ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbags14i16
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1dbj|D38090.1|WHTPH2AD Triticum aestivum mRNA for protein H2A, co... 722 0.0
2dbj|D38088.1|WHTPH2AB Triticum aestivum mRNA for protein H2A, co... 706 0.0
3dbj|D38087.1|WHTPH2AA Triticum aestivum mRNA for protein H2A, co... 674 0.0
4gb|BT016569.1| Zea mays clone Contig402 mRNA sequence 365 1e-97
5gb|BT019008.1| Zea mays clone Contig499.F mRNA sequence 365 1e-97
6gb|AY103710.1| Zea mays PCO123562 mRNA sequence 365 1e-97
7emb|X94973.1|TAH2A274 T.aestivum histone H2A gene (clone TH274) 353 5e-94
8gb|L75802.1|WHTHIH2A Triticum aestivum histone H2A gene, complet... 353 5e-94
9dbj|AK074018.1| Oryza sativa (japonica cultivar-group) cDNA clon... 353 5e-94
10ref|NM_193707.1| Oryza sativa (japonica cultivar-group), predic... 339 7e-90
11dbj|AK121750.1| Oryza sativa (japonica cultivar-group) cDNA clon... 339 7e-90
12gb|AY103585.1| Zea mays PCO123564 mRNA sequence 325 1e-85
13gb|AF493985.1| Triticum aestivum H2A-1 gene, partial sequence 321 2e-84
14ref|XM_475374.1| Oryza sativa (japonica cultivar-group), predic... 311 2e-81
15dbj|AK067406.1| Oryza sativa (japonica cultivar-group) cDNA clon... 311 2e-81
16gb|BT019315.1| Zea mays clone Contig989.F mRNA sequence 309 6e-81
17dbj|AK099763.1| Oryza sativa (japonica cultivar-group) cDNA clon... 303 4e-79
18gb|U08225.1|ZMU08225 Zea mays W-22 histone H2A mRNA, complete cds 297 2e-77
19gb|AY109370.1| Zea mays CL2029_4 mRNA sequence 278 2e-71
20gb|BT016301.1| Zea mays clone Contig134 mRNA sequence 240 5e-60
21gb|AY104486.1| Zea mays PCO109435 mRNA sequence 232 1e-57
22ref|XM_475081.1| Oryza sativa (japonica cultivar-group), predic... 230 5e-57
23dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic D... 230 5e-57
24gb|AC093921.2| Oryza sativa (japonica cultivar-group) chromosome... 230 5e-57
25gb|BT017719.1| Zea mays clone EL01N0447A04.c mRNA sequence 224 3e-55
26gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 212 1e-51
27gb|AC083942.8| Genomic sequence for Oryza sativa, Nipponbare str... 212 1e-51
28dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 212 1e-51
29dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 212 1e-51
30dbj|AP003144.1| Oryza sativa (japonica cultivar-group) genomic D... 212 1e-51
31ref|XM_478632.1| Oryza sativa (japonica cultivar-group), mRNA 196 6e-47
32dbj|AK099888.1| Oryza sativa (japonica cultivar-group) cDNA clon... 196 6e-47
33dbj|AK071511.1| Oryza sativa (japonica cultivar-group) cDNA clon... 196 6e-47
34dbj|AK058913.1| Oryza sativa (japonica cultivar-group) cDNA clon... 196 6e-47
35dbj|AK058540.1| Oryza sativa (japonica cultivar-group) cDNA clon... 196 6e-47
36gb|AC108876.2| Oryza sativa (japonica cultivar-group) chromosome... 192 1e-45
37gb|AC117265.2| Oryza sativa (japonica cultivar-group) chromosome... 192 1e-45
38ref|XM_482492.1| Oryza sativa (japonica cultivar-group), mRNA 182 1e-42
39dbj|AK121752.1| Oryza sativa (japonica cultivar-group) cDNA clon... 182 1e-42
40dbj|AK064299.1| Oryza sativa (japonica cultivar-group) cDNA clon... 176 6e-41
41ref|XM_478633.1| Oryza sativa (japonica cultivar-group), mRNA 159 1e-35
42dbj|AK059228.1| Oryza sativa (japonica cultivar-group) cDNA clon... 159 1e-35
43dbj|D38089.1|WHTPH2AC Triticum aestivum mRNA for protein H2A, co... 159 1e-35
44dbj|D38091.1|WHTPH2AE Triticum aestivum mRNA for protein H2A, co... 147 5e-32
45gb|AY104826.1| Zea mays PCO099353 mRNA sequence 143 8e-31
46emb|CR700361.2|CNS0G3CL Tetraodon nigroviridis full-length cDNA 137 5e-29
47gb|AF377946.3| Oryza sativa (japonica cultivar-group) chromosome... 135 2e-28
48gb|AC146936.4| Oryza sativa (japonica cultivar-group) chromosome... 135 2e-28
49gb|AC147426.2| Oryza sativa chromosome 3 B1377B10 genomic seque... 135 2e-28
50gb|AF255739.1|AF255739 Bufo bufo gagarizans replication-dependen... 135 2e-28
51gb|L41841.1|CREHIH3G Chlamydomonas reinhardtii histone H3, histo... 129 1e-26
52dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic D... 127 5e-26
53dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic D... 127 5e-26
54dbj|AP005734.4| Oryza sativa (japonica cultivar-group) genomic D... 127 5e-26
55dbj|AP003898.3| Oryza sativa (japonica cultivar-group) genomic D... 127 5e-26
56gb|AY110108.1| Zea mays CL14299_1 mRNA sequence 127 5e-26
57gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome... 127 5e-26
58emb|AL713943.3|CNS07YPC Oryza sativa chromosome 12, . BAC OSJNBa... 127 5e-26
59emb|AL731880.3|CNS08C8J Oryza sativa chromosome 12, . BAC OSJNBa... 127 5e-26
60gb|U16726.1|CRU16726 Chlamydomonas reinhardtii histone H1 (ch1),... 127 5e-26
61gb|U16724.1|CRU16724 Chlamydomonas reinhardtii histone H3 (ch3-I... 127 5e-26
62gb|BC010336.1| Mus musculus H2A histone family, member X, mRNA (... 121 3e-24
63gb|AC122428.4| Mus musculus BAC clone RP24-175C20 from chromosom... 121 3e-24
64ref|NM_010436.2| Mus musculus H2A histone family, member X (H2af... 121 3e-24
65emb|Z35401.1|MMHISTH2A M.musculus C3H gene for histone H2A.X 121 3e-24
66gb|BC005468.1| Mus musculus H2A histone family, member X, mRNA (... 121 3e-24
67gb|AY108339.1| Zea mays PCO070432 mRNA sequence 121 3e-24
68gb|AY104828.1| Zea mays PCO072413 mRNA sequence 121 3e-24
69ref|NM_178185.1| Mus musculus histone 1, H2ao (Hist1h2ao), mRNA 119 1e-23
70ref|XM_978341.1| PREDICTED: Mus musculus similar to histone 2a, ... 119 1e-23
71ref|XM_978296.1| PREDICTED: Mus musculus similar to histone 2a, ... 119 1e-23
72emb|AL592149.8| Mouse DNA sequence from clone RP23-283N14 on chr... 119 1e-23
73ref|NM_178189.2| Mus musculus histone 1, H2ac (Hist1h2ac), mRNA 119 1e-23
74emb|AL589879.21| Mouse DNA sequence from clone RP23-38E20 on chr... 119 1e-23
75emb|AL590614.8| Mouse DNA sequence from clone RP23-9O16 on chrom... 119 1e-23
76gb|BC065803.1| Mus musculus histone 1, H2ag, mRNA (cDNA clone MG... 119 1e-23
77dbj|AK145443.1| Mus musculus 5 days embryo whole body cDNA, RIKE... 119 1e-23
78dbj|AK146846.1| Mus musculus 17 days embryo heart cDNA, RIKEN fu... 119 1e-23
79gb|BC062251.1| Mus musculus cDNA clone MGC:73635 IMAGE:1224905, ... 119 1e-23
80ref|NM_178186.2| Mus musculus histone 1, H2ag (Hist1h2ag), mRNA 119 1e-23
81dbj|AK033518.1| Mus musculus adult male colon cDNA, RIKEN full-l... 119 1e-23
82gb|AY158919.1| Mus musculus histone protein Hist1h2ac gene, comp... 119 1e-23
83gb|AY158915.1| Mus musculus histone protein Hist1h2ag gene, comp... 119 1e-23
84gb|AY158913.1| Mus musculus histone protein Hist1h2ao gene, comp... 119 1e-23
85gb|AF517874.1| Griffithsia japonica isolate Gj10 histone protein... 113 7e-22
86emb|X58069.1|MMH2AX Mouse mRNA for Histone H2A.X 113 7e-22
87dbj|AK008124.1| Mus musculus adult male small intestine cDNA, RI... 113 7e-22
88dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic D... 113 7e-22
89dbj|AP005107.3| Oryza sativa (japonica cultivar-group) genomic D... 113 7e-22
90dbj|AP004651.3| Oryza sativa (japonica cultivar-group) genomic D... 113 7e-22
91gb|AY104637.1| Zea mays PCO070433 mRNA sequence 113 7e-22
92ref|XM_525084.1| PREDICTED: Pan troglodytes similar to Histone H... 111 3e-21
93gb|AC034285.6| Mus musculus chromosome 13, clone RP23-220G21, co... 111 3e-21
94gb|BC068823.1| Xenopus laevis cDNA clone IMAGE:6635737, partial cds 111 3e-21
95ref|NG_002734.1| Mus musculus histone 1, H2aj (Hist1h2aj) pseudo... 111 3e-21
96gb|BC058544.1| Mus musculus cDNA clone IMAGE:5711765, with appar... 111 3e-21
97emb|X05863.1|MMHIS2BB Mouse H2B and H2A-pseudo histone genes (291B) 111 3e-21
98emb|X05862.1|MMHIS2BA Mouse H2B and H2A histone genes (291A) 111 3e-21
99gb|BC099406.1| Mus musculus histone 1, H2ac, mRNA (cDNA clone MG... 111 3e-21
100emb|AL589651.8| Mouse DNA sequence from clone RP23-138F20 on chr... 111 3e-21
101emb|AL590388.4| Mouse DNA sequence from clone RP23-480B19 on chr... 111 3e-21
102gb|BC076498.1| Mus musculus histone 1, H2ae, mRNA (cDNA clone MG... 111 3e-21
103dbj|AK146117.1| Mus musculus TIB-55 BB88 cDNA, RIKEN full-length... 111 3e-21
104ref|NM_175660.2| Mus musculus histone 1, H2ab (Hist1h2ab), mRNA 111 3e-21
105gb|BC090402.1| Mus musculus cDNA clone MGC:103288 IMAGE:5150365,... 111 3e-21
106gb|BC069947.1| Mus musculus cDNA clone IMAGE:6494016 111 3e-21
107gb|BC055904.1| Mus musculus cDNA clone IMAGE:4913108 111 3e-21
108ref|NM_178187.2| Mus musculus histone 1, H2ae (Hist1h2ae), mRNA 111 3e-21
109ref|NM_178188.3| Mus musculus histone 1, H2ad (Hist1h2ad), mRNA 111 3e-21
110gb|U62669.1|MMU62669 Mus musculus histone H3.2-F (H3-F), histone... 111 3e-21
111dbj|AK028026.1| Mus musculus 18-day embryo whole body cDNA, RIKE... 111 3e-21
112ref|NM_178182.1| Mus musculus histone 1, H2ai (Hist1h2ai), mRNA 111 3e-21
113gb|AY158920.1| Mus musculus histone protein Hist1h2ab gene, comp... 111 3e-21
114gb|AY158918.1| Mus musculus histone protein Hist1h2ad gene, comp... 111 3e-21
115gb|AY158917.1| Mus musculus histone protein Hist1h2ae gene, comp... 111 3e-21
116gb|AY158914.1| Mus musculus histone protein Hist1h2ah gene, comp... 111 3e-21
117gb|AY158910.1| Mus musculus histone protein Hist1h2aj pseudogene... 111 3e-21
118gb|AY158909.1| Mus musculus histone protein Hist1h2ai gene, comp... 111 3e-21
119ref|NM_175659.1| Mus musculus histone 1, H2ah (Hist1h2ah), mRNA 111 3e-21
120gb|M37736.1|MUSHIS2AR Mouse replication-dependent histone H2A.1 ... 111 3e-21
121dbj|AK088040.1| Mus musculus 2 days neonate thymus thymic cells ... 109 1e-20
122gb|M31922.1|VVCH4AB V.carteri histone H2A-IV and H2B-IV genes, c... 109 1e-20
123gb|AF255740.1|AF255740 Bufo bufo gagarizans histone H1 (H1) and ... 107 5e-20
124gb|U70133.1|BBU70133 Bufo bufo gagarizans replication-dependent ... 107 5e-20
125ref|XM_522264.1| PREDICTED: Pan troglodytes similar to Histone H... 105 2e-19
126gb|BC004915.2| Homo sapiens H2A histone family, member X, mRNA (... 105 2e-19
127ref|XM_848163.1| PREDICTED: Canis familiaris similar to Histone ... 105 2e-19
128ref|NM_002105.2| Homo sapiens H2A histone family, member X (H2AF... 105 2e-19
129emb|BX063165.1|CNS09KWH Single read from an extremity of a full-... 105 2e-19
130emb|BX063164.1|CNS09KWG Single read from an extremity of a full-... 105 2e-19
131emb|BX040864.1|CNS093P0 Single read from an extremity of a full-... 105 2e-19
132emb|BX019683.1|CNS08NCN Single read from an extremity of a full-... 105 2e-19
133emb|BX016451.1|CNS08KUV Single read from an extremity of a full-... 105 2e-19
134emb|BX009846.1|CNS08FRE Single read from an extremity of a full-... 105 2e-19
135emb|X14850.1|HSH2AX Human H2A.X mRNA encoding histone H2A.X 105 2e-19
136gb|BC013416.2| Homo sapiens H2A histone family, member X, mRNA (... 105 2e-19
137emb|CR605072.1| full-length cDNA clone CS0DD007YB20 of Neuroblas... 105 2e-19
138gb|DQ015918.1| Homo sapiens H2A histone family, member X (H2AFX)... 105 2e-19
139gb|AC119796.2| Oryza sativa (japonica cultivar-group) chromosome... 105 2e-19
140gb|BC011694.2| Homo sapiens H2A histone family, member X, mRNA (... 105 2e-19
141dbj|AP003391.1| Homo sapiens genomic DNA, chromosome 11q clone:C... 105 2e-19
142gb|BC106331.1| Xenopus laevis cDNA clone MGC:130860 IMAGE:720558... 103 7e-19
143gb|BC001193.1| Homo sapiens histone 3, H2a, mRNA (cDNA clone MGC... 103 7e-19
144gb|BC082269.1| Homo sapiens histone 3, H2a, mRNA (cDNA clone MGC... 103 7e-19
145gb|AY389592.1| Hyacinthus orientalis histone H2A mRNA, complete cds 103 7e-19
146ref|NM_033445.2| Homo sapiens histone 3, H2a (HIST3H2A), mRNA 103 7e-19
147emb|AL139288.15| Human DNA sequence from clone RP5-915N17 on chr... 103 7e-19
148emb|X03018.1|XLHISH3A Xenopus laevis histone gene cluster XlH3-A... 103 7e-19
149dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic D... 103 7e-19
150ref|NM_178184.1| Mus musculus histone 1, H2an (Hist1h2an), mRNA 103 7e-19
151ref|NM_178183.1| Mus musculus histone 1, H2ak (Hist1h2ak), mRNA 103 7e-19
152ref|XM_225386.2| PREDICTED: Rattus norvegicus histone 1, H2an (p... 103 7e-19
153gb|AY158916.1| Mus musculus histone protein Hist1h2af gene, comp... 103 7e-19
154gb|AY158912.1| Mus musculus histone protein Hist1h2an gene, comp... 103 7e-19
155gb|AY158911.1| Mus musculus histone protein Hist1h2ak gene, comp... 103 7e-19
156dbj|AP003838.3| Oryza sativa (japonica cultivar-group) genomic D... 103 7e-19
157ref|XM_314447.2| Anopheles gambiae str. PEST ENSANGP00000016040 ... 103 7e-19
158ref|XM_306256.1| Anopheles gambiae str. PEST ENSANGP00000000004 ... 103 7e-19
159ref|NM_175661.1| Mus musculus histone 1, H2af (Hist1h2af), mRNA 103 7e-19
160emb|AL731753.2|CNS08C82 Oryza sativa chromosome 12, . BAC OJ1112... 103 7e-19
161gb|U95111.1|MSU95111 Mus spretus histone H2a pseudogene, complet... 103 7e-19
162gb|U16725.1|CRU16725 Chlamydomonas reinhardtii histone H3 (ch3-I... 103 7e-19
163gb|M21287.1|XELHX1H3 X.laevis histone H1B, H2A, H2B, and H4 gene... 103 7e-19
164gb|AY131974.1| Homo sapiens histone H2A (HIST3H2A) gene, complet... 103 7e-19
165gb|AY389588.1| Hyacinthus orientalis histone H2A mRNA, complete cds 101 3e-18
166ref|XM_577577.1| PREDICTED: Rattus norvegicus similar to Histone... 101 3e-18
167ref|XM_545430.1| PREDICTED: Canis familiaris similar to Histone ... 98 4e-17
168ref|XM_849168.1| PREDICTED: Canis familiaris similar to Histone ... 98 4e-17
169ref|XM_545413.1| PREDICTED: Canis familiaris similar to Histone ... 98 4e-17
170ref|XM_545411.1| PREDICTED: Canis familiaris similar to Histone ... 98 4e-17
171ref|XM_545400.2| PREDICTED: Canis familiaris similar to Histone ... 98 4e-17
172ref|XM_545394.2| PREDICTED: Canis familiaris similar to Histone ... 98 4e-17
173ref|XM_848774.1| PREDICTED: Canis familiaris similar to Histone ... 98 4e-17
174ref|XM_848759.1| PREDICTED: Canis familiaris similar to Histone ... 98 4e-17
175ref|XM_545384.2| PREDICTED: Canis familiaris similar to Histone ... 98 4e-17
176ref|XM_848716.1| PREDICTED: Canis familiaris similar to Histone ... 98 4e-17
177ref|XM_545376.2| PREDICTED: Canis familiaris similar to Histone ... 98 4e-17
178ref|XM_545373.1| PREDICTED: Canis familiaris similar to histone ... 98 4e-17
179ref|XM_854341.1| PREDICTED: Canis familiaris similar to Histone ... 98 4e-17
180ref|XM_545390.1| PREDICTED: Canis familiaris similar to Histone ... 98 4e-17
181ref|XM_539322.1| PREDICTED: Canis familiaris similar to Histone ... 98 4e-17
182emb|BX016452.1|CNS08KUW Single read from an extremity of a full-... 98 4e-17
183emb|BX007458.1|CNS08DX2 Single read from an extremity of a full-... 98 4e-17
184emb|X94693.1|TAH2A254 T.aestivum histone H2A gene 98 4e-17
185emb|X80328.1|MMH2B143 M.musculus genes H2b-143, H3-143 98 4e-17
186emb|CR457079.1| Homo sapiens full open reading frame cDNA clone ... 98 4e-17
187gb|L75824.1|WHTHIH2AA Triticum aestivum histone H2A gene, comple... 98 4e-17
188gb|AY760064.1| Muntiacus muntjak vaginalis H2A histone family me... 98 4e-17
189dbj|AP005195.3| Oryza sativa (japonica cultivar-group) genomic D... 98 4e-17
190gb|U95109.1|MSU95109 Mus spicilegus histone H2a pseudogene, comp... 98 4e-17
191gb|M33988.1|MUSH2AX1 Mouse histone H2A.1 gene, complete cds 98 4e-17
192gb|M14141.1|SUPH2A2 P.miliaris histone H2A-2.2 gene, complete cds 98 4e-17
193gb|BC077427.1| Xenopus laevis MGC82198 protein, mRNA (cDNA clone... 96 2e-16
194gb|AY849374.1| Emiliania huxleyi histone H2A mRNA, complete cds 96 2e-16
195ref|XM_576399.1| PREDICTED: Rattus norvegicus similar to Histone... 94 7e-16
196emb|BX008487.1|CNS08EPN Single read from an extremity of a full-... 92 3e-15
197gb|AY849373.1| Emiliania huxleyi histone H2A.X mRNA, complete cds 92 3e-15
198gb|BT016168.1| Zea mays clone Contig1 mRNA sequence 90 1e-14
199ref|XM_610233.2| PREDICTED: Bos taurus similar to Histone H2AFX ... 90 1e-14
200ref|XM_545421.1| PREDICTED: Canis familiaris similar to Histone ... 90 1e-14
201ref|XM_545419.2| PREDICTED: Canis familiaris similar to Histone ... 90 1e-14
202emb|CR673199.2|CNS0FIET Tetraodon nigroviridis full-length cDNA 90 1e-14
203emb|X59962.1|RNTH2AB R.norvegicus genes for TH2A and TH2B histones 90 1e-14
204ref|NM_021839.1| Rattus norvegicus testis-specific histone 2a (H... 90 1e-14
205gb|AY105006.1| Zea mays PCO108932 mRNA sequence 90 1e-14
206gb|DQ214188.1| Taeniopygia guttata clone 0058P0024E05 histone 1 ... 88 4e-14
207gb|DQ214187.1| Taeniopygia guttata clone 0058P0044E04 histone 1 ... 88 4e-14
208ref|XM_865148.1| PREDICTED: Bos taurus similar to Histone H2A.1 ... 88 4e-14
209ref|XM_545426.2| PREDICTED: Canis familiaris similar to Histone ... 88 4e-14
210ref|XM_225372.2| PREDICTED: Rattus norvegicus similar to Histone... 88 4e-14
211gb|U95110.1|MMU95110 Mus macedonicus histone H2a pseudogene, com... 88 4e-14
212emb|AL512384.9| Human DNA sequence from clone RP11-317E16 on chr... 86 2e-13
213emb|X14730.1|CMHIST2A Duck H2A histone gene 86 2e-13
214gb|M11085.1|SUPHIS2A2 Sea urchin (P.miliaris) late histone H2A-2... 86 2e-13
215ref|XM_527262.1| PREDICTED: Pan troglodytes similar to histone p... 84 7e-13
216ref|XM_871147.1| PREDICTED: Bos taurus similar to Histone H2A.1 ... 84 7e-13
217ref|XM_868899.1| PREDICTED: Bos taurus similar to Histone H2A.1 ... 84 7e-13
218ref|XM_543796.2| PREDICTED: Canis familiaris similar to H2A hist... 82 3e-12
219gb|AY158937.1| Mus musculus histone protein Hist1h2bc gene, comp... 82 3e-12
220ref|XM_551996.1| Anopheles gambiae str. PEST ENSANGP00000029020 ... 82 3e-12
221gb|M11084.1|SUPHIS2A1 Sea urchin (P.miliaris) late histone H2A-1... 82 3e-12
222gb|M14140.1|SUPH2B2 P.miliaris histone H2A-2.1 gene, complete cds 82 3e-12
223ref|XM_425469.1| PREDICTED: Gallus gallus similar to histone 2, ... 80 1e-11
224ref|XM_425465.1| PREDICTED: Gallus gallus similar to histone 2, ... 80 1e-11
225ref|XM_425459.1| PREDICTED: Gallus gallus similar to histone 2, ... 80 1e-11
226ref|XM_425455.1| PREDICTED: Gallus gallus similar to histone 2, ... 80 1e-11
227ref|XM_416195.1| PREDICTED: Gallus gallus similar to histone 2, ... 80 1e-11
228ref|XM_416192.1| PREDICTED: Gallus gallus similar to germinal hi... 80 1e-11
229ref|XM_906486.2| PREDICTED: Mus musculus similar to H2A histone ... 80 1e-11
230emb|X02218.1|GGHIS1 Chicken duplicated genes for histone H2A, H4... 80 1e-11
231dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic D... 80 1e-11
232gb|BC024397.1| Mus musculus H2A histone family, member J, mRNA (... 80 1e-11
233dbj|D11055.1|CHKH2A4H Gallus gallus gene for H2A histone, comple... 80 1e-11
234gb|U38933.1|GGU38933 Gallus gallus histone H2A (H2A-VIII) gene, ... 80 1e-11
235gb|U38931.1|GGU38931 Gallus gallus histone H2A (H2A-VI) gene, co... 80 1e-11
236emb|AL662960.3|OSJN00162 Oryza sativa genomic DNA, chromosome 4,... 80 1e-11
237gb|J00864.1|CHKH2A2B Chicken histone H2A/H2B gene pair and flanks 80 1e-11
238ref|XM_481315.1| Oryza sativa (japonica cultivar-group), mRNA 78 4e-11
239ref|XM_518300.1| PREDICTED: Pan troglodytes similar to Histone H... 78 4e-11
240ref|NM_175662.1| Mus musculus histone 2, H2ac (Hist2h2ac), mRNA 78 4e-11
241ref|NM_013549.1| Mus musculus histone 2, H2aa1 (Hist2h2aa1), mRNA 78 4e-11
242gb|BC104198.1| Homo sapiens histone 1, H2ak, mRNA (cDNA clone MG... 78 4e-11
243gb|BC104199.1| Homo sapiens histone 1, H2ak, mRNA (cDNA clone MG... 78 4e-11
244gb|BC080809.1| Mus musculus cDNA clone IMAGE:6466339 78 4e-11
245gb|BC034487.2| Homo sapiens histone 1, H2ak, mRNA (cDNA clone IM... 78 4e-11
246gb|BC010564.1| Mus musculus histone 2, H2aa1, mRNA (cDNA clone I... 78 4e-11
247ref|NG_001335.1| Homo sapiens genomic large histone family clust... 78 4e-11
248ref|NM_178213.2| Mus musculus histone 2, H2ab (Hist2h2ab), mRNA 78 4e-11
249ref|NG_000009.2| Homo sapiens small histone family cluster (HFS@... 78 4e-11
250ref|NM_021052.2| Homo sapiens histone 1, H2ae (HIST1H2AE), mRNA 78 4e-11
251ref|NM_003510.2| Homo sapiens histone 1, H2ak (HIST1H2AK), mRNA 78 4e-11
252ref|XM_981616.1| PREDICTED: Mus musculus similar to H2A histone ... 78 4e-11
253ref|XM_992084.1| PREDICTED: Mus musculus similar to H2A histone ... 78 4e-11
254ref|XM_994730.1| PREDICTED: Mus musculus similar to H2A histone ... 78 4e-11
255ref|XM_886396.1| PREDICTED: Mus musculus histone 2, H3c1 (Hist2h... 78 4e-11
256gb|BC064002.1| Mus musculus cDNA clone IMAGE:6823756, partial cds 78 4e-11
257gb|AY158922.2| Mus musculus histone protein Hist2h2ab gene, comp... 78 4e-11
258emb|Z98744.2|HS193B12 Human DNA sequence from clone RP1-193B12 o... 78 4e-11
259emb|AL031777.5|HS34B20 Human DNA sequence from clone RP1-34B20 o... 78 4e-11
260emb|Z83739.1|HSZ83739 H.sapiens hH2A/d gene 78 4e-11
261emb|Z30940.1|MDH2AHIST M.domesticus (CD-1) mRNA for histone H2A ... 78 4e-11
262emb|X80327.1|MPMP323 M.pahari genes mpH323 and mph2a23 78 4e-11
263emb|X16148.1|MMHIS2A3 Mouse H2a and H3 histone genes 78 4e-11
264dbj|AK158457.1| Mus musculus adult inner ear cDNA, RIKEN full-le... 78 4e-11
265dbj|AK006728.1| Mus musculus adult male testis cDNA, RIKEN full-... 78 4e-11
266dbj|AK077055.1| Mus musculus adult male testis cDNA, RIKEN full-... 78 4e-11
267dbj|AK002725.1| Mus musculus adult male kidney cDNA, RIKEN full-... 78 4e-11
268dbj|AK016171.1| Mus musculus adult male testis cDNA, RIKEN full-... 78 4e-11
269gb|U62674.1|MMU62674 Mus musculus histone H2a.2-615 (H2a-615), ... 78 4e-11
270gb|U62673.1|MMU62673 Mus musculus histone H2a(A)-613, histone H2... 78 4e-11
271dbj|AK028129.1| Mus musculus adult male stomach cDNA, RIKEN full... 78 4e-11
272gb|BC093862.1| Homo sapiens histone 1, H2ae, mRNA (cDNA clone MG... 78 4e-11
273gb|BC093836.1| Homo sapiens histone 1, H2ae, mRNA (cDNA clone MG... 78 4e-11
274ref|NM_178212.1| Mus musculus histone 2, H2aa2 (Hist2h2aa2), mRNA 78 4e-11
275gb|AY131991.1| Homo sapiens histone H2A (HIST1H2AK) gene, comple... 78 4e-11
276gb|AY158953.1| Mus musculus histone protein Hist2h3c2 gene, comp... 78 4e-11
277gb|AY158925.1| Mus musculus histone protein Hist2h2aa1 gene, com... 78 4e-11
278gb|AY158924.1| Mus musculus histone protein Hist2h2aa2 gene, com... 78 4e-11
279gb|AY158923.1| Mus musculus histone protein Hist2h2ac gene, comp... 78 4e-11
280dbj|AP005383.3| Oryza sativa (japonica cultivar-group) genomic D... 78 4e-11
281dbj|AP005097.3| Oryza sativa (japonica cultivar-group) genomic D... 78 4e-11
282dbj|AK130106.1| Homo sapiens cDNA FLJ26596 fis, clone LNF08501 78 4e-11
283gb|AY893520.1| Synthetic construct Homo sapiens clone FLH130895.... 78 4e-11
284gb|BC062255.1| Mus musculus histone 2, H2aa1, mRNA (cDNA clone M... 78 4e-11
285gb|AC093350.15| Mus musculus chromosome 3, clone RP23-16G3, comp... 78 4e-11
286gb|AC157656.3| Mus musculus BAC clone RP23-406A5 from chromosome... 78 4e-11
287gb|AC125099.3| Mus musculus BAC clone RP24-201C14 from 3, comple... 78 4e-11
288gb|BC053966.1| Mus musculus histone 2, H2aa2, mRNA (cDNA clone I... 78 4e-11
289ref|XM_667061.1| Plasmodium berghei strain ANKA histone h2a (PB3... 78 4e-11
290gb|BC089519.1| Mus musculus histone 2, H2aa1, mRNA (cDNA clone M... 78 4e-11
291gb|M60752.1|HUMHISAG Human histone H2A.1 (H2A) gene, complete cds 78 4e-11
292gb|AY131986.1| Homo sapiens histone H2A (HIST1H2AE) gene, comple... 78 4e-11
293gb|AC160122.2| Mus musculus BAC clone RP23-390G1 from chromosome... 78 4e-11
294ref|XM_527283.1| PREDICTED: Pan troglodytes similar to Hist2h2aa... 76 2e-10
295ref|XM_425467.1| PREDICTED: Gallus gallus similar to histone 2, ... 76 2e-10
296ref|XM_416193.1| PREDICTED: Gallus gallus similar to histone pro... 76 2e-10
297gb|BC069306.1| Homo sapiens histone 1, H2al, mRNA (cDNA clone MG... 76 2e-10
298ref|XM_607721.2| PREDICTED: Bos taurus similar to Histone H2A.1 ... 76 2e-10
299ref|XM_865976.1| PREDICTED: Bos taurus similar to Histone H2A.g ... 76 2e-10
300ref|NM_003511.2| Homo sapiens histone 1, H2al (HIST1H2AL), mRNA 76 2e-10
301emb|X83549.1|HSHISTN2A H.sapiens gene for histone H2A 76 2e-10
302emb|X80330.1|CLH2A232 C.longicaudatus genes for histones H2a.2 a... 76 2e-10
303emb|X07763.1|GGH2AB8 Chicken DNA for pCH3.5E histone H2A/H2B seq... 76 2e-10
304ref|XM_345255.2| PREDICTED: Rattus norvegicus histone 2, H2aa (p... 76 2e-10
305ref|XM_574998.1| PREDICTED: Rattus norvegicus similar to Hist2h2... 76 2e-10
306ref|XM_574997.1| PREDICTED: Rattus norvegicus similar to histone... 76 2e-10
307gb|AY131992.1| Homo sapiens histone H2A (HIST1H2AL) gene, comple... 76 2e-10
308gb|BC112072.1| Homo sapiens histone 1, H2ai, mRNA (cDNA clone MG... 76 2e-10
309gb|BC105129.1| Homo sapiens histone 1, H2ai, mRNA (cDNA clone MG... 76 2e-10
310gb|U38932.1|GGU38932 Gallus gallus histone H2A (H2A-VII) gene, c... 76 2e-10
311ref|NM_003530.3| Homo sapiens histone 1, H3d (HIST1H3D), mRNA 74 6e-10
312ref|NM_021065.2| Homo sapiens histone 1, H2ad (HIST1H2AD), mRNA 74 6e-10
313ref|XM_540292.2| PREDICTED: Canis familiaris similar to histone ... 74 6e-10
314ref|XM_845715.1| PREDICTED: Canis familiaris similar to Histone ... 74 6e-10
315ref|XM_540286.2| PREDICTED: Canis familiaris similar to Histone ... 74 6e-10
316ref|XM_785689.1| PREDICTED: Strongylocentrotus purpuratus simila... 74 6e-10
317emb|Z80776.1|HSH2AG H.sapiens H2A/g gene 74 6e-10
318emb|X16495.1|MMHIST2A Murine H2A gene for histone H2A 74 6e-10
319emb|X59961.1|RNH2AB R.norvegicus genes for H2A and H2B histones 74 6e-10
320emb|AJ245999.1|BNA245999 Brassica napus H2A gene for Histone H2A 74 6e-10
321emb|V00413.1|GGH2AX Chicken gene for histone H2A with flanking r... 74 6e-10
322gb|BC093807.1| Homo sapiens histone 1, H2ad, mRNA (cDNA clone MG... 74 6e-10
323emb|CR541999.1| Homo sapiens full open reading frame cDNA clone ... 74 6e-10
324emb|CR541970.1| Homo sapiens full open reading frame cDNA clone ... 74 6e-10
325gb|BC093809.1| Homo sapiens histone 1, H2ad, mRNA (cDNA clone MG... 74 6e-10
326gb|AY131985.1| Homo sapiens histone H2A (HIST1H2AD) gene, comple... 74 6e-10
327ref|XM_954349.1| Neurospora crassa OR74A hypothetical protein (N... 72 3e-09
328ref|XM_868674.1| PREDICTED: Bos taurus similar to Histone H2A.1 ... 72 3e-09
329ref|XM_331212.1| Neurospora crassa OR74A hypothetical protein (N... 72 3e-09
330ref|NM_177688.2| Mus musculus H2A histone family, member J (H2af... 72 3e-09
331gb|AC122804.4| Mus musculus BAC clone RP23-296J10 from 6, comple... 72 3e-09
332emb|CR709561.2|CNS0GAG5 Tetraodon nigroviridis full-length cDNA 72 3e-09
333emb|X06642.1|SPH2BAL3 Strongylocentrotus purpuratus late histone... 72 3e-09
334gb|AY062171.1| Neurospora crassa histone H2A (hh2A) and histone ... 72 3e-09
335dbj|AK053755.1| Mus musculus 0 day neonate eyeball cDNA, RIKEN f... 72 3e-09
336ref|NM_214553.1| Strongylocentrotus purpuratus late histone L3 H... 72 3e-09
337gb|BC099606.1| Mus musculus H2A histone family, member J, mRNA (... 72 3e-09
338ref|XM_527287.1| PREDICTED: Pan troglodytes similar to Histone H... 70 1e-08
339ref|XM_518286.1| PREDICTED: Pan troglodytes similar to Histone H... 70 1e-08
340gb|BC017379.1| Homo sapiens histone 1, H2ac, mRNA (cDNA clone MG... 70 1e-08
341ref|XM_870473.1| PREDICTED: Bos taurus similar to Histone H2A.1 ... 70 1e-08
342ref|NM_003514.2| Homo sapiens histone 1, H2am (HIST1H2AM), mRNA 70 1e-08
343ref|NM_003512.3| Homo sapiens histone 1, H2ac (HIST1H2AC), mRNA 70 1e-08
344emb|AL353759.8| Human DNA sequence from clone RP1-221C16 on chro... 70 1e-08
345gb|AY270707.1| Homo sapiens clone SKA08-D09 putative promoter se... 70 1e-08
346emb|Z80778.1|HSH2AL H.sapiens H2A/l gene 70 1e-08
347emb|X57138.1|HSH2B2H2 Human H2B.2 and H2A.1 genes for Histone H2... 70 1e-08
348ref|NM_001030753.1| Gallus gallus histone H2A (H2A-IX), mRNA 70 1e-08
349emb|CR624886.1| full-length cDNA clone CS0DK009YH13 of HeLa cell... 70 1e-08
350emb|CR621753.1| full-length cDNA clone CS0DI059YA15 of Placenta ... 70 1e-08
351gb|BC032686.1| Homo sapiens, clone IMAGE:5581652, mRNA 70 1e-08
352emb|CR608156.1| full-length cDNA clone CS0DI013YB19 of Placenta ... 70 1e-08
353gb|U91328.1|HSU91328 Human hereditary haemochromatosis region, h... 70 1e-08
354gb|U90551.1|HSU90551 Human histone 2A-like protein (H2A/l) mRNA,... 70 1e-08
355gb|AY131993.1| Homo sapiens histone H2A (HIST1H2AM) gene, comple... 70 1e-08
356gb|BC085010.1| Homo sapiens histone 1, H2ac, mRNA (cDNA clone MG... 70 1e-08
357gb|AY894000.1| Synthetic construct Homo sapiens clone FLH130938.... 70 1e-08
358gb|AY893556.1| Synthetic construct Homo sapiens clone FLH130901.... 70 1e-08
359gb|AY893555.1| Synthetic construct Homo sapiens clone FLH130900.... 70 1e-08
360gb|BC071668.1| Homo sapiens histone 1, H2am, mRNA (cDNA clone MG... 70 1e-08
361gb|BC050602.1| Homo sapiens histone 1, H2ac, mRNA (cDNA clone MG... 70 1e-08
362gb|BC032756.1| Homo sapiens histone 1, H2am, mRNA (cDNA clone MG... 70 1e-08
363dbj|D11054.1|CHKH2A3H Gallus gallus gene for H2A histone, comple... 70 1e-08
364gb|U38934.1|GGU38934 Gallus gallus histone H2A (H2A-IX) gene, co... 70 1e-08
365gb|AY131984.1| Homo sapiens histone H2A (HIST1H2AC) gene, comple... 70 1e-08
366ref|XM_527254.1| PREDICTED: Pan troglodytes similar to HIST2H3C ... 68 4e-08
367ref|XM_518289.1| PREDICTED: Pan troglodytes similar to Histone H... 68 4e-08
368ref|NM_178218.2| Mus musculus histone 3, H2a (Hist3h2a), mRNA 68 4e-08
369ref|XM_361034.1| Magnaporthe grisea 70-15 hypothetical protein (... 68 4e-08
370ref|XM_602496.2| PREDICTED: Bos taurus similar to Histone H2A.1 ... 68 4e-08
371gb|BC063781.1| Mus musculus histone 3, H2a, mRNA (cDNA clone MGC... 68 4e-08
372gb|BC058119.1| Mus musculus histone 3, H2a, mRNA (cDNA clone IMA... 68 4e-08
373ref|XM_869001.1| PREDICTED: Bos taurus similar to Histone H2A.1 ... 68 4e-08
374ref|NM_003513.2| Homo sapiens histone 1, H2ab (HIST1H2AB), mRNA 68 4e-08
375ref|XM_752558.1| Ustilago maydis 521 histone H2A (UM01504.1) par... 68 4e-08
376ref|XM_789760.1| PREDICTED: Strongylocentrotus purpuratus simila... 68 4e-08
377ref|XM_781115.1| PREDICTED: Strongylocentrotus purpuratus simila... 68 4e-08
378emb|X00089.1|HSHISH2A Human histone H2a gene 68 4e-08
379emb|AJ494853.1|ODI494853 Oikopleura dioica mRNA for histone H2A.... 68 4e-08
380emb|Z83741.1|HSZ83741 H.sapiens hH2A/m gene 68 4e-08
381dbj|AK077568.1| Mus musculus 8 days embryo whole body cDNA, RIKE... 68 4e-08
382dbj|AK051448.1| Mus musculus 12 days embryo spinal ganglion cDNA... 68 4e-08
383dbj|AK087537.1| Mus musculus 0 day neonate eyeball cDNA, RIKEN f... 68 4e-08
384dbj|AK015962.1| Mus musculus adult male testis cDNA, RIKEN full-... 68 4e-08
385dbj|AK083155.1| Mus musculus adult male hippocampus cDNA, RIKEN ... 68 4e-08
386dbj|AK082083.1| Mus musculus 0 day neonate cerebellum cDNA, RIKE... 68 4e-08
387ref|XM_344599.2| PREDICTED: Rattus norvegicus histone 1, H2ao (p... 68 4e-08
388gb|AY131983.1| Homo sapiens histone H2A (HIST1H2AB) gene, comple... 68 4e-08
389gb|AY158926.1| Mus musculus histone protein Hist3h2a gene, compl... 68 4e-08
390gb|AY850346.1| Magnaporthe grisea histone H2A-like protein mRNA,... 68 4e-08
391emb|AL662809.14| Mouse DNA sequence from clone RP23-441I8 on chr... 68 4e-08
392ref|NM_100760.2| Arabidopsis thaliana DNA binding AT1G08880 mRNA... 66 2e-07
393ref|XM_870470.1| PREDICTED: Bos taurus similar to Histone H2A.1 ... 66 2e-07
394gb|BC031333.1| Homo sapiens histone 1, H3d, mRNA (cDNA clone MGC... 66 2e-07
395emb|X07766.1|GGH2AB11 Chicken DNA for CH1-10 histone H2A/H2B seq... 66 2e-07
396gb|AY093975.1| Arabidopsis thaliana At1g08880/F7G19_24 mRNA, com... 66 2e-07
397gb|AF412092.1|AF412092 Arabidopsis thaliana At1g08880/F7G19_24 m... 66 2e-07
398emb|BX818384.1|CNS0ACP9 Arabidopsis thaliana Full-length cDNA Co... 66 2e-07
399emb|BX818184.1|CNS0ACP1 Arabidopsis thaliana Full-length cDNA Co... 66 2e-07
400emb|BX933556.1| Gallus gallus finished cDNA, clone ChEST42h4 66 2e-07
401gb|AY087924.1| Arabidopsis thaliana clone 39667 mRNA, complete s... 66 2e-07
402ref|NM_021840.2| Rattus norvegicus histone 2a (H2a), mRNA 64 6e-07
403gb|BC099140.1| Rattus norvegicus histone 2a, mRNA (cDNA clone MG... 64 6e-07
404dbj|AB168678.1| Macaca fascicularis testis cDNA clone: QtsA-1409... 64 6e-07
405gb|AY104725.1| Zea mays PCO121651 mRNA sequence 64 6e-07
406gb|BC060324.1| Homo sapiens histone 2, H2ac, mRNA (cDNA clone MG... 62 2e-06
407ref|XM_527273.1| PREDICTED: Pan troglodytes similar to Histone H... 62 2e-06
408ref|XM_527272.1| PREDICTED: Pan troglodytes similar to Histone H... 62 2e-06
409ref|NM_003517.2| Homo sapiens histone 2, H2ac (HIST2H2AC), mRNA 62 2e-06
410gb|AY648852.1| Homo sapiens histone H2A/r gene, complete cds 62 2e-06
411gb|BT018361.1| Zea mays clone EL01N0311D03.c mRNA sequence 62 2e-06
412gb|AY389710.1| Hyacinthus orientalis histone H2A mRNA, partial cds 62 2e-06
413gb|BC016677.1| Homo sapiens histone 1, H2ag, mRNA (cDNA clone MG... 62 2e-06
414gb|BC067782.1| Homo sapiens histone 1, H2ag, mRNA (cDNA clone IM... 62 2e-06
415ref|NM_021064.3| Homo sapiens histone 1, H2ag (HIST1H2AG), mRNA 62 2e-06
416ref|NM_080596.1| Homo sapiens histone 1, H2ah (HIST1H2AH), mRNA 62 2e-06
417ref|XM_391803.1| Gibberella zeae PH-1 H2A_NEUCR Histone H2A (FG1... 62 2e-06
418emb|AL591493.14| Human DNA sequence from clone RP11-196G18 on ch... 62 2e-06
419emb|AL021807.2|HS86C11 Human DNA sequence from clone RP1-86C11 o... 62 2e-06
420emb|AJ494852.1|ODI494852 Oikopleura dioica partial H2A.4 gene fo... 62 2e-06
421gb|BC093851.1| Homo sapiens histone 1, H2ai, mRNA (cDNA clone MG... 62 2e-06
422gb|BC093849.1| Homo sapiens histone 1, H2ai, mRNA (cDNA clone MG... 62 2e-06
423ref|XM_577573.1| PREDICTED: Rattus norvegicus similar to Histone... 62 2e-06
424gb|AY131988.1| Homo sapiens histone H2A (HIST1H2AH) gene, comple... 62 2e-06
425gb|AY131987.1| Homo sapiens histone H2A (HIST1H2AG) gene, comple... 62 2e-06
426ref|XM_318363.2| Anopheles gambiae str. PEST ENSANGP00000015971 ... 62 2e-06
427gb|L19778.1|HUMH2A1B Homo sapiens histone H2A.1b mRNA, complete cds 62 2e-06
428ref|NG_000827.2| Homo sapiens genomic histone family microcluste... 62 2e-06
429gb|AY131973.1| Homo sapiens histone H2A (HIST2H2AC) gene, comple... 62 2e-06
430ref|NM_118857.2| Arabidopsis thaliana DNA binding AT4G27230 mRNA... 60 1e-05
431ref|XM_871500.1| PREDICTED: Bos taurus similar to Histone H2A.o ... 60 1e-05
432ref|XM_614586.2| PREDICTED: Bos taurus similar to Histone H2A.o ... 60 1e-05
433ref|XM_866756.1| PREDICTED: Bos taurus similar to H3 histone, fa... 60 1e-05
434ref|XM_591391.2| PREDICTED: Bos taurus similar to Histone H2A.o ... 60 1e-05
435ref|XM_602557.2| PREDICTED: Bos taurus similar to Histone H2A.1 ... 60 1e-05
436gb|BC098891.1| Danio rerio zgc:114037, mRNA (cDNA clone MGC:1140... 60 1e-05
437ref|XM_569065.1| Cryptococcus neoformans var. neoformans JEC21 h... 60 1e-05
438emb|CR722682.2|CNS0GKKG Tetraodon nigroviridis full-length cDNA 60 1e-05
439emb|CR681249.2|CNS0FOLP Tetraodon nigroviridis full-length cDNA 60 1e-05
440emb|CR673736.2|CNS0FITQ Tetraodon nigroviridis full-length cDNA 60 1e-05
441emb|CR659269.2|CNS0F7NV Tetraodon nigroviridis full-length cDNA 60 1e-05
442ref|NM_001031826.1| Danio rerio zgc:114037 (zgc:114037), mRNA 60 1e-05
443emb|BX019514.1|CNS08N7Y Single read from an extremity of a full-... 60 1e-05
444ref|XM_683419.1| PREDICTED: Danio rerio similar to replication-d... 60 1e-05
445gb|BT006076.1| Arabidopsis thaliana clone U20287 putative histon... 60 1e-05
446gb|BT005779.1| Arabidopsis thaliana clone RAFL14-92-E07 (R20287)... 60 1e-05
447gb|AY088714.1| Arabidopsis thaliana clone 927 mRNA, complete seq... 60 1e-05
448gb|AY158938.1| Mus musculus histone protein Hist1h2bb gene, comp... 60 1e-05
449ref|XM_318365.1| Anopheles gambiae str. PEST ENSANGP00000015967 ... 60 1e-05
450ref|XM_307083.1| Anopheles gambiae str. PEST ENSANGP00000012043 ... 60 1e-05
451emb|CR354435.20| Zebrafish DNA sequence from clone CH211-113A14 ... 60 1e-05
452gb|BC107354.1| Mus musculus histone 1, H2aa, mRNA (cDNA clone MG... 58 4e-05
453gb|BC107355.1| Mus musculus histone 1, H2aa, mRNA (cDNA clone MG... 58 4e-05
454ref|NM_175658.1| Mus musculus histone 1, H2aa (Hist1h2aa), mRNA 58 4e-05
455emb|Z83245.4|CEZK131 Caenorhabditis elegans Cosmid ZK131, comple... 58 4e-05
456emb|Z81495.1|CEF08G2 Caenorhabditis elegans Cosmid F08G2, comple... 58 4e-05
457emb|X15633.1|CEHIS12 C. elegans core histone genes H2A(his12) an... 58 4e-05
458emb|AL606464.11| Mouse DNA sequence from clone RP23-462P2 on chr... 58 4e-05
459dbj|AB226296.1| Aspergillus oryzae cDNA, contig sequence: AoEST3158 58 4e-05
460dbj|AB223400.1| Aspergillus oryzae cDNA, contig sequence: AoEST0232 58 4e-05
461dbj|AP007167.1| Aspergillus oryzae RIB40 genomic DNA, SC020 58 4e-05
462ref|XM_683706.1| PREDICTED: Danio rerio similar to histone H2A (... 58 4e-05
463ref|NM_064497.1| Caenorhabditis elegans HIStone family member (h... 58 4e-05
464ref|NM_064490.1| Caenorhabditis elegans HIStone family member (h... 58 4e-05
465ref|NM_064486.2| Caenorhabditis elegans HIStone family member (h... 58 4e-05
466gb|AC084589.1|CBRG41K24 Caenorhabditis briggsae cosmid G41K24, c... 58 4e-05
467emb|BX936232.1| Gallus gallus finished cDNA, clone ChEST960i13 58 4e-05
468emb|BX935272.1| Gallus gallus finished cDNA, clone ChEST959a10 58 4e-05
469emb|BX933654.1| Gallus gallus finished cDNA, clone ChEST946f5 58 4e-05
470gb|AY158921.1| Mus musculus histone protein Hist1h2aa gene, comp... 58 4e-05
471dbj|AK214754.1| Mus musculus cDNA, clone:Y2G0132O07, strand:minu... 58 4e-05
472ref|NM_196515.1| Oryza sativa (japonica cultivar-group) putative... 56 2e-04
473ref|XM_513764.1| PREDICTED: Pan troglodytes LOC457261 (LOC457261... 56 2e-04
474ref|NM_006632.1| Homo sapiens solute carrier family 17 (sodium p... 56 2e-04
475ref|XM_870822.1| PREDICTED: Bos taurus similar to H2A histone fa... 56 2e-04
476gb|AY573602.1| Toxoplasma gondii histone H2A.1 gene, complete cds 56 2e-04
477emb|CR705345.2|CNS0G771 Tetraodon nigroviridis full-length cDNA 56 2e-04
478emb|AL138726.12| Human DNA sequence from clone RP1-139G21 on chr... 56 2e-04
479gb|BC103043.1| Bos taurus cDNA clone MGC:128401 IMAGE:7983967, c... 56 2e-04
480ref|NM_001024282.1| Rattus norvegicus Histone H2a (predicted) (R... 56 2e-04
481gb|AC016780.6| Genomic Sequence For Oryza sativa (japonica culti... 56 2e-04
482gb|AF098457.1|AF098457 Homo sapiens H2A/t pseudogene, complete s... 56 2e-04
483gb|U90545.1|HSU90545 Human sodium phosphate transporter (NPT4) m... 56 2e-04
484ref|NG_002685.1| Homo sapiens histone 1, H2a, pseudogene 2 (HIST... 56 2e-04
485emb|AL116588.1|CNS01DAS Botrytis cinerea strain T4 cDNA library 56 2e-04
486dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic D... 56 2e-04
487gb|BC092032.1| Xenopus laevis hypothetical protein MGC83508, mRN... 56 2e-04
488gb|AC027658.1| Oryza sativa (japonica cultivar-group) BAC nbxb00... 56 2e-04
489dbj|AK121515.1| Oryza sativa (japonica cultivar-group) cDNA clon... 56 2e-04
490gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome... 56 2e-04
491gb|U95113.1|RNU95113 Rattus norvegicus histone H2a gene, complet... 56 2e-04
492gb|J00980.1|XELHIS2AL xenopus laevis h2a histone gene & flanks 56 2e-04
493ref|NM_122649.2| Arabidopsis thaliana DNA binding AT5G27670 mRNA... 54 6e-04
494ref|XM_527281.1| PREDICTED: Pan troglodytes similar to H2A histo... 54 6e-04
495ref|XM_518299.1| PREDICTED: Pan troglodytes similar to Histone H... 54 6e-04
496ref|NM_001030332.2| Xenopus tropicalis hypothetical protein LOC5... 54 6e-04
497gb|BC062305.1| Homo sapiens cDNA clone IMAGE:3162462 54 6e-04
498ref|XM_603142.2| PREDICTED: Bos taurus similar to histone 1, H2a... 54 6e-04
499ref|XM_583411.2| PREDICTED: Bos taurus similar to Histone H2A.l ... 54 6e-04
500ref|XM_869647.1| PREDICTED: Bos taurus similar to Histone H2A.l ... 54 6e-04

>dbj|D38090.1|WHTPH2AD Triticum aestivum mRNA for protein H2A, complete cds, clone wcH2A-9
          Length = 704

 Score =  722 bits (364), Expect = 0.0
 Identities = 438/462 (94%), Gaps = 3/462 (0%)
 Strand = Plus / Minus

                                                                       
Query: 153 tggcgggggccttcttcttgggggacttggtggcggccttcttcttgggcgacttggtgg 212
           |||||| | |||||||||||||||||||||||| || ||||||||||||||||||||   
Sbjct: 495 tggcggcgaccttcttcttgggggacttggtggaggtcttcttcttgggcgacttgg--- 439

                                                                       
Query: 213 cctccttctcggccgcggcggcggacttcttggggagcagaacggagttgatgttgggga 272
           ||||||||||||| ||||||| |||||||||||||||||| |||||||||||||||||||
Sbjct: 438 cctccttctcggcggcggcgggggacttcttggggagcagcacggagttgatgttgggga 379

                                                                       
Query: 273 tcacgccgccgtgggcgatggtgacgccggcgagcagcctgccgagctcctggtcgttgc 332
           ||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 378 tcacgccaccgtgggcgatggtgacgccagcgagcagcctgccgagctcctggtcgttgc 319

                                                                       
Query: 333 ggacggcgagaagcaggtggcgcgggatgatgcgggtcttcttgttatccttggcggcgt 392
           |||| ||||| ||||||||||||||||||||||||||||||||||| |||||||| ||||
Sbjct: 318 ggacagcgagcagcaggtggcgcgggatgatgcgggtcttcttgttgtccttggccgcgt 259

                                                                       
Query: 393 tgccggcgagctcaagcacctctgcggcgaggtactcgaggacggcggcgaggtagacag 452
           ||||||| ||||| |||||||| ||||||||||||||||||||||||||||||||||| |
Sbjct: 258 tgccggcaagctccagcacctcggcggcgaggtactcgaggacggcggcgaggtagacgg 199

                                                                       
Query: 453 gggcgccggagccgacgcgctgggcgtagcggcccttcttgaggtagcgcccgatgcggc 512
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 198 gggcgccggagccgacgcgctgggcgtagcggcccttcttgaggtagcgcccgatgcggc 139

                                                                       
Query: 513 cgacggggaactggagaccggccttcacggaccgggtcaccgccttcttcctgtcgccgc 572
           |||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||
Sbjct: 138 cgacggggaactggagcccggccttcacggagcgggtcaccgccttcttcctgtcgccgc 79

                                                     
Query: 573 ccttccttccggccatcttcttgcttgctgctgctccggcga 614
           |||||||||||||||||||||||||||||||  |||||||||
Sbjct: 78  ccttccttccggccatcttcttgcttgctgcgtctccggcga 37



 Score = 46.1 bits (23), Expect = 0.14
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 178 cttggtggcggccttcttcttgggcgacttggtgg 212
           ||||| |||| ||||||||||||| ||||||||||
Sbjct: 497 cttggcggcgaccttcttcttgggggacttggtgg 463



to top

>dbj|D38088.1|WHTPH2AB Triticum aestivum mRNA for protein H2A, complete cds, clone wcH2A-3
          Length = 1153

 Score =  706 bits (356), Expect = 0.0
 Identities = 431/456 (94%)
 Strand = Plus / Minus

                                                                       
Query: 139 cggctactccttggtggcgggggccttcttcttgggggacttggtggcggccttcttctt 198
           |||||||||||||||||| | || ||||||||||||||||||||||||||||||||||||
Sbjct: 533 cggctactccttggtggctgcggtcttcttcttgggggacttggtggcggccttcttctt 474

                                                                       
Query: 199 gggcgacttggtggcctccttctcggccgcggcggcggacttcttggggagcagaacgga 258
           |||||||||||||| |||||||||||| ||| |||||| ||||||||||||||| |||||
Sbjct: 473 gggcgacttggtggactccttctcggcggcgccggcggccttcttggggagcagcacgga 414

                                                                       
Query: 259 gttgatgttggggatcacgccgccgtgggcgatggtgacgccggcgagcagcctgccgag 318
           ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||
Sbjct: 413 gttgatgttggggatgacgccgccgtgggcgatggtgacgccggcgagcagcctgcccag 354

                                                                       
Query: 319 ctcctggtcgttgcggacggcgagaagcaggtggcgcgggatgatgcgggtcttcttgtt 378
           ||||||||||||||||||||| || ||||||||||||||||||||||| |||||||||||
Sbjct: 353 ctcctggtcgttgcggacggccagcagcaggtggcgcgggatgatgcgcgtcttcttgtt 294

                                                                       
Query: 379 atccttggcggcgttgccggcgagctcaagcacctctgcggcgaggtactcgaggacggc 438
            |||||||| ||||||||||||||||| || ||||| |||||||||||||||||||||||
Sbjct: 293 gtccttggccgcgttgccggcgagctccaggacctcggcggcgaggtactcgaggacggc 234

                                                                       
Query: 439 ggcgaggtagacaggggcgccggagccgacgcgctgggcgtagcggcccttcttgaggta 498
           |||||||||||| ||||||||||||||||||  ||| |||||||||||||||||||||||
Sbjct: 233 ggcgaggtagacgggggcgccggagccgacggcctgcgcgtagcggcccttcttgaggta 174

                                                                       
Query: 499 gcgcccgatgcggccgacggggaactggagaccggccttcacggaccgggtcaccgcctt 558
           |||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||
Sbjct: 173 gcgcccgatgcggccgacggggaactggagcccggccttcacggagcgggtcaccgcctt 114

                                               
Query: 559 cttcctgtcgccgcccttccttccggccatcttctt 594
           |||||| |||||||||||||||||||||||||||||
Sbjct: 113 cttcctctcgccgcccttccttccggccatcttctt 78



to top

>dbj|D38087.1|WHTPH2AA Triticum aestivum mRNA for protein H2A, complete cds, clone wcH2A-2
          Length = 717

 Score =  674 bits (340), Expect = 0.0
 Identities = 447/481 (92%), Gaps = 10/481 (2%)
 Strand = Plus / Minus

                                                                       
Query: 139 cggctactccttggtggcgggggccttcttcttgggggacttggtggcggccttcttctt 198
           |||||||||||||||||| | || |||||||||||||||||||| |||||||||||    
Sbjct: 526 cggctactccttggtggctgcggtcttcttcttgggggacttggcggcggccttct---- 471

                                                                       
Query: 199 gggcgacttggtggcctccttctcggccgcggcggcggacttcttggggagcagaacgga 258
             |||||||||   ||||||||||||| || |||| |||||||||||||||||| |||||
Sbjct: 470 --gcgacttgg---cctccttctcggcggctgcgggggacttcttggggagcagcacgga 416

                                                                       
Query: 259 gttgatgttggggatcacgccgccgtgggcgatggtgacgccggcgagcagcctgccgag 318
           ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 415 gttgatgttggggatgacgccgccgtgggcgatggtgacgccggcgagcagcctgccgag 356

                                                                       
Query: 319 ctcctggtcgttgcggacggcgagaagcaggtggcgcgggatgatgcgggtcttcttgtt 378
           ||||||||||||||||||||| || ||||||||||||||||||||||| |||||||||||
Sbjct: 355 ctcctggtcgttgcggacggccagcagcaggtggcgcgggatgatgcgcgtcttcttgtt 296

                                                                       
Query: 379 atccttggcggcgttgccggcgagctcaagcacctctgcggcgaggtactcgaggacggc 438
            |||||||| ||||||||||| ||||| || ||||| |||||||||||||||||||||||
Sbjct: 295 gtccttggccgcgttgccggcaagctccaggacctcggcggcgaggtactcgaggacggc 236

                                                                       
Query: 439 ggcgaggtagacaggggcgccggagccgacgcgctgggcgtagcggcccttcttgaggta 498
           |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 235 ggcgaggtagacgggggcgccggagccgacgcgctgggcgtagcggcccttcttgaggta 176

                                                                       
Query: 499 gcgcccgatgcggccgacggggaactggagaccggccttcacggaccgggtcaccgcctt 558
           ||||||||||||||||||||||||||| || |||||||| ||||| ||||||||||||||
Sbjct: 175 gcgcccgatgcggccgacggggaactgcagcccggccttgacggagcgggtcaccgcctt 116

                                                                       
Query: 559 cttcctgtcgccgcccttccttccggccatcttcttgcttgctgctgctccggcgacgag 618
           |||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||
Sbjct: 115 cttcctgtcgccgcccttccttccggccatcttctt-cttgctgcttctccggcgacgag 57

            
Query: 619 g 619
           |
Sbjct: 56  g 56



 Score = 50.1 bits (25), Expect = 0.009
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                        
Query: 49  cactacggactaccaggcattacatacag 77
           |||||| ||||||||||||||||||||||
Sbjct: 640 cactacagactaccaggcattacatacag 612



to top

>gb|BT016569.1| Zea mays clone Contig402 mRNA sequence
          Length = 719

 Score =  365 bits (184), Expect = 1e-97
 Identities = 295/332 (88%)
 Strand = Plus / Minus

                                                                       
Query: 233 gcggacttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatg 292
           |||| ||||||||| || || || | ||||||||||||||  ||||||||||||||||||
Sbjct: 497 gcggtcttcttgggcaggagcaccgggttgatgttggggaggacgccgccgtgggcgatg 438

                                                                       
Query: 293 gtgacgccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtgg 352
           ||||||||||  |||||| |||||||||||| ||||||||||| ||| || |||| ||||
Sbjct: 437 gtgacgccggacagcagcttgccgagctcctcgtcgttgcggatggcaaggagcacgtgg 378

                                                                       
Query: 353 cgcgggatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacc 412
           |||||||||||||||||||||||||| |||||||| ||||||||||| ||||| ||||||
Sbjct: 377 cgcgggatgatgcgggtcttcttgttgtccttggcagcgttgccggccagctccagcacc 318

                                                                       
Query: 413 tctgcggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgc 472
           || ||||| |||||||||||||||||||| |||||||| |||||||| | ||||||||||
Sbjct: 317 tcggcggccaggtactcgaggacggcggccaggtagacgggggcgcccgtgccgacgcgc 258

                                                                       
Query: 473 tgggcgtagcggcccttcttgaggtagcgcccgatgcggccgacggggaactggagaccg 532
           || ||||| ||||||||||| ||||| |||||||||||||||||||| ||||| || |||
Sbjct: 257 tgcgcgtaccggcccttcttcaggtaccgcccgatgcggccgacgggaaactgcagcccg 198

                                           
Query: 533 gccttcacggaccgggtcaccgccttcttcct 564
           ||||| |||||||  ||||||| |||||||||
Sbjct: 197 gccttgacggacctcgtcaccgacttcttcct 166



to top

>gb|BT019008.1| Zea mays clone Contig499.F mRNA sequence
          Length = 674

 Score =  365 bits (184), Expect = 1e-97
 Identities = 293/328 (89%), Gaps = 1/328 (0%)
 Strand = Plus / Minus

                                                                       
Query: 238 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 297
           ||||||||| ||||| || | |||||||||||| | ||||||||||||||||||||| ||
Sbjct: 450 cttcttgggcagcaggaccgggttgatgttgggcaacacgccgccgtgggcgatggtcac 391

                                                                       
Query: 298 gccggcgagcagcctgcc-gagctcctggtcgttgcggacggcgagaagcaggtggcgcg 356
           |||||  |||||||| || |||||||| |||||||||||  || || |||| ||||||||
Sbjct: 390 gccggtcagcagccttcccgagctcctcgtcgttgcggatcgccagcagcacgtggcgcg 331

                                                                       
Query: 357 ggatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctg 416
           ||| |||||| ||||||||||| |||||||| ||||||||||||||||| || ||||| |
Sbjct: 330 ggacgatgcgcgtcttcttgttgtccttggcagcgttgccggcgagctccaggacctcag 271

                                                                       
Query: 417 cggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgctggg 476
           ||||||||||||| |||||||| ||||||||||| ||||| |||  |||||||||||| |
Sbjct: 270 cggcgaggtactccaggacggccgcgaggtagacgggggcaccgctgccgacgcgctgcg 211

                                                                       
Query: 477 cgtagcggcccttcttgaggtagcgcccgatgcggccgacggggaactggagaccggcct 536
           |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||
Sbjct: 210 cgtagcggcccttcttgaggtagcgcccgatgcggccgacggggaactggagcccggcct 151

                                       
Query: 537 tcacggaccgggtcaccgccttcttcct 564
           |||||||||  ||||||| |||||||||
Sbjct: 150 tcacggacctcgtcaccgacttcttcct 123



to top

>gb|AY103710.1| Zea mays PCO123562 mRNA sequence
          Length = 770

 Score =  365 bits (184), Expect = 1e-97
 Identities = 295/332 (88%)
 Strand = Plus / Minus

                                                                       
Query: 233 gcggacttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatg 292
           |||| ||||||||| || || || | ||||||||||||||  ||||||||||||||||||
Sbjct: 497 gcggtcttcttgggcaggagcaccgggttgatgttggggaggacgccgccgtgggcgatg 438

                                                                       
Query: 293 gtgacgccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtgg 352
           ||||||||||  |||||| |||||||||||| ||||||||||| ||| || |||| ||||
Sbjct: 437 gtgacgccggacagcagcttgccgagctcctcgtcgttgcggatggcaaggagcacgtgg 378

                                                                       
Query: 353 cgcgggatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacc 412
           |||||||||||||||||||||||||| |||||||| ||||||||||| ||||| ||||||
Sbjct: 377 cgcgggatgatgcgggtcttcttgttgtccttggcagcgttgccggccagctccagcacc 318

                                                                       
Query: 413 tctgcggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgc 472
           || ||||| |||||||||||||||||||| |||||||| |||||||| | ||||||||||
Sbjct: 317 tcggcggccaggtactcgaggacggcggccaggtagacgggggcgcccgtgccgacgcgc 258

                                                                       
Query: 473 tgggcgtagcggcccttcttgaggtagcgcccgatgcggccgacggggaactggagaccg 532
           || ||||| ||||||||||| ||||| |||||||||||||||||||| ||||| || |||
Sbjct: 257 tgcgcgtaccggcccttcttcaggtaccgcccgatgcggccgacgggaaactgcagcccg 198

                                           
Query: 533 gccttcacggaccgggtcaccgccttcttcct 564
           ||||| |||||||  ||||||| |||||||||
Sbjct: 197 gccttgacggacctcgtcaccgacttcttcct 166



to top

>emb|X94973.1|TAH2A274 T.aestivum histone H2A gene (clone TH274)
          Length = 2546

 Score =  353 bits (178), Expect = 5e-94
 Identities = 234/252 (92%), Gaps = 3/252 (1%)
 Strand = Plus / Minus

                                                                        
Query: 162  ccttcttcttgggggacttggtggcggccttcttcttgggcgacttggtggcctccttct 221
            |||||||||||||||||||||||| || ||||||||||||||||||||   |||||||||
Sbjct: 2308 ccttcttcttgggggacttggtggaggtcttcttcttgggcgacttgg---cctccttct 2252

                                                                        
Query: 222  cggccgcggcggcggacttcttggggagcagaacggagttgatgttggggatcacgccgc 281
            |||| ||||||| |||||||||||| ||||| |||||||||||  ||||||| |||||||
Sbjct: 2251 cggcggcggcgggggacttcttgggcagcagcacggagttgattgtggggatgacgccgc 2192

                                                                        
Query: 282  cgtgggcgatggtgacgccggcgagcagcctgccgagctcctggtcgttgcggacggcga 341
            |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||
Sbjct: 2191 cgtgggcgatggtgacgccggcaagcagcctgccgagctcctggtcgttgcggacggcga 2132

                                                                        
Query: 342  gaagcaggtggcgcgggatgatgcgggtcttcttgttatccttggcggcgttgccggcga 401
            | ||||||||||||||||||||||||||||||||||| |||||||| ||||||||||| |
Sbjct: 2131 gcagcaggtggcgcgggatgatgcgggtcttcttgttgtccttggctgcgttgccggcaa 2072

                        
Query: 402  gctcaagcacct 413
            |||| |||||||
Sbjct: 2071 gctccagcacct 2060



 Score =  331 bits (167), Expect = 2e-87
 Identities = 211/223 (94%), Gaps = 2/223 (0%)
 Strand = Plus / Minus

                                                                        
Query: 410  acctctgcggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacg 469
            ||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||| |
Sbjct: 1968 acctcggcggcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgatg 1909

                                                                        
Query: 470  cgctgggcgtagcggcccttcttgaggtagcgcccgatgcggccgacggggaactggaga 529
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| 
Sbjct: 1908 cgctgggcgtagcggcccttcttgaggtagcgcccgatgcggccgacggggaactggagc 1849

                                                                        
Query: 530  ccggccttcacggaccgggtcaccgccttcttcctgtcgccgcccttccttccggccatc 589
            |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1848 ccggccttcacggacctggtcaccgccttcttcctgtcgccgcccttccttccggccatc 1789

                                                       
Query: 590  tt-cttgcttgctgctgctccggcgacgagggctcacgaggtg 631
            || ||||| | || || |||||||||||||| ||| |||||||
Sbjct: 1788 ttgcttgc-tactacttctccggcgacgaggactctcgaggtg 1747



 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 31/32 (96%)
 Strand = Plus / Minus

                                            
Query: 90   gtccatgagaaatggatctaagcaacaatggc 121
            ||||| ||||||||||||||||||||||||||
Sbjct: 2373 gtccacgagaaatggatctaagcaacaatggc 2342



to top

>gb|L75802.1|WHTHIH2A Triticum aestivum histone H2A gene, complete cds
          Length = 2546

 Score =  353 bits (178), Expect = 5e-94
 Identities = 234/252 (92%), Gaps = 3/252 (1%)
 Strand = Plus / Minus

                                                                        
Query: 162  ccttcttcttgggggacttggtggcggccttcttcttgggcgacttggtggcctccttct 221
            |||||||||||||||||||||||| || ||||||||||||||||||||   |||||||||
Sbjct: 2308 ccttcttcttgggggacttggtggaggtcttcttcttgggcgacttgg---cctccttct 2252

                                                                        
Query: 222  cggccgcggcggcggacttcttggggagcagaacggagttgatgttggggatcacgccgc 281
            |||| ||||||| |||||||||||| ||||| |||||||||||  ||||||| |||||||
Sbjct: 2251 cggcggcggcgggggacttcttgggcagcagcacggagttgattgtggggatgacgccgc 2192

                                                                        
Query: 282  cgtgggcgatggtgacgccggcgagcagcctgccgagctcctggtcgttgcggacggcga 341
            |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||
Sbjct: 2191 cgtgggcgatggtgacgccggcaagcagcctgccgagctcctggtcgttgcggacggcga 2132

                                                                        
Query: 342  gaagcaggtggcgcgggatgatgcgggtcttcttgttatccttggcggcgttgccggcga 401
            | ||||||||||||||||||||||||||||||||||| |||||||| ||||||||||| |
Sbjct: 2131 gcagcaggtggcgcgggatgatgcgggtcttcttgttgtccttggctgcgttgccggcaa 2072

                        
Query: 402  gctcaagcacct 413
            |||| |||||||
Sbjct: 2071 gctccagcacct 2060



 Score =  331 bits (167), Expect = 2e-87
 Identities = 211/223 (94%), Gaps = 2/223 (0%)
 Strand = Plus / Minus

                                                                        
Query: 410  acctctgcggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacg 469
            ||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||| |
Sbjct: 1968 acctcggcggcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgatg 1909

                                                                        
Query: 470  cgctgggcgtagcggcccttcttgaggtagcgcccgatgcggccgacggggaactggaga 529
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| 
Sbjct: 1908 cgctgggcgtagcggcccttcttgaggtagcgcccgatgcggccgacggggaactggagc 1849

                                                                        
Query: 530  ccggccttcacggaccgggtcaccgccttcttcctgtcgccgcccttccttccggccatc 589
            |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1848 ccggccttcacggacctggtcaccgccttcttcctgtcgccgcccttccttccggccatc 1789

                                                       
Query: 590  tt-cttgcttgctgctgctccggcgacgagggctcacgaggtg 631
            || ||||| | || || |||||||||||||| ||| |||||||
Sbjct: 1788 ttgcttgc-tactacttctccggcgacgaggactctcgaggtg 1747



 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 31/32 (96%)
 Strand = Plus / Minus

                                            
Query: 90   gtccatgagaaatggatctaagcaacaatggc 121
            ||||| ||||||||||||||||||||||||||
Sbjct: 2373 gtccacgagaaatggatctaagcaacaatggc 2342



to top

>dbj|AK074018.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033075N03, full
           insert sequence
          Length = 797

 Score =  353 bits (178), Expect = 5e-94
 Identities = 292/330 (88%)
 Strand = Plus / Minus

                                                                       
Query: 233 gcggacttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatg 292
           |||| |||||| |||||||| || | ||||||||| || | |||||||||||| ||||||
Sbjct: 472 gcggtcttcttcgggagcagcaccgggttgatgttcggcagcacgccgccgtgcgcgatg 413

                                                                       
Query: 293 gtgacgccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtgg 352
           ||||| |||||||||||| | |||||||||| |||||||||||  || || |||| ||| 
Sbjct: 412 gtgaccccggcgagcagcttcccgagctcctcgtcgttgcggatcgccagcagcacgtgc 353

                                                                       
Query: 353 cgcgggatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacc 412
           | ||||||||| ||| |||||||||| |||   || ||||| ||||||||||| ||||||
Sbjct: 352 ctcgggatgatccggttcttcttgttgtcccgcgccgcgttcccggcgagctccagcacc 293

                                                                       
Query: 413 tctgcggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgc 472
           |||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||
Sbjct: 292 tctgcggcgaggtactcgaggacggcggcgaggtagacgggggcgccggtgccgacgcgc 233

                                                                       
Query: 473 tgggcgtagcggcccttcttgaggtagcgcccgatgcggccgacggggaactggagaccg 532
           ||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||
Sbjct: 232 tgggcgtagcggcccttcttgaggtagcggccgatgcggccgacggggaactggagcccg 173

                                         
Query: 533 gccttcacggaccgggtcaccgccttcttc 562
           ||||| ||||| || | ||||| |||||||
Sbjct: 172 gccttgacggagcgcgacaccggcttcttc 143



to top

>ref|NM_193707.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 480

 Score =  339 bits (171), Expect = 7e-90
 Identities = 288/327 (88%)
 Strand = Plus / Minus

                                                                       
Query: 238 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 297
           ||||||||| ||||| || | |||||||||||| | |||||| ||||| |||||||| ||
Sbjct: 399 cttcttgggcagcagcaccgggttgatgttgggcagcacgcctccgtgcgcgatggtcac 340

                                                                       
Query: 298 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 357
           |||||| |||||| |||||||||||| |||||| | ||  || || |||| |||||||||
Sbjct: 339 gccggccagcagcttgccgagctcctcgtcgttcctgatcgccagcagcacgtggcgcgg 280

                                                                       
Query: 358 gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 417
           |||||| | | |||||||||| ||| |||| ||||| ||||||||||| |||||||| ||
Sbjct: 279 gatgatcctgttcttcttgttgtccctggccgcgttcccggcgagctccagcacctcggc 220

                                                                       
Query: 418 ggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgctgggc 477
           ||||||||||||||||||||||||||||||||| |||||||||| ||||| |||||| ||
Sbjct: 219 ggcgaggtactcgaggacggcggcgaggtagacgggggcgccggtgccgatgcgctgcgc 160

                                                                       
Query: 478 gtagcggcccttcttgaggtagcgcccgatgcggccgacggggaactggagaccggcctt 537
           |||||||||||||||||||||||| ||||| |||||||||||||||||||| ||||||||
Sbjct: 159 gtagcggcccttcttgaggtagcggccgatacggccgacggggaactggagcccggcctt 100

                                      
Query: 538 cacggaccgggtcaccgccttcttcct 564
            ||||| || | |||||||||||||||
Sbjct: 99  gacggagcgcgacaccgccttcttcct 73



to top

>dbj|AK121750.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033087I02, full
           insert sequence
          Length = 754

 Score =  339 bits (171), Expect = 7e-90
 Identities = 288/327 (88%)
 Strand = Plus / Minus

                                                                       
Query: 238 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 297
           ||||||||| ||||| || | |||||||||||| | |||||| ||||| |||||||| ||
Sbjct: 489 cttcttgggcagcagcaccgggttgatgttgggcagcacgcctccgtgcgcgatggtcac 430

                                                                       
Query: 298 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 357
           |||||| |||||| |||||||||||| |||||| | ||  || || |||| |||||||||
Sbjct: 429 gccggccagcagcttgccgagctcctcgtcgttcctgatcgccagcagcacgtggcgcgg 370

                                                                       
Query: 358 gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 417
           |||||| | | |||||||||| ||| |||| ||||| ||||||||||| |||||||| ||
Sbjct: 369 gatgatcctgttcttcttgttgtccctggccgcgttcccggcgagctccagcacctcggc 310

                                                                       
Query: 418 ggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgctgggc 477
            |||||||||||||||||||||||||||||||| |||||||||| ||||| |||||||||
Sbjct: 309 agcgaggtactcgaggacggcggcgaggtagacgggggcgccggtgccgatgcgctgggc 250

                                                                       
Query: 478 gtagcggcccttcttgaggtagcgcccgatgcggccgacggggaactggagaccggcctt 537
           |||||||||||||||||||||||| ||||| |||||||||||||||||||| ||||||||
Sbjct: 249 gtagcggcccttcttgaggtagcggccgatacggccgacggggaactggagcccggcctt 190

                                      
Query: 538 cacggaccgggtcaccgccttcttcct 564
            ||||| || | |||||||||||||||
Sbjct: 189 gacggagcgcgacaccgccttcttcct 163



to top

>gb|AY103585.1| Zea mays PCO123564 mRNA sequence
          Length = 1953

 Score =  325 bits (164), Expect = 1e-85
 Identities = 287/328 (87%)
 Strand = Plus / Minus

                                                                       
Query: 238 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 297
           ||||||||| || || ||||||| |||||||||||  ||||||||||| |||||||||||
Sbjct: 610 cttcttgggcaggagcacggagtggatgttggggaggacgccgccgtgcgcgatggtgac 551

                                                                       
Query: 298 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 357
           |||||| |||||| | |||||||||| |||||||||||  || || |||| |||||||||
Sbjct: 550 gccggccagcagcttcccgagctcctcgtcgttgcggatcgccaggagcacgtggcgcgg 491

                                                                       
Query: 358 gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 417
           ||||||||| ||||||||||| || || || ||||| || || | ||| || ||||| ||
Sbjct: 490 gatgatgcgcgtcttcttgttgtctttcgccgcgttccctgccaactccagaacctcggc 431

                                                                       
Query: 418 ggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgctgggc 477
           |||||||||||| |||||||||||||||||||| |||||||| | ||| |||||||| ||
Sbjct: 430 ggcgaggtactccaggacggcggcgaggtagacgggggcgccagtgcccacgcgctgcgc 371

                                                                       
Query: 478 gtagcggcccttcttgaggtagcgcccgatgcggccgacggggaactggagaccggcctt 537
           ||| |||||||||||||||||||||||||| ||||||||||||||||| || ||||||||
Sbjct: 370 gtaccggcccttcttgaggtagcgcccgatccggccgacggggaactgcagcccggcctt 311

                                       
Query: 538 cacggaccgggtcaccgccttcttcctg 565
            |||||||| ||||||| ||||||||||
Sbjct: 310 gacggaccgcgtcaccgacttcttcctg 283



to top

>gb|AF493985.1| Triticum aestivum H2A-1 gene, partial sequence
          Length = 538

 Score =  321 bits (162), Expect = 2e-84
 Identities = 273/307 (88%), Gaps = 5/307 (1%)
 Strand = Plus / Plus

                                                                       
Query: 12  caggtacaatgtn-ccattgctagacgaatcgaacaggcactacggactaccaggcatta 70
           ||||||||||||  || ||||| ||||||||  || |||||||| ||||| |||||| ||
Sbjct: 41  caggtacaatgtcacccttgctcgacgaatctgacgggcactacagactagcaggcacta 100

                                                                       
Query: 71  catacaggatatcatcttagtccatgagaaatggatctaagcaacaatggcggggctatg 130
           ||||||||||  |||||||||||||||||||||||||||||||||||||||  |||||||
Sbjct: 101 catacaggatcccatcttagtccatgagaaatggatctaagcaacaatggctaggctatg 160

                                                                       
Query: 131 ggtgcaggcggctactccttggtggcgggggccttcttcttgggggacttggtggcggcc 190
           ||  | | |||||||||||| |||||||  | |||||||||||||||||||| ||| | |
Sbjct: 161 gggac-gacggctactccttcgtggcggccgtcttcttcttgggggacttggcggccgtc 219

                                                                       
Query: 191 ttcttcttgggcgacttggtggcctccttctcggccgcggcggcggacttcttggggagc 250
           |||||||||||||||||||   ||||||||||||| ||||| | ||||||||||||||||
Sbjct: 220 ttcttcttgggcgacttgg---cctccttctcggcggcggcaggggacttcttggggagc 276

                                                                       
Query: 251 agaacggagttgatgttggggatcacgccgccgtgggcgatggtgacgccggcgagcagc 310
           || ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||
Sbjct: 277 agcacggagttgatgttggggatcacaccgccgtgggcgatggtgacgccggcgagcagc 336

                  
Query: 311 ctgccga 317
            ||||||
Sbjct: 337 ttgccga 343



to top

>ref|XM_475374.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 492

 Score =  311 bits (157), Expect = 2e-81
 Identities = 283/325 (87%)
 Strand = Plus / Minus

                                                                       
Query: 238 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 297
           ||||||||||||||| || | |||||||||||| | ||| |||||||| |||||||||||
Sbjct: 393 cttcttggggagcagcaccgggttgatgttgggcagcaccccgccgtgcgcgatggtgac 334

                                                                       
Query: 298 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 357
           |||||| |||||| | |||||||||| |||||||||||  || || |||| ||| |||||
Sbjct: 333 gccggccagcagcttcccgagctcctcgtcgttgcggatcgccagcagcacgtgccgcgg 274

                                                                       
Query: 358 gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 417
           |||||| ||| |||||||||| |||   || ||||| || || ||||| |||||||| ||
Sbjct: 273 gatgatccggttcttcttgttgtcccgcgccgcgttccccgcaagctcgagcacctcggc 214

                                                                       
Query: 418 ggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgctgggc 477
           ||||||||||||||||||||||||||||||||| |||||||||| ||||| |||||||| 
Sbjct: 213 ggcgaggtactcgaggacggcggcgaggtagacgggggcgccggtgccgatgcgctggga 154

                                                                       
Query: 478 gtagcggcccttcttgaggtagcgcccgatgcggccgacggggaactggagaccggcctt 537
           ||||||||| | |||||||||||| ||||| |||||||||||||||||||| ||||||||
Sbjct: 153 gtagcggccttgcttgaggtagcggccgatacggccgacggggaactggagcccggcctt 94

                                    
Query: 538 cacggaccgggtcaccgccttcttc 562
            ||||| |||| ||||| |||||||
Sbjct: 93  gacggagcgggacaccggcttcttc 69



to top

>dbj|AK067406.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013099N23, full
           insert sequence
          Length = 1097

 Score =  311 bits (157), Expect = 2e-81
 Identities = 283/325 (87%)
 Strand = Plus / Minus

                                                                       
Query: 238 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 297
           ||||||||||||||| || | |||||||||||| | ||| |||||||| |||||||||||
Sbjct: 464 cttcttggggagcagcaccgggttgatgttgggcagcaccccgccgtgcgcgatggtgac 405

                                                                       
Query: 298 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 357
           |||||| |||||| | |||||||||| |||||||||||  || || |||| ||| |||||
Sbjct: 404 gccggccagcagcttcccgagctcctcgtcgttgcggatcgccagcagcacgtgccgcgg 345

                                                                       
Query: 358 gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 417
           |||||| ||| |||||||||| |||   || ||||| || || ||||| |||||||| ||
Sbjct: 344 gatgatccggttcttcttgttgtcccgcgccgcgttccccgcaagctcgagcacctcggc 285

                                                                       
Query: 418 ggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgctgggc 477
           ||||||||||||||||||||||||||||||||| |||||||||| ||||| |||||||| 
Sbjct: 284 ggcgaggtactcgaggacggcggcgaggtagacgggggcgccggtgccgatgcgctggga 225

                                                                       
Query: 478 gtagcggcccttcttgaggtagcgcccgatgcggccgacggggaactggagaccggcctt 537
           ||||||||| | |||||||||||| ||||| |||||||||||||||||||| ||||||||
Sbjct: 224 gtagcggccttgcttgaggtagcggccgatacggccgacggggaactggagcccggcctt 165

                                    
Query: 538 cacggaccgggtcaccgccttcttc 562
            ||||| |||| ||||| |||||||
Sbjct: 164 gacggagcgggacaccggcttcttc 140



to top

>gb|BT019315.1| Zea mays clone Contig989.F mRNA sequence
          Length = 699

 Score =  309 bits (156), Expect = 6e-81
 Identities = 285/328 (86%)
 Strand = Plus / Minus

                                                                       
Query: 238 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 297
           ||||||||| || || ||||||| |||||||||||  ||||| ||||| |||||||||||
Sbjct: 461 cttcttgggcaggagcacggagtggatgttggggaggacgccaccgtgcgcgatggtgac 402

                                                                       
Query: 298 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 357
           |||||| |||||| | |||||||||| |||||||||||  || || |||| |||||||||
Sbjct: 401 gccggccagcagcttcccgagctcctcgtcgttgcggatcgccaggagcacgtggcgcgg 342

                                                                       
Query: 358 gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 417
           ||||||||| ||||||||||| || || || ||||| || || | ||| || ||||| ||
Sbjct: 341 gatgatgcgcgtcttcttgttgtctttcgccgcgttccctgccaactccagaacctcggc 282

                                                                       
Query: 418 ggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgctgggc 477
           |||||||||||| || ||||||||||||||||| |||||||| | ||| |||||||| ||
Sbjct: 281 ggcgaggtactccagaacggcggcgaggtagacgggggcgccagtgcccacgcgctgcgc 222

                                                                       
Query: 478 gtagcggcccttcttgaggtagcgcccgatgcggccgacggggaactggagaccggcctt 537
           ||| |||||||||||||||||||||||||| ||||||||||||||||| || ||||||||
Sbjct: 221 gtaccggcccttcttgaggtagcgcccgatccggccgacggggaactgcagcccggcctt 162

                                       
Query: 538 cacggaccgggtcaccgccttcttcctg 565
            |||||||| ||||||| ||||||||||
Sbjct: 161 gacggaccgcgtcaccgacttcttcctg 134



to top

>dbj|AK099763.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013094K03, full
           insert sequence
          Length = 912

 Score =  303 bits (153), Expect = 4e-79
 Identities = 282/325 (86%)
 Strand = Plus / Minus

                                                                       
Query: 238 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 297
           ||||||||||||||| || | |||||||||||| | ||| |||||||| |||||||||||
Sbjct: 463 cttcttggggagcagcaccgggttgatgttgggcagcaccccgccgtgcgcgatggtgac 404

                                                                       
Query: 298 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 357
           |||||| |||||| | |||||||||| |||||||||||  || || |||| ||| |||||
Sbjct: 403 gccggccagcagcttcccgagctcctcgtcgttgcggatcgccagcagcacgtgccgcgg 344

                                                                       
Query: 358 gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 417
           |||||| ||| |||||||||| |||   || ||||| || || ||||| |||||||| ||
Sbjct: 343 gatgatccggttcttcttgttgtcccgcgccgcgttccccgcaagctcgagcacctcggc 284

                                                                       
Query: 418 ggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgctgggc 477
           ||||||||||||||||||||||||||||||||| |||||||||| ||||| |||||||| 
Sbjct: 283 ggcgaggtactcgaggacggcggcgaggtagacgggggcgccggtgccgatgcgctggga 224

                                                                       
Query: 478 gtagcggcccttcttgaggtagcgcccgatgcggccgacggggaactggagaccggcctt 537
           ||||||||| | |||||||||||| ||||| |||||||||||||||||||| ||||||||
Sbjct: 223 gtagcggccttgcttgaggtagcggccgatacggccgacggggaactggagcccggcctt 164

                                    
Query: 538 cacggaccgggtcaccgccttcttc 562
            |||||  ||| ||||| |||||||
Sbjct: 163 gacggagggggacaccggcttcttc 139



to top

>gb|U08225.1|ZMU08225 Zea mays W-22 histone H2A mRNA, complete cds
          Length = 714

 Score =  297 bits (150), Expect = 2e-77
 Identities = 282/327 (86%)
 Strand = Plus / Minus

                                                                       
Query: 238 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 297
           ||||||||| |||||||| | |||||| ||||||| ||| |||||||| |||||||| ||
Sbjct: 467 cttcttgggcagcagaacagggttgatattggggagcacaccgccgtgagcgatggtcac 408

                                                                       
Query: 298 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 357
           |||| | | |||| | || ||||||| |||||| ||||  || ||||||| |||||||||
Sbjct: 407 gccgcccaacagcttcccaagctcctcgtcgttccggatcgccagaagcacgtggcgcgg 348

                                                                       
Query: 358 gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 417
            || ||||| ||||||||||| ||| |||| || || ||||||||||| || ||||| ||
Sbjct: 347 aataatgcgagtcttcttgttgtccctggcagcattaccggcgagctccagaacctcagc 288

                                                                       
Query: 418 ggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgctgggc 477
           ||||||||| |||||||| |||||||||||||| |||||||||| ||||||   ||| ||
Sbjct: 287 ggcgaggtattcgaggacagcggcgaggtagacgggggcgccggtgccgacrrnctgcgc 228

                                                                       
Query: 478 gtagcggcccttcttgaggtagcgcccgatgcggccgacggggaactggagaccggcctt 537
           ||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||
Sbjct: 227 gtagcggcccttcttcaagtagcgcccgatgcggccgacggggaactggagaccggcctt 168

                                      
Query: 538 cacggaccgggtcaccgccttcttcct 564
           ||||||||  | ||||| |||||||||
Sbjct: 167 cacggacctcgacaccgacttcttcct 141



to top

>gb|AY109370.1| Zea mays CL2029_4 mRNA sequence
          Length = 1051

 Score =  278 bits (140), Expect = 2e-71
 Identities = 279/327 (85%)
 Strand = Plus / Minus

                                                                       
Query: 238 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 297
           ||||||||| |||||||| | |||||| ||||||| ||| |||||||| |||||||| ||
Sbjct: 486 cttcttgggcagcagaacagggttgatattggggagcacaccgccgtgagcgatggtcac 427

                                                                       
Query: 298 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 357
           |||| | |||||| | || ||||||| |||||| ||||  || ||||||| |||||||||
Sbjct: 426 gccgcccagcagcttcccaagctcctcgtcgttccggatcgccagaagcacgtggcgcgg 367

                                                                       
Query: 358 gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 417
            || ||||| ||||||||||| ||| |||| || || || |||||||| || ||||| ||
Sbjct: 366 aataatgcgagtcttcttgttgtccctggcagcattaccagcgagctccagaacctcagc 307

                                                                       
Query: 418 ggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgctgggc 477
           ||||||||| |||||||| ||||||||||||||     |||||| |||||| ||||| ||
Sbjct: 306 ggcgaggtattcgaggacagcggcgaggtagacnnnnncgccggtgccgacacgctgcgc 247

                                                                       
Query: 478 gtagcggcccttcttgaggtagcgcccgatgcggccgacggggaactggagaccggcctt 537
           ||||||||||||||| | ||||||||||||||||||||||||||||||||| ||||||||
Sbjct: 246 gtagcggcccttcttcaagtagcgcccgatgcggccgacggggaactggagcccggcctt 187

                                      
Query: 538 cacggaccgggtcaccgccttcttcct 564
           ||||||||  | ||||| |||||||||
Sbjct: 186 cacggacctcgacaccgacttcttcct 160



to top

>gb|BT016301.1| Zea mays clone Contig134 mRNA sequence
          Length = 846

 Score =  240 bits (121), Expect = 5e-60
 Identities = 259/305 (84%)
 Strand = Plus / Minus

                                                                       
Query: 239 ttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgacg 298
           |||||||||||||| || | |||||||||||| |  || |||||||| ||||||||||||
Sbjct: 396 ttcttggggagcagcacagggttgatgttgggcagaaccccgccgtgtgcgatggtgacg 337

                                                                       
Query: 299 ccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcggg 358
           ||||| || ||| | |||||||||| |||||||||||  || || || | ||| ||||||
Sbjct: 336 ccggccagtagcttcccgagctcctcgtcgttgcggatcgccagcagtacgtgccgcggg 277

                                                                       
Query: 359 atgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgcg 418
           ||||| ||| |||||||||| |||   || ||||| || || | ||| || | ||| |||
Sbjct: 276 atgatccggttcttcttgttgtcccgcgctgcgttccccgccaactcgaggagctcggcg 217

                                                                       
Query: 419 gcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgctgggcg 478
           |||||||||||||||||||| ||||||||||| |||||||||| |||||| ||||||| |
Sbjct: 216 gcgaggtactcgaggacggcagcgaggtagacgggggcgccggtgccgacacgctgggag 157

                                                                       
Query: 479 tagcggcccttcttgaggtagcgcccgatgcggccgacggggaactggagaccggccttc 538
           ||||| |||| |||||||||||| ||||| ||||| |||||||||||||| |||||||||
Sbjct: 156 tagcgaccctgcttgaggtagcggccgatacggcctacggggaactggaggccggccttc 97

                
Query: 539 acgga 543
           |||||
Sbjct: 96  acgga 92



to top

>gb|AY104486.1| Zea mays PCO109435 mRNA sequence
          Length = 992

 Score =  232 bits (117), Expect = 1e-57
 Identities = 258/305 (84%)
 Strand = Plus / Minus

                                                                       
Query: 239 ttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgacg 298
           |||||||||||||| || | |||||||||||| |  || |||||||| ||||||||||||
Sbjct: 467 ttcttggggagcagcacagggttgatgttgggcagaaccccgccgtgtgcgatggtgacg 408

                                                                       
Query: 299 ccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcggg 358
           ||||| || ||| | ||||||||||  ||||||||||  || || || | ||| ||||||
Sbjct: 407 ccggccagtagcttcccgagctcctcatcgttgcggatcgccagcagtacgtgtcgcggg 348

                                                                       
Query: 359 atgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgcg 418
           ||||| ||| |||||||||| |||   || ||||| || || | ||| || | ||| |||
Sbjct: 347 atgatccggttcttcttgttgtcccgcgctgcgttccccgccaactcgaggagctcggcg 288

                                                                       
Query: 419 gcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgctgggcg 478
           |||||||||||||||||||| ||||||||||| |||||||||| |||||| ||||||| |
Sbjct: 287 gcgaggtactcgaggacggcagcgaggtagacgggggcgccggtgccgacacgctgggag 228

                                                                       
Query: 479 tagcggcccttcttgaggtagcgcccgatgcggccgacggggaactggagaccggccttc 538
           ||||| |||| |||||||||||| ||||| ||||| |||||||||||||| |||||||||
Sbjct: 227 tagcgaccctgcttgaggtagcggccgatacggcctacggggaactggaggccggccttc 168

                
Query: 539 acgga 543
           |||||
Sbjct: 167 acgga 163



to top

>ref|XM_475081.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 522

 Score =  230 bits (116), Expect = 5e-57
 Identities = 143/152 (94%)
 Strand = Plus / Minus

                                                                       
Query: 411 cctctgcggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgc 470
           |||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||
Sbjct: 217 cctctgcggcgaggtactcgaggacggcggcgaggtagacgggggcgccggtgccgacgc 158

                                                                       
Query: 471 gctgggcgtagcggcccttcttgaggtagcgcccgatgcggccgacggggaactggagac 530
           ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
Sbjct: 157 gctgggcgtagcggcccttcttgaggtagcggccgatgcggccgacggggaactggagcc 98

                                           
Query: 531 cggccttcacggaccgggtcaccgccttcttc 562
           ||||||| ||||| || | ||||| |||||||
Sbjct: 97  cggccttgacggagcgcgacaccggcttcttc 66



 Score =  127 bits (64), Expect = 5e-26
 Identities = 151/180 (83%)
 Strand = Plus / Minus

                                                                       
Query: 233 gcggacttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatg 292
           |||| |||||| |||||||| || | ||||||||| || | |||||||||||| ||||||
Sbjct: 446 gcggtcttcttcgggagcagcaccgggttgatgttcggcagcacgccgccgtgcgcgatg 387

                                                                       
Query: 293 gtgacgccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtgg 352
           ||||| |||||||||||| | |||||||||| |||||||||||  || || |||| ||| 
Sbjct: 386 gtgaccccggcgagcagcttcccgagctcctcgtcgttgcggatcgccagcagcacgtgc 327

                                                                       
Query: 353 cgcgggatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacc 412
           | ||||||||| ||| |||||||||| |||   || ||||| ||||||||||| ||||||
Sbjct: 326 ctcgggatgatccggttcttcttgttgtcccgcgccgcgttcccggcgagctccagcacc 267



to top

>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5,
              complete sequence
          Length = 29737217

 Score =  230 bits (116), Expect = 5e-57
 Identities = 143/152 (94%)
 Strand = Plus / Minus

                                                                          
Query: 411    cctctgcggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgc 470
              |||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||
Sbjct: 707152 cctctgcggcgaggtactcgaggacggcggcgaggtagacgggggcgccggtgccgacgc 707093

                                                                          
Query: 471    gctgggcgtagcggcccttcttgaggtagcgcccgatgcggccgacggggaactggagac 530
              ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
Sbjct: 707092 gctgggcgtagcggcccttcttgaggtagcggccgatgcggccgacggggaactggagcc 707033

                                              
Query: 531    cggccttcacggaccgggtcaccgccttcttc 562
              ||||||| ||||| || | ||||| |||||||
Sbjct: 707032 cggccttgacggagcgcgacaccggcttcttc 707001



 Score =  192 bits (97), Expect = 1e-45
 Identities = 139/153 (90%)
 Strand = Plus / Plus

                                                                            
Query: 410      acctctgcggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacg 469
                ||||| ||||||||||||||||||||||||||||||||||| |||||||||| ||||| |
Sbjct: 22512575 acctcggcggcgaggtactcgaggacggcggcgaggtagacgggggcgccggtgccgatg 22512634

                                                                            
Query: 470      cgctgggcgtagcggcccttcttgaggtagcgcccgatgcggccgacggggaactggaga 529
                ||||||| ||||||||| | |||||||||||| ||||| |||||||||||||||||||| 
Sbjct: 22512635 cgctgggagtagcggccttgcttgaggtagcggccgatacggccgacggggaactggagc 22512694

                                                 
Query: 530      ccggccttcacggaccgggtcaccgccttcttc 562
                |||||||| ||||| |||| ||||| |||||||
Sbjct: 22512695 ccggccttgacggagcgggacaccggcttcttc 22512727



 Score =  129 bits (65), Expect = 1e-26
 Identities = 122/141 (86%)
 Strand = Plus / Plus

                                                                            
Query: 238      cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 297
                ||||||||||||||| || | |||||||||||| | ||| |||||||| |||||||||||
Sbjct: 22512327 cttcttggggagcagcaccgggttgatgttgggcagcaccccgccgtgcgcgatggtgac 22512386

                                                                            
Query: 298      gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 357
                |||||| |||||| | |||||||||| |||||||||||  || || |||| ||| |||||
Sbjct: 22512387 gccggccagcagcttcccgagctcctcgtcgttgcggatcgccagcagcacgtgccgcgg 22512446

                                     
Query: 358      gatgatgcgggtcttcttgtt 378
                |||||| ||| ||||||||||
Sbjct: 22512447 gatgatccggttcttcttgtt 22512467



 Score =  129 bits (65), Expect = 1e-26
 Identities = 152/181 (83%)
 Strand = Plus / Minus

                                                                          
Query: 233    gcggacttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatg 292
              |||| |||||| |||||||| || | ||||||||| || | |||||||||||| ||||||
Sbjct: 707409 gcggtcttcttcgggagcagcaccgggttgatgttcggcagcacgccgccgtgcgcgatg 707350

                                                                          
Query: 293    gtgacgccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtgg 352
              ||||| |||||||||||| | |||||||||| |||||||||||  || || |||| ||| 
Sbjct: 707349 gtgaccccggcgagcagcttcccgagctcctcgtcgttgcggatcgccagcagcacgtgc 707290

                                                                          
Query: 353    cgcgggatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacc 412
              | ||||||||| ||| |||||||||| |||   || ||||| ||||||||||| ||||||
Sbjct: 707289 ctcgggatgatccggttcttcttgttgtcccgcgccgcgttcccggcgagctccagcacc 707230

               
Query: 413    t 413
              |
Sbjct: 707229 t 707229



 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 598     tgctgctgctccggcgacga 617
               ||||||||||||||||||||
Sbjct: 4167404 tgctgctgctccggcgacga 4167423



to top

>gb|AC093921.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone
             OSJNBb0041A22, complete sequence
          Length = 117919

 Score =  230 bits (116), Expect = 5e-57
 Identities = 143/152 (94%)
 Strand = Plus / Minus

                                                                         
Query: 411   cctctgcggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgc 470
             |||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||
Sbjct: 52351 cctctgcggcgaggtactcgaggacggcggcgaggtagacgggggcgccggtgccgacgc 52292

                                                                         
Query: 471   gctgggcgtagcggcccttcttgaggtagcgcccgatgcggccgacggggaactggagac 530
             ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
Sbjct: 52291 gctgggcgtagcggcccttcttgaggtagcggccgatgcggccgacggggaactggagcc 52232

                                             
Query: 531   cggccttcacggaccgggtcaccgccttcttc 562
             ||||||| ||||| || | ||||| |||||||
Sbjct: 52231 cggccttgacggagcgcgacaccggcttcttc 52200



 Score =  129 bits (65), Expect = 1e-26
 Identities = 152/181 (83%)
 Strand = Plus / Minus

                                                                         
Query: 233   gcggacttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatg 292
             |||| |||||| |||||||| || | ||||||||| || | |||||||||||| ||||||
Sbjct: 52608 gcggtcttcttcgggagcagcaccgggttgatgttcggcagcacgccgccgtgcgcgatg 52549

                                                                         
Query: 293   gtgacgccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtgg 352
             ||||| |||||||||||| | |||||||||| |||||||||||  || || |||| ||| 
Sbjct: 52548 gtgaccccggcgagcagcttcccgagctcctcgtcgttgcggatcgccagcagcacgtgc 52489

                                                                         
Query: 353   cgcgggatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacc 412
             | ||||||||| ||| |||||||||| |||   || ||||| ||||||||||| ||||||
Sbjct: 52488 ctcgggatgatccggttcttcttgttgtcccgcgccgcgttcccggcgagctccagcacc 52429

              
Query: 413   t 413
             |
Sbjct: 52428 t 52428



to top

>gb|BT017719.1| Zea mays clone EL01N0447A04.c mRNA sequence
          Length = 772

 Score =  224 bits (113), Expect = 3e-55
 Identities = 275/329 (83%)
 Strand = Plus / Minus

                                                                       
Query: 231 cggcggacttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcga 290
           |||||| |||||||||||| || |||| ||| |||||||| | ||| |||||||| ||||
Sbjct: 456 cggcggccttcttggggaggaggacggggttaatgttgggcagcacaccgccgtgcgcga 397

                                                                       
Query: 291 tggtgacgccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggt 350
           ||||||| ||  | |||||| |||||||||||| ||||||||||| |||||| || ||||
Sbjct: 396 tggtgaccccacccagcagcttgccgagctcctcgtcgttgcggatggcgaggaggaggt 337

                                                                       
Query: 351 ggcgcgggatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagca 410
           ||||||||||||||||||| |||||||| ||    || |||||||| || ||||| || |
Sbjct: 336 ggcgcgggatgatgcgggttttcttgttgtcgcgcgccgcgttgccagccagctccagga 277

                                                                       
Query: 411 cctctgcggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgc 470
           |||| |||||||||||||||||||||||||| ||| | || || ||||| | ||| ||||
Sbjct: 276 cctcagcggcgaggtactcgaggacggcggccaggaacacgggagcgcccgtgcccacgc 217

                                                                       
Query: 471 gctgggcgtagcggcccttcttgaggtagcgcccgatgcggccgacggggaactggagac 530
           |||| ||||| || || ||||| ||||| || ||||||||||| ||||||||  |||| |
Sbjct: 216 gctgcgcgtaccgccctttcttcaggtaccgtccgatgcggcccacggggaaaaggagcc 157

                                        
Query: 531 cggccttcacggaccgggtcaccgccttc 559
           ||||||| || ||||| | ||||| ||||
Sbjct: 156 cggccttaactgaccgcgacaccggcttc 128



to top

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score =  212 bits (107), Expect = 1e-51
 Identities = 143/155 (92%)
 Strand = Plus / Plus

                                                                           
Query: 410     acctctgcggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacg 469
               ||||| || |||||||||||||||||||||||||||||||| |||||||||| ||||| |
Sbjct: 9471496 acctcggcagcgaggtactcgaggacggcggcgaggtagacgggggcgccggtgccgatg 9471555

                                                                           
Query: 470     cgctgggcgtagcggcccttcttgaggtagcgcccgatgcggccgacggggaactggaga 529
               |||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||| 
Sbjct: 9471556 cgctgggcgtagcggcccttcttgaggtagcggccgatacggccgacggggaactggagc 9471615

                                                  
Query: 530     ccggccttcacggaccgggtcaccgccttcttcct 564
               |||||||| ||||| || | |||||||||||||||
Sbjct: 9471616 ccggccttgacggagcgcgacaccgccttcttcct 9471650



 Score =  135 bits (68), Expect = 2e-28
 Identities = 113/128 (88%)
 Strand = Plus / Minus

                                                                            
Query: 410      acctctgcggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacg 469
                ||||| ||||||||||||||||||||||||| ||||||||| |||||||||| |||||||
Sbjct: 28998067 acctcggcggcgaggtactcgaggacggcggagaggtagacgggggcgccggcgccgacg 28998008

                                                                            
Query: 470      cgctgggcgtagcggcccttcttgaggtagcgcccgatgcggccgacggggaactggaga 529
                ||||  |||||   |||   ||||||||||||  ||||||||||||||||||||||||| 
Sbjct: 28998007 cgctccgcgtacttgccggccttgaggtagcgggcgatgcggccgacggggaactggagc 28997948

                        
Query: 530      ccggcctt 537
                ||||||||
Sbjct: 28997947 ccggcctt 28997940



 Score =  135 bits (68), Expect = 2e-28
 Identities = 149/176 (84%)
 Strand = Plus / Plus

                                                                           
Query: 238     cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 297
               ||||||||| ||||| || | |||||||||||| | |||||| ||||| |||||||| ||
Sbjct: 9471223 cttcttgggcagcagcaccgggttgatgttgggcagcacgcctccgtgcgcgatggtcac 9471282

                                                                           
Query: 298     gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 357
               |||||| |||||| |||||||||||| |||||| | ||  || || |||| |||||||||
Sbjct: 9471283 gccggccagcagcttgccgagctcctcgtcgttcctgatcgccagcagcacgtggcgcgg 9471342

                                                                       
Query: 358     gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacct 413
               |||||| | | |||||||||| ||| |||| ||||| ||||||||||| |||||||
Sbjct: 9471343 gatgatcctgttcttcttgttgtccctggccgcgttcccggcgagctccagcacct 9471398



 Score =  105 bits (53), Expect = 2e-19
 Identities = 71/77 (92%)
 Strand = Plus / Minus

                                                                           
Query: 488     ttcttgaggtagcgcccgatgcggccgacggggaactggagaccggccttcacggaccgg 547
               |||||||||||||||||||| |||||||||||||| ||||| |||||||| ||||| || 
Sbjct: 2464021 ttcttgaggtagcgcccgatacggccgacggggaattggagcccggccttgacggagcgc 2463962

                                
Query: 548     gtcaccgccttcttcct 564
               |||||||||||||||||
Sbjct: 2463961 gtcaccgccttcttcct 2463945



 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 154      ggcgggggccttcttcttgg 173
                ||||||||||||||||||||
Sbjct: 30359281 ggcgggggccttcttcttgg 30359262



 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 154      ggcgggggccttcttcttgg 173
                ||||||||||||||||||||
Sbjct: 29416085 ggcgggggccttcttcttgg 29416066



 Score = 40.1 bits (20), Expect = 8.9
 Identities = 38/44 (86%)
 Strand = Plus / Minus

                                                           
Query: 389     gcgttgccggcgagctcaagcacctctgcggcgaggtactcgag 432
               ||||||||||| ||||| || ||||| ||||  |||||||||||
Sbjct: 3353557 gcgttgccggccagctccaggacctcggcggttaggtactcgag 3353514



to top

>gb|AC083942.8| Genomic sequence for Oryza sativa, Nipponbare strain, clone
              OSJNBa0002D01, from chromosome 3, complete sequence
          Length = 187589

 Score =  212 bits (107), Expect = 1e-51
 Identities = 143/155 (92%)
 Strand = Plus / Plus

                                                                          
Query: 410    acctctgcggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacg 469
              ||||| || |||||||||||||||||||||||||||||||| |||||||||| ||||| |
Sbjct: 168896 acctcggcagcgaggtactcgaggacggcggcgaggtagacgggggcgccggtgccgatg 168955

                                                                          
Query: 470    cgctgggcgtagcggcccttcttgaggtagcgcccgatgcggccgacggggaactggaga 529
              |||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||| 
Sbjct: 168956 cgctgggcgtagcggcccttcttgaggtagcggccgatacggccgacggggaactggagc 169015

                                                 
Query: 530    ccggccttcacggaccgggtcaccgccttcttcct 564
              |||||||| ||||| || | |||||||||||||||
Sbjct: 169016 ccggccttgacggagcgcgacaccgccttcttcct 169050



 Score =  135 bits (68), Expect = 2e-28
 Identities = 149/176 (84%)
 Strand = Plus / Plus

                                                                          
Query: 238    cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 297
              ||||||||| ||||| || | |||||||||||| | |||||| ||||| |||||||| ||
Sbjct: 168623 cttcttgggcagcagcaccgggttgatgttgggcagcacgcctccgtgcgcgatggtcac 168682

                                                                          
Query: 298    gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 357
              |||||| |||||| |||||||||||| |||||| | ||  || || |||| |||||||||
Sbjct: 168683 gccggccagcagcttgccgagctcctcgtcgttcctgatcgccagcagcacgtggcgcgg 168742

                                                                      
Query: 358    gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacct 413
              |||||| | | |||||||||| ||| |||| ||||| ||||||||||| |||||||
Sbjct: 168743 gatgatcctgttcttcttgttgtccctggccgcgttcccggcgagctccagcacct 168798



to top

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
               sequence
          Length = 36192742

 Score =  212 bits (107), Expect = 1e-51
 Identities = 143/155 (92%)
 Strand = Plus / Plus

                                                                           
Query: 410     acctctgcggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacg 469
               ||||| || |||||||||||||||||||||||||||||||| |||||||||| ||||| |
Sbjct: 9469617 acctcggcagcgaggtactcgaggacggcggcgaggtagacgggggcgccggtgccgatg 9469676

                                                                           
Query: 470     cgctgggcgtagcggcccttcttgaggtagcgcccgatgcggccgacggggaactggaga 529
               |||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||| 
Sbjct: 9469677 cgctgggcgtagcggcccttcttgaggtagcggccgatacggccgacggggaactggagc 9469736

                                                  
Query: 530     ccggccttcacggaccgggtcaccgccttcttcct 564
               |||||||| ||||| || | |||||||||||||||
Sbjct: 9469737 ccggccttgacggagcgcgacaccgccttcttcct 9469771



 Score =  135 bits (68), Expect = 2e-28
 Identities = 113/128 (88%)
 Strand = Plus / Minus

                                                                            
Query: 410      acctctgcggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacg 469
                ||||| ||||||||||||||||||||||||| ||||||||| |||||||||| |||||||
Sbjct: 29089489 acctcggcggcgaggtactcgaggacggcggagaggtagacgggggcgccggcgccgacg 29089430

                                                                            
Query: 470      cgctgggcgtagcggcccttcttgaggtagcgcccgatgcggccgacggggaactggaga 529
                ||||  |||||   |||   ||||||||||||  ||||||||||||||||||||||||| 
Sbjct: 29089429 cgctccgcgtacttgccggccttgaggtagcgggcgatgcggccgacggggaactggagc 29089370

                        
Query: 530      ccggcctt 537
                ||||||||
Sbjct: 29089369 ccggcctt 29089362



 Score =  135 bits (68), Expect = 2e-28
 Identities = 149/176 (84%)
 Strand = Plus / Plus

                                                                           
Query: 238     cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 297
               ||||||||| ||||| || | |||||||||||| | |||||| ||||| |||||||| ||
Sbjct: 9469344 cttcttgggcagcagcaccgggttgatgttgggcagcacgcctccgtgcgcgatggtcac 9469403

                                                                           
Query: 298     gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 357
               |||||| |||||| |||||||||||| |||||| | ||  || || |||| |||||||||
Sbjct: 9469404 gccggccagcagcttgccgagctcctcgtcgttcctgatcgccagcagcacgtggcgcgg 9469463

                                                                       
Query: 358     gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacct 413
               |||||| | | |||||||||| ||| |||| ||||| ||||||||||| |||||||
Sbjct: 9469464 gatgatcctgttcttcttgttgtccctggccgcgttcccggcgagctccagcacct 9469519



 Score =  105 bits (53), Expect = 2e-19
 Identities = 71/77 (92%)
 Strand = Plus / Minus

                                                                           
Query: 488     ttcttgaggtagcgcccgatgcggccgacggggaactggagaccggccttcacggaccgg 547
               |||||||||||||||||||| |||||||||||||| ||||| |||||||| ||||| || 
Sbjct: 2464131 ttcttgaggtagcgcccgatacggccgacggggaattggagcccggccttgacggagcgc 2464072

                                
Query: 548     gtcaccgccttcttcct 564
               |||||||||||||||||
Sbjct: 2464071 gtcaccgccttcttcct 2464055



 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 154      ggcgggggccttcttcttgg 173
                ||||||||||||||||||||
Sbjct: 30450703 ggcgggggccttcttcttgg 30450684



 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 154      ggcgggggccttcttcttgg 173
                ||||||||||||||||||||
Sbjct: 29507507 ggcgggggccttcttcttgg 29507488



 Score = 40.1 bits (20), Expect = 8.9
 Identities = 38/44 (86%)
 Strand = Plus / Minus

                                                           
Query: 389     gcgttgccggcgagctcaagcacctctgcggcgaggtactcgag 432
               ||||||||||| ||||| || ||||| ||||  |||||||||||
Sbjct: 3353668 gcgttgccggccagctccaggacctcggcggttaggtactcgag 3353625



to top

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score =  212 bits (107), Expect = 1e-51
 Identities = 143/155 (92%)
 Strand = Plus / Minus

                                                                            
Query: 410      acctctgcggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacg 469
                ||||| ||||||||||||||||||||||||||||||||||| |||||||||| ||||| |
Sbjct: 17416866 acctcggcggcgaggtactcgaggacggcggcgaggtagacgggggcgccggtgccgatg 17416807

                                                                            
Query: 470      cgctgggcgtagcggcccttcttgaggtagcgcccgatgcggccgacggggaactggaga 529
                ||||| |||||||||||||||||||||||||| ||||| |||||||||||||||||||| 
Sbjct: 17416806 cgctgcgcgtagcggcccttcttgaggtagcggccgatacggccgacggggaactggagc 17416747

                                                   
Query: 530      ccggccttcacggaccgggtcaccgccttcttcct 564
                |||||||| ||||| || | |||||||||||||||
Sbjct: 17416746 ccggccttgacggagcgcgacaccgccttcttcct 17416712



 Score =  135 bits (68), Expect = 2e-28
 Identities = 149/176 (84%)
 Strand = Plus / Minus

                                                                            
Query: 238      cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 297
                ||||||||| ||||| || | |||||||||||| | |||||| ||||| |||||||| ||
Sbjct: 17417149 cttcttgggcagcagcaccgggttgatgttgggcagcacgcctccgtgcgcgatggtcac 17417090

                                                                            
Query: 298      gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 357
                |||||| |||||| |||||||||||| |||||| | ||  || || |||| |||||||||
Sbjct: 17417089 gccggccagcagcttgccgagctcctcgtcgttcctgatcgccagcagcacgtggcgcgg 17417030

                                                                        
Query: 358      gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacct 413
                |||||| | | |||||||||| ||| |||| ||||| ||||||||||| |||||||
Sbjct: 17417029 gatgatcctgttcttcttgttgtccctggccgcgttcccggcgagctccagcacct 17416974



 Score = 42.1 bits (21), Expect = 2.3
 Identities = 41/47 (87%), Gaps = 3/47 (6%)
 Strand = Plus / Minus

                                                               
Query: 166      cttcttgggggactt---ggtggcggccttcttcttgggcgacttgg 209
                |||||||||||||||   ||||||||  |||||||| ||||||||||
Sbjct: 43063463 cttcttgggggacttggcggtggcggggttcttctttggcgacttgg 43063417



 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                     
Query: 286      ggcgatggtgacgccggcgag 306
                |||||||||||||||||||||
Sbjct: 23243788 ggcgatggtgacgccggcgag 23243768



 Score = 40.1 bits (20), Expect = 8.9
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                                    
Query: 259      gttgatgttggggatcacgccgccgtgggcgatggt 294
                |||||||||||| | ||| ||||| |||||||||||
Sbjct: 43063370 gttgatgttgggcagcactccgccatgggcgatggt 43063335



to top

>dbj|AP003144.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0507H06
          Length = 136351

 Score =  212 bits (107), Expect = 1e-51
 Identities = 143/155 (92%)
 Strand = Plus / Minus

                                                                         
Query: 410   acctctgcggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacg 469
             ||||| ||||||||||||||||||||||||||||||||||| |||||||||| ||||| |
Sbjct: 70258 acctcggcggcgaggtactcgaggacggcggcgaggtagacgggggcgccggtgccgatg 70199

                                                                         
Query: 470   cgctgggcgtagcggcccttcttgaggtagcgcccgatgcggccgacggggaactggaga 529
             ||||| |||||||||||||||||||||||||| ||||| |||||||||||||||||||| 
Sbjct: 70198 cgctgcgcgtagcggcccttcttgaggtagcggccgatacggccgacggggaactggagc 70139

                                                
Query: 530   ccggccttcacggaccgggtcaccgccttcttcct 564
             |||||||| ||||| || | |||||||||||||||
Sbjct: 70138 ccggccttgacggagcgcgacaccgccttcttcct 70104



 Score =  135 bits (68), Expect = 2e-28
 Identities = 149/176 (84%)
 Strand = Plus / Minus

                                                                         
Query: 238   cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 297
             ||||||||| ||||| || | |||||||||||| | |||||| ||||| |||||||| ||
Sbjct: 70541 cttcttgggcagcagcaccgggttgatgttgggcagcacgcctccgtgcgcgatggtcac 70482

                                                                         
Query: 298   gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 357
             |||||| |||||| |||||||||||| |||||| | ||  || || |||| |||||||||
Sbjct: 70481 gccggccagcagcttgccgagctcctcgtcgttcctgatcgccagcagcacgtggcgcgg 70422

                                                                     
Query: 358   gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacct 413
             |||||| | | |||||||||| ||| |||| ||||| ||||||||||| |||||||
Sbjct: 70421 gatgatcctgttcttcttgttgtccctggccgcgttcccggcgagctccagcacct 70366



to top

>ref|XM_478632.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 823

 Score =  196 bits (99), Expect = 6e-47
 Identities = 189/219 (86%)
 Strand = Plus / Minus

                                                                       
Query: 262 gatgttggggatcacgccgccgtgggcgatggtgacgccggcgagcagcctgccgagctc 321
           ||||||||| ||||||||||||  |||||||||| ||||| |||||||| ||   | |||
Sbjct: 488 gatgttgggcatcacgccgccgctggcgatggtggcgccgccgagcagcttggtcaactc 429

                                                                       
Query: 322 ctggtcgttgcggacggcgagaagcaggtggcgcgggatgatgcgggtcttcttgttatc 381
           || ||||||||| || |||||  | | ||||||||| | |||||||||||||||||| ||
Sbjct: 428 ctcgtcgttgcgcaccgcgagctggatgtggcgcggcacgatgcgggtcttcttgttgtc 369

                                                                       
Query: 382 cttggcggcgttgccggcgagctcaagcacctctgcggcgaggtactcgaggacggcggc 441
           | | || ||||| ||||||||||| |||||||| ||||||||||||||||||||||||||
Sbjct: 368 cctcgccgcgttcccggcgagctcgagcacctcagcggcgaggtactcgaggacggcggc 309

                                                  
Query: 442 gaggtagacaggggcgccggagccgacgcgctgggcgta 480
           ||||||||| ||||| |||| ||||||||||| ||||||
Sbjct: 308 gaggtagacgggggccccggcgccgacgcgctcggcgta 270



to top

>dbj|AK099888.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013112I10, full
           insert sequence
          Length = 823

 Score =  196 bits (99), Expect = 6e-47
 Identities = 189/219 (86%)
 Strand = Plus / Minus

                                                                       
Query: 262 gatgttggggatcacgccgccgtgggcgatggtgacgccggcgagcagcctgccgagctc 321
           ||||||||| ||||||||||||  |||||||||| ||||| |||||||| ||   | |||
Sbjct: 488 gatgttgggcatcacgccgccgctggcgatggtggcgccgccgagcagcttggtcaactc 429

                                                                       
Query: 322 ctggtcgttgcggacggcgagaagcaggtggcgcgggatgatgcgggtcttcttgttatc 381
           || ||||||||| || |||||  | | ||||||||| | |||||||||||||||||| ||
Sbjct: 428 ctcgtcgttgcgcaccgcgagctggatgtggcgcggcacgatgcgggtcttcttgttgtc 369

                                                                       
Query: 382 cttggcggcgttgccggcgagctcaagcacctctgcggcgaggtactcgaggacggcggc 441
           | | || ||||| ||||||||||| |||||||| ||||||||||||||||||||||||||
Sbjct: 368 cctcgccgcgttcccggcgagctcgagcacctcagcggcgaggtactcgaggacggcggc 309

                                                  
Query: 442 gaggtagacaggggcgccggagccgacgcgctgggcgta 480
           ||||||||| ||||| |||| ||||||||||| ||||||
Sbjct: 308 gaggtagacgggggccccggcgccgacgcgctcggcgta 270



to top

>dbj|AK071511.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023096P04, full
           insert sequence
          Length = 824

 Score =  196 bits (99), Expect = 6e-47
 Identities = 189/219 (86%)
 Strand = Plus / Minus

                                                                       
Query: 262 gatgttggggatcacgccgccgtgggcgatggtgacgccggcgagcagcctgccgagctc 321
           ||||||||| || |||||||||  |||||||||| ||||| |||||||| ||  ||||||
Sbjct: 454 gatgttgggcatgacgccgccgctggcgatggtggcgccgccgagcagcttggtgagctc 395

                                                                       
Query: 322 ctggtcgttgcggacggcgagaagcaggtggcgcgggatgatgcgggtcttcttgttatc 381
           || ||||||||| || |||||  | | ||||||||| |  ||||||||||||||||| ||
Sbjct: 394 ctcgtcgttgcgcaccgcgagctggatgtggcgcggcacaatgcgggtcttcttgttgtc 335

                                                                       
Query: 382 cttggcggcgttgccggcgagctcaagcacctctgcggcgaggtactcgaggacggcggc 441
           | | || ||||| ||||||||||| |||||||| ||||||||||||||||||||||||||
Sbjct: 334 cctcgccgcgttcccggcgagctccagcacctcggcggcgaggtactcgaggacggcggc 275

                                                  
Query: 442 gaggtagacaggggcgccggagccgacgcgctgggcgta 480
           ||||||||| || ||||||| ||||||||||| ||||||
Sbjct: 274 gaggtagacgggagcgccggcgccgacgcgctcggcgta 236



to top

>dbj|AK058913.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-009-A01, full
           insert sequence
          Length = 733

 Score =  196 bits (99), Expect = 6e-47
 Identities = 189/219 (86%)
 Strand = Plus / Minus

                                                                       
Query: 262 gatgttggggatcacgccgccgtgggcgatggtgacgccggcgagcagcctgccgagctc 321
           ||||||||| || |||||||||  |||||||||| ||||| |||||||| ||  ||||||
Sbjct: 453 gatgttgggcatgacgccgccgctggcgatggtggcgccgccgagcagcttggtgagctc 394

                                                                       
Query: 322 ctggtcgttgcggacggcgagaagcaggtggcgcgggatgatgcgggtcttcttgttatc 381
           || ||||||||| || |||||  | | ||||||||| |  ||||||||||||||||| ||
Sbjct: 393 ctcgtcgttgcgcaccgcgagctggatgtggcgcggcacaatgcgggtcttcttgttgtc 334

                                                                       
Query: 382 cttggcggcgttgccggcgagctcaagcacctctgcggcgaggtactcgaggacggcggc 441
           | | || ||||| ||||||||||| |||||||| ||||||||||||||||||||||||||
Sbjct: 333 cctcgccgcgttcccggcgagctccagcacctcggcggcgaggtactcgaggacggcggc 274

                                                  
Query: 442 gaggtagacaggggcgccggagccgacgcgctgggcgta 480
           ||||||||| || ||||||| ||||||||||| ||||||
Sbjct: 273 gaggtagacgggagcgccggcgccgacgcgctcggcgta 235



to top

>dbj|AK058540.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-017-B06, full
           insert sequence
          Length = 1718

 Score =  196 bits (99), Expect = 6e-47
 Identities = 189/219 (86%)
 Strand = Plus / Minus

                                                                       
Query: 262 gatgttggggatcacgccgccgtgggcgatggtgacgccggcgagcagcctgccgagctc 321
           ||||||||| ||||||||||||  |||||||||| ||||| |||||||| ||   | |||
Sbjct: 489 gatgttgggcatcacgccgccgctggcgatggtggcgccgccgagcagcttggtcaactc 430

                                                                       
Query: 322 ctggtcgttgcggacggcgagaagcaggtggcgcgggatgatgcgggtcttcttgttatc 381
           || ||||||||| || |||||  | | ||||||||| | |||||||||||||||||| ||
Sbjct: 429 ctcgtcgttgcgcaccgcgagctggatgtggcgcggcacgatgcgggtcttcttgttgtc 370

                                                                       
Query: 382 cttggcggcgttgccggcgagctcaagcacctctgcggcgaggtactcgaggacggcggc 441
           | | || ||||| ||||||||||| |||||||| ||||||||||||||||||||||||||
Sbjct: 369 cctcgccgcgttcccggcgagctcgagcacctcagcggcgaggtactcgaggacggcggc 310

                                                  
Query: 442 gaggtagacaggggcgccggagccgacgcgctgggcgta 480
           ||||||||| ||||| |||| ||||||||||| ||||||
Sbjct: 309 gaggtagacgggggccccggcgccgacgcgctcggcgta 271



to top

>gb|AC108876.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1525_A02,
            complete sequence
          Length = 93826

 Score =  192 bits (97), Expect = 1e-45
 Identities = 139/153 (90%)
 Strand = Plus / Plus

                                                                        
Query: 410  acctctgcggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacg 469
            ||||| ||||||||||||||||||||||||||||||||||| |||||||||| ||||| |
Sbjct: 7625 acctcggcggcgaggtactcgaggacggcggcgaggtagacgggggcgccggtgccgatg 7684

                                                                        
Query: 470  cgctgggcgtagcggcccttcttgaggtagcgcccgatgcggccgacggggaactggaga 529
            ||||||| ||||||||| | |||||||||||| ||||| |||||||||||||||||||| 
Sbjct: 7685 cgctgggagtagcggccttgcttgaggtagcggccgatacggccgacggggaactggagc 7744

                                             
Query: 530  ccggccttcacggaccgggtcaccgccttcttc 562
            |||||||| ||||| |||| ||||| |||||||
Sbjct: 7745 ccggccttgacggagcgggacaccggcttcttc 7777



 Score =  129 bits (65), Expect = 1e-26
 Identities = 122/141 (86%)
 Strand = Plus / Plus

                                                                        
Query: 238  cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 297
            ||||||||||||||| || | |||||||||||| | ||| |||||||| |||||||||||
Sbjct: 7377 cttcttggggagcagcaccgggttgatgttgggcagcaccccgccgtgcgcgatggtgac 7436

                                                                        
Query: 298  gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 357
            |||||| |||||| | |||||||||| |||||||||||  || || |||| ||| |||||
Sbjct: 7437 gccggccagcagcttcccgagctcctcgtcgttgcggatcgccagcagcacgtgccgcgg 7496

                                 
Query: 358  gatgatgcgggtcttcttgtt 378
            |||||| ||| ||||||||||
Sbjct: 7497 gatgatccggttcttcttgtt 7517



to top

>gb|AC117265.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1281_H05,
              complete sequence
          Length = 163130

 Score =  192 bits (97), Expect = 1e-45
 Identities = 139/153 (90%)
 Strand = Plus / Plus

                                                                          
Query: 410    acctctgcggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacg 469
              ||||| ||||||||||||||||||||||||||||||||||| |||||||||| ||||| |
Sbjct: 101982 acctcggcggcgaggtactcgaggacggcggcgaggtagacgggggcgccggtgccgatg 102041

                                                                          
Query: 470    cgctgggcgtagcggcccttcttgaggtagcgcccgatgcggccgacggggaactggaga 529
              ||||||| ||||||||| | |||||||||||| ||||| |||||||||||||||||||| 
Sbjct: 102042 cgctgggagtagcggccttgcttgaggtagcggccgatacggccgacggggaactggagc 102101

                                               
Query: 530    ccggccttcacggaccgggtcaccgccttcttc 562
              |||||||| ||||| |||| ||||| |||||||
Sbjct: 102102 ccggccttgacggagcgggacaccggcttcttc 102134



 Score =  129 bits (65), Expect = 1e-26
 Identities = 122/141 (86%)
 Strand = Plus / Plus

                                                                          
Query: 238    cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 297
              ||||||||||||||| || | |||||||||||| | ||| |||||||| |||||||||||
Sbjct: 101734 cttcttggggagcagcaccgggttgatgttgggcagcaccccgccgtgcgcgatggtgac 101793

                                                                          
Query: 298    gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 357
              |||||| |||||| | |||||||||| |||||||||||  || || |||| ||| |||||
Sbjct: 101794 gccggccagcagcttcccgagctcctcgtcgttgcggatcgccagcagcacgtgccgcgg 101853

                                   
Query: 358    gatgatgcgggtcttcttgtt 378
              |||||| ||| ||||||||||
Sbjct: 101854 gatgatccggttcttcttgtt 101874



to top

>ref|XM_482492.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 405

 Score =  182 bits (92), Expect = 1e-42
 Identities = 230/276 (83%)
 Strand = Plus / Minus

                                                                       
Query: 262 gatgttggggatcacgccgccgtgggcgatggtgacgccggcgagcagcctgccgagctc 321
           ||||||||| || |||||||||| ||||||||||||| || ||||||| |     |||||
Sbjct: 339 gatgttgggcatgacgccgccgttggcgatggtgacggcgccgagcaggcgcgacagctc 280

                                                                       
Query: 322 ctggtcgttgcggacggcgagaagcaggtggcgcgggatgatgcgggtcttcttgttatc 381
           || ||||||||| ||||||||  | | ||| | ||| | ||| || ||||||||||| ||
Sbjct: 279 ctcgtcgttgcgcacggcgagctggatgtgcctcggcacgatccgcgtcttcttgttgtc 220

                                                                       
Query: 382 cttggcggcgttgccggcgagctcaagcacctctgcggcgaggtactcgaggacggcggc 441
           |   || ||||| |||||||||||||| ||||| ||||||||||||||||||||||||||
Sbjct: 219 ccgcgccgcgttcccggcgagctcaagaacctcggcggcgaggtactcgaggacggcggc 160

                                                                       
Query: 442 gaggtagacaggggcgccggagccgacgcgctgggcgtagcggcccttcttgaggtagcg 501
           ||||||||| |||||||||| ||||||||||| ||||||   |||   ||||||| ||||
Sbjct: 159 gaggtagacgggggcgccggcgccgacgcgctcggcgtacttgccggccttgaggaagcg 100

                                               
Query: 502 cccgatgcggccgacggggaactggagaccggcctt 537
             |||| | |||||||||||||||||| ||||||||
Sbjct: 99  ggcgatcctgccgacggggaactggagcccggcctt 64



to top

>dbj|AK121752.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033087P07, full
           insert sequence
          Length = 747

 Score =  182 bits (92), Expect = 1e-42
 Identities = 230/276 (83%)
 Strand = Plus / Minus

                                                                       
Query: 262 gatgttggggatcacgccgccgtgggcgatggtgacgccggcgagcagcctgccgagctc 321
           ||||||||| | ||||||||||  ||||||||||||| || ||||||||||||  |||||
Sbjct: 455 gatgttgggcagcacgccgccggcggcgatggtgacggcgccgagcagcctgctcagctc 396

                                                                       
Query: 322 ctggtcgttgcggacggcgagaagcaggtggcgcgggatgatgcgggtcttcttgttatc 381
           || ||||||||| || || ||  | | ||| | ||| | ||| ||| |||||||||| ||
Sbjct: 395 ctcgtcgttgcgcaccgccagctggatgtgcctcggcacgatccggttcttcttgttgtc 336

                                                                       
Query: 382 cttggcggcgttgccggcgagctcaagcacctctgcggcgaggtactcgaggacggcggc 441
           | | || ||||| || || ||||| |||||||| ||||||||||||||||||||||||| 
Sbjct: 335 cctcgccgcgttccccgccagctccagcacctcggcggcgaggtactcgaggacggcgga 276

                                                                       
Query: 442 gaggtagacaggggcgccggagccgacgcgctgggcgtagcggcccttcttgaggtagcg 501
           ||||||||| |||||||||| ||||||||||| ||||||   |||   ||||||||| | 
Sbjct: 275 gaggtagacgggggcgccggcgccgacgcgctcggcgtacttgccggccttgaggtacct 216

                                               
Query: 502 cccgatgcggccgacggggaactggagaccggcctt 537
             ||||||||||||||||||||||||| ||||||||
Sbjct: 215 ggcgatgcggccgacggggaactggaggccggcctt 180



to top

>dbj|AK064299.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-107-A07, full
           insert sequence
          Length = 724

 Score =  176 bits (89), Expect = 6e-41
 Identities = 230/277 (83%)
 Strand = Plus / Minus

                                                                       
Query: 262 gatgttggggatcacgccgccgtgggcgatggtgacgccggcgagcagcctgccgagctc 321
           ||||||||| | ||||||||||  |||||| ||||||  | | ||||||||||  |||||
Sbjct: 452 gatgttgggcagcacgccgccggcggcgatcgtgacggtgcccagcagcctgctcagctc 393

                                                                       
Query: 322 ctggtcgttgcggacggcgagaagcaggtggcgcgggatgatgcgggtcttcttgttatc 381
           || ||||||||| || || ||  | | ||| ||||| | ||| | | |||||||||| ||
Sbjct: 392 ctcgtcgttgcgcaccgccagctggatgtgccgcggcacgatcctgttcttcttgttgtc 333

                                                                       
Query: 382 cttggcggcgttgccggcgagctcaagcacctctgcggcgaggtactcgaggacggcggc 441
           | | || ||||| ||||| ||||| |||||||| ||||||||||||||||||||||||| 
Sbjct: 332 cctcgccgcgttcccggccagctccagcacctcggcggcgaggtactcgaggacggcgga 273

                                                                       
Query: 442 gaggtagacaggggcgccggagccgacgcgctgggcgtagcggcccttcttgaggtagcg 501
           ||||||||| |||||||||| |||||||||||  |||||   |||   ||||||||||||
Sbjct: 272 gaggtagacgggggcgccggcgccgacgcgctccgcgtacttgccggccttgaggtagcg 213

                                                
Query: 502 cccgatgcggccgacggggaactggagaccggccttc 538
             ||||||||||||||||||||||||| |||||||||
Sbjct: 212 ggcgatgcggccgacggggaactggagcccggccttc 176



to top

>ref|XM_478633.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 830

 Score =  159 bits (80), Expect = 1e-35
 Identities = 134/152 (88%)
 Strand = Plus / Minus

                                                                       
Query: 317 agctcctggtcgttgcggacggcgagaagcaggtggcgcgggatgatgcgggtcttcttg 376
           ||||||| ||||||||||||||||||  | | |||||| || |  |||||||||||||||
Sbjct: 439 agctcctcgtcgttgcggacggcgagctggatgtggcggggcactatgcgggtcttcttg 380

                                                                       
Query: 377 ttatccttggcggcgttgccggcgagctcaagcacctctgcggcgaggtactcgaggacg 436
           || ||| | || ||||| |||||||||||||| ||||| |||||||||||||||||||||
Sbjct: 379 ttgtccctcgccgcgttcccggcgagctcaagaacctcagcggcgaggtactcgaggacg 320

                                           
Query: 437 gcggcgaggtagacaggggcgccggagccgac 468
           |||||||||||||| |||||||||| ||||||
Sbjct: 319 gcggcgaggtagaccggggcgccggcgccgac 288



to top

>dbj|AK059228.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-024-D11, full
           insert sequence
          Length = 830

 Score =  159 bits (80), Expect = 1e-35
 Identities = 134/152 (88%)
 Strand = Plus / Minus

                                                                       
Query: 317 agctcctggtcgttgcggacggcgagaagcaggtggcgcgggatgatgcgggtcttcttg 376
           ||||||| ||||||||||||||||||  | | |||||| || |  |||||||||||||||
Sbjct: 439 agctcctcgtcgttgcggacggcgagctggatgtggcggggcactatgcgggtcttcttg 380

                                                                       
Query: 377 ttatccttggcggcgttgccggcgagctcaagcacctctgcggcgaggtactcgaggacg 436
           || ||| | || ||||| |||||||||||||| ||||| |||||||||||||||||||||
Sbjct: 379 ttgtccctcgccgcgttcccggcgagctcaagaacctcagcggcgaggtactcgaggacg 320

                                           
Query: 437 gcggcgaggtagacaggggcgccggagccgac 468
           |||||||||||||| |||||||||| ||||||
Sbjct: 319 gcggcgaggtagaccggggcgccggcgccgac 288



to top

>dbj|D38089.1|WHTPH2AC Triticum aestivum mRNA for protein H2A, complete cds, clone wcH2A-4
          Length = 725

 Score =  159 bits (80), Expect = 1e-35
 Identities = 245/300 (81%)
 Strand = Plus / Minus

                                                                       
Query: 238 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 297
           ||||||||||||||||| |  || ||||||||| || || ||||||  |||||| |||||
Sbjct: 445 cttcttggggagcagaaggttgtggatgttgggcatgacaccgccgctggcgattgtgac 386

                                                                       
Query: 298 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 357
              | ||||||| | |  |||||||| ||||||||||||||||||  | | |||||||||
Sbjct: 385 catgccgagcaggcgggagagctcctcgtcgttgcggacggcgagctggatgtggcgcgg 326

                                                                       
Query: 358 gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 417
            | |||||||||||||||||| ||| | || ||||| ||||| | ||| || ||||| ||
Sbjct: 325 cacgatgcgggtcttcttgttgtccctcgccgcgttcccggccaactccagaacctcagc 266

                                                                       
Query: 418 ggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgctgggc 477
           |||||| ||||| || ||||||||||||||||| |||||||||| |||||| | || |||
Sbjct: 265 ggcgagatactccagcacggcggcgaggtagacgggggcgccggcgccgaccctctcggc 206

                                                                       
Query: 478 gtagcggcccttcttgaggtagcgcccgatgcggccgacggggaactggagaccggcctt 537
           |||   |||   ||||||| | ||| |||| | |||||||||||||||||| ||||||||
Sbjct: 205 gtacttgccggccttgaggaaccgcgcgatcctgccgacggggaactggagcccggcctt 146



to top

>dbj|D38091.1|WHTPH2AE Triticum aestivum mRNA for protein H2A, complete cds, clone
           wcH2A-10
          Length = 691

 Score =  147 bits (74), Expect = 5e-32
 Identities = 185/222 (83%)
 Strand = Plus / Minus

                                                                       
Query: 316 gagctcctggtcgttgcggacggcgagaagcaggtggcgcgggatgatgcgggtcttctt 375
           |||||||| ||||||||||||||||||  | | ||||||||| | |||||||||||||||
Sbjct: 369 gagctcctcgtcgttgcggacggcgagctggatgtggcgcggcacgatgcgggtcttctt 310

                                                                       
Query: 376 gttatccttggcggcgttgccggcgagctcaagcacctctgcggcgaggtactcgaggac 435
           ||| ||| | || ||||| ||||| | ||| || ||||| |||||||| ||||| || ||
Sbjct: 309 gttgtccctcgccgcgttcccggccaactccagaacctcagcggcgagatactccagcac 250

                                                                       
Query: 436 ggcggcgaggtagacaggggcgccggagccgacgcgctgggcgtagcggcccttcttgag 495
           ||||||||||||||| |||||||||| |||||| | || ||||||   |||   ||||||
Sbjct: 249 ggcggcgaggtagacgggggcgccggcgccgaccctctcggcgtacttgccggccttgag 190

                                                     
Query: 496 gtagcgcccgatgcggccgacggggaactggagaccggcctt 537
           | | ||| |||| | |||||||||||||||||| ||||||||
Sbjct: 189 gaaccgcgcgatcctgccgacggggaactggagcccggcctt 148



to top

>gb|AY104826.1| Zea mays PCO099353 mRNA sequence
          Length = 793

 Score =  143 bits (72), Expect = 8e-31
 Identities = 141/164 (85%)
 Strand = Plus / Minus

                                                                       
Query: 317 agctcctggtcgttgcggacggcgagaagcaggtggcgcgggatgatgcgggtcttcttg 376
           ||||||| ||||||||| ||||||||  | | ||| ||||| | ||||||||||||||||
Sbjct: 383 agctcctcgtcgttgcgcacggcgagctggatgtgacgcggcacgatgcgggtcttcttg 324

                                                                       
Query: 377 ttatccttggcggcgttgccggcgagctcaagcacctctgcggcgaggtactcgaggacg 436
           |||||| | || ||||| || || ||||| || ||||| |||||||||||||||||||| 
Sbjct: 323 ttatccctcgctgcgttcccagcaagctccaggacctcagcggcgaggtactcgaggaca 264

                                                       
Query: 437 gcggcgaggtagacaggggcgccggagccgacgcgctgggcgta 480
           || |||||||||||||||||||||| ||| ||||||| ||||||
Sbjct: 263 gctgcgaggtagacaggggcgccggcgcccacgcgctcggcgta 220



to top

>emb|CR700361.2|CNS0G3CL Tetraodon nigroviridis full-length cDNA
          Length = 547

 Score =  137 bits (69), Expect = 5e-29
 Identities = 189/229 (82%)
 Strand = Plus / Minus

                                                                       
Query: 262 gatgttggggatcacgccgccgtgggcgatggtgacgccggcgagcagcctgccgagctc 321
           ||||||||| | ||||||||| ||||||||||| || ||| | |||||| ||   |||||
Sbjct: 365 gatgttgggcagcacgccgccctgggcgatggtcactccgcccagcagcttgttcagctc 306

                                                                       
Query: 322 ctggtcgttgcggacggcgagaagcaggtggcgcgggatgatgcgggtcttcttgttatc 381
           || ||||||||| ||||| ||  ||||||| ||||||||||| | |||||||||||| ||
Sbjct: 305 ctcgtcgttgcgcacggccagctgcaggtgccgcgggatgatcctggtcttcttgttgtc 246

                                                                       
Query: 382 cttggcggcgttgccggcgagctcaagcacctctgcggcgaggtactcgaggacggcggc 441
              ||||||||| ||||| ||||| || | ||| ||||  |||||||| || ||||| ||
Sbjct: 245 gcgggcggcgttcccggccagctccaggatctcagcggtcaggtactccagcacggccgc 186

                                                            
Query: 442 gaggtagacaggggcgccggagccgacgcgctgggcgtagcggcccttc 490
            |||||||| |||||||||| |||||| ||||||||||||  |||||||
Sbjct: 185 caggtagaccggggcgccggcgccgacacgctgggcgtagttgcccttc 137



to top

>gb|AF377946.3| Oryza sativa (japonica cultivar-group) chromosome 3, BAC clone
             OSJNBa0031O09, complete sequence
          Length = 161339

 Score =  135 bits (68), Expect = 2e-28
 Identities = 113/128 (88%)
 Strand = Plus / Minus

                                                                         
Query: 410   acctctgcggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacg 469
             ||||| ||||||||||||||||||||||||| ||||||||| |||||||||| |||||||
Sbjct: 38208 acctcggcggcgaggtactcgaggacggcggagaggtagacgggggcgccggcgccgacg 38149

                                                                         
Query: 470   cgctgggcgtagcggcccttcttgaggtagcgcccgatgcggccgacggggaactggaga 529
             ||||  |||||   |||   ||||||||||||  ||||||||||||||||||||||||| 
Sbjct: 38148 cgctccgcgtacttgccggccttgaggtagcgggcgatgcggccgacggggaactggagc 38089

                     
Query: 530   ccggcctt 537
             ||||||||
Sbjct: 38088 ccggcctt 38081



to top

>gb|AC146936.4| Oryza sativa (japonica cultivar-group) chromosome 3 clone B1154F06 map
              near C10769, complete sequence
          Length = 194856

 Score =  135 bits (68), Expect = 2e-28
 Identities = 113/128 (88%)
 Strand = Plus / Plus

                                                                          
Query: 410    acctctgcggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacg 469
              ||||| ||||||||||||||||||||||||| ||||||||| |||||||||| |||||||
Sbjct: 141224 acctcggcggcgaggtactcgaggacggcggagaggtagacgggggcgccggcgccgacg 141283

                                                                          
Query: 470    cgctgggcgtagcggcccttcttgaggtagcgcccgatgcggccgacggggaactggaga 529
              ||||  |||||   |||   ||||||||||||  ||||||||||||||||||||||||| 
Sbjct: 141284 cgctccgcgtacttgccggccttgaggtagcgggcgatgcggccgacggggaactggagc 141343

                      
Query: 530    ccggcctt 537
              ||||||||
Sbjct: 141344 ccggcctt 141351



to top

>gb|AC147426.2| Oryza sativa chromosome 3  B1377B10 genomic sequence, complete sequence
          Length = 184366

 Score =  135 bits (68), Expect = 2e-28
 Identities = 113/128 (88%)
 Strand = Plus / Minus

                                                                          
Query: 410    acctctgcggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacg 469
              ||||| ||||||||||||||||||||||||| ||||||||| |||||||||| |||||||
Sbjct: 181362 acctcggcggcgaggtactcgaggacggcggagaggtagacgggggcgccggcgccgacg 181303

                                                                          
Query: 470    cgctgggcgtagcggcccttcttgaggtagcgcccgatgcggccgacggggaactggaga 529
              ||||  |||||   |||   ||||||||||||  ||||||||||||||||||||||||| 
Sbjct: 181302 cgctccgcgtacttgccggccttgaggtagcgggcgatgcggccgacggggaactggagc 181243

                      
Query: 530    ccggcctt 537
              ||||||||
Sbjct: 181242 ccggcctt 181235



to top

>gb|AF255739.1|AF255739 Bufo bufo gagarizans replication-dependent histone H2A gene, complete
            cds
          Length = 2120

 Score =  135 bits (68), Expect = 2e-28
 Identities = 200/244 (81%)
 Strand = Plus / Minus

                                                                        
Query: 238  cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 297
            ||||||||| ||||| ||||  | ||||||||| |  ||||| || ||||||||||||||
Sbjct: 1165 cttcttgggcagcagcacggcctggatgttgggcaggacgcctccctgggcgatggtgac 1106

                                                                        
Query: 298  gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 357
            |||| | |||||| ||  |||||||| ||||||||| ||||| ||  ||||||| || ||
Sbjct: 1105 gccgcccagcagcttgttgagctcctcgtcgttgcgcacggccagctgcaggtgacgggg 1046

                                                                        
Query: 358  gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 417
            ||||||||||||||||||||| ||   |||||| |||||||| ||||| || | ||| ||
Sbjct: 1045 gatgatgcgggtcttcttgttgtcgcgggcggcattgccggccagctccaggatctcggc 986

                                                                        
Query: 418  ggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgctgggc 477
            || ||| |||||||| || ||||| | |||||| || ||||||| ||| || | ||||||
Sbjct: 985  ggtgagatactcgagcacagcggccaagtagacgggagcgccggcgcccaccctctgggc 926

                
Query: 478  gtag 481
            ||||
Sbjct: 925  gtag 922



to top

>gb|L41841.1|CREHIH3G Chlamydomonas reinhardtii histone H3, histone H4, histone H2B, and
            histone H2A genes, complete cds
          Length = 4358

 Score =  129 bits (65), Expect = 1e-26
 Identities = 191/233 (81%)
 Strand = Plus / Minus

                                                                        
Query: 305  agcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgggatgatg 364
            |||||| |||| ||||||| ||||||||||| ||| ||  | | |||||| || | ||||
Sbjct: 4093 agcagcttgcccagctcctcgtcgttgcggatggccagctggatgtggcggggcacgatg 4034

                                                                        
Query: 365  cgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgcggcgagg 424
            ||| |||||||||| ||   ||||||||||||||| ||||| |||||||| ||||  |||
Sbjct: 4033 cggttcttcttgttgtcgcgggcggcgttgccggccagctccagcacctcagcggtcagg 3974

                                                                        
Query: 425  tactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgctgggcgtagcgg 484
            ||||| || || ||||| ||||| || || |||||||  |||| ||||| ||||||   |
Sbjct: 3973 tactccagcacagcggccaggtacacgggcgcgccggcaccgatgcgctcggcgtacttg 3914

                                                                 
Query: 485  cccttcttgaggtagcgcccgatgcggccgacggggaactggagaccggcctt 537
            |||||||| ||||||||| | |||||||| ||||||||||| || ||||||||
Sbjct: 3913 cccttcttcaggtagcgcgcaatgcggccaacggggaactgcaggccggcctt 3861



to top

>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12, complete
                sequence
          Length = 27566993

 Score =  127 bits (64), Expect = 5e-26
 Identities = 112/128 (87%)
 Strand = Plus / Plus

                                                                            
Query: 410      acctctgcggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacg 469
                ||||| ||||||||||||||||||||||||| ||||||||| |||||||||| |||||||
Sbjct: 20924703 acctcggcggcgaggtactcgaggacggcggagaggtagacgggggcgccggcgccgacg 20924762

                                                                            
Query: 470      cgctgggcgtagcggcccttcttgaggtagcgcccgatgcggccgacggggaactggaga 529
                |||| ||||||   |||   ||||||||| |   ||||||||||||||||||||||||| 
Sbjct: 20924763 cgctcggcgtacttgccggccttgaggtacctggcgatgcggccgacggggaactggagg 20924822

                        
Query: 530      ccggcctt 537
                ||||||||
Sbjct: 20924823 ccggcctt 20924830



 Score =  103 bits (52), Expect = 7e-19
 Identities = 127/152 (83%)
 Strand = Plus / Plus

                                                                            
Query: 262      gatgttggggatcacgccgccgtgggcgatggtgacgccggcgagcagcctgccgagctc 321
                ||||||||| || |||||||||  |||||||||| ||||| |||||||| ||  ||||||
Sbjct: 14468549 gatgttgggcatgacgccgccgctggcgatggtggcgccgccgagcagcttggtgagctc 14468608

                                                                            
Query: 322      ctggtcgttgcggacggcgagaagcaggtggcgcgggatgatgcgggtcttcttgttatc 381
                || ||||||||| || |||||  | | ||||||||| |  ||||||||||||||||| ||
Sbjct: 14468609 ctcgtcgttgcgcaccgcgagctggatgtggcgcggcacaatgcgggtcttcttgttgtc 14468668

                                                
Query: 382      cttggcggcgttgccggcgagctcaagcacct 413
                | | || ||||| ||||||||||| |||||||
Sbjct: 14468669 cctcgccgcgttcccggcgagctccagcacct 14468700



 Score =  101 bits (51), Expect = 3e-18
 Identities = 66/71 (92%)
 Strand = Plus / Plus

                                                                            
Query: 410      acctctgcggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacg 469
                ||||| ||||||||||||||||||||||||||||||||||| || ||||||| |||||||
Sbjct: 14468900 acctcggcggcgaggtactcgaggacggcggcgaggtagacgggagcgccggcgccgacg 14468959

                           
Query: 470      cgctgggcgta 480
                |||| ||||||
Sbjct: 14468960 cgctcggcgta 14468970



 Score = 71.9 bits (36), Expect = 3e-09
 Identities = 63/72 (87%)
 Strand = Plus / Plus

                                                                            
Query: 262      gatgttggggatcacgccgccgtgggcgatggtgacgccggcgagcagcctgccgagctc 321
                ||||||||| | ||||||||||  ||||||||||||| || ||||||||||||  |||||
Sbjct: 20924457 gatgttgggcagcacgccgccggcggcgatggtgacggcgccgagcagcctgctcagctc 20924516

                            
Query: 322      ctggtcgttgcg 333
                || |||||||||
Sbjct: 20924517 ctcgtcgttgcg 20924528



 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 222      cggccgcggcggcggacttc 241
                ||||||||||||||||||||
Sbjct: 24757542 cggccgcggcggcggacttc 24757561



to top

>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete
                sequence
          Length = 28434780

 Score =  127 bits (64), Expect = 5e-26
 Identities = 112/128 (87%)
 Strand = Plus / Minus

                                                                            
Query: 410      acctctgcggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacg 469
                ||||| ||||||||||||||||||||||||||||||||||| |||||||||| |||||||
Sbjct: 20566250 acctcggcggcgaggtactcgaggacggcggcgaggtagacgggggcgccggcgccgacg 20566191

                                                                            
Query: 470      cgctgggcgtagcggcccttcttgaggtagcgcccgatgcggccgacggggaactggaga 529
                |||| ||||||   |||   ||||||| ||||  |||| | |||||||||||||||||| 
Sbjct: 20566190 cgctcggcgtacttgccggccttgaggaagcgggcgatcctgccgacggggaactggagc 20566131

                        
Query: 530      ccggcctt 537
                ||||||||
Sbjct: 20566130 ccggcctt 20566123



 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 78/91 (85%)
 Strand = Plus / Plus

                                                                            
Query: 411      cctctgcggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgc 470
                |||||||||| |||||| |||||||||| ||||||||||| |||| ||| | ||||||||
Sbjct: 11503412 cctctgcggcaaggtacccgaggacggcagcgaggtagacgggggtgccagtgccgacgc 11503471

                                               
Query: 471      gctgggcgtagcggcccttcttgaggtagcg 501
                | || ||||  ||||| |||| |||||||||
Sbjct: 11503472 gttgcgcgtgccggccgttctcgaggtagcg 11503502



 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 122/152 (80%)
 Strand = Plus / Minus

                                                                            
Query: 262      gatgttggggatcacgccgccgtgggcgatggtgacgccggcgagcagcctgccgagctc 321
                ||||||||| || |||||||||| ||||||||||||| || ||||||| |     |||||
Sbjct: 20566495 gatgttgggcatgacgccgccgttggcgatggtgacggcgccgagcaggcgcgacagctc 20566436

                                                                            
Query: 322      ctggtcgttgcggacggcgagaagcaggtggcgcgggatgatgcgggtcttcttgttatc 381
                || ||||||||| ||||||||  | | ||| | ||| | ||| || ||||||||||| ||
Sbjct: 20566435 ctcgtcgttgcgcacggcgagctggatgtgcctcggcacgatccgcgtcttcttgttgtc 20566376

                                                
Query: 382      cttggcggcgttgccggcgagctcaagcacct 413
                |   || ||||| |||||||||||||| ||||
Sbjct: 20566375 ccgcgccgcgttcccggcgagctcaagaacct 20566344



to top

>dbj|AP005734.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC
             clone:OSJNBb0032E15
          Length = 120419

 Score =  127 bits (64), Expect = 5e-26
 Identities = 112/128 (87%)
 Strand = Plus / Minus

                                                                         
Query: 410   acctctgcggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacg 469
             ||||| ||||||||||||||||||||||||||||||||||| |||||||||| |||||||
Sbjct: 70211 acctcggcggcgaggtactcgaggacggcggcgaggtagacgggggcgccggcgccgacg 70152

                                                                         
Query: 470   cgctgggcgtagcggcccttcttgaggtagcgcccgatgcggccgacggggaactggaga 529
             |||| ||||||   |||   ||||||| ||||  |||| | |||||||||||||||||| 
Sbjct: 70151 cgctcggcgtacttgccggccttgaggaagcgggcgatcctgccgacggggaactggagc 70092

                     
Query: 530   ccggcctt 537
             ||||||||
Sbjct: 70091 ccggcctt 70084



 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 122/152 (80%)
 Strand = Plus / Minus

                                                                         
Query: 262   gatgttggggatcacgccgccgtgggcgatggtgacgccggcgagcagcctgccgagctc 321
             ||||||||| || |||||||||| ||||||||||||| || ||||||| |     |||||
Sbjct: 70456 gatgttgggcatgacgccgccgttggcgatggtgacggcgccgagcaggcgcgacagctc 70397

                                                                         
Query: 322   ctggtcgttgcggacggcgagaagcaggtggcgcgggatgatgcgggtcttcttgttatc 381
             || ||||||||| ||||||||  | | ||| | ||| | ||| || ||||||||||| ||
Sbjct: 70396 ctcgtcgttgcgcacggcgagctggatgtgcctcggcacgatccgcgtcttcttgttgtc 70337

                                             
Query: 382   cttggcggcgttgccggcgagctcaagcacct 413
             |   || ||||| |||||||||||||| ||||
Sbjct: 70336 ccgcgccgcgttcccggcgagctcaagaacct 70305



to top

>dbj|AP003898.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC
             clone:OJ1663_D06
          Length = 139103

 Score =  127 bits (64), Expect = 5e-26
 Identities = 112/128 (87%)
 Strand = Plus / Minus

                                                                         
Query: 410   acctctgcggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacg 469
             ||||| ||||||||||||||||||||||||||||||||||| |||||||||| |||||||
Sbjct: 40622 acctcggcggcgaggtactcgaggacggcggcgaggtagacgggggcgccggcgccgacg 40563

                                                                         
Query: 470   cgctgggcgtagcggcccttcttgaggtagcgcccgatgcggccgacggggaactggaga 529
             |||| ||||||   |||   ||||||| ||||  |||| | |||||||||||||||||| 
Sbjct: 40562 cgctcggcgtacttgccggccttgaggaagcgggcgatcctgccgacggggaactggagc 40503

                     
Query: 530   ccggcctt 537
             ||||||||
Sbjct: 40502 ccggcctt 40495



 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 122/152 (80%)
 Strand = Plus / Minus

                                                                         
Query: 262   gatgttggggatcacgccgccgtgggcgatggtgacgccggcgagcagcctgccgagctc 321
             ||||||||| || |||||||||| ||||||||||||| || ||||||| |     |||||
Sbjct: 40867 gatgttgggcatgacgccgccgttggcgatggtgacggcgccgagcaggcgcgacagctc 40808

                                                                         
Query: 322   ctggtcgttgcggacggcgagaagcaggtggcgcgggatgatgcgggtcttcttgttatc 381
             || ||||||||| ||||||||  | | ||| | ||| | ||| || ||||||||||| ||
Sbjct: 40807 ctcgtcgttgcgcacggcgagctggatgtgcctcggcacgatccgcgtcttcttgttgtc 40748

                                             
Query: 382   cttggcggcgttgccggcgagctcaagcacct 413
             |   || ||||| |||||||||||||| ||||
Sbjct: 40747 ccgcgccgcgttcccggcgagctcaagaacct 40716



to top

>gb|AY110108.1| Zea mays CL14299_1 mRNA sequence
          Length = 712

 Score =  127 bits (64), Expect = 5e-26
 Identities = 205/252 (81%)
 Strand = Plus / Plus

                                                                       
Query: 286 ggcgatggtgacgccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaag 345
           ||||||||||||  |  |||||||| ||| ||| |||| ||||||||| ||||||||  |
Sbjct: 320 ggcgatggtgacagctccgagcagcttgctgagttcctcgtcgttgcgcacggcgagctg 379

                                                                       
Query: 346 caggtggcgcgggatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctc 405
            | ||| ||||| | ||||||| |||||||||| ||    || |||||||| || || ||
Sbjct: 380 gatgtgacgcggcacgatgcggttcttcttgttgtcgcgcgccgcgttgcccgccagttc 439

                                                                       
Query: 406 aagcacctctgcggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagcc 465
            | ||||||||| ||||| |||||||||||||||| ||||||||| || || ||   |||
Sbjct: 440 caacacctctgccgcgagatactcgaggacggcggagaggtagacgggcgcaccaccgcc 499

                                                                       
Query: 466 gacgcgctgggcgtagcggcccttcttgaggtagcgcccgatgcggccgacggggaactg 525
           |||||||| ||||||   |||   ||||||||||||| ||||||||||||||||||||||
Sbjct: 500 gacgcgctcggcgtacttgccggccttgaggtagcgcgcgatgcggccgacggggaactg 559

                       
Query: 526 gagaccggcctt 537
            || ||||||||
Sbjct: 560 cagcccggcctt 571



to top

>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence
          Length = 27492551

 Score =  127 bits (64), Expect = 5e-26
 Identities = 112/128 (87%)
 Strand = Plus / Plus

                                                                            
Query: 410      acctctgcggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacg 469
                ||||| ||||||||||||||||||||||||| ||||||||| |||||||||| |||||||
Sbjct: 20850917 acctcggcggcgaggtactcgaggacggcggagaggtagacgggggcgccggcgccgacg 20850976

                                                                            
Query: 470      cgctgggcgtagcggcccttcttgaggtagcgcccgatgcggccgacggggaactggaga 529
                |||| ||||||   |||   ||||||||| |   ||||||||||||||||||||||||| 
Sbjct: 20850977 cgctcggcgtacttgccggccttgaggtacctggcgatgcggccgacggggaactggagg 20851036

                        
Query: 530      ccggcctt 537
                ||||||||
Sbjct: 20851037 ccggcctt 20851044



 Score =  103 bits (52), Expect = 7e-19
 Identities = 127/152 (83%)
 Strand = Plus / Plus

                                                                            
Query: 262      gatgttggggatcacgccgccgtgggcgatggtgacgccggcgagcagcctgccgagctc 321
                ||||||||| || |||||||||  |||||||||| ||||| |||||||| ||  ||||||
Sbjct: 14422833 gatgttgggcatgacgccgccgctggcgatggtggcgccgccgagcagcttggtgagctc 14422892

                                                                            
Query: 322      ctggtcgttgcggacggcgagaagcaggtggcgcgggatgatgcgggtcttcttgttatc 381
                || ||||||||| || |||||  | | ||||||||| |  ||||||||||||||||| ||
Sbjct: 14422893 ctcgtcgttgcgcaccgcgagctggatgtggcgcggcacaatgcgggtcttcttgttgtc 14422952

                                                
Query: 382      cttggcggcgttgccggcgagctcaagcacct 413
                | | || ||||| ||||||||||| |||||||
Sbjct: 14422953 cctcgccgcgttcccggcgagctccagcacct 14422984



 Score =  101 bits (51), Expect = 3e-18
 Identities = 66/71 (92%)
 Strand = Plus / Plus

                                                                            
Query: 410      acctctgcggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacg 469
                ||||| ||||||||||||||||||||||||||||||||||| || ||||||| |||||||
Sbjct: 14423184 acctcggcggcgaggtactcgaggacggcggcgaggtagacgggagcgccggcgccgacg 14423243

                           
Query: 470      cgctgggcgta 480
                |||| ||||||
Sbjct: 14423244 cgctcggcgta 14423254



 Score = 71.9 bits (36), Expect = 3e-09
 Identities = 63/72 (87%)
 Strand = Plus / Plus

                                                                            
Query: 262      gatgttggggatcacgccgccgtgggcgatggtgacgccggcgagcagcctgccgagctc 321
                ||||||||| | ||||||||||  ||||||||||||| || ||||||||||||  |||||
Sbjct: 20850671 gatgttgggcagcacgccgccggcggcgatggtgacggcgccgagcagcctgctcagctc 20850730

                            
Query: 322      ctggtcgttgcg 333
                || |||||||||
Sbjct: 20850731 ctcgtcgttgcg 20850742



 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 222      cggccgcggcggcggacttc 241
                ||||||||||||||||||||
Sbjct: 24685748 cggccgcggcggcggacttc 24685767



to top

>emb|AL713943.3|CNS07YPC Oryza sativa chromosome 12, . BAC OSJNBa0030G16 of library OSJNBa from
             chromosome 12 of cultivar Nipponbare of ssp. japonica of
             Oryza sativa (rice), complete sequence
          Length = 182172

 Score =  127 bits (64), Expect = 5e-26
 Identities = 112/128 (87%)
 Strand = Plus / Plus

                                                                         
Query: 410   acctctgcggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacg 469
             ||||| ||||||||||||||||||||||||| ||||||||| |||||||||| |||||||
Sbjct: 10193 acctcggcggcgaggtactcgaggacggcggagaggtagacgggggcgccggcgccgacg 10252

                                                                         
Query: 470   cgctgggcgtagcggcccttcttgaggtagcgcccgatgcggccgacggggaactggaga 529
             |||| ||||||   |||   ||||||||| |   ||||||||||||||||||||||||| 
Sbjct: 10253 cgctcggcgtacttgccggccttgaggtacctggcgatgcggccgacggggaactggagg 10312

                     
Query: 530   ccggcctt 537
             ||||||||
Sbjct: 10313 ccggcctt 10320



 Score = 71.9 bits (36), Expect = 3e-09
 Identities = 63/72 (87%)
 Strand = Plus / Plus

                                                                         
Query: 262   gatgttggggatcacgccgccgtgggcgatggtgacgccggcgagcagcctgccgagctc 321
             ||||||||| | ||||||||||  ||||||||||||| || ||||||||||||  |||||
Sbjct: 9947  gatgttgggcagcacgccgccggcggcgatggtgacggcgccgagcagcctgctcagctc 10006

                         
Query: 322   ctggtcgttgcg 333
             || |||||||||
Sbjct: 10007 ctcgtcgttgcg 10018



to top

>emb|AL731880.3|CNS08C8J Oryza sativa chromosome 12, . BAC OSJNBa0035E02 of library OSJNBa from
             chromosome 12 of cultivar Nipponbare of ssp. japonica of
             Oryza sativa (rice), complete sequence
          Length = 107819

 Score =  127 bits (64), Expect = 5e-26
 Identities = 112/128 (87%)
 Strand = Plus / Minus

                                                                         
Query: 410   acctctgcggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacg 469
             ||||| ||||||||||||||||||||||||| ||||||||| |||||||||| |||||||
Sbjct: 34292 acctcggcggcgaggtactcgaggacggcggagaggtagacgggggcgccggcgccgacg 34233

                                                                         
Query: 470   cgctgggcgtagcggcccttcttgaggtagcgcccgatgcggccgacggggaactggaga 529
             |||| ||||||   |||   ||||||||| |   ||||||||||||||||||||||||| 
Sbjct: 34232 cgctcggcgtacttgccggccttgaggtacctggcgatgcggccgacggggaactggagg 34173

                     
Query: 530   ccggcctt 537
             ||||||||
Sbjct: 34172 ccggcctt 34165



 Score = 71.9 bits (36), Expect = 3e-09
 Identities = 63/72 (87%)
 Strand = Plus / Minus

                                                                         
Query: 262   gatgttggggatcacgccgccgtgggcgatggtgacgccggcgagcagcctgccgagctc 321
             ||||||||| | ||||||||||  ||||||||||||| || ||||||||||||  |||||
Sbjct: 34538 gatgttgggcagcacgccgccggcggcgatggtgacggcgccgagcagcctgctcagctc 34479

                         
Query: 322   ctggtcgttgcg 333
             || |||||||||
Sbjct: 34478 ctcgtcgttgcg 34467



to top

>gb|U16726.1|CRU16726 Chlamydomonas reinhardtii histone H1 (ch1), histone H2A (ch2a-IV),
            and histone H2B (ch2b-IV) genes, complete cds
          Length = 4502

 Score =  127 bits (64), Expect = 5e-26
 Identities = 241/300 (80%)
 Strand = Plus / Plus

                                                                        
Query: 238  cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 297
            ||||||||| ||||| |||| || ||||||||| | ||| |||||   ||||||||| ||
Sbjct: 3115 cttcttgggcagcagcacggcgtggatgttgggcagcacaccgcccgaggcgatggtcac 3174

                                                                        
Query: 298  gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 357
              || | |||||| |||| |||||||  |||||||||| ||| ||  | | |||||| ||
Sbjct: 3175 ctcgcccagcagcttgcccagctcctcatcgttgcggatggccagctggatgtggcgagg 3234

                                                                        
Query: 358  gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 417
             |  |||||| |||||||||| ||   ||||||||||||||| ||||| |||||||| ||
Sbjct: 3235 cacaatgcggttcttcttgttgtcgcgggcggcgttgccggccagctccagcacctcagc 3294

                                                                        
Query: 418  ggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgctgggc 477
            ||  |||||||| || |||||||| ||||| || || |||||||  |||| ||||| |||
Sbjct: 3295 ggtcaggtactccagcacggcggccaggtacacgggcgcgccggcaccgatgcgctcggc 3354

                                                                        
Query: 478  gtagcggcccttcttgaggtagcgcccgatgcggccgacggggaactggagaccggcctt 537
            |||   ||||||||| ||||||||| | |||||||| || |||||||| || ||||||||
Sbjct: 3355 gtacttgcccttcttcaggtagcgcgcaatgcggcccacagggaactgcaggccggcctt 3414



to top

>gb|U16724.1|CRU16724 Chlamydomonas reinhardtii histone H3 (ch3-II), histone H4 (ch4-II),
            histone H2B (ch2b-II) and histone H2A (ch2a-II) genes,
            complete cds
          Length = 3777

 Score =  127 bits (64), Expect = 5e-26
 Identities = 241/300 (80%)
 Strand = Plus / Minus

                                                                        
Query: 238  cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 297
            ||||||||| ||||| |||| || ||||||||| | ||| |||||   ||||||||| ||
Sbjct: 3579 cttcttgggcagcagcacggcgtggatgttgggcagcacaccgcccgaggcgatggtcac 3520

                                                                        
Query: 298  gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 357
              || | |||||| |||| |||||||  |||||||||| ||| ||  | | |||||| ||
Sbjct: 3519 ctcgcccagcagcttgcccagctcctcatcgttgcggatggccagctggatgtggcgggg 3460

                                                                        
Query: 358  gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 417
             | ||||||| |||||||||| ||   ||||||||||||||| ||||| |||||||| ||
Sbjct: 3459 cacgatgcggttcttcttgttgtcgcgggcggcgttgccggccagctccagcacctcagc 3400

                                                                        
Query: 418  ggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgctgggc 477
            ||  ||||||||||| || ||||| ||||| || || |||||||  |||| ||||| |||
Sbjct: 3399 ggtcaggtactcgagcacagcggccaggtacacgggcgcgccggcaccgatgcgctcggc 3340

                                                                        
Query: 478  gtagcggcccttcttgaggtagcgcccgatgcggccgacggggaactggagaccggcctt 537
            |||   ||||||||| ||||||||  | |||||||| || |||||||| || ||||||||
Sbjct: 3339 gtacttgcccttcttcaggtagcgtgcaatgcggcccacagggaactgcaggccggcctt 3280



to top

>gb|BC010336.1| Mus musculus H2A histone family, member X, mRNA (cDNA clone
           MGC:11561 IMAGE:3156946), complete cds
          Length = 1414

 Score =  121 bits (61), Expect = 3e-24
 Identities = 202/249 (81%)
 Strand = Plus / Minus

                                                                       
Query: 238 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 297
           ||||||||| ||||| ||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 407 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 348

                                                                       
Query: 298 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 357
           |||| | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||||||
Sbjct: 347 gccgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 288

                                                                       
Query: 358 gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 417
           ||||||||| ||||||||||| ||   ||| |||||||| || ||||| || | ||| ||
Sbjct: 287 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 228

                                                                       
Query: 418 ggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgctgggc 477
            | |||||||||||| || || || ||||| || || ||||| | ||| ||||||| |||
Sbjct: 227 agtgaggtactcgagcaccgctgccaggtacaccggcgcgcctgcgcccacgcgctcggc 168

                    
Query: 478 gtagcggcc 486
           |||| ||||
Sbjct: 167 gtagtggcc 159



to top

>gb|AC122428.4| Mus musculus BAC clone RP24-175C20 from chromosome 9, complete sequence
          Length = 185902

 Score =  121 bits (61), Expect = 3e-24
 Identities = 202/249 (81%)
 Strand = Plus / Plus

                                                                          
Query: 238    cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 297
              ||||||||| ||||| ||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 149654 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 149713

                                                                          
Query: 298    gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 357
              |||| | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||||||
Sbjct: 149714 gccgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 149773

                                                                          
Query: 358    gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 417
              ||||||||| ||||||||||| ||   ||| |||||||| || ||||| || | ||| ||
Sbjct: 149774 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 149833

                                                                          
Query: 418    ggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgctgggc 477
               | |||||||||||| || || || ||||| || || ||||| | ||| ||||||| |||
Sbjct: 149834 agtgaggtactcgagcaccgctgccaggtacaccggcgcgcctgcgcccacgcgctcggc 149893

                       
Query: 478    gtagcggcc 486
              |||| ||||
Sbjct: 149894 gtagtggcc 149902



to top

>ref|NM_010436.2| Mus musculus H2A histone family, member X (H2afx), mRNA
          Length = 1414

 Score =  121 bits (61), Expect = 3e-24
 Identities = 202/249 (81%)
 Strand = Plus / Minus

                                                                       
Query: 238 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 297
           ||||||||| ||||| ||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 407 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 348

                                                                       
Query: 298 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 357
           |||| | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||||||
Sbjct: 347 gccgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 288

                                                                       
Query: 358 gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 417
           ||||||||| ||||||||||| ||   ||| |||||||| || ||||| || | ||| ||
Sbjct: 287 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 228

                                                                       
Query: 418 ggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgctgggc 477
            | |||||||||||| || || || ||||| || || ||||| | ||| ||||||| |||
Sbjct: 227 agtgaggtactcgagcaccgctgccaggtacaccggcgcgcctgcgcccacgcgctcggc 168

                    
Query: 478 gtagcggcc 486
           |||| ||||
Sbjct: 167 gtagtggcc 159



to top

>emb|Z35401.1|MMHISTH2A M.musculus C3H gene for histone H2A.X
          Length = 2166

 Score =  121 bits (61), Expect = 3e-24
 Identities = 202/249 (81%)
 Strand = Plus / Minus

                                                                       
Query: 238 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 297
           ||||||||| ||||| ||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 986 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 927

                                                                       
Query: 298 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 357
           |||| | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||||||
Sbjct: 926 gccgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 867

                                                                       
Query: 358 gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 417
           ||||||||| ||||||||||| ||   ||| |||||||| || ||||| || | ||| ||
Sbjct: 866 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 807

                                                                       
Query: 418 ggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgctgggc 477
            | |||||||||||| || || || ||||| || || ||||| | ||| ||||||| |||
Sbjct: 806 agtgaggtactcgagcaccgctgccaggtacaccggcgcgcctgcgcccacgcgctcggc 747

                    
Query: 478 gtagcggcc 486
           |||| ||||
Sbjct: 746 gtagtggcc 738



to top

>gb|BC005468.1| Mus musculus H2A histone family, member X, mRNA (cDNA clone
           MGC:6616 IMAGE:3490058), complete cds
          Length = 1367

 Score =  121 bits (61), Expect = 3e-24
 Identities = 202/249 (81%)
 Strand = Plus / Minus

                                                                       
Query: 238 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 297
           ||||||||| ||||| ||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 401 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 342

                                                                       
Query: 298 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 357
           |||| | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||||||
Sbjct: 341 gccgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 282

                                                                       
Query: 358 gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 417
           ||||||||| ||||||||||| ||   ||| |||||||| || ||||| || | ||| ||
Sbjct: 281 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 222

                                                                       
Query: 418 ggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgctgggc 477
            | |||||||||||| || || || ||||| || || ||||| | ||| ||||||| |||
Sbjct: 221 agtgaggtactcgagcaccgctgccaggtacaccggcgcgcctgcgcccacgcgctcggc 162

                    
Query: 478 gtagcggcc 486
           |||| ||||
Sbjct: 161 gtagtggcc 153



to top

>gb|AY108339.1| Zea mays PCO070432 mRNA sequence
          Length = 811

 Score =  121 bits (61), Expect = 3e-24
 Identities = 130/153 (84%)
 Strand = Plus / Minus

                                                                       
Query: 316 gagctcctggtcgttgcggacggcgagaagcaggtggcgcgggatgatgcgggtcttctt 375
           |||||||| ||||||||||||||||||  | | ||||||||||| |||||||||||||||
Sbjct: 395 gagctcctcgtcgttgcggacggcgagctggatgtggcgcgggacgatgcgggtcttctt 336

                                                                       
Query: 376 gttatccttggcggcgttgccggcgagctcaagcacctctgcggcgaggtactcgaggac 435
           ||| |||   || ||||| ||||| ||||| || ||||| || || || |||||||| ||
Sbjct: 335 gttgtcccgagccgcgttcccggcaagctcgagaacctcagcagcaagatactcgagcac 276

                                            
Query: 436 ggcggcgaggtagacaggggcgccggagccgac 468
           ||| ||||||||||| |||||||||| ||||||
Sbjct: 275 ggcagcgaggtagacgggggcgccggcgccgac 243



to top

>gb|AY104828.1| Zea mays PCO072413 mRNA sequence
          Length = 741

 Score =  121 bits (61), Expect = 3e-24
 Identities = 157/189 (83%)
 Strand = Plus / Minus

                                                                       
Query: 349 gtggcgcgggatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaag 408
           ||||||||| |  ||||||||||||||||| ||| | |||||||| ||||| || || ||
Sbjct: 309 gtggcgcggcacaatgcgggtcttcttgttgtccctcgcggcgttcccggcaagttcgag 250

                                                                       
Query: 409 cacctctgcggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgac 468
            ||||| || ||||||||||||||||||||||||||||| || |||||||||| ||||||
Sbjct: 249 aacctcagccgcgaggtactcgaggacggcggcgaggtacacgggggcgccggcgccgac 190

                                                                       
Query: 469 gcgctgggcgtagcggcccttcttgaggtagcgcccgatgcggccgacggggaactggag 528
           |||||  |||||   ||||  ||||||| | |   | || | ||||||||||||||||||
Sbjct: 189 gcgctccgcgtacttgcccgccttgaggaacctggcaatcctgccgacggggaactggag 130

                    
Query: 529 accggcctt 537
            ||||||||
Sbjct: 129 tccggcctt 121



to top

>ref|NM_178185.1| Mus musculus histone 1, H2ao (Hist1h2ao), mRNA
          Length = 393

 Score =  119 bits (60), Expect = 1e-23
 Identities = 192/236 (81%)
 Strand = Plus / Minus

                                                                       
Query: 238 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 297
           ||||||||| ||||| ||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 360 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 301

                                                                       
Query: 298 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 357
           || | | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||||||
Sbjct: 300 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 241

                                                                       
Query: 358 gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 417
           ||||||||| ||||||||||| ||   ||| |||||||| || ||||| || | ||| ||
Sbjct: 240 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 181

                                                                   
Query: 418 ggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgct 473
            |  |||||||| || ||||| || |||||||| |||||||||| ||| |||||||
Sbjct: 180 cgtcaggtactccagcacggccgccaggtagaccggggcgccggcgcccacgcgct 125



to top

>ref|XM_978341.1| PREDICTED: Mus musculus similar to histone 2a, transcript variant 2
           (LOC665433), mRNA
          Length = 465

 Score =  119 bits (60), Expect = 1e-23
 Identities = 192/236 (81%)
 Strand = Plus / Minus

                                                                       
Query: 238 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 297
           ||||||||| ||||| ||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 392 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 333

                                                                       
Query: 298 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 357
           || | | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||||||
Sbjct: 332 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 273

                                                                       
Query: 358 gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 417
           ||||||||| ||||||||||| ||   ||| |||||||| || ||||| || | ||| ||
Sbjct: 272 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 213

                                                                   
Query: 418 ggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgct 473
            |  |||||||| || ||||| || |||||||| |||||||||| ||| |||||||
Sbjct: 212 cgtcaggtactccagcacggccgccaggtagaccggggcgccggcgcccacgcgct 157



to top

>ref|XM_978296.1| PREDICTED: Mus musculus similar to histone 2a, transcript variant 1
           (LOC665433), mRNA
          Length = 467

 Score =  119 bits (60), Expect = 1e-23
 Identities = 192/236 (81%)
 Strand = Plus / Minus

                                                                       
Query: 238 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 297
           ||||||||| ||||| ||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 394 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 335

                                                                       
Query: 298 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 357
           || | | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||||||
Sbjct: 334 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 275

                                                                       
Query: 358 gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 417
           ||||||||| ||||||||||| ||   ||| |||||||| || ||||| || | ||| ||
Sbjct: 274 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 215

                                                                   
Query: 418 ggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgct 473
            |  |||||||| || ||||| || |||||||| |||||||||| ||| |||||||
Sbjct: 214 cgtcaggtactccagcacggccgccaggtagaccggggcgccggcgcccacgcgct 159



to top

>emb|AL592149.8| Mouse DNA sequence from clone RP23-283N14 on chromosome 13 Contains a
              novel gene, the genes for three H1, four H2a, five H2b,
              four H3 and four H4 histone family members, the 3' end of a
              variant of the Hfe gene for hemochromatosis protein (Mr2)
              and ten CpG islands, complete sequence
          Length = 184730

 Score =  119 bits (60), Expect = 1e-23
 Identities = 192/236 (81%)
 Strand = Plus / Plus

                                                                          
Query: 238    cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 297
              ||||||||| ||||| ||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 163973 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 164032

                                                                          
Query: 298    gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 357
              || | | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||||||
Sbjct: 164033 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 164092

                                                                          
Query: 358    gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 417
              ||||||||| ||||||||||| ||   ||| |||||||| || ||||| || | ||| ||
Sbjct: 164093 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 164152

                                                                      
Query: 418    ggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgct 473
               |  |||||||| || ||||| || |||||||| |||||||||| ||| |||||||
Sbjct: 164153 cgtcaggtactccagcacggccgccaggtagaccggggcgccggcgcccacgcgct 164208



 Score =  111 bits (56), Expect = 3e-21
 Identities = 191/236 (80%)
 Strand = Plus / Minus

                                                                         
Query: 238   cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 297
             ||||||||| ||||| ||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 55436 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 55377

                                                                         
Query: 298   gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 357
             || | | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||||||
Sbjct: 55376 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 55317

                                                                         
Query: 358   gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 417
             ||||||||| ||||||||||| ||   ||| |||||||| || ||||| || | ||| ||
Sbjct: 55316 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 55257

                                                                     
Query: 418   ggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgct 473
              |  |||||||| || ||||| || ||||| || |||||||||| ||| |||||||
Sbjct: 55256 cgtcaggtactccagcacggccgccaggtacaccggggcgccggcgcccacgcgct 55201



 Score =  111 bits (56), Expect = 3e-21
 Identities = 191/236 (80%)
 Strand = Plus / Plus

                                                                         
Query: 238   cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 297
             ||||||||| ||||| ||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 51355 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 51414

                                                                         
Query: 298   gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 357
             || | | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||||||
Sbjct: 51415 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 51474

                                                                         
Query: 358   gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 417
             ||||||||| ||||||||||| ||   ||| |||||||| || ||||| || | ||| ||
Sbjct: 51475 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 51534

                                                                     
Query: 418   ggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgct 473
              |  |||||||| || ||||| || ||||| || |||||||||| ||| |||||||
Sbjct: 51535 cgtcaggtactccagcacggccgccaggtacaccggggcgccggcgcccacgcgct 51590



 Score =  103 bits (52), Expect = 7e-19
 Identities = 190/236 (80%)
 Strand = Plus / Minus

                                                                         
Query: 238   cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 297
             ||||||||| ||||| ||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 14872 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 14813

                                                                         
Query: 298   gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 357
             || | | | |||| ||  |||||||| ||||||||||| ||| ||  |||||||||||||
Sbjct: 14812 gcggcccaacagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 14753

                                                                         
Query: 358   gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 417
             ||||||||| ||||||||||| ||   ||| |||||||| || ||||| || | ||| ||
Sbjct: 14752 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 14693

                                                                     
Query: 418   ggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgct 473
              |  |||||||| || ||||| || ||||| || |||||||||| ||| |||||||
Sbjct: 14692 cgtcaggtactccagcacggccgccaggtacaccggggcgccggcgcccacgcgct 14637



to top

>ref|NM_178189.2| Mus musculus histone 1, H2ac (Hist1h2ac), mRNA
          Length = 2493

 Score =  119 bits (60), Expect = 1e-23
 Identities = 192/236 (81%)
 Strand = Plus / Minus

                                                                       
Query: 238 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 297
           ||||||||| ||||| ||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 404 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 345

                                                                       
Query: 298 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 357
           || | | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||||||
Sbjct: 344 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 285

                                                                       
Query: 358 gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 417
           ||||||||| ||||||||||| ||   ||| |||||||| || ||||| || | ||| ||
Sbjct: 284 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 225

                                                                   
Query: 418 ggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgct 473
            |  |||||||| || ||||| || |||||||| |||||||||| ||| |||||||
Sbjct: 224 cgtcaggtactccagcacggccgccaggtagaccggggcgccggcgcccacgcgct 169



to top

>emb|AL589879.21| Mouse DNA sequence from clone RP23-38E20 on chromosome 13 Contains the
             genes for H2b histone family member A, two H2a, two H4 and
             an H2b histone family member, a serine/threonine protein
             kinase pseudogene, a novel pseudogene, a novel gene
             (4930500C15Rik), the gene for a novel KRAB box and C2H2
             Zinc Finger containing protein, a ribosomal protein L21
             (RPL21) pseudogene, a TU mitochondrial translation
             elongation factor (tufa) pseudogene, the 5' end of the
             gene for a novel protein similar to nuclear envelope pore
             membrane protein POM121 and four CpG islands, complete
             sequence
          Length = 182817

 Score =  119 bits (60), Expect = 1e-23
 Identities = 192/236 (81%)
 Strand = Plus / Plus

                                                                         
Query: 238   cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 297
             ||||||||| ||||| ||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 33283 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 33342

                                                                         
Query: 298   gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 357
             || | | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||||||
Sbjct: 33343 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 33402

                                                                         
Query: 358   gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 417
             ||||||||| ||||||||||| ||   ||| |||||||| || ||||| || | ||| ||
Sbjct: 33403 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 33462

                                                                     
Query: 418   ggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgct 473
              |  |||||||| || ||||| || |||||||| |||||||||| ||| |||||||
Sbjct: 33463 cgtcaggtactccagcacggccgccaggtagaccggggcgccggcgcccacgcgct 33518



 Score =  119 bits (60), Expect = 1e-23
 Identities = 192/236 (81%)
 Strand = Plus / Minus

                                                                         
Query: 238   cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 297
             ||||||||| ||||| ||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 10993 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 10934

                                                                         
Query: 298   gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 357
             || | | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||||||
Sbjct: 10933 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 10874

                                                                         
Query: 358   gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 417
             ||||||||| ||||||||||| ||   ||| |||||||| || ||||| || | ||| ||
Sbjct: 10873 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 10814

                                                                     
Query: 418   ggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgct 473
              |  |||||||| || ||||| || |||||||| |||||||||| ||| |||||||
Sbjct: 10813 cgtcaggtactccagcacggccgccaggtagaccggggcgccggcgcccacgcgct 10758



to top

>emb|AL590614.8| Mouse DNA sequence from clone RP23-9O16 on chromosome 13 Contains the
             3' end of the gene for a novel protein similar to nuclear
             envelope pore membrane protein POM121, the Prss16 gene for
             thymus serine protease16, three novel genes, the genes for
             two H2a, two H2b and one H4 histone family members, a
             ribosomal protein L37A (Rpl37a) pseudogene, a novel
             pseudogene, three genes for novel vomeronasal 1 receptor H
             (V1rh) family members, the gene for a novel vomeronasal 1
             receptor I (V1ri) family member, six V1ri pseudogenes, a
             V1rh pseudogene and six CpG islands, complete sequence
          Length = 210845

 Score =  119 bits (60), Expect = 1e-23
 Identities = 192/236 (81%)
 Strand = Plus / Plus

                                                                         
Query: 238   cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 297
             ||||||||| ||||| ||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 59924 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 59983

                                                                         
Query: 298   gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 357
             || | | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||||||
Sbjct: 59984 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 60043

                                                                         
Query: 358   gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 417
             ||||||||| ||||||||||| ||   ||| |||||||| || ||||| || | ||| ||
Sbjct: 60044 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 60103

                                                                     
Query: 418   ggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgct 473
              |  |||||||| || ||||| || |||||||| |||||||||| ||| |||||||
Sbjct: 60104 cgtcaggtactccagcacggccgccaggtagaccggggcgccggcgcccacgcgct 60159



 Score =  111 bits (56), Expect = 3e-21
 Identities = 191/236 (80%)
 Strand = Plus / Plus

                                                                         
Query: 238   cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 297
             ||||||||| ||||| ||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 52549 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 52608

                                                                         
Query: 298   gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 357
             || | | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||||||
Sbjct: 52609 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 52668

                                                                         
Query: 358   gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 417
             ||||||||| ||||||||||| ||   ||| |||||||| || ||||| || | ||| ||
Sbjct: 52669 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 52728

                                                                     
Query: 418   ggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgct 473
              |  |||||||| || ||||| || ||||| || |||||||||| ||| |||||||
Sbjct: 52729 cgtcaggtactccagcacggccgccaggtacaccggggcgccggcgcccacgcgct 52784



to top

>gb|BC065803.1| Mus musculus histone 1, H2ag, mRNA (cDNA clone MGC:73771
           IMAGE:1263745), complete cds
          Length = 527

 Score =  119 bits (60), Expect = 1e-23
 Identities = 192/236 (81%)
 Strand = Plus / Minus

                                                                       
Query: 238 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 297
           ||||||||| ||||| ||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 382 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 323

                                                                       
Query: 298 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 357
           || | | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||||||
Sbjct: 322 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 263

                                                                       
Query: 358 gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 417
           ||||||||| ||||||||||| ||   ||| |||||||| || ||||| || | ||| ||
Sbjct: 262 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 203

                                                                   
Query: 418 ggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgct 473
            |  |||||||| || ||||| || |||||||| |||||||||| ||| |||||||
Sbjct: 202 cgtcaggtactccagcacggccgccaggtagaccggggcgccggcgcccacgcgct 147



to top

>dbj|AK145443.1| Mus musculus 5 days embryo whole body cDNA, RIKEN full-length
           enriched library, clone:I0C0045N09 product:histone 1,
           H2ad, full insert sequence
          Length = 446

 Score =  119 bits (60), Expect = 1e-23
 Identities = 192/236 (81%)
 Strand = Plus / Minus

                                                                       
Query: 238 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 297
           ||||||||| ||||| ||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 393 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 334

                                                                       
Query: 298 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 357
           || | | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||||||
Sbjct: 333 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 274

                                                                       
Query: 358 gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 417
           ||||||||| ||||||||||| ||   ||| |||||||| || ||||| || | ||| ||
Sbjct: 273 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 214

                                                                   
Query: 418 ggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgct 473
            |  |||||||| || ||||| || |||||||| |||||||||| ||| |||||||
Sbjct: 213 cgtcaggtactccagcacggccgccaggtagaccggggcgccggcgcccacgcgct 158



to top

>dbj|AK146846.1| Mus musculus 17 days embryo heart cDNA, RIKEN full-length enriched
           library, clone:I920064A15 product:histone 1, H2ad, full
           insert sequence
          Length = 445

 Score =  119 bits (60), Expect = 1e-23
 Identities = 192/236 (81%)
 Strand = Plus / Minus

                                                                       
Query: 238 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 297
           ||||||||| ||||| ||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 391 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 332

                                                                       
Query: 298 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 357
           || | | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||||||
Sbjct: 331 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 272

                                                                       
Query: 358 gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 417
           ||||||||| ||||||||||| ||   ||| |||||||| || ||||| || | ||| ||
Sbjct: 271 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 212

                                                                   
Query: 418 ggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgct 473
            |  |||||||| || ||||| || |||||||| |||||||||| ||| |||||||
Sbjct: 211 cgtcaggtactccagcacggccgccaggtagaccggggcgccggcgcccacgcgct 156



to top

>gb|BC062251.1| Mus musculus cDNA clone MGC:73635 IMAGE:1224905, complete cds
          Length = 444

 Score =  119 bits (60), Expect = 1e-23
 Identities = 192/236 (81%)
 Strand = Plus / Minus

                                                                       
Query: 238 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 297
           ||||||||| ||||| ||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 372 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 313

                                                                       
Query: 298 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 357
           || | | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||||||
Sbjct: 312 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 253

                                                                       
Query: 358 gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 417
           ||||||||| ||||||||||| ||   ||| |||||||| || ||||| || | ||| ||
Sbjct: 252 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 193

                                                                   
Query: 418 ggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgct 473
            |  |||||||| || ||||| || |||||||| |||||||||| ||| |||||||
Sbjct: 192 cgtcaggtactccagcacggccgccaggtagaccggggcgccggcgcccacgcgct 137



to top

>ref|NM_178186.2| Mus musculus histone 1, H2ag (Hist1h2ag), mRNA
          Length = 527

 Score =  119 bits (60), Expect = 1e-23
 Identities = 192/236 (81%)
 Strand = Plus / Minus

                                                                       
Query: 238 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 297
           ||||||||| ||||| ||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 382 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 323

                                                                       
Query: 298 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 357
           || | | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||||||
Sbjct: 322 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 263

                                                                       
Query: 358 gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 417
           ||||||||| ||||||||||| ||   ||| |||||||| || ||||| || | ||| ||
Sbjct: 262 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 203

                                                                   
Query: 418 ggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgct 473
            |  |||||||| || ||||| || |||||||| |||||||||| ||| |||||||
Sbjct: 202 cgtcaggtactccagcacggccgccaggtagaccggggcgccggcgcccacgcgct 147



to top

>dbj|AK033518.1| Mus musculus adult male colon cDNA, RIKEN full-length enriched
           library, clone:9030420B16 product:histone 1, H2ac, full
           insert sequence
          Length = 2493

 Score =  119 bits (60), Expect = 1e-23
 Identities = 192/236 (81%)
 Strand = Plus / Minus

                                                                       
Query: 238 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 297
           ||||||||| ||||| ||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 404 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 345

                                                                       
Query: 298 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 357
           || | | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||||||
Sbjct: 344 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 285

                                                                       
Query: 358 gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 417
           ||||||||| ||||||||||| ||   ||| |||||||| || ||||| || | ||| ||
Sbjct: 284 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 225

                                                                   
Query: 418 ggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgct 473
            |  |||||||| || ||||| || |||||||| |||||||||| ||| |||||||
Sbjct: 224 cgtcaggtactccagcacggccgccaggtagaccggggcgccggcgcccacgcgct 169



to top

>gb|AY158919.1| Mus musculus histone protein Hist1h2ac gene, complete cds
          Length = 1390

 Score =  119 bits (60), Expect = 1e-23
 Identities = 192/236 (81%)
 Strand = Plus / Minus

                                                                       
Query: 238 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 297
           ||||||||| ||||| ||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 860 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 801

                                                                       
Query: 298 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 357
           || | | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||||||
Sbjct: 800 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 741

                                                                       
Query: 358 gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 417
           ||||||||| ||||||||||| ||   ||| |||||||| || ||||| || | ||| ||
Sbjct: 740 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 681

                                                                   
Query: 418 ggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgct 473
            |  |||||||| || ||||| || |||||||| |||||||||| ||| |||||||
Sbjct: 680 cgtcaggtactccagcacggccgccaggtagaccggggcgccggcgcccacgcgct 625



to top

>gb|AY158915.1| Mus musculus histone protein Hist1h2ag gene, complete cds
          Length = 1392

 Score =  119 bits (60), Expect = 1e-23
 Identities = 192/236 (81%)
 Strand = Plus / Minus

                                                                       
Query: 238 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 297
           ||||||||| ||||| ||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 859 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 800

                                                                       
Query: 298 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 357
           || | | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||||||
Sbjct: 799 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 740

                                                                       
Query: 358 gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 417
           ||||||||| ||||||||||| ||   ||| |||||||| || ||||| || | ||| ||
Sbjct: 739 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 680

                                                                   
Query: 418 ggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgct 473
            |  |||||||| || ||||| || |||||||| |||||||||| ||| |||||||
Sbjct: 679 cgtcaggtactccagcacggccgccaggtagaccggggcgccggcgcccacgcgct 624



to top

>gb|AY158913.1| Mus musculus histone protein Hist1h2ao gene, complete cds
          Length = 1390

 Score =  119 bits (60), Expect = 1e-23
 Identities = 192/236 (81%)
 Strand = Plus / Minus

                                                                       
Query: 238 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 297
           ||||||||| ||||| ||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 860 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 801

                                                                       
Query: 298 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 357
           || | | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||||||
Sbjct: 800 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 741

                                                                       
Query: 358 gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 417
           ||||||||| ||||||||||| ||   ||| |||||||| || ||||| || | ||| ||
Sbjct: 740 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 681

                                                                   
Query: 418 ggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgct 473
            |  |||||||| || ||||| || |||||||| |||||||||| ||| |||||||
Sbjct: 680 cgtcaggtactccagcacggccgccaggtagaccggggcgccggcgcccacgcgct 625



to top

>gb|AF517874.1| Griffithsia japonica isolate Gj10 histone protein mRNA, partial cds
          Length = 628

 Score =  113 bits (57), Expect = 7e-22
 Identities = 174/213 (81%)
 Strand = Plus / Minus

                                                                       
Query: 325 gtcgttgcggacggcgagaagcaggtggcgcgggatgatgcgggtcttcttgttatcctt 384
           |||||| |||||||||||  | | |||||| |||||||| |||| ||||||||||||   
Sbjct: 347 gtcgttacggacggcgagctggatgtggcgggggatgatacgggacttcttgttatcgcg 288

                                                                       
Query: 385 ggcggcgttgccggcgagctcaagcacctctgcggcgaggtactcgaggacggcggcgag 444
           ||||||||||||||||||||| |||||||| || |  | |||||| | ||||||||| | 
Sbjct: 287 ggcggcgttgccggcgagctcgagcacctcggccgtcaagtactccatgacggcggccat 228

                                                                       
Query: 445 gtagacaggggcgccggagccgacgcgctgggcgtagcggcccttcttgaggtagcgccc 504
            || ||||||||||||| ||| ||||| | |||||||| ||||||   |||| ||||  |
Sbjct: 227 atacacaggggcgccggcgcccacgcggtcggcgtagccgcccttgcggaggaagcggtc 168

                                            
Query: 505 gatgcggccgacggggaactggagaccggcctt 537
           ||| || ||||| |||||||| || ||||||||
Sbjct: 167 gatacgaccgaccgggaactgcagcccggcctt 135



to top

>emb|X58069.1|MMH2AX Mouse mRNA for Histone H2A.X
          Length = 1359

 Score =  113 bits (57), Expect = 7e-22
 Identities = 201/249 (80%)
 Strand = Plus / Minus

                                                                       
Query: 238 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 297
           ||||||||| ||||| ||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 411 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 352

                                                                       
Query: 298 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 357
           |||| | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||| ||
Sbjct: 351 gccgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgagg 292

                                                                       
Query: 358 gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 417
           ||||||||| ||||||||||| ||   ||| |||||||| || ||||| || | ||| ||
Sbjct: 291 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 232

                                                                       
Query: 418 ggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgctgggc 477
            | |||||||||||| || || || ||||| || || ||||| | ||| ||||||| |||
Sbjct: 231 agtgaggtactcgagcaccgctgccaggtacaccggcgcgcctgcgcccacgcgctcggc 172

                    
Query: 478 gtagcggcc 486
           |||| ||||
Sbjct: 171 gtagtggcc 163



to top

>dbj|AK008124.1| Mus musculus adult male small intestine cDNA, RIKEN full-length
           enriched library, clone:2010005I09 product:H2A histone
           family, member X, full insert sequence
          Length = 564

 Score =  113 bits (57), Expect = 7e-22
 Identities = 202/249 (81%), Gaps = 1/249 (0%)
 Strand = Plus / Minus

                                                                       
Query: 238 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 297
           ||||||||| ||||| ||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 427 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 368

                                                                       
Query: 298 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 357
           |||| | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||||||
Sbjct: 367 gccgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 308

                                                                       
Query: 358 gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 417
           ||||||||| ||||||||||| ||   ||| |||||||| || ||||| || | ||| ||
Sbjct: 307 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 248

                                                                       
Query: 418 ggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgctgggc 477
            | |||||||||||| || || || ||||| || || ||||| | ||| ||||||| |||
Sbjct: 247 agtgaggtactcgagcaccgctgccaggtacaccggcgcgcctg-gcccacgcgctcggc 189

                    
Query: 478 gtagcggcc 486
           |||| ||||
Sbjct: 188 gtagtggcc 180



to top

>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete
               sequence
          Length = 30731886

 Score =  113 bits (57), Expect = 7e-22
 Identities = 72/77 (93%)
 Strand = Plus / Minus

                                                                           
Query: 488     ttcttgaggtagcgcccgatgcggccgacggggaactggagaccggccttcacggaccgg 547
               |||||||||||||||||||| |||||||||||||||||||| |||||||| ||||| || 
Sbjct: 7800552 ttcttgaggtagcgcccgatacggccgacggggaactggagcccggccttgacggagcgt 7800493

                                
Query: 548     gtcaccgccttcttcct 564
               |||||||||||||||||
Sbjct: 7800492 gtcaccgccttcttcct 7800476



to top

>dbj|AP005107.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC
             clone:P0431E05
          Length = 146091

 Score =  113 bits (57), Expect = 7e-22
 Identities = 72/77 (93%)
 Strand = Plus / Minus

                                                                         
Query: 488   ttcttgaggtagcgcccgatgcggccgacggggaactggagaccggccttcacggaccgg 547
             |||||||||||||||||||| |||||||||||||||||||| |||||||| ||||| || 
Sbjct: 14934 ttcttgaggtagcgcccgatacggccgacggggaactggagcccggccttgacggagcgt 14875

                              
Query: 548   gtcaccgccttcttcct 564
             |||||||||||||||||
Sbjct: 14874 gtcaccgccttcttcct 14858



to top

>dbj|AP004651.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC
              clone:OSJNBa0091G06
          Length = 161851

 Score =  113 bits (57), Expect = 7e-22
 Identities = 72/77 (93%)
 Strand = Plus / Minus

                                                                          
Query: 488    ttcttgaggtagcgcccgatgcggccgacggggaactggagaccggccttcacggaccgg 547
              |||||||||||||||||||| |||||||||||||||||||| |||||||| ||||| || 
Sbjct: 113050 ttcttgaggtagcgcccgatacggccgacggggaactggagcccggccttgacggagcgt 112991

                               
Query: 548    gtcaccgccttcttcct 564
              |||||||||||||||||
Sbjct: 112990 gtcaccgccttcttcct 112974



to top

>gb|AY104637.1| Zea mays PCO070433 mRNA sequence
          Length = 767

 Score =  113 bits (57), Expect = 7e-22
 Identities = 129/153 (84%)
 Strand = Plus / Minus

                                                                       
Query: 316 gagctcctggtcgttgcggacggcgagaagcaggtggcgcgggatgatgcgggtcttctt 375
           |||||| | ||||||||||||||||||  | | ||||||||| | |||||||||||||||
Sbjct: 395 gagctcttcgtcgttgcggacggcgagctggatgtggcgcggtacgatgcgggtcttctt 336

                                                                       
Query: 376 gttatccttggcggcgttgccggcgagctcaagcacctctgcggcgaggtactcgaggac 435
           ||| ||    || || |||||||| |||||||| ||||| || || || |||||||| ||
Sbjct: 335 gttgtcacgtgccgcattgccggccagctcaagaacctcagcagcaagatactcgagcac 276

                                            
Query: 436 ggcggcgaggtagacaggggcgccggagccgac 468
           ||| |||||||||||||||||||||| ||||||
Sbjct: 275 ggcagcgaggtagacaggggcgccggcgccgac 243



to top

>ref|XM_525084.1| PREDICTED: Pan troglodytes similar to Histone H2A.1 (LOC469700),
           mRNA
          Length = 393

 Score =  111 bits (56), Expect = 3e-21
 Identities = 191/236 (80%)
 Strand = Plus / Minus

                                                                       
Query: 238 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 297
           ||||||||| ||||| ||||  | ||||||||| |  ||||| || || |||||||| ||
Sbjct: 360 cttcttgggcagcagtacggcctggatgttgggcaggacgccaccctgcgcgatggtcac 301

                                                                       
Query: 298 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 357
           || | | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||||||
Sbjct: 300 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 241

                                                                       
Query: 358 gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 417
           ||||||||| ||||||||||| ||    || ||||||||||| ||||| || | ||| ||
Sbjct: 240 gatgatgcgcgtcttcttgttgtcgcgcgccgcgttgccggcaagctccaggatctcggc 181

                                                                   
Query: 418 ggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgct 473
            |  ||||||||||| || ||||| || ||||| |||||||||| ||| |||||||
Sbjct: 180 agtcaggtactcgagcaccgcggccagatagaccggggcgccggcgcccacgcgct 125



to top

>gb|AC034285.6| Mus musculus chromosome 13, clone RP23-220G21, complete sequence
          Length = 209720

 Score =  111 bits (56), Expect = 3e-21
 Identities = 191/236 (80%)
 Strand = Plus / Minus

                                                                         
Query: 238   cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 297
             ||||||||| ||||| ||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 64629 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 64570

                                                                         
Query: 298   gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 357
             || | | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||||||
Sbjct: 64569 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 64510

                                                                         
Query: 358   gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 417
             ||||||||| ||||||||||| ||   ||| |||||||| || ||||| || | ||| ||
Sbjct: 64509 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 64450

                                                                     
Query: 418   ggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgct 473
              |  |||||||| || ||||| || ||||| || |||||||||| ||| |||||||
Sbjct: 64449 cgtcaggtactccagcacggccgccaggtacaccggggcgccggcgcccacgcgct 64394



 Score =  111 bits (56), Expect = 3e-21
 Identities = 191/236 (80%)
 Strand = Plus / Plus

                                                                         
Query: 238   cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 297
             ||||||||| ||||| ||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 60548 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 60607

                                                                         
Query: 298   gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 357
             || | | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||||||
Sbjct: 60608 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 60667

                                                                         
Query: 358   gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 417
             ||||||||| ||||||||||| ||   ||| |||||||| || ||||| || | ||| ||
Sbjct: 60668 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 60727

                                                                     
Query: 418   ggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgct 473
              |  |||||||| || ||||| || ||||| || |||||||||| ||| |||||||
Sbjct: 60728 cgtcaggtactccagcacggccgccaggtacaccggggcgccggcgcccacgcgct 60783



 Score =  103 bits (52), Expect = 7e-19
 Identities = 190/236 (80%)
 Strand = Plus / Plus

                                                                          
Query: 238    cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 297
              ||||||||| ||||| ||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 101108 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 101167

                                                                          
Query: 298    gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 357
              || | | | |||| ||  |||||||| ||||||||||| ||| ||  |||||||||||||
Sbjct: 101168 gcggcccaacagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 101227

                                                                          
Query: 358    gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 417
              ||||||||| ||||||||||| ||   ||| |||||||| || ||||| || | ||| ||
Sbjct: 101228 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 101287

                                                                      
Query: 418    ggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgct 473
               |  |||||||| || ||||| || ||||| || |||||||||| ||| |||||||
Sbjct: 101288 cgtcaggtactccagcacggccgccaggtacaccggggcgccggcgcccacgcgct 101343



to top

>gb|BC068823.1| Xenopus laevis cDNA clone IMAGE:6635737, partial cds
          Length = 763

 Score =  111 bits (56), Expect = 3e-21
 Identities = 173/212 (81%)
 Strand = Plus / Plus

                                                                       
Query: 239 ttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgacg 298
           |||||||||||||| || || | ||||||||| |  || ||||| |||||||||||||| 
Sbjct: 290 ttcttggggagcagcacagactggatgttgggcagaaccccgccctgggcgatggtgacc 349

                                                                       
Query: 299 ccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcggg 358
           ||  |||||||  ||  |||||||| ||||||||| ||||||||  ||||||| |  |||
Sbjct: 350 cctccgagcagtttgttgagctcctcgtcgttgcgcacggcgagctgcaggtgcctgggg 409

                                                                       
Query: 359 atgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgcg 418
           |||||||| |||||||||||||||  ||| ||||||||||| | ||| || | ||| |||
Sbjct: 410 atgatgcgagtcttcttgttatcccgggcagcgttgccggccaactccaggatctcggcg 469

                                           
Query: 419 gcgaggtactcgaggacggcggcgaggtagac 450
           |  || |||||||| || ||||| ||||||||
Sbjct: 470 gtcagatactcgagcaccgcggccaggtagac 501



to top

>ref|NG_002734.1| Mus musculus histone 1, H2aj (Hist1h2aj) pseudogene on chromosome
           13
          Length = 1357

 Score =  111 bits (56), Expect = 3e-21
 Identities = 191/236 (80%)
 Strand = Plus / Minus

                                                                       
Query: 238 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 297
           ||||||||| ||||| ||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 842 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 783

                                                                       
Query: 298 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 357
           || | | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||||||
Sbjct: 782 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 723

                                                                       
Query: 358 gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 417
           ||||||||| ||||||||||| ||   ||| |||||||| || ||||| || | ||| ||
Sbjct: 722 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 663

                                                                   
Query: 418 ggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgct 473
            |  |||||||| || ||||| || ||||| || |||||||||| ||| |||||||
Sbjct: 662 cgtcaggtactccagcacggccgccaggtacaccggggcgccggcgcccacgcgct 607



to top

>gb|BC058544.1| Mus musculus cDNA clone IMAGE:5711765, with apparent retained
           intron
          Length = 497

 Score =  111 bits (56), Expect = 3e-21
 Identities = 191/236 (80%)
 Strand = Plus / Minus

                                                                       
Query: 238 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 297
           ||||||||| ||||| ||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 391 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 332

                                                                       
Query: 298 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 357
           || | | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||||||
Sbjct: 331 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 272

                                                                       
Query: 358 gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 417
           ||||||||| ||||||||||| ||   ||| |||||||| || ||||| || | ||| ||
Sbjct: 271 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 212

                                                                   
Query: 418 ggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgct 473
            |  |||||||| || ||||| || ||||| || |||||||||| ||| |||||||
Sbjct: 211 cgtcaggtactccagcacggccgccaggtacaccggggcgccggcgcccacgcgct 156



to top

>emb|X05863.1|MMHIS2BB Mouse H2B and H2A-pseudo histone genes (291B)
          Length = 1826

 Score =  111 bits (56), Expect = 3e-21
 Identities = 191/236 (80%)
 Strand = Plus / Minus

                                                                        
Query: 238  cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 297
            ||||||||| ||||| ||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 1308 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 1249

                                                                        
Query: 298  gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 357
            || | | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||||||
Sbjct: 1248 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 1189

                                                                        
Query: 358  gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 417
            ||||||||| ||||||||||| ||   ||| |||||||| || ||||| || | ||| ||
Sbjct: 1188 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 1129

                                                                    
Query: 418  ggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgct 473
             |  |||||||| || ||||| || ||||| || |||||||||| ||| |||||||
Sbjct: 1128 cgtcaggtactccagcacggccgccaggtacaccggggcgccggcgcccacgcgct 1073



to top

>emb|X05862.1|MMHIS2BA Mouse H2B and H2A histone genes (291A)
          Length = 1797

 Score =  111 bits (56), Expect = 3e-21
 Identities = 191/236 (80%)
 Strand = Plus / Minus

                                                                        
Query: 238  cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 297
            ||||||||| ||||| ||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 1309 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 1250

                                                                        
Query: 298  gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 357
            || | | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||||||
Sbjct: 1249 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 1190

                                                                        
Query: 358  gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 417
            ||||||||| ||||||||||| ||   ||| |||||||| || ||||| || | ||| ||
Sbjct: 1189 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 1130

                                                                    
Query: 418  ggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgct 473
             |  |||||||| || ||||| || ||||| || |||||||||| ||| |||||||
Sbjct: 1129 cgtcaggtactccagcacggccgccaggtacaccggggcgccggcgcccacgcgct 1074



to top

>gb|BC099406.1| Mus musculus histone 1, H2ac, mRNA (cDNA clone MGC:117571
           IMAGE:30789778), complete cds
          Length = 1075

 Score =  111 bits (56), Expect = 3e-21
 Identities = 191/236 (80%)
 Strand = Plus / Minus

                                                                       
Query: 238 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 297
           ||||||||| ||||| ||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 370 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 311

                                                                       
Query: 298 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 357
           || | | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||||||
Sbjct: 310 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 251

                                                                       
Query: 358 gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 417
           ||||||||| ||||||||||| ||   ||| |||||||| || ||||| || | ||| ||
Sbjct: 250 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 191

                                                                   
Query: 418 ggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgct 473
            |  |||||||| || ||||| || ||||| || |||||||||| ||| |||||||
Sbjct: 190 cgtcaggtactccagcacggccgccaggtacaccggggcgccggcgcccacgcgct 135



to top

>emb|AL589651.8| Mouse DNA sequence from clone RP23-138F20 on chromosome 13 Contains five
              genes for olfactory receptors, a novel gene, the H1f5 gene
              for H1 histone family member 5, three genes and one
              pseudogene for H2a histone family members, four genes for
              H2b, two genes for H4, and two genes for H3 histone family
              members and seven CpG islands, complete sequence
          Length = 222823

 Score =  111 bits (56), Expect = 3e-21
 Identities = 191/236 (80%)
 Strand = Plus / Plus

                                                                          
Query: 238    cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 297
              ||||||||| ||||| ||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 142450 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 142509

                                                                          
Query: 298    gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 357
              || | | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||||||
Sbjct: 142510 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 142569

                                                                          
Query: 358    gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 417
              ||||||||| ||||||||||| ||   ||| |||||||| || ||||| || | ||| ||
Sbjct: 142570 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 142629

                                                                      
Query: 418    ggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgct 473
               |  |||||||| || ||||| || ||||| || |||||||||| ||| |||||||
Sbjct: 142630 cgtcaggtactccagcacggccgccaggtacaccggggcgccggcgcccacgcgct 142685



 Score =  111 bits (56), Expect = 3e-21
 Identities = 191/236 (80%)
 Strand = Plus / Minus

                                                                          
Query: 238    cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 297
              ||||||||| ||||| ||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 137771 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 137712

                                                                          
Query: 298    gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 357
              || | | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||||||
Sbjct: 137711 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 137652

                                                                          
Query: 358    gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 417
              ||||||||| ||||||||||| ||   ||| |||||||| || ||||| || | ||| ||
Sbjct: 137651 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 137592

                                                                      
Query: 418    ggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgct 473
               |  |||||||| || ||||| || ||||| || |||||||||| ||| |||||||
Sbjct: 137591 cgtcaggtactccagcacggccgccaggtacaccggggcgccggcgcccacgcgct 137536



 Score =  103 bits (52), Expect = 7e-19
 Identities = 172/212 (81%)
 Strand = Plus / Plus

                                                                          
Query: 262    gatgttggggatcacgccgccgtgggcgatggtgacgccggcgagcagcctgccgagctc 321
              ||||||||| |  |||||||| || |||||||| |||| | | |||||| ||  ||||||
Sbjct: 207873 gatgttgggcaggacgccgccctgcgcgatggtcacgcggcccagcagcttgttgagctc 207932

                                                                          
Query: 322    ctggtcgttgcggacggcgagaagcaggtggcgcgggatgatgcgggtcttcttgttatc 381
              || ||||||||||| ||| ||  |||||||||||||||||||||| ||||||||||| ||
Sbjct: 207933 ctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtc 207992

                                                                          
Query: 382    cttggcggcgttgccggcgagctcaagcacctctgcggcgaggtactcgaggacggcggc 441
                 ||| |||||||| || ||||| || | ||| || |  |||||||| || ||||| ||
Sbjct: 207993 gcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcacggccgc 208052

                                              
Query: 442    gaggtagacaggggcgccggagccgacgcgct 473
               ||||| || |||||||||| ||| |||||||
Sbjct: 208053 caggtacaccggggcgccggcgcccacgcgct 208084



 Score =  103 bits (52), Expect = 7e-19
 Identities = 190/236 (80%)
 Strand = Plus / Plus

                                                                          
Query: 238    cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 297
              ||||||||| ||||| ||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 174458 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 174517

                                                                          
Query: 298    gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 357
              || | | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||||||
Sbjct: 174518 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 174577

                                                                          
Query: 358    gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 417
              ||| ||||| ||||||||||| ||   ||| |||||||| || ||||| || | ||| ||
Sbjct: 174578 gataatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 174637

                                                                      
Query: 418    ggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgct 473
               |  |||||||| || ||||| || ||||| || |||||||||| ||| |||||||
Sbjct: 174638 cgtcaggtactctagcacggctgccaggtacaccggggcgccggcgcccacgcgct 174693



to top

>emb|AL590388.4| Mouse DNA sequence from clone RP23-480B19 on chromosome 13 Contains the
              Slc17a1 gene for solute carrier family 17 (vesicular
              glutamate transporter) member 1, two genes for novel solute
              carrier family 17 (Slc17) members, two novel genes, the
              gene for a novel C3HC4 type zinc finger (ring finger)
              protein, the gene for an H2a, an H2b, two genes for H3 and
              two genes for H4 histone family members, a H2a histone
              family pseudogene, the H1f1 and  H1f2 genes for H1 histone
              family members 1 and 2, the H3f2 gene for H3 histone
              family, member 2 (H3.2), a novel pseudogene, the Hfe gene
              for hemochromatosis protein (Mr2) and two CpG islands,
              complete sequence
          Length = 186062

 Score =  111 bits (56), Expect = 3e-21
 Identities = 191/236 (80%)
 Strand = Plus / Plus

                                                                          
Query: 238    cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 297
              ||||||||| ||||| ||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 136886 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 136945

                                                                          
Query: 298    gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 357
              || | | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||||||
Sbjct: 136946 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 137005

                                                                          
Query: 358    gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 417
              ||||||||| ||||||||||| ||   ||| |||||||| || ||||| || | ||| ||
Sbjct: 137006 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 137065

                                                                      
Query: 418    ggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgct 473
               |  |||||||| || ||||| || ||||| || |||||||||| ||| |||||||
Sbjct: 137066 cgtcaggtactccagcacggccgccaggtacaccggggcgccggcgcccacgcgct 137121



 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 118/141 (83%)
 Strand = Plus / Minus

                                                                          
Query: 238    cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 297
              ||||||||| ||||| ||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 142180 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 142121

                                                                          
Query: 298    gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 357
              || | | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||||||
Sbjct: 142120 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 142061

                                   
Query: 358    gatgatgcgggtcttcttgtt 378
              ||||||||| |||||||||||
Sbjct: 142060 gatgatgcgcgtcttcttgtt 142040



to top

>gb|BC076498.1| Mus musculus histone 1, H2ae, mRNA (cDNA clone MGC:90847
           IMAGE:5713252), complete cds
          Length = 492

 Score =  111 bits (56), Expect = 3e-21
 Identities = 191/236 (80%)
 Strand = Plus / Minus

                                                                       
Query: 238 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 297
           ||||||||| ||||| ||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 390 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 331

                                                                       
Query: 298 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 357
           || | | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||||||
Sbjct: 330 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 271

                                                                       
Query: 358 gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 417
           ||||||||| ||||||||||| ||   ||| |||||||| || ||||| || | ||| ||
Sbjct: 270 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 211

                                                                   
Query: 418 ggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgct 473
            |  |||||||| || ||||| || ||||| || |||||||||| ||| |||||||
Sbjct: 210 cgtcaggtactccagcacggccgccaggtacaccggggcgccggcgcccacgcgct 155



to top

>dbj|AK146117.1| Mus musculus TIB-55 BB88 cDNA, RIKEN full-length enriched library,
           clone:I730004H15 product:histone 1, H2ai, full insert
           sequence
          Length = 1396

 Score =  111 bits (56), Expect = 3e-21
 Identities = 192/236 (81%), Gaps = 1/236 (0%)
 Strand = Plus / Minus

                                                                       
Query: 238 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 297
           ||||||||| ||||| ||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 371 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 312

                                                                       
Query: 298 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 357
           || ||| |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||||||
Sbjct: 311 gc-ggccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 253

                                                                       
Query: 358 gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 417
           ||||||||| ||||||||||| ||   ||| |||||||| || ||||| || | ||| ||
Sbjct: 252 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 193

                                                                   
Query: 418 ggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgct 473
            |  |||||||| || ||||| || ||||| || |||||||||| ||| |||||||
Sbjct: 192 cgtcaggtactccagcacggccgccaggtacaccggggcgccggcgcccacgcgct 137



to top

>ref|NM_175660.2| Mus musculus histone 1, H2ab (Hist1h2ab), mRNA
          Length = 506

 Score =  111 bits (56), Expect = 3e-21
 Identities = 191/236 (80%)
 Strand = Plus / Minus

                                                                       
Query: 238 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 297
           ||||||||| ||||| ||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 405 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 346

                                                                       
Query: 298 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 357
           || | | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||||||
Sbjct: 345 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 286

                                                                       
Query: 358 gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 417
           ||||||||| ||||||||||| ||   ||| |||||||| || ||||| || | ||| ||
Sbjct: 285 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 226

                                                                   
Query: 418 ggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgct 473
            |  |||||||| || ||||| || ||||| || |||||||||| ||| |||||||
Sbjct: 225 cgtcaggtactccagcacggccgccaggtacaccggggcgccggcgcccacgcgct 170



to top

>gb|BC090402.1| Mus musculus cDNA clone MGC:103288 IMAGE:5150365, complete cds
          Length = 447

 Score =  111 bits (56), Expect = 3e-21
 Identities = 191/236 (80%)
 Strand = Plus / Minus

                                                                       
Query: 238 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 297
           ||||||||| ||||| ||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 372 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 313

                                                                       
Query: 298 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 357
           || | | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||||||
Sbjct: 312 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 253

                                                                       
Query: 358 gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 417
           ||||||||| ||||||||||| ||   ||| |||||||| || ||||| || | ||| ||
Sbjct: 252 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 193

                                                                   
Query: 418 ggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgct 473
            |  |||||||| || ||||| || ||||| || |||||||||| ||| |||||||
Sbjct: 192 cgtcaggtactccagcacggccgccaggtacaccggggcgccggcgcccacgcgct 137



to top

>gb|BC069947.1| Mus musculus cDNA clone IMAGE:6494016
          Length = 2110

 Score =  111 bits (56), Expect = 3e-21
 Identities = 191/236 (80%)
 Strand = Plus / Minus

                                                                       
Query: 238 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 297
           ||||||||| ||||| ||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 630 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 571

                                                                       
Query: 298 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 357
           || | | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||||||
Sbjct: 570 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 511

                                                                       
Query: 358 gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 417
           ||||||||| ||||||||||| ||   ||| |||||||| || ||||| || | ||| ||
Sbjct: 510 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 451

                                                                   
Query: 418 ggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgct 473
            |  |||||||| || ||||| || ||||| || |||||||||| ||| |||||||
Sbjct: 450 cgtcaggtactccagcacggccgccaggtacaccggggcgccggcgcccacgcgct 395



to top

>gb|BC055904.1| Mus musculus cDNA clone IMAGE:4913108
          Length = 2221

 Score =  111 bits (56), Expect = 3e-21
 Identities = 191/236 (80%)
 Strand = Plus / Minus

                                                                       
Query: 238 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 297
           ||||||||| ||||| ||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 628 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 569

                                                                       
Query: 298 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 357
           || | | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||||||
Sbjct: 568 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 509

                                                                       
Query: 358 gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 417
           ||||||||| ||||||||||| ||   ||| |||||||| || ||||| || | ||| ||
Sbjct: 508 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 449

                                                                   
Query: 418 ggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgct 473
            |  |||||||| || ||||| || ||||| || |||||||||| ||| |||||||
Sbjct: 448 cgtcaggtactccagcacggccgccaggtacaccggggcgccggcgcccacgcgct 393



to top

>ref|NM_178187.2| Mus musculus histone 1, H2ae (Hist1h2ae), mRNA
          Length = 705

 Score =  111 bits (56), Expect = 3e-21
 Identities = 191/236 (80%)
 Strand = Plus / Minus

                                                                       
Query: 238 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 297
           ||||||||| ||||| ||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 473 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 414

                                                                       
Query: 298 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 357
           || | | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||||||
Sbjct: 413 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 354

                                                                       
Query: 358 gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 417
           ||||||||| ||||||||||| ||   ||| |||||||| || ||||| || | ||| ||
Sbjct: 353 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 294

                                                                   
Query: 418 ggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgct 473
            |  |||||||| || ||||| || ||||| || |||||||||| ||| |||||||
Sbjct: 293 cgtcaggtactccagcacggccgccaggtacaccggggcgccggcgcccacgcgct 238



to top

>ref|NM_178188.3| Mus musculus histone 1, H2ad (Hist1h2ad), mRNA
          Length = 393

 Score =  111 bits (56), Expect = 3e-21
 Identities = 191/236 (80%)
 Strand = Plus / Minus

                                                                       
Query: 238 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 297
           ||||||||| ||||| ||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 360 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 301

                                                                       
Query: 298 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 357
           || | | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||||||
Sbjct: 300 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 241

                                                                       
Query: 358 gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 417
           ||||||||| ||||||||||| ||   ||| |||||||| || ||||| || | ||| ||
Sbjct: 240 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 181

                                                                   
Query: 418 ggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgct 473
            |  |||||||| || ||||| || ||||| || |||||||||| ||| |||||||
Sbjct: 180 cgtcaggtactccagcacggccgccaggtacaccggggcgccggcgcccacgcgct 125



to top

>gb|U62669.1|MMU62669 Mus musculus histone H3.2-F (H3-F), histone H2a.1-F (H2a-F), histone
            H2b-F (H2b-F) genes, complete cds
          Length = 2822

 Score =  111 bits (56), Expect = 3e-21
 Identities = 191/236 (80%)
 Strand = Plus / Plus

                                                                        
Query: 238  cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 297
            ||||||||| ||||| ||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 1469 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 1528

                                                                        
Query: 298  gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 357
            || | | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||||||
Sbjct: 1529 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 1588

                                                                        
Query: 358  gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 417
            ||||||||| ||||||||||| ||   ||| |||||||| || ||||| || | ||| ||
Sbjct: 1589 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 1648

                                                                    
Query: 418  ggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgct 473
             |  |||||||| || ||||| || ||||| || |||||||||| ||| |||||||
Sbjct: 1649 cgtcaggtactccagcacggccgccaggtacaccggggcgccggcgcccacgcgct 1704



to top

>dbj|AK028026.1| Mus musculus 18-day embryo whole body cDNA, RIKEN full-length
           enriched library, clone:1190022L06 product:HISTONE H2A
           homolog [Homo sapiens], full insert sequence
          Length = 705

 Score =  111 bits (56), Expect = 3e-21
 Identities = 191/236 (80%)
 Strand = Plus / Minus

                                                                       
Query: 238 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 297
           ||||||||| ||||| ||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 473 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 414

                                                                       
Query: 298 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 357
           || | | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||||||
Sbjct: 413 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 354

                                                                       
Query: 358 gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 417
           ||||||||| ||||||||||| ||   ||| |||||||| || ||||| || | ||| ||
Sbjct: 353 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 294

                                                                   
Query: 418 ggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgct 473
            |  |||||||| || ||||| || ||||| || |||||||||| ||| |||||||
Sbjct: 293 cgtcaggtactccagcacggccgccaggtacaccggggcgccggcgcccacgcgct 238



to top

>ref|NM_178182.1| Mus musculus histone 1, H2ai (Hist1h2ai), mRNA
          Length = 393

 Score =  111 bits (56), Expect = 3e-21
 Identities = 191/236 (80%)
 Strand = Plus / Minus

                                                                       
Query: 238 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 297
           ||||||||| ||||| ||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 360 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 301

                                                                       
Query: 298 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 357
           || | | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||||||
Sbjct: 300 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 241

                                                                       
Query: 358 gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 417
           ||||||||| ||||||||||| ||   ||| |||||||| || ||||| || | ||| ||
Sbjct: 240 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 181

                                                                   
Query: 418 ggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgct 473
            |  |||||||| || ||||| || ||||| || |||||||||| ||| |||||||
Sbjct: 180 cgtcaggtactccagcacggccgccaggtacaccggggcgccggcgcccacgcgct 125



to top

>gb|AY158920.1| Mus musculus histone protein Hist1h2ab gene, complete cds
          Length = 1390

 Score =  111 bits (56), Expect = 3e-21
 Identities = 191/236 (80%)
 Strand = Plus / Minus

                                                                       
Query: 238 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 297
           ||||||||| ||||| ||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 860 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 801

                                                                       
Query: 298 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 357
           || | | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||||||
Sbjct: 800 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 741

                                                                       
Query: 358 gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 417
           ||||||||| ||||||||||| ||   ||| |||||||| || ||||| || | ||| ||
Sbjct: 740 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 681

                                                                   
Query: 418 ggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgct 473
            |  |||||||| || ||||| || ||||| || |||||||||| ||| |||||||
Sbjct: 680 cgtcaggtactccagcacggccgccaggtacaccggggcgccggcgcccacgcgct 625



to top

>gb|AY158918.1| Mus musculus histone protein Hist1h2ad gene, complete cds
          Length = 1390

 Score =  111 bits (56), Expect = 3e-21
 Identities = 191/236 (80%)
 Strand = Plus / Minus

                                                                       
Query: 238 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 297
           ||||||||| ||||| ||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 860 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 801

                                                                       
Query: 298 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 357
           || | | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||||||
Sbjct: 800 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 741

                                                                       
Query: 358 gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 417
           ||||||||| ||||||||||| ||   ||| |||||||| || ||||| || | ||| ||
Sbjct: 740 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 681

                                                                   
Query: 418 ggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgct 473
            |  |||||||| || ||||| || ||||| || |||||||||| ||| |||||||
Sbjct: 680 cgtcaggtactccagcacggccgccaggtacaccggggcgccggcgcccacgcgct 625



to top

>gb|AY158917.1| Mus musculus histone protein Hist1h2ae gene, complete cds
          Length = 1390

 Score =  111 bits (56), Expect = 3e-21
 Identities = 191/236 (80%)
 Strand = Plus / Minus

                                                                       
Query: 238 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 297
           ||||||||| ||||| ||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 860 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 801

                                                                       
Query: 298 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 357
           || | | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||||||
Sbjct: 800 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 741

                                                                       
Query: 358 gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 417
           ||||||||| ||||||||||| ||   ||| |||||||| || ||||| || | ||| ||
Sbjct: 740 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 681

                                                                   
Query: 418 ggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgct 473
            |  |||||||| || ||||| || ||||| || |||||||||| ||| |||||||
Sbjct: 680 cgtcaggtactccagcacggccgccaggtacaccggggcgccggcgcccacgcgct 625



to top

>gb|AY158914.1| Mus musculus histone protein Hist1h2ah gene, complete cds
          Length = 1381

 Score =  111 bits (56), Expect = 3e-21
 Identities = 191/236 (80%)
 Strand = Plus / Minus

                                                                       
Query: 238 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 297
           ||||||||| ||||| ||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 857 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 798

                                                                       
Query: 298 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 357
           || | | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||||||
Sbjct: 797 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 738

                                                                       
Query: 358 gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 417
           ||||||||| ||||||||||| ||   ||| |||||||| || ||||| || | ||| ||
Sbjct: 737 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 678

                                                                   
Query: 418 ggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgct 473
            |  |||||||| || ||||| || ||||| || |||||||||| ||| |||||||
Sbjct: 677 cgtcaggtactccagcacggccgccaggtacaccggggcgccggcgcccacgcgct 622



to top

>gb|AY158910.1| Mus musculus histone protein Hist1h2aj pseudogene, partial sequence
          Length = 1357

 Score =  111 bits (56), Expect = 3e-21
 Identities = 191/236 (80%)
 Strand = Plus / Minus

                                                                       
Query: 238 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 297
           ||||||||| ||||| ||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 842 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 783

                                                                       
Query: 298 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 357
           || | | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||||||
Sbjct: 782 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 723

                                                                       
Query: 358 gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 417
           ||||||||| ||||||||||| ||   ||| |||||||| || ||||| || | ||| ||
Sbjct: 722 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 663

                                                                   
Query: 418 ggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgct 473
            |  |||||||| || ||||| || ||||| || |||||||||| ||| |||||||
Sbjct: 662 cgtcaggtactccagcacggccgccaggtacaccggggcgccggcgcccacgcgct 607



to top

>gb|AY158909.1| Mus musculus histone protein Hist1h2ai gene, complete cds
          Length = 1387

 Score =  111 bits (56), Expect = 3e-21
 Identities = 191/236 (80%)
 Strand = Plus / Minus

                                                                       
Query: 238 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 297
           ||||||||| ||||| ||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 857 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 798

                                                                       
Query: 298 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 357
           || | | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||||||
Sbjct: 797 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 738

                                                                       
Query: 358 gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 417
           ||||||||| ||||||||||| ||   ||| |||||||| || ||||| || | ||| ||
Sbjct: 737 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 678

                                                                   
Query: 418 ggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgct 473
            |  |||||||| || ||||| || ||||| || |||||||||| ||| |||||||
Sbjct: 677 cgtcaggtactccagcacggccgccaggtacaccggggcgccggcgcccacgcgct 622



to top

>ref|NM_175659.1| Mus musculus histone 1, H2ah (Hist1h2ah), mRNA
          Length = 387

 Score =  111 bits (56), Expect = 3e-21
 Identities = 191/236 (80%)
 Strand = Plus / Minus

                                                                       
Query: 238 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 297
           ||||||||| ||||| ||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 360 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 301

                                                                       
Query: 298 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 357
           || | | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||||||
Sbjct: 300 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 241

                                                                       
Query: 358 gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 417
           ||||||||| ||||||||||| ||   ||| |||||||| || ||||| || | ||| ||
Sbjct: 240 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 181

                                                                   
Query: 418 ggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgct 473
            |  |||||||| || ||||| || ||||| || |||||||||| ||| |||||||
Sbjct: 180 cgtcaggtactccagcacggccgccaggtacaccggggcgccggcgcccacgcgct 125



to top

>gb|M37736.1|MUSHIS2AR Mouse replication-dependent histone H2A.1 gene
          Length = 668

 Score =  111 bits (56), Expect = 3e-21
 Identities = 191/236 (80%)
 Strand = Plus / Minus

                                                                       
Query: 238 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 297
           ||||||||| ||||| ||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 483 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 424

                                                                       
Query: 298 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 357
           || | | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||||||
Sbjct: 423 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 364

                                                                       
Query: 358 gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 417
           ||||||||| ||||||||||| ||   ||| |||||||| || ||||| || | ||| ||
Sbjct: 363 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 304

                                                                   
Query: 418 ggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgct 473
            |  |||||||| || ||||| || ||||| || |||||||||| ||| |||||||
Sbjct: 303 cgtcaggtactccagcacggccgccaggtacaccggggcgccggcgcccacgcgct 248



to top

>dbj|AK088040.1| Mus musculus 2 days neonate thymus thymic cells cDNA, RIKEN
           full-length enriched library, clone:E430002L09
           product:H2A histone family, member X, full insert
           sequence
          Length = 1379

 Score =  109 bits (55), Expect = 1e-20
 Identities = 160/195 (82%)
 Strand = Plus / Minus

                                                                       
Query: 238 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 297
           ||||||||| ||||| ||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 430 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 371

                                                                       
Query: 298 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 357
           |||| | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||||||
Sbjct: 370 gccgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 311

                                                                       
Query: 358 gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 417
           ||||||||| ||||||||||| ||   ||| |||||||| || ||||| || | ||| ||
Sbjct: 310 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 251

                          
Query: 418 ggcgaggtactcgag 432
            | ||||||||||||
Sbjct: 250 agtgaggtactcgag 236



to top

>gb|M31922.1|VVCH4AB V.carteri histone H2A-IV and H2B-IV genes, complete cds
          Length = 2132

 Score =  109 bits (55), Expect = 1e-20
 Identities = 241/303 (79%)
 Strand = Plus / Plus

                                                                       
Query: 235 ggacttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggt 294
           |||||||||||| |||||||||| ||  |||||||| | ||| ||||||   || |||||
Sbjct: 468 ggacttcttgggcagcagaacggcgtgaatgttgggcagcacaccgccggacgcaatggt 527

                                                                       
Query: 295 gacgccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcg 354
            ||| || | |||||| |||| ||||||| ||||||||||| ||||||  | | ||||||
Sbjct: 528 cacgtcgcccagcagcttgcccagctcctcgtcgttgcggatggcgagctggatgtggcg 587

                                                                       
Query: 355 cgggatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctc 414
           ||||| ||||||| |||||||||| ||   ||| |||||||| || ||||| || |||||
Sbjct: 588 cgggacgatgcggttcttcttgttgtcgcgggccgcgttgccagccagctccagaacctc 647

                                                                       
Query: 415 tgcggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgctg 474
            || |  |||||||| || || ||||| |||||||| |||||||| |  |||| ||||| 
Sbjct: 648 agcagtcaggtactccagcacagcggccaggtagacgggggcgccagcaccgatgcgctc 707

                                                                       
Query: 475 ggcgtagcggcccttcttgaggtagcgcccgatgcggccgacggggaactggagaccggc 534
           ||| ||   ||||||||| | ||| ||  | |||||||| || |||||||| ||||| ||
Sbjct: 708 ggcatacttgcccttcttcaagtaacgagcaatgcggcccacagggaactgcagaccagc 767

              
Query: 535 ctt 537
           |||
Sbjct: 768 ctt 770



to top

>gb|AF255740.1|AF255740 Bufo bufo gagarizans histone H1 (H1) and histone H2A variant (H2AInr)
            genes, complete cds
          Length = 2396

 Score =  107 bits (54), Expect = 5e-20
 Identities = 197/244 (80%), Gaps = 3/244 (1%)
 Strand = Plus / Minus

                                                                        
Query: 238  cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 297
            ||||||||| ||||| ||||  | ||||||||| |  |||||||| ||||||||||||||
Sbjct: 1584 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgggcgatggtgac 1525

                                                                        
Query: 298  gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 357
             ||| | |||||| ||  |||||||| ||||||||| ||||| ||  ||||||| || ||
Sbjct: 1524 tccgcccagcagcttgttgagctcctcgtcgttgcgcacggccagctgcaggtgacgggg 1465

                                                                        
Query: 358  gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 417
            |||||||||||   ||||||| ||   |||||| |||||||| ||||| || | ||| ||
Sbjct: 1464 gatgatgcggg---tcttgttgtcgcgggcggcattgccggccagctccaggatctcggc 1408

                                                                        
Query: 418  ggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgctgggc 477
            || ||| |||||||| || ||||| | |||||| || ||||||| ||| || | ||||||
Sbjct: 1407 ggtgagatactcgagcacagcggccaagtagacgggagcgccggcgcccaccctctgggc 1348

                
Query: 478  gtag 481
            ||||
Sbjct: 1347 gtag 1344



to top

>gb|U70133.1|BBU70133 Bufo bufo gagarizans replication-dependent histone H2A mRNA,
           complete cds
          Length = 466

 Score =  107 bits (54), Expect = 5e-20
 Identities = 162/198 (81%)
 Strand = Plus / Minus

                                                                       
Query: 284 tgggcgatggtgacgccggcgagcagcctgccgagctcctggtcgttgcggacggcgaga 343
           |||||||||||||| ||| | |||||| ||  |||||||| ||||||||| ||||| || 
Sbjct: 335 tgggcgatggtgactccgcccagcagcttgttgagctcctcgtcgttgcgcacggccagc 276

                                                                       
Query: 344 agcaggtggcgcgggatgatgcgggtcttcttgttatccttggcggcgttgccggcgagc 403
            ||||||| || ||||||||||| ||||||||||| ||   |||||| |||||||| |||
Sbjct: 275 tgcaggtgacgggggatgatgcgagtcttcttgttgtcgcgggcggcattgccggccagc 216

                                                                       
Query: 404 tcaagcacctctgcggcgaggtactcgaggacggcggcgaggtagacaggggcgccggag 463
           || || | ||| |||| ||| |||||||| || ||||| | |||||| || ||||||| |
Sbjct: 215 tccaggatctcggcggtgagatactcgagcacagcggccaagtagacgggagcgccggcg 156

                             
Query: 464 ccgacgcgctgggcgtag 481
           || || | ||||||||||
Sbjct: 155 cccaccctctgggcgtag 138



to top

>ref|XM_522264.1| PREDICTED: Pan troglodytes similar to Histone H2A.x (H2a/x)
           (LOC466864), mRNA
          Length = 432

 Score =  105 bits (53), Expect = 2e-19
 Identities = 203/253 (80%)
 Strand = Plus / Minus

                                                                       
Query: 238 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 297
           ||||||||| ||||| ||||  | ||||||||| |  ||||| || |||||||| || ||
Sbjct: 360 cttcttgggcagcagcacggcctggatgttgggcaggacgcctccctgggcgatcgtcac 301

                                                                       
Query: 298 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 357
           |||| | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||| ||
Sbjct: 300 gccgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgggg 241

                                                                       
Query: 358 gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 417
           |||||| || ||||||||||| ||   ||| || ||||| || ||||| || | ||| ||
Sbjct: 240 gatgattcgcgtcttcttgttgtcgcgggccgcattgcccgccagctccaggatctcagc 181

                                                                       
Query: 418 ggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgctgggc 477
           || ||||||||| || || || || ||||| || || ||||||| ||| ||||||| |||
Sbjct: 180 ggtgaggtactccagcactgccgccaggtacactggcgcgccggcgccaacgcgctcggc 121

                        
Query: 478 gtagcggcccttc 490
           |||| ||||||||
Sbjct: 120 gtagtggcccttc 108



to top

>gb|BC004915.2| Homo sapiens H2A histone family, member X, mRNA (cDNA clone
           MGC:4759 IMAGE:3537648), complete cds
          Length = 1580

 Score =  105 bits (53), Expect = 2e-19
 Identities = 203/253 (80%)
 Strand = Plus / Minus

                                                                       
Query: 238 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 297
           ||||||||| ||||| ||||  | ||||||||| |  ||||| || |||||||| || ||
Sbjct: 403 cttcttgggcagcagcacggcctggatgttgggcaggacgcctccctgggcgatcgtcac 344

                                                                       
Query: 298 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 357
           |||| | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||| ||
Sbjct: 343 gccgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgggg 284

                                                                       
Query: 358 gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 417
           |||||| || ||||||||||| ||   ||| || ||||| || ||||| || | ||| ||
Sbjct: 283 gatgattcgcgtcttcttgttgtcgcgggccgcattgcccgccagctccaggatctcagc 224

                                                                       
Query: 418 ggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgctgggc 477
           || ||||||||| || || || || ||||| || || ||||||| ||| ||||||| |||
Sbjct: 223 ggtgaggtactccagcactgccgccaggtacactggcgcgccggcgccaacgcgctcggc 164

                        
Query: 478 gtagcggcccttc 490
           |||| ||||||||
Sbjct: 163 gtagtggcccttc 151



to top

>ref|XM_848163.1| PREDICTED: Canis familiaris similar to Histone H2A.x (H2a/x)
           (LOC489372), mRNA
          Length = 841

 Score =  105 bits (53), Expect = 2e-19
 Identities = 203/253 (80%)
 Strand = Plus / Minus

                                                                       
Query: 238 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 297
           ||||||||| ||||| ||||  | ||||||||| |  ||||| || || ||||| || ||
Sbjct: 657 cttcttgggcagcagcacggcctggatgttgggcaggacgcctccctgcgcgatcgtcac 598

                                                                       
Query: 298 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 357
           |||| | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||| ||
Sbjct: 597 gccgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgggg 538

                                                                       
Query: 358 gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 417
           ||||||||| ||||||||||| ||   ||| |||||||| || ||||| || | ||| ||
Sbjct: 537 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 478

                                                                       
Query: 418 ggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgctgggc 477
            |  ||||||||||| ||||| || ||||| || || ||||||| ||| || |||| |||
Sbjct: 477 cgtcaggtactcgagcacggccgccaggtacaccggcgcgccggcgcccacccgctcggc 418

                        
Query: 478 gtagcggcccttc 490
           |||| ||||||||
Sbjct: 417 gtagtggcccttc 405



to top

>ref|NM_002105.2| Homo sapiens H2A histone family, member X (H2AFX), mRNA
          Length = 1651

 Score =  105 bits (53), Expect = 2e-19
 Identities = 203/253 (80%)
 Strand = Plus / Minus

                                                                       
Query: 238 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 297
           ||||||||| ||||| ||||  | ||||||||| |  ||||| || |||||||| || ||
Sbjct: 433 cttcttgggcagcagcacggcctggatgttgggcaggacgcctccctgggcgatcgtcac 374

                                                                       
Query: 298 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 357
           |||| | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||| ||
Sbjct: 373 gccgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgggg 314

                                                                       
Query: 358 gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 417
           |||||| || ||||||||||| ||   ||| || ||||| || ||||| || | ||| ||
Sbjct: 313 gatgattcgcgtcttcttgttgtcgcgggccgcattgcccgccagctccaggatctcagc 254

                                                                       
Query: 418 ggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgctgggc 477
           || ||||||||| || || || || ||||| || || ||||||| ||| ||||||| |||
Sbjct: 253 ggtgaggtactccagcactgccgccaggtacactggcgcgccggcgccaacgcgctcggc 194

                        
Query: 478 gtagcggcccttc 490
           |||| ||||||||
Sbjct: 193 gtagtggcccttc 181



to top

>emb|BX063165.1|CNS09KWH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC44DD07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 902

 Score =  105 bits (53), Expect = 2e-19
 Identities = 119/141 (84%)
 Strand = Plus / Plus

                                                                       
Query: 238 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 297
           ||||||||| ||||| ||||  | ||||||||| | ||||||||| ||||||||||| ||
Sbjct: 524 cttcttgggcagcagcacggcctggatgttgggcagcacgccgccctgggcgatggtcac 583

                                                                       
Query: 298 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 357
            ||||  |||||| ||   ||||||| ||||||||||| ||| ||  |||||||||||||
Sbjct: 584 cccggacagcagcttgttcagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 643

                                
Query: 358 gatgatgcgggtcttcttgtt 378
           ||||||||| |||||||||||
Sbjct: 644 gatgatgcgcgtcttcttgtt 664



to top

>emb|BX063164.1|CNS09KWG Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC44DD07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 924

 Score =  105 bits (53), Expect = 2e-19
 Identities = 119/141 (84%)
 Strand = Plus / Minus

                                                                       
Query: 238 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 297
           ||||||||| ||||| ||||  | ||||||||| | ||||||||| ||||||||||| ||
Sbjct: 477 cttcttgggcagcagcacggcctggatgttgggcagcacgccgccctgggcgatggtcac 418

                                                                       
Query: 298 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 357
            ||||  |||||| ||   ||||||| ||||||||||| ||| ||  |||||||||||||
Sbjct: 417 cccggacagcagcttgttcagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 358

                                
Query: 358 gatgatgcgggtcttcttgtt 378
           ||||||||| |||||||||||
Sbjct: 357 gatgatgcgcgtcttcttgtt 337



to top

>emb|BX040864.1|CNS093P0 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC11DG02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 972

 Score =  105 bits (53), Expect = 2e-19
 Identities = 119/141 (84%)
 Strand = Plus / Minus

                                                                       
Query: 238 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 297
           ||||||||| ||||| ||||  | ||||||||| | ||||||||| ||||||||||| ||
Sbjct: 470 cttcttgggcagcagcacggcctggatgttgggcagcacgccgccctgggcgatggtcac 411

                                                                       
Query: 298 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 357
            ||||  |||||| ||   ||||||| ||||||||||| ||| ||  |||||||||||||
Sbjct: 410 cccggacagcagcttgttcagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 351

                                
Query: 358 gatgatgcgggtcttcttgtt 378
           ||||||||| |||||||||||
Sbjct: 350 gatgatgcgcgtcttcttgtt 330



to top

>emb|BX019683.1|CNS08NCN Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA3AB10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 651

 Score =  105 bits (53), Expect = 2e-19
 Identities = 119/141 (84%)
 Strand = Plus / Minus

                                                                       
Query: 238 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 297
           ||||||||| ||||| ||||  | ||||||||| | ||||||||| ||||||||||| ||
Sbjct: 481 cttcttgggcagcagcacggcctggatgttgggcagcacgccgccctgggcgatggtcac 422

                                                                       
Query: 298 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 357
            ||||  |||||| ||   ||||||| ||||||||||| ||| ||  |||||||||||||
Sbjct: 421 cccggacagcagcttgttcagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 362

                                
Query: 358 gatgatgcgggtcttcttgtt 378
           ||||||||| |||||||||||
Sbjct: 361 gatgatgcgcgtcttcttgtt 341



to top

>emb|BX016451.1|CNS08KUV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA24CG10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 556

 Score =  105 bits (53), Expect = 2e-19
 Identities = 119/141 (84%)
 Strand = Plus / Minus

                                                                       
Query: 238 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 297
           ||||||||| ||||| ||||  | ||||||||| | ||||||||| ||||||||||| ||
Sbjct: 404 cttcttgggcagcagcacggcctggatgttgggcagcacgccgccctgggcgatggtcac 345

                                                                       
Query: 298 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 357
            ||||  |||||| ||   ||||||| ||||||||||| ||| ||  |||||||||||||
Sbjct: 344 cccggacagcagcttgttcagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 285

                                
Query: 358 gatgatgcgggtcttcttgtt 378
           ||||||||| |||||||||||
Sbjct: 284 gatgatgcgcgtcttcttgtt 264



to top

>emb|BX009846.1|CNS08FRE Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA15DF01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 357

 Score =  105 bits (53), Expect = 2e-19
 Identities = 119/141 (84%)
 Strand = Plus / Plus

                                                                       
Query: 238 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 297
           ||||||||| ||||| ||||  | ||||||||| | ||||||||| ||||||||||| ||
Sbjct: 117 cttcttgggcagcagcacggcctggatgttgggcagcacgccgccctgggcgatggtcac 176

                                                                       
Query: 298 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 357
            ||||  |||||| ||   ||||||| ||||||||||| ||| ||  |||||||||||||
Sbjct: 177 cccggacagcagcttgttcagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 236

                                
Query: 358 gatgatgcgggtcttcttgtt 378
           ||||||||| |||||||||||
Sbjct: 237 gatgatgcgcgtcttcttgtt 257



to top

>emb|X14850.1|HSH2AX Human H2A.X mRNA encoding histone H2A.X
          Length = 1585

 Score =  105 bits (53), Expect = 2e-19
 Identities = 203/253 (80%)
 Strand = Plus / Minus

                                                                       
Query: 238 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 297
           ||||||||| ||||| ||||  | ||||||||| |  ||||| || |||||||| || ||
Sbjct: 433 cttcttgggcagcagcacggcctggatgttgggcaggacgcctccctgggcgatcgtcac 374

                                                                       
Query: 298 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 357
           |||| | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||| ||
Sbjct: 373 gccgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgggg 314

                                                                       
Query: 358 gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 417
           |||||| || ||||||||||| ||   ||| || ||||| || ||||| || | ||| ||
Sbjct: 313 gatgattcgcgtcttcttgttgtcgcgggccgcattgcccgccagctccaggatctcagc 254

                                                                       
Query: 418 ggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgctgggc 477
           || ||||||||| || || || || ||||| || || ||||||| ||| ||||||| |||
Sbjct: 253 ggtgaggtactccagcactgccgccaggtacactggcgcgccggcgccaacgcgctcggc 194

                        
Query: 478 gtagcggcccttc 490
           |||| ||||||||
Sbjct: 193 gtagtggcccttc 181



to top

>gb|BC013416.2| Homo sapiens H2A histone family, member X, mRNA (cDNA clone
           MGC:4703 IMAGE:3534359), complete cds
          Length = 1616

 Score =  105 bits (53), Expect = 2e-19
 Identities = 203/253 (80%)
 Strand = Plus / Minus

                                                                       
Query: 238 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 297
           ||||||||| ||||| ||||  | ||||||||| |  ||||| || |||||||| || ||
Sbjct: 398 cttcttgggcagcagcacggcctggatgttgggcaggacgcctccctgggcgatcgtcac 339

                                                                       
Query: 298 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 357
           |||| | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||| ||
Sbjct: 338 gccgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgggg 279

                                                                       
Query: 358 gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 417
           |||||| || ||||||||||| ||   ||| || ||||| || ||||| || | ||| ||
Sbjct: 278 gatgattcgcgtcttcttgttgtcgcgggccgcattgcccgccagctccaggatctcagc 219

                                                                       
Query: 418 ggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgctgggc 477
           || ||||||||| || || || || ||||| || || ||||||| ||| ||||||| |||
Sbjct: 218 ggtgaggtactccagcactgccgccaggtacactggcgcgccggcgccaacgcgctcggc 159

                        
Query: 478 gtagcggcccttc 490
           |||| ||||||||
Sbjct: 158 gtagtggcccttc 146



to top

>emb|CR605072.1| full-length cDNA clone CS0DD007YB20 of Neuroblastoma Cot
           50-normalized of Homo sapiens (human)
          Length = 1373

 Score =  105 bits (53), Expect = 2e-19
 Identities = 203/253 (80%)
 Strand = Plus / Minus

                                                                       
Query: 238 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 297
           ||||||||| ||||| ||||  | ||||||||| |  ||||| || |||||||| || ||
Sbjct: 415 cttcttgggcagcagcacggcctggatgttgggcaggacgcctccctgggcgatcgtcac 356

                                                                       
Query: 298 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 357
           |||| | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||| ||
Sbjct: 355 gccgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgggg 296

                                                                       
Query: 358 gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 417
           |||||| || ||||||||||| ||   ||| || ||||| || ||||| || | ||| ||
Sbjct: 295 gatgattcgcgtcttcttgttgtcgcgggccgcattgcccgccagctccaggatctcagc 236

                                                                       
Query: 418 ggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgctgggc 477
           || ||||||||| || || || || ||||| || || ||||||| ||| ||||||| |||
Sbjct: 235 ggtgaggtactccagcactgccgccaggtacactggcgcgccggcgccaacgcgctcggc 176

                        
Query: 478 gtagcggcccttc 490
           |||| ||||||||
Sbjct: 175 gtagtggcccttc 163



to top

>gb|DQ015918.1| Homo sapiens H2A histone family, member X (H2AFX) gene, complete cds
          Length = 5462

 Score =  105 bits (53), Expect = 2e-19
 Identities = 203/253 (80%)
 Strand = Plus / Minus

                                                                        
Query: 238  cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 297
            ||||||||| ||||| ||||  | ||||||||| |  ||||| || |||||||| || ||
Sbjct: 2431 cttcttgggcagcagcacggcctggatgttgggcaggacgcctccctgggcgatcgtcac 2372

                                                                        
Query: 298  gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 357
            |||| | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||| ||
Sbjct: 2371 gccgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgggg 2312

                                                                        
Query: 358  gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 417
            |||||| || ||||||||||| ||   ||| || ||||| || ||||| || | ||| ||
Sbjct: 2311 gatgattcgcgtcttcttgttgtcgcgggccgcattgcccgccagctccaggatctcagc 2252

                                                                        
Query: 418  ggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgctgggc 477
            || ||||||||| || || || || ||||| || || ||||||| ||| ||||||| |||
Sbjct: 2251 ggtgaggtactccagcactgccgccaggtacactggcgcgccggcgccaacgcgctcggc 2192

                         
Query: 478  gtagcggcccttc 490
            |||| ||||||||
Sbjct: 2191 gtagtggcccttc 2179



to top

>gb|AC119796.2| Oryza sativa (japonica cultivar-group) chromosome 3 clone OJ1172F09,
             complete sequence
          Length = 106057

 Score =  105 bits (53), Expect = 2e-19
 Identities = 71/77 (92%)
 Strand = Plus / Minus

                                                                         
Query: 488   ttcttgaggtagcgcccgatgcggccgacggggaactggagaccggccttcacggaccgg 547
             |||||||||||||||||||| |||||||||||||| ||||| |||||||| ||||| || 
Sbjct: 36517 ttcttgaggtagcgcccgatacggccgacggggaattggagcccggccttgacggagcgc 36458

                              
Query: 548   gtcaccgccttcttcct 564
             |||||||||||||||||
Sbjct: 36457 gtcaccgccttcttcct 36441



to top

>gb|BC011694.2| Homo sapiens H2A histone family, member X, mRNA (cDNA clone
           MGC:19656 IMAGE:3139343), complete cds
          Length = 1589

 Score =  105 bits (53), Expect = 2e-19
 Identities = 203/253 (80%)
 Strand = Plus / Minus

                                                                       
Query: 238 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 297
           ||||||||| ||||| ||||  | ||||||||| |  ||||| || |||||||| || ||
Sbjct: 413 cttcttgggcagcagcacggcctggatgttgggcaggacgcctccctgggcgatcgtcac 354

                                                                       
Query: 298 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 357
           |||| | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||| ||
Sbjct: 353 gccgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgggg 294

                                                                       
Query: 358 gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 417
           |||||| || ||||||||||| ||   ||| || ||||| || ||||| || | ||| ||
Sbjct: 293 gatgattcgcgtcttcttgttgtcgcgggccgcattgcccgccagctccaggatctcagc 234

                                                                       
Query: 418 ggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgctgggc 477
           || ||||||||| || || || || ||||| || || ||||||| ||| ||||||| |||
Sbjct: 233 ggtgaggtactccagcactgccgccaggtacactggcgcgccggcgccaacgcgctcggc 174

                        
Query: 478 gtagcggcccttc 490
           |||| ||||||||
Sbjct: 173 gtagtggcccttc 161



to top

>dbj|AP003391.1| Homo sapiens genomic DNA, chromosome 11q clone:CTD-2589C9, complete
             sequences
          Length = 46239

 Score =  105 bits (53), Expect = 2e-19
 Identities = 203/253 (80%)
 Strand = Plus / Plus

                                                                         
Query: 238   cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 297
             ||||||||| ||||| ||||  | ||||||||| |  ||||| || |||||||| || ||
Sbjct: 9807  cttcttgggcagcagcacggcctggatgttgggcaggacgcctccctgggcgatcgtcac 9866

                                                                         
Query: 298   gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 357
             |||| | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||| ||
Sbjct: 9867  gccgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgggg 9926

                                                                         
Query: 358   gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 417
             |||||| || ||||||||||| ||   ||| || ||||| || ||||| || | ||| ||
Sbjct: 9927  gatgattcgcgtcttcttgttgtcgcgggccgcattgcccgccagctccaggatctcagc 9986

                                                                         
Query: 418   ggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgctgggc 477
             || ||||||||| || || || || ||||| || || ||||||| ||| ||||||| |||
Sbjct: 9987  ggtgaggtactccagcactgccgccaggtacactggcgcgccggcgccaacgcgctcggc 10046

                          
Query: 478   gtagcggcccttc 490
             |||| ||||||||
Sbjct: 10047 gtagtggcccttc 10059



to top

>gb|BC106331.1| Xenopus laevis cDNA clone MGC:130860 IMAGE:7205580, complete cds
          Length = 799

 Score =  103 bits (52), Expect = 7e-19
 Identities = 172/212 (81%)
 Strand = Plus / Minus

                                                                       
Query: 239 ttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgacg 298
           |||||||||||||| || || | ||||||||| |  || ||||| |||||||||||||| 
Sbjct: 371 ttcttggggagcagcacagactggatgttgggcaggacaccgccctgggcgatggtgacc 312

                                                                       
Query: 299 ccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcggg 358
           ||  |||||||  ||  |||||||| ||||||||| ||||||||  ||||||| |  |||
Sbjct: 311 cctccgagcagtttgttgagctcctcgtcgttgcgcacggcgagctgcaggtgcctgggg 252

                                                                       
Query: 359 atgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgcg 418
           ||||| || |||||||||||||||  ||| ||||||||||| | ||| || | ||| |||
Sbjct: 251 atgatccgagtcttcttgttatcccgggcagcgttgccggccaactcgaggatctcggcg 192

                                           
Query: 419 gcgaggtactcgaggacggcggcgaggtagac 450
           |  || |||||||| || ||||| ||||||||
Sbjct: 191 gtcagatactcgagcaccgcggcaaggtagac 160



to top

>gb|BC001193.1| Homo sapiens histone 3, H2a, mRNA (cDNA clone MGC:3165
           IMAGE:3355200), complete cds
          Length = 897

 Score =  103 bits (52), Expect = 7e-19
 Identities = 190/236 (80%)
 Strand = Plus / Minus

                                                                       
Query: 238 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 297
           ||||||||| ||||| ||||  | ||||||||| |  ||||| || || |||||||| ||
Sbjct: 402 cttcttgggcagcagtacggcctggatgttgggcaggacgccaccctgcgcgatggtcac 343

                                                                       
Query: 298 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 357
           || | | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||||||
Sbjct: 342 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 283

                                                                       
Query: 358 gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 417
           ||||||||| ||||||||||| ||    || ||||||||||| ||||| || | ||| ||
Sbjct: 282 gatgatgcgcgtcttcttgttgtcgcgcgccgcgttgccggcaagctccaggatctcggc 223

                                                                   
Query: 418 ggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgct 473
            |  | ||||||||| || ||||| || ||||| |||||||||| ||| |||||||
Sbjct: 222 agtcaagtactcgagcaccgcggccagatagaccggggcgccggcgcccacgcgct 167



to top

>gb|BC082269.1| Homo sapiens histone 3, H2a, mRNA (cDNA clone MGC:99456
           IMAGE:6671338), complete cds
          Length = 889

 Score =  103 bits (52), Expect = 7e-19
 Identities = 190/236 (80%)
 Strand = Plus / Minus

                                                                       
Query: 238 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 297
           ||||||||| ||||| ||||  | ||||||||| |  ||||| || || |||||||| ||
Sbjct: 392 cttcttgggcagcagtacggcctggatgttgggcaggacgccaccctgcgcgatggtcac 333

                                                                       
Query: 298 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 357
           || | | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||||||
Sbjct: 332 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 273

                                                                       
Query: 358 gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 417
           ||||||||| ||||||||||| ||    || ||||||||||| ||||| || | ||| ||
Sbjct: 272 gatgatgcgcgtcttcttgttgtcgcgcgccgcgttgccggcaagctccaggatctcggc 213

                                                                   
Query: 418 ggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgct 473
            |  | ||||||||| || ||||| || ||||| |||||||||| ||| |||||||
Sbjct: 212 agtcaagtactcgagcaccgcggccagatagaccggggcgccggcgcccacgcgct 157



to top

>gb|AY389592.1| Hyacinthus orientalis histone H2A mRNA, complete cds
          Length = 635

 Score =  103 bits (52), Expect = 7e-19
 Identities = 109/128 (85%)
 Strand = Plus / Minus

                                                                       
Query: 410 acctctgcggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacg 469
           ||||||||||| |||||||||||||||||||| |||||||| || || ||||  ||||| 
Sbjct: 227 acctctgcggctaggtactcgaggacggcggcaaggtagaccggagctccggtaccgaca 168

                                                                       
Query: 470 cgctgggcgtagcggcccttcttgaggtagcgcccgatgcggccgacggggaactggaga 529
           ||||| ||||| | ||||||||| | ||| || ||||  || ||||||||||||||||| 
Sbjct: 167 cgctgagcgtacctgcccttcttcaagtatcggccgagacgaccgacggggaactggagg 108

                   
Query: 530 ccggcctt 537
           ||||||||
Sbjct: 107 ccggcctt 100



to top

>ref|NM_033445.2| Homo sapiens histone 3, H2a (HIST3H2A), mRNA
          Length = 496

 Score =  103 bits (52), Expect = 7e-19
 Identities = 190/236 (80%)
 Strand = Plus / Minus

                                                                       
Query: 238 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 297
           ||||||||| ||||| ||||  | ||||||||| |  ||||| || || |||||||| ||
Sbjct: 402 cttcttgggcagcagtacggcctggatgttgggcaggacgccaccctgcgcgatggtcac 343

                                                                       
Query: 298 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 357
           || | | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||||||
Sbjct: 342 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 283

                                                                       
Query: 358 gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 417
           ||||||||| ||||||||||| ||    || ||||||||||| ||||| || | ||| ||
Sbjct: 282 gatgatgcgcgtcttcttgttgtcgcgcgccgcgttgccggcaagctccaggatctcggc 223

                                                                   
Query: 418 ggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgct 473
            |  | ||||||||| || ||||| || ||||| |||||||||| ||| |||||||
Sbjct: 222 agtcaagtactcgagcaccgcggccagatagaccggggcgccggcgcccacgcgct 167



to top

>emb|AL139288.15| Human DNA sequence from clone RP5-915N17 on chromosome 1q42.11-42.3,
              complete sequence
          Length = 151563

 Score =  103 bits (52), Expect = 7e-19
 Identities = 190/236 (80%)
 Strand = Plus / Minus

                                                                          
Query: 238    cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 297
              ||||||||| ||||| ||||  | ||||||||| |  ||||| || || |||||||| ||
Sbjct: 100907 cttcttgggcagcagtacggcctggatgttgggcaggacgccaccctgcgcgatggtcac 100848

                                                                          
Query: 298    gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 357
              || | | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||||||
Sbjct: 100847 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 100788

                                                                          
Query: 358    gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 417
              ||||||||| ||||||||||| ||    || ||||||||||| ||||| || | ||| ||
Sbjct: 100787 gatgatgcgcgtcttcttgttgtcgcgcgccgcgttgccggcaagctccaggatctcggc 100728

                                                                      
Query: 418    ggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgct 473
               |  | ||||||||| || ||||| || ||||| |||||||||| ||| |||||||
Sbjct: 100727 agtcaagtactcgagcaccgcggccagatagaccggggcgccggcgcccacgcgct 100672



to top

>emb|X03018.1|XLHISH3A Xenopus laevis histone gene cluster XlH3-A with genes H1A, H2B, H3
            and H4
          Length = 8592

 Score =  103 bits (52), Expect = 7e-19
 Identities = 172/212 (81%)
 Strand = Plus / Minus

                                                                        
Query: 239  ttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgacg 298
            |||||||||||||| || || | ||||||||| |  || ||||| |||||||||||||| 
Sbjct: 4730 ttcttggggagcagcacagactggatgttgggcaggacaccgccctgggcgatggtgacc 4671

                                                                        
Query: 299  ccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcggg 358
            ||  |||||||  ||  |||||||| ||||||||| ||||||||  ||||||| |  |||
Sbjct: 4670 cctccgagcagtttgttgagctcctcgtcgttgcgcacggcgagctgcaggtgcctgggg 4611

                                                                        
Query: 359  atgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgcg 418
            ||||| || |||||||||||||||  ||| ||||||||||| | ||| || | ||| |||
Sbjct: 4610 atgatccgagtcttcttgttatcccgggcagcgttgccggccaactcgaggatctcggcg 4551

                                            
Query: 419  gcgaggtactcgaggacggcggcgaggtagac 450
            |  || |||||||| || ||||| ||||||||
Sbjct: 4550 gtcagatactcgagcaccgcggcaaggtagac 4519



to top

>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete
                sequence
          Length = 29644043

 Score =  103 bits (52), Expect = 7e-19
 Identities = 127/152 (83%)
 Strand = Plus / Minus

                                                                            
Query: 262      gatgttggggatcacgccgccgtgggcgatggtgacgccggcgagcagcctgccgagctc 321
                ||||||||| ||||||||||||  |||||||||| ||||| |||||||| ||   | |||
Sbjct: 21537003 gatgttgggcatcacgccgccgctggcgatggtggcgccgccgagcagcttggtcaactc 21536944

                                                                            
Query: 322      ctggtcgttgcggacggcgagaagcaggtggcgcgggatgatgcgggtcttcttgttatc 381
                || ||||||||| || |||||  | | ||||||||| | |||||||||||||||||| ||
Sbjct: 21536943 ctcgtcgttgcgcaccgcgagctggatgtggcgcggcacgatgcgggtcttcttgttgtc 21536884

                                                
Query: 382      cttggcggcgttgccggcgagctcaagcacct 413
                | | || ||||| ||||||||||| |||||||
Sbjct: 21536883 cctcgccgcgttcccggcgagctcgagcacct 21536852



 Score =  101 bits (51), Expect = 3e-18
 Identities = 66/71 (92%)
 Strand = Plus / Minus

                                                                            
Query: 410      acctctgcggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacg 469
                ||||| ||||||||||||||||||||||||||||||||||| ||||| |||| |||||||
Sbjct: 21536579 acctcagcggcgaggtactcgaggacggcggcgaggtagacgggggccccggcgccgacg 21536520

                           
Query: 470      cgctgggcgta 480
                |||| ||||||
Sbjct: 21536519 cgctcggcgta 21536509



 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 70/77 (90%)
 Strand = Plus / Plus

                                                                            
Query: 488      ttcttgaggtagcgcccgatgcggccgacggggaactggagaccggccttcacggaccgg 547
                |||||||||||||||||||| |||| |||||| |||||||| |||||||| ||||| || 
Sbjct: 22313886 ttcttgaggtagcgcccgatacggctgacgggcaactggagcccggccttgacggagcgc 22313945

                                 
Query: 548      gtcaccgccttcttcct 564
                |||||||||||||||||
Sbjct: 22313946 gtcaccgccttcttcct 22313962



 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 56/59 (94%)
 Strand = Plus / Minus

                                                                           
Query: 410      acctctgcggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgac 468
                ||||| ||||||||||||||||||||||||||||||||||| |||||||||| ||||||
Sbjct: 21539259 acctcagcggcgaggtactcgaggacggcggcgaggtagaccggggcgccggcgccgac 21539201



 Score = 73.8 bits (37), Expect = 6e-10
 Identities = 82/97 (84%)
 Strand = Plus / Minus

                                                                            
Query: 317      agctcctggtcgttgcggacggcgagaagcaggtggcgcgggatgatgcgggtcttcttg 376
                ||||||| ||||||||||||||||||  | | |||||| || |  |||||||||||||||
Sbjct: 21539587 agctcctcgtcgttgcggacggcgagctggatgtggcggggcactatgcgggtcttcttg 21539528

                                                     
Query: 377      ttatccttggcggcgttgccggcgagctcaagcacct 413
                || ||| | || ||||| |||||||||||||| ||||
Sbjct: 21539527 ttgtccctcgccgcgttcccggcgagctcaagaacct 21539491



 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 154      ggcgggggccttcttcttgg 173
                ||||||||||||||||||||
Sbjct: 29547682 ggcgggggccttcttcttgg 29547663



to top

>ref|NM_178184.1| Mus musculus histone 1, H2an (Hist1h2an), mRNA
          Length = 393

 Score =  103 bits (52), Expect = 7e-19
 Identities = 172/212 (81%)
 Strand = Plus / Minus

                                                                       
Query: 262 gatgttggggatcacgccgccgtgggcgatggtgacgccggcgagcagcctgccgagctc 321
           ||||||||| |  |||||||| || |||||||| |||| | | |||||| ||  ||||||
Sbjct: 336 gatgttgggcaggacgccgccctgcgcgatggtcacgcggcccagcagcttgttgagctc 277

                                                                       
Query: 322 ctggtcgttgcggacggcgagaagcaggtggcgcgggatgatgcgggtcttcttgttatc 381
           || ||||||||||| ||| ||  |||||||||||||||||||||| ||||||||||| ||
Sbjct: 276 ctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtc 217

                                                                       
Query: 382 cttggcggcgttgccggcgagctcaagcacctctgcggcgaggtactcgaggacggcggc 441
              ||| |||||||| || ||||| || | ||| || |  |||||||| || ||||| ||
Sbjct: 216 gcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcacggccgc 157

                                           
Query: 442 gaggtagacaggggcgccggagccgacgcgct 473
            ||||| || |||||||||| ||| |||||||
Sbjct: 156 caggtacaccggggcgccggcgcccacgcgct 125



to top

>ref|NM_178183.1| Mus musculus histone 1, H2ak (Hist1h2ak), mRNA
          Length = 393

 Score =  103 bits (52), Expect = 7e-19
 Identities = 190/236 (80%)
 Strand = Plus / Minus

                                                                       
Query: 238 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 297
           ||||||||| ||||| ||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 360 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 301

                                                                       
Query: 298 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 357
           || | | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||||||
Sbjct: 300 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 241

                                                                       
Query: 358 gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 417
           ||| ||||| ||||||||||| ||   ||| |||||||| || ||||| || | ||| ||
Sbjct: 240 gataatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 181

                                                                   
Query: 418 ggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgct 473
            |  |||||||| || ||||| || ||||| || |||||||||| ||| |||||||
Sbjct: 180 cgtcaggtactctagcacggctgccaggtacaccggggcgccggcgcccacgcgct 125



to top

>ref|XM_225386.2| PREDICTED: Rattus norvegicus histone 1, H2an (predicted)
           (Hist1h2an_predicted), mRNA
          Length = 546

 Score =  103 bits (52), Expect = 7e-19
 Identities = 163/200 (81%)
 Strand = Plus / Minus

                                                                       
Query: 262 gatgttggggatcacgccgccgtgggcgatggtgacgccggcgagcagcctgccgagctc 321
           ||||||||| |  |||||||| || |||||||| |||| | | |||||| ||  ||||||
Sbjct: 336 gatgttgggcaggacgccgccctgtgcgatggtcacgcggcccagcagcttgttgagctc 277

                                                                       
Query: 322 ctggtcgttgcggacggcgagaagcaggtggcgcgggatgatgcgggtcttcttgttatc 381
           || ||||||||||| ||| ||  |||||||||||||||||||||| ||||||||||| ||
Sbjct: 276 ctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtc 217

                                                                       
Query: 382 cttggcggcgttgccggcgagctcaagcacctctgcggcgaggtactcgaggacggcggc 441
           | | || |||||||| || ||||| || | ||| || |  |||||||| || ||||| ||
Sbjct: 216 cctcgctgcgttgcccgccagctccaggatctcggccgtcaggtactccagcacggccgc 157

                               
Query: 442 gaggtagacaggggcgccgg 461
            ||||| || ||||||||||
Sbjct: 156 caggtacaccggggcgccgg 137



to top

>gb|AY158916.1| Mus musculus histone protein Hist1h2af gene, complete cds
          Length = 1390

 Score =  103 bits (52), Expect = 7e-19
 Identities = 190/236 (80%)
 Strand = Plus / Minus

                                                                       
Query: 238 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 297
           ||||||||| ||||| ||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 884 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 825

                                                                       
Query: 298 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 357
           || | | | |||| ||  |||||||| ||||||||||| ||| ||  |||||||||||||
Sbjct: 824 gcggcccaacagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 765

                                                                       
Query: 358 gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 417
           ||||||||| ||||||||||| ||   ||| |||||||| || ||||| || | ||| ||
Sbjct: 764 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 705

                                                                   
Query: 418 ggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgct 473
            |  |||||||| || ||||| || ||||| || |||||||||| ||| |||||||
Sbjct: 704 cgtcaggtactccagcacggccgccaggtacaccggggcgccggcgcccacgcgct 649



to top

>gb|AY158912.1| Mus musculus histone protein Hist1h2an gene, complete cds
          Length = 1390

 Score =  103 bits (52), Expect = 7e-19
 Identities = 172/212 (81%)
 Strand = Plus / Minus

                                                                       
Query: 262 gatgttggggatcacgccgccgtgggcgatggtgacgccggcgagcagcctgccgagctc 321
           ||||||||| |  |||||||| || |||||||| |||| | | |||||| ||  ||||||
Sbjct: 836 gatgttgggcaggacgccgccctgcgcgatggtcacgcggcccagcagcttgttgagctc 777

                                                                       
Query: 322 ctggtcgttgcggacggcgagaagcaggtggcgcgggatgatgcgggtcttcttgttatc 381
           || ||||||||||| ||| ||  |||||||||||||||||||||| ||||||||||| ||
Sbjct: 776 ctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtc 717

                                                                       
Query: 382 cttggcggcgttgccggcgagctcaagcacctctgcggcgaggtactcgaggacggcggc 441
              ||| |||||||| || ||||| || | ||| || |  |||||||| || ||||| ||
Sbjct: 716 gcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcacggccgc 657

                                           
Query: 442 gaggtagacaggggcgccggagccgacgcgct 473
            ||||| || |||||||||| ||| |||||||
Sbjct: 656 caggtacaccggggcgccggcgcccacgcgct 625



to top

>gb|AY158911.1| Mus musculus histone protein Hist1h2ak gene, complete cds
          Length = 1201

 Score =  103 bits (52), Expect = 7e-19
 Identities = 190/236 (80%)
 Strand = Plus / Minus

                                                                       
Query: 238 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 297
           ||||||||| ||||| ||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 894 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 835

                                                                       
Query: 298 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 357
           || | | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||||||
Sbjct: 834 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 775

                                                                       
Query: 358 gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 417
           ||| ||||| ||||||||||| ||   ||| |||||||| || ||||| || | ||| ||
Sbjct: 774 gataatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 715

                                                                   
Query: 418 ggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgct 473
            |  |||||||| || ||||| || ||||| || |||||||||| ||| |||||||
Sbjct: 714 cgtcaggtactctagcacggctgccaggtacaccggggcgccggcgcccacgcgct 659



to top

>dbj|AP003838.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC
             clone:OJ1582_D10
          Length = 103475

 Score =  103 bits (52), Expect = 7e-19
 Identities = 127/152 (83%)
 Strand = Plus / Minus

                                                                         
Query: 262   gatgttggggatcacgccgccgtgggcgatggtgacgccggcgagcagcctgccgagctc 321
             ||||||||| ||||||||||||  |||||||||| ||||| |||||||| ||   | |||
Sbjct: 74787 gatgttgggcatcacgccgccgctggcgatggtggcgccgccgagcagcttggtcaactc 74728

                                                                         
Query: 322   ctggtcgttgcggacggcgagaagcaggtggcgcgggatgatgcgggtcttcttgttatc 381
             || ||||||||| || |||||  | | ||||||||| | |||||||||||||||||| ||
Sbjct: 74727 ctcgtcgttgcgcaccgcgagctggatgtggcgcggcacgatgcgggtcttcttgttgtc 74668

                                             
Query: 382   cttggcggcgttgccggcgagctcaagcacct 413
             | | || ||||| ||||||||||| |||||||
Sbjct: 74667 cctcgccgcgttcccggcgagctcgagcacct 74636



 Score =  101 bits (51), Expect = 3e-18
 Identities = 66/71 (92%)
 Strand = Plus / Minus

                                                                         
Query: 410   acctctgcggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacg 469
             ||||| ||||||||||||||||||||||||||||||||||| ||||| |||| |||||||
Sbjct: 74363 acctcagcggcgaggtactcgaggacggcggcgaggtagacgggggccccggcgccgacg 74304

                        
Query: 470   cgctgggcgta 480
             |||| ||||||
Sbjct: 74303 cgctcggcgta 74293



 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 56/59 (94%)
 Strand = Plus / Minus

                                                                        
Query: 410   acctctgcggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgac 468
             ||||| ||||||||||||||||||||||||||||||||||| |||||||||| ||||||
Sbjct: 77043 acctcagcggcgaggtactcgaggacggcggcgaggtagaccggggcgccggcgccgac 76985



 Score = 73.8 bits (37), Expect = 6e-10
 Identities = 82/97 (84%)
 Strand = Plus / Minus

                                                                         
Query: 317   agctcctggtcgttgcggacggcgagaagcaggtggcgcgggatgatgcgggtcttcttg 376
             ||||||| ||||||||||||||||||  | | |||||| || |  |||||||||||||||
Sbjct: 77371 agctcctcgtcgttgcggacggcgagctggatgtggcggggcactatgcgggtcttcttg 77312

                                                  
Query: 377   ttatccttggcggcgttgccggcgagctcaagcacct 413
             || ||| | || ||||| |||||||||||||| ||||
Sbjct: 77311 ttgtccctcgccgcgttcccggcgagctcaagaacct 77275



to top

>ref|XM_314447.2| Anopheles gambiae str. PEST ENSANGP00000016040
           (ENSANGG00000013551), partial mRNA
          Length = 375

 Score =  103 bits (52), Expect = 7e-19
 Identities = 190/236 (80%)
 Strand = Plus / Minus

                                                                       
Query: 238 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 297
           ||||||||| ||||| ||||  | ||||||||| | ||||||||| ||||||||||| ||
Sbjct: 357 cttcttgggcagcagcacggcctggatgttgggcagcacgccgccctgggcgatggtcac 298

                                                                       
Query: 298 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 357
            ||||  |||||| ||   ||||||| ||||||||||| ||| ||  |||| ||||||||
Sbjct: 297 cccggacagcagcttgttcagctcctcgtcgttgcggatggccagctgcagatggcgcgg 238

                                                                       
Query: 358 gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 417
           ||||||||| ||||||||||| ||   ||| ||||| || || ||||| ||||| || ||
Sbjct: 237 gatgatgcgcgtcttcttgttgtcgcgggccgcgttacccgccagctcgagcacttccgc 178

                                                                   
Query: 418 ggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgct 473
            || |||||||| | ||| ||||| || ||||| || ||||| |  ||||||||||
Sbjct: 177 cgccaggtactccatgaccgcggccagatagacgggcgcgcccgctccgacgcgct 122



to top

>ref|XM_306256.1| Anopheles gambiae str. PEST ENSANGP00000000004
           (ENSANGG00000000004), mRNA
          Length = 630

 Score =  103 bits (52), Expect = 7e-19
 Identities = 190/236 (80%)
 Strand = Plus / Minus

                                                                       
Query: 238 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 297
           ||||||||| ||||| ||||  | ||||||||| | ||||||||| ||||||||||| ||
Sbjct: 471 cttcttgggcagcagcacggcctggatgttgggcagcacgccgccctgggcgatggtcac 412

                                                                       
Query: 298 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 357
            ||||  |||||| ||   ||||||| ||||||||||| ||| ||  |||| ||||||||
Sbjct: 411 cccggacagcagcttgttcagctcctcgtcgttgcggatggccagctgcagatggcgcgg 352

                                                                       
Query: 358 gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 417
           ||||||||| ||||||||||| ||   ||| ||||| || || ||||| ||||| || ||
Sbjct: 351 gatgatgcgcgtcttcttgttgtcgcgggccgcgttacccgccagctcgagcacttccgc 292

                                                                   
Query: 418 ggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgct 473
            || |||||||| | ||| ||||| || ||||| || ||||| |  ||||||||||
Sbjct: 291 cgccaggtactccatgaccgcggccagatagacgggcgcgcccgctccgacgcgct 236



to top

>ref|NM_175661.1| Mus musculus histone 1, H2af (Hist1h2af), mRNA
          Length = 393

 Score =  103 bits (52), Expect = 7e-19
 Identities = 190/236 (80%)
 Strand = Plus / Minus

                                                                       
Query: 238 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 297
           ||||||||| ||||| ||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 360 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 301

                                                                       
Query: 298 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 357
           || | | | |||| ||  |||||||| ||||||||||| ||| ||  |||||||||||||
Sbjct: 300 gcggcccaacagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 241

                                                                       
Query: 358 gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 417
           ||||||||| ||||||||||| ||   ||| |||||||| || ||||| || | ||| ||
Sbjct: 240 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 181

                                                                   
Query: 418 ggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgct 473
            |  |||||||| || ||||| || ||||| || |||||||||| ||| |||||||
Sbjct: 180 cgtcaggtactccagcacggccgccaggtacaccggggcgccggcgcccacgcgct 125



to top

>emb|AL731753.2|CNS08C82 Oryza sativa chromosome 12, . BAC OJ1112_B07 of library Monsanto from
             chromosome 12 of cultivar Nipponbare of ssp. japonica of
             Oryza sativa (rice), complete sequence
          Length = 118101

 Score =  103 bits (52), Expect = 7e-19
 Identities = 127/152 (83%)
 Strand = Plus / Minus

                                                                         
Query: 262   gatgttggggatcacgccgccgtgggcgatggtgacgccggcgagcagcctgccgagctc 321
             ||||||||| || |||||||||  |||||||||| ||||| |||||||| ||  ||||||
Sbjct: 48743 gatgttgggcatgacgccgccgctggcgatggtggcgccgccgagcagcttggtgagctc 48684

                                                                         
Query: 322   ctggtcgttgcggacggcgagaagcaggtggcgcgggatgatgcgggtcttcttgttatc 381
             || ||||||||| || |||||  | | ||||||||| |  ||||||||||||||||| ||
Sbjct: 48683 ctcgtcgttgcgcaccgcgagctggatgtggcgcggcacaatgcgggtcttcttgttgtc 48624

                                             
Query: 382   cttggcggcgttgccggcgagctcaagcacct 413
             | | || ||||| ||||||||||| |||||||
Sbjct: 48623 cctcgccgcgttcccggcgagctccagcacct 48592



 Score =  101 bits (51), Expect = 3e-18
 Identities = 66/71 (92%)
 Strand = Plus / Minus

                                                                         
Query: 410   acctctgcggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacg 469
             ||||| ||||||||||||||||||||||||||||||||||| || ||||||| |||||||
Sbjct: 48392 acctcggcggcgaggtactcgaggacggcggcgaggtagacgggagcgccggcgccgacg 48333

                        
Query: 470   cgctgggcgta 480
             |||| ||||||
Sbjct: 48332 cgctcggcgta 48322



to top

>gb|U95111.1|MSU95111 Mus spretus histone H2a pseudogene, complete sequence
          Length = 567

 Score =  103 bits (52), Expect = 7e-19
 Identities = 190/236 (80%)
 Strand = Plus / Minus

                                                                       
Query: 238 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 297
           ||||||||| ||||| ||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 423 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 364

                                                                       
Query: 298 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 357
           || | | |||||| ||  |||||||  ||||||||||| ||| ||  |||||||||||||
Sbjct: 363 gcggcccagcagcttgttgagctccacgtcgttgcggatggccagctgcaggtggcgcgg 304

                                                                       
Query: 358 gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 417
           ||||||||| ||||||||||| ||   ||| |||||||| || ||||| || | ||| ||
Sbjct: 303 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 244

                                                                   
Query: 418 ggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgct 473
            |  |||||||| || ||||| || ||||| || |||||||||| ||| |||||||
Sbjct: 243 cgtcaggtactccagcacggccgccaggtacaccggggcgccggcgcccacgcgct 188



to top

>gb|U16725.1|CRU16725 Chlamydomonas reinhardtii histone H3 (ch3-III), histone H4 (ch4-III),
            histone H2B (ch2b-III) and histone H2A (ch2a-III) genes,
            complete cds
          Length = 4582

 Score =  103 bits (52), Expect = 7e-19
 Identities = 238/300 (79%)
 Strand = Plus / Minus

                                                                        
Query: 238  cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 297
            ||||||||| ||||| |||| || ||||||||| | ||| |||||   |||||| || ||
Sbjct: 3458 cttcttgggcagcagcacggcgtggatgttgggcagcacaccgcccgaggcgatcgtcac 3399

                                                                        
Query: 298  gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 357
              || | |||||| |||| |||||||  || ||||||| ||| ||  | | |||||| ||
Sbjct: 3398 ctcgcccagcagcttgcccagctcctcatcattgcggatggccagctggatgtggcgggg 3339

                                                                        
Query: 358  gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 417
             | ||| ||| |||||||||| ||   ||||||||||||||| ||||| |||||||| ||
Sbjct: 3338 cacgatacggttcttcttgttgtcgcgggcggcgttgccggccagctctagcacctcagc 3279

                                                                        
Query: 418  ggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgctgggc 477
            ||  |||||||| || || ||||| ||||| || || |||||||  |||| ||||| |||
Sbjct: 3278 ggtcaggtactccagcacagcggccaggtacacgggcgcgccggcaccgatgcgctcggc 3219

                                                                        
Query: 478  gtagcggcccttcttgaggtagcgcccgatgcggccgacggggaactggagaccggcctt 537
            |||   ||||||||| ||||||||| | |||||||| || |||||||| || ||||||||
Sbjct: 3218 gtacttgcccttcttcaggtagcgcgcaatgcggcccacagggaactgcaggccggcctt 3159



to top

>gb|M21287.1|XELHX1H3 X.laevis histone H1B, H2A, H2B, and H4 genes, complete cds, and
            histone H3 gene, 3' end, gene cluster X1h3
          Length = 8608

 Score =  103 bits (52), Expect = 7e-19
 Identities = 172/212 (81%)
 Strand = Plus / Minus

                                                                        
Query: 239  ttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgacg 298
            |||||||||||||| || || | ||||||||| |  || ||||| |||||||||||||| 
Sbjct: 4747 ttcttggggagcagcacagactggatgttgggcaggacaccgccctgggcgatggtgacc 4688

                                                                        
Query: 299  ccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcggg 358
            ||  |||||||  ||  |||||||| ||||||||| ||||||||  ||||||| |  |||
Sbjct: 4687 cctccgagcagtttgttgagctcctcgtcgttgcgcacggcgagctgcaggtgcctgggg 4628

                                                                        
Query: 359  atgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgcg 418
            ||||| || |||||||||||||||  ||| ||||||||||| | ||| || | ||| |||
Sbjct: 4627 atgatccgagtcttcttgttatcccgggcagcgttgccggccaactcgaggatctcggcg 4568

                                            
Query: 419  gcgaggtactcgaggacggcggcgaggtagac 450
            |  || |||||||| || ||||| ||||||||
Sbjct: 4567 gtcagatactcgagcaccgcggcaaggtagac 4536



to top

>gb|AY131974.1| Homo sapiens histone H2A (HIST3H2A) gene, complete cds
          Length = 1173

 Score =  103 bits (52), Expect = 7e-19
 Identities = 190/236 (80%)
 Strand = Plus / Minus

                                                                       
Query: 238 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 297
           ||||||||| ||||| ||||  | ||||||||| |  ||||| || || |||||||| ||
Sbjct: 752 cttcttgggcagcagtacggcctggatgttgggcaggacgccaccctgcgcgatggtcac 693

                                                                       
Query: 298 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 357
           || | | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||||||
Sbjct: 692 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 633

                                                                       
Query: 358 gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 417
           ||||||||| ||||||||||| ||    || ||||||||||| ||||| || | ||| ||
Sbjct: 632 gatgatgcgcgtcttcttgttgtcgcgcgccgcgttgccggcaagctccaggatctcggc 573

                                                                   
Query: 418 ggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgct 473
            |  | ||||||||| || ||||| || ||||| |||||||||| ||| |||||||
Sbjct: 572 agtcaagtactcgagcaccgcggccagatagaccggggcgccggcgcccacgcgct 517



to top

>gb|AY389588.1| Hyacinthus orientalis histone H2A mRNA, complete cds
          Length = 643

 Score =  101 bits (51), Expect = 3e-18
 Identities = 129/155 (83%)
 Strand = Plus / Minus

                                                                       
Query: 410 acctctgcggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacg 469
           ||||| || ||||||||||| | |||||||||||||||||| || || |||| |||||| 
Sbjct: 242 acctcagcagcgaggtactccaagacggcggcgaggtagaccggagctccggtgccgaca 183

                                                                       
Query: 470 cgctgggcgtagcggcccttcttgaggtagcgcccgatgcggccgacggggaactggaga 529
           ||||| ||||| | ||||||||| | ||| || ||||  ||||| |||||||||||||| 
Sbjct: 182 cgctgagcgtacctgcccttcttcaagtatcggccgagacggccaacggggaactggagc 123

                                              
Query: 530 ccggccttcacggaccgggtcaccgccttcttcct 564
           |||||||| ||||| || | |||||  ||||||||
Sbjct: 122 ccggccttgacggatcgagacaccgatttcttcct 88



to top

>ref|XM_577577.1| PREDICTED: Rattus norvegicus similar to Histone H2A.1 (LOC502129),
           mRNA
          Length = 393

 Score =  101 bits (51), Expect = 3e-18
 Identities = 153/187 (81%)
 Strand = Plus / Minus

                                                                       
Query: 275 acgccgccgtgggcgatggtgacgccggcgagcagcctgccgagctcctggtcgttgcgg 334
           |||||||| || |||||||| |||| | | |||||| ||  |||||||| ||||||||||
Sbjct: 323 acgccgccctgtgcgatggtcacgcggcccagcagcttgttgagctcctcgtcgttgcgg 264

                                                                       
Query: 335 acggcgagaagcaggtggcgcgggatgatgcgggtcttcttgttatccttggcggcgttg 394
           | ||| ||  |||||||||||||||||||||| ||||||||||| ||| | || ||||||
Sbjct: 263 atggccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtccctcgctgcgttg 204

                                                                       
Query: 395 ccggcgagctcaagcacctctgcggcgaggtactcgaggacggcggcgaggtagacaggg 454
           || || ||||| || | ||| || |  |||||||| || ||||| || ||||| || |||
Sbjct: 203 cccgccagctccaggatctcggccgtcaggtactccagcacggccgccaggtacaccggg 144

                  
Query: 455 gcgccgg 461
           |||||||
Sbjct: 143 gcgccgg 137



to top

>ref|XM_545430.1| PREDICTED: Canis familiaris similar to Histone H2A.l (H2A/l)
           (LOC488308), mRNA
          Length = 456

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 118/141 (83%)
 Strand = Plus / Minus

                                                                       
Query: 238 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 297
           ||||||||| ||||| ||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 423 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 364

                                                                       
Query: 298 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 357
           || | | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||||||
Sbjct: 363 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 304

                                
Query: 358 gatgatgcgggtcttcttgtt 378
           ||||||||| |||||||||||
Sbjct: 303 gatgatgcgcgtcttcttgtt 283



to top

>ref|XM_849168.1| PREDICTED: Canis familiaris similar to Histone H2A.l (H2A/l)
           (LOC611496), mRNA
          Length = 393

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 118/141 (83%)
 Strand = Plus / Minus

                                                                       
Query: 238 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 297
           ||||||||| ||||| ||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 360 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 301

                                                                       
Query: 298 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 357
           || | | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||||||
Sbjct: 300 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 241

                                
Query: 358 gatgatgcgggtcttcttgtt 378
           ||||||||| |||||||||||
Sbjct: 240 gatgatgcgcgtcttcttgtt 220



to top

>ref|XM_545413.1| PREDICTED: Canis familiaris similar to Histone H2A.l (H2A/l)
           (LOC488291), mRNA
          Length = 387

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 118/141 (83%)
 Strand = Plus / Minus

                                                                       
Query: 238 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 297
           ||||||||| ||||| ||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 360 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 301

                                                                       
Query: 298 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 357
           || | | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||||||
Sbjct: 300 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 241

                                
Query: 358 gatgatgcgggtcttcttgtt 378
           ||||||||| |||||||||||
Sbjct: 240 gatgatgcgcgtcttcttgtt 220



to top

>ref|XM_545411.1| PREDICTED: Canis familiaris similar to Histone H2A.1 (LOC488289),
           mRNA
          Length = 393

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 118/141 (83%)
 Strand = Plus / Minus

                                                                       
Query: 238 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 297
           ||||||||| ||||| ||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 360 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 301

                                                                       
Query: 298 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 357
           || | | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||||||
Sbjct: 300 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 241

                                
Query: 358 gatgatgcgggtcttcttgtt 378
           ||||||||| |||||||||||
Sbjct: 240 gatgatgcgcgtcttcttgtt 220



to top

>ref|XM_545400.2| PREDICTED: Canis familiaris similar to Histone H2A.l (H2A/l)
           (LOC488278), mRNA
          Length = 576

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 118/141 (83%)
 Strand = Plus / Minus

                                                                       
Query: 238 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 297
           ||||||||| ||||| ||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 360 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 301

                                                                       
Query: 298 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 357
           || | | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||||||
Sbjct: 300 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 241

                                
Query: 358 gatgatgcgggtcttcttgtt 378
           ||||||||| |||||||||||
Sbjct: 240 gatgatgcgcgtcttcttgtt 220



to top

>ref|XM_545394.2| PREDICTED: Canis familiaris similar to Histone H2A.l (H2A/l)
           (LOC488272), mRNA
          Length = 393

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 118/141 (83%)
 Strand = Plus / Minus

                                                                       
Query: 238 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 297
           ||||||||| ||||| ||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 360 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 301

                                                                       
Query: 298 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 357
           || | | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||||||
Sbjct: 300 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 241

                                
Query: 358 gatgatgcgggtcttcttgtt 378
           ||||||||| |||||||||||
Sbjct: 240 gatgatgcgcgtcttcttgtt 220



to top

>ref|XM_848774.1| PREDICTED: Canis familiaris similar to Histone H2A.1 (LOC611132),
           mRNA
          Length = 393

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 118/141 (83%)
 Strand = Plus / Minus

                                                                       
Query: 238 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 297
           ||||||||| ||||| ||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 360 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 301

                                                                       
Query: 298 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 357
           || | | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||||||
Sbjct: 300 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 241

                                
Query: 358 gatgatgcgggtcttcttgtt 378
           ||||||||| |||||||||||
Sbjct: 240 gatgatgcgcgtcttcttgtt 220



to top

>ref|XM_848759.1| PREDICTED: Canis familiaris similar to Histone H2A.l (H2A/l)
           (LOC488270), mRNA
          Length = 462

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 118/141 (83%)
 Strand = Plus / Minus

                                                                       
Query: 238 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 297
           ||||||||| ||||| ||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 429 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 370

                                                                       
Query: 298 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 357
           || | | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||||||
Sbjct: 369 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 310

                                
Query: 358 gatgatgcgggtcttcttgtt 378
           ||||||||| |||||||||||
Sbjct: 309 gatgatgcgcgtcttcttgtt 289



to top

>ref|XM_545384.2| PREDICTED: Canis familiaris similar to Histone H2A.l (H2A/l)
           (LOC488262), mRNA
          Length = 393

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 118/141 (83%)
 Strand = Plus / Minus

                                                                       
Query: 238 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 297
           ||||||||| ||||| ||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 360 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 301

                                                                       
Query: 298 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 357
           || | | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||||||
Sbjct: 300 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 241

                                
Query: 358 gatgatgcgggtcttcttgtt 378
           ||||||||| |||||||||||
Sbjct: 240 gatgatgcgcgtcttcttgtt 220



to top

>ref|XM_848716.1| PREDICTED: Canis familiaris similar to Histone H2A.1 (LOC611082),
           mRNA
          Length = 393

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 118/141 (83%)
 Strand = Plus / Minus

                                                                       
Query: 238 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 297
           ||||||||| ||||| ||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 360 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 301

                                                                       
Query: 298 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 357
           || | | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||||||
Sbjct: 300 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 241

                                
Query: 358 gatgatgcgggtcttcttgtt 378
           ||||||||| |||||||||||
Sbjct: 240 gatgatgcgcgtcttcttgtt 220



to top

>ref|XM_545376.2| PREDICTED: Canis familiaris similar to Histone H2A.l (H2A/l)
           (LOC488254), mRNA
          Length = 417

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 118/141 (83%)
 Strand = Plus / Minus

                                                                       
Query: 238 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 297
           ||||||||| ||||| ||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 384 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 325

                                                                       
Query: 298 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 357
           || | | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||||||
Sbjct: 324 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 265

                                
Query: 358 gatgatgcgggtcttcttgtt 378
           ||||||||| |||||||||||
Sbjct: 264 gatgatgcgcgtcttcttgtt 244



to top

>ref|XM_545373.1| PREDICTED: Canis familiaris similar to histone H2A (LOC488251),
           mRNA
          Length = 396

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 118/141 (83%)
 Strand = Plus / Minus

                                                                       
Query: 238 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 297
           ||||||||| ||||| ||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 360 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 301

                                                                       
Query: 298 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 357
           || | | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||||||
Sbjct: 300 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 241

                                
Query: 358 gatgatgcgggtcttcttgtt 378
           ||||||||| |||||||||||
Sbjct: 240 gatgatgcgcgtcttcttgtt 220



to top

>ref|XM_854341.1| PREDICTED: Canis familiaris similar to Histone H2A.l (H2A/l),
           transcript variant 2 (LOC488268), mRNA
          Length = 402

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 118/141 (83%)
 Strand = Plus / Minus

                                                                       
Query: 238 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 297
           ||||||||| ||||| ||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 360 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 301

                                                                       
Query: 298 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 357
           || | | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||||||
Sbjct: 300 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 241

                                
Query: 358 gatgatgcgggtcttcttgtt 378
           ||||||||| |||||||||||
Sbjct: 240 gatgatgcgcgtcttcttgtt 220



to top

>ref|XM_545390.1| PREDICTED: Canis familiaris similar to Histone H2A.l (H2A/l),
           transcript variant 1 (LOC488268), mRNA
          Length = 393

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 118/141 (83%)
 Strand = Plus / Minus

                                                                       
Query: 238 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 297
           ||||||||| ||||| ||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 360 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 301

                                                                       
Query: 298 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 357
           || | | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||||||
Sbjct: 300 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 241

                                
Query: 358 gatgatgcgggtcttcttgtt 378
           ||||||||| |||||||||||
Sbjct: 240 gatgatgcgcgtcttcttgtt 220



to top

>ref|XM_539322.1| PREDICTED: Canis familiaris similar to Histone H2A.1 (LOC482203),
           mRNA
          Length = 393

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 118/141 (83%)
 Strand = Plus / Minus

                                                                       
Query: 238 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 297
           ||||||||| ||||| ||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 360 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 301

                                                                       
Query: 298 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 357
           || | | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||||||
Sbjct: 300 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 241

                                
Query: 358 gatgatgcgggtcttcttgtt 378
           ||||||||| |||||||||||
Sbjct: 240 gatgatgcgcgtcttcttgtt 220



to top

>emb|BX016452.1|CNS08KUW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA24CG10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 594

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 118/141 (83%)
 Strand = Plus / Plus

                                                                       
Query: 238 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 297
           ||||||||| ||||| ||||  | ||||||||| | ||||||||| ||||||||||| ||
Sbjct: 74  cttcttgggcagcagcacggcctggatgttgggcagcacgccgccctgggcgatggtcac 133

                                                                       
Query: 298 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 357
            ||||  |||||| ||   ||||||| ||||||||||| ||| |   |||||||||||||
Sbjct: 134 cccggacagcagcttgttcagctcctcgtcgttgcggatggccaactgcaggtggcgcgg 193

                                
Query: 358 gatgatgcgggtcttcttgtt 378
           ||||||||| |||||||||||
Sbjct: 194 gatgatgcgcgtcttcttgtt 214



to top

>emb|BX007458.1|CNS08DX2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA12BG11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 349

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 100/117 (85%)
 Strand = Plus / Minus

                                                                       
Query: 262 gatgttggggatcacgccgccgtgggcgatggtgacgccggcgagcagcctgccgagctc 321
           ||||||||| | ||||||||| ||||||||||| || ||||  |||||| ||   |||||
Sbjct: 141 gatgttgggcagcacgccgccctgggcgatggtcaccccggacagcagcttgttcagctc 82

                                                                    
Query: 322 ctggtcgttgcggacggcgagaagcaggtggcgcgggatgatgcgggtcttcttgtt 378
           || ||||||||||| ||| ||  |||||||||||||||||||||| |||||||||||
Sbjct: 81  ctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttcttgtt 25



to top

>emb|X94693.1|TAH2A254 T.aestivum histone H2A gene
          Length = 2241

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 67/73 (91%)
 Strand = Plus / Minus

                                                                        
Query: 408  gcacctctgcggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccga 467
            ||||||| |||||||||||||| |||||||||||||||||||| ||||||||||  ||||
Sbjct: 1295 gcacctcagcggcgaggtactcaaggacggcggcgaggtagacgggggcgccggctccga 1236

                         
Query: 468  cgcgctgggcgta 480
            |||||| ||||||
Sbjct: 1235 cgcgctcggcgta 1223



 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 119/144 (82%)
 Strand = Plus / Minus

                                                                        
Query: 262  gatgttggggatcacgccgccgtgggcgatggtgacgccggcgagcagcctgccgagctc 321
            ||||||||| ||||| ||||||  |||||||||| ||||| |||||| | ||   |||||
Sbjct: 1707 gatgttgggcatcacaccgccgctggcgatggtggcgccgccgagcaacttggtcagctc 1648

                                                                        
Query: 322  ctggtcgttgcggacggcgagaagcaggtggcgcgggatgatgcgggtcttcttgttatc 381
            || ||| ||||| ||||||||  | | ||||||||| | ||| |||||||||||||| ||
Sbjct: 1647 ctcgtcattgcgcacggcgagctggatgtggcgcggcacgatacgggtcttcttgttgtc 1588

                                    
Query: 382  cttggcggcgttgccggcgagctc 405
            | |||||||||| ||||| |||||
Sbjct: 1587 cctggcggcgtttccggccagctc 1564



to top

>emb|X80328.1|MMH2B143 M.musculus genes H2b-143, H3-143
          Length = 3210

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 118/141 (83%)
 Strand = Plus / Minus

                                                                        
Query: 238  cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 297
            ||||||||| ||||| ||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 1933 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 1874

                                                                        
Query: 298  gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 357
            || | | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||||||
Sbjct: 1873 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 1814

                                 
Query: 358  gatgatgcgggtcttcttgtt 378
            ||||||||| |||||||||||
Sbjct: 1813 gatgatgcgcgtcttcttgtt 1793



to top

>emb|CR457079.1| Homo sapiens full open reading frame cDNA clone RZPDo834A117D for
           gene H2AFX, H2A histone family, member X; complete cds,
           incl. stopcodon
          Length = 432

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 202/253 (79%)
 Strand = Plus / Minus

                                                                       
Query: 238 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 297
           ||||||||| ||||| ||||  | ||||||||| |  ||||| || |||||||| || ||
Sbjct: 360 cttcttgggcagcagcacggcctggatgttgggcaggacgcctccctgggcgatcgtcac 301

                                                                       
Query: 298 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 357
           |||| | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||| ||
Sbjct: 300 gccgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgggg 241

                                                                       
Query: 358 gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 417
           ||||||  | ||||||||||| ||   ||| || ||||| || ||||| || | ||| ||
Sbjct: 240 gatgattagcgtcttcttgttgtcgcgggccgcattgcccgccagctccaggatctcagc 181

                                                                       
Query: 418 ggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgctgggc 477
           || ||||||||| || || || || ||||| || || ||||||| ||| ||||||| |||
Sbjct: 180 ggtgaggtactccagcactgccgccaggtacactggcgcgccggcgccaacgcgctcggc 121

                        
Query: 478 gtagcggcccttc 490
           |||| ||||||||
Sbjct: 120 gtagtggcccttc 108



to top

>gb|L75824.1|WHTHIH2AA Triticum aestivum histone H2A gene, complete cds
          Length = 2241

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 67/73 (91%)
 Strand = Plus / Minus

                                                                        
Query: 408  gcacctctgcggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccga 467
            ||||||| |||||||||||||| |||||||||||||||||||| ||||||||||  ||||
Sbjct: 1295 gcacctcagcggcgaggtactcaaggacggcggcgaggtagacgggggcgccggctccga 1236

                         
Query: 468  cgcgctgggcgta 480
            |||||| ||||||
Sbjct: 1235 cgcgctcggcgta 1223



 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 119/144 (82%)
 Strand = Plus / Minus

                                                                        
Query: 262  gatgttggggatcacgccgccgtgggcgatggtgacgccggcgagcagcctgccgagctc 321
            ||||||||| ||||| ||||||  |||||||||| ||||| |||||| | ||   |||||
Sbjct: 1707 gatgttgggcatcacaccgccgctggcgatggtggcgccgccgagcaacttggtcagctc 1648

                                                                        
Query: 322  ctggtcgttgcggacggcgagaagcaggtggcgcgggatgatgcgggtcttcttgttatc 381
            || ||| ||||| ||||||||  | | ||||||||| | ||| |||||||||||||| ||
Sbjct: 1647 ctcgtcattgcgcacggcgagctggatgtggcgcggcacgatacgggtcttcttgttgtc 1588

                                    
Query: 382  cttggcggcgttgccggcgagctc 405
            | |||||||||| ||||| |||||
Sbjct: 1587 cctggcggcgtttccggccagctc 1564



to top

>gb|AY760064.1| Muntiacus muntjak vaginalis H2A histone family member X (H2AX)
           mRNA, partial cds
          Length = 300

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 184/229 (80%)
 Strand = Plus / Minus

                                                                       
Query: 262 gatgttggggatcacgccgccgtgggcgatggtgacgccggcgagcagcctgccgagctc 321
           ||||||||| |  ||||| || |||||||| || |||||| | |||||| ||  ||||||
Sbjct: 297 gatgttgggcaggacgcctccctgggcgatcgtcacgccgcccagcagcttgttgagctc 238

                                                                       
Query: 322 ctggtcgttgcggacggcgagaagcaggtggcgcgggatgatgcgggtcttcttgttatc 381
           || ||||||||||| ||| ||  |||||||||| ||||| || || ||||||||||| ||
Sbjct: 237 ctcgtcgttgcggatggccagctgcaggtggcgggggattatccgcgtcttcttgttgtc 178

                                                                       
Query: 382 cttggcggcgttgccggcgagctcaagcacctctgcggcgaggtactcgaggacggcggc 441
              ||| |||||||| || ||||| || | ||| |||| |||||||||||| || || ||
Sbjct: 177 gcgggccgcgttgcccgccagctccaggatctcagcggtgaggtactcgagtaccgccgc 118

                                                            
Query: 442 gaggtagacaggggcgccggagccgacgcgctgggcgtagcggcccttc 490
            |||||||| || ||||||| ||| || | || ||||||| ||||||||
Sbjct: 117 caggtagaccggcgcgccggcgcccaccctctcggcgtagtggcccttc 69



to top

>dbj|AP005195.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC
              clone:P0567H04
          Length = 181420

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 70/77 (90%)
 Strand = Plus / Plus

                                                                          
Query: 488    ttcttgaggtagcgcccgatgcggccgacggggaactggagaccggccttcacggaccgg 547
              |||||||||||||||||||| |||| |||||| |||||||| |||||||| ||||| || 
Sbjct: 119132 ttcttgaggtagcgcccgatacggctgacgggcaactggagcccggccttgacggagcgc 119191

                               
Query: 548    gtcaccgccttcttcct 564
              |||||||||||||||||
Sbjct: 119192 gtcaccgccttcttcct 119208



to top

>gb|U95109.1|MSU95109 Mus spicilegus histone H2a pseudogene, complete sequence
          Length = 531

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 118/141 (83%)
 Strand = Plus / Minus

                                                                       
Query: 238 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 297
           ||||||||| ||||| ||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 387 cttcttgggcagcagcacggcctggatgttgggcacgacgccgccctgcgcgatggtcac 328

                                                                       
Query: 298 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 357
           || | | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||||||
Sbjct: 327 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 268

                                
Query: 358 gatgatgcgggtcttcttgtt 378
           ||||||||| |||||||||||
Sbjct: 267 gatgatgcgcgtcttcttgtt 247



to top

>gb|M33988.1|MUSH2AX1 Mouse histone H2A.1 gene, complete cds
          Length = 929

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 118/141 (83%)
 Strand = Plus / Minus

                                                                       
Query: 238 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 297
           ||||||||| ||||| ||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 523 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 464

                                                                       
Query: 298 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 357
           || | | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||||||
Sbjct: 463 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 404

                                
Query: 358 gatgatgcgggtcttcttgtt 378
           ||||||||| |||||||||||
Sbjct: 403 gatgatgcgcgtcttcttgtt 383



to top

>gb|M14141.1|SUPH2A2 P.miliaris histone H2A-2.2 gene, complete cds
          Length = 375

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 118/141 (83%)
 Strand = Plus / Minus

                                                                       
Query: 316 gagctcctggtcgttgcggacggcgagaagcaggtggcgcgggatgatgcgggtcttctt 375
           |||||||| |||||||||||| || ||  | || ||||| |||||||| | | |||||||
Sbjct: 279 gagctcctcgtcgttgcggacagccagctgaagatggcgggggatgatcctgctcttctt 220

                                                                       
Query: 376 gttatccttggcggcgttgccggcgagctcaagcacctctgcggcgaggtactcgaggac 435
           ||| ||   ||||||||||||||||||||| || | ||| |||| |||||||||||||||
Sbjct: 219 gttgtcgcgggcggcgttgccggcgagctcgaggatctcagcggtgaggtactcgaggac 160

                                
Query: 436 ggcggcgaggtagacaggggc 456
           ||| |||||||| || |||||
Sbjct: 159 ggctgcgaggtacactggggc 139



to top

>gb|BC077427.1| Xenopus laevis MGC82198 protein, mRNA (cDNA clone MGC:82198
           IMAGE:3402168), complete cds
          Length = 1591

 Score = 95.6 bits (48), Expect = 2e-16
 Identities = 171/212 (80%)
 Strand = Plus / Minus

                                                                       
Query: 239 ttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgacg 298
           |||||||| ||||| ||||| | ||||||||| |  || ||||| || ||||| ||||| 
Sbjct: 367 ttcttgggcagcagcacggactggatgttgggcaggaccccgccctgagcgatagtgact 308

                                                                       
Query: 299 ccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcggg 358
           ||  |||||||  ||  ||||||||  |||||||| || |||||  ||||||| |  |||
Sbjct: 307 cctccgagcagtttgttgagctcctcatcgttgcgcacagcgagctgcaggtgcctgggg 248

                                                                       
Query: 359 atgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgcg 418
           ||||||||||||||||||||||||  ||| ||||||||||| | ||| || | ||| |||
Sbjct: 247 atgatgcgggtcttcttgttatcccgggcagcgttgccggccaactccaggatctcagcg 188

                                           
Query: 419 gcgaggtactcgaggacggcggcgaggtagac 450
           |  ||||||||||| || |||||||| |||||
Sbjct: 187 gtcaggtactcgagcactgcggcgagatagac 156



to top

>gb|AY849374.1| Emiliania huxleyi histone H2A mRNA, complete cds
          Length = 680

 Score = 95.6 bits (48), Expect = 2e-16
 Identities = 201/252 (79%)
 Strand = Plus / Minus

                                                                       
Query: 235 ggacttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggt 294
           ||||||||| || || || || |||| |||||||||||  |||||||| || |||| |||
Sbjct: 357 ggacttcttcggcaggagcaccgagtggatgttggggaggacgccgccctgcgcgacggt 298

                                                                       
Query: 295 gacgccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcg 354
            |||||| |||| | | ||  |||||||| ||||||||| || |||||    | ||| ||
Sbjct: 297 cacgccgccgaggaacttgttgagctcctcgtcgttgcgcaccgcgagggtgatgtgccg 238

                                                                       
Query: 355 cgggatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctc 414
            || |||||||| | ||||||||| ||    ||||||||||| |||||||| ||||||||
Sbjct: 237 gggaatgatgcgcgacttcttgttgtcgcgcgcggcgttgcccgcgagctcgagcacctc 178

                                                                       
Query: 415 tgcggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgctg 474
            || || | |||||||||||||||||| |||||||| || || || | ||||| ||||  
Sbjct: 177 ggccgccatgtactcgaggacggcggccaggtagaccggcgctcccgcgccgatgcgcga 118

                       
Query: 475 ggcgtagcggcc 486
           ||||||||||||
Sbjct: 117 ggcgtagcggcc 106



to top

>ref|XM_576399.1| PREDICTED: Rattus norvegicus similar to Histone H2A.x (H2a/x)
           (LOC500987), mRNA
          Length = 1569

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 194/243 (79%)
 Strand = Plus / Minus

                                                                       
Query: 238 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 297
           ||||||||| ||||| ||||  | ||||||||| |  |||||||| || ||||| || ||
Sbjct: 639 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatagtcac 580

                                                                       
Query: 298 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 357
           |||| | |||||| ||  |||||||| |||||||||||  || ||  |||||||||||||
Sbjct: 579 gccgcccagcagcttgttgagctcctcgtcgttgcggatagccagctgcaggtggcgcgg 520

                                                                       
Query: 358 gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 417
           ||| ||||| ||||||||||| |||   || |||||||| || ||||| || | ||| ||
Sbjct: 519 gataatgcgcgtcttcttgttgtcccgagccgcgttgcccgccagctccaggatctcggc 460

                                                                       
Query: 418 ggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgctgggc 477
            | |||||||||||| || || || ||||| || || ||||| | ||| ||||||| |||
Sbjct: 459 agtgaggtactcgagcaccgccgccaggtacacgggcgcgcctgcgcccacgcgctcggc 400

              
Query: 478 gta 480
           |||
Sbjct: 399 gta 397



to top

>emb|BX008487.1|CNS08EPN Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA13DG08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 408

 Score = 91.7 bits (46), Expect = 3e-15
 Identities = 119/142 (83%), Gaps = 1/142 (0%)
 Strand = Plus / Minus

                                                                       
Query: 238 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 297
           ||||||||| ||||| ||||  | ||||||||| | ||||||||| ||||||||||| ||
Sbjct: 231 cttcttgggcagcagcacggcctggatgttgggcagcacgccgccctgggcgatggtcac 172

                                                                       
Query: 298 g-ccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcg 356
             ||||  |||||| ||   ||||||| ||||||||||| ||| ||  ||||||||||||
Sbjct: 171 ctccggacagcagcttgttcagctcctcgtcgttgcggatggccagctgcaggtggcgcg 112

                                 
Query: 357 ggatgatgcgggtcttcttgtt 378
           |||||||||| |||||||||||
Sbjct: 111 ggatgatgcgcgtcttcttgtt 90



to top

>gb|AY849373.1| Emiliania huxleyi histone H2A.X mRNA, complete cds
          Length = 613

 Score = 91.7 bits (46), Expect = 3e-15
 Identities = 175/218 (80%)
 Strand = Plus / Minus

                                                                       
Query: 236 gacttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtg 295
           ||||||||||| || || || |||| |||||||||||  ||||||||   ||| ||||||
Sbjct: 359 gacttcttgggcaggagcaccgagtggatgttggggaggacgccgcccgaggcaatggtg 300

                                                                       
Query: 296 acgccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgc 355
           |||||| |||| | | ||  |||||||| |||||||||||| ||||| |  |||||||||
Sbjct: 299 acgccgccgaggaacttgttgagctcctcgtcgttgcggaccgcgaggacgaggtggcgc 240

                                                                       
Query: 356 gggatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctct 415
           ||  ||| |||  |||||||||| ||      ||| ||||| |||||||| |||||||| 
Sbjct: 239 ggcgtgacgcgcttcttcttgttgtcgcgacaggcattgcccgcgagctcgagcacctcg 180

                                                 
Query: 416 gcggcgaggtactcgaggacggcggcgaggtagacagg 453
           || || | |||||||| |||||||| ||||||||||||
Sbjct: 179 gcagccatgtactcgatgacggcggtgaggtagacagg 142



to top

>gb|BT016168.1| Zea mays clone Contig1 mRNA sequence
          Length = 676

 Score = 89.7 bits (45), Expect = 1e-14
 Identities = 144/177 (81%)
 Strand = Plus / Minus

                                                                       
Query: 349 gtggcgcgggatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaag 408
           ||||||||| | ||| ||| |||||||||| |||   || ||||| ||||| ||||| ||
Sbjct: 350 gtggcgcggcacgatacggttcttcttgttgtcccgagcagcgttcccggccagctccag 291

                                                                       
Query: 409 cacctctgcggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgac 468
           |||||| |||||||| |||||||| ||||||| |||||| || ||||| |||| ||||||
Sbjct: 290 cacctcggcggcgagatactcgagaacggcggagaggtacacgggggccccggcgccgac 231

                                                                    
Query: 469 gcgctgggcgtagcggcccttcttgaggtagcgcccgatgcggccgacggggaactg 525
           |||||  || ||    ||   ||||||||| ||| ||||||| ||||||||||||||
Sbjct: 230 gcgctccgcatacttcccggccttgaggtaccgcgcgatgcgaccgacggggaactg 174



to top

>ref|XM_610233.2| PREDICTED: Bos taurus similar to Histone H2AFX (Histone H2A.X)
           (H2a/x) (LOC531733), mRNA
          Length = 1724

 Score = 89.7 bits (45), Expect = 1e-14
 Identities = 183/229 (79%)
 Strand = Plus / Minus

                                                                       
Query: 262 gatgttggggatcacgccgccgtgggcgatggtgacgccggcgagcagcctgccgagctc 321
           ||||||||| |  ||||| || |||||||| || |||||| | |||||| ||  ||||||
Sbjct: 825 gatgttgggcaggacgcctccctgggcgatcgtcacgccgcccagcagcttgttgagctc 766

                                                                       
Query: 322 ctggtcgttgcggacggcgagaagcaggtggcgcgggatgatgcgggtcttcttgttatc 381
           || ||||||||||| ||| ||  |||||||||| ||||| || || ||||||||||| ||
Sbjct: 765 ctcgtcgttgcggatggccagctgcaggtggcgggggattatccgcgtcttcttgttgtc 706

                                                                       
Query: 382 cttggcggcgttgccggcgagctcaagcacctctgcggcgaggtactcgaggacggcggc 441
              ||| || ||||| || ||||| || | ||| |||| |||||||||||| || || ||
Sbjct: 705 gcgggccgcattgcccgccagctccaggatctcagcggtgaggtactcgagtaccgccgc 646

                                                            
Query: 442 gaggtagacaggggcgccggagccgacgcgctgggcgtagcggcccttc 490
            |||||||| || ||||||| ||| || | || ||||||| ||||||||
Sbjct: 645 caggtagaccggcgcgccggcgcccaccctctcggcgtagtggcccttc 597



to top

>ref|XM_545421.1| PREDICTED: Canis familiaris similar to Histone H2A.1 (LOC488299),
           mRNA
          Length = 387

 Score = 89.7 bits (45), Expect = 1e-14
 Identities = 117/141 (82%)
 Strand = Plus / Minus

                                                                       
Query: 238 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 297
           ||||||||| ||||| ||||  | ||||||||| |  |||||||| || |||||||||||
Sbjct: 360 cttcttgggcagcagcacggcctggatgttgggcaagacgccgccctgcgcgatggtgac 301

                                                                       
Query: 298 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 357
              | | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||||||
Sbjct: 300 tttgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 241

                                
Query: 358 gatgatgcgggtcttcttgtt 378
           ||||||||| |||||||||||
Sbjct: 240 gatgatgcgcgtcttcttgtt 220



to top

>ref|XM_545419.2| PREDICTED: Canis familiaris similar to Histone H2A.1 (LOC488297),
           mRNA
          Length = 393

 Score = 89.7 bits (45), Expect = 1e-14
 Identities = 117/141 (82%)
 Strand = Plus / Minus

                                                                       
Query: 238 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 297
           ||||||||| ||||| ||||  | ||||||||| |  |||||||| || |||||||||||
Sbjct: 360 cttcttgggcagcagcacggcctggatgttgggcaagacgccgccctgcgcgatggtgac 301

                                                                       
Query: 298 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 357
              | | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||||||
Sbjct: 300 tttgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 241

                                
Query: 358 gatgatgcgggtcttcttgtt 378
           ||||||||| |||||||||||
Sbjct: 240 gatgatgcgcgtcttcttgtt 220



to top

>emb|CR673199.2|CNS0FIET Tetraodon nigroviridis full-length cDNA
          Length = 775

 Score = 89.7 bits (45), Expect = 1e-14
 Identities = 154/189 (81%), Gaps = 1/189 (0%)
 Strand = Plus / Minus

                                                                       
Query: 262 gatgttggggatcacgccgccgtgggcgatggtgacgccggcgagcagcctgccgagctc 321
           ||||||||| | ||||||||| || |||||||| || ||  | |||||| ||  ||||||
Sbjct: 374 gatgttgggcagcacgccgccctgagcgatggtcactcctcccagcagcttgttgagctc 315

                                                                       
Query: 322 ctggtcgttgcggacggcgagaagcaggtggcgcgggatgatgcgggtcttcttgttatc 381
           || ||||||||| || || ||  |||||||||| |||||||||||||| |||||||| ||
Sbjct: 314 ctcgtcgttgcgcaccgccagctgcaggtggcgggggatgatgcgggt-ttcttgttgtc 256

                                                                       
Query: 382 cttggcggcgttgccggcgagctcaagcacctctgcggcgaggtactcgaggacggcggc 441
              ||| ||||||||||| ||||| || | ||| ||||  |||||||| || ||||||||
Sbjct: 255 gcgggcagcgttgccggccagctccaggatctcggcggtcaggtactccagcacggcggc 196

                    
Query: 442 gaggtagac 450
            ||||||||
Sbjct: 195 caggtagac 187



 Score = 46.1 bits (23), Expect = 0.14
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 509 cggccgacggggaactggagaccggcc 535
           |||||||||||||||||||| ||||||
Sbjct: 128 cggccgacggggaactggagcccggcc 102



to top

>emb|X59962.1|RNTH2AB R.norvegicus genes for TH2A and TH2B histones
          Length = 1653

 Score = 89.7 bits (45), Expect = 1e-14
 Identities = 120/145 (82%)
 Strand = Plus / Minus

                                                                        
Query: 238  cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 297
            ||||||||| ||||| ||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 1496 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 1437

                                                                        
Query: 298  gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 357
            || | | |||||| |   |||||||| ||||||||||| ||| ||  |||||||||||||
Sbjct: 1436 gcggcccagcagcttattgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 1377

                                     
Query: 358  gatgatgcgggtcttcttgttatcc 382
            ||| ||||| |||||||||||||||
Sbjct: 1376 gataatgcgcgtcttcttgttatcc 1352



to top

>ref|NM_021839.1| Rattus norvegicus testis-specific histone 2a (Hist1h2aa), mRNA
          Length = 393

 Score = 89.7 bits (45), Expect = 1e-14
 Identities = 120/145 (82%)
 Strand = Plus / Minus

                                                                       
Query: 238 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 297
           ||||||||| ||||| ||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 360 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 301

                                                                       
Query: 298 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 357
           || | | |||||| |   |||||||| ||||||||||| ||| ||  |||||||||||||
Sbjct: 300 gcggcccagcagcttattgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 241

                                    
Query: 358 gatgatgcgggtcttcttgttatcc 382
           ||| ||||| |||||||||||||||
Sbjct: 240 gataatgcgcgtcttcttgttatcc 216



to top

>gb|AY105006.1| Zea mays PCO108932 mRNA sequence
          Length = 841

 Score = 89.7 bits (45), Expect = 1e-14
 Identities = 144/177 (81%)
 Strand = Plus / Minus

                                                                       
Query: 349 gtggcgcgggatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaag 408
           ||||||||| | ||| ||| |||||||||| |||   || ||||| ||||| ||||| ||
Sbjct: 338 gtggcgcggcacgatacggttcttcttgttgtcccgagcagcgttcccggccagctccag 279

                                                                       
Query: 409 cacctctgcggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgac 468
           |||||| |||||||| |||||||| ||||||| |||||| || ||||| |||| ||||||
Sbjct: 278 cacctcggcggcgagatactcgagaacggcggagaggtacacgggggccccggcgccgac 219

                                                                    
Query: 469 gcgctgggcgtagcggcccttcttgaggtagcgcccgatgcggccgacggggaactg 525
           |||||  || ||    ||   ||||||||| ||| ||||||| ||||||||||||||
Sbjct: 218 gcgctccgcatacttcccggccttgaggtaccgcgcgatgcgaccgacggggaactg 162



to top

>gb|DQ214188.1| Taeniopygia guttata clone 0058P0024E05 histone 1 H2ai-like mRNA,
           complete sequence
          Length = 786

 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 188/236 (79%)
 Strand = Plus / Minus

                                                                       
Query: 238 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 297
           ||||||||| ||||| ||||  | ||||||||| | ||||||||| || ||||| || ||
Sbjct: 443 cttcttgggcagcagcacggcctggatgttgggcagcacgccgccctgcgcgatcgtcac 384

                                                                       
Query: 298 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 357
              | | |||||| ||  |||||||| ||||||||||| ||||||  |||||||||| ||
Sbjct: 383 cttgcccagcagcttgttgagctcctcgtcgttgcggatggcgagctgcaggtggcgggg 324

                                                                       
Query: 358 gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 417
           ||||||||| ||||||||||| ||   ||| |||||||| || ||||| || | ||| ||
Sbjct: 323 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 264

                                                                   
Query: 418 ggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgct 473
            |  |||||||| || ||||| || ||||| || || ||||||| ||| |||||||
Sbjct: 263 cgtcaggtactccagcacggccgccaggtacaccggcgcgccggcgcccacgcgct 208



to top

>gb|DQ214187.1| Taeniopygia guttata clone 0058P0044E04 histone 1 H2ai-like mRNA,
           complete sequence
          Length = 786

 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 188/236 (79%)
 Strand = Plus / Minus

                                                                       
Query: 238 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 297
           ||||||||| ||||| ||||  | ||||||||| | ||||||||| || ||||| || ||
Sbjct: 443 cttcttgggcagcagcacggcctggatgttgggcagcacgccgccctgcgcgatcgtcac 384

                                                                       
Query: 298 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 357
              | | |||||| ||  |||||||| ||||||||||| ||||||  |||||||||| ||
Sbjct: 383 cttgcccagcagcttgttgagctcctcgtcgttgcggatggcgagctgcaggtggcgggg 324

                                                                       
Query: 358 gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 417
           ||||||||| ||||||||||| ||   ||| |||||||| || ||||| || | ||| ||
Sbjct: 323 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 264

                                                                   
Query: 418 ggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgct 473
            |  |||||||| || ||||| || ||||| || || ||||||| ||| |||||||
Sbjct: 263 cgtcaggtactccagcacggccgccaggtacaccggcgcgccggcgcccacgcgct 208



to top

>ref|XM_865148.1| PREDICTED: Bos taurus similar to Histone H2A.1 (LOC613926), mRNA
          Length = 393

 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 137/168 (81%)
 Strand = Plus / Minus

                                                                       
Query: 238 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 297
           |||||| |||||||| ||||  | ||||||||| |  |||||||| || |||||||||||
Sbjct: 360 cttcttagggagcagcacggcctggatgttgggcaggacgccgccctgagcgatggtgac 301

                                                                       
Query: 298 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 357
              | | |||||| ||  |||||||| ||||||||||| ||| ||  ||| ||| |||||
Sbjct: 300 tttgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaagtgacgcgg 241

                                                           
Query: 358 gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctc 405
           ||||||||||||||||||||| |||  ||| |||||||| || |||||
Sbjct: 240 gatgatgcgggtcttcttgttgtcccgggccgcgttgcccgccagctc 193



to top

>ref|XM_545426.2| PREDICTED: Canis familiaris similar to Histone H2A.l (H2A/l)
           (LOC488304), mRNA
          Length = 588

 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 89/104 (85%)
 Strand = Plus / Minus

                                                                       
Query: 275 acgccgccgtgggcgatggtgacgccggcgagcagcctgccgagctcctggtcgttgcgg 334
           |||||||| || |||||||| |||| | | |||||| ||  |||||||| ||||||||||
Sbjct: 470 acgccgccctgcgcgatggtcacgcggcccagcagcttgttgagctcctcgtcgttgcgg 411

                                                       
Query: 335 acggcgagaagcaggtggcgcgggatgatgcgggtcttcttgtt 378
           | ||| ||  |||||||||||||||||||||| |||||||||||
Sbjct: 410 atggccagctgcaggtggcgcgggatgatgcgcgtcttcttgtt 367



to top

>ref|XM_225372.2| PREDICTED: Rattus norvegicus similar to Histone H2A.1 (LOC306962),
           mRNA
          Length = 437

 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 107/128 (83%)
 Strand = Plus / Minus

                                                                       
Query: 278 ccgccgtgggcgatggtgacgccggcgagcagcctgccgagctcctggtcgttgcggacg 337
           ||||| || |||||||| |||| | | |||||| ||  |||||||| ||||||||||| |
Sbjct: 334 ccgccctgcgcgatggtcacgcggcccagcagcttgttgagctcctcgtcgttgcggatg 275

                                                                       
Query: 338 gcgagaagcaggtggcgcgggatgatgcgggtcttcttgttatccttggcggcgttgccg 397
           || ||  |||||||||||||||||||||| ||||||||||| ||| | || |||||||| 
Sbjct: 274 gccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtccctcgccgcgttgccc 215

                   
Query: 398 gcgagctc 405
           || |||||
Sbjct: 214 gccagctc 207



to top

>gb|U95110.1|MMU95110 Mus macedonicus histone H2a pseudogene, complete sequence
          Length = 571

 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 170/212 (80%)
 Strand = Plus / Minus

                                                                       
Query: 262 gatgttggggatcacgccgccgtgggcgatggtgacgccggcgagcagcctgccgagctc 321
           ||||||||| |  |||||||| || |||||||| |||| | | |||||| ||  ||||||
Sbjct: 403 gatgttgggcaggacgccgccctgcgcgatggtcacgcggcccagcagcttgttgagctc 344

                                                                       
Query: 322 ctggtcgttgcggacggcgagaagcaggtggcgcgggatgatgcgggtcttcttgttatc 381
           || ||||||||||| ||| ||  ||||||||| |||||||||||| || |||||||| ||
Sbjct: 343 ctcgtcgttgcggatggccagctgcaggtggcacgggatgatgcgcgttttcttgttgtc 284

                                                                       
Query: 382 cttggcggcgttgccggcgagctcaagcacctctgcggcgaggtactcgaggacggcggc 441
              ||| |||||||| || ||||| || | ||| || |  |||||||| || ||||| ||
Sbjct: 283 gcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcacggccgc 224

                                           
Query: 442 gaggtagacaggggcgccggagccgacgcgct 473
            ||||| || |||||||||| ||| |||||||
Sbjct: 223 caggtacaccggggcgccggcgcccacgcgct 192



to top

>emb|AL512384.9| Human DNA sequence from clone RP11-317E16 on chromosome 6 Contains the
             3' end of the gene for sectretagogin (SECRET), the genes
             for novel H2A and H2B histone family members, H2A and H2B
             histone family pseudogenes, complete sequence
          Length = 49963

 Score = 85.7 bits (43), Expect = 2e-13
 Identities = 64/71 (90%)
 Strand = Plus / Minus

                                                                         
Query: 305   agcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgggatgatg 364
             |||||| || ||||||||| ||||||||||| ||| ||  ||||||||||||||||||||
Sbjct: 39873 agcagcttgtcgagctccttgtcgttgcggatggccagctgcaggtggcgcgggatgatg 39814

                        
Query: 365   cgggtcttctt 375
             |||||||||||
Sbjct: 39813 cgggtcttctt 39803



to top

>emb|X14730.1|CMHIST2A Duck H2A histone gene
          Length = 845

 Score = 85.7 bits (43), Expect = 2e-13
 Identities = 178/223 (79%)
 Strand = Plus / Minus

                                                                       
Query: 239 ttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgacg 298
           |||||||| ||||| ||||  | ||||||||| | ||| ||||| || ||||||||||| 
Sbjct: 509 ttcttgggcagcagcacggcctggatgttgggcagcaccccgccctgcgcgatggtgacc 450

                                                                       
Query: 299 ccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcggg 358
             | | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||| |||
Sbjct: 449 ttgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcggggg 390

                                                                       
Query: 359 atgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgcg 418
           |||||||| ||||||||||| ||   ||| |||||||| || ||||| || | ||| || 
Sbjct: 389 atgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgctagctctaggatctcggcc 330

                                                      
Query: 419 gcgaggtactcgaggacggcggcgaggtagacaggggcgccgg 461
           |  |||||||| || ||||| || ||||| || ||||||||||
Sbjct: 329 gttaggtactccagtacggccgccaggtacaccggggcgccgg 287



to top

>gb|M11085.1|SUPHIS2A2 Sea urchin (P.miliaris) late histone H2A-2 late mRNA, complete cds
          Length = 430

 Score = 85.7 bits (43), Expect = 2e-13
 Identities = 157/195 (80%)
 Strand = Plus / Minus

                                                                       
Query: 262 gatgttggggatcacgccgccgtgggcgatggtgacgccggcgagcagcctgccgagctc 321
           |||||||||||  || || || || ||||||||||| ||  |||| ||| ||  ||||||
Sbjct: 348 gatgttggggaggacaccaccctgagcgatggtgactcctccgagaagcttgttgagctc 289

                                                                       
Query: 322 ctggtcgttgcggacggcgagaagcaggtggcgcgggatgatgcgggtcttcttgttatc 381
           || |||||||||||| || |   | || || || |||||||| | | |||||||||| ||
Sbjct: 288 ctcgtcgttgcggacagccaactgaagatgacgggggatgatcctgctcttcttgttgtc 229

                                                                       
Query: 382 cttggcggcgttgccggcgagctcaagcacctctgcggcgaggtactcgaggacggcggc 441
              ||||||||||||||||||||| || | ||| |||| |||||||||||||||||| ||
Sbjct: 228 gcgggcggcgttgccggcgagctcgaggatctcagcggtgaggtactcgaggacggctgc 169

                          
Query: 442 gaggtagacaggggc 456
           |||||| || |||||
Sbjct: 168 gaggtacactggggc 154



to top

>ref|XM_527262.1| PREDICTED: Pan troglodytes similar to histone protein Hist1h2af
           (LOC471884), mRNA
          Length = 420

 Score = 83.8 bits (42), Expect = 7e-13
 Identities = 57/62 (91%)
 Strand = Plus / Minus

                                                                       
Query: 317 agctcctggtcgttgcggacggcgagaagcaggtggcgcgggatgatgcgggtcttcttg 376
           ||||||| ||||||||||| ||| ||  ||||||||||||||||||||||||||||||||
Sbjct: 281 agctcctcgtcgttgcggatggctagctgcaggtggcgcgggatgatgcgggtcttcttg 222

             
Query: 377 tt 378
           ||
Sbjct: 221 tt 220



to top

>ref|XM_871147.1| PREDICTED: Bos taurus similar to Histone H2A.1 (LOC618824), mRNA
          Length = 453

 Score = 83.8 bits (42), Expect = 7e-13
 Identities = 78/90 (86%)
 Strand = Plus / Minus

                                                                       
Query: 316 gagctcctggtcgttgcggacggcgagaagcaggtggcgcgggatgatgcgggtcttctt 375
           |||||||| |||||||||||  || ||  ||||||| |||||||||||||||||||||||
Sbjct: 282 gagctcctcgtcgttgcggattgccagctgcaggtgacgcgggatgatgcgggtcttctt 223

                                         
Query: 376 gttatccttggcggcgttgccggcgagctc 405
           |||||||  ||| |||||||| || |||||
Sbjct: 222 gttatcccgggccgcgttgcccgccagctc 193



to top

>ref|XM_868899.1| PREDICTED: Bos taurus similar to Histone H2A.1 (LOC616790), mRNA
          Length = 413

 Score = 83.8 bits (42), Expect = 7e-13
 Identities = 78/90 (86%)
 Strand = Plus / Minus

                                                                       
Query: 316 gagctcctggtcgttgcggacggcgagaagcaggtggcgcgggatgatgcgggtcttctt 375
           |||||||| ||||||||||| ||| ||  ||||||| |||||||||||||||||||||||
Sbjct: 302 gagctcctcgtcgttgcggatggccagctgcaggtgacgcgggatgatgcgggtcttctt 243

                                         
Query: 376 gttatccttggcggcgttgccggcgagctc 405
           ||| |||  ||| |||||||| || |||||
Sbjct: 242 gttgtcccgggccgcgttgcccgccagctc 213



to top

>ref|XM_543796.2| PREDICTED: Canis familiaris similar to H2A histone family, member J
           isoform 2 (LOC486669), mRNA
          Length = 598

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 116/141 (82%)
 Strand = Plus / Minus

                                                                       
Query: 238 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 297
           ||||||||| ||||| ||||  | ||||||||| |  |||||||| || |||||||||||
Sbjct: 438 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtgac 379

                                                                       
Query: 298 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 357
                | |||||| ||  |||||||| ||||||||||| ||||||  |||||||||||||
Sbjct: 378 tttccccagcagcttgttgagctcctcgtcgttgcggatggcgagttgcaggtggcgcgg 319

                                
Query: 358 gatgatgcgggtcttcttgtt 378
           |||||| | ||||||||||||
Sbjct: 318 gatgatcctggtcttcttgtt 298



to top

>gb|AY158937.1| Mus musculus histone protein Hist1h2bc gene, complete cds
          Length = 1401

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 107/129 (82%)
 Strand = Plus / Plus

                                                                       
Query: 345 gcaggtggcgcgggatgatgcgggtcttcttgttatccttggcggcgttgccggcgagct 404
           |||||||||||||||||||||| ||||||||||| ||   ||| |||||||| || ||||
Sbjct: 17  gcaggtggcgcgggatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagct 76

                                                                       
Query: 405 caagcacctctgcggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagc 464
           | || | ||| || |  |||||||| || ||||| || |||||||| |||||||||| ||
Sbjct: 77  ccaggatctcggccgtcaggtactccagcacggccgccaggtagaccggggcgccggcgc 136

                    
Query: 465 cgacgcgct 473
           | |||||||
Sbjct: 137 ccacgcgct 145



to top

>ref|XM_551996.1| Anopheles gambiae str. PEST ENSANGP00000029020
           (ENSANGG00000023190), partial mRNA
          Length = 297

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 107/129 (82%)
 Strand = Plus / Minus

                                                                       
Query: 238 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 297
           ||||||||| ||||| ||||  | ||||||||| | ||||||||| ||||||||||| ||
Sbjct: 279 cttcttgggcagcagcacggcctggatgttgggcagcacgccgccctgggcgatggtcac 220

                                                                       
Query: 298 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 357
            ||||  |||||| ||   ||||||| ||||||||||| ||| ||  |||| ||||||||
Sbjct: 219 cccggacagcagcttgttcagctcctcgtcgttgcggatggccagctgcagatggcgcgg 160

                    
Query: 358 gatgatgcg 366
           |||||||||
Sbjct: 159 gatgatgcg 151



to top

>gb|M11084.1|SUPHIS2A1 Sea urchin (P.miliaris) late histone H2A-1 late mRNA, complete cds
          Length = 465

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 179/225 (79%)
 Strand = Plus / Minus

                                                                       
Query: 232 ggcggacttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgat 291
           ||||| |||||||||||| || || |  | |||||||||||  || || || || |||||
Sbjct: 404 ggcggtcttcttggggaggaggacagcctggatgttggggaggacaccaccctgagcgat 345

                                                                       
Query: 292 ggtgacgccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtg 351
           |||||| ||  |||| ||| ||  |||||||| |||||||||||| || |   | || ||
Sbjct: 344 ggtgactcctccgagaagcttgttgagctcctcgtcgttgcggacagccaactgaagatg 285

                                                                       
Query: 352 gcgcgggatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcac 411
            || |||||||| | | |||||||||| ||   ||||||||||||||||||||| || | 
Sbjct: 284 acgggggatgatcctgctcttcttgttgtcgcgggcggcgttgccggcgagctcgaggat 225

                                                        
Query: 412 ctctgcggcgaggtactcgaggacggcggcgaggtagacaggggc 456
           ||| |||| |||||||||||| ||||| |||||||| || |||||
Sbjct: 224 ctcagcggtgaggtactcgagtacggctgcgaggtacactggggc 180



to top

>gb|M14140.1|SUPH2B2 P.miliaris histone H2A-2.1 gene, complete cds
          Length = 375

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 86/101 (85%)
 Strand = Plus / Minus

                                                                       
Query: 356 gggatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctct 415
           |||||||| | | |||||||||| ||   ||||||||||||||||||||| || | ||| 
Sbjct: 239 gggatgatcctgctcttcttgttgtcgcgggcggcgttgccggcgagctcgaggatctca 180

                                                    
Query: 416 gcggcgaggtactcgaggacggcggcgaggtagacaggggc 456
           |||| |||||||||||||||||| |||||||| || |||||
Sbjct: 179 gcggtgaggtactcgaggacggctgcgaggtacactggggc 139



to top

>ref|XM_425469.1| PREDICTED: Gallus gallus similar to histone 2, H2ac (LOC427895),
           mRNA
          Length = 390

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 178/224 (79%)
 Strand = Plus / Minus

                                                                       
Query: 238 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 297
           ||||||||| ||||| ||||  | ||||||||| | ||| ||||| || |||||||| ||
Sbjct: 360 cttcttgggcagcagcacggcctggatgttgggcagcaccccgccctgcgcgatggtcac 301

                                                                       
Query: 298 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 357
              | | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||| ||
Sbjct: 300 cttgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgggg 241

                                                                       
Query: 358 gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 417
           ||||||||| ||||||||||| ||   ||| |||||||| || ||||| || | ||| ||
Sbjct: 240 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 181

                                                       
Query: 418 ggcgaggtactcgaggacggcggcgaggtagacaggggcgccgg 461
            |  |||||||| || ||||| || ||||| || ||||||||||
Sbjct: 180 cgtcaggtactccagcacggccgccaggtacaccggggcgccgg 137



to top

>ref|XM_425465.1| PREDICTED: Gallus gallus similar to histone 2, H2ac (LOC427891),
           mRNA
          Length = 390

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 178/224 (79%)
 Strand = Plus / Minus

                                                                       
Query: 238 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 297
           ||||||||| ||||| ||||  | ||||||||| | ||| ||||| || |||||||| ||
Sbjct: 360 cttcttgggcagcagcacggcctggatgttgggcagcaccccgccctgcgcgatggtcac 301

                                                                       
Query: 298 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 357
              | | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||| ||
Sbjct: 300 cttgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgggg 241

                                                                       
Query: 358 gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 417
           ||||||||| ||||||||||| ||   ||| |||||||| || ||||| || | ||| ||
Sbjct: 240 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 181

                                                       
Query: 418 ggcgaggtactcgaggacggcggcgaggtagacaggggcgccgg 461
            |  |||||||| || ||||| || ||||| || ||||||||||
Sbjct: 180 cgtcaggtactccagcacggccgccaggtacaccggggcgccgg 137



to top

>ref|XM_425459.1| PREDICTED: Gallus gallus similar to histone 2, H2ac (LOC427885),
           mRNA
          Length = 918

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 178/224 (79%)
 Strand = Plus / Minus

                                                                       
Query: 238 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 297
           ||||||||| ||||| ||||  | ||||||||| | ||| ||||| || |||||||| ||
Sbjct: 360 cttcttgggcagcagcacggcctggatgttgggcagcaccccgccctgcgcgatggtcac 301

                                                                       
Query: 298 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 357
              | | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||| ||
Sbjct: 300 cttgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgggg 241

                                                                       
Query: 358 gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 417
           ||||||||| ||||||||||| ||   ||| |||||||| || ||||| || | ||| ||
Sbjct: 240 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 181

                                                       
Query: 418 ggcgaggtactcgaggacggcggcgaggtagacaggggcgccgg 461
            |  |||||||| || ||||| || ||||| || ||||||||||
Sbjct: 180 cgtcaggtactccagcacggccgccaggtacaccggggcgccgg 137



to top

>ref|XM_425455.1| PREDICTED: Gallus gallus similar to histone 2, H2ac (LOC427881),
           mRNA
          Length = 534

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 178/224 (79%)
 Strand = Plus / Minus

                                                                       
Query: 238 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 297
           ||||||||| ||||| ||||  | ||||||||| | ||| ||||| || |||||||| ||
Sbjct: 504 cttcttgggcagcagcacggcctggatgttgggcagcaccccgccctgcgcgatggtcac 445

                                                                       
Query: 298 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 357
              | | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||| ||
Sbjct: 444 cttgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgggg 385

                                                                       
Query: 358 gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 417
           ||||||||| ||||||||||| ||   ||| |||||||| || ||||| || | ||| ||
Sbjct: 384 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 325

                                                       
Query: 418 ggcgaggtactcgaggacggcggcgaggtagacaggggcgccgg 461
            |  |||||||| || ||||| || ||||| || ||||||||||
Sbjct: 324 cgtcaggtactccagcacggccgccaggtacaccggggcgccgg 281



to top

>ref|XM_416195.1| PREDICTED: Gallus gallus similar to histone 2, H2ac (LOC417955), mRNA
          Length = 1220

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 178/224 (79%)
 Strand = Plus / Minus

                                                                        
Query: 238  cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 297
            ||||||||| ||||| ||||  | ||||||||| | ||| ||||| || |||||||| ||
Sbjct: 1190 cttcttgggcagcagcacggcctggatgttgggcagcaccccgccctgcgcgatggtcac 1131

                                                                        
Query: 298  gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 357
               | | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||| ||
Sbjct: 1130 cttgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgggg 1071

                                                                        
Query: 358  gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 417
            ||||||||| ||||||||||| ||   ||| |||||||| || ||||| || | ||| ||
Sbjct: 1070 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 1011

                                                        
Query: 418  ggcgaggtactcgaggacggcggcgaggtagacaggggcgccgg 461
             |  |||||||| || ||||| || ||||| || ||||||||||
Sbjct: 1010 cgtcaggtactccagcacggccgccaggtacaccggggcgccgg 967



to top

>ref|XM_416192.1| PREDICTED: Gallus gallus similar to germinal histone H4 gene
           (LOC417952), mRNA
          Length = 1374

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 178/224 (79%)
 Strand = Plus / Plus

                                                                       
Query: 238 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 297
           ||||||||| ||||| ||||  | ||||||||| | ||| ||||| || |||||||| ||
Sbjct: 730 cttcttgggcagcagcacggcctggatgttgggcagcaccccgccctgcgcgatggtcac 789

                                                                       
Query: 298 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 357
              | | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||| ||
Sbjct: 790 cttgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgggg 849

                                                                       
Query: 358 gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 417
           ||||||||| ||||||||||| ||   ||| |||||||| || ||||| || | ||| ||
Sbjct: 850 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 909

                                                       
Query: 418 ggcgaggtactcgaggacggcggcgaggtagacaggggcgccgg 461
            |  |||||||| || ||||| || ||||| || ||||||||||
Sbjct: 910 cgtcaggtactccagcacggccgccaggtacaccggggcgccgg 953



to top

>ref|XM_906486.2| PREDICTED: Mus musculus similar to H2A histone family, member J
           (LOC632401), mRNA
          Length = 1833

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 136/168 (80%)
 Strand = Plus / Minus

                                                                       
Query: 238 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 297
           ||||||||| ||||| ||||  | ||| ||||| |  |||||||| || |||||||| ||
Sbjct: 456 cttcttgggcagcagcacggcctggatattgggcaggacgccgccctgcgcgatggtcac 397

                                                                       
Query: 298 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 357
            | | | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||| ||
Sbjct: 396 acggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgagg 337

                                                           
Query: 358 gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctc 405
           ||||||||| ||||||||||| ||| | || |||||||| || |||||
Sbjct: 336 gatgatgcgcgtcttcttgttgtccctcgccgcgttgcccgccagctc 289



to top

>emb|X02218.1|GGHIS1 Chicken duplicated genes for histone H2A, H4 and a histone H3 gene
          Length = 8384

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 178/224 (79%)
 Strand = Plus / Minus

                                                                        
Query: 238  cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 297
            ||||||||| ||||| ||||  | ||||||||| | ||| ||||| || |||||||| ||
Sbjct: 5291 cttcttgggcagcagcacggcctggatgttgggcagcaccccgccctgcgcgatggtcac 5232

                                                                        
Query: 298  gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 357
               | | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||| ||
Sbjct: 5231 cttgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgggg 5172

                                                                        
Query: 358  gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 417
            ||||||||| ||||||||||| ||   ||| |||||||| || ||||| || | ||| ||
Sbjct: 5171 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 5112

                                                        
Query: 418  ggcgaggtactcgaggacggcggcgaggtagacaggggcgccgg 461
             |  |||||||| || ||||| || ||||| || ||||||||||
Sbjct: 5111 cgtcaggtactccagcacggccgccaggtacaccggggcgccgg 5068



 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 119/146 (81%)
 Strand = Plus / Plus

                                                                        
Query: 316  gagctcctggtcgttgcggacggcgagaagcaggtggcgcgggatgatgcgggtcttctt 375
            |||||||| ||||||||||| ||| ||  |||||||||| ||||||||||| ||||||||
Sbjct: 2231 gagctcctcgtcgttgcggatggccagctgcaggtggcgggggatgatgcgcgtcttctt 2290

                                                                        
Query: 376  gttatccttggcggcgttgccggcgagctcaagcacctctgcggcgaggtactcgaggac 435
            ||| ||   ||| |||||||| || ||||| || | ||| || |  |||||||| || ||
Sbjct: 2291 gttgtcgcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcac 2350

                                      
Query: 436  ggcggcgaggtagacaggggcgccgg 461
            ||| || ||||| || ||||||||||
Sbjct: 2351 ggccgccaggtacaccggggcgccgg 2376



to top

>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete
               sequence
          Length = 35498469

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 105/128 (82%), Gaps = 9/128 (7%)
 Strand = Plus / Minus

                                                                           
Query: 435     cggcggcgaggtagacaggggcgccggagccgacgcgctgggcgtagcggcccttcttga 494
               |||||||||||||||| || ||||||  |||||||||||| || ||||| ||||||||||
Sbjct: 7508224 cggcggcgaggtagacgggtgcgccgatgccgacgcgctgcgcatagcgtcccttcttga 7508165

                                                                           
Query: 495     ggtagcgcccgatgcggccgacggggaactggagaccggccttcacggaccgggtcaccg 554
               ||||||         ||||||||||||||||||| | ||||||  |||| |||| |||||
Sbjct: 7508164 ggtagc---------ggccgacggggaactggagcctggccttgccggagcgggacaccg 7508114

                       
Query: 555     ccttcttc 562
                |||||||
Sbjct: 7508113 gcttcttc 7508106



 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 166     cttcttgggggacttggtggc 186
               |||||||||||||||||||||
Sbjct: 7508532 cttcttgggggacttggtggc 7508512



 Score = 42.1 bits (21), Expect = 2.3
 Identities = 133/169 (78%), Gaps = 1/169 (0%)
 Strand = Plus / Minus

                                                                           
Query: 245     gggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgacgccggcg 304
               |||||||| || | ||||||||| || | ||| || || || |||||||||||||| || 
Sbjct: 7508467 gggagcagcaccgggttgatgttcggcagcacaccaccatgcgcgatggtgacgccagcc 7508408

                                                                           
Query: 305     agcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgggatgatg 364
               ||||| || |||||||| | |||||||  ||  || || |||| ||| | ||||||||| 
Sbjct: 7508407 agcag-cttccgagctcatcgtcgttgtagatcgccagcagcacgtgcctcgggatgatc 7508349

                                                                
Query: 365     cgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacct 413
               ||| | ||||||||  ||   || ||||| ||||||||||| |||||||
Sbjct: 7508348 cggtttttcttgttgccccgcgccgcgttcccggcgagctccagcacct 7508300



 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 154      ggcgggggccttcttcttgg 173
                ||||||||||||||||||||
Sbjct: 32130756 ggcgggggccttcttcttgg 32130737



 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 222    cggccgcggcggcggacttc 241
              ||||||||||||||||||||
Sbjct: 377412 cggccgcggcggcggacttc 377393



to top

>gb|BC024397.1| Mus musculus H2A histone family, member J, mRNA (cDNA clone
           MGC:36202 IMAGE:5055276), complete cds
          Length = 550

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 136/168 (80%)
 Strand = Plus / Minus

                                                                       
Query: 238 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 297
           ||||||||| ||||| ||||  | ||| ||||| |  |||||||| || |||||||| ||
Sbjct: 412 cttcttgggcagcagcacggcctggatattgggcaggacgccgccctgcgcgatggtcac 353

                                                                       
Query: 298 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 357
            | | | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||| ||
Sbjct: 352 acggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgagg 293

                                                           
Query: 358 gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctc 405
           ||||||||| ||||||||||| ||| | || |||||||| || |||||
Sbjct: 292 gatgatgcgcgtcttcttgttgtccctcgccgcgttgcccgccagctc 245



to top

>dbj|D11055.1|CHKH2A4H Gallus gallus gene for H2A histone, complete cds
          Length = 1028

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 178/224 (79%)
 Strand = Plus / Minus

                                                                       
Query: 238 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 297
           ||||||||| ||||| ||||  | ||||||||| | ||| ||||| || |||||||| ||
Sbjct: 691 cttcttgggcagcagcacggcctggatgttgggcagcaccccgccctgcgcgatggtcac 632

                                                                       
Query: 298 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 357
              | | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||| ||
Sbjct: 631 cttgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgggg 572

                                                                       
Query: 358 gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 417
           ||||||||| ||||||||||| ||   ||| |||||||| || ||||| || | ||| ||
Sbjct: 571 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 512

                                                       
Query: 418 ggcgaggtactcgaggacggcggcgaggtagacaggggcgccgg 461
            |  |||||||| || ||||| || ||||| || ||||||||||
Sbjct: 511 cgtcaggtactccagcacggccgccaggtacaccggggcgccgg 468



to top

>gb|U38933.1|GGU38933 Gallus gallus histone H2A (H2A-VIII) gene, complete cds
          Length = 740

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 178/224 (79%)
 Strand = Plus / Minus

                                                                       
Query: 238 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 297
           ||||||||| ||||| ||||  | ||||||||| | ||| ||||| || |||||||| ||
Sbjct: 538 cttcttgggcagcagcacggcctggatgttgggcagcaccccgccctgcgcgatggtcac 479

                                                                       
Query: 298 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 357
              | | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||| ||
Sbjct: 478 cttgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgggg 419

                                                                       
Query: 358 gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 417
           ||||||||| ||||||||||| ||   ||| |||||||| || ||||| || | ||| ||
Sbjct: 418 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 359

                                                       
Query: 418 ggcgaggtactcgaggacggcggcgaggtagacaggggcgccgg 461
            |  |||||||| || ||||| || ||||| || ||||||||||
Sbjct: 358 cgtcaggtactccagcacggccgccaggtacaccggggcgccgg 315



to top

>gb|U38931.1|GGU38931 Gallus gallus histone H2A (H2A-VI) gene, complete cds
          Length = 743

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 178/224 (79%)
 Strand = Plus / Minus

                                                                       
Query: 238 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 297
           ||||||||| ||||| ||||  | ||||||||| | ||| ||||| || |||||||| ||
Sbjct: 383 cttcttgggcagcagcacggcctggatgttgggcagcaccccgccctgcgcgatggtcac 324

                                                                       
Query: 298 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 357
              | | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||| ||
Sbjct: 323 cttgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgggg 264

                                                                       
Query: 358 gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 417
           ||||||||| ||||||||||| ||   ||| |||||||| || ||||| || | ||| ||
Sbjct: 263 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 204

                                                       
Query: 418 ggcgaggtactcgaggacggcggcgaggtagacaggggcgccgg 461
            |  |||||||| || ||||| || ||||| || ||||||||||
Sbjct: 203 cgtcaggtactccagcacggccgccaggtacaccggggcgccgg 160



to top

>emb|AL662960.3|OSJN00162 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0021F22,
             complete sequence
          Length = 181498

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 105/128 (82%), Gaps = 9/128 (7%)
 Strand = Plus / Minus

                                                                         
Query: 435   cggcggcgaggtagacaggggcgccggagccgacgcgctgggcgtagcggcccttcttga 494
             |||||||||||||||| || ||||||  |||||||||||| || ||||| ||||||||||
Sbjct: 30697 cggcggcgaggtagacgggtgcgccgatgccgacgcgctgcgcatagcgtcccttcttga 30638

                                                                         
Query: 495   ggtagcgcccgatgcggccgacggggaactggagaccggccttcacggaccgggtcaccg 554
             ||||||         ||||||||||||||||||| | ||||||  |||| |||| |||||
Sbjct: 30637 ggtagc---------ggccgacggggaactggagcctggccttgccggagcgggacaccg 30587

                     
Query: 555   ccttcttc 562
              |||||||
Sbjct: 30586 gcttcttc 30579



 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 166   cttcttgggggacttggtggc 186
             |||||||||||||||||||||
Sbjct: 31005 cttcttgggggacttggtggc 30985



 Score = 42.1 bits (21), Expect = 2.3
 Identities = 133/169 (78%), Gaps = 1/169 (0%)
 Strand = Plus / Minus

                                                                         
Query: 245   gggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgacgccggcg 304
             |||||||| || | ||||||||| || | ||| || || || |||||||||||||| || 
Sbjct: 30940 gggagcagcaccgggttgatgttcggcagcacaccaccatgcgcgatggtgacgccagcc 30881

                                                                         
Query: 305   agcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgggatgatg 364
             ||||| || |||||||| | |||||||  ||  || || |||| ||| | ||||||||| 
Sbjct: 30880 agcag-cttccgagctcatcgtcgttgtagatcgccagcagcacgtgcctcgggatgatc 30822

                                                              
Query: 365   cgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacct 413
             ||| | ||||||||  ||   || ||||| ||||||||||| |||||||
Sbjct: 30821 cggtttttcttgttgccccgcgccgcgttcccggcgagctccagcacct 30773



to top

>gb|J00864.1|CHKH2A2B Chicken histone H2A/H2B gene pair and flanks
          Length = 1564

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 178/224 (79%)
 Strand = Plus / Plus

                                                                       
Query: 238 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 297
           ||||||||| ||||| ||||  | ||||||||| | ||| ||||| || |||||||| ||
Sbjct: 286 cttcttgggcagcagcacggcctggatgttgggcagcaccccgccctgcgcgatggtcac 345

                                                                       
Query: 298 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 357
              | | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||| ||
Sbjct: 346 cttgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgggg 405

                                                                       
Query: 358 gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 417
           ||||||||| ||||||||||| ||   ||| |||||||| || ||||| || | ||| ||
Sbjct: 406 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgctagctccaggatctcggc 465

                                                       
Query: 418 ggcgaggtactcgaggacggcggcgaggtagacaggggcgccgg 461
            |  |||||||| || ||||| || ||||| || ||||||||||
Sbjct: 466 cgtcaggtactccagcacggccgctaggtacaccggggcgccgg 509



to top

>ref|XM_481315.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 936

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 78/91 (85%)
 Strand = Plus / Minus

                                                                       
Query: 411 cctctgcggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgc 470
           |||||||||| |||||| |||||||||| ||||||||||| |||| ||| | ||||||||
Sbjct: 490 cctctgcggcaaggtacccgaggacggcagcgaggtagacgggggtgccagtgccgacgc 431

                                          
Query: 471 gctgggcgtagcggcccttcttgaggtagcg 501
           | || ||||  ||||| |||| |||||||||
Sbjct: 430 gttgcgcgtgccggccgttctcgaggtagcg 400



to top

>ref|XM_518300.1| PREDICTED: Pan troglodytes similar to Histone H2A.1 (LOC462507),
           mRNA
          Length = 846

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 57/63 (90%)
 Strand = Plus / Minus

                                                                       
Query: 316 gagctcctggtcgttgcggacggcgagaagcaggtggcgcgggatgatgcgggtcttctt 375
           |||||||| ||||||||||| ||| ||  ||| |||||||||||||||||||||||||||
Sbjct: 228 gagctcctcgtcgttgcggatggccagctgcaagtggcgcgggatgatgcgggtcttctt 169

              
Query: 376 gtt 378
           |||
Sbjct: 168 gtt 166



to top

>ref|NM_175662.1| Mus musculus histone 2, H2ac (Hist2h2ac), mRNA
          Length = 390

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 57/63 (90%)
 Strand = Plus / Minus

                                                                       
Query: 316 gagctcctggtcgttgcggacggcgagaagcaggtggcgcgggatgatgcgggtcttctt 375
           |||||||| ||||||||||| ||| ||  |||||||||||||||||||||| ||||||||
Sbjct: 282 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 223

              
Query: 376 gtt 378
           |||
Sbjct: 222 gtt 220



to top

>ref|NM_013549.1| Mus musculus histone 2, H2aa1 (Hist2h2aa1), mRNA
          Length = 578

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 57/63 (90%)
 Strand = Plus / Minus

                                                                       
Query: 316 gagctcctggtcgttgcggacggcgagaagcaggtggcgcgggatgatgcgggtcttctt 375
           |||||||| ||||||||||| ||| ||  |||||||||||||||||||||| ||||||||
Sbjct: 325 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 266

              
Query: 376 gtt 378
           |||
Sbjct: 265 gtt 263



to top

>gb|BC104198.1| Homo sapiens histone 1, H2ak, mRNA (cDNA clone MGC:125892
           IMAGE:40031339), complete cds
          Length = 438

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 57/63 (90%)
 Strand = Plus / Minus

                                                                       
Query: 316 gagctcctggtcgttgcggacggcgagaagcaggtggcgcgggatgatgcgggtcttctt 375
           |||||||| ||||||||||| ||| ||  ||| |||||||||||||||||||||||||||
Sbjct: 282 gagctcctcgtcgttgcggatggccagctgcaagtggcgcgggatgatgcgggtcttctt 223

              
Query: 376 gtt 378
           |||
Sbjct: 222 gtt 220



to top

>gb|BC104199.1| Homo sapiens histone 1, H2ak, mRNA (cDNA clone MGC:125893
           IMAGE:40031340), complete cds
          Length = 438

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 57/63 (90%)
 Strand = Plus / Minus

                                                                       
Query: 316 gagctcctggtcgttgcggacggcgagaagcaggtggcgcgggatgatgcgggtcttctt 375
           |||||||| ||||||||||| ||| ||  ||| |||||||||||||||||||||||||||
Sbjct: 282 gagctcctcgtcgttgcggatggccagctgcaagtggcgcgggatgatgcgggtcttctt 223

              
Query: 376 gtt 378
           |||
Sbjct: 222 gtt 220



to top

>gb|BC080809.1| Mus musculus cDNA clone IMAGE:6466339
          Length = 2972

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 57/63 (90%)
 Strand = Plus / Minus

                                                                       
Query: 316 gagctcctggtcgttgcggacggcgagaagcaggtggcgcgggatgatgcgggtcttctt 375
           |||||||| ||||||||||| ||| ||  |||||||||||||||||||||| ||||||||
Sbjct: 309 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 250

              
Query: 376 gtt 378
           |||
Sbjct: 249 gtt 247



to top

>gb|BC034487.2| Homo sapiens histone 1, H2ak, mRNA (cDNA clone IMAGE:4825623), with
           apparent retained intron
          Length = 2884

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 57/63 (90%)
 Strand = Plus / Minus

                                                                       
Query: 316 gagctcctggtcgttgcggacggcgagaagcaggtggcgcgggatgatgcgggtcttctt 375
           |||||||| ||||||||||| ||| ||  ||| |||||||||||||||||||||||||||
Sbjct: 318 gagctcctcgtcgttgcggatggccagctgcaagtggcgcgggatgatgcgggtcttctt 259

              
Query: 376 gtt 378
           |||
Sbjct: 258 gtt 256



to top

>gb|BC010564.1| Mus musculus histone 2, H2aa1, mRNA (cDNA clone IMAGE:3582122),
           partial cds
          Length = 543

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 57/63 (90%)
 Strand = Plus / Minus

                                                                       
Query: 316 gagctcctggtcgttgcggacggcgagaagcaggtggcgcgggatgatgcgggtcttctt 375
           |||||||| ||||||||||| ||| ||  |||||||||||||||||||||| ||||||||
Sbjct: 309 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 250

              
Query: 376 gtt 378
           |||
Sbjct: 249 gtt 247



to top

>ref|NG_001335.1| Homo sapiens genomic large histone family cluster (HFL@) on chromosome 6
          Length = 269712

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 54/59 (91%)
 Strand = Plus / Minus

                                                                         
Query: 317    agctcctggtcgttgcggacggcgagaagcaggtggcgcgggatgatgcgggtcttctt 375
              ||||||| ||||||||||| ||| ||  |||||||||||||||||||||||||||||||
Sbjct: 201255 agctcctcgtcgttgcggatggctagctgcaggtggcgcgggatgatgcgggtcttctt 201197



 Score = 73.8 bits (37), Expect = 6e-10
 Identities = 76/89 (85%)
 Strand = Plus / Plus

                                                                          
Query: 317    agctcctggtcgttgcggacggcgagaagcaggtggcgcgggatgatgcgggtcttcttg 376
              ||||||| ||||||||||| ||| ||  ||||||| || |||||||||||||||||||||
Sbjct: 182963 agctcctcgtcgttgcggatggccagctgcaggtgtcgggggatgatgcgggtcttcttg 183022

                                           
Query: 377    ttatccttggcggcgttgccggcgagctc 405
              || ||   |||||||||||| || |||||
Sbjct: 183023 ttgtcgcgggcggcgttgcccgccagctc 183051



 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 56/63 (88%)
 Strand = Plus / Minus

                                                                          
Query: 316    gagctcctggtcgttgcggacggcgagaagcaggtggcgcgggatgatgcgggtcttctt 375
              |||||||| ||||||||||| ||| ||  ||| |||||||||||||||||| ||||||||
Sbjct: 108456 gagctcctcgtcgttgcggatggccagctgcaagtggcgcgggatgatgcgagtcttctt 108397

                 
Query: 376    gtt 378
              |||
Sbjct: 108396 gtt 108394



 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 34/34 (100%)
 Strand = Plus / Plus

                                               
Query: 345   gcaggtggcgcgggatgatgcgggtcttcttgtt 378
             ||||||||||||||||||||||||||||||||||
Sbjct: 17258 gcaggtggcgcgggatgatgcgggtcttcttgtt 17291



to top

>ref|NM_178213.2| Mus musculus histone 2, H2ab (Hist2h2ab), mRNA
          Length = 390

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 57/63 (90%)
 Strand = Plus / Minus

                                                                       
Query: 316 gagctcctggtcgttgcggacggcgagaagcaggtggcgcgggatgatgcgggtcttctt 375
           |||||||| ||||||||||| ||| ||  |||||||||||||||||||||| ||||||||
Sbjct: 282 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 223

              
Query: 376 gtt 378
           |||
Sbjct: 222 gtt 220



to top

>ref|NG_000009.2| Homo sapiens small histone family cluster (HFS@) on chromosome 6
          Length = 91567

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 57/63 (90%)
 Strand = Plus / Minus

                                                                         
Query: 316   gagctcctggtcgttgcggacggcgagaagcaggtggcgcgggatgatgcgggtcttctt 375
             |||||||| ||||||||||| ||| ||  ||| |||||||||||||||||||||||||||
Sbjct: 56394 gagctcctcgtcgttgcggatggccagctgcaagtggcgcgggatgatgcgggtcttctt 56335

                
Query: 376   gtt 378
             |||
Sbjct: 56334 gtt 56332



 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 77/90 (85%)
 Strand = Plus / Plus

                                                                         
Query: 316   gagctcctggtcgttgcggacggcgagaagcaggtggcgcgggatgatgcgggtcttctt 375
             |||||||| ||||||||||| ||| ||  ||| |||||||||||| ||||||||||||||
Sbjct: 28816 gagctcctcgtcgttgcggatggccagctgcaagtggcgcgggataatgcgggtcttctt 28875

                                           
Query: 376   gttatccttggcggcgttgccggcgagctc 405
             ||| ||   |||||||||||| || |||||
Sbjct: 28876 gttgtcgcgggcggcgttgcccgccagctc 28905



 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 56/63 (88%)
 Strand = Plus / Minus

                                                                        
Query: 316  gagctcctggtcgttgcggacggcgagaagcaggtggcgcgggatgatgcgggtcttctt 375
            |||||||| ||||||||||| ||| ||  ||| |||||||||||||||||||||||| ||
Sbjct: 1584 gagctcctcgtcgttgcggatggccagctgcaagtggcgcgggatgatgcgggtcttttt 1525

               
Query: 376  gtt 378
            |||
Sbjct: 1524 gtt 1522



 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 54/63 (85%)
 Strand = Plus / Plus

                                                                         
Query: 316   gagctcctggtcgttgcggacggcgagaagcaggtggcgcgggatgatgcgggtcttctt 375
             ||||||||  |||||||||| ||| ||  | ||||| |||||||||||||| ||||||||
Sbjct: 85961 gagctcctcatcgttgcggatggccagctggaggtgacgcgggatgatgcgagtcttctt 86020

                
Query: 376   gtt 378
             |||
Sbjct: 86021 gtt 86023



 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 54/63 (85%)
 Strand = Plus / Minus

                                                                         
Query: 316   gagctcctggtcgttgcggacggcgagaagcaggtggcgcgggatgatgcgggtcttctt 375
             ||||||||  |||||||||| ||| ||  | ||||| |||||||||||||| ||||||||
Sbjct: 79993 gagctcctcatcgttgcggatggccagctggaggtgacgcgggatgatgcgagtcttctt 79934

                
Query: 376   gtt 378
             |||
Sbjct: 79933 gtt 79931



 Score = 44.1 bits (22), Expect = 0.57
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 509   cggccgacggggaactggagaccggc 534
             ||||| ||||||||||||||||||||
Sbjct: 29009 cggcccacggggaactggagaccggc 29034



to top

>ref|NM_021052.2| Homo sapiens histone 1, H2ae (HIST1H2AE), mRNA
          Length = 564

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 54/59 (91%)
 Strand = Plus / Minus

                                                                      
Query: 317 agctcctggtcgttgcggacggcgagaagcaggtggcgcgggatgatgcgggtcttctt 375
           ||||||| ||||||||||| ||| ||  |||||||||||||||||||||||||||||||
Sbjct: 336 agctcctcgtcgttgcggatggctagctgcaggtggcgcgggatgatgcgggtcttctt 278


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,771,889
Number of Sequences: 3902068
Number of extensions: 4771889
Number of successful extensions: 99533
Number of sequences better than 10.0: 790
Number of HSP's better than 10.0 without gapping: 810
Number of HSP's successfully gapped in prelim test: 1
Number of HSP's that attempted gapping in prelim test: 93193
Number of HSP's gapped (non-prelim): 6251
length of query: 655
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 632
effective length of database: 17,143,297,704
effective search space: 10834564148928
effective search space used: 10834564148928
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top