ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbags14f13
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1ref|XM_475487.1| Oryza sativa (japonica cultivar-group), predic... 74 6e-10
2dbj|AK100622.1| Oryza sativa (japonica cultivar-group) cDNA clon... 74 6e-10
3dbj|AK060635.1| Oryza sativa (japonica cultivar-group) cDNA clon... 74 6e-10
4gb|AC130605.3| Oryza sativa (japonica cultivar-group) chromosome... 72 2e-09
5dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic D... 72 2e-09
6ref|XM_640046.1| Dictyostelium discoideum developmental protein ... 46 0.14
7gb|AC116920.3| Dictyostelium discoideum chromosome 2 map 4415041... 46 0.14
8gb|AF081800.1|AF081800 Dictyostelium discoideum developmental pr... 46 0.14
9gb|AY101355.1| Opisthonecta matiensis actin II gene, partial cds 44 0.54
10gb|AY844991.1| Epulopiscium sp. N.l._2_clone_38 16S ribosomal RN... 42 2.1
11gb|AC164536.5| Mus musculus chromosome 18, clone RP23-425H1, com... 42 2.1
12emb|AL590427.15| Human DNA sequence from clone RP11-396N10 on ch... 42 2.1
13emb|BX569689.1| Synechococcus sp. WH8102 complete genome; segmen... 42 2.1
14gb|AC093193.11| Homo sapiens Xp BAC RP11-607K23 (Roswell Park Ca... 42 2.1
15ref|NM_001036789.1| Arabidopsis thaliana unknown protein AT5G103... 40 8.4
16ref|NM_121070.3| Arabidopsis thaliana unknown protein AT5G10320 ... 40 8.4
17ref|NM_001036788.1| Arabidopsis thaliana unknown protein AT5G103... 40 8.4
18ref|NM_115224.1| Arabidopsis thaliana ATP binding / kinase/ prot... 40 8.4
19gb|BC079718.1| Xenopus laevis MGC81105 protein, mRNA (cDNA clone... 40 8.4
20ref|NG_002690.1| Homo sapiens Prader-Willi/Angelman syndrome reg... 40 8.4
21gb|BT011749.1| Arabidopsis thaliana At5g10320 gene, complete cds 40 8.4
22gb|AC116326.5| Mus musculus BAC clone RP24-64C6 from chromosome ... 40 8.4
23gb|AC121806.3| Mus musculus BAC clone RP23-448L10 from chromosom... 40 8.4
24gb|AC146805.17| Medicago truncatula clone mth2-12n20, complete s... 40 8.4
25emb|AL691458.7| Human DNA sequence from clone RP11-13F15 on chro... 40 8.4
26emb|AL137003.12| Human DNA sequence from clone RP1-151F17 on chr... 40 8.4
27emb|CR380953.1| Candida glabrata strain CBS138 chromosome G comp... 40 8.4
28emb|AL360334.1|ATF18D22 Arabidopsis thaliana DNA chromosome 5, B... 40 8.4
29gb|AC124303.5| Homo sapiens chromosome 15, clone RP11-145P16, co... 40 8.4
30emb|CR383661.10| Zebrafish DNA sequence from clone DKEY-44L21 in... 40 8.4
31gb|AC093013.14| Homo sapiens 12 BAC RP11-158O15 (Roswell Park Ca... 40 8.4
32gb|AC104658.6| Homo sapiens BAC clone RP11-593M6 from 4, complet... 40 8.4
33gb|AC091784.8| Genomic sequence for Mus musculus, clone RP23-213... 40 8.4
34gb|AF250841.1|AF250841 Homo sapiens PAC clones A17157 and P0950 ... 40 8.4
35emb|BX005480.12| Mouse DNA sequence from clone RP23-142M12 on ch... 40 8.4
36gb|AC151837.4| Mus musculus BAC clone RP23-330A14 from chromosom... 40 8.4
37dbj|AB056170.1| Uncultured rumen bacterium gene for 16S ribosoma... 40 8.4
38emb|BX832119.1|CNS0A23Z Arabidopsis thaliana Full-length cDNA Co... 40 8.4
39emb|BX830334.1|CNS0A1RU Arabidopsis thaliana Full-length cDNA Co... 40 8.4
40emb|BX830313.1|CNS0A1JS Arabidopsis thaliana Full-length cDNA Co... 40 8.4
41gb|AC104689.4| Homo sapiens BAC clone RP11-158O16 from 4, comple... 40 8.4
42dbj|AB196513.1| Paralichthys olivaceus COL1A1 mRNA for type 1 co... 40 8.4
43dbj|AK176186.1| Arabidopsis thaliana mRNA for putative protein, ... 40 8.4
44gb|AC154543.2| Mus musculus BAC clone RP23-228E21 from 12, compl... 40 8.4
45emb|CT010578.16| Mouse DNA sequence from clone RP23-268O1 on chr... 40 8.4
46emb|AL137786.3|CNS01DWO Human chromosome 14 DNA sequence BAC R-4... 40 8.4
47emb|AL132966.1|ATF4P12 Arabidopsis thaliana DNA chromosome 3, BA... 40 8.4
48gb|AF027390.1|AF027390 Homo sapiens 7q telomere, complete sequence 40 8.4
49gb|AC002112.1|AC002112 Genomic sequence from Human 6, complete s... 40 8.4
50emb|AL670544.7| Mouse DNA sequence from clone RP23-16G8 on chrom... 40 8.4
51gb|AY552850.1| Meleagris gallopavo clone MNT-278 microsatellite ... 40 8.4

>ref|XM_475487.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 1191

 Score = 73.8 bits (37), Expect = 6e-10
 Identities = 76/89 (85%)
 Strand = Plus / Minus

                                                                        
Query: 526  gtgccagtgcccacactgatgagagcaattcatttggtttatccagctgctccaaaattg 585
            ||||||||||||| || |||||||||| |||||| ||||| |||| ||||||||||||| 
Sbjct: 1036 gtgccagtgcccatacggatgagagcacttcattgggtttgtccaactgctccaaaattt 977

                                         
Query: 586  tgtaatctccattcgctgcatacttgaag 614
            || | ||||| || ||||  |||||||||
Sbjct: 976  tgaagtctccttttgctgagtacttgaag 948



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 58/67 (86%)
 Strand = Plus / Minus

                                                                        
Query: 365  ctaaattttactgggaatcttgtgtccaaggaaagcctccaaatcacttatagatttcaa 424
            ||||||||| ||||||||| ||| || |||||| ||||| | |||  |||||||||||||
Sbjct: 1191 ctaaattttgctgggaatcctgtctctaaggaatgcctctatatcttttatagatttcaa 1132

                   
Query: 425  accttct 431
            |||||||
Sbjct: 1131 accttct 1125



to top

>dbj|AK100622.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023108G08, full
            insert sequence
          Length = 2535

 Score = 73.8 bits (37), Expect = 6e-10
 Identities = 76/89 (85%)
 Strand = Plus / Minus

                                                                        
Query: 526  gtgccagtgcccacactgatgagagcaattcatttggtttatccagctgctccaaaattg 585
            ||||||||||||| || |||||||||| |||||| ||||| |||| ||||||||||||| 
Sbjct: 2161 gtgccagtgcccatacggatgagagcacttcattgggtttgtccaactgctccaaaattt 2102

                                         
Query: 586  tgtaatctccattcgctgcatacttgaag 614
            || | ||||| || ||||  |||||||||
Sbjct: 2101 tgaagtctccttttgctgagtacttgaag 2073



 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 69/80 (86%)
 Strand = Plus / Minus

                                                                        
Query: 352  gaaacaatcccacctaaattttactgggaatcttgtgtccaaggaaagcctccaaatcac 411
            |||||| ||||| ||||||||| ||||||||| ||| || |||||| ||||| | |||  
Sbjct: 2329 gaaacattcccatctaaattttgctgggaatcctgtctctaaggaatgcctctatatctt 2270

                                
Query: 412  ttatagatttcaaaccttct 431
            ||||||||||||||||||||
Sbjct: 2269 ttatagatttcaaaccttct 2250



to top

>dbj|AK060635.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-027-B11, full
            insert sequence
          Length = 1695

 Score = 73.8 bits (37), Expect = 6e-10
 Identities = 76/89 (85%)
 Strand = Plus / Minus

                                                                        
Query: 526  gtgccagtgcccacactgatgagagcaattcatttggtttatccagctgctccaaaattg 585
            ||||||||||||| || |||||||||| |||||| ||||| |||| ||||||||||||| 
Sbjct: 1343 gtgccagtgcccatacggatgagagcacttcattgggtttgtccaactgctccaaaattt 1284

                                         
Query: 586  tgtaatctccattcgctgcatacttgaag 614
            || | ||||| || ||||  |||||||||
Sbjct: 1283 tgaagtctccttttgctgagtacttgaag 1255



 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 69/80 (86%)
 Strand = Plus / Minus

                                                                        
Query: 352  gaaacaatcccacctaaattttactgggaatcttgtgtccaaggaaagcctccaaatcac 411
            |||||| ||||| ||||||||| ||||||||| ||| || |||||| ||||| | |||  
Sbjct: 1511 gaaacattcccatctaaattttgctgggaatcctgtctctaaggaatgcctctatatctt 1452

                                
Query: 412  ttatagatttcaaaccttct 431
            ||||||||||||||||||||
Sbjct: 1451 ttatagatttcaaaccttct 1432



to top

>gb|AC130605.3| Oryza sativa (japonica cultivar-group) chromosome 5 clone P0010D04,
             complete sequence
          Length = 122599

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 69/80 (86%)
 Strand = Plus / Plus

                                                                         
Query: 352   gaaacaatcccacctaaattttactgggaatcttgtgtccaaggaaagcctccaaatcac 411
             |||||| ||||| ||||||||| ||||||||| ||| || |||||| ||||| | |||  
Sbjct: 24494 gaaacattcccatctaaattttgctgggaatcctgtctctaaggaatgcctctatatctt 24553

                                 
Query: 412   ttatagatttcaaaccttct 431
             ||||||||||||||||||||
Sbjct: 24554 ttatagatttcaaaccttct 24573



 Score = 69.9 bits (35), Expect = 9e-09
 Identities = 53/59 (89%)
 Strand = Plus / Plus

                                                                        
Query: 526   gtgccagtgcccacactgatgagagcaattcatttggtttatccagctgctccaaaatt 584
             ||||||||||||| || |||||||||| |||||| ||||| |||| |||||||||||||
Sbjct: 24662 gtgccagtgcccatacggatgagagcacttcattgggtttgtccaactgctccaaaatt 24720



to top

>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete
                sequence
          Length = 29737217

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 69/80 (86%)
 Strand = Plus / Plus

                                                                            
Query: 352      gaaacaatcccacctaaattttactgggaatcttgtgtccaaggaaagcctccaaatcac 411
                |||||| ||||| ||||||||| ||||||||| ||| || |||||| ||||| | |||  
Sbjct: 24338704 gaaacattcccatctaaattttgctgggaatcctgtctctaaggaatgcctctatatctt 24338763

                                    
Query: 412      ttatagatttcaaaccttct 431
                ||||||||||||||||||||
Sbjct: 24338764 ttatagatttcaaaccttct 24338783



 Score = 69.9 bits (35), Expect = 9e-09
 Identities = 53/59 (89%)
 Strand = Plus / Plus

                                                                           
Query: 526      gtgccagtgcccacactgatgagagcaattcatttggtttatccagctgctccaaaatt 584
                ||||||||||||| || |||||||||| |||||| ||||| |||| |||||||||||||
Sbjct: 24338872 gtgccagtgcccatacggatgagagcacttcattgggtttgtccaactgctccaaaatt 24338930



to top

>ref|XM_640046.1| Dictyostelium discoideum developmental protein (DDB0220129), partial
            mRNA
          Length = 1383

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 505  atgggagtgatgatggtgcttgt 527
            |||||||||||||||||||||||
Sbjct: 1054 atgggagtgatgatggtgcttgt 1032



to top

>gb|AC116920.3| Dictyostelium discoideum chromosome 2 map 4415041-4520361 strain AX4,
             complete sequence
          Length = 105320

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 505   atgggagtgatgatggtgcttgt 527
             |||||||||||||||||||||||
Sbjct: 24884 atgggagtgatgatggtgcttgt 24906



to top

>gb|AF081800.1|AF081800 Dictyostelium discoideum developmental protein DG1074 (DG1074)
           gene, partial cds
          Length = 905

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 505 atgggagtgatgatggtgcttgt 527
           |||||||||||||||||||||||
Sbjct: 725 atgggagtgatgatggtgcttgt 703



to top

>gb|AY101355.1| Opisthonecta matiensis actin II gene, partial cds
          Length = 1105

 Score = 44.1 bits (22), Expect = 0.54
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 23  atagcagaggttttccttaata 44
           ||||||||||||||||||||||
Sbjct: 615 atagcagaggttttccttaata 594



to top

>gb|AY844991.1| Epulopiscium sp. N.l._2_clone_38 16S ribosomal RNA (rrn) gene,
           partial sequence
          Length = 1433

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 292 tttcctctcctgcactccggc 312
           |||||||||||||||||||||
Sbjct: 608 tttcctctcctgcactccggc 588



to top

>gb|AC164536.5| Mus musculus chromosome 18, clone RP23-425H1, complete sequence
          Length = 188835

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 171   tgtatcttttggaaaataaac 191
             |||||||||||||||||||||
Sbjct: 93191 tgtatcttttggaaaataaac 93171



to top

>emb|AL590427.15| Human DNA sequence from clone RP11-396N10 on chromosome 1 Contains the
             5' end of the NTNG1 gene for netrin G1 and a CpG island,
             complete sequence
          Length = 160135

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 289   tgatttcctctcctgcactcc 309
             |||||||||||||||||||||
Sbjct: 51338 tgatttcctctcctgcactcc 51358



to top

>emb|BX569689.1| Synechococcus sp. WH8102 complete genome; segment 1/7
          Length = 348764

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 480    ttcttcccaggggggctgctg 500
              |||||||||||||||||||||
Sbjct: 261642 ttcttcccaggggggctgctg 261662



to top

>gb|AC093193.11| Homo sapiens Xp BAC RP11-607K23 (Roswell Park Cancer Institute Human
             BAC Library) complete sequence
          Length = 83001

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 187   taaactgtgcattcatcaaca 207
             |||||||||||||||||||||
Sbjct: 13003 taaactgtgcattcatcaaca 12983



to top

>ref|NM_001036789.1| Arabidopsis thaliana unknown protein AT5G10320 transcript variant
           AT5G10320.3 mRNA, complete cds
          Length = 1570

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 542 tgatgagagcaattcatttg 561
           ||||||||||||||||||||
Sbjct: 893 tgatgagagcaattcatttg 912



to top

>ref|NM_121070.3| Arabidopsis thaliana unknown protein AT5G10320 transcript variant
           AT5G10320.1 mRNA, complete cds
          Length = 1518

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 542 tgatgagagcaattcatttg 561
           ||||||||||||||||||||
Sbjct: 896 tgatgagagcaattcatttg 915



to top

>ref|NM_001036788.1| Arabidopsis thaliana unknown protein AT5G10320 transcript variant
           AT5G10320.2 mRNA, complete cds
          Length = 1516

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 542 tgatgagagcaattcatttg 561
           ||||||||||||||||||||
Sbjct: 894 tgatgagagcaattcatttg 913



to top

>ref|NM_115224.1| Arabidopsis thaliana ATP binding / kinase/ protein kinase/ protein
           serine/threonine kinase/ protein-tyrosine kinase
           AT3G53640 mRNA, complete cds
          Length = 1929

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 511 gtgatgatggtgcttgtgcc 530
           ||||||||||||||||||||
Sbjct: 108 gtgatgatggtgcttgtgcc 89



to top

>gb|BC079718.1| Xenopus laevis MGC81105 protein, mRNA (cDNA clone MGC:82153
           IMAGE:7012450), complete cds
          Length = 2523

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 488 aggggggctgctgagaaatgggag 511
           ||||||||||||| ||||||||||
Sbjct: 6   aggggggctgctgggaaatgggag 29



to top

>ref|NG_002690.1| Homo sapiens Prader-Willi/Angelman syndrome region (PWSAS@) on chromosome
              15
          Length = 755217

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 559    ttggtttatccagctgctcc 578
              ||||||||||||||||||||
Sbjct: 354035 ttggtttatccagctgctcc 354054



to top

>gb|BT011749.1| Arabidopsis thaliana At5g10320 gene, complete cds
          Length = 1209

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 542 tgatgagagcaattcatttg 561
           ||||||||||||||||||||
Sbjct: 776 tgatgagagcaattcatttg 795



to top

>gb|AC116326.5| Mus musculus BAC clone RP24-64C6 from chromosome 7, complete sequence
          Length = 181548

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 540  actgatgagagcaattcatt 559
            ||||||||||||||||||||
Sbjct: 2578 actgatgagagcaattcatt 2559



to top

>gb|AC121806.3| Mus musculus BAC clone RP23-448L10 from chromosome 7, complete sequence
          Length = 182011

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 178   tttggaaaataaactgtgca 197
             ||||||||||||||||||||
Sbjct: 42886 tttggaaaataaactgtgca 42905



to top

>gb|AC146805.17| Medicago truncatula clone mth2-12n20, complete sequence
          Length = 44109

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 88    agatgtgtcaactttctgaa 107
             ||||||||||||||||||||
Sbjct: 20962 agatgtgtcaactttctgaa 20981



to top

>emb|AL691458.7| Human DNA sequence from clone RP11-13F15 on chromosome 10, complete
             sequence
          Length = 69133

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 354   aacaatcccacctaaatttt 373
             ||||||||||||||||||||
Sbjct: 11989 aacaatcccacctaaatttt 11970



to top

>emb|AL137003.12| Human DNA sequence from clone RP1-151F17 on chromosome 6 Contains the
             3' end of the SCA1 gene for spinocerebellar ataxia
             1n(olivopontocerebellar ataxia 1, autosomal dominant,
             ataxin 1), complete sequence
          Length = 113802

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 290   gatttcctctcctgcactcc 309
             ||||||||||||||||||||
Sbjct: 78559 gatttcctctcctgcactcc 78540



to top

>emb|CR380953.1| Candida glabrata strain CBS138 chromosome G complete sequence
          Length = 992211

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 510  agtgatgatggtgcttgtgc 529
            ||||||||||||||||||||
Sbjct: 2904 agtgatgatggtgcttgtgc 2923



to top

>emb|AL360334.1|ATF18D22 Arabidopsis thaliana DNA chromosome 5, BAC clone F18D22 (ESSA project)
          Length = 57180

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 542   tgatgagagcaattcatttg 561
             ||||||||||||||||||||
Sbjct: 49832 tgatgagagcaattcatttg 49813



to top

>gb|AC124303.5| Homo sapiens chromosome 15, clone RP11-145P16, complete sequence
          Length = 160535

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 559    ttggtttatccagctgctcc 578
              ||||||||||||||||||||
Sbjct: 124224 ttggtttatccagctgctcc 124205



to top

>emb|CR383661.10| Zebrafish DNA sequence from clone DKEY-44L21 in linkage group 20
            Contains the gene for a novel protein similar to mouse
            and human O-acyltransferase (membrane bound) domain
            containing 2 (OACT2), the 5' end of the gene for a novel
            protein similar to rat kinase D-interacting substance of
            220 kDa (RGD:619949) and a CpG island, complete sequence
          Length = 116874

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 244  actttcagttagcaagcctg 263
            ||||||||||||||||||||
Sbjct: 2328 actttcagttagcaagcctg 2309



to top

>gb|AC093013.14| Homo sapiens 12 BAC RP11-158O15 (Roswell Park Cancer Institute Human
             BAC Library) complete sequence
          Length = 161114

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 552   aattcatttggtttatccag 571
             ||||||||||||||||||||
Sbjct: 71560 aattcatttggtttatccag 71579



to top

>gb|AC104658.6| Homo sapiens BAC clone RP11-593M6 from 4, complete sequence
          Length = 140028

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 175   tcttttggaaaataaactgt 194
             ||||||||||||||||||||
Sbjct: 49631 tcttttggaaaataaactgt 49612



to top

>gb|AC091784.8| Genomic sequence for Mus musculus, clone RP23-213D23, complete sequence
          Length = 215410

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 170   atgtatcttttggaaaataa 189
             ||||||||||||||||||||
Sbjct: 55289 atgtatcttttggaaaataa 55308



to top

>gb|AF250841.1|AF250841 Homo sapiens PAC clones A17157 and P0950 imprinted HBII-85 and HBII-52
             small nucleolar RNA genes, complete sequence
          Length = 228017

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 559   ttggtttatccagctgctcc 578
             ||||||||||||||||||||
Sbjct: 47271 ttggtttatccagctgctcc 47290



to top

>emb|BX005480.12| Mouse DNA sequence from clone RP23-142M12 on chromosome X, complete
             sequence
          Length = 196326

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 170   atgtatcttttggaaaataa 189
             ||||||||||||||||||||
Sbjct: 21830 atgtatcttttggaaaataa 21811



to top

>gb|AC151837.4| Mus musculus BAC clone RP23-330A14 from chromosome 7, complete sequence
          Length = 209661

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 540   actgatgagagcaattcatt 559
             ||||||||||||||||||||
Sbjct: 52152 actgatgagagcaattcatt 52133



to top

>dbj|AB056170.1| Uncultured rumen bacterium gene for 16S ribosomal RNA, clone:9(ER)
          Length = 671

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 292 tttcctctcctgcactccggcatg 315
           |||||||||||||||||| |||||
Sbjct: 575 tttcctctcctgcactccagcatg 552



to top

>emb|BX832119.1|CNS0A23Z Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH52ZH05 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1374

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 542 tgatgagagcaattcatttg 561
           ||||||||||||||||||||
Sbjct: 784 tgatgagagcaattcatttg 803



to top

>emb|BX830334.1|CNS0A1RU Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB74ZB03 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 1396

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 542 tgatgagagcaattcatttg 561
           ||||||||||||||||||||
Sbjct: 783 tgatgagagcaattcatttg 802



to top

>emb|BX830313.1|CNS0A1JS Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB72ZC06 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 1361

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 542 tgatgagagcaattcatttg 561
           ||||||||||||||||||||
Sbjct: 684 tgatgagagcaattcatttg 703



to top

>gb|AC104689.4| Homo sapiens BAC clone RP11-158O16 from 4, complete sequence
          Length = 161428

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 552   aattcatttggtttatccag 571
             ||||||||||||||||||||
Sbjct: 89556 aattcatttggtttatccag 89537



to top

>dbj|AB196513.1| Paralichthys olivaceus COL1A1 mRNA for type 1 collagen alpha 1,
           complete cds
          Length = 5117

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 472 cctctccgttcttcccaggggggc 495
           ||||||||||||| ||||||||||
Sbjct: 804 cctctccgttctttccaggggggc 781



to top

>dbj|AK176186.1| Arabidopsis thaliana mRNA for putative protein, complete cds,
           clone: RAFL23-05-H06
          Length = 1471

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 542 tgatgagagcaattcatttg 561
           ||||||||||||||||||||
Sbjct: 894 tgatgagagcaattcatttg 913



to top

>gb|AC154543.2| Mus musculus BAC clone RP23-228E21 from 12, complete sequence
          Length = 197876

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 179   ttggaaaataaactgtgcattcat 202
             |||||||||||| |||||||||||
Sbjct: 45389 ttggaaaataaaatgtgcattcat 45366



to top

>emb|CT010578.16| Mouse DNA sequence from clone RP23-268O1 on chromosome 12, complete
             sequence
          Length = 180650

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 179   ttggaaaataaactgtgcattcat 202
             |||||||||||| |||||||||||
Sbjct: 51580 ttggaaaataaaatgtgcattcat 51557



to top

>emb|AL137786.3|CNS01DWO Human chromosome 14 DNA sequence BAC R-433J8 of library RPCI-11 from
             chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 197689

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 498   ctgagaaatgggagtgatga 517
             ||||||||||||||||||||
Sbjct: 57478 ctgagaaatgggagtgatga 57459



to top

>emb|AL132966.1|ATF4P12 Arabidopsis thaliana DNA chromosome 3, BAC clone F4P12
          Length = 144628

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 511    gtgatgatggtgcttgtgcc 530
              ||||||||||||||||||||
Sbjct: 129498 gtgatgatggtgcttgtgcc 129517



to top

>gb|AF027390.1|AF027390 Homo sapiens 7q telomere, complete sequence
          Length = 225432

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 171    tgtatcttttggaaaataaa 190
              ||||||||||||||||||||
Sbjct: 155550 tgtatcttttggaaaataaa 155569



to top

>gb|AC002112.1|AC002112 Genomic sequence from Human 6, complete sequence
          Length = 115967

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 290   gatttcctctcctgcactcc 309
             ||||||||||||||||||||
Sbjct: 62644 gatttcctctcctgcactcc 62663



to top

>emb|AL670544.7| Mouse DNA sequence from clone RP23-16G8 on chromosome X, complete
             sequence
          Length = 236946

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 173   tatcttttggaaaataaact 192
             ||||||||||||||||||||
Sbjct: 63152 tatcttttggaaaataaact 63171



to top

>gb|AY552850.1| Meleagris gallopavo clone MNT-278 microsatellite sequence
          Length = 1348

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 90  atgtgtcaactttctgaaat 109
           ||||||||||||||||||||
Sbjct: 629 atgtgtcaactttctgaaat 648


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 5,931,673
Number of Sequences: 3902068
Number of extensions: 5931673
Number of successful extensions: 112683
Number of sequences better than 10.0: 51
Number of HSP's better than 10.0 without gapping: 51
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 112531
Number of HSP's gapped (non-prelim): 152
length of query: 614
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 591
effective length of database: 17,143,297,704
effective search space: 10131688943064
effective search space used: 10131688943064
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top