Sbjct: 332 caagagcaggcggaccgcggtctggatctcccgggaggtgatggtgg 286



 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 57/65 (87%)
 Strand = Plus / Minus

                                                                       
Query: 292 aaggagttcatgatggacatggccttggaggagatgccgatgtccggntgcacctgcttg 351
           |||||||||||||||  |||||||||||| ||||||||| | || || ||||||||||||
Sbjct: 220 aaggagttcatgatgctcatggccttggaagagatgccggtatcggggtgcacctgcttg 161

                
Query: 352 ancac 356
           | |||
Sbjct: 160 agcac 156



to top

>gb|M21287.1|XELHX1H3 X.laevis histone H1B, H2A, H2B, and H4 genes, complete cds, and
            histone H3 gene, 3' end, gene cluster X1h3
          Length = 8608

 Score =  125 bits (63), Expect = 1e-25
 Identities = 96/107 (89%)
 Strand = Plus / Minus

                                                                        
Query: 120  ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 179
            |||| |||||||||||||||||||||||||||| |||||||||||||| ||||| || ||
Sbjct: 2073 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctccccagg 2014

                                                           
Query: 180  gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgg 226
             | ||  |||||||| | |||||||||||||||||||||||||||||
Sbjct: 2013 caagagcaggcggaccgcggtctggatctcccgggaggtgatggtgg 1967



 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 57/65 (87%)
 Strand = Plus / Minus

                                                                        
Query: 292  aaggagttcatgatggacatggccttggaggagatgccgatgtccggntgcacctgcttg 351
            |||||||||||||||  |||||||||||| ||||||||| | || || ||||||||||||
Sbjct: 1901 aaggagttcatgatgctcatggccttggaagagatgccggtatcggggtgcacctgcttg 1842

                 
Query: 352  ancac 356
            | |||
Sbjct: 1841 agcac 1837



to top

>ref|XM_782648.1| PREDICTED: Strongylocentrotus purpuratus similar to Histone H2B
           (LOC582704), mRNA
          Length = 372

 Score =  121 bits (61), Expect = 2e-24
 Identities = 106/121 (87%)
 Strand = Plus / Minus

                                                                       
Query: 120 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 179
           |||| |||||||||| |||||||||||||| |||||||| |||||||| ||||| |||||
Sbjct: 360 ggtgtacttggtgacagccttggtgccctcagagacggcatgcttggccagctctccggg 301

                                                                       
Query: 180 gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgta 239
           ||||| ||| ||||| | |||||||||||| |||  | ||||||||| ||||||||||||
Sbjct: 300 gaggaggagacggacagcggtctggatctctcggctgctgatggtggacttcttgttgta 241

            
Query: 240 c 240
           |
Sbjct: 240 c 240



 Score = 52.0 bits (26), Expect = 0.001
 Identities = 64/77 (83%)
 Strand = Plus / Minus

                                                                       
Query: 274 tcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatg 333
           |||||||  ||||||| ||||  ||||||||||||||||||||||  |||||| ||  ||
Sbjct: 206 tcgaagacatcgttgacgaagctgttcatgatggacatggccttgctggagataccagtg 147

                            
Query: 334 tccggntgcacctgctt 350
           || || || ||||||||
Sbjct: 146 tcggggtggacctgctt 130



to top

>ref|XM_785670.1| PREDICTED: Strongylocentrotus purpuratus similar to Histone H2B
           (LOC585864), mRNA
          Length = 372

 Score =  121 bits (61), Expect = 2e-24
 Identities = 106/121 (87%)
 Strand = Plus / Minus

                                                                       
Query: 120 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 179
           |||| |||||||||| |||||||||||||| |||||||| |||||||| ||||| |||||
Sbjct: 360 ggtgtacttggtgacagccttggtgccctcagagacggcatgcttggccagctctccggg 301

                                                                       
Query: 180 gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgta 239
           ||||| ||| ||||| | |||||||||||| |||  | ||||||||| ||||||||||||
Sbjct: 300 gaggaggagacggacagcggtctggatctctcggctgctgatggtggacttcttgttgta 241

            
Query: 240 c 240
           |
Sbjct: 240 c 240



 Score = 52.0 bits (26), Expect = 0.001
 Identities = 64/77 (83%)
 Strand = Plus / Minus

                                                                       
Query: 274 tcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatg 333
           |||||||  ||||||| ||||  ||||||||||||||||||||||  |||||| ||  ||
Sbjct: 206 tcgaagacatcgttgacgaagctgttcatgatggacatggccttgctggagataccagtg 147

                            
Query: 334 tccggntgcacctgctt 350
           || || || ||||||||
Sbjct: 146 tcggggtggacctgctt 130



to top

>gb|DQ215263.1| Taeniopygia guttata clone 0058P0013D11 histone 1 H2be -like mRNA,
           complete sequence
          Length = 838

 Score =  117 bits (59), Expect = 3e-23
 Identities = 95/107 (88%)
 Strand = Plus / Minus

                                                                       
Query: 120 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 179
           |||| |||||||||| ||||||||||||||||| |||||||||||||| |||||||||||
Sbjct: 416 ggtgtacttggtgacagccttggtgccctcggacacggcgtgcttggccagctcgccggg 357

                                                          
Query: 180 gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgg 226
            || |  ||||| ||||  |||||||||||||| |||||||||||||
Sbjct: 356 cagcagcaggcgcacggccgtctggatctcccgcgaggtgatggtgg 310



 Score = 97.6 bits (49), Expect = 2e-17
 Identities = 77/87 (88%)
 Strand = Plus / Minus

                                                                       
Query: 274 tcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatg 333
           |||||||||||||||| ||||||||||||||||  |||||||||||| ||||||||  ||
Sbjct: 262 tcgaagatgtcgttgacgaaggagttcatgatgcccatggccttggacgagatgcccgtg 203

                                      
Query: 334 tccggntgcacctgcttgancaccttg 360
           || || ||||||||||| | |||||||
Sbjct: 202 tcggggtgcacctgcttcagcaccttg 176



to top

>ref|XM_513763.1| PREDICTED: Pan troglodytes LOC457260 (LOC457260), mRNA
          Length = 753

 Score =  117 bits (59), Expect = 3e-23
 Identities = 95/107 (88%)
 Strand = Plus / Minus

                                                                       
Query: 120 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 179
           |||| |||||||||| ||||||||||||||||| |||||||||||||| |||||||||||
Sbjct: 384 ggtgtacttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccggg 325

                                                          
Query: 180 gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgg 226
            || |  ||||| ||||  ||||||||||| ||||||||||||||||
Sbjct: 324 cagcagcaggcgcacggccgtctggatctcgcgggaggtgatggtgg 278



 Score = 97.6 bits (49), Expect = 2e-17
 Identities = 77/87 (88%)
 Strand = Plus / Minus

                                                                       
Query: 274 tcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatg 333
           |||||||||||||||| ||||||||||||||||  |||||||||||| ||||||||| ||
Sbjct: 230 tcgaagatgtcgttgacgaaggagttcatgatgcccatggccttggacgagatgccggtg 171

                                      
Query: 334 tccggntgcacctgcttgancaccttg 360
           || || || |||||||| | |||||||
Sbjct: 170 tcggggtggacctgcttcagcaccttg 144



to top

>ref|XM_427116.1| PREDICTED: Gallus gallus similar to histone H2B.8 - chicken
           (LOC429558), mRNA
          Length = 381

 Score =  117 bits (59), Expect = 3e-23
 Identities = 95/107 (88%)
 Strand = Plus / Minus

                                                                       
Query: 120 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 179
           |||| ||||||||||||||||||||||||| ||||||||||||||||| ||||| |||||
Sbjct: 369 ggtgtacttggtgacggccttggtgccctcagagacggcgtgcttggccagctctccggg 310

                                                          
Query: 180 gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgg 226
            || |  ||||| ||||  |||||||||||||| |||||||||||||
Sbjct: 309 cagcagcaggcgcacggctgtctggatctcccgcgaggtgatggtgg 263



 Score = 99.6 bits (50), Expect = 6e-18
 Identities = 75/84 (89%)
 Strand = Plus / Minus

                                                                       
Query: 277 aagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtcc 336
           ||||||||||||| ||||||||||||||||  |||||||||||||||||||||| |||| 
Sbjct: 212 aagatgtcgttgacgaaggagttcatgatgcccatggccttggaggagatgccggtgtcg 153

                                   
Query: 337 ggntgcacctgcttgancaccttg 360
           || || |||||||| | |||||||
Sbjct: 152 gggtggacctgctttagcaccttg 129



to top

>ref|XM_427013.1| PREDICTED: Gallus gallus similar to histone H2B.8 - chicken
           (LOC429457), partial mRNA
          Length = 628

 Score =  117 bits (59), Expect = 3e-23
 Identities = 95/107 (88%)
 Strand = Plus / Minus

                                                                       
Query: 120 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 179
           |||| ||||||||||||||||||||||||| ||||||||||||||||| ||||| |||||
Sbjct: 616 ggtgtacttggtgacggccttggtgccctcagagacggcgtgcttggccagctctccggg 557

                                                          
Query: 180 gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgg 226
            || |  ||||| ||||  |||||||||||||| |||||||||||||
Sbjct: 556 cagcagcaggcgcacggctgtctggatctcccgcgaggtgatggtgg 510



 Score = 99.6 bits (50), Expect = 6e-18
 Identities = 75/84 (89%)
 Strand = Plus / Minus

                                                                       
Query: 277 aagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtcc 336
           ||||||||||||| ||||||||||||||||  |||||||||||||||||||||| |||| 
Sbjct: 459 aagatgtcgttgacgaaggagttcatgatgcccatggccttggaggagatgccggtgtcg 400

                                   
Query: 337 ggntgcacctgcttgancaccttg 360
           || || |||||||| | |||||||
Sbjct: 399 gggtggacctgctttagcaccttg 376



to top

>ref|XM_954347.1| Neurospora crassa OR74A hypothetical protein (NCU02435.1) partial
           mRNA
          Length = 414

 Score =  117 bits (59), Expect = 3e-23
 Identities = 101/115 (87%)
 Strand = Plus / Minus

                                                                       
Query: 125 acttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggagga 184
           ||||||| |||||||| ||||| || || || ||||||||||| ||||||||||||||||
Sbjct: 394 acttggtaacggccttagtgccttccgatacagcgtgcttggcaagctcgccggggagga 335

                                                                  
Query: 185 cgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgta 239
            |||||| || |||||||||||||| || |||| |||||||| ||||||||||||
Sbjct: 334 tgaggcgaacagaggtctggatctcacgagaggagatggtggacttcttgttgta 280



to top

>ref|XM_331210.1| Neurospora crassa OR74A hypothetical protein (NCU02435.1) partial
           mRNA
          Length = 414

 Score =  117 bits (59), Expect = 3e-23
 Identities = 101/115 (87%)
 Strand = Plus / Minus

                                                                       
Query: 125 acttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggagga 184
           ||||||| |||||||| ||||| || || || ||||||||||| ||||||||||||||||
Sbjct: 394 acttggtaacggccttagtgccttccgatacagcgtgcttggcaagctcgccggggagga 335

                                                                  
Query: 185 cgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgta 239
            |||||| || |||||||||||||| || |||| |||||||| ||||||||||||
Sbjct: 334 tgaggcgaacagaggtctggatctcacgagaggagatggtggacttcttgttgta 280



to top

>emb|CR855675.2| Xenopus tropicalis finished cDNA, clone TGas058p09
          Length = 484

 Score =  117 bits (59), Expect = 3e-23
 Identities = 95/107 (88%)
 Strand = Plus / Minus

                                                                       
Query: 120 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 179
           |||| |||||||||| ||||||||||||||||| |||||||||||||| ||||| || ||
Sbjct: 375 ggtgtacttggtgacagccttggtgccctcggacacggcgtgcttggccagctccccagg 316

                                                          
Query: 180 gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgg 226
            || |  |||||||| | |||||||||||||||||||||||||||||
Sbjct: 315 cagcagcaggcggaccgcggtctggatctcccgggaggtgatggtgg 269



 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 67/78 (85%)
 Strand = Plus / Minus

                                                                       
Query: 283 tcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtccggntgc 342
           |||||||  |||||||||||||||  |||||||||||| ||||||||| | || || |||
Sbjct: 212 tcgttgacaaaggagttcatgatgctcatggccttggaagagatgccggtatcggggtgc 153

                             
Query: 343 acctgcttgancaccttg 360
           |||||||| | |||||||
Sbjct: 152 acctgcttcagcaccttg 135



to top

>ref|XM_787146.1| PREDICTED: Strongylocentrotus purpuratus similar to Histone H2B
           (LOC587419), mRNA
          Length = 372

 Score =  113 bits (57), Expect = 4e-22
 Identities = 99/113 (87%)
 Strand = Plus / Minus

                                                                       
Query: 127 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggaggacg 186
           ||||||||||||||||||||||| ||||||||||||||||| ||||| |||||||||| |
Sbjct: 353 ttggtgacggccttggtgccctcagagacggcgtgcttggccagctctccggggaggagg 294

                                                                
Query: 187 aggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgta 239
           || | ||| | |||||||| ||| |||  ||||||||| | ||||||||||||
Sbjct: 293 agtctgacagcggtctggacctcacggctggtgatggtagacttcttgttgta 241



 Score = 42.1 bits (21), Expect = 1.2
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 274 tcgaagatgtcgttgatgaaggagttcatgatggacatggc 314
           |||||||  ||||||| ||||  ||||||||||||||||||
Sbjct: 206 tcgaagacatcgttgacgaagctgttcatgatggacatggc 166



to top

>ref|XM_781061.1| PREDICTED: Strongylocentrotus purpuratus similar to Histone H2B
           (LOC581037), mRNA
          Length = 468

 Score =  113 bits (57), Expect = 4e-22
 Identities = 105/121 (86%)
 Strand = Plus / Minus

                                                                       
Query: 120 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 179
           |||| |||||||||| |||||||||||||| |||||||| |||||||| | ||| |||||
Sbjct: 456 ggtgtacttggtgacagccttggtgccctcagagacggcatgcttggccaactctccggg 397

                                                                       
Query: 180 gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgta 239
           ||||| ||| ||||| | |||||||||||| |||  | ||||||||| ||||||||||||
Sbjct: 396 gaggaggagacggacagcggtctggatctctcggctgctgatggtggacttcttgttgta 337

            
Query: 240 c 240
           |
Sbjct: 336 c 336



 Score = 50.1 bits (25), Expect = 0.005
 Identities = 57/68 (83%)
 Strand = Plus / Minus

                                                                       
Query: 283 tcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtccggntgc 342
           ||||||| ||||  ||||||||||||||||||||||  |||||| ||  |||| || || 
Sbjct: 293 tcgttgacgaagctgttcatgatggacatggccttgctggagataccagtgtcggggtgg 234

                   
Query: 343 acctgctt 350
           ||||||||
Sbjct: 233 acctgctt 226



to top

>ref|XM_786200.1| PREDICTED: Strongylocentrotus purpuratus similar to H2B histone
           family, member F (LOC586416), mRNA
          Length = 471

 Score =  111 bits (56), Expect = 2e-21
 Identities = 104/120 (86%)
 Strand = Plus / Minus

                                                                       
Query: 120 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 179
           |||| |||||||||| |||||||||||||| |||||||||||||||||||| || |||||
Sbjct: 363 ggtgtacttggtgacagccttggtgccctcagagacggcgtgcttggcgagttctccggg 304

                                                                       
Query: 180 gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgta 239
           ||||| ||| | ||| | |||||||| ||| |||  | ||||||||| ||||||||||||
Sbjct: 303 gaggaggagtctgacagcggtctggacctcacggctgctgatggtggacttcttgttgta 244



 Score = 42.1 bits (21), Expect = 1.2
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 274 tcgaagatgtcgttgatgaaggagttcatgatggacatggc 314
           |||||||  ||||||| ||||  ||||||||||||||||||
Sbjct: 209 tcgaagacatcgttgacgaagctgttcatgatggacatggc 169



to top

>ref|XM_786178.1| PREDICTED: Strongylocentrotus purpuratus similar to Histone H2B
           291B (LOC586394), mRNA
          Length = 375

 Score =  111 bits (56), Expect = 2e-21
 Identities = 104/120 (86%)
 Strand = Plus / Minus

                                                                       
Query: 120 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 179
           |||| |||||||||| |||||||||||||| |||||||||||||||||||| || |||||
Sbjct: 363 ggtgtacttggtgacagccttggtgccctcagagacggcgtgcttggcgagttctccggg 304

                                                                       
Query: 180 gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgta 239
           ||||| ||| | ||| | |||||||| ||| |||  | ||||||||| ||||||||||||
Sbjct: 303 gaggaggagtctgacagcggtctggacctcacggctgctgatggtggacttcttgttgta 244



 Score = 42.1 bits (21), Expect = 1.2
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 274 tcgaagatgtcgttgatgaaggagttcatgatggacatggc 314
           |||||||  ||||||| ||||  ||||||||||||||||||
Sbjct: 209 tcgaagacatcgttgacgaagctgttcatgatggacatggc 169



to top

>emb|X06643.1|SPH2BL4 Strongylocentrotus purpuratus late histone gene fragment L4 H2b
          Length = 627

 Score =  111 bits (56), Expect = 2e-21
 Identities = 104/120 (86%)
 Strand = Plus / Minus

                                                                       
Query: 120 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 179
           |||| |||||||||| |||||||||||||| |||||||||||||||||||| || |||||
Sbjct: 314 ggtgtacttggtgacagccttggtgccctcagagacggcgtgcttggcgagttctccggg 255

                                                                       
Query: 180 gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgta 239
           ||||| ||| | ||| | |||||||| ||| |||  | ||||||||| ||||||||||||
Sbjct: 254 gaggaggagcctgacagcggtctggacctcacggctgctgatggtggacttcttgttgta 195



 Score = 42.1 bits (21), Expect = 1.2
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 274 tcgaagatgtcgttgatgaaggagttcatgatggacatggc 314
           |||||||  ||||||| ||||  ||||||||||||||||||
Sbjct: 160 tcgaagacatcgttgacgaagctgttcatgatggacatggc 120



to top

>emb|X06640.1|SPH2BL1 Strongylocentrotus purpuratus late histone gene L1 H2b
          Length = 1497

 Score =  111 bits (56), Expect = 2e-21
 Identities = 104/120 (86%)
 Strand = Plus / Minus

                                                                        
Query: 120  ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 179
            |||| |||||||||| |||||||||||||| ||||||||||||||||| ||||| |||||
Sbjct: 1352 ggtgtacttggtgacagccttggtgccctcagagacggcgtgcttggccagctctccggg 1293

                                                                        
Query: 180  gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgta 239
            ||||| ||| | ||||  |||||||| ||| ||   ||||||||||| ||||||||||||
Sbjct: 1292 gaggaggagtctgacgacggtctggacctcacgactggtgatggtggacttcttgttgta 1233



to top

>ref|NM_214552.1| Strongylocentrotus purpuratus late histone L1 H2b (LOC373347), mRNA
          Length = 372

 Score =  111 bits (56), Expect = 2e-21
 Identities = 104/120 (86%)
 Strand = Plus / Minus

                                                                       
Query: 120 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 179
           |||| |||||||||| |||||||||||||| ||||||||||||||||| ||||| |||||
Sbjct: 360 ggtgtacttggtgacagccttggtgccctcagagacggcgtgcttggccagctctccggg 301

                                                                       
Query: 180 gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgta 239
           ||||| ||| | ||||  |||||||| ||| ||   ||||||||||| ||||||||||||
Sbjct: 300 gaggaggagtctgacgacggtctggacctcacgactggtgatggtggacttcttgttgta 241



to top

>gb|M14142.1|SUPH2B1 P.miliaris histone H2B-2.1 gene, complete cds
          Length = 375

 Score =  111 bits (56), Expect = 2e-21
 Identities = 104/120 (86%)
 Strand = Plus / Minus

                                                                       
Query: 120 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 179
           |||| ||||||||||||||||||||||||| |||||||||||||||||||| || |||||
Sbjct: 363 ggtgtacttggtgacggccttggtgccctcagagacggcgtgcttggcgagttcaccggg 304

                                                                       
Query: 180 gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgta 239
           |||||  || | ||| | |||||||| ||| |||  | ||||||||| ||||||||||||
Sbjct: 303 gaggagaagtctgacagcggtctggacctcacggctgctgatggtggacttcttgttgta 244



 Score = 52.0 bits (26), Expect = 0.001
 Identities = 64/77 (83%)
 Strand = Plus / Minus

                                                                       
Query: 274 tcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatg 333
           |||||||  ||||||| ||||  |||||||||||||||||| |||  |||||||||  ||
Sbjct: 209 tcgaagacatcgttgacgaagctgttcatgatggacatggctttgctggagatgccagtg 150

                            
Query: 334 tccggntgcacctgctt 350
           || || || ||||||||
Sbjct: 149 tcggggtggacctgctt 133



to top

>gb|BC077692.1| Xenopus tropicalis histone 1, H2bk, mRNA (cDNA clone MGC:89948
           IMAGE:7030528), complete cds
          Length = 540

 Score =  109 bits (55), Expect = 6e-21
 Identities = 94/107 (87%)
 Strand = Plus / Minus

                                                                       
Query: 120 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 179
           |||| ||||||| || ||||||||||||||||| |||||||||||||| ||||| || ||
Sbjct: 409 ggtgtacttggtaacagccttggtgccctcggacacggcgtgcttggccagctccccagg 350

                                                          
Query: 180 gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgg 226
            || |  |||||||| | |||||||||||||||||||||||||||||
Sbjct: 349 cagcagcaggcggaccgcggtctggatctcccgggaggtgatggtgg 303



 Score = 79.8 bits (40), Expect = 6e-12
 Identities = 68/78 (87%)
 Strand = Plus / Minus

                                                                       
Query: 283 tcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtccggntgc 342
           |||||||  |||||||||||||||  |||||||||||||||||||||| | || || |||
Sbjct: 246 tcgttgacaaaggagttcatgatgctcatggccttggaggagatgccggtatcggggtgc 187

                             
Query: 343 acctgcttgancaccttg 360
           |||||||| | |||||||
Sbjct: 186 acctgcttcagcaccttg 169



to top

>gb|BC107084.1| Homo sapiens histone 2, H2be, mRNA (cDNA clone MGC:129733
           IMAGE:40014260), complete cds
          Length = 459

 Score =  109 bits (55), Expect = 6e-21
 Identities = 94/107 (87%)
 Strand = Plus / Minus

                                                                       
Query: 120 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 179
           |||| |||||||||| ||||||||||||||||| |||||||||||||| |||||||||||
Sbjct: 370 ggtgtacttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccggg 311

                                                          
Query: 180 gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgg 226
            || |  ||||| ||||  ||||||||||| ||||| ||||||||||
Sbjct: 310 cagcagcaggcgcacggccgtctggatctcgcgggatgtgatggtgg 264



 Score = 97.6 bits (49), Expect = 2e-17
 Identities = 77/87 (88%)
 Strand = Plus / Minus

                                                                       
Query: 274 tcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatg 333
           |||||||||||||||| ||||||||||||||||  |||||||||||| ||||||||| ||
Sbjct: 216 tcgaagatgtcgttgacgaaggagttcatgatgcccatggccttggacgagatgccggtg 157

                                      
Query: 334 tccggntgcacctgcttgancaccttg 360
           || || || |||||||| | |||||||
Sbjct: 156 tcggggtggacctgcttcagcaccttg 130



to top

>gb|BC107085.1| Homo sapiens histone 2, H2be, mRNA (cDNA clone MGC:129734
           IMAGE:40014264), complete cds
          Length = 459

 Score =  109 bits (55), Expect = 6e-21
 Identities = 94/107 (87%)
 Strand = Plus / Minus

                                                                       
Query: 120 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 179
           |||| |||||||||| ||||||||||||||||| |||||||||||||| |||||||||||
Sbjct: 370 ggtgtacttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccggg 311

                                                          
Query: 180 gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgg 226
            || |  ||||| ||||  ||||||||||| ||||| ||||||||||
Sbjct: 310 cagcagcaggcgcacggccgtctggatctcgcgggatgtgatggtgg 264



 Score = 97.6 bits (49), Expect = 2e-17
 Identities = 77/87 (88%)
 Strand = Plus / Minus

                                                                       
Query: 274 tcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatg 333
           |||||||||||||||| ||||||||||||||||  |||||||||||| ||||||||| ||
Sbjct: 216 tcgaagatgtcgttgacgaaggagttcatgatgcccatggccttggacgagatgccggtg 157

                                      
Query: 334 tccggntgcacctgcttgancaccttg 360
           || || || |||||||| | |||||||
Sbjct: 156 tcggggtggacctgcttcagcaccttg 130



to top

>gb|BC069193.1| Homo sapiens histone 2, H2be, mRNA (cDNA clone MGC:78419
           IMAGE:3936695), complete cds
          Length = 2224

 Score =  109 bits (55), Expect = 6e-21
 Identities = 94/107 (87%)
 Strand = Plus / Minus

                                                                       
Query: 120 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 179
           |||| |||||||||| ||||||||||||||||| |||||||||||||| |||||||||||
Sbjct: 393 ggtgtacttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccggg 334

                                                          
Query: 180 gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgg 226
            || |  ||||| ||||  ||||||||||| ||||| ||||||||||
Sbjct: 333 cagcagcaggcgcacggccgtctggatctcgcgggatgtgatggtgg 287



 Score = 97.6 bits (49), Expect = 2e-17
 Identities = 77/87 (88%)
 Strand = Plus / Minus

                                                                       
Query: 274 tcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatg 333
           |||||||||||||||| ||||||||||||||||  |||||||||||| ||||||||| ||
Sbjct: 239 tcgaagatgtcgttgacgaaggagttcatgatgcccatggccttggacgagatgccggtg 180

                                      
Query: 334 tccggntgcacctgcttgancaccttg 360
           || || || |||||||| | |||||||
Sbjct: 179 tcggggtggacctgcttcagcaccttg 153



to top

>gb|BC005827.2| Homo sapiens histone 2, H2be, mRNA (cDNA clone IMAGE:2989788), with
           apparent retained intron
          Length = 2210

 Score =  109 bits (55), Expect = 6e-21
 Identities = 94/107 (87%)
 Strand = Plus / Minus

                                                                       
Query: 120 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 179
           |||| |||||||||| ||||||||||||||||| |||||||||||||| |||||||||||
Sbjct: 381 ggtgtacttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccggg 322

                                                          
Query: 180 gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgg 226
            || |  ||||| ||||  ||||||||||| ||||| ||||||||||
Sbjct: 321 cagcagcaggcgcacggccgtctggatctcgcgggatgtgatggtgg 275



 Score = 97.6 bits (49), Expect = 2e-17
 Identities = 77/87 (88%)
 Strand = Plus / Minus

                                                                       
Query: 274 tcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatg 333
           |||||||||||||||| ||||||||||||||||  |||||||||||| ||||||||| ||
Sbjct: 227 tcgaagatgtcgttgacgaaggagttcatgatgcccatggccttggacgagatgccggtg 168

                                      
Query: 334 tccggntgcacctgcttgancaccttg 360
           || || || |||||||| | |||||||
Sbjct: 167 tcggggtggacctgcttcagcaccttg 141



to top

>ref|NM_003528.2| Homo sapiens histone 2, H2be (HIST2H2BE), mRNA
          Length = 2223

 Score =  109 bits (55), Expect = 6e-21
 Identities = 94/107 (87%)
 Strand = Plus / Minus

                                                                       
Query: 120 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 179
           |||| |||||||||| ||||||||||||||||| |||||||||||||| |||||||||||
Sbjct: 411 ggtgtacttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccggg 352

                                                          
Query: 180 gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgg 226
            || |  ||||| ||||  ||||||||||| ||||| ||||||||||
Sbjct: 351 cagcagcaggcgcacggccgtctggatctcgcgggatgtgatggtgg 305



 Score = 97.6 bits (49), Expect = 2e-17
 Identities = 77/87 (88%)
 Strand = Plus / Minus

                                                                       
Query: 274 tcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatg 333
           |||||||||||||||| ||||||||||||||||  |||||||||||| ||||||||| ||
Sbjct: 257 tcgaagatgtcgttgacgaaggagttcatgatgcccatggccttggacgagatgccggtg 198

                                      
Query: 334 tccggntgcacctgcttgancaccttg 360
           || || || |||||||| | |||||||
Sbjct: 197 tcggggtggacctgcttcagcaccttg 171



to top

>emb|AL591493.14| Human DNA sequence from clone RP11-196G18 on chromosome 1 Contains a
              ubiquitin-conjugating enzyme E2D 1 (UBC4/5 homolog, yeast)
              (UBE2D1) pseudogene, the FCGR1A gene for Fc fragment of
              IgG, high affinity Ia, receptor for (CD64), a novel gene
              similar to histone 2, H2be (HIST2H2BE), a novel gene
              similar to histone 2, H3c (HIST2H3C), the HIST2H4 gene for
              histone 2, H4, the HIST2H3C gene for histone 2, H3c, the
              HIST2H2AA gene for histone 2, H2aa, a histone 2, H2bd
              pseudogene (HIST2H2BD), a histone 2, H2bc pseudogene
              (HIST2H2BC), a novel gene similar to histone 2, H2aa
              (HIST2H2AA), a novel gene similar to histone 2, H3c
              (HIST2H3C), a novel gene similar to histone 1, H4
              (HIST2H4), the HIST2H2BE gene for histone 2, H2be, the
              HIST2H2AC gene for histone 2, H2ac, the HIST2H2AB gene for
              histone 2, H2ab, a novel protein similar to histone 2, a
              novel gene, the SV2A gene for synaptic vesicle glycoprotein
              2A, the 3' end of the SF3B4 gene for splicing factor 3b,
              subunit 4, 49kDa and five CpG islands, complete sequence
          Length = 188956

 Score =  109 bits (55), Expect = 6e-21
 Identities = 94/107 (87%)
 Strand = Plus / Plus

                                                                          
Query: 120    ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 179
              |||| |||||||||| ||||||||||||||||| |||||||||||||| |||||||||||
Sbjct: 147982 ggtgtacttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccggg 148041

                                                             
Query: 180    gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgg 226
               || |  ||||| ||||  ||||||||||| ||||| ||||||||||
Sbjct: 148042 cagcagcaggcgcacggccgtctggatctcgcgggatgtgatggtgg 148088



 Score =  109 bits (55), Expect = 6e-21
 Identities = 94/107 (87%)
 Strand = Plus / Plus

                                                                         
Query: 120   ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 179
             |||| |||||||||| ||||||||||||||||| |||||||||||||| |||||||||||
Sbjct: 73670 ggtgtacttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccggg 73729

                                                            
Query: 180   gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgg 226
              || |  ||||| ||||  ||||||||||| ||||| ||||||||||
Sbjct: 73730 cagcagcaggcgcacggccgtctggatctcgcgggatgtgatggtgg 73776



 Score = 99.6 bits (50), Expect = 6e-18
 Identities = 90/102 (88%), Gaps = 1/102 (0%)
 Strand = Plus / Plus

                                                                          
Query: 125    acttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggagga 184
              |||||||||| ||||||||||||||||| |||||||||||||| ||||||||||| || |
Sbjct: 112138 acttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccgggcagca 112197

                                                        
Query: 185    cgaggcggacggaggtctggatctcccgggaggtgatggtgg 226
                ||||| ||||  |||||||||| |||||| ||||||||||
Sbjct: 112198 gcaggcgcacggccgtctggatct-ccgggacgtgatggtgg 112238



 Score = 99.6 bits (50), Expect = 6e-18
 Identities = 90/102 (88%), Gaps = 1/102 (0%)
 Strand = Plus / Minus

                                                                          
Query: 125    acttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggagga 184
              |||||||||| ||||||||||||||||| |||||||||||||| ||||||||||| || |
Sbjct: 105128 acttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccgggcagca 105069

                                                        
Query: 185    cgaggcggacggaggtctggatctcccgggaggtgatggtgg 226
                ||||| ||||  |||||||||| |||||| ||||||||||
Sbjct: 105068 gcaggcgcacggccgtctggatct-ccgggacgtgatggtgg 105028



 Score = 97.6 bits (49), Expect = 2e-17
 Identities = 77/87 (88%)
 Strand = Plus / Plus

                                                                          
Query: 274    tcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatg 333
              |||||||||||||||| ||||||||||||||||  |||||||||||| ||||||||| ||
Sbjct: 148136 tcgaagatgtcgttgacgaaggagttcatgatgcccatggccttggacgagatgccggtg 148195

                                         
Query: 334    tccggntgcacctgcttgancaccttg 360
              || || || |||||||| | |||||||
Sbjct: 148196 tcggggtggacctgcttcagcaccttg 148222



 Score = 97.6 bits (49), Expect = 2e-17
 Identities = 77/87 (88%)
 Strand = Plus / Plus

                                                                         
Query: 274   tcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatg 333
             |||||||||||||||| ||||||||||||||||  |||||||||||| ||||||||| ||
Sbjct: 73824 tcgaagatgtcgttgacgaaggagttcatgatgcccatggccttggacgagatgccggtg 73883

                                        
Query: 334   tccggntgcacctgcttgancaccttg 360
             || || || |||||||| | |||||||
Sbjct: 73884 tcggggtggacctgcttcagcaccttg 73910



 Score = 73.8 bits (37), Expect = 3e-10
 Identities = 74/87 (85%)
 Strand = Plus / Plus

                                                                          
Query: 274    tcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatg 333
              |||||||||||||||| ||||||||||||||||  |||||||||| |  |||||||| ||
Sbjct: 112286 tcgaagatgtcgttgaggaaggagttcatgatgcccatggccttgcaccagatgccggtg 112345

                                         
Query: 334    tccggntgcacctgcttgancaccttg 360
              || || || ||| |||| | |||||||
Sbjct: 112346 tcggggtggacccgcttcagcaccttg 112372



 Score = 73.8 bits (37), Expect = 3e-10
 Identities = 74/87 (85%)
 Strand = Plus / Minus

                                                                          
Query: 274    tcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatg 333
              |||||||||||||||| ||||||||||||||||  |||||||||| |  |||||||| ||
Sbjct: 104980 tcgaagatgtcgttgaggaaggagttcatgatgcccatggccttgcaccagatgccggtg 104921

                                         
Query: 334    tccggntgcacctgcttgancaccttg 360
              || || || ||| |||| | |||||||
Sbjct: 104920 tcggggtggacccgcttcagcaccttg 104894



to top

>emb|AL357493.8| Human DNA sequence from clone RP11-439A17 on chromosome 1 Contains four
              novel genes, a novel gene (MGC57827), a ribosomal protein
              L22 (RPL22) pseudogene, a histone 2 H3c (HIST2H3C)
              pseudogene, the HIST2H2BB gene for histone 2 H2bb, the
              FCGR1B gene for Fc fragment of IgG high affinity Ib
              receptor for (CD64) and three CpG islands, complete
              sequence
          Length = 189539

 Score =  109 bits (55), Expect = 6e-21
 Identities = 94/107 (87%)
 Strand = Plus / Minus

                                                                          
Query: 120    ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 179
              |||| |||||||||| ||||||||||||||||| |||||||||||||| |||||||||||
Sbjct: 159255 ggtgtacttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccggg 159196

                                                             
Query: 180    gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgg 226
               || |  ||||| ||||  ||||||||||| ||||| ||||||||||
Sbjct: 159195 cagcagcaggcgcacggccgtctggatctcacgggatgtgatggtgg 159149



 Score = 93.7 bits (47), Expect = 4e-16
 Identities = 75/85 (88%)
 Strand = Plus / Minus

                                                                          
Query: 274    tcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatg 333
              |||||||||||||||| ||||||||||||||||  |||||||||||| ||||||||| ||
Sbjct: 159101 tcgaagatgtcgttgacgaaggagttcatgatgcccatggccttggacgagatgccggtg 159042

                                       
Query: 334    tccggntgcacctgcttgancacct 358
              || || || |||||||| | |||||
Sbjct: 159041 tcggggtggacctgcttcagcacct 159017



to top

>emb|AL109948.9|HSJ998N21 Human DNA sequence from clone RP5-998N21 on chromosome 1 Contains a
             ubiquitin-conjugating enzyme HBUCE1 pseudogene, the FCGR1C
             gene for Fc fragment of IgG high affinity Ic receptor for
             (CD64), two novel genes, the HIST2H2BA gene for histone 2
             H2ba, the gene for a novel protein similar to histone 2
             H3c (HIST2H3C), a novel gene, a ribosomal protein L22
             (RPL22) pseudogene, a novel gene and three CpG islands,
             complete sequence
          Length = 129426

 Score =  109 bits (55), Expect = 6e-21
 Identities = 94/107 (87%)
 Strand = Plus / Plus

                                                                         
Query: 120   ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 179
             |||| |||||||||| ||||||||||||||||| |||||||||||||| |||||||||||
Sbjct: 68592 ggtgtacttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccggg 68651

                                                            
Query: 180   gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgg 226
              || |  ||||| ||||  ||||||||||| ||||| ||||||||||
Sbjct: 68652 cagcagcaggcgcacggccgtctggatctcgcgggacgtgatggtgg 68698



 Score = 85.7 bits (43), Expect = 9e-14
 Identities = 74/85 (87%)
 Strand = Plus / Plus

                                                                         
Query: 274   tcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatg 333
             |||||||||||||||| ||||||||||||||||  ||||| |||||| ||||||||| ||
Sbjct: 68746 tcgaagatgtcgttgacgaaggagttcatgatgcccatggtcttggacgagatgccggtg 68805

                                      
Query: 334   tccggntgcacctgcttgancacct 358
             || || || |||||||| | |||||
Sbjct: 68806 tcggggtggacctgcttcagcacct 68830



to top

>emb|BX072512.1|CNS09S44 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAD1BH03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 621

 Score =  109 bits (55), Expect = 6e-21
 Identities = 94/107 (87%)
 Strand = Plus / Minus

                                                                       
Query: 120 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 179
           |||| |||||||||||||||||||||||||||| |||||||||||||| |||||||||||
Sbjct: 466 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctcgccggg 407

                                                          
Query: 180 gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgg 226
           ||| |  || || || |  ||||||||||| ||||| ||||||||||
Sbjct: 406 gagcaacagtcgcaccgccgtctggatctcgcgggacgtgatggtgg 360



 Score = 81.8 bits (41), Expect = 1e-12
 Identities = 75/87 (86%)
 Strand = Plus / Minus

                                                                       
Query: 274 tcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatg 333
           |||||||||||||| | ||||  ||||||||||  ||| ||||||||||| |||||| ||
Sbjct: 312 tcgaagatgtcgttcacgaagctgttcatgatgctcatcgccttggaggaaatgccggtg 253

                                      
Query: 334 tccggntgcacctgcttgancaccttg 360
           ||||| ||||||||||| | |||||||
Sbjct: 252 tccgggtgcacctgcttcagcaccttg 226



to top

>emb|BX072414.1|CNS09S1E Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAD1BC10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 718

 Score =  109 bits (55), Expect = 6e-21
 Identities = 94/107 (87%)
 Strand = Plus / Plus

                                                                       
Query: 120 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 179
           |||| |||||||||||||||||||||||||||| |||||||||||||| |||||||||||
Sbjct: 267 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctcgccggg 326

                                                          
Query: 180 gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgg 226
           ||| |  || || || |  ||||||||||| ||||| ||||||||||
Sbjct: 327 gagcaacagtcgcaccgccgtctggatctcgcgggacgtgatggtgg 373



 Score = 81.8 bits (41), Expect = 1e-12
 Identities = 75/87 (86%)
 Strand = Plus / Plus

                                                                       
Query: 274 tcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatg 333
           |||||||||||||| | ||||  ||||||||||  ||| ||||||||||| |||||| ||
Sbjct: 421 tcgaagatgtcgttcacgaagctgttcatgatgctcatcgccttggaggaaatgccggtg 480

                                      
Query: 334 tccggntgcacctgcttgancaccttg 360
           ||||| ||||||||||| | |||||||
Sbjct: 481 tccgggtgcacctgcttcagcaccttg 507



to top

>emb|BX051496.1|CNS09BWC Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC28DD12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 767

 Score =  109 bits (55), Expect = 6e-21
 Identities = 94/107 (87%)
 Strand = Plus / Plus

                                                                       
Query: 120 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 179
           |||| |||||||||||||||||||||||||||| |||||||||||||| |||||||||||
Sbjct: 247 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctcgccggg 306

                                                          
Query: 180 gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgg 226
           ||| |  || || || |  ||||||||||| ||||| ||||||||||
Sbjct: 307 gagcaacagtcgcaccgccgtctggatctcgcgggacgtgatggtgg 353



 Score = 81.8 bits (41), Expect = 1e-12
 Identities = 75/87 (86%)
 Strand = Plus / Plus

                                                                       
Query: 274 tcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatg 333
           |||||||||||||| | ||||  ||||||||||  ||| ||||||||||| |||||| ||
Sbjct: 401 tcgaagatgtcgttcacgaagctgttcatgatgctcatcgccttggaggaaatgccggtg 460

                                      
Query: 334 tccggntgcacctgcttgancaccttg 360
           ||||| ||||||||||| | |||||||
Sbjct: 461 tccgggtgcacctgcttcagcaccttg 487



to top

>emb|BX051495.1|CNS09BWB Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC28DD12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 758

 Score =  109 bits (55), Expect = 6e-21
 Identities = 94/107 (87%)
 Strand = Plus / Minus

                                                                       
Query: 120 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 179
           |||| |||||||||||||||||||||||||||| |||||||||||||| |||||||||||
Sbjct: 463 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctcgccggg 404

                                                          
Query: 180 gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgg 226
           ||| |  || || || |  ||||||||||| ||||| ||||||||||
Sbjct: 403 gagcaacagtcgcaccgccgtctggatctcgcgggacgtgatggtgg 357



 Score = 81.8 bits (41), Expect = 1e-12
 Identities = 75/87 (86%)
 Strand = Plus / Minus

                                                                       
Query: 274 tcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatg 333
           |||||||||||||| | ||||  ||||||||||  ||| ||||||||||| |||||| ||
Sbjct: 309 tcgaagatgtcgttcacgaagctgttcatgatgctcatcgccttggaggaaatgccggtg 250

                                      
Query: 334 tccggntgcacctgcttgancaccttg 360
           ||||| ||||||||||| | |||||||
Sbjct: 249 tccgggtgcacctgcttcagcaccttg 223



to top

>emb|BX047440.1|CNS098RO Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC21CG06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 735

 Score =  109 bits (55), Expect = 6e-21
 Identities = 94/107 (87%)
 Strand = Plus / Minus

                                                                       
Query: 120 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 179
           |||| |||||||||||||||||||||||||||| |||||||||||||| |||||||||||
Sbjct: 444 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctcgccggg 385

                                                          
Query: 180 gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgg 226
           ||| |  || || || |  ||||||||||| ||||| ||||||||||
Sbjct: 384 gagcaacagtcgcaccgccgtctggatctcgcgggacgtgatggtgg 338



 Score = 81.8 bits (41), Expect = 1e-12
 Identities = 75/87 (86%)
 Strand = Plus / Minus

                                                                       
Query: 274 tcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatg 333
           |||||||||||||| | ||||  ||||||||||  ||| ||||||||||| |||||| ||
Sbjct: 290 tcgaagatgtcgttcacgaagctgttcatgatgctcatcgccttggaggaaatgccggtg 231

                                      
Query: 334 tccggntgcacctgcttgancaccttg 360
           ||||| ||||||||||| | |||||||
Sbjct: 230 tccgggtgcacctgcttcagcaccttg 204



to top

>emb|BX038423.1|CNS091T7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAB2DC11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 721

 Score =  109 bits (55), Expect = 6e-21
 Identities = 94/107 (87%)
 Strand = Plus / Minus

                                                                       
Query: 120 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 179
           |||| |||||||||||||||||||||||||||| |||||||||||||| |||||||||||
Sbjct: 478 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctcgccggg 419

                                                          
Query: 180 gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgg 226
           ||| |  || || || |  ||||||||||| ||||| ||||||||||
Sbjct: 418 gagcaacagtcgcaccgccgtctggatctcgcgggacgtgatggtgg 372



 Score = 81.8 bits (41), Expect = 1e-12
 Identities = 75/87 (86%)
 Strand = Plus / Minus

                                                                       
Query: 274 tcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatg 333
           |||||||||||||| | ||||  ||||||||||  ||| ||||||||||| |||||| ||
Sbjct: 324 tcgaagatgtcgttcacgaagctgttcatgatgctcatcgccttggaggaaatgccggtg 265

                                      
Query: 334 tccggntgcacctgcttgancaccttg 360
           ||||| ||||||||||| | |||||||
Sbjct: 264 tccgggtgcacctgcttcagcaccttg 238



to top

>emb|BX032827.1|CNS08XHR Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA48DH07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 670

 Score =  109 bits (55), Expect = 6e-21
 Identities = 94/107 (87%)
 Strand = Plus / Minus

                                                                       
Query: 120 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 179
           |||| |||||||||||||||||||||||||||| |||||||||||||| |||||||||||
Sbjct: 461 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctcgccggg 402

                                                          
Query: 180 gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgg 226
           ||| |  || || || |  ||||||||||| ||||| ||||||||||
Sbjct: 401 gagcaacagtcgcaccgccgtctggatctcgcgggacgtgatggtgg 355



 Score = 81.8 bits (41), Expect = 1e-12
 Identities = 75/87 (86%)
 Strand = Plus / Minus

                                                                       
Query: 274 tcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatg 333
           |||||||||||||| | ||||  ||||||||||  ||| ||||||||||| |||||| ||
Sbjct: 307 tcgaagatgtcgttcacgaagctgttcatgatgctcatcgccttggaggaaatgccggtg 248

                                      
Query: 334 tccggntgcacctgcttgancaccttg 360
           ||||| ||||||||||| | |||||||
Sbjct: 247 tccgggtgcacctgcttcagcaccttg 221



to top

>emb|BX031663.1|CNS08WLF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA47AG09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 770

 Score =  109 bits (55), Expect = 6e-21
 Identities = 94/107 (87%)
 Strand = Plus / Plus

                                                                       
Query: 120 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 179
           |||| |||||||||||||||||||||||||||| |||||||||||||| |||||||||||
Sbjct: 236 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctcgccggg 295

                                                          
Query: 180 gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgg 226
           ||| |  || || || |  ||||||||||| ||||| ||||||||||
Sbjct: 296 gagcaacagtcgcaccgccgtctggatctcgcgggacgtgatggtgg 342



 Score = 81.8 bits (41), Expect = 1e-12
 Identities = 75/87 (86%)
 Strand = Plus / Plus

                                                                       
Query: 274 tcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatg 333
           |||||||||||||| | ||||  ||||||||||  ||| ||||||||||| |||||| ||
Sbjct: 390 tcgaagatgtcgttcacgaagctgttcatgatgctcatcgccttggaggaaatgccggtg 449

                                      
Query: 334 tccggntgcacctgcttgancaccttg 360
           ||||| ||||||||||| | |||||||
Sbjct: 450 tccgggtgcacctgcttcagcaccttg 476



to top

>emb|BX021771.1|CNS08OYN Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA32BB12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 544

 Score =  109 bits (55), Expect = 6e-21
 Identities = 94/107 (87%)
 Strand = Plus / Plus

                                                                       
Query: 120 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 179
           |||| |||||||||||||||||||||||||||| |||||||||||||| |||||||||||
Sbjct: 245 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctcgccggg 304

                                                          
Query: 180 gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgg 226
           ||| |  || || || |  ||||||||||| ||||| ||||||||||
Sbjct: 305 gagcaacagtcgcaccgccgtctggatctcgcgggacgtgatggtgg 351



 Score = 73.8 bits (37), Expect = 3e-10
 Identities = 74/87 (85%)
 Strand = Plus / Plus

                                                                       
Query: 274 tcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatg 333
           |||||||||| ||| | ||||  ||||||||||  ||| ||||||||||| |||||| ||
Sbjct: 399 tcgaagatgttgttcacgaagctgttcatgatgctcatcgccttggaggaaatgccggtg 458

                                      
Query: 334 tccggntgcacctgcttgancaccttg 360
           ||||| ||||||||||| | |||||||
Sbjct: 459 tccgggtgcacctgcttcagcaccttg 485



to top

>emb|BX013307.1|CNS08IFJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA20AB09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 758

 Score =  109 bits (55), Expect = 6e-21
 Identities = 94/107 (87%)
 Strand = Plus / Minus

                                                                       
Query: 120 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 179
           |||| |||||||||||||||||||||||||||| |||||||||||||| |||||||||||
Sbjct: 452 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctcgccggg 393

                                                          
Query: 180 gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgg 226
           ||| |  || || || |  ||||||||||| ||||| ||||||||||
Sbjct: 392 gagcaacagtcgcaccgccgtctggatctcgcgggacgtgatggtgg 346



 Score = 81.8 bits (41), Expect = 1e-12
 Identities = 75/87 (86%)
 Strand = Plus / Minus

                                                                       
Query: 274 tcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatg 333
           |||||||||||||| | ||||  ||||||||||  ||| ||||||||||| |||||| ||
Sbjct: 298 tcgaagatgtcgttcacgaagctgttcatgatgctcatcgccttggaggaaatgccggtg 239

                                      
Query: 334 tccggntgcacctgcttgancaccttg 360
           ||||| ||||||||||| | |||||||
Sbjct: 238 tccgggtgcacctgcttcagcaccttg 212



to top

>emb|BX012776.1|CNS08I0S Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA2AH06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 780

 Score =  109 bits (55), Expect = 6e-21
 Identities = 94/107 (87%)
 Strand = Plus / Minus

                                                                       
Query: 120 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 179
           |||| |||||||||||||||||||||||||||| |||||||||||||| |||||||||||
Sbjct: 470 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctcgccggg 411

                                                          
Query: 180 gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgg 226
           ||| |  || || || |  ||||||||||| ||||| ||||||||||
Sbjct: 410 gagcaacagtcgcaccgccgtctggatctcgcgggacgtgatggtgg 364



 Score = 81.8 bits (41), Expect = 1e-12
 Identities = 75/87 (86%)
 Strand = Plus / Minus

                                                                       
Query: 274 tcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatg 333
           |||||||||||||| | ||||  ||||||||||  ||| ||||||||||| |||||| ||
Sbjct: 316 tcgaagatgtcgttcacgaagctgttcatgatgctcatcgccttggaggaaatgccggtg 257

                                      
Query: 334 tccggntgcacctgcttgancaccttg 360
           ||||| ||||||||||| | |||||||
Sbjct: 256 tccgggtgcacctgcttcagcaccttg 230



to top

>emb|BX012380.1|CNS08HPS Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA19CF11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 758

 Score =  109 bits (55), Expect = 6e-21
 Identities = 94/107 (87%)
 Strand = Plus / Plus

                                                                       
Query: 120 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 179
           |||| |||||||||||||||||||||||||||| |||||||||||||| |||||||||||
Sbjct: 248 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctcgccggg 307

                                                          
Query: 180 gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgg 226
           ||| |  || || || |  ||||||||||| ||||| ||||||||||
Sbjct: 308 gagcaacagtcgcaccgccgtctggatctcgcgggacgtgatggtgg 354



 Score = 73.8 bits (37), Expect = 3e-10
 Identities = 74/87 (85%)
 Strand = Plus / Plus

                                                                       
Query: 274 tcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatg 333
           |||||||||||||| | ||||  || |||||||  ||| ||||||||||| |||||| ||
Sbjct: 402 tcgaagatgtcgttcacgaagctgtacatgatgctcatcgccttggaggaaatgccggtg 461

                                      
Query: 334 tccggntgcacctgcttgancaccttg 360
           ||||| ||||||||||| | |||||||
Sbjct: 462 tccgggtgcacctgcttcagcaccttg 488



to top

>emb|BX009211.1|CNS08F9R Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA15AA01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 750

 Score =  109 bits (55), Expect = 6e-21
 Identities = 94/107 (87%)
 Strand = Plus / Minus

                                                                       
Query: 120 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 179
           |||| |||||||||||||||||||||||||||| |||||||||||||| |||||||||||
Sbjct: 452 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctcgccggg 393

                                                          
Query: 180 gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgg 226
           ||| |  || || || |  ||||||||||| ||||| ||||||||||
Sbjct: 392 gagcaacagtcgcaccgccgtctggatctcgcgggacgtgatggtgg 346



 Score = 81.8 bits (41), Expect = 1e-12
 Identities = 75/87 (86%)
 Strand = Plus / Minus

                                                                       
Query: 274 tcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatg 333
           |||||||||||||| | ||||  ||||||||||  ||| ||||||||||| |||||| ||
Sbjct: 298 tcgaagatgtcgttcacgaagctgttcatgatgctcatcgccttggaggaaatgccggtg 239

                                      
Query: 334 tccggntgcacctgcttgancaccttg 360
           ||||| ||||||||||| | |||||||
Sbjct: 238 tccgggtgcacctgcttcagcaccttg 212



to top

>emb|X98185.1|AGH2B A.gambiae mRNA for histone H2B
          Length = 698

 Score =  109 bits (55), Expect = 6e-21
 Identities = 94/107 (87%)
 Strand = Plus / Minus

                                                                       
Query: 120 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 179
           |||| |||||||||||||||||||||||||||| |||||||||||||| |||||||||||
Sbjct: 423 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctcgccggg 364

                                                          
Query: 180 gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgg 226
           ||| |  || || || |  ||||||||||| ||||| ||||||||||
Sbjct: 363 gagcaacagtcgcaccgccgtctggatctcgcgggacgtgatggtgg 317



 Score = 81.8 bits (41), Expect = 1e-12
 Identities = 75/87 (86%)
 Strand = Plus / Minus

                                                                       
Query: 274 tcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatg 333
           |||||||||||||| | ||||  ||||||||||  ||| ||||||||||| |||||| ||
Sbjct: 272 tcgaagatgtcgttcacgaagctgttcatgatgctcatcgccttggaggaaatgccggtg 213

                                      
Query: 334 tccggntgcacctgcttgancaccttg 360
           ||||| ||||||||||| | |||||||
Sbjct: 212 tccgggtgcacctgcttcagcaccttg 186



to top

>emb|X57985.1|HSHIST H.sapiens genes for histones H2B.1 and H2A
          Length = 2964

 Score =  109 bits (55), Expect = 6e-21
 Identities = 94/107 (87%)
 Strand = Plus / Minus

                                                                       
Query: 120 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 179
           |||| |||||||||| ||||||||||||||||| |||||||||||||| |||||||||||
Sbjct: 869 ggtgtacttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccggg 810

                                                          
Query: 180 gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgg 226
            || |  ||||| ||||  ||||||||||| ||||| ||||||||||
Sbjct: 809 cagcagcaggcgcacggccgtctggatctcgcgggatgtgatggtgg 763



 Score = 97.6 bits (49), Expect = 2e-17
 Identities = 77/87 (88%)
 Strand = Plus / Minus

                                                                       
Query: 274 tcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatg 333
           |||||||||||||||| ||||||||||||||||  |||||||||||| ||||||||| ||
Sbjct: 715 tcgaagatgtcgttgacgaaggagttcatgatgcccatggccttggacgagatgccggtg 656

                                      
Query: 334 tccggntgcacctgcttgancaccttg 360
           || || || |||||||| | |||||||
Sbjct: 655 tcggggtggacctgcttcagcaccttg 629



to top

>emb|CR541895.1| Homo sapiens full open reading frame cDNA clone RZPDo834A0933D for
           gene HIST2H2BE, histone 2, H2be; complete cds, incl.
           stopcodon
          Length = 381

 Score =  109 bits (55), Expect = 6e-21
 Identities = 94/107 (87%)
 Strand = Plus / Minus

                                                                       
Query: 120 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 179
           |||| |||||||||| ||||||||||||||||| |||||||||||||| |||||||||||
Sbjct: 369 ggtgtacttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccggg 310

                                                          
Query: 180 gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgg 226
            || |  ||||| ||||  ||||||||||| ||||| ||||||||||
Sbjct: 309 cagcagcaggcgcacggccgtctggatctcgcgggatgtgatggtgg 263



 Score = 97.6 bits (49), Expect = 2e-17
 Identities = 77/87 (88%)
 Strand = Plus / Minus

                                                                       
Query: 274 tcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatg 333
           |||||||||||||||| ||||||||||||||||  |||||||||||| ||||||||| ||
Sbjct: 215 tcgaagatgtcgttgacgaaggagttcatgatgcccatggccttggacgagatgccggtg 156

                                      
Query: 334 tccggntgcacctgcttgancaccttg 360
           || || || |||||||| | |||||||
Sbjct: 155 tcggggtggacctgcttcagcaccttg 129



to top

>ref|NM_001006890.1| Xenopus tropicalis histone 1, H2bk (hist1h2bk), mRNA
          Length = 540

 Score =  109 bits (55), Expect = 6e-21
 Identities = 94/107 (87%)
 Strand = Plus / Minus

                                                                       
Query: 120 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 179
           |||| ||||||| || ||||||||||||||||| |||||||||||||| ||||| || ||
Sbjct: 409 ggtgtacttggtaacagccttggtgccctcggacacggcgtgcttggccagctccccagg 350

                                                          
Query: 180 gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgg 226
            || |  |||||||| | |||||||||||||||||||||||||||||
Sbjct: 349 cagcagcaggcggaccgcggtctggatctcccgggaggtgatggtgg 303



 Score = 79.8 bits (40), Expect = 6e-12
 Identities = 68/78 (87%)
 Strand = Plus / Minus

                                                                       
Query: 283 tcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtccggntgc 342
           |||||||  |||||||||||||||  |||||||||||||||||||||| | || || |||
Sbjct: 246 tcgttgacaaaggagttcatgatgctcatggccttggaggagatgccggtatcggggtgc 187

                             
Query: 343 acctgcttgancaccttg 360
           |||||||| | |||||||
Sbjct: 186 acctgcttcagcaccttg 169



to top

>gb|BC096121.1| Homo sapiens histone 2, H2be, mRNA (cDNA clone MGC:116767
           IMAGE:40002353), complete cds
          Length = 430

 Score =  109 bits (55), Expect = 6e-21
 Identities = 94/107 (87%)
 Strand = Plus / Minus

                                                                       
Query: 120 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 179
           |||| |||||||||| ||||||||||||||||| |||||||||||||| |||||||||||
Sbjct: 369 ggtgtacttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccggg 310

                                                          
Query: 180 gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgg 226
            || |  ||||| ||||  ||||||||||| ||||| ||||||||||
Sbjct: 309 cagcagcaggcgcacggccgtctggatctcgcgggatgtgatggtgg 263



 Score = 97.6 bits (49), Expect = 2e-17
 Identities = 77/87 (88%)
 Strand = Plus / Minus

                                                                       
Query: 274 tcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatg 333
           |||||||||||||||| ||||||||||||||||  |||||||||||| ||||||||| ||
Sbjct: 215 tcgaagatgtcgttgacgaaggagttcatgatgcccatggccttggacgagatgccggtg 156

                                      
Query: 334 tccggntgcacctgcttgancaccttg 360
           || || || |||||||| | |||||||
Sbjct: 155 tcggggtggacctgcttcagcaccttg 129



to top

>emb|CR858221.1| Pongo pygmaeus mRNA; cDNA DKFZp469C0528 (from clone DKFZp469C0528)
          Length = 2237

 Score =  109 bits (55), Expect = 6e-21
 Identities = 94/107 (87%)
 Strand = Plus / Minus

                                                                       
Query: 120 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 179
           |||| |||||||||| ||||||||||||||||| |||||||||||||| |||||||||||
Sbjct: 411 ggtgtacttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccggg 352

                                                          
Query: 180 gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgg 226
            || |  ||||| ||||  ||||||||||| ||||| ||||||||||
Sbjct: 351 cagcagcaggcgcacggccgtctggatctcgcgggatgtgatggtgg 305



 Score = 97.6 bits (49), Expect = 2e-17
 Identities = 77/87 (88%)
 Strand = Plus / Minus

                                                                       
Query: 274 tcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatg 333
           |||||||||||||||| ||||||||||||||||  |||||||||||| ||||||||| ||
Sbjct: 257 tcgaagatgtcgttgacgaaggagttcatgatgcccatggccttggacgagatgccggtg 198

                                      
Query: 334 tccggntgcacctgcttgancaccttg 360
           || || || |||||||| | |||||||
Sbjct: 197 tcggggtggacctgcttcagcaccttg 171



to top

>ref|NG_002621.1| Homo sapiens histone 2, H2ba (HIST2H2BA) pseudogene on chromosome 1
          Length = 1137

 Score =  109 bits (55), Expect = 6e-21
 Identities = 94/107 (87%)
 Strand = Plus / Minus

                                                                       
Query: 120 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 179
           |||| |||||||||| ||||||||||||||||| |||||||||||||| |||||||||||
Sbjct: 748 ggtgtacttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccggg 689

                                                          
Query: 180 gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgg 226
            || |  ||||| ||||  ||||||||||| ||||| ||||||||||
Sbjct: 688 cagcagcaggcgcacggccgtctggatctcacgggatgtgatggtgg 642



 Score = 93.7 bits (47), Expect = 4e-16
 Identities = 75/85 (88%)
 Strand = Plus / Minus

                                                                       
Query: 274 tcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatg 333
           |||||||||||||||| ||||||||||||||||  |||||||||||| ||||||||| ||
Sbjct: 594 tcgaagatgtcgttgacgaaggagttcatgatgcccatggccttggacgagatgccggtg 535

                                    
Query: 334 tccggntgcacctgcttgancacct 358
           || || || |||||||| | |||||
Sbjct: 534 tcggggtggacctgcttcagcacct 510



to top

>ref|NG_002652.1| Homo sapiens histone 2, H2bb (HIST2H2BB) pseudogene on chromosome 1
          Length = 1137

 Score =  109 bits (55), Expect = 6e-21
 Identities = 94/107 (87%)
 Strand = Plus / Minus

                                                                       
Query: 120 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 179
           |||| |||||||||| ||||||||||||||||| |||||||||||||| |||||||||||
Sbjct: 748 ggtgtacttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccggg 689

                                                          
Query: 180 gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgg 226
            || |  ||||| ||||  ||||||||||| ||||| ||||||||||
Sbjct: 688 cagcagcaggcgcacggccgtctggatctcacgggatgtgatggtgg 642



 Score = 93.7 bits (47), Expect = 4e-16
 Identities = 75/85 (88%)
 Strand = Plus / Minus

                                                                       
Query: 274 tcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatg 333
           |||||||||||||||| ||||||||||||||||  |||||||||||| ||||||||| ||
Sbjct: 594 tcgaagatgtcgttgacgaaggagttcatgatgcccatggccttggacgagatgccggtg 535

                                    
Query: 334 tccggntgcacctgcttgancacct 358
           || || || |||||||| | |||||
Sbjct: 534 tcggggtggacctgcttcagcacct 510



to top

>gb|AY131975.1| Homo sapiens histone H2B (HIST2H2BA) pseudogene, complete sequence
          Length = 1137

 Score =  109 bits (55), Expect = 6e-21
 Identities = 94/107 (87%)
 Strand = Plus / Minus

                                                                       
Query: 120 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 179
           |||| |||||||||| ||||||||||||||||| |||||||||||||| |||||||||||
Sbjct: 748 ggtgtacttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccggg 689

                                                          
Query: 180 gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgg 226
            || |  ||||| ||||  ||||||||||| ||||| ||||||||||
Sbjct: 688 cagcagcaggcgcacggccgtctggatctcacgggatgtgatggtgg 642



 Score = 93.7 bits (47), Expect = 4e-16
 Identities = 75/85 (88%)
 Strand = Plus / Minus

                                                                       
Query: 274 tcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatg 333
           |||||||||||||||| ||||||||||||||||  |||||||||||| ||||||||| ||
Sbjct: 594 tcgaagatgtcgttgacgaaggagttcatgatgcccatggccttggacgagatgccggtg 535

                                    
Query: 334 tccggntgcacctgcttgancacct 358
           || || || |||||||| | |||||
Sbjct: 534 tcggggtggacctgcttcagcacct 510



to top

>gb|AY131976.1| Homo sapiens histone H2B (HIST2H2BB) pseudogene, complete sequence
          Length = 1137

 Score =  109 bits (55), Expect = 6e-21
 Identities = 94/107 (87%)
 Strand = Plus / Minus

                                                                       
Query: 120 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 179
           |||| |||||||||| ||||||||||||||||| |||||||||||||| |||||||||||
Sbjct: 748 ggtgtacttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccggg 689

                                                          
Query: 180 gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgg 226
            || |  ||||| ||||  ||||||||||| ||||| ||||||||||
Sbjct: 688 cagcagcaggcgcacggccgtctggatctcacgggatgtgatggtgg 642



 Score = 93.7 bits (47), Expect = 4e-16
 Identities = 75/85 (88%)
 Strand = Plus / Minus

                                                                       
Query: 274 tcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatg 333
           |||||||||||||||| ||||||||||||||||  |||||||||||| ||||||||| ||
Sbjct: 594 tcgaagatgtcgttgacgaaggagttcatgatgcccatggccttggacgagatgccggtg 535

                                    
Query: 334 tccggntgcacctgcttgancacct 358
           || || || |||||||| | |||||
Sbjct: 534 tcggggtggacctgcttcagcacct 510



to top

>gb|AY131979.1| Homo sapiens histone H2B (HIST2H2BE) gene, complete cds
          Length = 1137

 Score =  109 bits (55), Expect = 6e-21
 Identities = 94/107 (87%)
 Strand = Plus / Minus

                                                                       
Query: 120 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 179
           |||| |||||||||| ||||||||||||||||| |||||||||||||| |||||||||||
Sbjct: 749 ggtgtacttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccggg 690

                                                          
Query: 180 gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgg 226
            || |  ||||| ||||  ||||||||||| ||||| ||||||||||
Sbjct: 689 cagcagcaggcgcacggccgtctggatctcgcgggatgtgatggtgg 643



 Score = 97.6 bits (49), Expect = 2e-17
 Identities = 77/87 (88%)
 Strand = Plus / Minus

                                                                       
Query: 274 tcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatg 333
           |||||||||||||||| ||||||||||||||||  |||||||||||| ||||||||| ||
Sbjct: 595 tcgaagatgtcgttgacgaaggagttcatgatgcccatggccttggacgagatgccggtg 536

                                      
Query: 334 tccggntgcacctgcttgancaccttg 360
           || || || |||||||| | |||||||
Sbjct: 535 tcggggtggacctgcttcagcaccttg 509



to top

>ref|XM_558160.1| Anopheles gambiae str. PEST ENSANGP00000027582
           (ENSANGG00000022768), partial mRNA
          Length = 513

 Score =  109 bits (55), Expect = 6e-21
 Identities = 94/107 (87%)
 Strand = Plus / Plus

                                                                       
Query: 120 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 179
           |||| |||||||||||||||||||||||||||| |||||||||||||| |||||||||||
Sbjct: 46  ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctcgccggg 105

                                                          
Query: 180 gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgg 226
           ||| |  || || || |  ||||||||||| ||||| ||||||||||
Sbjct: 106 gagcaacagtcgcaccgccgtctggatctcgcgggacgtgatggtgg 152



 Score = 81.8 bits (41), Expect = 1e-12
 Identities = 75/87 (86%)
 Strand = Plus / Plus

                                                                       
Query: 274 tcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatg 333
           |||||||||||||| | ||||  ||||||||||  ||| ||||||||||| |||||| ||
Sbjct: 200 tcgaagatgtcgttcacgaagctgttcatgatgctcatcgccttggaggaaatgccggtg 259

                                      
Query: 334 tccggntgcacctgcttgancaccttg 360
           ||||| ||||||||||| | |||||||
Sbjct: 260 tccgggtgcacctgcttcagcaccttg 286



to top

>ref|XM_320334.2| Anopheles gambiae str. PEST ENSANGP00000014097
           (ENSANGG00000011608), mRNA
          Length = 671

 Score =  109 bits (55), Expect = 6e-21
 Identities = 94/107 (87%)
 Strand = Plus / Minus

                                                                       
Query: 120 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 179
           |||| |||||||||||||||||||||||||||| |||||||||||||| |||||||||||
Sbjct: 420 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctcgccggg 361

                                                          
Query: 180 gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgg 226
           ||| |  || || || |  ||||||||||| ||||| ||||||||||
Sbjct: 360 gagcaacagtcgcaccgccgtctggatctcgcgggacgtgatggtgg 314



 Score = 81.8 bits (41), Expect = 1e-12
 Identities = 75/87 (86%)
 Strand = Plus / Minus

                                                                       
Query: 274 tcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatg 333
           |||||||||||||| | ||||  ||||||||||  ||| ||||||||||| |||||| ||
Sbjct: 266 tcgaagatgtcgttcacgaagctgttcatgatgctcatcgccttggaggaaatgccggtg 207

                                      
Query: 334 tccggntgcacctgcttgancaccttg 360
           ||||| ||||||||||| | |||||||
Sbjct: 206 tccgggtgcacctgcttcagcaccttg 180



to top

>ref|XM_320329.2| Anopheles gambiae str. PEST ENSANGP00000014080
           (ENSANGG00000011591), mRNA
          Length = 695

 Score =  109 bits (55), Expect = 6e-21
 Identities = 94/107 (87%)
 Strand = Plus / Minus

                                                                       
Query: 120 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 179
           |||| |||||||||||||||||||||||||||| |||||||||||||| |||||||||||
Sbjct: 464 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctcgccggg 405

                                                          
Query: 180 gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgg 226
           ||| |  || || || |  ||||||||||| ||||| ||||||||||
Sbjct: 404 gagcaacagtcgcaccgccgtctggatctcgcgggacgtgatggtgg 358



 Score = 81.8 bits (41), Expect = 1e-12
 Identities = 75/87 (86%)
 Strand = Plus / Minus

                                                                       
Query: 274 tcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatg 333
           |||||||||||||| | ||||  ||||||||||  ||| ||||||||||| |||||| ||
Sbjct: 310 tcgaagatgtcgttcacgaagctgttcatgatgctcatcgccttggaggaaatgccggtg 251

                                      
Query: 334 tccggntgcacctgcttgancaccttg 360
           ||||| ||||||||||| | |||||||
Sbjct: 250 tccgggtgcacctgcttcagcaccttg 224



to top

>ref|XM_314450.2| Anopheles gambiae str. PEST ENSANGP00000000674
           (ENSANGG00000000607), partial mRNA
          Length = 363

 Score =  109 bits (55), Expect = 6e-21
 Identities = 94/107 (87%)
 Strand = Plus / Minus

                                                                       
Query: 120 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 179
           |||| |||||||||||||||||||||||||||| |||||||||||||| |||||||||||
Sbjct: 351 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctcgccggg 292

                                                          
Query: 180 gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgg 226
           ||| |  || || || |  ||||||||||| ||||| ||||||||||
Sbjct: 291 gagcaacagtcgcaccgccgtctggatctcgcgggacgtgatggtgg 245



 Score = 81.8 bits (41), Expect = 1e-12
 Identities = 75/87 (86%)
 Strand = Plus / Minus

                                                                       
Query: 274 tcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatg 333
           |||||||||||||| | ||||  ||||||||||  ||| ||||||||||| |||||| ||
Sbjct: 197 tcgaagatgtcgttcacgaagctgttcatgatgctcatcgccttggaggaaatgccggtg 138

                                      
Query: 334 tccggntgcacctgcttgancaccttg 360
           ||||| ||||||||||| | |||||||
Sbjct: 137 tccgggtgcacctgcttcagcaccttg 111



to top

>ref|XM_314448.2| Anopheles gambiae str. PEST ENSANGP00000016043
           (ENSANGG00000013554), mRNA
          Length = 704

 Score =  109 bits (55), Expect = 6e-21
 Identities = 94/107 (87%)
 Strand = Plus / Minus

                                                                       
Query: 120 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 179
           |||| |||||||||||||||||||||||||||| |||||||||||||| |||||||||||
Sbjct: 470 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctcgccggg 411

                                                          
Query: 180 gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgg 226
           ||| |  || || || |  ||||||||||| ||||| ||||||||||
Sbjct: 410 gagcaacagtcgcaccgccgtctggatctcgcgggacgtgatggtgg 364



 Score = 81.8 bits (41), Expect = 1e-12
 Identities = 75/87 (86%)
 Strand = Plus / Minus

                                                                       
Query: 274 tcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatg 333
           |||||||||||||| | ||||  ||||||||||  ||| ||||||||||| |||||| ||
Sbjct: 316 tcgaagatgtcgttcacgaagctgttcatgatgctcatcgccttggaggaaatgccggtg 257

                                      
Query: 334 tccggntgcacctgcttgancaccttg 360
           ||||| ||||||||||| | |||||||
Sbjct: 256 tccgggtgcacctgcttcagcaccttg 230



to top

>ref|XM_306853.2| Anopheles gambiae str. PEST ENSANGP00000000106
           (ENSANGG00000000104), partial mRNA
          Length = 321

 Score =  109 bits (55), Expect = 6e-21
 Identities = 94/107 (87%)
 Strand = Plus / Minus

                                                                       
Query: 120 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 179
           |||| |||||||||||||||||||||||||||| |||||||||||||| |||||||||||
Sbjct: 309 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctcgccggg 250

                                                          
Query: 180 gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgg 226
           ||| |  || || || |  ||||||||||| ||||| ||||||||||
Sbjct: 249 gagcaacagtcgcaccgccgtctggatctcgcgggacgtgatggtgg 203



 Score = 79.8 bits (40), Expect = 6e-12
 Identities = 74/86 (86%)
 Strand = Plus / Minus

                                                                       
Query: 274 tcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatg 333
           |||||||||||||| | ||||  ||||||||||  ||| ||||||||||| |||||| ||
Sbjct: 155 tcgaagatgtcgttcacgaagctgttcatgatgctcatcgccttggaggaaatgccggtg 96

                                     
Query: 334 tccggntgcacctgcttgancacctt 359
           ||||| ||||||||||| | ||||||
Sbjct: 95  tccgggtgcacctgcttcagcacctt 70



to top

>ref|XM_306255.2| Anopheles gambiae str. PEST ENSANGP00000000003
           (ENSANGG00000000003), partial mRNA
          Length = 375

 Score =  109 bits (55), Expect = 6e-21
 Identities = 94/107 (87%)
 Strand = Plus / Minus

                                                                       
Query: 120 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 179
           |||| |||||||||||||||||||||||||||| |||||||||||||| |||||||||||
Sbjct: 363 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctcgccggg 304

                                                          
Query: 180 gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgg 226
           ||| |  || || || |  ||||||||||| ||||| ||||||||||
Sbjct: 303 gagcaacagtcgcaccgccgtctggatctcgcgggacgtgatggtgg 257



 Score = 81.8 bits (41), Expect = 1e-12
 Identities = 75/87 (86%)
 Strand = Plus / Minus

                                                                       
Query: 274 tcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatg 333
           |||||||||||||| | ||||  ||||||||||  ||| ||||||||||| |||||| ||
Sbjct: 209 tcgaagatgtcgttcacgaagctgttcatgatgctcatcgccttggaggaaatgccggtg 150

                                      
Query: 334 tccggntgcacctgcttgancaccttg 360
           ||||| ||||||||||| | |||||||
Sbjct: 149 tccgggtgcacctgcttcagcaccttg 123



to top

>gb|AY893641.1| Synthetic construct Homo sapiens clone FLH130870.01X histone 2 H2be
           (HIST2H2BE) mRNA, complete cds
          Length = 381

 Score =  109 bits (55), Expect = 6e-21
 Identities = 94/107 (87%)
 Strand = Plus / Minus

                                                                       
Query: 120 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 179
           |||| |||||||||| ||||||||||||||||| |||||||||||||| |||||||||||
Sbjct: 369 ggtgtacttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccggg 310

                                                          
Query: 180 gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgg 226
            || |  ||||| ||||  ||||||||||| ||||| ||||||||||
Sbjct: 309 cagcagcaggcgcacggccgtctggatctcgcgggatgtgatggtgg 263



 Score = 97.6 bits (49), Expect = 2e-17
 Identities = 77/87 (88%)
 Strand = Plus / Minus

                                                                       
Query: 274 tcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatg 333
           |||||||||||||||| ||||||||||||||||  |||||||||||| ||||||||| ||
Sbjct: 215 tcgaagatgtcgttgacgaaggagttcatgatgcccatggccttggacgagatgccggtg 156

                                      
Query: 334 tccggntgcacctgcttgancaccttg 360
           || || || |||||||| | |||||||
Sbjct: 155 tcggggtggacctgcttcagcaccttg 129



to top

>gb|BC098289.1| Homo sapiens histone 1, H2bn, mRNA (cDNA clone MGC:119804
           IMAGE:40014249), complete cds
          Length = 456

 Score =  109 bits (55), Expect = 6e-21
 Identities = 94/107 (87%)
 Strand = Plus / Minus

                                                                       
Query: 120 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 179
           |||| |||||||||| ||||||||||||||||| |||||||||||||| |||||||||||
Sbjct: 369 ggtgtacttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccggg 310

                                                          
Query: 180 gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgg 226
            || |  ||||| ||||  ||||||||||| ||||| ||||||||||
Sbjct: 309 cagcagcaggcgcacggccgtctggatctcgcgggatgtgatggtgg 263



 Score = 97.6 bits (49), Expect = 2e-17
 Identities = 77/87 (88%)
 Strand = Plus / Minus

                                                                       
Query: 274 tcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatg 333
           |||||||||||||||| ||||||||||||||||  |||||||||||| ||||||||| ||
Sbjct: 215 tcgaagatgtcgttgacgaaggagttcatgatgcccatggccttggacgagatgccggtg 156

                                      
Query: 334 tccggntgcacctgcttgancaccttg 360
           || || || |||||||| | |||||||
Sbjct: 155 tcggggtggacctgcttcagcaccttg 129



to top

>gb|BC098112.1| Homo sapiens histone 1, H2bn, mRNA (cDNA clone MGC:119802
           IMAGE:40014245), complete cds
          Length = 458

 Score =  109 bits (55), Expect = 6e-21
 Identities = 94/107 (87%)
 Strand = Plus / Minus

                                                                       
Query: 120 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 179
           |||| |||||||||| ||||||||||||||||| |||||||||||||| |||||||||||
Sbjct: 369 ggtgtacttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccggg 310

                                                          
Query: 180 gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgg 226
            || |  ||||| ||||  ||||||||||| ||||| ||||||||||
Sbjct: 309 cagcagcaggcgcacggccgtctggatctcgcgggatgtgatggtgg 263



 Score = 97.6 bits (49), Expect = 2e-17
 Identities = 77/87 (88%)
 Strand = Plus / Minus

                                                                       
Query: 274 tcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatg 333
           |||||||||||||||| ||||||||||||||||  |||||||||||| ||||||||| ||
Sbjct: 215 tcgaagatgtcgttgacgaaggagttcatgatgcccatggccttggacgagatgccggtg 156

                                      
Query: 334 tccggntgcacctgcttgancaccttg 360
           || || || |||||||| | |||||||
Sbjct: 155 tcggggtggacctgcttcagcaccttg 129



to top

>ref|NM_001024599.2| Homo sapiens histone 2, H2bf (HIST2H2BF), mRNA
          Length = 1858

 Score =  109 bits (55), Expect = 6e-21
 Identities = 94/107 (87%)
 Strand = Plus / Minus

                                                                       
Query: 120 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 179
           |||| |||||||||| ||||||||||||||||| |||||||||||||| |||||||||||
Sbjct: 402 ggtgtacttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccggg 343

                                                          
Query: 180 gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgg 226
            || |  ||||| ||||  ||||||||||| ||||| ||||||||||
Sbjct: 342 cagcagcaggcgcacggccgtctggatctcgcgggatgtgatggtgg 296



 Score = 97.6 bits (49), Expect = 2e-17
 Identities = 77/87 (88%)
 Strand = Plus / Minus

                                                                       
Query: 274 tcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatg 333
           |||||||||||||||| ||||||||||||||||  |||||||||||| ||||||||| ||
Sbjct: 248 tcgaagatgtcgttgacgaaggagttcatgatgcccatggccttggacgagatgccggtg 189

                                      
Query: 334 tccggntgcacctgcttgancaccttg 360
           || || || |||||||| | |||||||
Sbjct: 188 tcggggtggacctgcttcagcaccttg 162



to top

>dbj|AB085854.1| Rosellinia necatrix hh2b gene for histone H2B, complete cds
          Length = 1819

 Score =  109 bits (55), Expect = 6e-21
 Identities = 100/115 (86%)
 Strand = Plus / Minus

                                                                        
Query: 125  acttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggagga 184
            ||||||||||||||||||| || |||||||| || |||||||| || |||||||||||||
Sbjct: 1295 acttggtgacggccttggtaccttcggagacagcatgcttggcaagttcgccggggagga 1236

                                                                   
Query: 185  cgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgta 239
             ||||||||||||||||||||| || || || |  ||||||  ||||||||||||
Sbjct: 1235 tgaggcggacggaggtctggatttcacgcgaagaaatggtgctcttcttgttgta 1181



to top

>gb|BC110793.1| Homo sapiens histone 2, H2bf, mRNA (cDNA clone MGC:131639
           IMAGE:5224812), complete cds
          Length = 1858

 Score =  109 bits (55), Expect = 6e-21
 Identities = 94/107 (87%)
 Strand = Plus / Minus

                                                                       
Query: 120 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 179
           |||| |||||||||| ||||||||||||||||| |||||||||||||| |||||||||||
Sbjct: 402 ggtgtacttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccggg 343

                                                          
Query: 180 gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgg 226
            || |  ||||| ||||  ||||||||||| ||||| ||||||||||
Sbjct: 342 cagcagcaggcgcacggccgtctggatctcgcgggatgtgatggtgg 296



 Score = 97.6 bits (49), Expect = 2e-17
 Identities = 77/87 (88%)
 Strand = Plus / Minus

                                                                       
Query: 274 tcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatg 333
           |||||||||||||||| ||||||||||||||||  |||||||||||| ||||||||| ||
Sbjct: 248 tcgaagatgtcgttgacgaaggagttcatgatgcccatggccttggacgagatgccggtg 189

                                      
Query: 334 tccggntgcacctgcttgancaccttg 360
           || || || |||||||| | |||||||
Sbjct: 188 tcggggtggacctgcttcagcaccttg 162



to top

>gb|BC106916.1| Homo sapiens similar to histone H2B histone family, mRNA (cDNA
           clone MGC:126031 IMAGE:40032208), complete cds
          Length = 520

 Score =  109 bits (55), Expect = 6e-21
 Identities = 94/107 (87%)
 Strand = Plus / Minus

                                                                       
Query: 120 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 179
           |||| |||||||||| ||||||||||||||||| |||||||||||||| |||||||||||
Sbjct: 378 ggtgtacttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccggg 319

                                                          
Query: 180 gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgg 226
            || |  ||||| ||||  ||||||||||| ||||| ||||||||||
Sbjct: 318 cagcagcaggcgcacggccgtctggatctcacgggatgtgatggtgg 272



 Score = 93.7 bits (47), Expect = 4e-16
 Identities = 75/85 (88%)
 Strand = Plus / Minus

                                                                       
Query: 274 tcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatg 333
           |||||||||||||||| ||||||||||||||||  |||||||||||| ||||||||| ||
Sbjct: 224 tcgaagatgtcgttgacgaaggagttcatgatgcccatggccttggacgagatgccggtg 165

                                    
Query: 334 tccggntgcacctgcttgancacct 358
           || || || |||||||| | |||||
Sbjct: 164 tcggggtggacctgcttcagcacct 140



to top

>gb|BC073925.1| Homo sapiens similar to histone H2B histone family, mRNA (cDNA
           clone MGC:90432 IMAGE:5190019), complete cds
          Length = 2221

 Score =  109 bits (55), Expect = 6e-21
 Identities = 94/107 (87%)
 Strand = Plus / Minus

                                                                       
Query: 120 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 179
           |||| |||||||||| ||||||||||||||||| |||||||||||||| |||||||||||
Sbjct: 350 ggtgtacttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccggg 291

                                                          
Query: 180 gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgg 226
            || |  ||||| ||||  ||||||||||| ||||| ||||||||||
Sbjct: 290 cagcagcaggcgcacggccgtctggatctcgcgggacgtgatggtgg 244



 Score = 85.7 bits (43), Expect = 9e-14
 Identities = 74/85 (87%)
 Strand = Plus / Minus

                                                                       
Query: 274 tcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatg 333
           |||||||||||||||| ||||||||||||||||  ||||| |||||| ||||||||| ||
Sbjct: 196 tcgaagatgtcgttgacgaaggagttcatgatgcccatggtcttggacgagatgccggtg 137

                                    
Query: 334 tccggntgcacctgcttgancacct 358
           || || || |||||||| | |||||
Sbjct: 136 tcggggtggacctgcttcagcacct 112



to top

>gb|M60756.1|HUMHISH2BA Human histone H2B.1 mRNA, 3' end
          Length = 2100

 Score =  109 bits (55), Expect = 6e-21
 Identities = 94/107 (87%)
 Strand = Plus / Minus

                                                                       
Query: 120 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 179
           |||| |||||||||| ||||||||||||||||| |||||||||||||| |||||||||||
Sbjct: 294 ggtgtacttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccggg 235

                                                          
Query: 180 gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgg 226
            || |  ||||| ||||  ||||||||||| ||||| ||||||||||
Sbjct: 234 cagcagcaggcgcacggccgtctggatctcgcgggatgtgatggtgg 188



 Score = 97.6 bits (49), Expect = 2e-17
 Identities = 77/87 (88%)
 Strand = Plus / Minus

                                                                       
Query: 274 tcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatg 333
           |||||||||||||||| ||||||||||||||||  |||||||||||| ||||||||| ||
Sbjct: 140 tcgaagatgtcgttgacgaaggagttcatgatgcccatggccttggacgagatgccggtg 81

                                      
Query: 334 tccggntgcacctgcttgancaccttg 360
           || || || |||||||| | |||||||
Sbjct: 80  tcggggtggacctgcttcagcaccttg 54



to top

>emb|BX008531.1|CNS08EQV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA14AA07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 499

 Score =  107 bits (54), Expect = 2e-20
 Identities = 90/102 (88%)
 Strand = Plus / Minus

                                                                       
Query: 125 acttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggagga 184
           |||||||||||||||||||||||||||| |||||||||||||| |||||||||||||| |
Sbjct: 445 acttggtgacggccttggtgccctcggacacggcgtgcttggccagctcgccggggagca 386

                                                     
Query: 185 cgaggcggacggaggtctggatctcccgggaggtgatggtgg 226
             || || || |  ||||||||||| ||||| ||||||||||
Sbjct: 385 acagtcgcaccgccgtctggatctcgcgggacgtgatggtgg 344



 Score = 81.8 bits (41), Expect = 1e-12
 Identities = 75/87 (86%)
 Strand = Plus / Minus

                                                                       
Query: 274 tcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatg 333
           |||||||||||||| | ||||  ||||||||||  ||| ||||||||||| |||||| ||
Sbjct: 296 tcgaagatgtcgttcacgaagctgttcatgatgctcatcgccttggaggaaatgccggtg 237

                                      
Query: 334 tccggntgcacctgcttgancaccttg 360
           ||||| ||||||||||| | |||||||
Sbjct: 236 tccgggtgcacctgcttcagcaccttg 210



to top

>emb|Z59559.1|HS163A6R H.sapiens CpG island DNA genomic Mse1 fragment, clone 163a6,
           reverse read cpg163a6.rt1b
          Length = 199

 Score =  107 bits (54), Expect = 2e-20
 Identities = 92/105 (87%)
 Strand = Plus / Minus

                                                                       
Query: 120 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 179
           |||| ||||||||||||||||||||||||| || |||||||||||||| ||||| |||||
Sbjct: 167 ggtgtacttggtgacggccttggtgccctccgacacggcgtgcttggccagctctccggg 108

                                                        
Query: 180 gaggacgaggcggacggaggtctggatctcccgggaggtgatggt 224
            || |  ||||| ||||  ||||||||||||| ||||||||||||
Sbjct: 107 aagcancaggcgcacggccgtctggatctccctggaggtgatggt 63



to top

>gb|BC051872.1| Homo sapiens histone 1, H2bk, mRNA (cDNA clone MGC:60248
           IMAGE:6526835), complete cds
          Length = 844

 Score =  105 bits (53), Expect = 1e-19
 Identities = 92/105 (87%)
 Strand = Plus / Minus

                                                                       
Query: 120 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 179
           |||| |||||||||||||||||||||||||||| |||||||||||||| | ||| |||||
Sbjct: 409 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccaactccccggg 350

                                                        
Query: 180 gaggacgaggcggacggaggtctggatctcccgggaggtgatggt 224
            || |  ||||| ||||  ||||||||||||| ||||||||||||
Sbjct: 349 cagcagcaggcgcacggccgtctggatctccctggaggtgatggt 305



 Score = 89.7 bits (45), Expect = 6e-15
 Identities = 76/87 (87%)
 Strand = Plus / Minus

                                                                       
Query: 274 tcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatg 333
           |||||||||||||||| |||||||||||||||   ||||||||| |||||||||||| ||
Sbjct: 255 tcgaagatgtcgttgacgaaggagttcatgattcccatggccttagaggagatgccggtg 196

                                      
Query: 334 tccggntgcacctgcttgancaccttg 360
           || || || |||||||| | |||||||
Sbjct: 195 tcggggtggacctgcttcagcaccttg 169



to top

>gb|BC106899.1| Homo sapiens histone 1, H2bg, mRNA (cDNA clone IMAGE:40031316),
           partial cds
          Length = 435

 Score =  105 bits (53), Expect = 1e-19
 Identities = 92/105 (87%)
 Strand = Plus / Minus

                                                                       
Query: 120 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 179
           |||| ||||||||||||||||||||||||| || |||||||||||||| ||||| |||||
Sbjct: 368 ggtgtacttggtgacggccttggtgccctccgacacggcgtgcttggccagctctccggg 309

                                                        
Query: 180 gaggacgaggcggacggaggtctggatctcccgggaggtgatggt 224
            || |  ||||| ||||  ||||||||||||| ||||||||||||
Sbjct: 308 aagcagcaggcgcacggccgtctggatctccctggaggtgatggt 264



 Score = 46.1 bits (23), Expect = 0.078
 Identities = 66/81 (81%)
 Strand = Plus / Minus

                                                                       
Query: 280 atgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtccggn 339
           |||||||| | ||| || |||||||||  |||||||||||| ||||||||  |||| || 
Sbjct: 208 atgtcgttaacgaaagaattcatgatgcccatggccttggaagagatgccagtgtcggga 149

                                
Query: 340 tgcacctgcttgancaccttg 360
           || ||||| || | |||||||
Sbjct: 148 tggacctgtttcagcaccttg 128



to top

>ref|XM_518302.1| PREDICTED: Pan troglodytes similar to H2B histone family, member F
           (LOC462509), mRNA
          Length = 843

 Score =  105 bits (53), Expect = 1e-19
 Identities = 92/105 (87%)
 Strand = Plus / Minus

                                                                       
Query: 120 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 179
           |||| |||||||||||||||| ||||||||||| |||||||||||||| ||||| |||||
Sbjct: 369 ggtgtacttggtgacggcctttgtgccctcggacacggcgtgcttggccagctccccggg 310

                                                        
Query: 180 gaggacgaggcggacggaggtctggatctcccgggaggtgatggt 224
            || |  ||||| ||||  ||||||||||||| ||||||||||||
Sbjct: 309 cagcagcaggcgcacggccgtctggatctccctggaggtgatggt 265



 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 277 aagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtc 335
           |||||||| |||| ||||||||||||||||  ||||||||| || ||||||||| ||||
Sbjct: 212 aagatgtcattgacgaaggagttcatgatgcccatggccttcgatgagatgccggtgtc 154



to top

>ref|XM_518301.1| PREDICTED: Pan troglodytes similar to histone H2B (LOC462508), mRNA
          Length = 1026

 Score =  105 bits (53), Expect = 1e-19
 Identities = 92/105 (87%)
 Strand = Plus / Minus

                                                                       
Query: 120 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 179
           |||| ||||||||||||||||||||||||| || || ||||||||||| ||||| |||||
Sbjct: 461 ggtgtacttggtgacggccttggtgccctccgacaccgcgtgcttggccagctccccggg 402

                                                        
Query: 180 gaggacgaggcggacggaggtctggatctcccgggaggtgatggt 224
           ||| |  ||||| ||||  ||||||||||||| ||||||||||||
Sbjct: 401 gagcagcaggcgcacggccgtctggatctccctggaggtgatggt 357



 Score = 81.8 bits (41), Expect = 1e-12
 Identities = 75/87 (86%)
 Strand = Plus / Minus

                                                                       
Query: 274 tcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatg 333
           ||||||||||| |||| ||||||||||||||||  |||||||||||| ||||| ||| ||
Sbjct: 307 tcgaagatgtcattgacgaaggagttcatgatgcccatggccttggacgagataccggtg 248

                                      
Query: 334 tccggntgcacctgcttgancaccttg 360
           || || || |||||||| | |||||||
Sbjct: 247 tcggggtggacctgcttcagcaccttg 221



to top

>ref|XM_518294.1| PREDICTED: Pan troglodytes similar to H2B histone family, member R
           (LOC462500), mRNA
          Length = 572

 Score =  105 bits (53), Expect = 1e-19
 Identities = 92/105 (87%)
 Strand = Plus / Minus

                                                                       
Query: 120 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 179
           |||| |||||||||||||||||||||||||||| |||||||||||||| | ||| |||||
Sbjct: 381 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccaactccccggg 322

                                                        
Query: 180 gaggacgaggcggacggaggtctggatctcccgggaggtgatggt 224
            || |  ||||| ||||  ||||||||||||| ||||||||||||
Sbjct: 321 cagcagcaggcgcacggccgtctggatctccctggaggtgatggt 277



 Score = 44.1 bits (22), Expect = 0.31
 Identities = 45/53 (84%)
 Strand = Plus / Minus

                                                                
Query: 298 ttcatgatggacatggccttggaggagatgccgatgtccggntgcacctgctt 350
           |||||||||  |||||||||||| || |||||| |||| || || ||||||||
Sbjct: 203 ttcatgatgcccatggccttggacgaaatgccggtgtcagggtggacctgctt 151



to top

>gb|BC106720.1| Homo sapiens histone 1, H2bo, mRNA (cDNA clone MGC:119806
           IMAGE:40014271), complete cds
          Length = 441

 Score =  105 bits (53), Expect = 1e-19
 Identities = 92/105 (87%)
 Strand = Plus / Minus

                                                                       
Query: 120 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 179
           |||| |||||||||||||||| ||||||||||| |||||||||||||| ||||| |||||
Sbjct: 390 ggtgtacttggtgacggcctttgtgccctcggacacggcgtgcttggccagctccccggg 331

                                                        
Query: 180 gaggacgaggcggacggaggtctggatctcccgggaggtgatggt 224
            || |  ||||| ||||  ||||||||||||| ||||||||||||
Sbjct: 330 cagcagcaggcgcacggccgtctggatctccctggaggtgatggt 286



 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 71/84 (84%)
 Strand = Plus / Minus

                                                                       
Query: 277 aagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtcc 336
           |||||||| |||| ||||||||||||||||  ||||||||| || ||||||||| |||| 
Sbjct: 233 aagatgtcattgacgaaggagttcatgatgcccatggccttcgatgagatgccggtgtcg 174

                                   
Query: 337 ggntgcacctgcttgancaccttg 360
           || || || ||||| | |||||||
Sbjct: 173 gggtggacttgcttcagcaccttg 150



to top

>ref|NM_017445.1| Homo sapiens H2B histone family, member S (H2BFS), mRNA
          Length = 381

 Score =  105 bits (53), Expect = 1e-19
 Identities = 92/105 (87%)
 Strand = Plus / Minus

                                                                       
Query: 120 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 179
           |||| |||||||||||||||||||||||||||| |||||||||||||| | ||| |||||
Sbjct: 369 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccaactccccggg 310

                                                        
Query: 180 gaggacgaggcggacggaggtctggatctcccgggaggtgatggt 224
            || |  ||||| ||||  ||||||||||||| ||||||||||||
Sbjct: 309 cagcagcaggcgcacggccgtctggatctccctggaggtgatggt 265



 Score = 89.7 bits (45), Expect = 6e-15
 Identities = 76/87 (87%)
 Strand = Plus / Minus

                                                                       
Query: 274 tcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatg 333
           |||||||||||||||| |||||||||||||||   ||||||||| |||||||||||| ||
Sbjct: 215 tcgaagatgtcgttgacgaaggagttcatgattcccatggccttagaggagatgccggtg 156

                                      
Query: 334 tccggntgcacctgcttgancaccttg 360
           || || || |||||||| | |||||||
Sbjct: 155 tcggggtggacctgcttcagcaccttg 129



to top

>ref|NM_003527.4| Homo sapiens histone 1, H2bo (HIST1H2BO), mRNA
          Length = 467

 Score =  105 bits (53), Expect = 1e-19
 Identities = 92/105 (87%)
 Strand = Plus / Minus

                                                                       
Query: 120 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 179
           |||| |||||||||||||||| ||||||||||| |||||||||||||| ||||| |||||
Sbjct: 407 ggtgtacttggtgacggcctttgtgccctcggacacggcgtgcttggccagctccccggg 348

                                                        
Query: 180 gaggacgaggcggacggaggtctggatctcccgggaggtgatggt 224
            || |  ||||| ||||  ||||||||||||| ||||||||||||
Sbjct: 347 cagcagcaggcgcacggccgtctggatctccctggaggtgatggt 303



 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 71/84 (84%)
 Strand = Plus / Minus

                                                                       
Query: 277 aagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtcc 336
           |||||||| |||| ||||||||||||||||  ||||||||| || ||||||||| |||| 
Sbjct: 250 aagatgtcattgacgaaggagttcatgatgcccatggccttcgatgagatgccggtgtcg 191

                                   
Query: 337 ggntgcacctgcttgancaccttg 360
           || || || ||||| | |||||||
Sbjct: 190 gggtggacttgcttcagcaccttg 167



to top

>gb|BC000893.1| Homo sapiens histone 1, H2bk, mRNA (cDNA clone MGC:5132
           IMAGE:3463930), complete cds
          Length = 845

 Score =  105 bits (53), Expect = 1e-19
 Identities = 92/105 (87%)
 Strand = Plus / Minus

                                                                       
Query: 120 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 179
           |||| |||||||||||||||||||||||||||| |||||||||||||| | ||| |||||
Sbjct: 411 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccaactccccggg 352

                                                        
Query: 180 gaggacgaggcggacggaggtctggatctcccgggaggtgatggt 224
            || |  ||||| ||||  ||||||||||||| ||||||||||||
Sbjct: 351 cagcagcaggcgcacggccgtctggatctccctggaggtgatggt 307



 Score = 89.7 bits (45), Expect = 6e-15
 Identities = 76/87 (87%)
 Strand = Plus / Minus

                                                                       
Query: 274 tcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatg 333
           |||||||||||||||| |||||||||||||||   ||||||||| |||||||||||| ||
Sbjct: 257 tcgaagatgtcgttgacgaaggagttcatgattcccatggccttagaggagatgccggtg 198

                                      
Query: 334 tccggntgcacctgcttgancaccttg 360
           || || || |||||||| | |||||||
Sbjct: 197 tcggggtggacctgcttcagcaccttg 171



to top

>ref|XM_607722.1| PREDICTED: Bos taurus similar to Histone H2B 291B (LOC529278), mRNA
          Length = 381

 Score =  105 bits (53), Expect = 1e-19
 Identities = 78/87 (89%)
 Strand = Plus / Minus

                                                                       
Query: 274 tcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatg 333
           |||||||||||||||| ||||||||||||||||  |||||||||||| ||||||||| ||
Sbjct: 215 tcgaagatgtcgttgacgaaggagttcatgatgcccatggccttggacgagatgccggtg 156

                                      
Query: 334 tccggntgcacctgcttgancaccttg 360
           ||||| || |||||||| | |||||||
Sbjct: 155 tccgggtggacctgcttcagcaccttg 129



 Score = 87.7 bits (44), Expect = 2e-14
 Identities = 86/100 (86%)
 Strand = Plus / Minus

                                                                       
Query: 125 acttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggagga 184
           ||||||||||||||||||||||||| || |||||||||||||| || || ||||| || |
Sbjct: 364 acttggtgacggccttggtgccctcagacacggcgtgcttggccagttctccgggaagca 305

                                                   
Query: 185 cgaggcggacggaggtctggatctcccgggaggtgatggt 224
             ||||| ||||  ||||||||||||| ||| ||||||||
Sbjct: 304 gcaggcgcacggccgtctggatctccctggatgtgatggt 265



to top

>ref|XM_866738.1| PREDICTED: Bos taurus similar to Histone H2B 291B (LOC615043), mRNA
          Length = 748

 Score =  105 bits (53), Expect = 1e-19
 Identities = 92/105 (87%)
 Strand = Plus / Minus

                                                                       
Query: 120 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 179
           |||| |||||||||| ||||||||||||||||| |||||||||||||| |||||||||||
Sbjct: 401 ggtgtacttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccggg 342

                                                        
Query: 180 gaggacgaggcggacggaggtctggatctcccgggaggtgatggt 224
            || |  || || ||||  ||||||||||||||||| ||||||||
Sbjct: 341 cagcagaagtcgcacggccgtctggatctcccgggacgtgatggt 297



 Score = 81.8 bits (41), Expect = 1e-12
 Identities = 75/87 (86%)
 Strand = Plus / Minus

                                                                       
Query: 274 tcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatg 333
           ||||||||||||||||  || ||||||||||||  |||||| ||||| ||||||||| ||
Sbjct: 247 tcgaagatgtcgttgacaaatgagttcatgatgcccatggctttggacgagatgccggtg 188

                                      
Query: 334 tccggntgcacctgcttgancaccttg 360
           ||||| |||||||| || | |||||||
Sbjct: 187 tccgggtgcacctgtttcaacaccttg 161



to top

>ref|XM_618175.2| PREDICTED: Bos taurus similar to H2B histone family, member F,
           transcript variant 1 (LOC537985), mRNA
          Length = 2304

 Score =  105 bits (53), Expect = 1e-19
 Identities = 92/105 (87%)
 Strand = Plus / Minus

                                                                       
Query: 120 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 179
           |||| |||||||||| ||||||||||||||||| |||||||||||||| |||||||| ||
Sbjct: 385 ggtgtacttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccagg 326

                                                        
Query: 180 gaggacgaggcggacggaggtctggatctcccgggaggtgatggt 224
            || |  ||||| ||||  ||||||||||||||||| ||||||||
Sbjct: 325 cagcagcaggcgcacggccgtctggatctcccgggacgtgatggt 281



 Score = 73.8 bits (37), Expect = 3e-10
 Identities = 74/87 (85%)
 Strand = Plus / Minus

                                                                       
Query: 274 tcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatg 333
           ||||||||||||||||  || ||||||||||||  ||| |||||||| || || ||| ||
Sbjct: 231 tcgaagatgtcgttgacaaatgagttcatgatgcccatagccttggacgaaataccggtg 172

                                      
Query: 334 tccggntgcacctgcttgancaccttg 360
           ||||| ||||||||||| | |||||||
Sbjct: 171 tccgggtgcacctgcttcagcaccttg 145



to top

>ref|NG_001335.1| Homo sapiens genomic large histone family cluster (HFL@) on chromosome 6
          Length = 269712

 Score =  105 bits (53), Expect = 1e-19
 Identities = 92/105 (87%)
 Strand = Plus / Plus

                                                                          
Query: 120    ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 179
              |||| ||||||||||||||||||||||||| || |||||||||||||| ||||| |||||
Sbjct: 107478 ggtgtacttggtgacggccttggtgccctccgacacggcgtgcttggccagctctccggg 107537

                                                           
Query: 180    gaggacgaggcggacggaggtctggatctcccgggaggtgatggt 224
               || |  ||||| ||||  ||||||||||||| ||||||||||||
Sbjct: 107538 aagcagcaggcgcacggccgtctggatctccctggaggtgatggt 107582



 Score =  101 bits (51), Expect = 2e-18
 Identities = 93/107 (86%)
 Strand = Plus / Minus

                                                                          
Query: 120    ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 179
              |||| ||||||||||||||||||||||||| || ||||||||||| || ||||| |||||
Sbjct: 183927 ggtgtacttggtgacggccttggtgccctctgacacggcgtgcttagccagctccccggg 183868

                                                             
Query: 180    gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgg 226
               || |  ||||| ||||  ||||||||||||| ||||||||||||||
Sbjct: 183867 cagcagcaggcgtacggccgtctggatctccctggaggtgatggtgg 183821



 Score = 97.6 bits (49), Expect = 2e-17
 Identities = 91/105 (86%)
 Strand = Plus / Minus

                                                                          
Query: 120    ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 179
              |||| ||||||||||||||||||||||||| || |||||||||||||| ||||| || ||
Sbjct: 142538 ggtgtacttggtgacggccttggtgccctccgacacggcgtgcttggccagctcccccgg 142479

                                                           
Query: 180    gaggacgaggcggacggaggtctggatctcccgggaggtgatggt 224
               || |  ||||| ||||  ||||||||||||| ||||||||||||
Sbjct: 142478 aagcagcaggcgcacggccgtctggatctccctggaggtgatggt 142434



 Score = 89.7 bits (45), Expect = 6e-15
 Identities = 90/105 (85%)
 Strand = Plus / Minus

                                                                          
Query: 120    ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 179
              |||| |||||||||||||||| ||||||||||| |||||||||||||| || || || ||
Sbjct: 236019 ggtgtacttggtgacggccttagtgccctcggacacggcgtgcttggccagttccccagg 235960

                                                           
Query: 180    gaggacgaggcggacggaggtctggatctcccgggaggtgatggt 224
               || |  ||||| ||||  ||||||||||||| ||||||||||||
Sbjct: 235959 cagcagcaggcgcacggctgtctggatctccctggaggtgatggt 235915



 Score = 89.7 bits (45), Expect = 6e-15
 Identities = 76/87 (87%)
 Strand = Plus / Minus

                                                                          
Query: 274    tcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatg 333
              |||||||| ||||||| ||||||||||||||||  |||||||||||| ||||||||| ||
Sbjct: 183773 tcgaagatatcgttgacgaaggagttcatgatgcccatggccttggatgagatgccggtg 183714

                                         
Query: 334    tccggntgcacctgcttgancaccttg 360
              || || || |||||||| | |||||||
Sbjct: 183713 tcggggtggacctgctttagcaccttg 183687



 Score = 89.7 bits (45), Expect = 6e-15
 Identities = 90/105 (85%)
 Strand = Plus / Minus

                                                                          
Query: 120    ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 179
              |||| ||||||| ||||||||||||||||| || || ||||||||||| ||||| |||||
Sbjct: 168164 ggtgtacttggtaacggccttggtgccctctgacacagcgtgcttggccagctccccggg 168105

                                                           
Query: 180    gaggacgaggcggacggaggtctggatctcccgggaggtgatggt 224
               || |  ||||| ||||  ||||||||||||| ||||||||||||
Sbjct: 168104 aagcagcaggcgcacggccgtctggatctccctggaggtgatggt 168060



 Score = 75.8 bits (38), Expect = 9e-11
 Identities = 67/77 (87%)
 Strand = Plus / Plus

                                                                         
Query: 274   tcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatg 333
             |||||||||||||||| |||||| ||||||||   |||||||||||| ||||||||| ||
Sbjct: 27385 tcgaagatgtcgttgacgaaggaattcatgatccccatggccttggatgagatgccggtg 27444

                              
Query: 334   tccggntgcacctgctt 350
             || || || ||||||||
Sbjct: 27445 tcggggtggacctgctt 27461



 Score = 73.8 bits (37), Expect = 3e-10
 Identities = 74/87 (85%)
 Strand = Plus / Minus

                                                                          
Query: 274    tcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatg 333
              |||||||||||||||| |||||| ||||||||   ||| |||||||| ||||||||| ||
Sbjct: 142384 tcgaagatgtcgttgacgaaggaattcatgatccccattgccttggaagagatgccggtg 142325

                                         
Query: 334    tccggntgcacctgcttgancaccttg 360
              || || || |||||||| | |||||||
Sbjct: 142324 tcgggatggacctgcttcagcaccttg 142298



 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 84/100 (84%)
 Strand = Plus / Plus

                                                                          
Query: 125    acttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggagga 184
              |||||||||| |||||||| || ||||| || ||||||||||| ||||| ||||| || |
Sbjct: 200280 acttggtgacagccttggtaccttcggacactgcgtgcttggccagctctccgggaagca 200339

                                                      
Query: 185    cgaggcggacggaggtctggatctcccgggaggtgatggt 224
                || || |||| |||||||||||||| |||||| |||||
Sbjct: 200340 gcagacgcacggcggtctggatctccctggaggtaatggt 200379



 Score = 65.9 bits (33), Expect = 8e-08
 Identities = 73/87 (83%)
 Strand = Plus / Minus

                                                                          
Query: 274    tcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatg 333
              ||||| |||||||||| |||||||||||| ||   ||| |||||||| ||||||||| ||
Sbjct: 257190 tcgaaaatgtcgttgacgaaggagttcataatccccatagccttggacgagatgccggtg 257131

                                         
Query: 334    tccggntgcacctgcttgancaccttg 360
              || || || |||||||| | |||||||
Sbjct: 257130 tcggggtggacctgcttcagcaccttg 257104



 Score = 63.9 bits (32), Expect = 3e-07
 Identities = 50/56 (89%)
 Strand = Plus / Plus

                                                                      
Query: 274    tcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgcc 329
              |||||||||||||| | |||||| |||||||||  |||||||||||| ||||||||
Sbjct: 200429 tcgaagatgtcgttaacgaaggaattcatgatgcccatggccttggatgagatgcc 200484



 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 86/105 (81%)
 Strand = Plus / Minus

                                                                          
Query: 120    ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 179
              |||| |||||||||| |||||||||||||| || || ||||| ||||| ||||| |||||
Sbjct: 257344 ggtgtacttggtgaccgccttggtgccctccgacaccgcgtgtttggccagctccccggg 257285

                                                           
Query: 180    gaggacgaggcggacggaggtctggatctcccgggaggtgatggt 224
               || |  ||||| || |  || |||||||||| ||| ||||||||
Sbjct: 257284 tagcagcaggcgcacagccgtttggatctccctggaagtgatggt 257240



 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 72/87 (82%)
 Strand = Plus / Minus

                                                                          
Query: 274    tcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatg 333
              |||||||| |||||||  ||||| ||||||||   |||||| ||||||||||||||| ||
Sbjct: 235865 tcgaagatatcgttgacaaaggaattcatgatccccatggctttggaggagatgccggtg 235806

                                         
Query: 334    tccggntgcacctgcttgancaccttg 360
              || || || || ||||| | |||||||
Sbjct: 235805 tcggggtggacttgcttcagcaccttg 235779



 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 72/87 (82%)
 Strand = Plus / Minus

                                                                          
Query: 274    tcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatg 333
              ||||||||||||||||  ||||| ||||||||   |||||| || |||||||||||| ||
Sbjct: 168010 tcgaagatgtcgttgacaaaggaattcatgatccccatggctttagaggagatgccggtg 167951

                                         
Query: 334    tccggntgcacctgcttgancaccttg 360
              || || || ||||| || | |||||||
Sbjct: 167950 tcggggtggacctgtttcagcaccttg 167924



 Score = 46.1 bits (23), Expect = 0.078
 Identities = 66/81 (81%)
 Strand = Plus / Plus

                                                                          
Query: 280    atgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtccggn 339
              |||||||| | ||| || |||||||||  |||||||||||| ||||||||  |||| || 
Sbjct: 107638 atgtcgttaacgaaagaattcatgatgcccatggccttggaagagatgccagtgtcggga 107697

                                   
Query: 340    tgcacctgcttgancaccttg 360
              || ||||| || | |||||||
Sbjct: 107698 tggacctgtttcagcaccttg 107718



 Score = 40.1 bits (20), Expect = 4.8
 Identities = 80/100 (80%)
 Strand = Plus / Plus

                                                                         
Query: 125   acttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggagga 184
             ||||||| || ||||| ||||||||||| || || ||||| || ||||| || || || |
Sbjct: 27236 acttggtaactgccttagtgccctcggacacagcatgcttagccagctccccaggcagca 27295

                                                     
Query: 185   cgaggcggacggaggtctggatctcccgggaggtgatggt 224
               ||||| || |  ||||| ||||||| ||||||||||||
Sbjct: 27296 gcaggcgcacagccgtctgaatctccctggaggtgatggt 27335



to top

>ref|NG_000009.2| Homo sapiens small histone family cluster (HFS@) on chromosome 6
          Length = 91567

 Score =  105 bits (53), Expect = 1e-19
 Identities = 92/105 (87%)
 Strand = Plus / Plus

                                                                       
Query: 120 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 179
           |||| |||||||||||||||| ||||||||||| |||||||||||||| ||||| |||||
Sbjct: 621 ggtgtacttggtgacggcctttgtgccctcggacacggcgtgcttggccagctccccggg 680

                                                        
Query: 180 gaggacgaggcggacggaggtctggatctcccgggaggtgatggt 224
            || |  ||||| ||||  ||||||||||||| ||||||||||||
Sbjct: 681 cagcagcaggcgcacggccgtctggatctccctggaggtgatggt 725



 Score = 97.6 bits (49), Expect = 2e-17
 Identities = 91/105 (86%)
 Strand = Plus / Minus

                                                                         
Query: 120   ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 179
             |||| ||||||||||||||||||||||||| || || ||||||||||| ||||| || ||
Sbjct: 86914 ggtgtacttggtgacggccttggtgccctccgacaccgcgtgcttggccagctcccccgg 86855

                                                          
Query: 180   gaggacgaggcggacggaggtctggatctcccgggaggtgatggt 224
              || |  ||||| |||| |||||||||||||| ||||||||||||
Sbjct: 86854 aagcagcaggcgcacggcggtctggatctccctggaggtgatggt 86810



 Score = 89.7 bits (45), Expect = 6e-15
 Identities = 90/105 (85%)
 Strand = Plus / Plus

                                                                         
Query: 120   ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 179
             |||| ||||||||||||||||||||||||| || || ||||||||||| ||||| || ||
Sbjct: 55422 ggtgtacttggtgacggccttggtgccctccgacaccgcgtgcttggccagctcccctgg 55481

                                                          
Query: 180   gaggacgaggcggacggaggtctggatctcccgggaggtgatggt 224
              || |  ||||| ||||  ||||||||||||| ||||||||||||
Sbjct: 55482 cagcagcaggcgcacggccgtctggatctccctggaggtgatggt 55526



 Score = 81.8 bits (41), Expect = 1e-12
 Identities = 75/87 (86%)
 Strand = Plus / Minus

                                                                         
Query: 274   tcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatg 333
             |||||||||||||||| |||||||||||||||   ||||||||| || ||||||||| ||
Sbjct: 86760 tcgaagatgtcgttgacgaaggagttcatgattcccatggccttagaagagatgccggtg 86701

                                        
Query: 334   tccggntgcacctgcttgancaccttg 360
             || || || |||||||| | |||||||
Sbjct: 86700 tcggggtggacctgcttcagcaccttg 86674



 Score = 81.8 bits (41), Expect = 1e-12
 Identities = 75/87 (86%)
 Strand = Plus / Plus

                                                                         
Query: 274   tcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatg 333
             ||||||||||| |||| ||||||||||||||||  |||||||||||| ||||| ||| ||
Sbjct: 55576 tcgaagatgtcattgacgaaggagttcatgatgcccatggccttggacgagataccggtg 55635

                                        
Query: 334   tccggntgcacctgcttgancaccttg 360
             || || || |||||||| | |||||||
Sbjct: 55636 tcggggtggacctgcttcagcaccttg 55662



 Score = 79.8 bits (40), Expect = 6e-12
 Identities = 85/100 (85%)
 Strand = Plus / Plus

                                                                         
Query: 125   acttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggagga 184
             |||||||||||||||||||||||||||| |||||||||||||| |  || ||||| || |
Sbjct: 79045 acttggtgacggccttggtgccctcggacacggcgtgcttggccaattccccgggtagca 79104

                                                     
Query: 185   cgaggcggacggaggtctggatctcccgggaggtgatggt 224
               ||||| ||||  |||||||||||||  || ||||||||
Sbjct: 79105 gtaggcgcacggccgtctggatctccctcgaagtgatggt 79144



 Score = 75.8 bits (38), Expect = 9e-11
 Identities = 72/84 (85%)
 Strand = Plus / Plus

                                                                         
Query: 277   aagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtcc 336
             ||||||||||||| |||||||||||||||   ||| |||||||| ||||||||| |||| 
Sbjct: 79197 aagatgtcgttgacgaaggagttcatgattcccatagccttggaagagatgccggtgtcg 79256

                                     
Query: 337   ggntgcacctgcttgancaccttg 360
             || || |||||||| | |||||||
Sbjct: 79257 gggtggacctgcttcagcaccttg 79280



 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 71/84 (84%)
 Strand = Plus / Plus

                                                                       
Query: 277 aagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtcc 336
           |||||||| |||| ||||||||||||||||  ||||||||| || ||||||||| |||| 
Sbjct: 778 aagatgtcattgacgaaggagttcatgatgcccatggccttcgatgagatgccggtgtcg 837

                                   
Query: 337 ggntgcacctgcttgancaccttg 360
           || || || ||||| | |||||||
Sbjct: 838 gggtggacttgcttcagcaccttg 861



 Score = 44.1 bits (22), Expect = 0.31
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 199   gtctggatctcccgggaggtgatggt 224
             ||||||||||||| ||||||||||||
Sbjct: 30318 gtctggatctccctggaggtgatggt 30293



to top

>ref|NM_080593.1| Homo sapiens histone 1, H2bk (HIST1H2BK), mRNA
          Length = 820

 Score =  105 bits (53), Expect = 1e-19
 Identities = 92/105 (87%)
 Strand = Plus / Minus

                                                                       
Query: 120 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 179
           |||| |||||||||||||||||||||||||||| |||||||||||||| | ||| |||||
Sbjct: 411 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccaactccccggg 352

                                                        
Query: 180 gaggacgaggcggacggaggtctggatctcccgggaggtgatggt 224
            || |  ||||| ||||  ||||||||||||| ||||||||||||
Sbjct: 351 cagcagcaggcgcacggccgtctggatctccctggaggtgatggt 307



 Score = 89.7 bits (45), Expect = 6e-15
 Identities = 76/87 (87%)
 Strand = Plus / Minus

                                                                       
Query: 274 tcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatg 333
           |||||||||||||||| |||||||||||||||   ||||||||| |||||||||||| ||
Sbjct: 257 tcgaagatgtcgttgacgaaggagttcatgattcccatggccttagaggagatgccggtg 198

                                      
Query: 334 tccggntgcacctgcttgancaccttg 360
           || || || |||||||| | |||||||
Sbjct: 197 tcggggtggacctgcttcagcaccttg 171



to top

>ref|NM_003526.2| Homo sapiens histone 1, H2bc (HIST1H2BC), mRNA
          Length = 438

 Score =  105 bits (53), Expect = 1e-19
 Identities = 92/105 (87%)
 Strand = Plus / Minus

                                                                       
Query: 120 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 179
           |||| ||||||||||||||||||||||||| || |||||||||||||| ||||| |||||
Sbjct: 369 ggtgtacttggtgacggccttggtgccctccgacacggcgtgcttggccagctctccggg 310

                                                        
Query: 180 gaggacgaggcggacggaggtctggatctcccgggaggtgatggt 224
            || |  ||||| ||||  ||||||||||||| ||||||||||||
Sbjct: 309 aagcagcaggcgcacggccgtctggatctccctggaggtgatggt 265



 Score = 46.1 bits (23), Expect = 0.078
 Identities = 66/81 (81%)
 Strand = Plus / Minus

                                                                       
Query: 280 atgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtccggn 339
           |||||||| | ||| || |||||||||  |||||||||||| ||||||||  |||| || 
Sbjct: 209 atgtcgttaacgaaagaattcatgatgcccatggccttggaagagatgccagtgtcggga 150

                                
Query: 340 tgcacctgcttgancaccttg 360
           || ||||| || | |||||||
Sbjct: 149 tggacctgtttcagcaccttg 129



to top

>gb|BC009612.1| Homo sapiens histone 1, H2bc, mRNA (cDNA clone IMAGE:4102077), with
           apparent retained intron
          Length = 1178

 Score =  105 bits (53), Expect = 1e-19
 Identities = 92/105 (87%)
 Strand = Plus / Minus

                                                                       
Query: 120 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 179
           |||| ||||||||||||||||||||||||| || |||||||||||||| ||||| |||||
Sbjct: 391 ggtgtacttggtgacggccttggtgccctccgacacggcgtgcttggccagctctccggg 332

                                                        
Query: 180 gaggacgaggcggacggaggtctggatctcccgggaggtgatggt 224
            || |  ||||| ||||  ||||||||||||| ||||||||||||
Sbjct: 331 aagcagcaggcgcacggccgtctggatctccctggaggtgatggt 287



 Score = 46.1 bits (23), Expect = 0.078
 Identities = 66/81 (81%)
 Strand = Plus / Minus

                                                                       
Query: 280 atgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtccggn 339
           |||||||| | ||| || |||||||||  |||||||||||| ||||||||  |||| || 
Sbjct: 231 atgtcgttaacgaaagaattcatgatgcccatggccttggaagagatgccagtgtcggga 172

                                
Query: 340 tgcacctgcttgancaccttg 360
           || ||||| || | |||||||
Sbjct: 171 tggacctgtttcagcaccttg 151



to top

>ref|XM_535910.2| PREDICTED: Canis familiaris similar to Histone H2B 291B, transcript
           variant 1 (LOC478743), mRNA
          Length = 1047

 Score =  105 bits (53), Expect = 1e-19
 Identities = 92/105 (87%)
 Strand = Plus / Minus

                                                                       
Query: 120 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 179
           |||| |||||||||||||||||||||||||||| |||||||||||||| ||||| |||||
Sbjct: 393 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctccccggg 334

                                                        
Query: 180 gaggacgaggcggacggaggtctggatctcccgggaggtgatggt 224
            || |  ||||| ||||  ||||||||||||| ||| ||||||||
Sbjct: 333 cagcagcaggcgcacggccgtctggatctccctggacgtgatggt 289



 Score = 89.7 bits (45), Expect = 6e-15
 Identities = 76/87 (87%)
 Strand = Plus / Minus

                                                                       
Query: 274 tcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatg 333
           |||||||||||||||| ||| ||||||||||||  |||||||||||| ||||||||  ||
Sbjct: 239 tcgaagatgtcgttgacgaacgagttcatgatgcccatggccttggacgagatgcccgtg 180

                                      
Query: 334 tccggntgcacctgcttgancaccttg 360
           || || ||||||||||| | |||||||
Sbjct: 179 tcggggtgcacctgcttcagcaccttg 153



to top

>ref|XM_843136.1| PREDICTED: Canis familiaris similar to Histone H2B 291B, transcript
           variant 2 (LOC478743), mRNA
          Length = 487

 Score =  105 bits (53), Expect = 1e-19
 Identities = 92/105 (87%)
 Strand = Plus / Minus

                                                                       
Query: 120 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 179
           |||| |||||||||||||||||||||||||||| |||||||||||||| ||||| |||||
Sbjct: 393 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctccccggg 334

                                                        
Query: 180 gaggacgaggcggacggaggtctggatctcccgggaggtgatggt 224
            || |  ||||| ||||  ||||||||||||| ||| ||||||||
Sbjct: 333 cagcagcaggcgcacggccgtctggatctccctggacgtgatggt 289



 Score = 89.7 bits (45), Expect = 6e-15
 Identities = 76/87 (87%)
 Strand = Plus / Minus

                                                                       
Query: 274 tcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatg 333
           |||||||||||||||| ||| ||||||||||||  |||||||||||| ||||||||  ||
Sbjct: 239 tcgaagatgtcgttgacgaacgagttcatgatgcccatggccttggacgagatgcccgtg 180

                                      
Query: 334 tccggntgcacctgcttgancaccttg 360
           || || ||||||||||| | |||||||
Sbjct: 179 tcggggtgcacctgcttcagcaccttg 153



to top

>ref|XM_849151.1| PREDICTED: Canis familiaris similar to Histone H2B 291B
           (LOC611482), mRNA
          Length = 386

 Score =  105 bits (53), Expect = 1e-19
 Identities = 92/105 (87%)
 Strand = Plus / Minus

                                                                       
Query: 120 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 179
           |||| |||||||||||||||||||||||||||| |||||||||||||| ||||| |||||
Sbjct: 374 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctccccggg 315

                                                        
Query: 180 gaggacgaggcggacggaggtctggatctcccgggaggtgatggt 224
            || |  ||||| ||||  ||||||||||||| ||| ||||||||
Sbjct: 314 cagcagcaggcgcacggccgtctggatctccctggacgtgatggt 270



 Score = 89.7 bits (45), Expect = 6e-15
 Identities = 76/87 (87%)
 Strand = Plus / Minus

                                                                       
Query: 274 tcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatg 333
           |||||||||||||||| ||| ||||||||||||  |||||||||||| ||||||||  ||
Sbjct: 220 tcgaagatgtcgttgacgaacgagttcatgatgcccatggccttggacgagatgcccgtg 161

                                      
Query: 334 tccggntgcacctgcttgancaccttg 360
           || || ||||||||||| | |||||||
Sbjct: 160 tcggggtgcacctgcttcagcaccttg 134



to top

>ref|XM_849134.1| PREDICTED: Canis familiaris similar to Histone H2B 291B
           (LOC611465), mRNA
          Length = 388

 Score =  105 bits (53), Expect = 1e-19
 Identities = 92/105 (87%)
 Strand = Plus / Minus

                                                                       
Query: 120 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 179
           |||| |||||||||||||||||||||||||||| |||||||||||||| ||||| |||||
Sbjct: 376 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctccccggg 317

                                                        
Query: 180 gaggacgaggcggacggaggtctggatctcccgggaggtgatggt 224
            || |  ||||| ||||  ||||||||||||| ||| ||||||||
Sbjct: 316 cagcagcaggcgcacggccgtctggatctccctggacgtgatggt 272



 Score = 89.7 bits (45), Expect = 6e-15
 Identities = 76/87 (87%)
 Strand = Plus / Minus

                                                                       
Query: 274 tcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatg 333
           |||||||||||||||| ||| ||||||||||||  |||||||||||| ||||||||  ||
Sbjct: 222 tcgaagatgtcgttgacgaacgagttcatgatgcccatggccttggacgagatgcccgtg 163

                                      
Query: 334 tccggntgcacctgcttgancaccttg 360
           || || ||||||||||| | |||||||
Sbjct: 162 tcggggtgcacctgcttcagcaccttg 136



to top

>ref|XM_545412.2| PREDICTED: Canis familiaris similar to H2B histone family, member T
           (LOC488290), mRNA
          Length = 421

 Score =  105 bits (53), Expect = 1e-19
 Identities = 92/105 (87%)
 Strand = Plus / Minus

                                                                       
Query: 120 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 179
           |||| |||||||||||||||||||||||||||| |||||||||||||| ||||| |||||
Sbjct: 376 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctccccggg 317

                                                        
Query: 180 gaggacgaggcggacggaggtctggatctcccgggaggtgatggt 224
            || |  ||||| ||||  ||||||||||||| ||| ||||||||
Sbjct: 316 cagcagcaggcgcacggccgtctggatctccctggacgtgatggt 272



 Score = 89.7 bits (45), Expect = 6e-15
 Identities = 76/87 (87%)
 Strand = Plus / Minus

                                                                       
Query: 274 tcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatg 333
           |||||||||||||||| ||| ||||||||||||  |||||||||||| ||||||||  ||
Sbjct: 222 tcgaagatgtcgttgacgaacgagttcatgatgcccatggccttggacgagatgcccgtg 163

                                      
Query: 334 tccggntgcacctgcttgancaccttg 360
           || || ||||||||||| | |||||||
Sbjct: 162 tcggggtgcacctgcttcagcaccttg 136



to top

>ref|XM_545410.2| PREDICTED: Canis familiaris similar to H2B histone family, member R
           (LOC488288), mRNA
          Length = 384

 Score =  105 bits (53), Expect = 1e-19
 Identities = 92/105 (87%)
 Strand = Plus / Minus

                                                                       
Query: 120 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 179
           |||| |||||||||||||||||||||||||||| |||||||||||||| ||||| |||||
Sbjct: 372 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctccccggg 313

                                                        
Query: 180 gaggacgaggcggacggaggtctggatctcccgggaggtgatggt 224
            || |  ||||| ||||  ||||||||||||| ||| ||||||||
Sbjct: 312 cagcagcaggcgcacggccgtctggatctccctggacgtgatggt 268



 Score = 89.7 bits (45), Expect = 6e-15
 Identities = 76/87 (87%)
 Strand = Plus / Minus

                                                                       
Query: 274 tcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatg 333
           |||||||||||||||| ||| ||||||||||||  |||||||||||| ||||||||  ||
Sbjct: 218 tcgaagatgtcgttgacgaacgagttcatgatgcccatggccttggacgagatgcccgtg 159

                                      
Query: 334 tccggntgcacctgcttgancaccttg 360
           || || ||||||||||| | |||||||
Sbjct: 158 tcggggtgcacctgcttcagcaccttg 132



to top

>ref|XM_545401.2| PREDICTED: Canis familiaris similar to H2B histone family, member F
           (LOC488279), mRNA
          Length = 513

 Score =  105 bits (53), Expect = 1e-19
 Identities = 92/105 (87%)
 Strand = Plus / Minus

                                                                       
Query: 120 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 179
           |||| |||||||||||||||||||||||||||| |||||||||||||| ||||| |||||
Sbjct: 438 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctccccggg 379

                                                        
Query: 180 gaggacgaggcggacggaggtctggatctcccgggaggtgatggt 224
            || |  ||||| ||||  ||||||||||||| ||| ||||||||
Sbjct: 378 cagcagcaggcgcacggccgtctggatctccctggacgtgatggt 334



 Score = 89.7 bits (45), Expect = 6e-15
 Identities = 76/87 (87%)
 Strand = Plus / Minus

                                                                       
Query: 274 tcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatg 333
           |||||||||||||||| ||| ||||||||||||  |||||||||||| ||||||||  ||
Sbjct: 284 tcgaagatgtcgttgacgaacgagttcatgatgcccatggccttggacgagatgcccgtg 225

                                      
Query: 334 tccggntgcacctgcttgancaccttg 360
           || || ||||||||||| | |||||||
Sbjct: 224 tcggggtgcacctgcttcagcaccttg 198



to top

>ref|XM_545398.2| PREDICTED: Canis familiaris similar to Histone H2B 291B
           (LOC488276), mRNA
          Length = 438

 Score =  105 bits (53), Expect = 1e-19
 Identities = 92/105 (87%)
 Strand = Plus / Minus

                                                                       
Query: 120 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 179
           |||| |||||||||||||||||||||||||||| |||||||||||||| ||||| |||||
Sbjct: 376 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctccccggg 317

                                                        
Query: 180 gaggacgaggcggacggaggtctggatctcccgggaggtgatggt 224
            || |  ||||| ||||  ||||||||||||| ||| ||||||||
Sbjct: 316 cagcagcaggcgcacggccgtctggatctccctggacgtgatggt 272



 Score = 89.7 bits (45), Expect = 6e-15
 Identities = 76/87 (87%)
 Strand = Plus / Minus

                                                                       
Query: 274 tcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatg 333
           |||||||||||||||| ||| ||||||||||||  |||||||||||| ||||||||  ||
Sbjct: 222 tcgaagatgtcgttgacgaacgagttcatgatgcccatggccttggacgagatgcccgtg 163

                                      
Query: 334 tccggntgcacctgcttgancaccttg 360
           || || ||||||||||| | |||||||
Sbjct: 162 tcggggtgcacctgcttcagcaccttg 136



to top

>ref|XM_848802.1| PREDICTED: Canis familiaris similar to H2B histone family, member T
           (LOC611158), mRNA
          Length = 883

 Score =  105 bits (53), Expect = 1e-19
 Identities = 92/105 (87%)
 Strand = Plus / Minus

                                                                       
Query: 120 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 179
           |||| |||||||||||||||||||||||||||| |||||||||||||| ||||| |||||
Sbjct: 363 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctccccggg 304

                                                        
Query: 180 gaggacgaggcggacggaggtctggatctcccgggaggtgatggt 224
            || |  ||||| ||||  ||||||||||||| ||| ||||||||
Sbjct: 303 cagcagcaggcgcacggccgtctggatctccctggacgtgatggt 259



 Score = 89.7 bits (45), Expect = 6e-15
 Identities = 76/87 (87%)
 Strand = Plus / Minus

                                                                       
Query: 274 tcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatg 333
           |||||||||||||||| ||| ||||||||||||  |||||||||||| ||||||||  ||
Sbjct: 209 tcgaagatgtcgttgacgaacgagttcatgatgcccatggccttggacgagatgcccgtg 150

                                      
Query: 334 tccggntgcacctgcttgancaccttg 360
           || || ||||||||||| | |||||||
Sbjct: 149 tcggggtgcacctgcttcagcaccttg 123



to top

>ref|XM_545418.1| PREDICTED: Canis familiaris similar to Histone H2B 291B
           (LOC488296), mRNA
          Length = 381

 Score =  105 bits (53), Expect = 1e-19
 Identities = 92/105 (87%)
 Strand = Plus / Minus

                                                                       
Query: 120 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 179
           |||| |||||||||||||||||||||||||||| |||||||||||||| ||||| |||||
Sbjct: 369 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctccccggg 310

                                                        
Query: 180 gaggacgaggcggacggaggtctggatctcccgggaggtgatggt 224
            || |  ||||| ||||  ||||||||||||| ||| ||||||||
Sbjct: 309 cagcagcaggcgcacggccgtctggatctccctggacgtgatggt 265



 Score = 89.7 bits (45), Expect = 6e-15
 Identities = 76/87 (87%)
 Strand = Plus / Minus

                                                                       
Query: 274 tcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatg 333
           |||||||||||||||| ||| ||||||||||||  |||||||||||| ||||||||  ||
Sbjct: 215 tcgaagatgtcgttgacgaacgagttcatgatgcccatggccttggacgagatgcccgtg 156

                                      
Query: 334 tccggntgcacctgcttgancaccttg 360
           || || ||||||||||| | |||||||
Sbjct: 155 tcggggtgcacctgcttcagcaccttg 129



to top

>ref|XM_848724.1| PREDICTED: Canis familiaris similar to H2B histone family, member F
           (LOC611089), mRNA
          Length = 381

 Score =  105 bits (53), Expect = 1e-19
 Identities = 92/105 (87%)
 Strand = Plus / Minus

                                                                       
Query: 120 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 179
           |||| |||||||||||||||||||||||||||| |||||||||||||| ||||| |||||
Sbjct: 369 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctccccggg 310

                                                        
Query: 180 gaggacgaggcggacggaggtctggatctcccgggaggtgatggt 224
            || |  ||||| ||||  ||||||||||||| ||| ||||||||
Sbjct: 309 cagcagcaggcgcacggccgtctggatctccctggacgtgatggt 265



 Score = 89.7 bits (45), Expect = 6e-15
 Identities = 76/87 (87%)
 Strand = Plus / Minus

                                                                       
Query: 274 tcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatg 333
           |||||||||||||||| ||| ||||||||||||  |||||||||||| ||||||||  ||
Sbjct: 215 tcgaagatgtcgttgacgaacgagttcatgatgcccatggccttggacgagatgcccgtg 156

                                      
Query: 334 tccggntgcacctgcttgancaccttg 360
           || || ||||||||||| | |||||||
Sbjct: 155 tcggggtgcacctgcttcagcaccttg 129



to top

>ref|XM_545375.1| PREDICTED: Canis familiaris similar to testis-specific histone 2b
           (LOC488253), mRNA
          Length = 384

 Score =  105 bits (53), Expect = 1e-19
 Identities = 92/105 (87%)
 Strand = Plus / Minus

                                                                       
Query: 120 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 179
           |||| |||||||||||||||||||||||||||| |||||||||||||| ||||| |||||
Sbjct: 372 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctccccggg 313

                                                        
Query: 180 gaggacgaggcggacggaggtctggatctcccgggaggtgatggt 224
            || |  ||||| ||||  ||||||||||||| ||| ||||||||
Sbjct: 312 cagcagcaggcgcacggccgtctggatctccctggacgtgatggt 268



 Score = 87.7 bits (44), Expect = 2e-14
 Identities = 75/86 (87%)
 Strand = Plus / Minus

                                                                       
Query: 274 tcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatg 333
           |||||||||||||||| ||| ||||||||||||  |||||||||||| ||||||||  ||
Sbjct: 218 tcgaagatgtcgttgacgaacgagttcatgatgcccatggccttggacgagatgcccgtg 159

                                     
Query: 334 tccggntgcacctgcttgancacctt 359
           || || ||||||||||| | ||||||
Sbjct: 158 tcggggtgcacctgcttcagcacctt 133



to top

>ref|XM_545374.2| PREDICTED: Canis familiaris similar to testis-specific histone 2b
           (LOC488252), mRNA
          Length = 384

 Score =  105 bits (53), Expect = 1e-19
 Identities = 92/105 (87%)
 Strand = Plus / Minus

                                                                       
Query: 120 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 179
           |||| |||||||||||||||||||||||||||| |||||||||||||| ||||| |||||
Sbjct: 372 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctccccggg 313

                                                        
Query: 180 gaggacgaggcggacggaggtctggatctcccgggaggtgatggt 224
            || |  ||||| ||||  ||||||||||||| ||| ||||||||
Sbjct: 312 cagcagcaggcgcacggccgtctggatctccctggacgtgatggt 268



 Score = 89.7 bits (45), Expect = 6e-15
 Identities = 76/87 (87%)
 Strand = Plus / Minus

                                                                       
Query: 274 tcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatg 333
           |||||||||||||||| ||| ||||||||||||  |||||||||||| ||||||||  ||
Sbjct: 218 tcgaagatgtcgttgacgaacgagttcatgatgcccatggccttggacgagatgcccgtg 159

                                      
Query: 334 tccggntgcacctgcttgancaccttg 360
           || || ||||||||||| | |||||||
Sbjct: 158 tcggggtgcacctgcttcagcaccttg 132



to top

>ref|XM_844623.1| PREDICTED: Canis familiaris similar to Histone H2B 291B, transcript
           variant 1 (LOC608682), mRNA
          Length = 342

 Score =  105 bits (53), Expect = 1e-19
 Identities = 92/105 (87%)
 Strand = Plus / Minus

                                                                       
Query: 120 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 179
           |||| |||||||||||||||||||||||||||| |||||||||||||| ||||| |||||
Sbjct: 330 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctccccggg 271

                                                        
Query: 180 gaggacgaggcggacggaggtctggatctcccgggaggtgatggt 224
            || |  ||||| ||||  ||||||||||||| ||| ||||||||
Sbjct: 270 cagcagcaggcgcacggccgtctggatctccctggacgtgatggt 226



 Score = 89.7 bits (45), Expect = 6e-15
 Identities = 76/87 (87%)
 Strand = Plus / Minus

                                                                       
Query: 274 tcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatg 333
           |||||||||||||||| ||| ||||||||||||  |||||||||||| ||||||||  ||
Sbjct: 176 tcgaagatgtcgttgacgaacgagttcatgatgcccatggccttggacgagatgcccgtg 117

                                      
Query: 334 tccggntgcacctgcttgancaccttg 360
           || || ||||||||||| | |||||||
Sbjct: 116 tcggggtgcacctgcttcagcaccttg 90



to top

>ref|XM_854475.1| PREDICTED: Canis familiaris similar to Histone H2B 291B, transcript
           variant 2 (LOC608682), mRNA
          Length = 383

 Score =  105 bits (53), Expect = 1e-19
 Identities = 92/105 (87%)
 Strand = Plus / Minus

                                                                       
Query: 120 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 179
           |||| |||||||||||||||||||||||||||| |||||||||||||| ||||| |||||
Sbjct: 371 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctccccggg 312

                                                        
Query: 180 gaggacgaggcggacggaggtctggatctcccgggaggtgatggt 224
            || |  ||||| ||||  ||||||||||||| ||| ||||||||
Sbjct: 311 cagcagcaggcgcacggccgtctggatctccctggacgtgatggt 267



 Score = 89.7 bits (45), Expect = 6e-15
 Identities = 76/87 (87%)
 Strand = Plus / Minus

                                                                       
Query: 274 tcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatg 333
           |||||||||||||||| ||| ||||||||||||  |||||||||||| ||||||||  ||
Sbjct: 217 tcgaagatgtcgttgacgaacgagttcatgatgcccatggccttggacgagatgcccgtg 158

                                      
Query: 334 tccggntgcacctgcttgancaccttg 360
           || || ||||||||||| | |||||||
Sbjct: 157 tcggggtgcacctgcttcagcaccttg 131



to top

>ref|XM_854447.1| PREDICTED: Canis familiaris similar to H2B histone family, member
           T, transcript variant 3 (LOC488303), mRNA
          Length = 651

 Score =  105 bits (53), Expect = 1e-19
 Identities = 92/105 (87%)
 Strand = Plus / Minus

                                                                       
Query: 120 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 179
           |||| |||||||||||||||||||||||||||| |||||||||||||| ||||| |||||
Sbjct: 385 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctccccggg 326

                                                        
Query: 180 gaggacgaggcggacggaggtctggatctcccgggaggtgatggt 224
            || |  ||||| ||||  ||||||||||||| ||| ||||||||
Sbjct: 325 cagcagcaggcgcacggccgtctggatctccctggacgtgatggt 281



 Score = 89.7 bits (45), Expect = 6e-15
 Identities = 76/87 (87%)
 Strand = Plus / Minus

                                                                       
Query: 274 tcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatg 333
           |||||||||||||||| ||| ||||||||||||  |||||||||||| ||||||||  ||
Sbjct: 231 tcgaagatgtcgttgacgaacgagttcatgatgcccatggccttggacgagatgcccgtg 172

                                      
Query: 334 tccggntgcacctgcttgancaccttg 360
           || || ||||||||||| | |||||||
Sbjct: 171 tcggggtgcacctgcttcagcaccttg 145



to top

>ref|XM_545425.2| PREDICTED: Canis familiaris similar to H2B histone family, member
           T, transcript variant 2 (LOC488303), mRNA
          Length = 442

 Score =  105 bits (53), Expect = 1e-19
 Identities = 92/105 (87%)
 Strand = Plus / Minus

                                                                       
Query: 120 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 179
           |||| |||||||||||||||||||||||||||| |||||||||||||| ||||| |||||
Sbjct: 369 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctccccggg 310

                                                        
Query: 180 gaggacgaggcggacggaggtctggatctcccgggaggtgatggt 224
            || |  ||||| ||||  ||||||||||||| ||| ||||||||
Sbjct: 309 cagcagcaggcgcacggccgtctggatctccctggacgtgatggt 265



 Score = 89.7 bits (45), Expect = 6e-15
 Identities = 76/87 (87%)
 Strand = Plus / Minus

                                                                       
Query: 274 tcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatg 333
           |||||||||||||||| ||| ||||||||||||  |||||||||||| ||||||||  ||
Sbjct: 215 tcgaagatgtcgttgacgaacgagttcatgatgcccatggccttggacgagatgcccgtg 156

                                      
Query: 334 tccggntgcacctgcttgancaccttg 360
           || || ||||||||||| | |||||||
Sbjct: 155 tcggggtgcacctgcttcagcaccttg 129



to top

>ref|XM_854265.1| PREDICTED: Canis familiaris similar to Histone H2B 291B, transcript
           variant 2 (LOC488267), mRNA
          Length = 440

 Score =  105 bits (53), Expect = 1e-19
 Identities = 92/105 (87%)
 Strand = Plus / Minus

                                                                       
Query: 120 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 179
           |||| |||||||||||||||||||||||||||| |||||||||||||| ||||| |||||
Sbjct: 377 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctccccggg 318

                                                        
Query: 180 gaggacgaggcggacggaggtctggatctcccgggaggtgatggt 224
            || |  ||||| ||||  ||||||||||||| ||| ||||||||
Sbjct: 317 cagcagcaggcgcacggccgtctggatctccctggacgtgatggt 273



 Score = 89.7 bits (45), Expect = 6e-15
 Identities = 76/87 (87%)
 Strand = Plus / Minus

                                                                       
Query: 274 tcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatg 333
           |||||||||||||||| ||| ||||||||||||  |||||||||||| ||||||||  ||
Sbjct: 223 tcgaagatgtcgttgacgaacgagttcatgatgcccatggccttggacgagatgcccgtg 164

                                      
Query: 334 tccggntgcacctgcttgancaccttg 360
           || || ||||||||||| | |||||||
Sbjct: 163 tcggggtgcacctgcttcagcaccttg 137



to top

>ref|XM_545389.2| PREDICTED: Canis familiaris similar to Histone H2B 291B, transcript
           variant 1 (LOC488267), mRNA
          Length = 1108

 Score =  105 bits (53), Expect = 1e-19
 Identities = 92/105 (87%)
 Strand = Plus / Minus

                                                                       
Query: 120 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 179
           |||| |||||||||||||||||||||||||||| |||||||||||||| ||||| |||||
Sbjct: 377 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctccccggg 318

                                                        
Query: 180 gaggacgaggcggacggaggtctggatctcccgggaggtgatggt 224
            || |  ||||| ||||  ||||||||||||| ||| ||||||||
Sbjct: 317 cagcagcaggcgcacggccgtctggatctccctggacgtgatggt 273



 Score = 89.7 bits (45), Expect = 6e-15
 Identities = 76/87 (87%)
 Strand = Plus / Minus

                                                                       
Query: 274 tcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatg 333
           |||||||||||||||| ||| ||||||||||||  |||||||||||| ||||||||  ||
Sbjct: 223 tcgaagatgtcgttgacgaacgagttcatgatgcccatggccttggacgagatgcccgtg 164

                                      
Query: 334 tccggntgcacctgcttgancaccttg 360
           || || ||||||||||| | |||||||
Sbjct: 163 tcggggtgcacctgcttcagcaccttg 137



to top

>ref|XM_854155.1| PREDICTED: Canis familiaris similar to histone 1, H2ai (predicted),
           transcript variant 3 (LOC480760), mRNA
          Length = 862

 Score =  105 bits (53), Expect = 1e-19
 Identities = 92/105 (87%)
 Strand = Plus / Minus

                                                                       
Query: 120 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 179
           |||| |||||||||||||||||||||||||||| |||||||||||||| ||||| |||||
Sbjct: 768 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctccccggg 709

                                                        
Query: 180 gaggacgaggcggacggaggtctggatctcccgggaggtgatggt 224
            || |  ||||| ||||  ||||||||||||| ||| ||||||||
Sbjct: 708 cagcagcaggcgcacggccgtctggatctccctggacgtgatggt 664



 Score = 89.7 bits (45), Expect = 6e-15
 Identities = 76/87 (87%)
 Strand = Plus / Minus

                                                                       
Query: 274 tcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatg 333
           |||||||||||||||| ||| ||||||||||||  |||||||||||| ||||||||  ||
Sbjct: 614 tcgaagatgtcgttgacgaacgagttcatgatgcccatggccttggacgagatgcccgtg 555

                                      
Query: 334 tccggntgcacctgcttgancaccttg 360
           || || ||||||||||| | |||||||
Sbjct: 554 tcggggtgcacctgcttcagcaccttg 528



to top

>ref|XM_854116.1| PREDICTED: Canis familiaris similar to histone 1, H2ai (predicted),
           transcript variant 2 (LOC480760), mRNA
          Length = 487

 Score =  105 bits (53), Expect = 1e-19
 Identities = 92/105 (87%)
 Strand = Plus / Minus

                                                                       
Query: 120 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 179
           |||| |||||||||||||||||||||||||||| |||||||||||||| ||||| |||||
Sbjct: 393 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctccccggg 334

                                                        
Query: 180 gaggacgaggcggacggaggtctggatctcccgggaggtgatggt 224
            || |  ||||| ||||  ||||||||||||| ||| ||||||||
Sbjct: 333 cagcagcaggcgcacggccgtctggatctccctggacgtgatggt 289



 Score = 89.7 bits (45), Expect = 6e-15
 Identities = 76/87 (87%)
 Strand = Plus / Minus

                                                                       
Query: 274 tcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatg 333
           |||||||||||||||| ||| ||||||||||||  |||||||||||| ||||||||  ||
Sbjct: 239 tcgaagatgtcgttgacgaacgagttcatgatgcccatggccttggacgagatgcccgtg 180

                                      
Query: 334 tccggntgcacctgcttgancaccttg 360
           || || ||||||||||| | |||||||
Sbjct: 179 tcggggtgcacctgcttcagcaccttg 153



to top

>ref|XM_537880.2| PREDICTED: Canis familiaris similar to histone 1, H2ai (predicted),
           transcript variant 1 (LOC480760), mRNA
          Length = 1422

 Score =  105 bits (53), Expect = 1e-19
 Identities = 92/105 (87%)
 Strand = Plus / Minus

                                                                       
Query: 120 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 179
           |||| |||||||||||||||||||||||||||| |||||||||||||| ||||| |||||
Sbjct: 768 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctccccggg 709

                                                        
Query: 180 gaggacgaggcggacggaggtctggatctcccgggaggtgatggt 224
            || |  ||||| ||||  ||||||||||||| ||| ||||||||
Sbjct: 708 cagcagcaggcgcacggccgtctggatctccctggacgtgatggt 664



 Score = 89.7 bits (45), Expect = 6e-15
 Identities = 76/87 (87%)
 Strand = Plus / Minus

                                                                       
Query: 274 tcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatg 333
           |||||||||||||||| ||| ||||||||||||  |||||||||||| ||||||||  ||
Sbjct: 614 tcgaagatgtcgttgacgaacgagttcatgatgcccatggccttggacgagatgcccgtg 555

                                      
Query: 334 tccggntgcacctgcttgancaccttg 360
           || || ||||||||||| | |||||||
Sbjct: 554 tcggggtgcacctgcttcagcaccttg 528



to top

>gb|BC038854.1| Homo sapiens SECIS binding protein 2, mRNA (cDNA clone
           IMAGE:5209694), with apparent retained intron
          Length = 1740

 Score =  105 bits (53), Expect = 1e-19
 Identities = 92/105 (87%)
 Strand = Plus / Minus

                                                                       
Query: 120 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 179
           |||| ||||||||||||||||||||||||| || |||||||||||||| ||||| |||||
Sbjct: 370 ggtgtacttggtgacggccttggtgccctccgacacggcgtgcttggccagctctccggg 311

                                                        
Query: 180 gaggacgaggcggacggaggtctggatctcccgggaggtgatggt 224
            || |  ||||| ||||  ||||||||||||| ||||||||||||
Sbjct: 310 aagcagcaggcgcacggccgtctggatctccctggaggtgatggt 266



 Score = 46.1 bits (23), Expect = 0.078
 Identities = 66/81 (81%)
 Strand = Plus / Minus

                                                                       
Query: 280 atgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtccggn 339
           |||||||| | ||| || |||||||||  |||||||||||| ||||||||  |||| || 
Sbjct: 210 atgtcgttaacgaaagaattcatgatgcccatggccttggaagagatgccagtgtcggga 151

                                
Query: 340 tgcacctgcttgancaccttg 360
           || ||||| || | |||||||
Sbjct: 150 tggacctgtttcagcaccttg 130



to top

>gb|AF531298.1| Homo sapiens histone H2B (HIST1H2BO) gene, complete cds
          Length = 1137

 Score =  105 bits (53), Expect = 1e-19
 Identities = 92/105 (87%)
 Strand = Plus / Minus

                                                                       
Query: 120 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 179
           |||| |||||||||||||||| ||||||||||| |||||||||||||| ||||| |||||
Sbjct: 749 ggtgtacttggtgacggcctttgtgccctcggacacggcgtgcttggccagctccccggg 690

                                                        
Query: 180 gaggacgaggcggacggaggtctggatctcccgggaggtgatggt 224
            || |  ||||| ||||  ||||||||||||| ||||||||||||
Sbjct: 689 cagcagcaggcgcacggccgtctggatctccctggaggtgatggt 645



 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 71/84 (84%)
 Strand = Plus / Minus

                                                                       
Query: 277 aagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtcc 336
           |||||||| |||| ||||||||||||||||  ||||||||| || ||||||||| |||| 
Sbjct: 592 aagatgtcattgacgaaggagttcatgatgcccatggccttcgatgagatgccggtgtcg 533

                                   
Query: 337 ggntgcacctgcttgancaccttg 360
           || || || ||||| | |||||||
Sbjct: 532 gggtggacttgcttcagcaccttg 509



to top

>gb|AF531294.1| Homo sapiens histone H2B (HIST1H2BK) gene, complete cds
          Length = 1137

 Score =  105 bits (53), Expect = 1e-19
 Identities = 92/105 (87%)
 Strand = Plus / Minus

                                                                       
Query: 120 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 179
           |||| |||||||||||||||||||||||||||| |||||||||||||| | ||| |||||
Sbjct: 748 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccaactccccggg 689

                                                        
Query: 180 gaggacgaggcggacggaggtctggatctcccgggaggtgatggt 224
            || |  ||||| ||||  ||||||||||||| ||||||||||||
Sbjct: 688 cagcagcaggcgcacggccgtctggatctccctggaggtgatggt 644



 Score = 89.7 bits (45), Expect = 6e-15
 Identities = 76/87 (87%)
 Strand = Plus / Minus

                                                                       
Query: 274 tcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatg 333
           |||||||||||||||| |||||||||||||||   ||||||||| |||||||||||| ||
Sbjct: 594 tcgaagatgtcgttgacgaaggagttcatgattcccatggccttagaggagatgccggtg 535

                                      
Query: 334 tccggntgcacctgcttgancaccttg 360
           || || || |||||||| | |||||||
Sbjct: 534 tcggggtggacctgcttcagcaccttg 508



to top

>gb|AF531286.1| Homo sapiens histone H2B (HIST1H2BC) gene, complete cds
          Length = 1137

 Score =  105 bits (53), Expect = 1e-19
 Identities = 92/105 (87%)
 Strand = Plus / Minus

                                                                       
Query: 120 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 179
           |||| ||||||||||||||||||||||||| || |||||||||||||| ||||| |||||
Sbjct: 748 ggtgtacttggtgacggccttggtgccctccgacacggcgtgcttggccagctctccggg 689

                                                        
Query: 180 gaggacgaggcggacggaggtctggatctcccgggaggtgatggt 224
            || |  ||||| ||||  ||||||||||||| ||||||||||||
Sbjct: 688 aagcagcaggcgcacggccgtctggatctccctggaggtgatggt 644



 Score = 46.1 bits (23), Expect = 0.078
 Identities = 66/81 (81%)
 Strand = Plus / Minus

                                                                       
Query: 280 atgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtccggn 339
           |||||||| | ||| || |||||||||  |||||||||||| ||||||||  |||| || 
Sbjct: 588 atgtcgttaacgaaagaattcatgatgcccatggccttggaagagatgccagtgtcggga 529

                                
Query: 340 tgcacctgcttgancaccttg 360
           || ||||| || | |||||||
Sbjct: 528 tggacctgtttcagcaccttg 508



to top

>emb|Z98744.2|HS193B12 Human DNA sequence from clone RP1-193B12 on chromosome 6p21.3-22.3
             Contains the H2AFD, H2BFD, H2AFI, H1F5, H3FF, H4FK, H3FJ,
             H2AFN, and H2BFN histone genes, the OR2B2 gene for
             olfactory receptor 2B2, histone H2B family member I
             pseudogene H2BFIP, a hypothetical protein pseudogene,
             ESTs, STSs, GSSs and CpG islands, complete sequence
          Length = 100374

 Score =  105 bits (53), Expect = 1e-19
 Identities = 92/105 (87%)
 Strand = Plus / Minus

                                                                         
Query: 120   ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 179
             |||| |||||||||||||||| ||||||||||| |||||||||||||| ||||| |||||
Sbjct: 57572 ggtgtacttggtgacggcctttgtgccctcggacacggcgtgcttggccagctccccggg 57513

                                                          
Query: 180   gaggacgaggcggacggaggtctggatctcccgggaggtgatggt 224
              || |  ||||| ||||  ||||||||||||| ||||||||||||
Sbjct: 57512 cagcagcaggcgcacggccgtctggatctccctggaggtgatggt 57468



 Score = 89.7 bits (45), Expect = 6e-15
 Identities = 90/105 (85%)
 Strand = Plus / Minus

                                                                        
Query: 120  ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 179
            |||| ||||||||||||||||||||||||| || || ||||||||||| ||||| || ||
Sbjct: 2771 ggtgtacttggtgacggccttggtgccctccgacaccgcgtgcttggccagctcccctgg 2712

                                                         
Query: 180  gaggacgaggcggacggaggtctggatctcccgggaggtgatggt 224
             || |  ||||| ||||  ||||||||||||| ||||||||||||
Sbjct: 2711 cagcagcaggcgcacggccgtctggatctccctggaggtgatggt 2667



 Score = 81.8 bits (41), Expect = 1e-12
 Identities = 75/87 (86%)
 Strand = Plus / Minus

                                                                        
Query: 274  tcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatg 333
            ||||||||||| |||| ||||||||||||||||  |||||||||||| ||||| ||| ||
Sbjct: 2617 tcgaagatgtcattgacgaaggagttcatgatgcccatggccttggacgagataccggtg 2558

                                       
Query: 334  tccggntgcacctgcttgancaccttg 360
            || || || |||||||| | |||||||
Sbjct: 2557 tcggggtggacctgcttcagcaccttg 2531



 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 71/84 (84%)
 Strand = Plus / Minus

                                                                         
Query: 277   aagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtcc 336
             |||||||| |||| ||||||||||||||||  ||||||||| || ||||||||| |||| 
Sbjct: 57415 aagatgtcattgacgaaggagttcatgatgcccatggccttcgatgagatgccggtgtcg 57356

                                     
Query: 337   ggntgcacctgcttgancaccttg 360
             || || || ||||| | |||||||
Sbjct: 57355 gggtggacttgcttcagcaccttg 57332



 Score = 44.1 bits (22), Expect = 0.31
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 199   gtctggatctcccgggaggtgatggt 224
             ||||||||||||| ||||||||||||
Sbjct: 27875 gtctggatctccctggaggtgatggt 27900



to top

>emb|AL353759.8| Human DNA sequence from clone RP1-221C16 on chromosome 6 Contains the
             3' part of the HFE gene for haemochromatosis protein, two
             genes for novel histone 4 family members, two genes for
             novel histone 1 family members, three genes for novel
             histone 2B family members, a gene for a novel histone 2A
             family member, a novel pseudogene, STSs, GSSs, ESTs and
             CpG islands, complete sequence
          Length = 101099

 Score =  105 bits (53), Expect = 1e-19
 Identities = 92/105 (87%)
 Strand = Plus / Plus

                                                                         
Query: 120   ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 179
             |||| ||||||||||||||||||||||||| || |||||||||||||| ||||| |||||
Sbjct: 29859 ggtgtacttggtgacggccttggtgccctccgacacggcgtgcttggccagctctccggg 29918

                                                          
Query: 180   gaggacgaggcggacggaggtctggatctcccgggaggtgatggt 224
              || |  ||||| ||||  ||||||||||||| ||||||||||||
Sbjct: 29919 aagcagcaggcgcacggccgtctggatctccctggaggtgatggt 29963



 Score = 97.6 bits (49), Expect = 2e-17
 Identities = 91/105 (86%)
 Strand = Plus / Minus

                                                                         
Query: 120   ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 179
             |||| ||||||||||||||||||||||||| || |||||||||||||| ||||| || ||
Sbjct: 64919 ggtgtacttggtgacggccttggtgccctccgacacggcgtgcttggccagctcccccgg 64860

                                                          
Query: 180   gaggacgaggcggacggaggtctggatctcccgggaggtgatggt 224
              || |  ||||| ||||  ||||||||||||| ||||||||||||
Sbjct: 64859 aagcagcaggcgcacggccgtctggatctccctggaggtgatggt 64815



 Score = 89.7 bits (45), Expect = 6e-15
 Identities = 90/105 (85%)
 Strand = Plus / Minus

                                                                         
Query: 120   ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 179
             |||| ||||||| ||||||||||||||||| || || ||||||||||| ||||| |||||
Sbjct: 90545 ggtgtacttggtaacggccttggtgccctctgacacagcgtgcttggccagctccccggg 90486

                                                          
Query: 180   gaggacgaggcggacggaggtctggatctcccgggaggtgatggt 224
              || |  ||||| ||||  ||||||||||||| ||||||||||||
Sbjct: 90485 aagcagcaggcgcacggccgtctggatctccctggaggtgatggt 90441



 Score = 73.8 bits (37), Expect = 3e-10
 Identities = 74/87 (85%)
 Strand = Plus / Minus

                                                                         
Query: 274   tcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatg 333
             |||||||||||||||| |||||| ||||||||   ||| |||||||| ||||||||| ||
Sbjct: 64765 tcgaagatgtcgttgacgaaggaattcatgatccccattgccttggaagagatgccggtg 64706

                                        
Query: 334   tccggntgcacctgcttgancaccttg 360
             || || || |||||||| | |||||||
Sbjct: 64705 tcgggatggacctgcttcagcaccttg 64679



 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 72/87 (82%)
 Strand = Plus / Minus

                                                                         
Query: 274   tcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatg 333
             ||||||||||||||||  ||||| ||||||||   |||||| || |||||||||||| ||
Sbjct: 90391 tcgaagatgtcgttgacaaaggaattcatgatccccatggctttagaggagatgccggtg 90332

                                        
Query: 334   tccggntgcacctgcttgancaccttg 360
             || || || ||||| || | |||||||
Sbjct: 90331 tcggggtggacctgtttcagcaccttg 90305



 Score = 46.1 bits (23), Expect = 0.078
 Identities = 66/81 (81%)
 Strand = Plus / Plus

                                                                         
Query: 280   atgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtccggn 339
             |||||||| | ||| || |||||||||  |||||||||||| ||||||||  |||| || 
Sbjct: 30019 atgtcgttaacgaaagaattcatgatgcccatggccttggaagagatgccagtgtcggga 30078

                                  
Query: 340   tgcacctgcttgancaccttg 360
             || ||||| || | |||||||
Sbjct: 30079 tggacctgtttcagcaccttg 30099



to top

>emb|AL021807.2|HS86C11 Human DNA sequence from clone RP1-86C11 on chromosome 6p21.31-22.1
             Contains a vomeronasal olfactory 1 receptor chromosome 6-2
             (VN1R6-2P) pseudogene, histone genes H2BFN and H2AFA, the
             gene for a novel protein identical to H2B histone family
             member A (H2BFA), the gene for a novel protein identical
             to H2A histone family member I (H2AFI), a novel histone
             gene similar to H4F2 and three CpG islands, complete
             sequence
          Length = 89016

 Score =  105 bits (53), Expect = 1e-19
 Identities = 92/105 (87%)
 Strand = Plus / Plus

                                                                         
Query: 120   ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 179
             |||| |||||||||||||||||||||||||||| |||||||||||||| | ||| |||||
Sbjct: 69735 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccaactccccggg 69794

                                                          
Query: 180   gaggacgaggcggacggaggtctggatctcccgggaggtgatggt 224
              || |  ||||| ||||  ||||||||||||| ||||||||||||
Sbjct: 69795 cagcagcaggcgcacggccgtctggatctccctggaggtgatggt 69839



 Score = 89.7 bits (45), Expect = 6e-15
 Identities = 76/87 (87%)
 Strand = Plus / Plus

                                                                         
Query: 274   tcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatg 333
             |||||||||||||||| |||||||||||||||   ||||||||| |||||||||||| ||
Sbjct: 69889 tcgaagatgtcgttgacgaaggagttcatgattcccatggccttagaggagatgccggtg 69948

                                        
Query: 334   tccggntgcacctgcttgancaccttg 360
             || || || |||||||| | |||||||
Sbjct: 69949 tcggggtggacctgcttcagcaccttg 69975



 Score = 81.8 bits (41), Expect = 1e-12
 Identities = 89/105 (84%)
 Strand = Plus / Plus

                                                                         
Query: 120   ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 179
             |||| |||||||||||||||| || |||||||| |||||||||||||| | ||| || ||
Sbjct: 55687 ggtgtacttggtgacggccttagtaccctcggacacggcgtgcttggccaactccccagg 55746

                                                          
Query: 180   gaggacgaggcggacggaggtctggatctcccgggaggtgatggt 224
              || |  ||||| ||||  ||||||||||||| ||||||||||||
Sbjct: 55747 cagcagcaggcgcacggccgtctggatctccctggaggtgatggt 55791



 Score = 44.1 bits (22), Expect = 0.31
 Identities = 45/53 (84%)
 Strand = Plus / Plus

                                                                  
Query: 298   ttcatgatggacatggccttggaggagatgccgatgtccggntgcacctgctt 350
             |||||||||  |||||||||||| || |||||| |||| || || ||||||||
Sbjct: 55865 ttcatgatgcccatggccttggacgaaatgccggtgtcagggtggacctgctt 55917



to top

>emb|X57138.1|HSH2B2H2 Human H2B.2 and H2A.1 genes for Histone H2A and H2B
          Length = 1661

 Score =  105 bits (53), Expect = 1e-19
 Identities = 92/105 (87%)
 Strand = Plus / Plus

                                                                       
Query: 120 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 179
           |||| |||||||||||||||| ||||||||||| |||||||||||||| ||||| |||||
Sbjct: 410 ggtgtacttggtgacggcctttgtgccctcggacacggcgtgcttggccagctccccggg 469

                                                        
Query: 180 gaggacgaggcggacggaggtctggatctcccgggaggtgatggt 224
            || |  ||||| ||||  ||||||||||||| ||||||||||||
Sbjct: 470 cagcagcaggcgcacggccgtctggatctccctggaggtgatggt 514



 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 71/84 (84%)
 Strand = Plus / Plus

                                                                       
Query: 277 aagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtcc 336
           |||||||| |||| ||||||||||||||||  ||||||||| || ||||||||| |||| 
Sbjct: 567 aagatgtcattgacgaaggagttcatgatgcccatggccttcgatgagatgccggtgtcg 626

                                   
Query: 337 ggntgcacctgcttgancaccttg 360
           || || || ||||| | |||||||
Sbjct: 627 gggtggacttgcttcagcaccttg 650



to top

>emb|AJ223352.1|HSAJ3352 Homo sapiens mRNA for for histone H2B, clone pjG4-5-14
          Length = 829

 Score =  105 bits (53), Expect = 1e-19
 Identities = 92/105 (87%)
 Strand = Plus / Minus

                                                                       
Query: 120 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 179
           |||| |||||||||||||||||||||||||||| |||||||||||||| | ||| |||||
Sbjct: 385 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccaactccccggg 326

                                                        
Query: 180 gaggacgaggcggacggaggtctggatctcccgggaggtgatggt 224
            || |  ||||| ||||  ||||||||||||| ||||||||||||
Sbjct: 325 cagcagcaggcgcacggccgtctggatctccctggaggtgatggt 281



 Score = 89.7 bits (45), Expect = 6e-15
 Identities = 76/87 (87%)
 Strand = Plus / Minus

                                                                       
Query: 274 tcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatg 333
           |||||||||||||||| |||||||||||||||   ||||||||| |||||||||||| ||
Sbjct: 231 tcgaagatgtcgttgacgaaggagttcatgattcccatggccttagaggagatgccggtg 172

                                      
Query: 334 tccggntgcacctgcttgancaccttg 360
           || || || |||||||| | |||||||
Sbjct: 171 tcggggtggacctgcttcagcaccttg 145



to top

>gb|BC064959.1| Homo sapiens histone 1, H2bk, mRNA (cDNA clone MGC:74942
           IMAGE:6093977), complete cds
          Length = 859

 Score =  105 bits (53), Expect = 1e-19
 Identities = 92/105 (87%)
 Strand = Plus / Minus

                                                                       
Query: 120 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 179
           |||| |||||||||||||||||||||||||||| |||||||||||||| | ||| |||||
Sbjct: 409 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccaactccccggg 350

                                                        
Query: 180 gaggacgaggcggacggaggtctggatctcccgggaggtgatggt 224
            || |  ||||| ||||  ||||||||||||| ||||||||||||
Sbjct: 349 cagcagcaggcgcacggccgtctggatctccctggaggtgatggt 305



 Score = 89.7 bits (45), Expect = 6e-15
 Identities = 76/87 (87%)
 Strand = Plus / Minus

                                                                       
Query: 274 tcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatg 333
           |||||||||||||||| |||||||||||||||   ||||||||| |||||||||||| ||
Sbjct: 255 tcgaagatgtcgttgacgaaggagttcatgattcccatggccttagaggagatgccggtg 196

                                      
Query: 334 tccggntgcacctgcttgancaccttg 360
           || || || |||||||| | |||||||
Sbjct: 195 tcggggtggacctgcttcagcaccttg 169



to top

>gb|U91328.1|HSU91328 Human hereditary haemochromatosis region, histone 2A-like protein gene,
             hereditary haemochromatosis (HLA-H) gene, RoRet gene, and
             sodium phosphate transporter (NPT3) gene, complete cds
          Length = 246282

 Score =  105 bits (53), Expect = 1e-19
 Identities = 92/105 (87%)
 Strand = Plus / Minus

                                                                         
Query: 120   ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 179
             |||| ||||||||||||||||||||||||| || |||||||||||||| ||||| |||||
Sbjct: 17523 ggtgtacttggtgacggccttggtgccctccgacacggcgtgcttggccagctctccggg 17464

                                                          
Query: 180   gaggacgaggcggacggaggtctggatctcccgggaggtgatggt 224
              || |  ||||| ||||  ||||||||||||| ||||||||||||
Sbjct: 17463 aagcagcaggcgcacggccgtctggatctccctggaggtgatggt 17419



 Score = 75.8 bits (38), Expect = 9e-11
 Identities = 67/77 (87%)
 Strand = Plus / Minus

                                                                         
Query: 274   tcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatg 333
             |||||||||||||||| |||||| ||||||||   |||||||||||| ||||||||| ||
Sbjct: 97616 tcgaagatgtcgttgacgaaggaattcatgatccccatggccttggatgagatgccggtg 97557

                              
Query: 334   tccggntgcacctgctt 350
             || || || ||||||||
Sbjct: 97556 tcggggtggacctgctt 97540



 Score = 46.1 bits (23), Expect = 0.078
 Identities = 66/81 (81%)
 Strand = Plus / Minus

                                                                         
Query: 280   atgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtccggn 339
             |||||||| | ||| || |||||||||  |||||||||||| ||||||||  |||| || 
Sbjct: 17363 atgtcgttaacgaaagaattcatgatgcccatggccttggaagagatgccagtgtcggga 17304

                                  
Query: 340   tgcacctgcttgancaccttg 360
             || ||||| || | |||||||
Sbjct: 17303 tggacctgtttcagcaccttg 17283



 Score = 40.1 bits (20), Expect = 4.8
 Identities = 80/100 (80%)
 Strand = Plus / Minus

                                                                         
Query: 125   acttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggagga 184
             ||||||| || ||||| ||||||||||| || || ||||| || ||||| || || || |
Sbjct: 97765 acttggtaactgccttagtgccctcggacacagcatgcttagccagctccccaggcagca 97706

                                                     
Query: 185   cgaggcggacggaggtctggatctcccgggaggtgatggt 224
               ||||| || |  ||||| ||||||| ||||||||||||
Sbjct: 97705 gcaggcgcacagccgtctgaatctccctggaggtgatggt 97666



to top

>ref|XM_220506.2| PREDICTED: Rattus norvegicus histone 3, H2ba (predicted)
           (Hist3h2ba_predicted), mRNA
          Length = 585

 Score =  105 bits (53), Expect = 1e-19
 Identities = 78/87 (89%)
 Strand = Plus / Minus

                                                                       
Query: 274 tcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatg 333
           |||||||||||||||| ||| ||||||||||||  |||||||||||| ||||||||| ||
Sbjct: 215 tcgaagatgtcgttgacgaacgagttcatgatgcccatggccttggacgagatgccggtg 156

                                      
Query: 334 tccggntgcacctgcttgancaccttg 360
           ||||| ||||||||||| | |||||||
Sbjct: 155 tccgggtgcacctgcttcagcaccttg 129



 Score = 52.0 bits (26), Expect = 0.001
 Identities = 47/54 (87%)
 Strand = Plus / Minus

                                                                 
Query: 120 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctc 173
           |||| |||||||||| ||||||||||| || || ||||| |||||||| |||||
Sbjct: 369 ggtgtacttggtgactgccttggtgccttccgacacggcatgcttggccagctc 316



to top

>dbj|AB041017.1| Homo sapiens H2BFS gene for H2B histone family protein, complete
           cds
          Length = 821

 Score =  105 bits (53), Expect = 1e-19
 Identities = 92/105 (87%)
 Strand = Plus / Minus

                                                                       
Query: 120 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 179
           |||| |||||||||||||||||||||||||||| |||||||||||||| | ||| |||||
Sbjct: 397 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccaactccccggg 338

                                                        
Query: 180 gaggacgaggcggacggaggtctggatctcccgggaggtgatggt 224
            || |  ||||| ||||  ||||||||||||| ||||||||||||
Sbjct: 337 cagcagcaggcgcacggccgtctggatctccctggaggtgatggt 293



 Score = 89.7 bits (45), Expect = 6e-15
 Identities = 76/87 (87%)
 Strand = Plus / Minus

                                                                       
Query: 274 tcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatg 333
           |||||||||||||||| |||||||||||||||   ||||||||| |||||||||||| ||
Sbjct: 243 tcgaagatgtcgttgacgaaggagttcatgattcccatggccttagaggagatgccggtg 184

                                      
Query: 334 tccggntgcacctgcttgancaccttg 360
           || || || |||||||| | |||||||
Sbjct: 183 tcggggtggacctgcttcagcaccttg 157



to top

>emb|BX647290.1|HSM807434 Homo sapiens mRNA; cDNA DKFZp781B2436 (from clone DKFZp781B2436)
          Length = 1890

 Score =  105 bits (53), Expect = 1e-19
 Identities = 92/105 (87%)
 Strand = Plus / Minus

                                                                       
Query: 120 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 179
           |||| |||||||||||||||| ||||||||||| |||||||||||||| ||||| |||||
Sbjct: 407 ggtgtacttggtgacggcctttgtgccctcggacacggcgtgcttggccagctccccggg 348

                                                        
Query: 180 gaggacgaggcggacggaggtctggatctcccgggaggtgatggt 224
            || |  ||||| ||||  ||||||||||||| ||||||||||||
Sbjct: 347 cagcagcaggcgcacggccgtctggatctccctggaggtgatggt 303



 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 71/84 (84%)
 Strand = Plus / Minus

                                                                       
Query: 277 aagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtcc 336
           |||||||| |||| ||||||||||||||||  ||||||||| || ||||||||| |||| 
Sbjct: 250 aagatgtcattgacgaaggagttcatgatgcccatggccttcgatgagatgccggtgtcg 191

                                   
Query: 337 ggntgcacctgcttgancaccttg 360
           || || || ||||| | |||||||
Sbjct: 190 gggtggacttgcttcagcaccttg 167



to top

>emb|Z57636.1|HS187F7F H.sapiens CpG island DNA genomic Mse1 fragment, clone 187f7,
           forward read cpg187f7.ft1a
          Length = 199

 Score =  105 bits (53), Expect = 1e-19
 Identities = 92/105 (87%)
 Strand = Plus / Plus

                                                                       
Query: 120 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 179
           |||| ||||||||||||||||||||||||| || |||||||||||||| ||||| |||||
Sbjct: 34  ggtgtacttggtgacggccttggtgccctccgacacggcgtgcttggccagctctccggg 93

                                                        
Query: 180 gaggacgaggcggacggaggtctggatctcccgggaggtgatggt 224
            || |  ||||| ||||  ||||||||||||| ||||||||||||
Sbjct: 94  aagcagcaggcgcacggccgtctggatctccctggaggtgatggt 138



to top

>dbj|AP001751.1| Homo sapiens genomic DNA, chromosome 21q, section 95/105
          Length = 340000

 Score =  105 bits (53), Expect = 1e-19
 Identities = 92/105 (87%)
 Strand = Plus / Minus

                                                                          
Query: 120    ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 179
              |||| |||||||||||||||||||||||||||| |||||||||||||| | ||| |||||
Sbjct: 298226 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccaactccccggg 298167

                                                           
Query: 180    gaggacgaggcggacggaggtctggatctcccgggaggtgatggt 224
               || |  ||||| ||||  ||||||||||||| ||||||||||||
Sbjct: 298166 cagcagcaggcgcacggccgtctggatctccctggaggtgatggt 298122



 Score = 89.7 bits (45), Expect = 6e-15
 Identities = 76/87 (87%)
 Strand = Plus / Minus

                                                                          
Query: 274    tcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatg 333
              |||||||||||||||| |||||||||||||||   ||||||||| |||||||||||| ||
Sbjct: 298072 tcgaagatgtcgttgacgaaggagttcatgattcccatggccttagaggagatgccggtg 298013

                                         
Query: 334    tccggntgcacctgcttgancaccttg 360
              || || || |||||||| | |||||||
Sbjct: 298012 tcggggtggacctgcttcagcaccttg 297986



to top

>ref|NG_000827.2| Homo sapiens genomic histone family microcluster (HFM@) on chromosome 6
          Length = 20621

 Score =  105 bits (53), Expect = 1e-19
 Identities = 92/105 (87%)
 Strand = Plus / Plus

                                                                         
Query: 120   ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 179
             |||| |||||||||||||||||||||||||||| |||||||||||||| | ||| |||||
Sbjct: 18936 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccaactccccggg 18995

                                                          
Query: 180   gaggacgaggcggacggaggtctggatctcccgggaggtgatggt 224
              || |  ||||| ||||  ||||||||||||| ||||||||||||
Sbjct: 18996 cagcagcaggcgcacggccgtctggatctccctggaggtgatggt 19040



 Score = 89.7 bits (45), Expect = 6e-15
 Identities = 76/87 (87%)
 Strand = Plus / Plus

                                                                         
Query: 274   tcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatg 333
             |||||||||||||||| |||||||||||||||   ||||||||| |||||||||||| ||
Sbjct: 19090 tcgaagatgtcgttgacgaaggagttcatgattcccatggccttagaggagatgccggtg 19149

                                        
Query: 334   tccggntgcacctgcttgancaccttg 360
             || || || |||||||| | |||||||
Sbjct: 19150 tcggggtggacctgcttcagcaccttg 19176



 Score = 81.8 bits (41), Expect = 1e-12
 Identities = 89/105 (84%)
 Strand = Plus / Plus

                                                                        
Query: 120  ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 179
            |||| |||||||||||||||| || |||||||| |||||||||||||| | ||| || ||
Sbjct: 4888 ggtgtacttggtgacggccttagtaccctcggacacggcgtgcttggccaactccccagg 4947

                                                         
Query: 180  gaggacgaggcggacggaggtctggatctcccgggaggtgatggt 224
             || |  ||||| ||||  ||||||||||||| ||||||||||||
Sbjct: 4948 cagcagcaggcgcacggccgtctggatctccctggaggtgatggt 4992



 Score = 44.1 bits (22), Expect = 0.31
 Identities = 45/53 (84%)
 Strand = Plus / Plus

                                                                 
Query: 298  ttcatgatggacatggccttggaggagatgccgatgtccggntgcacctgctt 350
            |||||||||  |||||||||||| || |||||| |||| || || ||||||||
Sbjct: 5066 ttcatgatgcccatggccttggacgaaatgccggtgtcagggtggacctgctt 5118



to top

>gb|BC108737.1| Homo sapiens histone 1, H2bk, mRNA (cDNA clone MGC:131989
           IMAGE:4707078), complete cds
          Length = 880

 Score =  105 bits (53), Expect = 1e-19
 Identities = 92/105 (87%)
 Strand = Plus / Minus

                                                                       
Query: 120 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 179
           |||| |||||||||||||||||||||||||||| |||||||||||||| | ||| |||||
Sbjct: 409 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccaactccccggg 350

                                                        
Query: 180 gaggacgaggcggacggaggtctggatctcccgggaggtgatggt 224
            || |  ||||| ||||  ||||||||||||| ||||||||||||
Sbjct: 349 cagcagcaggcgcacggccgtctggatctccctggaggtgatggt 305



 Score = 89.7 bits (45), Expect = 6e-15
 Identities = 76/87 (87%)
 Strand = Plus / Minus

                                                                       
Query: 274 tcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatg 333
           |||||||||||||||| |||||||||||||||   ||||||||| |||||||||||| ||
Sbjct: 255 tcgaagatgtcgttgacgaaggagttcatgattcccatggccttagaggagatgccggtg 196

                                      
Query: 334 tccggntgcacctgcttgancaccttg 360
           || || || |||||||| | |||||||
Sbjct: 195 tcggggtggacctgcttcagcaccttg 169



to top

>emb|Z80783.1|HSH2BL H.sapiens H2B/l gene
          Length = 601

 Score =  105 bits (53), Expect = 1e-19
 Identities = 92/105 (87%)
 Strand = Plus / Minus

                                                                       
Query: 120 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 179
           |||| ||||||||||||||||||||||||| || |||||||||||||| ||||| |||||
Sbjct: 456 ggtgtacttggtgacggccttggtgccctccgacacggcgtgcttggccagctctccggg 397

                                                        
Query: 180 gaggacgaggcggacggaggtctggatctcccgggaggtgatggt 224
            || |  ||||| ||||  ||||||||||||| ||||||||||||
Sbjct: 396 aagcagcaggcgcacggccgtctggatctccctggaggtgatggt 352



 Score = 46.1 bits (23), Expect = 0.078
 Identities = 66/81 (81%)
 Strand = Plus / Minus

                                                                       
Query: 280 atgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtccggn 339
           |||||||| | ||| || |||||||||  |||||||||||| ||||||||  |||| || 
Sbjct: 296 atgtcgttaacgaaagaattcatgatgcccatggccttggaagagatgccagtgtcggga 237

                                
Query: 340 tgcacctgcttgancaccttg 360
           || ||||| || | |||||||
Sbjct: 236 tggacctgtttcagcaccttg 216



to top

>dbj|AP001051.1| Homo sapiens genomic DNA, chromosome 21, clone:KB161B12, MX1-D21S171
            region, complete sequence
          Length = 84904

 Score =  105 bits (53), Expect = 1e-19
 Identities = 92/105 (87%)
 Strand = Plus / Minus

                                                                        
Query: 120  ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 179
            |||| |||||||||||||||||||||||||||| |||||||||||||| | ||| |||||
Sbjct: 4500 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccaactccccggg 4441

                                                         
Query: 180  gaggacgaggcggacggaggtctggatctcccgggaggtgatggt 224
             || |  ||||| ||||  ||||||||||||| ||||||||||||
Sbjct: 4440 cagcagcaggcgcacggccgtctggatctccctggaggtgatggt 4396



 Score = 89.7 bits (45), Expect = 6e-15
 Identities = 76/87 (87%)
 Strand = Plus / Minus

                                                                        
Query: 274  tcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatg 333
            |||||||||||||||| |||||||||||||||   ||||||||| |||||||||||| ||
Sbjct: 4346 tcgaagatgtcgttgacgaaggagttcatgattcccatggccttagaggagatgccggtg 4287

                                       
Query: 334  tccggntgcacctgcttgancaccttg 360
            || || || |||||||| | |||||||
Sbjct: 4286 tcggggtggacctgcttcagcaccttg 4260



to top

>dbj|AP001050.1| Homo sapiens genomic DNA, chromosome 21, clone:KB953G5, MX1-D21S171
             region, complete sequence
          Length = 98992

 Score =  105 bits (53), Expect = 1e-19
 Identities = 92/105 (87%)
 Strand = Plus / Minus

                                                                         
Query: 120   ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 179
             |||| |||||||||||||||||||||||||||| |||||||||||||| | ||| |||||
Sbjct: 76143 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccaactccccggg 76084

                                                          
Query: 180   gaggacgaggcggacggaggtctggatctcccgggaggtgatggt 224
              || |  ||||| ||||  ||||||||||||| ||||||||||||
Sbjct: 76083 cagcagcaggcgcacggccgtctggatctccctggaggtgatggt 76039



 Score = 89.7 bits (45), Expect = 6e-15
 Identities = 76/87 (87%)
 Strand = Plus / Minus

                                                                         
Query: 274   tcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatg 333
             |||||||||||||||| |||||||||||||||   ||||||||| |||||||||||| ||
Sbjct: 75989 tcgaagatgtcgttgacgaaggagttcatgattcccatggccttagaggagatgccggtg 75930

                                        
Query: 334   tccggntgcacctgcttgancaccttg 360
             || || || |||||||| | |||||||
Sbjct: 75929 tcggggtggacctgcttcagcaccttg 75903



to top

>ref|XM_524860.1| PREDICTED: Pan troglodytes LOC469477 (LOC469477), mRNA
          Length = 1068

 Score =  103 bits (52), Expect = 4e-19
 Identities = 95/108 (87%), Gaps = 1/108 (0%)
 Strand = Plus / Minus

                                                                       
Query: 120 ggtgaacttggtgacg-gccttggtgccctcggagacggcgtgcttggcgagctcgccgg 178
           |||| ||||||||||| ||||||||||||||||| |||||||||||||| ||||||||||
Sbjct: 370 ggtgtacttggtgacgcgccttggtgccctcggacacggcgtgcttggccagctcgccgg 311

                                                           
Query: 179 ggaggacgaggcggacggaggtctggatctcccgggaggtgatggtgg 226
           | || |  ||||| ||||  ||||||||||| ||||| ||||||||||
Sbjct: 310 gcagcagcaggcgcacggccgtctggatctcgcgggatgtgatggtgg 263



 Score = 97.6 bits (49), Expect = 2e-17
 Identities = 77/87 (88%)
 Strand = Plus / Minus

                                                                       
Query: 274 tcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatg 333
           |||||||||||||||| ||||||||||||||||  |||||||||||| ||||||||| ||
Sbjct: 215 tcgaagatgtcgttgacgaaggagttcatgatgcccatggccttggacgagatgccggtg 156

                                      
Query: 334 tccggntgcacctgcttgancaccttg 360
           || || || |||||||| | |||||||
Sbjct: 155 tcggggtggacctgcttcagcaccttg 129



to top

>ref|XM_792924.1| PREDICTED: Strongylocentrotus purpuratus similar to histone 2, H2,
           like (LOC593451), mRNA
          Length = 342

 Score =  103 bits (52), Expect = 4e-19
 Identities = 103/120 (85%)
 Strand = Plus / Minus

                                                                       
Query: 120 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 179
           |||| |||||||||| ||||||||||||||  |||||||| ||||||| ||||| |||||
Sbjct: 330 ggtgtacttggtgacagccttggtgccctcaaagacggcgagcttggccagctctccggg 271

                                                                       
Query: 180 gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgta 239
           ||||| ||| ||||| | |||||||||||| |||  | ||||||||| |||||| |||||
Sbjct: 270 gaggaggagacggacagcggtctggatctctcggctgctgatggtggacttcttattgta 211



 Score = 50.1 bits (25), Expect = 0.005
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 274 tcgaagatgtcgttgatgaaggagttcatgatggacatggccttg 318
           |||||||  ||||||| ||||  ||||||||||||||||||||||
Sbjct: 176 tcgaagacatcgttgacgaagctgttcatgatggacatggccttg 132



to top

>ref|NM_003522.3| Homo sapiens histone 1, H2bf (HIST1H2BF), mRNA
          Length = 430

 Score =  101 bits (51), Expect = 2e-18
 Identities = 93/107 (86%)
 Strand = Plus / Minus

                                                                       
Query: 120 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 179
           |||| ||||||||||||||||||||||||| || ||||||||||| || ||||| |||||
Sbjct: 369 ggtgtacttggtgacggccttggtgccctctgacacggcgtgcttagccagctccccggg 310

                                                          
Query: 180 gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgg 226
            || |  ||||| ||||  ||||||||||||| ||||||||||||||
Sbjct: 309 cagcagcaggcgtacggccgtctggatctccctggaggtgatggtgg 263



 Score = 89.7 bits (45), Expect = 6e-15
 Identities = 76/87 (87%)
 Strand = Plus / Minus

                                                                       
Query: 274 tcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatg 333
           |||||||| ||||||| ||||||||||||||||  |||||||||||| ||||||||| ||
Sbjct: 215 tcgaagatatcgttgacgaaggagttcatgatgcccatggccttggatgagatgccggtg 156

                                      
Query: 334 tccggntgcacctgcttgancaccttg 360
           || || || |||||||| | |||||||
Sbjct: 155 tcggggtggacctgctttagcaccttg 129



to top

>ref|XM_545431.2| PREDICTED: Canis familiaris similar to Histone H2B 291B
           (LOC488309), partial mRNA
          Length = 705

 Score =  101 bits (51), Expect = 2e-18
 Identities = 87/99 (87%)
 Strand = Plus / Minus

                                                                       
Query: 126 cttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggaggac 185
           ||||||||||||||||||||||||||| |||||||||||||| ||||| ||||| || | 
Sbjct: 363 cttggtgacggccttggtgccctcggacacggcgtgcttggccagctccccgggcagcag 304

                                                  
Query: 186 gaggcggacggaggtctggatctcccgggaggtgatggt 224
            ||||| ||||  ||||||||||||| ||| ||||||||
Sbjct: 303 caggcgcacggccgtctggatctccctggacgtgatggt 265



 Score = 89.7 bits (45), Expect = 6e-15
 Identities = 76/87 (87%)
 Strand = Plus / Minus

                                                                       
Query: 274 tcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatg 333
           |||||||||||||||| ||| ||||||||||||  |||||||||||| ||||||||  ||
Sbjct: 215 tcgaagatgtcgttgacgaacgagttcatgatgcccatggccttggacgagatgcccgtg 156

                                      
Query: 334 tccggntgcacctgcttgancaccttg 360
           || || ||||||||||| | |||||||
Sbjct: 155 tcggggtgcacctgcttcagcaccttg 129



to top

>gb|AF531289.1| Homo sapiens histone H2B (HIST1H2BF) gene, complete cds
          Length = 1137

 Score =  101 bits (51), Expect = 2e-18
 Identities = 93/107 (86%)
 Strand = Plus / Minus

                                                                       
Query: 120 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 179
           |||| ||||||||||||||||||||||||| || ||||||||||| || ||||| |||||
Sbjct: 749 ggtgtacttggtgacggccttggtgccctctgacacggcgtgcttagccagctccccggg 690

                                                          
Query: 180 gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgg 226
            || |  ||||| ||||  ||||||||||||| ||||||||||||||
Sbjct: 689 cagcagcaggcgtacggccgtctggatctccctggaggtgatggtgg 643



 Score = 89.7 bits (45), Expect = 6e-15
 Identities = 76/87 (87%)
 Strand = Plus / Minus

                                                                       
Query: 274 tcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatg 333
           |||||||| ||||||| ||||||||||||||||  |||||||||||| ||||||||| ||
Sbjct: 595 tcgaagatatcgttgacgaaggagttcatgatgcccatggccttggatgagatgccggtg 536

                                      
Query: 334 tccggntgcacctgcttgancaccttg 360
           || || || |||||||| | |||||||
Sbjct: 535 tcggggtggacctgctttagcaccttg 509



to top

>emb|CR669650.2|CNS0FFO8 Tetraodon nigroviridis full-length cDNA
          Length = 617

 Score =  101 bits (51), Expect = 2e-18
 Identities = 93/107 (86%)
 Strand = Plus / Minus

                                                                       
Query: 120 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 179
           |||| ||||||| |||||||||||||||||||| |||||||||||||| ||||| || ||
Sbjct: 410 ggtgtacttggtcacggccttggtgccctcggacacggcgtgcttggccagctcccccgg 351

                                                          
Query: 180 gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgg 226
            || |  || |  |||| |||||||||||||||||||||||||||||
Sbjct: 350 cagcagcagcctcacggcggtctggatctcccgggaggtgatggtgg 304



 Score = 87.7 bits (44), Expect = 2e-14
 Identities = 64/71 (90%)
 Strand = Plus / Minus

                                                                       
Query: 280 atgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtccggn 339
           |||||||||| ||||||||||||||||  |||||||||||||||||||||  |||| || 
Sbjct: 250 atgtcgttgacgaaggagttcatgatgctcatggccttggaggagatgcccgtgtctggg 191

                      
Query: 340 tgcacctgctt 350
           |||||||||||
Sbjct: 190 tgcacctgctt 180



to top

>gb|BC056264.1| Homo sapiens histone 1, H2bg, mRNA (cDNA clone IMAGE:6668499),
           partial cds
          Length = 1219

 Score =  101 bits (51), Expect = 2e-18
 Identities = 93/107 (86%)
 Strand = Plus / Minus

                                                                       
Query: 120 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 179
           |||| ||||||||||||||||||||||||| || ||||||||||| || ||||| |||||
Sbjct: 412 ggtgtacttggtgacggccttggtgccctctgacacggcgtgcttagccagctccccggg 353

                                                          
Query: 180 gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgg 226
            || |  ||||| ||||  ||||||||||||| ||||||||||||||
Sbjct: 352 cagcagcaggcgtacggccgtctggatctccctggaggtgatggtgg 306



 Score = 89.7 bits (45), Expect = 6e-15
 Identities = 76/87 (87%)
 Strand = Plus / Minus

                                                                       
Query: 274 tcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatg 333
           |||||||| ||||||| ||||||||||||||||  |||||||||||| ||||||||| ||
Sbjct: 258 tcgaagatatcgttgacgaaggagttcatgatgcccatggccttggatgagatgccggtg 199

                                      
Query: 334 tccggntgcacctgcttgancaccttg 360
           || || || |||||||| | |||||||
Sbjct: 198 tcggggtggacctgctttagcaccttg 172



to top

>emb|AL031777.5|HS34B20 Human DNA sequence from clone RP1-34B20 on chromosome 6p21.31-22.2
            Contains seventeen histone (pseudo)genes and gene RPS10P1
            (40S Ribosomal protein S10 pseudogene 1), three CpG
            islands, ESTs, STSs and GSSs, complete sequence
          Length = 89301

 Score =  101 bits (51), Expect = 2e-18
 Identities = 93/107 (86%)
 Strand = Plus / Minus

                                                                        
Query: 120  ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 179
            |||| ||||||||||||||||||||||||| || ||||||||||| || ||||| |||||
Sbjct: 5309 ggtgtacttggtgacggccttggtgccctctgacacggcgtgcttagccagctccccggg 5250

                                                           
Query: 180  gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgg 226
             || |  ||||| ||||  ||||||||||||| ||||||||||||||
Sbjct: 5249 cagcagcaggcgtacggccgtctggatctccctggaggtgatggtgg 5203



 Score = 89.7 bits (45), Expect = 6e-15
 Identities = 90/105 (85%)
 Strand = Plus / Minus

                                                                         
Query: 120   ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 179
             |||| |||||||||||||||| ||||||||||| |||||||||||||| || || || ||
Sbjct: 57401 ggtgtacttggtgacggccttagtgccctcggacacggcgtgcttggccagttccccagg 57342

                                                          
Query: 180   gaggacgaggcggacggaggtctggatctcccgggaggtgatggt 224
              || |  ||||| ||||  ||||||||||||| ||||||||||||
Sbjct: 57341 cagcagcaggcgcacggctgtctggatctccctggaggtgatggt 57297



 Score = 89.7 bits (45), Expect = 6e-15
 Identities = 76/87 (87%)
 Strand = Plus / Minus

                                                                        
Query: 274  tcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatg 333
            |||||||| ||||||| ||||||||||||||||  |||||||||||| ||||||||| ||
Sbjct: 5155 tcgaagatatcgttgacgaaggagttcatgatgcccatggccttggatgagatgccggtg 5096

                                       
Query: 334  tccggntgcacctgcttgancaccttg 360
            || || || |||||||| | |||||||
Sbjct: 5095 tcggggtggacctgctttagcaccttg 5069



 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 84/100 (84%)
 Strand = Plus / Plus

                                                                         
Query: 125   acttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggagga 184
             |||||||||| |||||||| || ||||| || ||||||||||| ||||| ||||| || |
Sbjct: 21662 acttggtgacagccttggtaccttcggacactgcgtgcttggccagctctccgggaagca 21721

                                                     
Query: 185   cgaggcggacggaggtctggatctcccgggaggtgatggt 224
               || || |||| |||||||||||||| |||||| |||||
Sbjct: 21722 gcagacgcacggcggtctggatctccctggaggtaatggt 21761



 Score = 65.9 bits (33), Expect = 8e-08
 Identities = 73/87 (83%)
 Strand = Plus / Minus

                                                                         
Query: 274   tcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatg 333
             ||||| |||||||||| |||||||||||| ||   ||| |||||||| ||||||||| ||
Sbjct: 78572 tcgaaaatgtcgttgacgaaggagttcataatccccatagccttggacgagatgccggtg 78513

                                        
Query: 334   tccggntgcacctgcttgancaccttg 360
             || || || |||||||| | |||||||
Sbjct: 78512 tcggggtggacctgcttcagcaccttg 78486



 Score = 63.9 bits (32), Expect = 3e-07
 Identities = 50/56 (89%)
 Strand = Plus / Plus

                                                                     
Query: 274   tcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgcc 329
             |||||||||||||| | |||||| |||||||||  |||||||||||| ||||||||
Sbjct: 21811 tcgaagatgtcgttaacgaaggaattcatgatgcccatggccttggatgagatgcc 21866



 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 86/105 (81%)
 Strand = Plus / Minus

                                                                         
Query: 120   ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 179
             |||| |||||||||| |||||||||||||| || || ||||| ||||| ||||| |||||
Sbjct: 78726 ggtgtacttggtgaccgccttggtgccctccgacaccgcgtgtttggccagctccccggg 78667

                                                          
Query: 180   gaggacgaggcggacggaggtctggatctcccgggaggtgatggt 224
              || |  ||||| || |  || |||||||||| ||| ||||||||
Sbjct: 78666 tagcagcaggcgcacagccgtttggatctccctggaagtgatggt 78622



 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 72/87 (82%)
 Strand = Plus / Minus

                                                                         
Query: 274   tcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatg 333
             |||||||| |||||||  ||||| ||||||||   |||||| ||||||||||||||| ||
Sbjct: 57247 tcgaagatatcgttgacaaaggaattcatgatccccatggctttggaggagatgccggtg 57188

                                        
Query: 334   tccggntgcacctgcttgancaccttg 360
             || || || || ||||| | |||||||
Sbjct: 57187 tcggggtggacttgcttcagcaccttg 57161



to top

>emb|BX068880.1|CNS09PB8 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC53BC09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 780

 Score =  101 bits (51), Expect = 2e-18
 Identities = 93/107 (86%)
 Strand = Plus / Plus

                                                                       
Query: 120 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 179
           |||| |||||||||||||||||||||||||||| |||||||||||||| |||||||||||
Sbjct: 270 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctcgccggg 329

                                                          
Query: 180 gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgg 226
           ||| |  ||  | || |  ||||||||||| ||||| ||||||||||
Sbjct: 330 gagcaacagttgcaccgccgtctggatctcgcgggacgtgatggtgg 376



 Score = 73.8 bits (37), Expect = 3e-10
 Identities = 74/87 (85%)
 Strand = Plus / Plus

                                                                       
Query: 274 tcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatg 333
           |||||||||| ||| | ||||  ||||||||||  ||| ||||||||||| |||||| ||
Sbjct: 424 tcgaagatgttgttcacgaagctgttcatgatgctcatcgccttggaggaaatgccggtg 483

                                      
Query: 334 tccggntgcacctgcttgancaccttg 360
           ||||| ||||||||||| | |||||||
Sbjct: 484 tccgggtgcacctgcttcagcaccttg 510



to top

>emb|BX053939.1|CNS09DS7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC31DF02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 722

 Score =  101 bits (51), Expect = 2e-18
 Identities = 93/107 (86%)
 Strand = Plus / Plus

                                                                       
Query: 120 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 179
           |||| |||||||||||||||||||||||||||| |||||||||||||| |||||||||||
Sbjct: 235 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctcgccggg 294

                                                          
Query: 180 gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgg 226
           ||| |  ||  | || |  ||||||||||| ||||| ||||||||||
Sbjct: 295 gagcaacagttgcaccgccgtctggatctcgcgggacgtgatggtgg 341



 Score = 60.0 bits (30), Expect = 5e-06
 Identities = 74/88 (84%), Gaps = 1/88 (1%)
 Strand = Plus / Plus

                                                                       
Query: 274 tcgaagatgtcgttgatgaaggagttcatgatggacatggccttgg-aggagatgccgat 332
           |||||||||| ||| | ||||  ||||||||||  ||| ||||||| |||| |||||| |
Sbjct: 389 tcgaagatgttgttcacgaagctgttcatgatgctcatcgccttgggaggaaatgccggt 448

                                       
Query: 333 gtccggntgcacctgcttgancaccttg 360
           |||||| ||||||||||| | |||||||
Sbjct: 449 gtccgggtgcacctgcttcagcaccttg 476



to top

>emb|BX053938.1|CNS09DS6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC31DF02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 758

 Score =  101 bits (51), Expect = 2e-18
 Identities = 93/107 (86%)
 Strand = Plus / Minus

                                                                       
Query: 120 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 179
           |||| ||||||| |||||||||||||||||||| |||||||||||||| |||||||||||
Sbjct: 693 ggtgtacttggtaacggccttggtgccctcggacacggcgtgcttggccagctcgccggg 634

                                                          
Query: 180 gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgg 226
           ||| |  || || || |  ||||||||||| ||||| ||||||||||
Sbjct: 633 gagcaaaagtcgcaccgccgtctggatctcgcgggacgtgatggtgg 587



 Score = 81.8 bits (41), Expect = 1e-12
 Identities = 75/87 (86%)
 Strand = Plus / Minus

                                                                       
Query: 274 tcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatg 333
           |||||||||||||| | ||||  ||||||||||  ||| ||||||||||| |||||| ||
Sbjct: 539 tcgaagatgtcgttcacgaagctgttcatgatgctcatcgccttggaggaaatgccggtg 480

                                      
Query: 334 tccggntgcacctgcttgancaccttg 360
           ||||| ||||||||||| | |||||||
Sbjct: 479 tccgggtgcacctgcttcagcaccttg 453



to top

>emb|BX034441.1|CNS08YQL Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA50BD08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 773

 Score =  101 bits (51), Expect = 2e-18
 Identities = 60/63 (95%)
 Strand = Plus / Plus

                                                                       
Query: 120 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 179
           |||| |||||||||||||||||||||||||||| |||||||||||||| |||||||||||
Sbjct: 249 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctcgccggg 308

              
Query: 180 gag 182
           |||
Sbjct: 309 gag 311



 Score = 81.8 bits (41), Expect = 1e-12
 Identities = 75/87 (86%)
 Strand = Plus / Plus

                                                                       
Query: 274 tcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatg 333
           |||||||||||||| | ||||  ||||||||||  ||| ||||||||||| |||||| ||
Sbjct: 402 tcgaagatgtcgttcacgaagctgttcatgatgctcatcgccttggaggaaatgccggtg 461

                                      
Query: 334 tccggntgcacctgcttgancaccttg 360
           ||||| ||||||||||| | |||||||
Sbjct: 462 tccgggtgcacctgcttcagcaccttg 488



to top

>emb|BX014617.1|CNS08JFX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA22AA07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 409

 Score =  101 bits (51), Expect = 2e-18
 Identities = 60/63 (95%)
 Strand = Plus / Minus

                                                                       
Query: 120 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 179
           |||| |||||||||||||||||||||||||||| |||||||||||||| |||||||||||
Sbjct: 170 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctcgccggg 111

              
Query: 180 gag 182
           |||
Sbjct: 110 gag 108



to top

>emb|BX008532.1|CNS08EQW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA14AA07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 536

 Score =  101 bits (51), Expect = 2e-18
 Identities = 60/63 (95%)
 Strand = Plus / Plus

                                                                       
Query: 120 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 179
           |||| |||||||||||||||||||||||||||| |||||||||||||| |||||||||||
Sbjct: 204 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctcgccggg 263

              
Query: 180 gag 182
           |||
Sbjct: 264 gag 266



 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 72/87 (82%)
 Strand = Plus / Plus

                                                                       
Query: 274 tcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatg 333
           |||||||||| ||| | ||||  ||||||||||  ||| ||||||||||| |||||| ||
Sbjct: 358 tcgaagatgttgttcacgaagctgttcatgatgctcatcgccttggaggaaatgccggtg 417

                                      
Query: 334 tccggntgcacctgcttgancaccttg 360
           | ||| ||||||| ||| | |||||||
Sbjct: 418 tgcgggtgcaccttctttagcaccttg 444



to top

>emb|X02916.1|SGH4H2B Rainbow trout histone H4 and H2B genes
          Length = 2930

 Score =  101 bits (51), Expect = 2e-18
 Identities = 93/107 (86%)
 Strand = Plus / Minus

                                                                        
Query: 120  ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 179
            |||| ||||||| |||||||||||||||||||| || ||||||||||| ||||| |||||
Sbjct: 2103 ggtgtacttggtcacggccttggtgccctcggacactgcgtgcttggccagctctccggg 2044

                                                           
Query: 180  gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgg 226
            ||| |  ||||| || | ||||||||||||||  |||||||||||||
Sbjct: 2043 gagcagcaggcgcactgcggtctggatctccctagaggtgatggtgg 1997



 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 66/77 (85%)
 Strand = Plus / Minus

                                                                        
Query: 274  tcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatg 333
            |||||||||||||| | ||| |||||||||||   |||||||||||||||||||||| | 
Sbjct: 1949 tcgaagatgtcgttcacgaacgagttcatgattcccatggccttggaggagatgccggta 1890

                             
Query: 334  tccggntgcacctgctt 350
            || || || ||||||||
Sbjct: 1889 tcggggtggacctgctt 1873



to top

>gb|BC096123.1| Homo sapiens histone 1, H2bf, mRNA (cDNA clone MGC:116769
           IMAGE:40002357), complete cds
          Length = 430

 Score =  101 bits (51), Expect = 2e-18
 Identities = 93/107 (86%)
 Strand = Plus / Minus

                                                                       
Query: 120 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 179
           |||| ||||||||||||||||||||||||| || ||||||||||| || ||||| |||||
Sbjct: 369 ggtgtacttggtgacggccttggtgccctctgacacggcgtgcttagccagctccccggg 310

                                                          
Query: 180 gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgg 226
            || |  ||||| ||||  ||||||||||||| ||||||||||||||
Sbjct: 309 cagcagcaggcgtacggccgtctggatctccctggaggtgatggtgg 263



 Score = 89.7 bits (45), Expect = 6e-15
 Identities = 76/87 (87%)
 Strand = Plus / Minus

                                                                       
Query: 274 tcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatg 333
           |||||||| ||||||| ||||||||||||||||  |||||||||||| ||||||||| ||
Sbjct: 215 tcgaagatatcgttgacgaaggagttcatgatgcccatggccttggatgagatgccggtg 156

                                      
Query: 334 tccggntgcacctgcttgancaccttg 360
           || || || |||||||| | |||||||
Sbjct: 155 tcggggtggacctgctttagcaccttg 129



to top

>gb|BC096120.1| Homo sapiens histone 1, H2bf, mRNA (cDNA clone MGC:116766
           IMAGE:40002352), complete cds
          Length = 430

 Score =  101 bits (51), Expect = 2e-18
 Identities = 93/107 (86%)
 Strand = Plus / Minus

                                                                       
Query: 120 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 179
           |||| ||||||||||||||||||||||||| || ||||||||||| || ||||| |||||
Sbjct: 369 ggtgtacttggtgacggccttggtgccctctgacacggcgtgcttagccagctccccggg 310

                                                          
Query: 180 gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgg 226
            || |  ||||| ||||  ||||||||||||| ||||||||||||||
Sbjct: 309 cagcagcaggcgtacggccgtctggatctccctggaggtgatggtgg 263



 Score = 89.7 bits (45), Expect = 6e-15
 Identities = 76/87 (87%)
 Strand = Plus / Minus

                                                                       
Query: 274 tcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatg 333
           |||||||| ||||||| ||||||||||||||||  |||||||||||| ||||||||| ||
Sbjct: 215 tcgaagatatcgttgacgaaggagttcatgatgcccatggccttggatgagatgccggtg 156

                                      
Query: 334 tccggntgcacctgcttgancaccttg 360
           || || || |||||||| | |||||||
Sbjct: 155 tcggggtggacctgctttagcaccttg 129



to top

>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete
                sequence
          Length = 22696651

 Score =  101 bits (51), Expect = 2e-18
 Identities = 81/91 (89%)
 Strand = Plus / Plus

                                                                            
Query: 135      ggccttggtgccctcggagacggcgtgcttggcgagctcgccggggaggacgaggcggac 194
                |||||||||||||||||||| |||||| |||||||| ||| |||||||||||||||||||
Sbjct: 22490854 ggccttggtgccctcggagatggcgtggttggcgaggtcggcggggaggacgaggcggac 22490913

                                               
Query: 195      ggaggtctggatctcccgggaggtgatggtg 225
                || || ||| | ||| |||||||||| ||||
Sbjct: 22490914 ggcggactgaacctcacgggaggtgagggtg 22490944



 Score = 44.1 bits (22), Expect = 0.31
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                            
Query: 268     agcttntcgaagatgtcgttgatgaagga 296
               ||||| | |||||||||||||||||||||
Sbjct: 6982961 agcttcttgaagatgtcgttgatgaagga 6982933



to top

>dbj|AP006162.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC
            clone:B1331F11
          Length = 132205

 Score =  101 bits (51), Expect = 2e-18
 Identities = 81/91 (89%)
 Strand = Plus / Plus

                                                                        
Query: 135  ggccttggtgccctcggagacggcgtgcttggcgagctcgccggggaggacgaggcggac 194
            |||||||||||||||||||| |||||| |||||||| ||| |||||||||||||||||||
Sbjct: 6055 ggccttggtgccctcggagatggcgtggttggcgaggtcggcggggaggacgaggcggac 6114

                                           
Query: 195  ggaggtctggatctcccgggaggtgatggtg 225
            || || ||| | ||| |||||||||| ||||
Sbjct: 6115 ggcggactgaacctcacgggaggtgagggtg 6145



to top

>dbj|AK106505.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-105-F12, full
           insert sequence
          Length = 1228

 Score =  101 bits (51), Expect = 2e-18
 Identities = 81/91 (89%)
 Strand = Plus / Minus

                                                                       
Query: 135 ggccttggtgccctcggagacggcgtgcttggcgagctcgccggggaggacgaggcggac 194
           |||||||||||||||||||| |||||| |||||||| ||| |||||||||||||||||||
Sbjct: 985 ggccttggtgccctcggagatggcgtggttggcgaggtcggcggggaggacgaggcggac 926

                                          
Query: 195 ggaggtctggatctcccgggaggtgatggtg 225
           || || ||| | ||| |||||||||| ||||
Sbjct: 925 ggcggactgaacctcacgggaggtgagggtg 895



to top

>emb|Z80779.1|HSH2BG H.sapiens H2B/g gene
          Length = 1020

 Score =  101 bits (51), Expect = 2e-18
 Identities = 93/107 (86%)
 Strand = Plus / Minus

                                                                       
Query: 120 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 179
           |||| ||||||||||||||||||||||||| || ||||||||||| || ||||| |||||
Sbjct: 566 ggtgtacttggtgacggccttggtgccctctgacacggcgtgcttagccagctccccggg 507

                                                          
Query: 180 gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgg 226
            || |  ||||| ||||  ||||||||||||| ||||||||||||||
Sbjct: 506 cagcagcaggcgcacggccgtctggatctccctggaggtgatggtgg 460



 Score = 89.7 bits (45), Expect = 6e-15
 Identities = 76/87 (87%)
 Strand = Plus / Minus

                                                                       
Query: 274 tcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatg 333
           |||||||| ||||||| ||||||||||||||||  |||||||||||| ||||||||| ||
Sbjct: 412 tcgaagatatcgttgacgaaggagttcatgatgcccatggccttggatgagatgccggtg 353

                                      
Query: 334 tccggntgcacctgcttgancaccttg 360
           || || || |||||||| | |||||||
Sbjct: 352 tcggggtggacctgctttagcaccttg 326



to top

>gb|M31921.1|VVCH2AB V.carteri histone H2A-III and H2B-III genes, complete cds
          Length = 1442

 Score =  101 bits (51), Expect = 2e-18
 Identities = 102/119 (85%)
 Strand = Plus / Minus

                                                                        
Query: 121  gtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccgggg 180
            |||||||||||||| |||||||| |||||||| || ||||||||||| |||||||| || 
Sbjct: 1264 gtgaacttggtgacagccttggttccctcggacacagcgtgcttggccagctcgcctggc 1205

                                                                       
Query: 181  aggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgta 239
            ||||| ||||| ||||  |||||||| || || || |||| ||| ||||||||||||||
Sbjct: 1204 aggacaaggcgcacggcagtctggatttcgcgagacgtgacggtcggcttcttgttgta 1146



 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 68/80 (85%)
 Strand = Plus / Minus

                                                                        
Query: 280  atgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtccggn 339
            |||||||||||||||  ||||||||||  ||| |||||||||  ||||||| |||| || 
Sbjct: 1105 atgtcgttgatgaagctgttcatgatgctcatcgccttggagctgatgccggtgtcaggg 1046

                                
Query: 340  tgcacctgcttgancacctt 359
            ||||||||||| | ||||||
Sbjct: 1045 tgcacctgcttcagcacctt 1026



to top

>ref|XM_518295.1| PREDICTED: Pan troglodytes similar to H2B histone family, member T;
           histone family member (LOC462501), mRNA
          Length = 1521

 Score = 99.6 bits (50), Expect = 6e-18
 Identities = 86/98 (87%)
 Strand = Plus / Minus

                                                                       
Query: 127 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggaggacg 186
           |||||||||||||||||||||||||| |||||||||||||| | ||| ||||| || |  
Sbjct: 402 ttggtgacggccttggtgccctcggacacggcgtgcttggccaactccccgggcagcagc 343

                                                 
Query: 187 aggcggacggaggtctggatctcccgggaggtgatggt 224
           ||||| ||||  ||||||||||||| ||||||||||||
Sbjct: 342 aggcgcacggccgtctggatctccctggaggtgatggt 305



 Score = 89.7 bits (45), Expect = 6e-15
 Identities = 76/87 (87%)
 Strand = Plus / Minus

                                                                       
Query: 274 tcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatg 333
           |||||||||||||||| |||||||||||||||   ||||||||| |||||||||||| ||
Sbjct: 255 tcgaagatgtcgttgacgaaggagttcatgattcccatggccttagaggagatgccggtg 196

                                      
Query: 334 tccggntgcacctgcttgancaccttg 360
           || || || |||||||| | |||||||
Sbjct: 195 tcggggtggacctgcttcagcaccttg 169



to top

>ref|XM_513764.1| PREDICTED: Pan troglodytes LOC457261 (LOC457261), mRNA
          Length = 789

 Score = 99.6 bits (50), Expect = 6e-18
 Identities = 90/102 (88%), Gaps = 1/102 (0%)
 Strand = Plus / Minus

                                                                       
Query: 125 acttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggagga 184
           |||||||||| ||||||||||||||||| |||||||||||||| ||||||||||| || |
Sbjct: 186 acttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccgggcagca 127

                                                     
Query: 185 cgaggcggacggaggtctggatctcccgggaggtgatggtgg 226
             ||||| ||||  |||||||||| |||||| ||||||||||
Sbjct: 126 gcaggcgcacggccgtctggatct-ccgggacgtgatggtgg 86



 Score = 93.7 bits (47), Expect = 4e-16
 Identities = 91/103 (88%), Gaps = 2/103 (1%)
 Strand = Plus / Plus

                                                                       
Query: 125 acttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggagga 184
           |||||||||| ||||||||||||||||| |||||||||||||| ||||||||||| || |
Sbjct: 293 acttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccgggcagca 352

                                                      
Query: 185 cgaggcggacggaggtctggatctcccgggag-gtgatggtgg 226
             ||||| ||||  |||||||||| ||||||| ||||||||||
Sbjct: 353 gcaggcgcacggccgtctggatct-ccgggagcgtgatggtgg 394



 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 32/33 (96%)
 Strand = Plus / Minus

                                            
Query: 274 tcgaagatgtcgttgatgaaggagttcatgatg 306
           |||||||||||||||| ||||||||||||||||
Sbjct: 38  tcgaagatgtcgttgaggaaggagttcatgatg 6



to top

>gb|AY656810.1| Homo sapiens H2B/t variant gene, complete cds
          Length = 1874

 Score = 99.6 bits (50), Expect = 6e-18
 Identities = 90/102 (88%), Gaps = 1/102 (0%)
 Strand = Plus / Minus

                                                                       
Query: 125 acttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggagga 184
           |||||||||| ||||||||||||||||| |||||||||||||| ||||||||||| || |
Sbjct: 743 acttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccgggcagca 684

                                                     
Query: 185 cgaggcggacggaggtctggatctcccgggaggtgatggtgg 226
             ||||| ||||  |||||||||| |||||| ||||||||||
Sbjct: 683 gcaggcgcacggccgtctggatct-ccgggacgtgatggtgg 643



 Score = 73.8 bits (37), Expect = 3e-10
 Identities = 74/87 (85%)
 Strand = Plus / Minus

                                                                       
Query: 274 tcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatg 333
           |||||||||||||||| ||||||||||||||||  |||||||||| |  |||||||| ||
Sbjct: 595 tcgaagatgtcgttgaggaaggagttcatgatgcccatggccttgcaccagatgccggtg 536

                                      
Query: 334 tccggntgcacctgcttgancaccttg 360
           || || || ||| |||| | |||||||
Sbjct: 535 tcggggtggacccgcttcagcaccttg 509



to top

>gb|AY648853.1| Homo sapiens histone H2B/s (HIST2H2BD) gene, complete cds
          Length = 1861

 Score = 99.6 bits (50), Expect = 6e-18
 Identities = 90/102 (88%), Gaps = 1/102 (0%)
 Strand = Plus / Minus

                                                                       
Query: 125 acttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggagga 184
           |||||||||| ||||||||||||||||| |||||||||||||| ||||||||||| || |
Sbjct: 743 acttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccgggcagca 684

                                                     
Query: 185 cgaggcggacggaggtctggatctcccgggaggtgatggtgg 226
             ||||| ||||  |||||||||| |||||| ||||||||||
Sbjct: 683 gcaggcgcacggccgtctggatct-ccgggacgtgatggtgg 643



 Score = 73.8 bits (37), Expect = 3e-10
 Identities = 74/87 (85%)
 Strand = Plus / Minus

                                                                       
Query: 274 tcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatg 333
           |||||||||||||||| ||||||||||||||||  |||||||||| |  |||||||| ||
Sbjct: 595 tcgaagatgtcgttgaggaaggagttcatgatgcccatggccttgcaccagatgccggtg 536

                                      
Query: 334 tccggntgcacctgcttgancaccttg 360
           || || || ||| |||| | |||||||
Sbjct: 535 tcggggtggacccgcttcagcaccttg 509



to top

>ref|XM_868991.1| PREDICTED: Bos taurus similar to Histone H2B 291B (LOC616868), mRNA
          Length = 674

 Score = 99.6 bits (50), Expect = 6e-18
 Identities = 86/98 (87%)
 Strand = Plus / Minus

                                                                       
Query: 127 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggaggacg 186
           |||||||||||||||||||||||||| |||||||||||||| ||||| ||||| || |  
Sbjct: 371 ttggtgacggccttggtgccctcggacacggcgtgcttggccagctccccgggcagcagc 312

                                                 
Query: 187 aggcggacggaggtctggatctcccgggaggtgatggt 224
           ||||| ||||  ||||||||||||| ||| ||||||||
Sbjct: 311 aggcgcacggccgtctggatctccctggatgtgatggt 274



 Score = 89.7 bits (45), Expect = 6e-15
 Identities = 76/87 (87%)
 Strand = Plus / Minus

                                                                       
Query: 274 tcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatg 333
           |||||||| ||||||| |||||||||||||||   |||||||||||| ||||||||| ||
Sbjct: 224 tcgaagatatcgttgacgaaggagttcatgattcccatggccttggacgagatgccggtg 165

                                      
Query: 334 tccggntgcacctgcttgancaccttg 360
           ||||| || |||||||| | |||||||
Sbjct: 164 tccgggtggacctgcttcagcaccttg 138



to top

>gb|BC071638.1| Homo sapiens cDNA clone IMAGE:4390105, containing frame-shift
           errors
          Length = 618

 Score = 99.6 bits (50), Expect = 6e-18
 Identities = 90/102 (88%), Gaps = 1/102 (0%)
 Strand = Plus / Minus

                                                                       
Query: 125 acttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggagga 184
           |||||||||| ||||||||||||||||| |||||||||||||| ||||||||||| || |
Sbjct: 414 acttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccgggcagca 355

                                                     
Query: 185 cgaggcggacggaggtctggatctcccgggaggtgatggtgg 226
             ||||| ||||  |||||||||| |||||| ||||||||||
Sbjct: 354 gcaggcgcacggccgtctggatct-ccgggacgtgatggtgg 314



 Score = 73.8 bits (37), Expect = 3e-10
 Identities = 74/87 (85%)
 Strand = Plus / Minus

                                                                       
Query: 274 tcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatg 333
           |||||||||||||||| ||||||||||||||||  |||||||||| |  |||||||| ||
Sbjct: 266 tcgaagatgtcgttgaggaaggagttcatgatgcccatggccttgcaccagatgccggtg 207

                                      
Query: 334 tccggntgcacctgcttgancaccttg 360
           || || || ||| |||| | |||||||
Sbjct: 206 tcggggtggacccgcttcagcaccttg 180



to top

>gb|BC068044.1| Homo sapiens cDNA clone IMAGE:6380649, containing frame-shift
           errors
          Length = 687

 Score = 99.6 bits (50), Expect = 6e-18
 Identities = 90/102 (88%), Gaps = 1/102 (0%)
 Strand = Plus / Minus

                                                                       
Query: 125 acttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggagga 184
           |||||||||| ||||||||||||||||| |||||||||||||| ||||||||||| || |
Sbjct: 428 acttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccgggcagca 369

                                                     
Query: 185 cgaggcggacggaggtctggatctcccgggaggtgatggtgg 226
             ||||| ||||  |||||||||| |||||| ||||||||||
Sbjct: 368 gcaggcgcacggccgtctggatct-ccgggacgtgatggtgg 328



 Score = 73.8 bits (37), Expect = 3e-10
 Identities = 74/87 (85%)
 Strand = Plus / Minus

                                                                       
Query: 274 tcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatg 333
           |||||||||||||||| ||||||||||||||||  |||||||||| |  |||||||| ||
Sbjct: 280 tcgaagatgtcgttgaggaaggagttcatgatgcccatggccttgcaccagatgccggtg 221

                                      
Query: 334 tccggntgcacctgcttgancaccttg 360
           || || || ||| |||| | |||||||
Sbjct: 220 tcggggtggacccgcttcagcaccttg 194



to top

>emb|BX038797.1|CNS0923L Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAB3BD09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 105

 Score = 99.6 bits (50), Expect = 6e-18
 Identities = 56/58 (96%)
 Strand = Plus / Plus

                                                                     
Query: 125 acttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggag 182
           |||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||
Sbjct: 45  acttggtgacggccttggtgccctcggacacggcgtgcttggccagctcgccggggag 102



to top

>emb|X14731.1|CMHIST2B Duck H2B histone gene
          Length = 1179

 Score = 99.6 bits (50), Expect = 6e-18
 Identities = 94/106 (88%), Gaps = 2/106 (1%)
 Strand = Plus / Minus

                                                                        
Query: 120  ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 179
            |||| |||||||||| |||||||||||||||||||||||||||||||| |||||||||||
Sbjct: 1042 ggtgtacttggtgaccgccttggtgccctcggagacggcgtgcttggccagctcgccggg 983

                                                          
Query: 180  gagga-cgaggcggacggaggtctggatctcccgggaggtgatggt 224
             || | |||  || ||||  |||||||||||||| |||||||||||
Sbjct: 982  cagcagcga-ccgcacggccgtctggatctcccgcgaggtgatggt 938



 Score = 97.6 bits (49), Expect = 2e-17
 Identities = 77/87 (88%)
 Strand = Plus / Minus

                                                                       
Query: 274 tcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatg 333
           |||||||||||||||| ||||||||||||||||  |||||||||||| ||||||||  ||
Sbjct: 888 tcgaagatgtcgttgacgaaggagttcatgatgcccatggccttggacgagatgcccgtg 829

                                      
Query: 334 tccggntgcacctgcttgancaccttg 360
           || || ||||||||||| | |||||||
Sbjct: 828 tcggggtgcacctgcttcagcaccttg 802



to top

>gb|DQ118972.1| Toxoplasma gondii histone 2B variant 2 mRNA, complete cds
          Length = 446

 Score = 99.6 bits (50), Expect = 6e-18
 Identities = 86/98 (87%)
 Strand = Plus / Minus

                                                                       
Query: 120 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 179
           |||| ||||||||||||||||||||||||| || ||||||||||| ||||| || |||||
Sbjct: 342 ggtgtacttggtgacggccttggtgccctcagacacggcgtgctttgcgagttctccggg 283

                                                 
Query: 180 gaggacgaggcggacggaggtctggatctcccgggagg 217
           ||| || || || |||| ||||||||| ||||||||||
Sbjct: 282 gagaaccagacgaacggcggtctggatttcccgggagg 245



to top

>gb|BC108143.1| Bos taurus similar to Histone H2B 291B, mRNA (cDNA clone MGC:133641
           IMAGE:8049327), complete cds
          Length = 503

 Score = 99.6 bits (50), Expect = 6e-18
 Identities = 86/98 (87%)
 Strand = Plus / Minus

                                                                       
Query: 127 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggaggacg 186
           |||||||||||||||||||||||||| |||||||||||||| ||||| ||||| || |  
Sbjct: 391 ttggtgacggccttggtgccctcggacacggcgtgcttggccagctccccgggcagcagc 332

                                                 
Query: 187 aggcggacggaggtctggatctcccgggaggtgatggt 224
           ||||| ||||  ||||||||||||| ||| ||||||||
Sbjct: 331 aggcgcacggccgtctggatctccctggatgtgatggt 294



 Score = 89.7 bits (45), Expect = 6e-15
 Identities = 76/87 (87%)
 Strand = Plus / Minus

                                                                       
Query: 274 tcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatg 333
           |||||||| ||||||| |||||||||||||||   |||||||||||| ||||||||| ||
Sbjct: 244 tcgaagatatcgttgacgaaggagttcatgattcccatggccttggacgagatgccggtg 185

                                      
Query: 334 tccggntgcacctgcttgancaccttg 360
           ||||| || |||||||| | |||||||
Sbjct: 184 tccgggtggacctgcttcagcaccttg 158



to top

>ref|NM_001037469.1| Bos taurus similar to Histone H2B 291B (MGC133641), mRNA
          Length = 503

 Score = 99.6 bits (50), Expect = 6e-18
 Identities = 86/98 (87%)
 Strand = Plus / Minus

                                                                       
Query: 127 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggaggacg 186
           |||||||||||||||||||||||||| |||||||||||||| ||||| ||||| || |  
Sbjct: 391 ttggtgacggccttggtgccctcggacacggcgtgcttggccagctccccgggcagcagc 332

                                                 
Query: 187 aggcggacggaggtctggatctcccgggaggtgatggt 224
           ||||| ||||  ||||||||||||| ||| ||||||||
Sbjct: 331 aggcgcacggccgtctggatctccctggatgtgatggt 294



 Score = 89.7 bits (45), Expect = 6e-15
 Identities = 76/87 (87%)
 Strand = Plus / Minus

                                                                       
Query: 274 tcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatg 333
           |||||||| ||||||| |||||||||||||||   |||||||||||| ||||||||| ||
Sbjct: 244 tcgaagatatcgttgacgaaggagttcatgattcccatggccttggacgagatgccggtg 185

                                      
Query: 334 tccggntgcacctgcttgancaccttg 360
           ||||| || |||||||| | |||||||
Sbjct: 184 tccgggtggacctgcttcagcaccttg 158



to top

>ref|XM_936779.1| PREDICTED: Homo sapiens similar to H2B histone family, member F
           (LOC647719), mRNA
          Length = 703

 Score = 99.6 bits (50), Expect = 6e-18
 Identities = 90/102 (88%), Gaps = 1/102 (0%)
 Strand = Plus / Minus

                                                                       
Query: 125 acttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggagga 184
           |||||||||| ||||||||||||||||| |||||||||||||| ||||||||||| || |
Sbjct: 484 acttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccgggcagca 425

                                                     
Query: 185 cgaggcggacggaggtctggatctcccgggaggtgatggtgg 226
             ||||| ||||  |||||||||| |||||| ||||||||||
Sbjct: 424 gcaggcgcacggccgtctggatct-ccgggacgtgatggtgg 384



 Score = 73.8 bits (37), Expect = 3e-10
 Identities = 74/87 (85%)
 Strand = Plus / Minus

                                                                       
Query: 274 tcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatg 333
           |||||||||||||||| ||||||||||||||||  |||||||||| |  |||||||| ||
Sbjct: 336 tcgaagatgtcgttgaggaaggagttcatgatgcccatggccttgcaccagatgccggtg 277

                                      
Query: 334 tccggntgcacctgcttgancaccttg 360
           || || || ||| |||| | |||||||
Sbjct: 276 tcggggtggacccgcttcagcaccttg 250



to top

>ref|NG_002619.1| Homo sapiens histone 2, H2bc (HIST2H2BC) pseudogene on chromosome 1
          Length = 1134

 Score = 99.6 bits (50), Expect = 6e-18
 Identities = 90/102 (88%), Gaps = 1/102 (0%)
 Strand = Plus / Minus

                                                                       
Query: 125 acttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggagga 184
           |||||||||| ||||||||||||||||| |||||||||||||| ||||||||||| || |
Sbjct: 742 acttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccgggcagca 683

                                                     
Query: 185 cgaggcggacggaggtctggatctcccgggaggtgatggtgg 226
             ||||| ||||  |||||||||| |||||| ||||||||||
Sbjct: 682 gcaggcgcacggccgtctggatct-ccgggacgtgatggtgg 642



 Score = 73.8 bits (37), Expect = 3e-10
 Identities = 74/87 (85%)
 Strand = Plus / Minus

                                                                       
Query: 274 tcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatg 333
           |||||||||||||||| ||||||||||||||||  |||||||||| |  |||||||| ||
Sbjct: 594 tcgaagatgtcgttgaggaaggagttcatgatgcccatggccttgcaccagatgccggtg 535

                                      
Query: 334 tccggntgcacctgcttgancaccttg 360
           || || || ||| |||| | |||||||
Sbjct: 534 tcggggtggacccgcttcagcaccttg 508



to top

>ref|NG_002620.1| Homo sapiens histone 2, H2bd (HIST2H2BD) pseudogene on chromosome 1
          Length = 1134

 Score = 99.6 bits (50), Expect = 6e-18
 Identities = 90/102 (88%), Gaps = 1/102 (0%)
 Strand = Plus / Minus

                                                                       
Query: 125 acttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggagga 184
           |||||||||| ||||||||||||||||| |||||||||||||| ||||||||||| || |
Sbjct: 741 acttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccgggcagca 682

                                                     
Query: 185 cgaggcggacggaggtctggatctcccgggaggtgatggtgg 226
             ||||| ||||  |||||||||| |||||| ||||||||||
Sbjct: 681 gcaggcgcacggccgtctggatct-ccgggacgtgatggtgg 641



 Score = 73.8 bits (37), Expect = 3e-10
 Identities = 74/87 (85%)
 Strand = Plus / Minus

                                                                       
Query: 274 tcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatg 333
           |||||||||||||||| ||||||||||||||||  |||||||||| |  |||||||| ||
Sbjct: 593 tcgaagatgtcgttgaggaaggagttcatgatgcccatggccttgcaccagatgccggtg 534

                                      
Query: 334 tccggntgcacctgcttgancaccttg 360
           || || || ||| |||| | |||||||
Sbjct: 533 tcggggtggacccgcttcagcaccttg 507



to top

>gb|AY131977.1| Homo sapiens histone H2B (HIST2H2BC) pseudogene, complete sequence
          Length = 1134

 Score = 99.6 bits (50), Expect = 6e-18
 Identities = 90/102 (88%), Gaps = 1/102 (0%)
 Strand = Plus / Minus

                                                                       
Query: 125 acttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggagga 184
           |||||||||| ||||||||||||||||| |||||||||||||| ||||||||||| || |
Sbjct: 742 acttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccgggcagca 683

                                                     
Query: 185 cgaggcggacggaggtctggatctcccgggaggtgatggtgg 226
             ||||| ||||  |||||||||| |||||| ||||||||||
Sbjct: 682 gcaggcgcacggccgtctggatct-ccgggacgtgatggtgg 642



 Score = 73.8 bits (37), Expect = 3e-10
 Identities = 74/87 (85%)
 Strand = Plus / Minus

                                                                       
Query: 274 tcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatg 333
           |||||||||||||||| ||||||||||||||||  |||||||||| |  |||||||| ||
Sbjct: 594 tcgaagatgtcgttgaggaaggagttcatgatgcccatggccttgcaccagatgccggtg 535

                                      
Query: 334 tccggntgcacctgcttgancaccttg 360
           || || || ||| |||| | |||||||
Sbjct: 534 tcggggtggacccgcttcagcaccttg 508



to top

>gb|AY131978.1| Homo sapiens histone H2B (HIST2H2BD) pseudogene, complete sequence
          Length = 1134

 Score = 99.6 bits (50), Expect = 6e-18
 Identities = 90/102 (88%), Gaps = 1/102 (0%)
 Strand = Plus / Minus

                                                                       
Query: 125 acttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggagga 184
           |||||||||| ||||||||||||||||| |||||||||||||| ||||||||||| || |
Sbjct: 741 acttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccgggcagca 682

                                                     
Query: 185 cgaggcggacggaggtctggatctcccgggaggtgatggtgg 226
             ||||| ||||  |||||||||| |||||| ||||||||||
Sbjct: 681 gcaggcgcacggccgtctggatct-ccgggacgtgatggtgg 641



 Score = 73.8 bits (37), Expect = 3e-10
 Identities = 74/87 (85%)
 Strand = Plus / Minus

                                                                       
Query: 274 tcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatg 333
           |||||||||||||||| ||||||||||||||||  |||||||||| |  |||||||| ||
Sbjct: 593 tcgaagatgtcgttgaggaaggagttcatgatgcccatggccttgcaccagatgccggtg 534

                                      
Query: 334 tccggntgcacctgcttgancaccttg 360
           || || || ||| |||| | |||||||
Sbjct: 533 tcggggtggacccgcttcagcaccttg 507



to top

>gb|BC107301.1| Mus musculus histone 3, H2bb, mRNA (cDNA clone MGC:130255
           IMAGE:40053183), complete cds
          Length = 465

 Score = 97.6 bits (49), Expect = 2e-17
 Identities = 77/87 (88%)
 Strand = Plus / Minus

                                                                       
Query: 274 tcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatg 333
           ||||||||||| |||| ||| ||||||||||||  |||||||||||| ||||||||| ||
Sbjct: 298 tcgaagatgtcattgacgaacgagttcatgatgcccatggccttggacgagatgccggtg 239

                                      
Query: 334 tccggntgcacctgcttgancaccttg 360
           ||||| ||||||||||| | |||||||
Sbjct: 238 tccggatgcacctgcttcagcaccttg 212



 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 82/98 (83%)
 Strand = Plus / Minus

                                                                       
Query: 127 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggaggacg 186
           |||||||| ||||||||||||||||| ||||| |||||||| ||||| ||||| || |  
Sbjct: 445 ttggtgactgccttggtgccctcggacacggcatgcttggccagctccccgggcagcagc 386

                                                 
Query: 187 aggcggacggaggtctggatctcccgggaggtgatggt 224
           ||||| ||||  ||||| | ||| ||||| ||||||||
Sbjct: 385 aggcgcacggccgtctgcacctcgcgggacgtgatggt 348



to top

>ref|XM_527280.1| PREDICTED: Pan troglodytes similar to ribosomal protein L24-like;
           homolog of yeast ribosomal like protein 24; 60S
           ribosomal protein L30 isolog; my024 protein (LOC471902),
           mRNA
          Length = 1131

 Score = 97.6 bits (49), Expect = 2e-17
 Identities = 91/105 (86%)
 Strand = Plus / Minus

                                                                       
Query: 120 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 179
           |||| ||||||||||||||||||||||||| || || ||||||||||| ||||| || ||
Sbjct: 369 ggtgtacttggtgacggccttggtgccctccgacaccgcgtgcttggccagctcccccgg 310

                                                        
Query: 180 gaggacgaggcggacggaggtctggatctcccgggaggtgatggt 224
            || |  ||||| |||| |||||||||||||| ||||||||||||
Sbjct: 309 aagcagcaggcgcacggcggtctggatctccctggaggtgatggt 265



 Score = 81.8 bits (41), Expect = 1e-12
 Identities = 75/87 (86%)
 Strand = Plus / Minus

                                                                       
Query: 274 tcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatg 333
           |||||||||||||||| |||||||||||||||   ||||||||| || ||||||||| ||
Sbjct: 215 tcgaagatgtcgttgacgaaggagttcatgattcccatggccttagaagagatgccggtg 156

                                      
Query: 334 tccggntgcacctgcttgancaccttg 360
           || || || |||||||| | |||||||
Sbjct: 155 tcggggtggacctgcttcagcaccttg 129



to top

>ref|XM_527258.1| PREDICTED: Pan troglodytes similar to histone H2b-616 (LOC471880),
           mRNA
          Length = 381

 Score = 97.6 bits (49), Expect = 2e-17
 Identities = 91/105 (86%)
 Strand = Plus / Minus

                                                                       
Query: 120 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 179
           |||| |||||||||| |||||||||||||| || |||||||||||||| ||||| |||||
Sbjct: 369 ggtgtacttggtgaccgccttggtgccctccgacacggcgtgcttggccagctctccggg 310

                                                        
Query: 180 gaggacgaggcggacggaggtctggatctcccgggaggtgatggt 224
            || |  ||||| ||||  ||||||||||||| ||||||||||||
Sbjct: 309 aagcagcaggcgcacggccgtctggatctccctggaggtgatggt 265



to top

>ref|XM_518287.1| PREDICTED: Pan troglodytes similar to Histone H2B 291B (LOC462491),
           mRNA
          Length = 643

 Score = 97.6 bits (49), Expect = 2e-17
 Identities = 91/105 (86%)
 Strand = Plus / Minus

                                                                       
Query: 120 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 179
           |||| ||||||||||||||||||||||||| || |||||||||||||| ||||| || ||
Sbjct: 419 ggtgtacttggtgacggccttggtgccctccgacacggcgtgcttggccagctcccccgg 360

                                                        
Query: 180 gaggacgaggcggacggaggtctggatctcccgggaggtgatggt 224
            || |  ||||| ||||  ||||||||||||| ||||||||||||
Sbjct: 359 aagcagcaggcgcacggccgtctggatctccctggaggtgatggt 315



 Score = 65.9 bits (33), Expect = 8e-08
 Identities = 73/87 (83%)
 Strand = Plus / Minus

                                                                       
Query: 274 tcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatg 333
           |||||||||||||||| |||||| ||||||||   ||| || ||||| ||||||||| ||
Sbjct: 265 tcgaagatgtcgttgacgaaggaattcatgatccccattgctttggaagagatgccggtg 206

                                      
Query: 334 tccggntgcacctgcttgancaccttg 360
           || || || |||||||| | |||||||
Sbjct: 205 tcgggatggacctgcttcagcaccttg 179



to top

>gb|BC107302.1| Mus musculus histone 3, H2bb, mRNA (cDNA clone MGC:130256
           IMAGE:40053184), complete cds
          Length = 466

 Score = 97.6 bits (49), Expect = 2e-17
 Identities = 77/87 (88%)
 Strand = Plus / Minus

                                                                       
Query: 274 tcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatg 333
           ||||||||||| |||| ||| ||||||||||||  |||||||||||| ||||||||| ||
Sbjct: 299 tcgaagatgtcattgacgaacgagttcatgatgcccatggccttggacgagatgccggtg 240

                                      
Query: 334 tccggntgcacctgcttgancaccttg 360
           ||||| ||||||||||| | |||||||
Sbjct: 239 tccggatgcacctgcttcagcaccttg 213



 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 82/98 (83%)
 Strand = Plus / Minus

                                                                       
Query: 127 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggaggacg 186
           |||||||| ||||||||||||||||| ||||| |||||||| ||||| ||||| || |  
Sbjct: 446 ttggtgactgccttggtgccctcggacacggcatgcttggccagctccccgggcagcagc 387

                                                 
Query: 187 aggcggacggaggtctggatctcccgggaggtgatggt 224
           ||||| ||||  ||||| | ||| ||||| ||||||||
Sbjct: 386 aggcgcacggccgtctgcacctcgcgggacgtgatggt 349



to top

>ref|XM_525086.1| PREDICTED: Pan troglodytes similar to Histone H2B F (H2B 291A)
           (LOC469702), mRNA
          Length = 381

 Score = 97.6 bits (49), Expect = 2e-17
 Identities = 77/87 (88%)
 Strand = Plus / Minus

                                                                       
Query: 274 tcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatg 333
           ||||||||||| |||| ||||||||||||||||  |||||||||||| ||||||||| ||
Sbjct: 215 tcgaagatgtcattgacgaaggagttcatgatgcccatggccttggacgagatgccggtg 156

                                      
Query: 334 tccggntgcacctgcttgancaccttg 360
           || || ||||||||||| | |||||||
Sbjct: 155 tcggggtgcacctgcttcagcaccttg 129



 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 90/107 (84%)
 Strand = Plus / Minus

                                                                       
Query: 120 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 179
           |||| |||||||||| ||||| |||| |||||| |||||||||||||| |||||||||||
Sbjct: 369 ggtgtacttggtgacagccttagtgcgctcggacacggcgtgcttggccagctcgccggg 310

                                                          
Query: 180 gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgg 226
            || |  ||||| ||||  ||||| || || ||||| ||||||||||
Sbjct: 309 cagcagcaggcgcacggccgtctgcatttcgcgggacgtgatggtgg 263



to top

>ref|XM_525085.1| PREDICTED: Pan troglodytes similar to histone 3, H2bb (LOC469701),
           mRNA
          Length = 399

 Score = 97.6 bits (49), Expect = 2e-17
 Identities = 77/87 (88%)
 Strand = Plus / Minus

                                                                       
Query: 274 tcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatg 333
           ||||||||||| |||| ||||||||||||||||  |||||||||||| ||||||||| ||
Sbjct: 233 tcgaagatgtcattgacgaaggagttcatgatgcccatggccttggacgagatgccggtg 174

                                      
Query: 334 tccggntgcacctgcttgancaccttg 360
           || || ||||||||||| | |||||||
Sbjct: 173 tcggggtgcacctgcttcagcaccttg 147



 Score = 81.8 bits (41), Expect = 1e-12
 Identities = 53/57 (92%)
 Strand = Plus / Minus

                                                                    
Query: 120 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgcc 176
           |||| |||||||||| ||||||||||||||||| |||||||||||||| ||||||||
Sbjct: 387 ggtgtacttggtgacagccttggtgccctcggacacggcgtgcttggccagctcgcc 331



to top

>ref|NM_023422.2| Mus musculus histone 1, H2bc (Hist1h2bc), mRNA
          Length = 730

 Score = 97.6 bits (49), Expect = 2e-17
 Identities = 91/105 (86%)
 Strand = Plus / Minus

                                                                       
Query: 120 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 179
           |||| ||||||||||||||||||||||||| || || ||||||||||| ||||| |||||
Sbjct: 404 ggtgtacttggtgacggccttggtgccctccgacaccgcgtgcttggccagctccccggg 345

                                                        
Query: 180 gaggacgaggcggacggaggtctggatctcccgggaggtgatggt 224
            || |  ||||| ||||  ||||||||||||||||| ||||||||
Sbjct: 344 cagcagcaggcgcacggccgtctggatctcccgggacgtgatggt 300



 Score = 89.7 bits (45), Expect = 6e-15
 Identities = 76/87 (87%)
 Strand = Plus / Minus

                                                                       
Query: 274 tcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatg 333
           |||||||||||||| | ||| ||||||||||||  |||||||||||||||||||||| ||
Sbjct: 250 tcgaagatgtcgttcacgaacgagttcatgatgcccatggccttggaggagatgccggtg 191

                                      
Query: 334 tccggntgcacctgcttgancaccttg 360
           || || ||||| ||||| | |||||||
Sbjct: 190 tcggggtgcacttgcttcagcaccttg 164


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,955,311
Number of Sequences: 3902068
Number of extensions: 1955311
Number of successful extensions: 43725
Number of sequences better than 10.0: 907
Number of HSP's better than 10.0 without gapping: 924
Number of HSP's successfully gapped in prelim test: 1
Number of HSP's that attempted gapping in prelim test: 40725
Number of HSP's gapped (non-prelim): 2880
length of query: 361
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 339
effective length of database: 17,147,199,772
effective search space: 5812900722708
effective search space used: 5812900722708
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top