ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbags14h20
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AC084163.4| Mus musculus strain C57BL6/J chromosome 6 clone R... 42 1.0
2emb|BX001019.7| Zebrafish DNA sequence from clone DKEY-13H9 in l... 42 1.0
3gb|AC140941.1| Gallus gallus BAC clone TAM32-50C3 from chromosom... 42 1.0
4ref|NG_005114.1| Homo sapiens coagulation factor VIII region (F8... 40 4.0
5gb|AC116576.3| Mus musculus BAC clone RP23-263J19 from 3, comple... 40 4.0
6emb|BX293995.4| Human DNA sequence from clone RP11-143H17 on chr... 40 4.0
7gb|AC100818.2| Homo sapiens chromosome 8, clone RP11-473J6, comp... 40 4.0
8gb|AC012215.11| Homo sapiens chromosome , clone RP11-345N15, com... 40 4.0
9gb|AC083838.6| Homo sapiens chromosome 8, clone RP11-42L4, compl... 40 4.0
10gb|AF238481.1|AF238481 Hepatitis C virus 2a polyprotein gene, co... 40 4.0
11gb|AF177036.1|AF177036 Hepatitis C virus clone pJ6CF, complete g... 40 4.0
12gb|AC159217.3| Pan troglodytes BAC clone CH251-347C9 from chromo... 40 4.0
13emb|CT573417.1| Pan troglodytes chromosome X clone PTB-001B13 ma... 40 4.0

>gb|AC084163.4| Mus musculus strain C57BL6/J chromosome 6 clone RP23-287D23, complete
             sequence
          Length = 214292

 Score = 42.1 bits (21), Expect = 1.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 124   tcatagaaaaaacaatcaaca 144
             |||||||||||||||||||||
Sbjct: 53119 tcatagaaaaaacaatcaaca 53139



to top

>emb|BX001019.7| Zebrafish DNA sequence from clone DKEY-13H9 in linkage group 16, complete
              sequence
          Length = 226271

 Score = 42.1 bits (21), Expect = 1.0
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 233    tactactactactgtaacaccctac 257
              ||||||||||||||||||| |||||
Sbjct: 168269 tactactactactgtaacaacctac 168245



to top

>gb|AC140941.1| Gallus gallus BAC clone TAM32-50C3 from chromosome ul, complete
             sequence
          Length = 116265

 Score = 42.1 bits (21), Expect = 1.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 269   tccacaactggattgctgagg 289
             |||||||||||||||||||||
Sbjct: 95447 tccacaactggattgctgagg 95467



to top

>ref|NG_005114.1| Homo sapiens coagulation factor VIII region (F8@) on chromosome X
          Length = 652898

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 125    catagaaaaaacaatcaaca 144
              ||||||||||||||||||||
Sbjct: 343983 catagaaaaaacaatcaaca 343964



to top

>gb|AC116576.3| Mus musculus BAC clone RP23-263J19 from 3, complete sequence
          Length = 205336

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 225    aaagtagatactactactac 244
              ||||||||||||||||||||
Sbjct: 123961 aaagtagatactactactac 123980



to top

>emb|BX293995.4| Human DNA sequence from clone RP11-143H17 on chromosome X Contains the
             3' end of a novel gene (C6.1A) and a phosphatidylinositol
             binding clathrin assembly protein (PICALM) pseudogene,
             complete sequence
          Length = 74649

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 125   catagaaaaaacaatcaaca 144
             ||||||||||||||||||||
Sbjct: 10542 catagaaaaaacaatcaaca 10561



to top

>gb|AC100818.2| Homo sapiens chromosome 8, clone RP11-473J6, complete sequence
          Length = 178856

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 21     aaatatagggtctgacctat 40
              ||||||||||||||||||||
Sbjct: 140988 aaatatagggtctgacctat 140969



to top

>gb|AC012215.11| Homo sapiens chromosome , clone RP11-345N15, complete sequence
          Length = 210723

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 21     aaatatagggtctgacctat 40
              ||||||||||||||||||||
Sbjct: 206467 aaatatagggtctgacctat 206486



to top

>gb|AC083838.6| Homo sapiens chromosome 8, clone RP11-42L4, complete sequence
          Length = 156623

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 21     aaatatagggtctgacctat 40
              ||||||||||||||||||||
Sbjct: 135821 aaatatagggtctgacctat 135840



to top

>gb|AF238481.1|AF238481 Hepatitis C virus 2a polyprotein gene, complete cds
          Length = 9416

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 267  actccacaactggattgctgagga 290
            |||||||||||||||| |||||||
Sbjct: 6195 actccacaactggattactgagga 6218



to top

>gb|AF177036.1|AF177036 Hepatitis C virus clone pJ6CF, complete genome
          Length = 9711

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 267  actccacaactggattgctgagga 290
            |||||||||||||||| |||||||
Sbjct: 6229 actccacaactggattactgagga 6252



to top

>gb|AC159217.3| Pan troglodytes BAC clone CH251-347C9 from chromosome unknown, complete
              sequence
          Length = 173847

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 125    catagaaaaaacaatcaaca 144
              ||||||||||||||||||||
Sbjct: 161691 catagaaaaaacaatcaaca 161672



to top

>emb|CT573417.1| Pan troglodytes chromosome X clone PTB-001B13 map Xq28, complete
             sequence
          Length = 117521

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 125   catagaaaaaacaatcaaca 144
             ||||||||||||||||||||
Sbjct: 80063 catagaaaaaacaatcaaca 80044


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,536,159
Number of Sequences: 3902068
Number of extensions: 1536159
Number of successful extensions: 33225
Number of sequences better than 10.0: 13
Number of HSP's better than 10.0 without gapping: 13
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 33204
Number of HSP's gapped (non-prelim): 21
length of query: 306
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 284
effective length of database: 17,147,199,772
effective search space: 4869804735248
effective search space used: 4869804735248
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top