Clone Name	rbags13o19
Clone Library Name	barley_pub

---

No.	Definition	Score (bits)	E Value
1	ref|XM_470037.1| Oryza sativa (japonica cultivar-group), mRNA	365	1e-97
2	dbj|AK064984.1| Oryza sativa (japonica cultivar-group) cDNA clon...	365	1e-97
3	gb|AY104047.1| Zea mays PCO131880 mRNA sequence	307	2e-80
4	ref|XM_477083.1| Oryza sativa (japonica cultivar-group), mRNA	272	1e-69
5	dbj|AK063732.1| Oryza sativa (japonica cultivar-group) cDNA clon...	272	1e-69
6	gb|BT016220.1| Zea mays clone Contig53 mRNA sequence	260	4e-66
7	gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3	260	4e-66
8	gb|AC135958.2| Oryza sativa chromosome 3 BAC OSJNBa0059E14 genom...	260	4e-66
9	dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D...	260	4e-66
10	gb|AY104097.1| Zea mays PCO131882 mRNA sequence	260	4e-66
11	dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic D...	204	2e-49
12	dbj|AP003943.3| Oryza sativa (japonica cultivar-group) genomic D...	204	2e-49
13	dbj|AP004911.1| Lotus japonicus genomic DNA, chromosome 4, clone...	149	1e-32
14	dbj|AP006685.1| Lotus japonicus genomic DNA, chromosome 1, clone...	127	4e-26
15	gb|AC093196.2| Drosophila melanogaster clone BACR22H06, complete...	119	1e-23
16	gb|AC009744.8| Drosophila melanogaster clone BACR06G16, complete...	119	1e-23
17	gb|AY231813.1| Drosophila yakuba clone yak-em_sop mRNA sequence	119	1e-23
18	emb|X69120.1|DMRPS2 D.melanogaster mRNA for ribosomal protein S2	119	1e-23
19	gb|AY094799.1| Drosophila melanogaster LD24077 full insert cDNA	119	1e-23
20	ref|NM_057526.3| Drosophila melanogaster string of pearls CG5920...	119	1e-23
21	gb|AE003626.4| Drosophila melanogaster chromosome 2L, section 35...	119	1e-23
22	gb|U01334.1|DMU01334 Drosophila melanogaster ribosomal protein S...	119	1e-23
23	gb|AC005135.1|AC005135 Drosophila melanogaster DNA sequence (P1 ...	119	1e-23
24	gb|U01335.1|DMU01335 Drosophila melanogaster ribosomal protein S...	119	1e-23
25	emb|AJ132531.1|PAB132531 Picea abies mRNA for 40S ribosomal prot...	111	2e-21
26	ref|NM_129748.2| Arabidopsis thaliana structural constituent of ...	107	4e-20
27	gb|AY133561.1| Arabidopsis thaliana At2g41840/T11A7.6 mRNA, comp...	107	4e-20
28	gb|AY048250.1| Arabidopsis thaliana At2g41840/T11A7.6 mRNA, comp...	107	4e-20
29	gb|AY085726.1| Arabidopsis thaliana clone 17415 mRNA, complete s...	107	4e-20
30	emb|BX814292.1|CNS0ABYL Arabidopsis thaliana Full-length cDNA Co...	100	9e-18
31	ref|NM_104618.2| Arabidopsis thaliana XW6; structural constituen...	98	4e-17
32	gb|AY072528.1| Arabidopsis thaliana ribosomal protein S2, putati...	98	4e-17
33	gb|AF386958.1|AF386958 Arabidopsis thaliana ribosomal protein S2...	98	4e-17
34	dbj|AB008016.1| Arabidopsis thaliana XW6 mRNA, complete cds	98	4e-17
35	gb|AC082643.6|AC082643 Arabidopsis thaliana chromosome 1 BAC F9K...	94	6e-16
36	gb|AC008051.3|F19C14 Sequence of BAC F19C14 from Arabidopsis tha...	94	6e-16
37	dbj|AB077822.1| Arabidopsis thaliana genomic DNA, chromosome 1, ...	94	6e-16
38	ref|NM_148602.2| Arabidopsis thaliana structural constituent of ...	92	2e-15
39	ref|NM_104632.3| Arabidopsis thaliana structural constituent of ...	92	2e-15
40	ref|NM_104640.3| Arabidopsis thaliana structural constituent of ...	92	2e-15
41	gb|AY486481.1| Capsicum annuum 40S ribosomal protein S2 mRNA, pa...	92	2e-15
42	gb|AY133659.1| Arabidopsis thaliana At1g59359/T4M14_3 mRNA, comp...	92	2e-15
43	gb|AY065030.1| Arabidopsis thaliana At1g59359/T4M14_3 mRNA, comp...	92	2e-15
44	dbj|AK220575.1| Arabidopsis thaliana mRNA for ribosomal protein ...	92	2e-15
45	emb|BX815169.1|CNS0ABBY Arabidopsis thaliana Full-length cDNA Co...	92	2e-15
46	emb|BX817373.1|CNS0AAYC Arabidopsis thaliana Full-length cDNA Co...	92	2e-15
47	dbj|AB008017.1| Arabidopsis thaliana RF12 mRNA, partial cds	92	2e-15
48	gb|AY292470.1| Gadus ogac S2 ribosomal protein (S2) gene, partia...	90	9e-15
49	gb|AY292469.1| Gadus macrocephalus S2 ribosomal protein (S2) gen...	90	9e-15
50	gb|AY088743.1| Arabidopsis thaliana clone 93867 mRNA, complete s...	90	9e-15
51	ref|NM_115609.2| Arabidopsis thaliana structural constituent of ...	88	3e-14
52	gb|BT006200.1| Arabidopsis thaliana At3g57490 mRNA, complete cds	88	3e-14
53	gb|AC027036.12|AC027036 Arabidopsis thaliana chromosome 1 BAC T4...	88	3e-14
54	gb|AY084252.1| Arabidopsis thaliana clone 101250 mRNA, complete ...	88	3e-14
55	dbj|AB078516.1| Arabidopsis thaliana genomic DNA, chromosome 1, ...	88	3e-14
56	dbj|AB076984.1| Arabidopsis thaliana DNA, chromosome 1, clone:P1...	88	3e-14
57	gb|AC091305.9| Homo sapiens chromosome 18, clone RP11-644A7, com...	86	1e-13
58	gb|AC012618.7| Homo sapiens chromosome 19 clone CTD-2666L21, com...	86	1e-13
59	gb|AY120723.1| Arabidopsis thaliana ribosomal protein S2, putati...	84	5e-13
60	gb|AY292483.1| Brosme brosme S2 ribosomal protein (S2) gene, par...	82	2e-12
61	gb|AY292479.1| Eleginus gracilis S2 ribosomal protein (S2) gene,...	82	2e-12
62	gb|AY292478.1| Microgadus proximus S2 ribosomal protein (S2) gen...	82	2e-12
63	gb|AY292477.1| Microgadus tomcod S2 ribosomal protein (S2) gene,...	82	2e-12
64	gb|AY292475.1| Pollachius virens S2 ribosomal protein (S2) gene,...	82	2e-12
65	gb|AY292474.1| Merlangius merlangus S2 ribosomal protein (S2) ge...	82	2e-12
66	gb|AY292473.1| Melanogrammus aeglefinus S2 ribosomal protein (S2...	82	2e-12
67	gb|AY292472.1| Boreogadus saida S2 ribosomal protein (S2) gene, ...	82	2e-12
68	gb|AY292471.1| Theragra chalcogramma S2 ribosomal protein (S2) g...	82	2e-12
69	gb|AY292468.1| Gadus morhua S2 ribosomal protein (S2) gene, part...	82	2e-12
70	gb|AY292467.1| Arctogadus glacialis S2 ribosomal protein (S2) ge...	82	2e-12
71	gb|AC140104.22| Medicago truncatula clone mth2-10g22, complete s...	82	2e-12
72	gb|AC142395.41| Medicago truncatula clone mth2-18g1, complete se...	82	2e-12
73	gb|AC002339.3| Arabidopsis thaliana chromosome 2 clone T11A7 map...	82	2e-12
74	ref|XM_523967.1| PREDICTED: Pan troglodytes similar to 40S ribos...	78	3e-11
75	ref|XM_517458.1| PREDICTED: Pan troglodytes similar to GRB2-asso...	78	3e-11
76	ref|XM_515580.1| PREDICTED: Pan troglodytes LOC459356 (LOC459356...	78	3e-11
77	gb|AY292480.1| Micromesistius poutassou S2 ribosomal protein (S2...	78	3e-11
78	gb|AY292476.1| Pollachius pollachius S2 ribosomal protein (S2) g...	78	3e-11
79	emb|AL137072.8| Human DNA sequence from clone RP11-29B11 on chro...	78	3e-11
80	emb|X17206.1|HSLLREP3 Human mRNA for LLRep3	78	3e-11
81	gb|AC097658.2| Homo sapiens BAC clone RP11-364L4 from 4, complet...	78	3e-11
82	ref|XM_938104.1| PREDICTED: Homo sapiens similar to ribosomal pr...	78	3e-11
83	ref|XM_930178.1| PREDICTED: Homo sapiens similar to ribosomal pr...	78	3e-11
84	ref|XM_946024.1| PREDICTED: Homo sapiens similar to ribosomal pr...	78	3e-11
85	ref|XM_946023.1| PREDICTED: Homo sapiens similar to ribosomal pr...	78	3e-11
86	ref|XM_946022.1| PREDICTED: Homo sapiens similar to ribosomal pr...	78	3e-11
87	ref|XM_946021.1| PREDICTED: Homo sapiens similar to ribosomal pr...	78	3e-11
88	ref|XM_946020.1| PREDICTED: Homo sapiens similar to ribosomal pr...	78	3e-11
89	ref|XM_942473.1| PREDICTED: Homo sapiens similar to ribosomal pr...	78	3e-11
90	ref|NG_002522.1| Homo sapiens ribosomal protein S2 pseudogene 4 ...	78	3e-11
91	gb|DQ021880.1| Homo sapiens GRB2-associated binding protein 1 (G...	78	3e-11
92	gb|AC022210.8| Homo sapiens BAC clone RP11-617F9 from 2, complet...	78	3e-11
93	emb|AL590326.3|CNS07EG7 Human chromosome 14 DNA sequence BAC R-4...	78	3e-11
94	emb|AL583810.5|CNS07EFZ Human chromosome 14 DNA sequence BAC C-3...	78	3e-11
95	emb|AL596275.10| Human DNA sequence from clone RP11-183G22 on ch...	76	1e-10
96	emb|AL355802.13| Human DNA sequence from clone RP3-337H4 on chro...	76	1e-10
97	ref|XM_215498.3| PREDICTED: Rattus norvegicus similar to Hypothe...	76	1e-10
98	gb|AY826151.1| Aedes albopictus clone AL_364 ribosomal protein S...	74	5e-10
99	gb|AY741679.1| Aedes aegypti 40S ribosomal protein S2 (40sRpS2) ...	74	5e-10
100	gb|DQ439993.1| Aedes aegypti clone AE-155 ribosomal protein S2 m...	74	5e-10
101	gb|AY292484.1| Molva molva S2 ribosomal protein (S2) gene, parti...	74	5e-10
102	emb|AL133248.1|ATT8H10 Arabidopsis thaliana DNA chromosome 3, BA...	74	5e-10
103	emb|CR938517.1| Single read from an extremity of a full-length c...	74	5e-10
104	emb|CR938367.1| Single read from an extremity of a full-length c...	74	5e-10
105	emb|CR938322.1| Single read from an extremity of a full-length c...	74	5e-10
106	emb|CR938321.1| Single read from an extremity of a full-length c...	74	5e-10
107	emb|CR938259.1| Single read from an extremity of a full-length c...	74	5e-10
108	emb|CR938258.1| Single read from an extremity of a full-length c...	74	5e-10
109	emb|CR938129.1| Single read from an extremity of a full-length c...	74	5e-10
110	emb|CR938020.1| Single read from an extremity of a full-length c...	74	5e-10
111	emb|CR937910.1| Single read from an extremity of a cDNA clone ma...	74	5e-10
112	emb|CR937909.1| Single read from an extremity of a cDNA clone ma...	74	5e-10
113	ref|XM_946019.1| PREDICTED: Homo sapiens similar to ribosomal pr...	74	5e-10
114	gb|DQ214052.1| Taeniopygia guttata clone 0058P0045G10 ribosomal ...	72	2e-09
115	gb|DQ214051.1| Taeniopygia guttata clone 0058P0017F05 ribosomal ...	72	2e-09
116	gb|DQ214050.1| Taeniopygia guttata clone 0061P0020E02 ribosomal ...	72	2e-09
117	gb|AY769315.1| Bombyx mori ribosomal protein S2 (RpS2) mRNA, com...	72	2e-09
118	gb|AY292481.1| Trisopterus esmarkii S2 ribosomal protein (S2) ge...	72	2e-09
119	dbj|AP003745.5| Oryza sativa (japonica cultivar-group) genomic D...	72	2e-09
120	dbj|AP004349.3| Oryza sativa (japonica cultivar-group) genomic D...	72	2e-09
121	gb|BC105985.1| Homo sapiens ribosomal protein S2, mRNA (cDNA clo...	70	8e-09
122	gb|BC106060.1| Homo sapiens ribosomal protein S2, mRNA (cDNA clo...	70	8e-09
123	gb|BC103756.1| Homo sapiens ribosomal protein S2, mRNA (cDNA clo...	70	8e-09
124	gb|BC098726.1| Rattus norvegicus ribosomal protein S2, mRNA (cDN...	70	8e-09
125	ref|XM_514839.1| PREDICTED: Pan troglodytes similar to ribosomal...	70	8e-09
126	ref|XM_511195.1| PREDICTED: Pan troglodytes LOC454344 (LOC454344...	70	8e-09
127	ref|XM_510798.1| PREDICTED: Pan troglodytes similar to ribosomal...	70	8e-09
128	ref|XM_520152.1| PREDICTED: Pan troglodytes similar to ribosomal...	70	8e-09
129	ref|XM_527688.1| PREDICTED: Pan troglodytes similar to MGC27348 ...	70	8e-09
130	gb|BC016178.1| Homo sapiens ribosomal protein S2, mRNA (cDNA clo...	70	8e-09
131	gb|AC092268.4| Homo sapiens chromosome X clone RP11-185O17 map p...	70	8e-09
132	gb|BC075830.1| Homo sapiens ribosomal protein S2, mRNA (cDNA clo...	70	8e-09
133	gb|BC073966.1| Homo sapiens ribosomal protein S2, mRNA (cDNA clo...	70	8e-09
134	gb|BC012354.1| Homo sapiens ribosomal protein S2, mRNA (cDNA clo...	70	8e-09
135	gb|BC010165.2| Homo sapiens ribosomal protein S2, mRNA (cDNA clo...	70	8e-09
136	gb|BC025677.1| Homo sapiens ribosomal protein S2, mRNA (cDNA clo...	70	8e-09
137	gb|BC001795.1| Homo sapiens ribosomal protein S2, mRNA (cDNA clo...	70	8e-09
138	gb|BC016951.2| Homo sapiens ribosomal protein S2, mRNA (cDNA clo...	70	8e-09
139	gb|BC021545.1| Homo sapiens ribosomal protein S2, mRNA (cDNA clo...	70	8e-09
140	gb|BC023541.1| Homo sapiens ribosomal protein S2, mRNA (cDNA clo...	70	8e-09
141	ref|NM_031838.3| Rattus norvegicus ribosomal protein S2 (Rps2), ...	70	8e-09
142	gb|BC061291.1| Xenopus tropicalis cDNA clone IMAGE:5381631, cont...	70	8e-09
143	ref|XR_003219.1| PREDICTED: Mus musculus similar to ribosomal pr...	70	8e-09
144	gb|BC019021.2| Homo sapiens ribosomal protein S2, mRNA (cDNA clo...	70	8e-09
145	gb|BC005824.1| Homo sapiens cDNA clone IMAGE:2823381, **** WARNI...	70	8e-09
146	gb|BC005129.1| Homo sapiens PDZ domain containing 7, mRNA (cDNA ...	70	8e-09
147	gb|BC020336.1| Homo sapiens ribosomal protein S2, mRNA (cDNA clo...	70	8e-09
148	gb|AC023105.7| Homo sapiens BAC clone GS1-13M19 from 7, complete...	70	8e-09
149	ref|NG_002360.1| Homo sapiens ribosomal protein S2 pseudogene (L...	70	8e-09
150	gb|AC004448.4| Homo sapiens chromosome 17, clone CTB-187M2, comp...	70	8e-09
151	gb|BC021002.1| Homo sapiens cDNA clone IMAGE:3841858, **** WARNI...	70	8e-09
152	gb|BC063508.1| Homo sapiens cDNA clone IMAGE:3861495, **** WARNI...	70	8e-09
153	gb|BC044628.1| Homo sapiens mRNA similar to collagen, type XVII,...	70	8e-09
154	gb|BC011850.1| Homo sapiens mRNA similar to delta (Drosophila)-l...	70	8e-09
155	gb|BC011661.1| Homo sapiens cDNA clone IMAGE:4130973, **** WARNI...	70	8e-09
156	gb|BC012773.1| Homo sapiens cDNA clone IMAGE:3837950, **** WARNI...	70	8e-09
157	gb|BC004120.1| Homo sapiens mRNA similar to ribosomal protein S2...	70	8e-09
158	gb|BC013970.1| Homo sapiens mRNA similar to makorin, ring finger...	70	8e-09
159	emb|AL663070.15| Human DNA sequence from clone RP3-342P20 on chr...	70	8e-09
160	emb|AL590383.6| Human DNA sequence from clone RP11-213N20 on chr...	70	8e-09
161	emb|AL583834.6| Human DNA sequence from clone RP11-480N24 on chr...	70	8e-09
162	gb|AC026366.20| Homo sapiens 12 BAC RP11-139O18 (Roswell Park Ca...	70	8e-09
163	emb|X57432.1|RRRPS2 R.rattus mRNA for ribosomal protein S2	70	8e-09
164	gb|BC066321.1| Homo sapiens ribosomal protein S2, mRNA (cDNA clo...	70	8e-09
165	emb|AL832857.1|HSM804168 Homo sapiens genomic DNA; cDNA DKFZp667...	70	8e-09
166	gb|BC008862.2| Homo sapiens ribosomal protein S2, mRNA (cDNA clo...	70	8e-09
167	emb|BX649539.6| Mouse DNA sequence from clone RP24-371A24 on chr...	70	8e-09
168	gb|BC006559.2| Homo sapiens ribosomal protein S2, mRNA (cDNA clo...	70	8e-09
169	gb|BC035504.1| Homo sapiens, clone IMAGE:4636047, mRNA	70	8e-09
170	gb|BC026177.1| Homo sapiens ribosomal protein S2 pseudogene, mRN...	70	8e-09
171	emb|CR626574.1| full-length cDNA clone CS0DJ014YK12 of T cells (...	70	8e-09
172	emb|CR625501.1| full-length cDNA clone CS0DI080YC10 of Placenta ...	70	8e-09
173	emb|CR624847.1| full-length cDNA clone CS0DH002YK09 of T cells (...	70	8e-09
174	emb|CR622407.1| full-length cDNA clone CS0DI084YM13 of Placenta ...	70	8e-09
175	emb|CR620130.1| full-length cDNA clone CS0DA002YB15 of Neuroblas...	70	8e-09
176	emb|CR617837.1| full-length cDNA clone CS0DC019YM02 of Neuroblas...	70	8e-09
177	emb|CR617024.1| full-length cDNA clone CS0DI020YA19 of Placenta ...	70	8e-09
178	emb|CR616773.1| full-length cDNA clone CS0DA001YA14 of Neuroblas...	70	8e-09
179	emb|CR616346.1| full-length cDNA clone CS0DA003YB13 of Neuroblas...	70	8e-09
180	emb|CR613584.1| full-length cDNA clone CS0DH005YA07 of T cells (...	70	8e-09
181	emb|CR613101.1| full-length cDNA clone CS0DI021YI17 of Placenta ...	70	8e-09
182	emb|CR612811.1| full-length cDNA clone CS0DF034YC19 of Fetal bra...	70	8e-09
183	emb|CR610190.1| full-length cDNA clone CS0CAP004YA17 of Thymus o...	70	8e-09
184	emb|CR609604.1| full-length cDNA clone CS0CAP007YC22 of Thymus o...	70	8e-09
185	emb|CR608509.1| full-length cDNA clone CS0DG001YB20 of B cells (...	70	8e-09
186	emb|CR608345.1| full-length cDNA clone CS0DE007YL08 of Placenta ...	70	8e-09
187	emb|CR608202.1| full-length cDNA clone CS0DK001YN08 of HeLa cell...	70	8e-09
188	emb|CR607747.1| full-length cDNA clone CS0CAP007YB09 of Thymus o...	70	8e-09
189	emb|CR607612.1| full-length cDNA clone CS0DE002YJ03 of Placenta ...	70	8e-09
190	emb|CR607006.1| full-length cDNA clone CS0DL005YN02 of B cells (...	70	8e-09
191	emb|CR606602.1| full-length cDNA clone CS0DE002YD08 of Placenta ...	70	8e-09
192	emb|CR605226.1| full-length cDNA clone CS0DA001YI08 of Neuroblas...	70	8e-09
193	emb|CR603246.1| full-length cDNA clone CS0DE002YA17 of Placenta ...	70	8e-09
194	emb|CR602473.1| full-length cDNA clone CS0DM013YC17 of Fetal liv...	70	8e-09
195	emb|CR600325.1| full-length cDNA clone CS0DJ011YG17 of T cells (...	70	8e-09
196	emb|CR600119.1| full-length cDNA clone CS0DH004YP15 of T cells (...	70	8e-09
197	emb|CR598755.1| full-length cDNA clone CS0DH007YG11 of T cells (...	70	8e-09
198	emb|CR596231.1| full-length cDNA clone CS0CAP001YL18 of Thymus o...	70	8e-09
199	emb|CR595621.1| full-length cDNA clone CS0DJ003YI21 of T cells (...	70	8e-09
200	emb|CR594414.1| full-length cDNA clone CS0DF019YI05 of Fetal bra...	70	8e-09
201	emb|CR593677.1| full-length cDNA clone CS0DI020YA20 of Placenta ...	70	8e-09
202	emb|CR593327.1| full-length cDNA clone CS0DJ011YJ17 of T cells (...	70	8e-09
203	emb|CR593005.1| full-length cDNA clone CS0DC023YC03 of Neuroblas...	70	8e-09
204	emb|CR591765.1| full-length cDNA clone CS0DF026YI06 of Fetal bra...	70	8e-09
205	emb|CR590936.1| full-length cDNA clone CS0DJ001YF12 of T cells (...	70	8e-09
206	gb|AC073596.40| Homo sapiens 12 BAC RP11-385C6 (Roswell Park Can...	70	8e-09
207	ref|XM_937623.1| PREDICTED: Homo sapiens similar to ribosomal pr...	70	8e-09
208	ref|XM_499270.2| PREDICTED: Homo sapiens similar to ribosomal pr...	70	8e-09
209	ref|XM_171158.5| PREDICTED: Homo sapiens similar to ribosomal pr...	70	8e-09
210	ref|XM_945419.1| PREDICTED: Homo sapiens similar to ribosomal pr...	70	8e-09
211	ref|XM_945418.1| PREDICTED: Homo sapiens similar to ribosomal pr...	70	8e-09
212	ref|XM_945417.1| PREDICTED: Homo sapiens similar to ribosomal pr...	70	8e-09
213	ref|XM_945415.1| PREDICTED: Homo sapiens similar to ribosomal pr...	70	8e-09
214	ref|XM_941738.1| PREDICTED: Homo sapiens similar to ribosomal pr...	70	8e-09
215	ref|XM_934189.1| PREDICTED: Homo sapiens similar to ribosomal pr...	70	8e-09
216	ref|XM_934185.1| PREDICTED: Homo sapiens similar to ribosomal pr...	70	8e-09
217	ref|XM_934183.1| PREDICTED: Homo sapiens similar to ribosomal pr...	70	8e-09
218	ref|XM_934180.1| PREDICTED: Homo sapiens similar to ribosomal pr...	70	8e-09
219	ref|XM_934176.1| PREDICTED: Homo sapiens similar to ribosomal pr...	70	8e-09
220	ref|XM_039218.13| PREDICTED: Homo sapiens similar to ribosomal p...	70	8e-09
221	gb|BC068051.1| Homo sapiens ribosomal protein S2, mRNA (cDNA clo...	70	8e-09
222	gb|AC129342.5| Rattus norvegicus BAC CH230-229B21 (Children's H...	70	8e-09
223	ref|NM_001007868.1| Xenopus tropicalis MGC89305 protein (MGC8930...	70	8e-09
224	gb|BC017252.1| Homo sapiens, clone IMAGE:2905229, mRNA	70	8e-09
225	gb|BC007700.1| Homo sapiens, clone IMAGE:3954272, mRNA	70	8e-09
226	ref|XM_573268.1| PREDICTED: Rattus norvegicus similar to ribosom...	70	8e-09
227	gb|AY161272.1| Spodoptera frugiperda ribosomal protein S2 mRNA, ...	70	8e-09
228	gb|AC107956.8| Homo sapiens chromosome 11, clone RP11-452G18, co...	70	8e-09
229	gb|AY892474.1| Synthetic construct Homo sapiens clone FLH028028....	70	8e-09
230	gb|AY889989.1| Synthetic construct Homo sapiens clone FLH028029....	70	8e-09
231	gb|BC071923.1| Homo sapiens ribosomal protein S2, mRNA (cDNA clo...	70	8e-09
232	gb|BC080133.1| Xenopus tropicalis MGC89305 protein, mRNA (cDNA c...	70	8e-09
233	gb|BC071924.1| Homo sapiens ribosomal protein S2, mRNA (cDNA clo...	70	8e-09
234	gb|BC071922.1| Homo sapiens ribosomal protein S2, mRNA (cDNA clo...	70	8e-09
235	gb|BC071673.1| Homo sapiens ribosomal protein S2, mRNA (cDNA clo...	70	8e-09
236	gb|BC018993.2| Homo sapiens ribosomal protein S2, mRNA (cDNA clo...	70	8e-09
237	gb|BC032129.2| Homo sapiens ribosomal protein S2, mRNA (cDNA clo...	70	8e-09
238	ref|NM_002952.3| Homo sapiens ribosomal protein S2 (RPS2), mRNA	70	8e-09
239	emb|CR855816.2| Xenopus tropicalis finished cDNA, clone TTpA011p12	70	8e-09
240	dbj|AB082925.1| Homo sapiens rps2 mRNA for ribosomal protein S2,...	70	8e-09
241	gb|BC008329.2| Homo sapiens ribosomal protein S2, mRNA (cDNA clo...	70	8e-09
242	gb|BC029979.1| Homo sapiens ribosomal protein S2, mRNA (cDNA clo...	70	8e-09
243	gb|BC013833.1| Homo sapiens ribosomal protein S2, mRNA (cDNA clo...	70	8e-09
244	gb|BC035427.1| Homo sapiens ribosomal protein S2, mRNA (cDNA clo...	70	8e-09
245	gb|U92700.1|RNU92700 Rattus norvegicus ribosomal protein S2 mRNA...	70	8e-09
246	gb|U92699.1|RNU92699 Rattus norvegicus ribosomal protein S2 mRNA...	70	8e-09
247	gb|U92698.1|RNU92698 Rattus norvegicus ribosomal protein S2 mRNA...	70	8e-09
248	gb|U92697.1|RNU92697 Rattus norvegicus ribosomal protein S2 mRNA...	70	8e-09
249	gb|U92696.1|RNU92696 Rattus norvegicus ribosomal protein S2 mRNA...	70	8e-09
250	dbj|AB065088.1| Homo sapiens OK/KNS-cl.6 mRNA for ribosomal prot...	70	8e-09
251	ref|XM_513399.1| PREDICTED: Pan troglodytes similar to ribosomal...	68	3e-08
252	gb|AC005606.3| Homo sapiens chromosome 16, P1 clone 109-8C (LANL...	68	3e-08
253	gb|AC005363.1| Homo sapiens chromosome 16, P1 clone 47-2H (LANL)...	68	3e-08
254	ref|XM_414845.1| PREDICTED: Gallus gallus similar to 40S ribosom...	68	3e-08
255	ref|XM_849364.1| PREDICTED: Canis familiaris similar to 40S ribo...	68	3e-08
256	gb|AC147056.3| Pan troglodytes BAC clone RP43-153F5 from 7, comp...	68	3e-08
257	gb|BC063011.1| Homo sapiens ribosomal protein S2, mRNA (cDNA clo...	68	3e-08
258	ref|XM_532470.2| PREDICTED: Canis familiaris hypothetical LOC475...	68	3e-08
259	ref|XM_855734.1| PREDICTED: Canis familiaris similar to 40S ribo...	68	3e-08
260	ref|XM_845058.1| PREDICTED: Canis familiaris similar to 40S ribo...	68	3e-08
261	ref|XM_859982.1| PREDICTED: Canis familiaris similar to 40S ribo...	68	3e-08
262	ref|XM_859963.1| PREDICTED: Canis familiaris similar to 40S ribo...	68	3e-08
263	ref|XM_859945.1| PREDICTED: Canis familiaris similar to 40S ribo...	68	3e-08
264	ref|XM_859927.1| PREDICTED: Canis familiaris similar to 40S ribo...	68	3e-08
265	ref|XM_537011.2| PREDICTED: Canis familiaris similar to 40S ribo...	68	3e-08
266	emb|AL162430.15| Human DNA sequence from clone RP11-296A18 on ch...	68	3e-08
267	emb|AL031671.12|HS688G8 Human DNA sequence from clone RP4-688G8 ...	68	3e-08
268	gb|AC164432.3| Mus musculus BAC clone RP23-394G23 from chromosom...	68	3e-08
269	gb|AC151992.3| Mus musculus BAC clone RP23-212H13 from chromosom...	68	3e-08
270	gb|BC102227.1| Bos taurus ribosomal protein S2, mRNA (cDNA clone...	68	3e-08
271	gb|AC008494.8| Homo sapiens chromosome 5 clone CTC-428G20, compl...	68	3e-08
272	ref|XM_942424.1| PREDICTED: Homo sapiens similar to ribosomal pr...	68	3e-08
273	ref|XM_496363.2| PREDICTED: Homo sapiens similar to ribosomal pr...	68	3e-08
274	emb|BX935640.2| Gallus gallus finished cDNA, clone ChEST173d23	68	3e-08
275	emb|CR386183.1| Gallus gallus finished cDNA, clone ChEST100d8	68	3e-08
276	emb|CR386179.1| Gallus gallus finished cDNA, clone ChEST99k23	68	3e-08
277	ref|NG_000946.1| Homo sapiens ribosomal protein S2-like 1 (RPS2L...	68	3e-08
278	emb|BX934597.2| Gallus gallus finished cDNA, clone ChEST28g10	68	3e-08
279	emb|BX816200.1|CNS0ABME Arabidopsis thaliana Full-length cDNA Co...	68	3e-08
280	emb|BX933609.1| Gallus gallus finished cDNA, clone ChEST944e1	68	3e-08
281	gb|AC008585.4|AC008585 Homo sapiens chromosome 5 clone CTC-568C6...	68	3e-08
282	dbj|AB099060.1| Bos taurus mRNA for similar to ribosomal protein...	68	3e-08
283	dbj|AB098951.1| Bos taurus mRNA for similar to ribosomal protein...	68	3e-08
284	gb|AF013215.1|AF013215 Bos taurus ribosomal protein S2 mRNA, par...	68	3e-08
285	ref|NM_001033613.1| Bos taurus ribosomal protein S2 (RPS2), mRNA	68	3e-08
286	gb|U48359.1|GGU48359 Gallus gallus kinesin light chain mRNA, com...	68	3e-08
287	gb|AC091981.4| Homo sapiens chromosome 5 clone RP11-549L3, compl...	68	3e-08
288	dbj|AB065089.1| Homo sapiens OK/KNS-cl.7 mRNA for ribosomal prot...	68	3e-08
289	emb|BX066421.1|CNS09NEX Single read from an extremity of a full-...	66	1e-07
290	emb|BX058439.1|CNS09H97 Single read from an extremity of a full-...	66	1e-07
291	dbj|AB246885.1| Lethenteron japonicum RPS2 mRNA for ribosomal pr...	66	1e-07
292	ref|XM_945956.1| PREDICTED: Homo sapiens similar to ribosomal pr...	66	1e-07
293	ref|XM_934646.1| PREDICTED: Homo sapiens similar to ribosomal pr...	66	1e-07
294	ref|XM_230560.2| PREDICTED: Rattus norvegicus similar to ribosom...	66	1e-07
295	gb|AY190670.1| Pagrus major 40S ribosomal protein S2 mRNA, parti...	64	5e-07
296	gb|AY292482.1| Trisopterus minutus S2 ribosomal protein (S2) gen...	64	5e-07
297	ref|XR_003800.1| PREDICTED: Mus musculus similar to 40S ribosoma...	64	5e-07
298	ref|XR_005015.1| PREDICTED: Mus musculus similar to 40S ribosoma...	64	5e-07
299	ref|XM_001000286.1| PREDICTED: Mus musculus similar to 40S ribos...	64	5e-07
300	ref|XM_001001372.1| PREDICTED: Mus musculus similar to 40S ribos...	64	5e-07
301	gb|AC090881.9| Mus Musculus Strain C57BL6/J chromosome 17 BAC, R...	64	5e-07
302	gb|AF266169.1|AF266169 Gillichthys mirabilis 40S ribosomal prote...	64	5e-07
303	gb|AC098590.3| Homo sapiens BAC clone RP11-324J13 from 4, comple...	64	5e-07
304	gb|DQ206604.1| Monosiga brevicollis isolate TOA25 ribosomal prot...	64	5e-07
305	emb|CT025562.10| Mouse DNA sequence from clone RP24-225O12 on ch...	64	5e-07
306	gb|BC106136.1| Mus musculus ribosomal protein S2, mRNA (cDNA clo...	62	2e-06
307	ref|XM_514680.1| PREDICTED: Pan troglodytes LOC458285 (LOC458285...	62	2e-06
308	gb|AC161597.7| Mus musculus BAC clone RP23-387P23 from chromosom...	62	2e-06
309	ref|XM_508308.1| PREDICTED: Pan troglodytes similar to ribosomal...	62	2e-06
310	ref|XM_527392.1| PREDICTED: Pan troglodytes similar to 40S ribos...	62	2e-06
311	ref|XM_513943.1| PREDICTED: Pan troglodytes similar to ribosomal...	62	2e-06
312	gb|AC005742.1| Mus musculus chromosome 11, BAC clone CT7-111I18 ...	62	2e-06
313	gb|AC154566.2| Mus musculus BAC clone RP23-407A17 from chromosom...	62	2e-06
314	gb|AC120413.20| Mus musculus chromosome 5, clone RP24-458L16, co...	62	2e-06
315	gb|AC114657.8| Mus musculus chromosome 5, clone RP24-161C20, com...	62	2e-06
316	gb|AC140426.3| Mus musculus BAC clone RP24-98A17 from chromosome...	62	2e-06
317	gb|AC132345.4| Mus musculus BAC clone RP24-177P9 from chromosome...	62	2e-06
318	gb|BC116446.1| Mus musculus ribosomal protein S2, mRNA (cDNA clo...	62	2e-06
319	ref|NM_008503.2| Mus musculus ribosomal protein S2 (Rps2), mRNA	62	2e-06
320	ref|XM_001000337.1| PREDICTED: Mus musculus similar to 40S ribos...	62	2e-06
321	ref|XM_985894.1| PREDICTED: Mus musculus similar to 40S ribosoma...	62	2e-06
322	ref|XM_980478.1| PREDICTED: Mus musculus similar to 40S ribosoma...	62	2e-06
323	ref|XM_911531.2| PREDICTED: Mus musculus similar to 40S ribosoma...	62	2e-06
324	ref|XM_001002026.1| PREDICTED: Mus musculus similar to 40S ribos...	62	2e-06
325	ref|XM_989830.1| PREDICTED: Mus musculus similar to 40S ribosoma...	62	2e-06
326	ref|XM_994358.1| PREDICTED: Mus musculus similar to 40S ribosoma...	62	2e-06
327	ref|XM_985281.1| PREDICTED: Mus musculus similar to 40S ribosoma...	62	2e-06
328	ref|XM_001001275.1| PREDICTED: Mus musculus similar to 40S ribos...	62	2e-06
329	ref|XM_916654.2| PREDICTED: Mus musculus similar to 40S ribosoma...	62	2e-06
330	ref|XM_484395.4| PREDICTED: Mus musculus similar to 40S ribosoma...	62	2e-06
331	ref|XR_003869.1| PREDICTED: Mus musculus similar to 40S ribosoma...	62	2e-06
332	ref|XR_002630.1| PREDICTED: Mus musculus similar to ribosomal pr...	62	2e-06
333	ref|XR_002093.1| PREDICTED: Mus musculus hypothetical LOC634678 ...	62	2e-06
334	ref|XM_618996.3| PREDICTED: Mus musculus similar to 40S ribosoma...	62	2e-06
335	ref|XR_004619.1| PREDICTED: Mus musculus similar to 40S ribosoma...	62	2e-06
336	ref|XR_004907.1| PREDICTED: Mus musculus similar to 40S ribosoma...	62	2e-06
337	ref|XR_002067.1| PREDICTED: Mus musculus similar to 40S ribosoma...	62	2e-06
338	ref|XM_924178.2| PREDICTED: Mus musculus similar to 40S ribosoma...	62	2e-06
339	ref|XM_916251.2| PREDICTED: Mus musculus similar to 40S ribosoma...	62	2e-06
340	ref|XR_002990.1| PREDICTED: Mus musculus similar to 40S ribosoma...	62	2e-06
341	ref|XM_902930.2| PREDICTED: Mus musculus similar to 40S ribosoma...	62	2e-06
342	ref|XM_620794.3| PREDICTED: Mus musculus similar to 40S ribosoma...	62	2e-06
343	ref|XR_002464.1| PREDICTED: Mus musculus similar to 40S ribosoma...	62	2e-06
344	ref|XR_001689.1| PREDICTED: Mus musculus similar to 40S ribosoma...	62	2e-06
345	ref|XR_004453.1| PREDICTED: Mus musculus similar to 40S ribosoma...	62	2e-06
346	ref|XM_983255.1| PREDICTED: Mus musculus similar to 40S ribosoma...	62	2e-06
347	ref|XM_145024.7| PREDICTED: Mus musculus similar to 40S ribosoma...	62	2e-06
348	ref|XM_917764.2| PREDICTED: Mus musculus similar to 40S ribosoma...	62	2e-06
349	ref|XR_004683.1| PREDICTED: Mus musculus similar to 40S ribosoma...	62	2e-06
350	ref|XR_002482.1| PREDICTED: Mus musculus similar to 40S ribosoma...	62	2e-06
351	ref|XM_975042.1| PREDICTED: Mus musculus similar to 40S ribosoma...	62	2e-06
352	ref|XM_896126.2| PREDICTED: Mus musculus similar to 40S ribosoma...	62	2e-06
353	ref|XM_620258.3| PREDICTED: Mus musculus similar to 40S ribosoma...	62	2e-06
354	ref|XM_001002369.1| PREDICTED: Mus musculus similar to 40S ribos...	62	2e-06
355	ref|XM_924915.2| PREDICTED: Mus musculus similar to 40S ribosoma...	62	2e-06
356	ref|XM_917364.2| PREDICTED: Mus musculus similar to 40S ribosoma...	62	2e-06
357	ref|XR_003696.1| PREDICTED: Mus musculus hypothetical LOC620877 ...	62	2e-06
358	ref|XR_002985.1| PREDICTED: Mus musculus similar to 40S ribosoma...	62	2e-06
359	ref|XR_004792.1| PREDICTED: Mus musculus similar to 40S ribosoma...	62	2e-06
360	ref|XM_985424.1| PREDICTED: Mus musculus similar to 40S ribosoma...	62	2e-06
361	gb|AY518321.1| Homo sapiens cell division cycle 27 (CDC27) gene,...	62	2e-06
362	ref|XM_899463.2| PREDICTED: Mus musculus similar to 40S ribosoma...	62	2e-06
363	gb|AC132346.3| Mus musculus BAC clone RP24-179K8 from chromosome...	62	2e-06
364	gb|AC122252.4| Mus musculus BAC clone RP23-170E7 from chromosome...	62	2e-06
365	gb|AC122242.2| Mus musculus BAC clone RP23-147P2 from chromosome...	62	2e-06
366	gb|AC122367.4| Mus musculus BAC clone RP23-449L24 from chromosom...	62	2e-06
367	gb|AC122478.3| Mus musculus BAC clone RP24-337D11 from chromosom...	62	2e-06
368	gb|AC127237.3| Mus musculus BAC clone RP24-363G13 from chromosom...	62	2e-06
369	gb|AC117196.3| Mus musculus BAC clone RP23-108H19 from 8, comple...	62	2e-06
370	gb|AC121903.2| Mus musculus BAC clone RP24-174G24 from 18, compl...	62	2e-06
371	gb|AC084392.1| Mus musculus BAC clone GS1-182G5 from UL, complet...	62	2e-06
372	gb|BC060584.1| Rattus norvegicus cDNA clone MGC:72931 IMAGE:6886...	62	2e-06
373	emb|CR707364.2|CNS0G8R4 Tetraodon nigroviridis full-length cDNA	62	2e-06
374	gb|AC069564.34| Mus musculus strain C57BL/6J chromosome 17 clone...	62	2e-06
375	emb|AL049540.11|HSJ890O15 Human DNA sequence from clone RP5-890O...	62	2e-06
376	emb|BX056361.1|CNS09FNH Single read from an extremity of a full-...	62	2e-06
377	gb|AC159199.3| Mus musculus BAC clone RP23-401H23 from chromosom...	62	2e-06
378	emb|AL591136.20| Mouse DNA sequence from clone RP23-273P3 on chr...	62	2e-06
379	gb|AC164631.5| Mus musculus 6 BAC RP23-359M3 (Roswell Park Cance...	62	2e-06
380	emb|AL645741.15| Mouse DNA sequence from clone RP23-239O19 on ch...	62	2e-06
381	emb|AL645727.16| Mouse DNA sequence from clone RP23-20G7 on chro...	62	2e-06
382	emb|AL929371.6| Mouse DNA sequence from clone RP23-176O5 on chro...	62	2e-06
383	gb|BC094058.1| Mus musculus ribosomal protein S2, mRNA (cDNA clo...	62	2e-06
384	dbj|AK146259.1| Mus musculus CRL-1722 L5178Y-R cDNA, RIKEN full-...	62	2e-06
385	dbj|AK151985.1| Mus musculus bone marrow macrophage cDNA, RIKEN ...	62	2e-06
386	dbj|AK159138.1| Mus musculus osteoclast-like cell cDNA, RIKEN fu...	62	2e-06
387	dbj|AK159121.1| Mus musculus osteoclast-like cell cDNA, RIKEN fu...	62	2e-06
388	ref|XM_941676.1| PREDICTED: Homo sapiens similar to 40S ribosoma...	62	2e-06
389	ref|XM_930151.1| PREDICTED: Homo sapiens similar to 40S ribosoma...	62	2e-06
390	dbj|AK166726.1| Mus musculus blastocyst blastocyst cDNA, RIKEN f...	62	2e-06
391	dbj|AK166664.1| Mus musculus morula whole body morula cDNA, RIKE...	62	2e-06
392	dbj|AK167799.1| Mus musculus TIB-55 BB88 cDNA, RIKEN full-length...	62	2e-06
393	dbj|AK152299.1| Mus musculus bone marrow macrophage cDNA, RIKEN ...	62	2e-06
394	dbj|AK151119.1| Mus musculus bone marrow macrophage cDNA, RIKEN ...	62	2e-06
395	dbj|AK168630.1| Mus musculus 16 days embryo heart cDNA, RIKEN fu...	62	2e-06
396	dbj|AK166549.1| Mus musculus 5 days embryo whole body cDNA, RIKE...	62	2e-06
397	dbj|AK168528.1| Mus musculus 16 days embryo kidney cDNA, RIKEN f...	62	2e-06
398	dbj|AK168307.1| Mus musculus TIB-55 BB88 cDNA, RIKEN full-length...	62	2e-06
399	dbj|AK167033.1| Mus musculus blastocyst blastocyst cDNA, RIKEN f...	62	2e-06
400	dbj|AK163821.1| Mus musculus 16 days embryo head cDNA, RIKEN ful...	62	2e-06
401	dbj|AK167974.1| Mus musculus TIB-55 BB88 cDNA, RIKEN full-length...	62	2e-06
402	dbj|AK169119.1| Mus musculus 17 days embryo kidney cDNA, RIKEN f...	62	2e-06
403	gb|AC025186.6| Homo sapiens chromosome 5 clone CTD-2375G15, comp...	62	2e-06
404	gb|AC161265.2| Mus musculus BAC clone RP23-271F18 from chromosom...	62	2e-06
405	gb|AC025176.5| Homo sapiens chromosome 5 clone CTD-2116N20, comp...	62	2e-06
406	dbj|AK012360.1| Mus musculus 11 days embryo whole body cDNA, RIK...	62	2e-06
407	emb|BX813333.7| Mouse DNA sequence from clone RP23-255A6 on chro...	62	2e-06
408	gb|BC094273.1| Mus musculus ribosomal protein S2, mRNA (cDNA clo...	62	2e-06
409	gb|BC092286.1| Mus musculus ribosomal protein S2, mRNA (cDNA clo...	62	2e-06
410	gb|BC093493.1| Mus musculus ribosomal protein S2, mRNA (cDNA clo...	62	2e-06
411	gb|AF283559.1|AF283559 Mus musculus ribosomal protein S2 mRNA, c...	62	2e-06
412	ref|XM_220196.3| PREDICTED: Rattus norvegicus similar to 40S rib...	62	2e-06
413	ref|XM_217412.3| PREDICTED: Rattus norvegicus similar to 40S rib...	62	2e-06
414	dbj|AK191286.1| Mus musculus cDNA, clone:Y1G0105G13, strand:plus...	62	2e-06
415	gb|BC091755.1| Mus musculus ribosomal protein S2, mRNA (cDNA clo...	62	2e-06
416	emb|BX649621.5| Mouse DNA sequence from clone RP23-173F3 on chro...	62	2e-06
417	gb|BC091730.1| Mus musculus ribosomal protein S2, mRNA (cDNA clo...	62	2e-06
418	dbj|AK130930.1| Homo sapiens cDNA FLJ27420 fis, clone WMC07143	62	2e-06
419	gb|BC087956.1| Mus musculus ribosomal protein S2, mRNA (cDNA clo...	62	2e-06
420	gb|BC002186.1| Mus musculus ribosomal protein S2, mRNA (cDNA clo...	62	2e-06
421	gb|BC110678.1| Mus musculus ribosomal protein S2, mRNA (cDNA clo...	62	2e-06
422	gb|U89418.1|MMU89418 Mus musculus strain BALB/c ribosomal protei...	62	2e-06
423	gb|AC002558.1|AC002558 Homo sapiens chromosome 17, clone hRPC867...	62	2e-06
424	gb|AC132607.4| Mus musculus BAC clone RP23-447F22 from 12, compl...	62	2e-06
425	gb|AC153654.4| Mus musculus BAC clone RP23-457N11 from chromosom...	62	2e-06
426	emb|AL831776.3| Mouse DNA sequence from clone RP23-307M2 on chro...	62	2e-06
427	emb|AL606932.10| Mouse DNA sequence from clone RP23-247I20 on ch...	62	2e-06
428	emb|AL606903.8| Mouse DNA sequence from clone RP23-278I3 on chro...	62	2e-06
429	gb|M20634.1|MUSRSC Mouse LLRep3 protein pseudogene from a repeti...	62	2e-06
430	gb|M20632.1|MUSRSA Mouse LLRep3 protein mRNA from a repetitive e...	62	2e-06
431	emb|AL607129.16| Mouse DNA sequence from clone RP23-120H2 on chr...	62	2e-06
432	ref|XM_524020.1| PREDICTED: Pan troglodytes LOC468632 (LOC468632...	60	8e-06
433	gb|AC154680.2| Mus musculus BAC clone RP24-313N16 from chromosom...	60	8e-06
434	ref|XM_528196.1| PREDICTED: Pan troglodytes similar to 40S ribos...	60	8e-06
435	gb|AY440574.1| Armigeres subalbatus ASAP ID: 41459 cytosolic sma...	60	8e-06
436	ref|XM_549224.2| PREDICTED: Canis familiaris similar to 40S ribo...	60	8e-06
437	ref|XR_003909.1| PREDICTED: Mus musculus hypothetical LOC238756 ...	60	8e-06
438	ref|XR_004882.1| PREDICTED: Mus musculus hypothetical protein LO...	60	8e-06
439	ref|XR_002658.1| PREDICTED: Mus musculus hypothetical protein LO...	60	8e-06
440	ref|XR_002170.1| PREDICTED: Mus musculus hypothetical protein LO...	60	8e-06
441	ref|XR_003760.1| PREDICTED: Mus musculus similar to 40S ribosoma...	60	8e-06
442	gb|AC124472.4| Mus musculus BAC clone RP24-83E15 from chromosome...	60	8e-06
443	ref|XM_537709.2| PREDICTED: Canis familiaris similar to 40S ribo...	60	8e-06
444	gb|AC005521.1| Homo sapiens PAC clone RP5-1106E3 from 7, complet...	60	8e-06
445	emb|AL592295.25| Human DNA sequence from clone RP11-122G18 on ch...	60	8e-06
446	emb|BX071803.1|CNS09RKF Single read from an extremity of a full-...	60	8e-06
447	emb|BX054443.1|CNS09E67 Single read from an extremity of a full-...	60	8e-06
448	emb|BX050722.1|CNS09BAU Single read from an extremity of a full-...	60	8e-06
449	emb|BX047937.1|CNS0995H Single read from an extremity of a full-...	60	8e-06
450	emb|BX041710.1|CNS094CI Single read from an extremity of a full-...	60	8e-06
451	emb|BX034001.1|CNS08YED Single read from an extremity of a full-...	60	8e-06
452	emb|BX032203.1|CNS08X0F Single read from an extremity of a full-...	60	8e-06
453	ref|XM_776684.1| PREDICTED: Strongylocentrotus purpuratus simila...	60	8e-06
454	gb|AC112708.3| Homo sapiens chromosome 19 clone LLNL-FOS_33C4, c...	60	8e-06
455	gb|AC104619.5| Homo sapiens BAC clone RP11-192C21 from 4, comple...	60	8e-06
456	ref|XM_935549.1| PREDICTED: Homo sapiens similar to 40S ribosoma...	60	8e-06
457	ref|XM_937777.1| PREDICTED: Homo sapiens similar to 40S ribosoma...	60	8e-06
458	ref|XM_929786.1| PREDICTED: Homo sapiens similar to 40S ribosoma...	60	8e-06
459	emb|AL928891.20| Mouse DNA sequence from clone RP23-17O9 on chro...	60	8e-06
460	gb|AY130359.1| Branchiostoma lanceolatum ribosomal protein S2 mR...	60	8e-06
461	ref|XM_574216.1| PREDICTED: Rattus norvegicus similar to ribosom...	60	8e-06
462	gb|BC067645.1| Danio rerio ribosomal protein S2, mRNA (cDNA clon...	58	3e-05
463	gb|AY016021.1| Mus musculus clone 03245 alpha globin gene cluste...	58	3e-05
464	ref|XR_002648.1| PREDICTED: Mus musculus hypothetical protein LO...	58	3e-05
465	ref|XR_001700.1| PREDICTED: Mus musculus hypothetical protein LO...	58	3e-05
466	ref|XR_004692.1| PREDICTED: Mus musculus hypothetical protein LO...	58	3e-05
467	emb|CR392027.16| Zebrafish DNA sequence from clone CH211-139G16 ...	58	3e-05
468	emb|BX053311.1|CNS09DAR Single read from an extremity of a full-...	58	3e-05
469	emb|BX053310.1|CNS09DAQ Single read from an extremity of a full-...	58	3e-05
470	emb|BX071942.1|CNS09ROA Single read from an extremity of a full-...	58	3e-05
471	emb|BX071917.1|CNS09RNL Single read from an extremity of a full-...	58	3e-05
472	emb|BX071916.1|CNS09RNK Single read from an extremity of a full-...	58	3e-05
473	emb|BX071881.1|CNS09RML Single read from an extremity of a full-...	58	3e-05
474	emb|BX071859.1|CNS09RLZ Single read from an extremity of a full-...	58	3e-05
475	emb|BX071858.1|CNS09RLY Single read from an extremity of a full-...	58	3e-05
476	emb|BX071840.1|CNS09RLG Single read from an extremity of a full-...	58	3e-05
477	emb|BX071839.1|CNS09RLF Single read from an extremity of a full-...	58	3e-05
478	emb|BX071830.1|CNS09RL6 Single read from an extremity of a full-...	58	3e-05
479	emb|BX071824.1|CNS09RL0 Single read from an extremity of a full-...	58	3e-05
480	emb|BX071802.1|CNS09RKE Single read from an extremity of a full-...	58	3e-05
481	emb|BX071637.1|CNS09RFT Single read from an extremity of a full-...	58	3e-05
482	emb|BX071636.1|CNS09RFS Single read from an extremity of a full-...	58	3e-05
483	emb|BX071157.1|CNS09R2H Single read from an extremity of a full-...	58	3e-05
484	emb|BX071130.1|CNS09R1Q Single read from an extremity of a full-...	58	3e-05
485	emb|BX071129.1|CNS09R1P Single read from an extremity of a full-...	58	3e-05
486	emb|BX071126.1|CNS09R1M Single read from an extremity of a full-...	58	3e-05
487	emb|BX071354.1|CNS09R7Y Single read from an extremity of a full-...	58	3e-05
488	emb|BX070994.1|CNS09QXY Single read from an extremity of a full-...	58	3e-05
489	emb|BX070993.1|CNS09QXX Single read from an extremity of a full-...	58	3e-05
490	emb|BX070950.1|CNS09QWQ Single read from an extremity of a full-...	58	3e-05
491	emb|BX070845.1|CNS09QTT Single read from an extremity of a full-...	58	3e-05
492	emb|BX070796.1|CNS09QSG Single read from an extremity of a full-...	58	3e-05
493	emb|BX070740.1|CNS09QQW Single read from an extremity of a full-...	58	3e-05
494	emb|BX070705.1|CNS09QPX Single read from an extremity of a full-...	58	3e-05
495	emb|BX070571.1|CNS09QM7 Single read from an extremity of a full-...	58	3e-05
496	emb|BX070570.1|CNS09QM6 Single read from an extremity of a full-...	58	3e-05
497	emb|BX070250.1|CNS09QDA Single read from an extremity of a full-...	58	3e-05
498	emb|BX070249.1|CNS09QD9 Single read from an extremity of a full-...	58	3e-05
499	emb|BX070108.1|CNS09Q9C Single read from an extremity of a full-...	58	3e-05
500	emb|BX070107.1|CNS09Q9B Single read from an extremity of a full-...	58	3e-05

---

>ref|XM_470037.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1064

 Score =  365 bits (184), Expect = 1e-97
 Identities = 382/447 (85%), Gaps = 2/447 (0%)
 Strand = Plus / Minus

                                                                       
Query: 97  taactataataaaacaaagtgcattagacagctcccagctagtaaaaaccct--ttacac 154
           |||||||  ||||||||||||||| |||||  ||| |||||| ||| || ||  |||| |
Sbjct: 929 taactattgtaaaacaaagtgcatcagacaagtccgagctagcaaagactctctttactc 870

                                                                       
Query: 155 cgacatcctaagcttctatcttctcggctggtacatcatggatcagggccttggtcggtt 214
           || |||||||||| ||||  |||||| | ||| |||||   || || ||||| ||||| |
Sbjct: 869 cgccatcctaagcctctacgttctcgacaggtgcatcaatcataagagccttagtcggct 810

                                                                       
Query: 215 tcgccaagatgtcggtgaactcctggtacggagtcttggtgaaggtcgtctccctccaga 274
           | ||||||| ||||||| |||||||| | |||| ||||  |||  | || ||||||||||
Sbjct: 809 tggccaagaggtcggtgtactcctggaatggagacttgacgaacttggtgtccctccaga 750

                                                                       
Query: 275 agtcaggggtgaggaatccataggtcttcatcaggcagtcgaaggttgccttgacgaagt 334
           ||||||| || ||||||||||| ||||||||||||||||| ||||| |||||||||||||
Sbjct: 749 agtcaggagtaaggaatccataagtcttcatcaggcagtcaaaggtggccttgacgaagt 690

                                                                       
Query: 335 tgccaagggtcttggtggatccacgcgaggaagtgaagacatcatcaataccagcgaact 394
           ||||||||||||||||||||||||| || || ||||||||||| ||||| || |||||||
Sbjct: 689 tgccaagggtcttggtggatccacgggacgaggtgaagacatcctcaatgccggcgaact 630

                                                                       
Query: 395 ggagcaccttcttggggacccgggcggcgacgattccagaacccctcggggcgggcacca 454
           | |||||||||||||| || ||||||||||| || || ||||||||||||||||||||||
Sbjct: 629 gcagcaccttcttgggcacgcgggcggcgacaatacccgaacccctcggggcgggcacca 570

                                                                       
Query: 455 tacgcacggtgacagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgc 514
           | ||||||||||||||||| ||||| |||||||||||||| ||||||||||| |||   |
Sbjct: 569 tgcgcacggtgacagagccacactttccggtgaccttgcacggcacggtgtgcggctgcc 510

                                      
Query: 515 cgatcttgttcccccagtagcccctcc 541
           |||||||||| |||||||| |||||||
Sbjct: 509 cgatcttgttaccccagtaacccctcc 483

---

>dbj|AK064984.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013001C14, full
           insert sequence
          Length = 1084

 Score =  365 bits (184), Expect = 1e-97
 Identities = 382/447 (85%), Gaps = 2/447 (0%)
 Strand = Plus / Minus

                                                                       
Query: 97  taactataataaaacaaagtgcattagacagctcccagctagtaaaaaccct--ttacac 154
           |||||||  ||||||||||||||| |||||  ||| |||||| ||| || ||  |||| |
Sbjct: 971 taactattgtaaaacaaagtgcatcagacaagtccgagctagcaaagactctctttactc 912

                                                                       
Query: 155 cgacatcctaagcttctatcttctcggctggtacatcatggatcagggccttggtcggtt 214
           || |||||||||| ||||  |||||| | ||| |||||   || || ||||| ||||| |
Sbjct: 911 cgccatcctaagcctctacgttctcgacaggtgcatcaatcataagagccttagtcggct 852

                                                                       
Query: 215 tcgccaagatgtcggtgaactcctggtacggagtcttggtgaaggtcgtctccctccaga 274
           | ||||||| ||||||| |||||||| | |||| ||||  |||  | || ||||||||||
Sbjct: 851 tggccaagaggtcggtgtactcctggaatggagacttgacgaacttggtgtccctccaga 792

                                                                       
Query: 275 agtcaggggtgaggaatccataggtcttcatcaggcagtcgaaggttgccttgacgaagt 334
           ||||||| || ||||||||||| ||||||||||||||||| ||||| |||||||||||||
Sbjct: 791 agtcaggagtaaggaatccataagtcttcatcaggcagtcaaaggtggccttgacgaagt 732

                                                                       
Query: 335 tgccaagggtcttggtggatccacgcgaggaagtgaagacatcatcaataccagcgaact 394
           ||||||||||||||||||||||||| || || ||||||||||| ||||| || |||||||
Sbjct: 731 tgccaagggtcttggtggatccacgggacgaggtgaagacatcctcaatgccggcgaact 672

                                                                       
Query: 395 ggagcaccttcttggggacccgggcggcgacgattccagaacccctcggggcgggcacca 454
           | |||||||||||||| || ||||||||||| || || ||||||||||||||||||||||
Sbjct: 671 gcagcaccttcttgggcacgcgggcggcgacaatacccgaacccctcggggcgggcacca 612

                                                                       
Query: 455 tacgcacggtgacagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgc 514
           | ||||||||||||||||| ||||| |||||||||||||| ||||||||||| |||   |
Sbjct: 611 tgcgcacggtgacagagccacactttccggtgaccttgcacggcacggtgtgcggctgcc 552

                                      
Query: 515 cgatcttgttcccccagtagcccctcc 541
           |||||||||| |||||||| |||||||
Sbjct: 551 cgatcttgttaccccagtaacccctcc 525

---

>gb|AY104047.1| Zea mays PCO131880 mRNA sequence
          Length = 873

 Score =  307 bits (155), Expect = 2e-80
 Identities = 293/339 (86%)
 Strand = Plus / Minus

                                                                       
Query: 203 ccttggtcggtttcgccaagatgtcggtgaactcctggtacggagtcttggtgaaggtcg 262
           ||||||| || |||||||  | ||| ||| ||| |||| |||||||| ||| |||  | |
Sbjct: 636 ccttggtgggcttcgccagcaggtccgtgtactgctggaacggagtcatggagaacttgg 577

                                                                       
Query: 263 tctccctccagaagtcaggggtgaggaatccataggtcttcatcaggcagtcgaaggttg 322
           |||  |||||||| ||||| || ||||| || ||||||||||| ||||||||||||||||
Sbjct: 576 tctgactccagaattcaggagtaaggaagccgtaggtcttcatgaggcagtcgaaggttg 517

                                                                       
Query: 323 ccttgacgaagttgccaagggtcttggtggatccacgcgaggaagtgaagacatcatcaa 382
           ||||||||||||||||||||||||| ||||| ||||| || || ||||||||||| ||||
Sbjct: 516 ccttgacgaagttgccaagggtcttagtggagccacgggacgaggtgaagacatcctcaa 457

                                                                       
Query: 383 taccagcgaactggagcaccttcttggggacccgggcggcgacgattccagaacccctcg 442
           | ||||||||||| |||||||||||||| || || ||||||||||| ||||||||||| |
Sbjct: 456 tgccagcgaactgcagcaccttcttgggcacgcgcgcggcgacgatgccagaacccctgg 397

                                                                       
Query: 443 gggcgggcaccatacgcacggtgacagagccgcacttgccggtgaccttgcagggcacgg 502
           | || |||||||| ||||||||||| || |||||||||||||||||||||||||||||||
Sbjct: 396 gcgcaggcaccatgcgcacggtgacggacccgcacttgccggtgaccttgcagggcacgg 337

                                                  
Query: 503 tgtggggcatgccgatcttgttcccccagtagcccctcc 541
           |||| |||   ||||||||||| ||||||||||| ||||
Sbjct: 336 tgtgcggctgcccgatcttgtttccccagtagcctctcc 298

---

>ref|XM_477083.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 831

 Score =  272 bits (137), Expect = 1e-69
 Identities = 278/325 (85%)
 Strand = Plus / Minus

                                                                       
Query: 217 gccaagatgtcggtgaactcctggtacggagtcttggtgaaggtcgtctccctccagaag 276
           ||||||| ||| ||| |||||||| |||| |||||| | ||  | ||||| |||||||||
Sbjct: 779 gccaagaggtccgtgtactcctggaacggcgtcttgataaacctggtctctctccagaag 720

                                                                       
Query: 277 tcaggggtgaggaatccataggtcttcatcaggcagtcgaaggttgccttgacgaagttg 336
           ||||| || ||||| |||||||||||||| || || |||||||| |||||||||||||||
Sbjct: 719 tcaggagtcaggaacccataggtcttcatgagacaatcgaaggtggccttgacgaagttg 660

                                                                       
Query: 337 ccaagggtcttggtggatccacgcgaggaagtgaagacatcatcaataccagcgaactgg 396
           || |||||||||||||| || ||||| || |||||||| || || || || |||||||||
Sbjct: 659 ccgagggtcttggtggagccgcgcgacgaggtgaagacgtcctcgatgccggcgaactgg 600

                                                                       
Query: 397 agcaccttcttggggacccgggcggcgacgattccagaacccctcggggcgggcaccata 456
           |||||||||||||| ||  | || || ||||| || || ||||| || || |||||||| 
Sbjct: 599 agcaccttcttgggcacgtgcgccgccacgatcccggaccccctgggcgccggcaccatg 540

                                                                       
Query: 457 cgcacggtgacagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccg 516
           ||||||||||| |||||||||||||||||||||||||| ||||||||||| ||| | |||
Sbjct: 539 cgcacggtgacggagccgcacttgccggtgaccttgcacggcacggtgtgcggcttcccg 480

                                    
Query: 517 atcttgttcccccagtagcccctcc 541
           ||||||||||||||||| |||||||
Sbjct: 479 atcttgttcccccagtaccccctcc 455

---

>dbj|AK063732.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-120-E09, full
           insert sequence
          Length = 869

 Score =  272 bits (137), Expect = 1e-69
 Identities = 278/325 (85%)
 Strand = Plus / Minus

                                                                       
Query: 217 gccaagatgtcggtgaactcctggtacggagtcttggtgaaggtcgtctccctccagaag 276
           ||||||| ||| ||| |||||||| |||| |||||| | ||  | ||||| |||||||||
Sbjct: 447 gccaagaggtccgtgtactcctggaacggcgtcttgataaacctggtctctctccagaag 388

                                                                       
Query: 277 tcaggggtgaggaatccataggtcttcatcaggcagtcgaaggttgccttgacgaagttg 336
           ||||| || ||||| |||||||||||||| || || |||||||| |||||||||||||||
Sbjct: 387 tcaggagtcaggaacccataggtcttcatgagacaatcgaaggtggccttgacgaagttg 328

                                                                       
Query: 337 ccaagggtcttggtggatccacgcgaggaagtgaagacatcatcaataccagcgaactgg 396
           || |||||||||||||| || ||||| || |||||||| || || || || |||||||||
Sbjct: 327 ccgagggtcttggtggagccgcgcgacgaggtgaagacgtcctcgatgccggcgaactgg 268

                                                                       
Query: 397 agcaccttcttggggacccgggcggcgacgattccagaacccctcggggcgggcaccata 456
           |||||||||||||| ||  | || || ||||| || || ||||| || || |||||||| 
Sbjct: 267 agcaccttcttgggcacgtgcgccgccacgatcccggaccccctgggcgccggcaccatg 208

                                                                       
Query: 457 cgcacggtgacagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccg 516
           ||||||||||| |||||||||||||||||||||||||| ||||||||||| ||| | |||
Sbjct: 207 cgcacggtgacggagccgcacttgccggtgaccttgcacggcacggtgtgcggcttcccg 148

                                    
Query: 517 atcttgttcccccagtagcccctcc 541
           ||||||||||||||||| |||||||
Sbjct: 147 atcttgttcccccagtaccccctcc 123

---

>gb|BT016220.1| Zea mays clone Contig53 mRNA sequence
          Length = 1159

 Score =  260 bits (131), Expect = 4e-66
 Identities = 287/339 (84%)
 Strand = Plus / Minus

                                                                       
Query: 203 ccttggtcggtttcgccaagatgtcggtgaactcctggtacggagtcttggtgaaggtcg 262
           |||| ||||| || ||||||| |||||||||||||||| |||| |||||||   |  | |
Sbjct: 873 cctttgtcggcttagccaagaggtcggtgaactcctggaacggggtcttggcatacttgg 814

                                                                       
Query: 263 tctccctccagaagtcaggggtgaggaatccataggtcttcatcaggcagtcgaaggttg 322
           ||||   |||||| ||||| |||||||| || |||||||||||||| || || |||||||
Sbjct: 813 tctcggcccagaactcaggagtgaggaagccgtaggtcttcatcagacaatcaaaggttg 754

                                                                       
Query: 323 ccttgacgaagttgccaagggtcttggtggatccacgcgaggaagtgaagacatcatcaa 382
           ||||||||||||| || || ||||||||||| ||||| || || || |||||||| ||||
Sbjct: 753 ccttgacgaagttaccgagtgtcttggtggagccacgggacgaggtaaagacatcttcaa 694

                                                                       
Query: 383 taccagcgaactggagcaccttcttggggacccgggcggcgacgattccagaacccctcg 442
           | || ||||||||||| ||||||||||| || ||||| ||||| || || || ||||| |
Sbjct: 693 tgccggcgaactggaggaccttcttgggcacgcgggcagcgacaatcccggaccccctgg 634

                                                                       
Query: 443 gggcgggcaccatacgcacggtgacagagccgcacttgccggtgaccttgcagggcacgg 502
           | || |||||||| ||||||||||| || ||||||||||||||||||||||||||||| |
Sbjct: 633 gcgccggcaccatgcgcacggtgacggacccgcacttgccggtgaccttgcagggcacag 574

                                                  
Query: 503 tgtggggcatgccgatcttgttcccccagtagcccctcc 541
           |||| |||  |||||||||||| ||||||||||||||||
Sbjct: 573 tgtgcggctggccgatcttgtttccccagtagcccctcc 535

---

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score =  260 bits (131), Expect = 4e-66
 Identities = 197/219 (89%)
 Strand = Plus / Minus

                                                                            
Query: 323      ccttgacgaagttgccaagggtcttggtggatccacgcgaggaagtgaagacatcatcaa 382
                ||||||||||||||||||||||||||||||||||||| || || ||||||||||| ||||
Sbjct: 33465835 ccttgacgaagttgccaagggtcttggtggatccacgggacgaggtgaagacatcctcaa 33465776

                                                                            
Query: 383      taccagcgaactggagcaccttcttggggacccgggcggcgacgattccagaacccctcg 442
                | || |||||||| |||||||||||||| || ||||||||||| || || ||||||||||
Sbjct: 33465775 tgccggcgaactgcagcaccttcttgggcacgcgggcggcgacaatacccgaacccctcg 33465716

                                                                            
Query: 443      gggcgggcaccatacgcacggtgacagagccgcacttgccggtgaccttgcagggcacgg 502
                ||||||||||||| ||||||||||||||||| ||||| |||||||||||||| |||||||
Sbjct: 33465715 gggcgggcaccatgcgcacggtgacagagccacactttccggtgaccttgcacggcacgg 33465656

                                                       
Query: 503      tgtggggcatgccgatcttgttcccccagtagcccctcc 541
                |||| |||   ||||||||||| |||||||| |||||||
Sbjct: 33465655 tgtgcggctgcccgatcttgttaccccagtaacccctcc 33465617



 Score =  111 bits (56), Expect = 2e-21
 Identities = 188/231 (81%), Gaps = 2/231 (0%)
 Strand = Plus / Minus

                                                                            
Query: 97       taactataataaaacaaagtgcattagacagctcccagctagtaaaaaccct--ttacac 154
                |||||||  ||||||||||||||| |||||  ||| |||||| ||| || ||  |||| |
Sbjct: 33466856 taactattgtaaaacaaagtgcatcagacaagtccgagctagcaaagactctctttactc 33466797

                                                                            
Query: 155      cgacatcctaagcttctatcttctcggctggtacatcatggatcagggccttggtcggtt 214
                || |||||||||| ||||  |||||| | ||| |||||   || || ||||| ||||| |
Sbjct: 33466796 cgccatcctaagcctctacgttctcgacaggtgcatcaatcataagagccttagtcggct 33466737

                                                                            
Query: 215      tcgccaagatgtcggtgaactcctggtacggagtcttggtgaaggtcgtctccctccaga 274
                | ||||||| ||||||| |||||||| | |||| ||||  |||  | || ||||||||||
Sbjct: 33466736 tggccaagaggtcggtgtactcctggaatggagacttgacgaacttggtgtccctccaga 33466677

                                                                   
Query: 275      agtcaggggtgaggaatccataggtcttcatcaggcagtcgaaggttgcct 325
                ||||||| || ||||||||||| ||||||||||||||||| ||||| ||||
Sbjct: 33466676 agtcaggagtaaggaatccataagtcttcatcaggcagtcaaaggtggcct 33466626

---

>gb|AC135958.2| Oryza sativa chromosome 3 BAC OSJNBa0059E14 genomic sequence, complete
             sequence
          Length = 154555

 Score =  260 bits (131), Expect = 4e-66
 Identities = 197/219 (89%)
 Strand = Plus / Plus

                                                                         
Query: 323   ccttgacgaagttgccaagggtcttggtggatccacgcgaggaagtgaagacatcatcaa 382
             ||||||||||||||||||||||||||||||||||||| || || ||||||||||| ||||
Sbjct: 32276 ccttgacgaagttgccaagggtcttggtggatccacgggacgaggtgaagacatcctcaa 32335

                                                                         
Query: 383   taccagcgaactggagcaccttcttggggacccgggcggcgacgattccagaacccctcg 442
             | || |||||||| |||||||||||||| || ||||||||||| || || ||||||||||
Sbjct: 32336 tgccggcgaactgcagcaccttcttgggcacgcgggcggcgacaatacccgaacccctcg 32395

                                                                         
Query: 443   gggcgggcaccatacgcacggtgacagagccgcacttgccggtgaccttgcagggcacgg 502
             ||||||||||||| ||||||||||||||||| ||||| |||||||||||||| |||||||
Sbjct: 32396 gggcgggcaccatgcgcacggtgacagagccacactttccggtgaccttgcacggcacgg 32455

                                                    
Query: 503   tgtggggcatgccgatcttgttcccccagtagcccctcc 541
             |||| |||   ||||||||||| |||||||| |||||||
Sbjct: 32456 tgtgcggctgcccgatcttgttaccccagtaacccctcc 32494



 Score =  111 bits (56), Expect = 2e-21
 Identities = 188/231 (81%), Gaps = 2/231 (0%)
 Strand = Plus / Plus

                                                                         
Query: 97    taactataataaaacaaagtgcattagacagctcccagctagtaaaaaccct--ttacac 154
             |||||||  ||||||||||||||| |||||  ||| |||||| ||| || ||  |||| |
Sbjct: 31255 taactattgtaaaacaaagtgcatcagacaagtccgagctagcaaagactctctttactc 31314

                                                                         
Query: 155   cgacatcctaagcttctatcttctcggctggtacatcatggatcagggccttggtcggtt 214
             || |||||||||| ||||  |||||| | ||| |||||   || || ||||| ||||| |
Sbjct: 31315 cgccatcctaagcctctacgttctcgacaggtgcatcaatcataagagccttagtcggct 31374

                                                                         
Query: 215   tcgccaagatgtcggtgaactcctggtacggagtcttggtgaaggtcgtctccctccaga 274
             | ||||||| ||||||| |||||||| | |||| ||||  |||  | || ||||||||||
Sbjct: 31375 tggccaagaggtcggtgtactcctggaatggagacttgacgaacttggtgtccctccaga 31434

                                                                
Query: 275   agtcaggggtgaggaatccataggtcttcatcaggcagtcgaaggttgcct 325
             ||||||| || ||||||||||| ||||||||||||||||| ||||| ||||
Sbjct: 31435 agtcaggagtaaggaatccataagtcttcatcaggcagtcaaaggtggcct 31485

---

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
                sequence
          Length = 36192742

 Score =  260 bits (131), Expect = 4e-66
 Identities = 197/219 (89%)
 Strand = Plus / Minus

                                                                            
Query: 323      ccttgacgaagttgccaagggtcttggtggatccacgcgaggaagtgaagacatcatcaa 382
                ||||||||||||||||||||||||||||||||||||| || || ||||||||||| ||||
Sbjct: 33556345 ccttgacgaagttgccaagggtcttggtggatccacgggacgaggtgaagacatcctcaa 33556286

                                                                            
Query: 383      taccagcgaactggagcaccttcttggggacccgggcggcgacgattccagaacccctcg 442
                | || |||||||| |||||||||||||| || ||||||||||| || || ||||||||||
Sbjct: 33556285 tgccggcgaactgcagcaccttcttgggcacgcgggcggcgacaatacccgaacccctcg 33556226

                                                                            
Query: 443      gggcgggcaccatacgcacggtgacagagccgcacttgccggtgaccttgcagggcacgg 502
                ||||||||||||| ||||||||||||||||| ||||| |||||||||||||| |||||||
Sbjct: 33556225 gggcgggcaccatgcgcacggtgacagagccacactttccggtgaccttgcacggcacgg 33556166

                                                       
Query: 503      tgtggggcatgccgatcttgttcccccagtagcccctcc 541
                |||| |||   ||||||||||| |||||||| |||||||
Sbjct: 33556165 tgtgcggctgcccgatcttgttaccccagtaacccctcc 33556127



 Score =  111 bits (56), Expect = 2e-21
 Identities = 188/231 (81%), Gaps = 2/231 (0%)
 Strand = Plus / Minus

                                                                            
Query: 97       taactataataaaacaaagtgcattagacagctcccagctagtaaaaaccct--ttacac 154
                |||||||  ||||||||||||||| |||||  ||| |||||| ||| || ||  |||| |
Sbjct: 33557366 taactattgtaaaacaaagtgcatcagacaagtccgagctagcaaagactctctttactc 33557307

                                                                            
Query: 155      cgacatcctaagcttctatcttctcggctggtacatcatggatcagggccttggtcggtt 214
                || |||||||||| ||||  |||||| | ||| |||||   || || ||||| ||||| |
Sbjct: 33557306 cgccatcctaagcctctacgttctcgacaggtgcatcaatcataagagccttagtcggct 33557247

                                                                            
Query: 215      tcgccaagatgtcggtgaactcctggtacggagtcttggtgaaggtcgtctccctccaga 274
                | ||||||| ||||||| |||||||| | |||| ||||  |||  | || ||||||||||
Sbjct: 33557246 tggccaagaggtcggtgtactcctggaatggagacttgacgaacttggtgtccctccaga 33557187

                                                                   
Query: 275      agtcaggggtgaggaatccataggtcttcatcaggcagtcgaaggttgcct 325
                ||||||| || ||||||||||| ||||||||||||||||| ||||| ||||
Sbjct: 33557186 agtcaggagtaaggaatccataagtcttcatcaggcagtcaaaggtggcct 33557136

---

>gb|AY104097.1| Zea mays PCO131882 mRNA sequence
          Length = 1083

 Score =  260 bits (131), Expect = 4e-66
 Identities = 287/339 (84%)
 Strand = Plus / Minus

                                                                       
Query: 203 ccttggtcggtttcgccaagatgtcggtgaactcctggtacggagtcttggtgaaggtcg 262
           |||| ||||| || ||||||| |||||||||||||||| |||| |||||||   |  | |
Sbjct: 777 cctttgtcggcttagccaagaggtcggtgaactcctggaacggggtcttggcatacttgg 718

                                                                       
Query: 263 tctccctccagaagtcaggggtgaggaatccataggtcttcatcaggcagtcgaaggttg 322
           ||||   |||||| ||||| |||||||| || |||||||||||||| || || |||||||
Sbjct: 717 tctcggcccagaactcaggagtgaggaagccgtaggtcttcatcagacaatcaaaggttg 658

                                                                       
Query: 323 ccttgacgaagttgccaagggtcttggtggatccacgcgaggaagtgaagacatcatcaa 382
           ||||||||||||| || || ||||||||||| ||||| || || || |||||||| ||||
Sbjct: 657 ccttgacgaagttaccgagtgtcttggtggagccacgggacgaggtaaagacatcctcaa 598

                                                                       
Query: 383 taccagcgaactggagcaccttcttggggacccgggcggcgacgattccagaacccctcg 442
           | || ||||||||||| ||||||||||| || ||||| ||||| || || || ||||| |
Sbjct: 597 tgccggcgaactggaggaccttcttgggcacgcgggcagcgacaatcccggaccccctgg 538

                                                                       
Query: 443 gggcgggcaccatacgcacggtgacagagccgcacttgccggtgaccttgcagggcacgg 502
           | || |||||||| ||||||||||| || ||||||||||||||||||||||||||||| |
Sbjct: 537 gcgccggcaccatgcgcacggtgacggacccgcacttgccggtgaccttgcagggcacag 478

                                                  
Query: 503 tgtggggcatgccgatcttgttcccccagtagcccctcc 541
           |||| |||  |||||||||||| ||||||||||||||||
Sbjct: 477 tgtgcggctggccgatcttgtttccccagtagcccctcc 439

---

>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete
               sequence
          Length = 29644043

 Score =  204 bits (103), Expect = 2e-49
 Identities = 190/219 (86%)
 Strand = Plus / Minus

                                                                           
Query: 323     ccttgacgaagttgccaagggtcttggtggatccacgcgaggaagtgaagacatcatcaa 382
               |||||||||||||||| |||||||||||||| || ||||| || |||||||| || || |
Sbjct: 5820039 ccttgacgaagttgccgagggtcttggtggagccgcgcgacgaggtgaagacgtcctcga 5819980

                                                                           
Query: 383     taccagcgaactggagcaccttcttggggacccgggcggcgacgattccagaacccctcg 442
               | || ||||||||||||||||||||||| ||  | || || ||||| || || ||||| |
Sbjct: 5819979 tgccggcgaactggagcaccttcttgggcacgtgcgccgccacgatcccggaccccctgg 5819920

                                                                           
Query: 443     gggcgggcaccatacgcacggtgacagagccgcacttgccggtgaccttgcagggcacgg 502
               | || |||||||| ||||||||||| |||||||||||||||||||||||||| |||||||
Sbjct: 5819919 gcgccggcaccatgcgcacggtgacggagccgcacttgccggtgaccttgcacggcacgg 5819860

                                                      
Query: 503     tgtggggcatgccgatcttgttcccccagtagcccctcc 541
               |||| ||| | |||||||||||||||||||| |||||||
Sbjct: 5819859 tgtgcggcttcccgatcttgttcccccagtaccccctcc 5819821



 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 91/109 (83%)
 Strand = Plus / Minus

                                                                           
Query: 217     gccaagatgtcggtgaactcctggtacggagtcttggtgaaggtcgtctccctccagaag 276
               ||||||| ||| ||| |||||||| |||| |||||| | ||  | ||||| |||||||||
Sbjct: 5820953 gccaagaggtccgtgtactcctggaacggcgtcttgataaacctggtctctctccagaag 5820894

                                                                
Query: 277     tcaggggtgaggaatccataggtcttcatcaggcagtcgaaggttgcct 325
               ||||| || ||||| |||||||||||||| || || |||||||| ||||
Sbjct: 5820893 tcaggagtcaggaacccataggtcttcatgagacaatcgaaggtggcct 5820845



 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 75/88 (85%)
 Strand = Plus / Minus

                                                                            
Query: 323      ccttgacgaagttgccaagggtcttggtggatccacgcgaggaagtgaagacatcatcaa 382
                |||||||||||||||  |||||||||||||| ||||| || || |||||||| || || |
Sbjct: 13387865 ccttgacgaagttgctgagggtcttggtggagccacgtgacgaggtgaagacgtcctcga 13387806

                                            
Query: 383      taccagcgaactggagcaccttcttggg 410
                | || |||||||  ||||||||||||||
Sbjct: 13387805 tgccggcgaacttaagcaccttcttggg 13387778



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 39/45 (86%)
 Strand = Plus / Minus

                                                             
Query: 466      acagagccgcacttgccggtgaccttgcagggcacggtgtggggc 510
                ||||||||| ||||| |||  |||||||| | |||||||||||||
Sbjct: 13387722 acagagccgtacttgtcggcaaccttgcacgacacggtgtggggc 13387678

---

>dbj|AP003943.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC
              clone:OJ1119_B04
          Length = 151721

 Score =  204 bits (103), Expect = 2e-49
 Identities = 190/219 (86%)
 Strand = Plus / Minus

                                                                          
Query: 323    ccttgacgaagttgccaagggtcttggtggatccacgcgaggaagtgaagacatcatcaa 382
              |||||||||||||||| |||||||||||||| || ||||| || |||||||| || || |
Sbjct: 127067 ccttgacgaagttgccgagggtcttggtggagccgcgcgacgaggtgaagacgtcctcga 127008

                                                                          
Query: 383    taccagcgaactggagcaccttcttggggacccgggcggcgacgattccagaacccctcg 442
              | || ||||||||||||||||||||||| ||  | || || ||||| || || ||||| |
Sbjct: 127007 tgccggcgaactggagcaccttcttgggcacgtgcgccgccacgatcccggaccccctgg 126948

                                                                          
Query: 443    gggcgggcaccatacgcacggtgacagagccgcacttgccggtgaccttgcagggcacgg 502
              | || |||||||| ||||||||||| |||||||||||||||||||||||||| |||||||
Sbjct: 126947 gcgccggcaccatgcgcacggtgacggagccgcacttgccggtgaccttgcacggcacgg 126888

                                                     
Query: 503    tgtggggcatgccgatcttgttcccccagtagcccctcc 541
              |||| ||| | |||||||||||||||||||| |||||||
Sbjct: 126887 tgtgcggcttcccgatcttgttcccccagtaccccctcc 126849



 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 91/109 (83%)
 Strand = Plus / Minus

                                                                          
Query: 217    gccaagatgtcggtgaactcctggtacggagtcttggtgaaggtcgtctccctccagaag 276
              ||||||| ||| ||| |||||||| |||| |||||| | ||  | ||||| |||||||||
Sbjct: 127981 gccaagaggtccgtgtactcctggaacggcgtcttgataaacctggtctctctccagaag 127922

                                                               
Query: 277    tcaggggtgaggaatccataggtcttcatcaggcagtcgaaggttgcct 325
              ||||| || ||||| |||||||||||||| || || |||||||| ||||
Sbjct: 127921 tcaggagtcaggaacccataggtcttcatgagacaatcgaaggtggcct 127873

---

>dbj|AP004911.1| Lotus japonicus genomic DNA, chromosome 4, clone:LjT13O11, TM0069,
             complete sequence
          Length = 103659

 Score =  149 bits (75), Expect = 1e-32
 Identities = 183/219 (83%)
 Strand = Plus / Plus

                                                                         
Query: 323   ccttgacgaagttgccaagggtcttggtggatccacgcgaggaagtgaagacatcatcaa 382
             |||||||||| || |||||||| |||||||| || |  ||||||||||| ||||||||||
Sbjct: 75702 ccttgacgaaatttccaagggttttggtggaacccctggaggaagtgaaaacatcatcaa 75761

                                                                         
Query: 383   taccagcgaactggagcaccttcttggggacccgggcggcgacgattccagaacccctcg 442
             | ||||||||||| |  ||||||||||| ||||  || || |||||||||||||| |  |
Sbjct: 75762 tcccagcgaactgcaagaccttcttgggaaccctagcagcaacgattccagaaccacgag 75821

                                                                         
Query: 443   gggcgggcaccatacgcacggtgacagagccgcacttgccggtgaccttgcagggcacgg 502
             | || || ||||| || || ||||| || || ||||| ||||| ||||||||||| ||||
Sbjct: 75822 gagcagggaccatgcggacagtgacggaaccacactttccggtaaccttgcagggaacgg 75881

                                                    
Query: 503   tgtggggcatgccgatcttgttcccccagtagcccctcc 541
             |||||||| | ||||||||||| |||||||| |||||||
Sbjct: 75882 tgtggggctttccgatcttgttaccccagtatcccctcc 75920

---

>dbj|AP006685.1| Lotus japonicus genomic DNA, chromosome 1, clone:LjT45M12, TM0378b,
             complete sequence
          Length = 86433

 Score =  127 bits (64), Expect = 4e-26
 Identities = 226/280 (80%)
 Strand = Plus / Minus

                                                                         
Query: 262   gtctccctccagaagtcaggggtgaggaatccataggtcttcatcaggcagtcgaaggtt 321
             |||||| ||||||| ||||| || ||||| |  ||||| |||| ||  ||||| || |||
Sbjct: 17933 gtctccttccagaattcaggtgtcaggaaactgtaggttttcagcaaacagtcaaaagtt 17874

                                                                         
Query: 322   gccttgacgaagttgccaagggtcttggtggatccacgcgaggaagtgaagacatcatca 381
             ||||||||||| ||||| || |||||||||||||| |  || ||||||||||||||||||
Sbjct: 17873 gccttgacgaaattgccgagtgtcttggtggatcctctggaagaagtgaagacatcatca 17814

                                                                         
Query: 382   ataccagcgaactggagcaccttcttggggacccgggcggcgacgattccagaacccctc 441
             || ||||||||||| | ||||||||| || ||||  || || |||||||| ||||| |  
Sbjct: 17813 atcccagcgaactgcaacaccttctttggaaccctagcagccacgattcccgaaccacga 17754

                                                                         
Query: 442   ggggcgggcaccatacgcacggtgacagagccgcacttgccggtgaccttgcagggcacg 501
             || || || ||||| |  || || || || || ||||| || || |||||||| || || 
Sbjct: 17753 ggcgctggaaccattctgacagttacggaaccacacttccctgtcaccttgcacggaaca 17694

                                                     
Query: 502   gtgtggggcatgccgatcttgttcccccagtagcccctcc 541
             ||||||||| | || ||||||||||||||||| |||||||
Sbjct: 17693 gtgtggggcttcccaatcttgttcccccagtaccccctcc 17654

---

>gb|AC093196.2| Drosophila melanogaster clone BACR22H06, complete sequence
          Length = 173008

 Score =  119 bits (60), Expect = 1e-23
 Identities = 75/80 (93%)
 Strand = Plus / Plus

                                                                          
Query: 457    cgcacggtgacagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccg 516
              ||||||| ||| || ||||||||||||||||||||||||||||||||||||||| |||||
Sbjct: 112651 cgcacggagacggaaccgcacttgccggtgaccttgcagggcacggtgtggggcttgccg 112710

                                  
Query: 517    atcttgttcccccagtagcc 536
              |||||||| |||||||||||
Sbjct: 112711 atcttgttgccccagtagcc 112730

---

>gb|AC009744.8| Drosophila melanogaster clone BACR06G16, complete sequence
          Length = 179038

 Score =  119 bits (60), Expect = 1e-23
 Identities = 75/80 (93%)
 Strand = Plus / Plus

                                                                        
Query: 457  cgcacggtgacagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccg 516
            ||||||| ||| || ||||||||||||||||||||||||||||||||||||||| |||||
Sbjct: 5510 cgcacggagacggaaccgcacttgccggtgaccttgcagggcacggtgtggggcttgccg 5569

                                
Query: 517  atcttgttcccccagtagcc 536
            |||||||| |||||||||||
Sbjct: 5570 atcttgttgccccagtagcc 5589

---

>gb|AY231813.1| Drosophila yakuba clone yak-em_sop mRNA sequence
          Length = 801

 Score =  119 bits (60), Expect = 1e-23
 Identities = 75/80 (93%)
 Strand = Plus / Minus

                                                                       
Query: 457 cgcacggtgacagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccg 516
           ||||||| ||| || ||||||||||||||||||||||||||||||||||||||| |||||
Sbjct: 530 cgcacggagacggatccgcacttgccggtgaccttgcagggcacggtgtggggcttgccg 471

                               
Query: 517 atcttgttcccccagtagcc 536
           |||||||| |||||||||||
Sbjct: 470 atcttgtttccccagtagcc 451

---

>emb|X69120.1|DMRPS2 D.melanogaster mRNA for ribosomal protein S2
          Length = 916

 Score =  119 bits (60), Expect = 1e-23
 Identities = 75/80 (93%)
 Strand = Plus / Minus

                                                                       
Query: 457 cgcacggtgacagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccg 516
           ||||||| ||| || ||||||||||||||||||||||||||||||||||||||| |||||
Sbjct: 548 cgcacggagacggaaccgcacttgccggtgaccttgcagggcacggtgtggggcttgccg 489

                               
Query: 517 atcttgttcccccagtagcc 536
           |||||||| |||||||||||
Sbjct: 488 atcttgttgccccagtagcc 469

---

>gb|AY094799.1| Drosophila melanogaster LD24077 full insert cDNA
          Length = 915

 Score =  119 bits (60), Expect = 1e-23
 Identities = 75/80 (93%)
 Strand = Plus / Minus

                                                                       
Query: 457 cgcacggtgacagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccg 516
           ||||||| ||| || ||||||||||||||||||||||||||||||||||||||| |||||
Sbjct: 560 cgcacggagacggaaccgcacttgccggtgaccttgcagggcacggtgtggggcttgccg 501

                               
Query: 517 atcttgttcccccagtagcc 536
           |||||||| |||||||||||
Sbjct: 500 atcttgttgccccagtagcc 481

---

>ref|NM_057526.3| Drosophila melanogaster string of pearls CG5920-RA (sop), mRNA
          Length = 939

 Score =  119 bits (60), Expect = 1e-23
 Identities = 75/80 (93%)
 Strand = Plus / Minus

                                                                       
Query: 457 cgcacggtgacagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccg 516
           ||||||| ||| || ||||||||||||||||||||||||||||||||||||||| |||||
Sbjct: 601 cgcacggagacggaaccgcacttgccggtgaccttgcagggcacggtgtggggcttgccg 542

                               
Query: 517 atcttgttcccccagtagcc 536
           |||||||| |||||||||||
Sbjct: 541 atcttgttgccccagtagcc 522

---

>gb|AE003626.4| Drosophila melanogaster chromosome 2L, section 35 of 83 of the complete
              sequence
          Length = 264919

 Score =  119 bits (60), Expect = 1e-23
 Identities = 75/80 (93%)
 Strand = Plus / Plus

                                                                          
Query: 457    cgcacggtgacagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccg 516
              ||||||| ||| || ||||||||||||||||||||||||||||||||||||||| |||||
Sbjct: 187740 cgcacggagacggaaccgcacttgccggtgaccttgcagggcacggtgtggggcttgccg 187799

                                  
Query: 517    atcttgttcccccagtagcc 536
              |||||||| |||||||||||
Sbjct: 187800 atcttgttgccccagtagcc 187819

---

>gb|U01334.1|DMU01334 Drosophila melanogaster ribosomal protein S2 (sop) mRNA, complete
           cds
          Length = 905

 Score =  119 bits (60), Expect = 1e-23
 Identities = 75/80 (93%)
 Strand = Plus / Minus

                                                                       
Query: 457 cgcacggtgacagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccg 516
           ||||||| ||| || ||||||||||||||||||||||||||||||||||||||| |||||
Sbjct: 566 cgcacggagacggaaccgcacttgccggtgaccttgcagggcacggtgtggggcttgccg 507

                               
Query: 517 atcttgttcccccagtagcc 536
           |||||||| |||||||||||
Sbjct: 506 atcttgttgccccagtagcc 487

---

>gb|AC005135.1|AC005135 Drosophila melanogaster DNA sequence (P1 DS07070 (D331)), complete
             sequence
          Length = 67297

 Score =  119 bits (60), Expect = 1e-23
 Identities = 75/80 (93%)
 Strand = Plus / Plus

                                                                         
Query: 457   cgcacggtgacagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccg 516
             ||||||| ||| || ||||||||||||||||||||||||||||||||||||||| |||||
Sbjct: 39286 cgcacggagacggaaccgcacttgccggtgaccttgcagggcacggtgtggggcttgccg 39345

                                 
Query: 517   atcttgttcccccagtagcc 536
             |||||||| |||||||||||
Sbjct: 39346 atcttgttgccccagtagcc 39365

---

>gb|U01335.1|DMU01335 Drosophila melanogaster ribosomal protein S2 (sop) gene, complete cds
          Length = 1358

 Score =  119 bits (60), Expect = 1e-23
 Identities = 75/80 (93%)
 Strand = Plus / Minus

                                                                        
Query: 457  cgcacggtgacagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccg 516
            ||||||| ||| || ||||||||||||||||||||||||||||||||||||||| |||||
Sbjct: 1019 cgcacggagacggaaccgcacttgccggtgaccttgcagggcacggtgtggggcttgccg 960

                                
Query: 517  atcttgttcccccagtagcc 536
            |||||||| |||||||||||
Sbjct: 959  atcttgttgccccagtagcc 940

---

>emb|AJ132531.1|PAB132531 Picea abies mRNA for 40S ribosomal protein S2
          Length = 1090

 Score =  111 bits (56), Expect = 2e-21
 Identities = 224/280 (80%)
 Strand = Plus / Minus

                                                                       
Query: 262 gtctccctccagaagtcaggggtgaggaatccataggtcttcatcaggcagtcgaaggtt 321
           ||||||||||| || ||||| || |  |||||||| ||||| |  || || || || |||
Sbjct: 779 gtctccctccacaaatcaggtgttaaaaatccataagtctttaatagacactcaaaagtt 720

                                                                       
Query: 322 gccttgacgaagttgccaagggtcttggtggatccacgcgaggaagtgaagacatcatca 381
           |||||||| || || ||||| |||||||| || || |||||||| ||||||||||| || 
Sbjct: 719 gccttgacaaaatttccaagagtcttggtcgaccctcgcgaggaggtgaagacatcttcg 660

                                                                       
Query: 382 ataccagcgaactggagcaccttcttggggacccgggcggcgacgattccagaacccctc 441
           || ||||| ||||| || ||||||||||| || || || || ||||| |||| ||| || 
Sbjct: 659 atcccagcaaactgcagaaccttcttgggcactcgagcagccacgatcccagcacctctg 600

                                                                       
Query: 442 ggggcgggcaccatacgcacggtgacagagccgcacttgccggtgaccttgcagggcacg 501
           |||||||||||||| |  || || |||||||| || || || |||||||||   || |||
Sbjct: 599 ggggcgggcaccattctgaccgttacagagccacatttcccagtgaccttgacaggaacg 540

                                                   
Query: 502 gtgtggggcatgccgatcttgttcccccagtagcccctcc 541
           || |||||  | ||||||||||| |||||||| |||||||
Sbjct: 539 gtatggggtttaccgatcttgttaccccagtaacccctcc 500

---

>ref|NM_129748.2| Arabidopsis thaliana structural constituent of ribosome AT2G41840
           mRNA, complete cds
          Length = 1214

 Score =  107 bits (54), Expect = 4e-20
 Identities = 123/146 (84%)
 Strand = Plus / Minus

                                                                       
Query: 262 gtctccctccagaagtcaggggtgaggaatccataggtcttcatcaggcagtcgaaggtt 321
           |||||| ||||||| || ||||| |||||||| || ||||||   ||||| ||||| || 
Sbjct: 899 gtctccttccagaactctggggtaaggaatccgtaagtcttctgaaggcaatcgaatgta 840

                                                                       
Query: 322 gccttgacgaagttgccaagggtcttggtggatccacgcgaggaagtgaagacatcatca 381
           |||||||||||||| ||||| || ||||||||||| |  ||||||||||| |||||||||
Sbjct: 839 gccttgacgaagtttccaagagttttggtggatcccctggaggaagtgaaaacatcatca 780

                                     
Query: 382 ataccagcgaactggagcaccttctt 407
           || |||||||| || || ||||||||
Sbjct: 779 attccagcgaattgaagaaccttctt 754

---

>gb|AY133561.1| Arabidopsis thaliana At2g41840/T11A7.6 mRNA, complete cds
          Length = 858

 Score =  107 bits (54), Expect = 4e-20
 Identities = 123/146 (84%)
 Strand = Plus / Minus

                                                                       
Query: 262 gtctccctccagaagtcaggggtgaggaatccataggtcttcatcaggcagtcgaaggtt 321
           |||||| ||||||| || ||||| |||||||| || ||||||   ||||| ||||| || 
Sbjct: 758 gtctccttccagaactctggggtaaggaatccgtaagtcttctgaaggcaatcgaatgta 699

                                                                       
Query: 322 gccttgacgaagttgccaagggtcttggtggatccacgcgaggaagtgaagacatcatca 381
           |||||||||||||| ||||| || ||||||||||| |  ||||||||||| |||||||||
Sbjct: 698 gccttgacgaagtttccaagagttttggtggatcccctggaggaagtgaaaacatcatca 639

                                     
Query: 382 ataccagcgaactggagcaccttctt 407
           || |||||||| || || ||||||||
Sbjct: 638 attccagcgaattgaagaaccttctt 613

---

>gb|AY048250.1| Arabidopsis thaliana At2g41840/T11A7.6 mRNA, complete cds
          Length = 1079

 Score =  107 bits (54), Expect = 4e-20
 Identities = 123/146 (84%)
 Strand = Plus / Minus

                                                                       
Query: 262 gtctccctccagaagtcaggggtgaggaatccataggtcttcatcaggcagtcgaaggtt 321
           |||||| ||||||| || ||||| |||||||| || ||||||   ||||| ||||| || 
Sbjct: 822 gtctccttccagaactctggggtaaggaatccgtaagtcttctgaaggcaatcgaatgta 763

                                                                       
Query: 322 gccttgacgaagttgccaagggtcttggtggatccacgcgaggaagtgaagacatcatca 381
           |||||||||||||| ||||| || ||||||||||| |  ||||||||||| |||||||||
Sbjct: 762 gccttgacgaagtttccaagagttttggtggatcccctggaggaagtgaaaacatcatca 703

                                     
Query: 382 ataccagcgaactggagcaccttctt 407
           || |||||||| || || ||||||||
Sbjct: 702 attccagcgaattgaagaaccttctt 677

---

>gb|AY085726.1| Arabidopsis thaliana clone 17415 mRNA, complete sequence
          Length = 1190

 Score =  107 bits (54), Expect = 4e-20
 Identities = 123/146 (84%)
 Strand = Plus / Minus

                                                                       
Query: 262 gtctccctccagaagtcaggggtgaggaatccataggtcttcatcaggcagtcgaaggtt 321
           |||||| ||||||| || ||||| |||||||| || ||||||   ||||| ||||| || 
Sbjct: 899 gtctccttccagaactctggggtaaggaatccgtaagtcttctgaaggcaatcgaatgta 840

                                                                       
Query: 322 gccttgacgaagttgccaagggtcttggtggatccacgcgaggaagtgaagacatcatca 381
           |||||||||||||| ||||| || ||||||||||| |  ||||||||||| |||||||||
Sbjct: 839 gccttgacgaagtttccaagagttttggtggatcccctggaggaagtgaaaacatcatca 780

                                     
Query: 382 ataccagcgaactggagcaccttctt 407
           || |||||||| || || ||||||||
Sbjct: 779 attccagcgaattgaagaaccttctt 754

---

>emb|BX814292.1|CNS0ABYL Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB66ZF02 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 1056

 Score = 99.6 bits (50), Expect = 9e-18
 Identities = 176/218 (80%)
 Strand = Plus / Minus

                                                                       
Query: 313 tcgaaggttgccttgacgaagttgccaagggtcttggtggatccacgcgaggaagtgaag 372
           ||||| || |||||||| ||||| |||||||| ||||| ||||| |  || ||||| |||
Sbjct: 702 tcgaatgtagccttgacaaagtttccaagggttttggtagatcctcttgaagaagtaaag 643

                                                                       
Query: 373 acatcatcaataccagcgaactggagcaccttcttggggacccgggcggcgacgattcca 432
           ||||||||||||||||||||||| || |||||||| || ||||  || || || || |||
Sbjct: 642 acatcatcaataccagcgaactgaagaaccttcttaggaaccctagcagcaacaatacca 583

                                                                       
Query: 433 gaacccctcggggcgggcaccatacgcacggtgacagagccgcacttgccggtgaccttg 492
           ||||| |||||||| || ||||| | ||| || ||||| || || || || || ||||| 
Sbjct: 582 gaacctctcggggcaggaaccattctcacagtaacagaaccacatttaccagtaacctta 523

                                                 
Query: 493 cagggcacggtgtggggcatgccgatcttgttccccca 530
           || ||||| ||||| ||| | || ||||| ||||||||
Sbjct: 522 caaggcacagtgtgtggcttcccaatcttattccccca 485

---

>ref|NM_104618.2| Arabidopsis thaliana XW6; structural constituent of ribosome
           AT1G58380 (XW6) mRNA, complete cds
          Length = 1109

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 181/225 (80%)
 Strand = Plus / Minus

                                                                       
Query: 309 gcagtcgaaggttgccttgacgaagttgccaagggtcttggtggatccacgcgaggaagt 368
           |||||| || || |||||||| ||||| ||||| || || || ||||| |  || |||||
Sbjct: 791 gcagtcaaacgtcgccttgacaaagtttccaagagttttagtagatcctctggaagaagt 732

                                                                       
Query: 369 gaagacatcatcaataccagcgaactggagcaccttcttggggacccgggcggcgacgat 428
            |||||||||||||||||||||||||| || |||||||| || ||||  || || || ||
Sbjct: 731 aaagacatcatcaataccagcgaactgaagaaccttcttaggaaccctagcagcaacaat 672

                                                                       
Query: 429 tccagaacccctcggggcgggcaccatacgcacggtgacagagccgcacttgccggtgac 488
            |||||||| ||||| || || ||||| | ||| || |||||||| ||||| || || ||
Sbjct: 671 accagaacctctcggagcaggaaccattctcacagtaacagagccacacttcccagtaac 612

                                                        
Query: 489 cttgcagggcacggtgtggggcatgccgatcttgttcccccagta 533
           ||| || ||||| ||||| ||| | || ||||| |||||||||||
Sbjct: 611 cttacaaggcacagtgtgtggcttcccaatcttattcccccagta 567

---

>gb|AY072528.1| Arabidopsis thaliana ribosomal protein S2, putative (At1g58380;
           F9K23.9) mRNA, complete cds
          Length = 971

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 181/225 (80%)
 Strand = Plus / Minus

                                                                       
Query: 309 gcagtcgaaggttgccttgacgaagttgccaagggtcttggtggatccacgcgaggaagt 368
           |||||| || || |||||||| ||||| ||||| || || || ||||| |  || |||||
Sbjct: 708 gcagtcaaacgtcgccttgacaaagtttccaagagttttagtagatcctctggaagaagt 649

                                                                       
Query: 369 gaagacatcatcaataccagcgaactggagcaccttcttggggacccgggcggcgacgat 428
            |||||||||||||||||||||||||| || |||||||| || ||||  || || || ||
Sbjct: 648 aaagacatcatcaataccagcgaactgaagaaccttcttaggaaccctagcagcaacaat 589

                                                                       
Query: 429 tccagaacccctcggggcgggcaccatacgcacggtgacagagccgcacttgccggtgac 488
            |||||||| ||||| || || ||||| | ||| || |||||||| ||||| || || ||
Sbjct: 588 accagaacctctcggagcaggaaccattctcacagtaacagagccacactttccagtaac 529

                                                        
Query: 489 cttgcagggcacggtgtggggcatgccgatcttgttcccccagta 533
           ||| || ||||| ||||| ||| | || ||||| |||||||||||
Sbjct: 528 cttacaaggcacagtgtgtggcttcccaatcttattcccccagta 484

---

>gb|AF386958.1|AF386958 Arabidopsis thaliana ribosomal protein S2, putative (F9K23.9) mRNA,
           complete cds
          Length = 1071

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 181/225 (80%)
 Strand = Plus / Minus

                                                                       
Query: 309 gcagtcgaaggttgccttgacgaagttgccaagggtcttggtggatccacgcgaggaagt 368
           |||||| || || |||||||| ||||| ||||| || || || ||||| |  || |||||
Sbjct: 759 gcagtcaaacgtcgccttgacaaagtttccaagagttttagtagatcctctggaagaagt 700

                                                                       
Query: 369 gaagacatcatcaataccagcgaactggagcaccttcttggggacccgggcggcgacgat 428
            |||||||||||||||||||||||||| || |||||||| || ||||  || || || ||
Sbjct: 699 aaagacatcatcaataccagcgaactgaagaaccttcttaggaaccctagcagcaacaat 640

                                                                       
Query: 429 tccagaacccctcggggcgggcaccatacgcacggtgacagagccgcacttgccggtgac 488
            |||||||| ||||| || || ||||| | ||| || |||||||| ||||| || || ||
Sbjct: 639 accagaacctctcggagcaggaaccattctcacagtaacagagccacacttcccagtaac 580

                                                        
Query: 489 cttgcagggcacggtgtggggcatgccgatcttgttcccccagta 533
           ||| || ||||| ||||| ||| | || ||||| |||||||||||
Sbjct: 579 cttacaaggcacagtgtgtggcttcccaatcttattcccccagta 535

---

>dbj|AB008016.1| Arabidopsis thaliana XW6 mRNA, complete cds
          Length = 1075

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 181/225 (80%)
 Strand = Plus / Minus

                                                                       
Query: 309 gcagtcgaaggttgccttgacgaagttgccaagggtcttggtggatccacgcgaggaagt 368
           |||||| || || |||||||| ||||| ||||| || || || ||||| |  || |||||
Sbjct: 758 gcagtcaaacgtcgccttgacaaagtttccaagagttttagtagatcctctggaagaagt 699

                                                                       
Query: 369 gaagacatcatcaataccagcgaactggagcaccttcttggggacccgggcggcgacgat 428
            |||||||||||||||||||||||||| || |||||||| || ||||  || || || ||
Sbjct: 698 aaagacatcatcaataccagcgaactgaagaaccttcttaggaaccctagcagcaacaat 639

                                                                       
Query: 429 tccagaacccctcggggcgggcaccatacgcacggtgacagagccgcacttgccggtgac 488
            |||||||| ||||| || || ||||| | ||| || |||||||| ||||| || || ||
Sbjct: 638 accagaacctctcggagcaggaaccattctcacagtaacagagccacacttcccagtaac 579

                                                        
Query: 489 cttgcagggcacggtgtggggcatgccgatcttgttcccccagta 533
           ||| || ||||| ||||| ||| | || ||||| |||||||||||
Sbjct: 578 cttacaaggcacagtgtgtggcttcccaatcttattcccccagta 534

---

>gb|AC082643.6|AC082643 Arabidopsis thaliana chromosome 1 BAC F9K23 genomic sequence, complete
             sequence
          Length = 48891

 Score = 93.7 bits (47), Expect = 6e-16
 Identities = 170/211 (80%)
 Strand = Plus / Plus

                                                                         
Query: 323   ccttgacgaagttgccaagggtcttggtggatccacgcgaggaagtgaagacatcatcaa 382
             ||||||| ||||| ||||| || || || ||||| |  || ||||| |||||||||||||
Sbjct: 42960 ccttgacaaagtttccaagagttttagtagatcctctggaagaagtaaagacatcatcaa 43019

                                                                         
Query: 383   taccagcgaactggagcaccttcttggggacccgggcggcgacgattccagaacccctcg 442
             ||||||||||||| || |||||||| || ||||  || || || || |||||||| ||||
Sbjct: 43020 taccagcgaactgaagaaccttcttaggaaccctagcagcaacaataccagaacctctcg 43079

                                                                         
Query: 443   gggcgggcaccatacgcacggtgacagagccgcacttgccggtgaccttgcagggcacgg 502
             | || || ||||| | ||| || |||||||| ||||| || || ||||| || ||||| |
Sbjct: 43080 gagcaggaaccattctcacagtaacagagccacacttcccagtaaccttacaaggcacag 43139

                                            
Query: 503   tgtggggcatgccgatcttgttcccccagta 533
             |||| ||| | || ||||| |||||||||||
Sbjct: 43140 tgtgtggcttcccaatcttattcccccagta 43170

---

>gb|AC008051.3|F19C14 Sequence of BAC F19C14 from Arabidopsis thaliana chromosome 1,
           complete sequence
          Length = 86014

 Score = 93.7 bits (47), Expect = 6e-16
 Identities = 170/211 (80%)
 Strand = Plus / Plus

                                                                       
Query: 323 ccttgacgaagttgccaagggtcttggtggatccacgcgaggaagtgaagacatcatcaa 382
           ||||||| ||||| ||||| || || || ||||| |  || ||||| |||||||||||||
Sbjct: 66  ccttgacaaagtttccaagagttttagtagatcctctggaagaagtaaagacatcatcaa 125

                                                                       
Query: 383 taccagcgaactggagcaccttcttggggacccgggcggcgacgattccagaacccctcg 442
           ||||||||||||| || |||||||| || ||||  || || || || |||||||| ||||
Sbjct: 126 taccagcgaactgaagaaccttcttaggaaccctagcagcaacaataccagaacctctcg 185

                                                                       
Query: 443 gggcgggcaccatacgcacggtgacagagccgcacttgccggtgaccttgcagggcacgg 502
           | || || ||||| | ||| || |||||||| ||||| || || ||||| || ||||| |
Sbjct: 186 gagcaggaaccattctcacagtaacagagccacacttcccagtaaccttacaaggcacag 245

                                          
Query: 503 tgtggggcatgccgatcttgttcccccagta 533
           |||| ||| | || ||||| |||||||||||
Sbjct: 246 tgtgtggcttcccaatcttattcccccagta 276

---

>dbj|AB077822.1| Arabidopsis thaliana genomic DNA, chromosome 1, P1 clone:X7J, complete
             sequence
          Length = 77636

 Score = 93.7 bits (47), Expect = 6e-16
 Identities = 170/211 (80%)
 Strand = Plus / Minus

                                                                         
Query: 323   ccttgacgaagttgccaagggtcttggtggatccacgcgaggaagtgaagacatcatcaa 382
             ||||||| ||||| ||||| || || || ||||| |  || ||||| |||||||||||||
Sbjct: 18364 ccttgacaaagtttccaagagttttagtagatcctctggaagaagtaaagacatcatcaa 18305

                                                                         
Query: 383   taccagcgaactggagcaccttcttggggacccgggcggcgacgattccagaacccctcg 442
             ||||||||||||| || |||||||| || ||||  || || || || |||||||| ||||
Sbjct: 18304 taccagcgaactgaagaaccttcttaggaaccctagcagcaacaataccagaacctctcg 18245

                                                                         
Query: 443   gggcgggcaccatacgcacggtgacagagccgcacttgccggtgaccttgcagggcacgg 502
             | || || ||||| | ||| || |||||||| ||||| || || ||||| || ||||| |
Sbjct: 18244 gagcaggaaccattctcacagtaacagagccacacttcccagtaaccttacaaggcacag 18185

                                            
Query: 503   tgtggggcatgccgatcttgttcccccagta 533
             |||| ||| | || ||||| |||||||||||
Sbjct: 18184 tgtgtggcttcccaatcttattcccccagta 18154

---

>ref|NM_148602.2| Arabidopsis thaliana structural constituent of ribosome AT1G58684
           mRNA, complete cds
          Length = 1004

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 175/218 (80%)
 Strand = Plus / Minus

                                                                       
Query: 313 tcgaaggttgccttgacgaagttgccaagggtcttggtggatccacgcgaggaagtgaag 372
           ||||| || |||||||| ||||| |||||||| ||||| ||||| |  || ||||| |||
Sbjct: 704 tcgaatgtagccttgacaaagtttccaagggttttggtagatcctcttgaagaagtaaag 645

                                                                       
Query: 373 acatcatcaataccagcgaactggagcaccttcttggggacccgggcggcgacgattcca 432
           ||||||||||||||||||||||| || |||||||| || ||||  || || || || |||
Sbjct: 644 acatcatcaataccagcgaactgaagaaccttcttaggaaccctagcagcaacaatacca 585

                                                                       
Query: 433 gaacccctcggggcgggcaccatacgcacggtgacagagccgcacttgccggtgaccttg 492
           ||||| ||||| || || ||||| | ||| || ||||| || || || || || ||||| 
Sbjct: 584 gaacctctcggagcaggaaccattctcacagtaacagaaccacatttaccagtaacctta 525

                                                 
Query: 493 cagggcacggtgtggggcatgccgatcttgttccccca 530
           || ||||| ||||| ||| | || ||||| ||||||||
Sbjct: 524 caaggcacagtgtgtggcttcccaatcttattccccca 487

---

>ref|NM_104632.3| Arabidopsis thaliana structural constituent of ribosome AT1G58983
           mRNA, complete cds
          Length = 1126

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 175/218 (80%)
 Strand = Plus / Minus

                                                                       
Query: 313 tcgaaggttgccttgacgaagttgccaagggtcttggtggatccacgcgaggaagtgaag 372
           ||||| || |||||||| ||||| |||||||| ||||| ||||| |  || ||||| |||
Sbjct: 716 tcgaatgtagccttgacaaagtttccaagggttttggtagatcctcttgaagaagtaaag 657

                                                                       
Query: 373 acatcatcaataccagcgaactggagcaccttcttggggacccgggcggcgacgattcca 432
           ||||||||||||||||||||||| || |||||||| || ||||  || || || || |||
Sbjct: 656 acatcatcaataccagcgaactgaagaaccttcttaggaaccctagcagcaacaatacca 597

                                                                       
Query: 433 gaacccctcggggcgggcaccatacgcacggtgacagagccgcacttgccggtgaccttg 492
           ||||| ||||| || || ||||| | ||| || ||||| || || || || || ||||| 
Sbjct: 596 gaacctctcggagcaggaaccattctcacagtaacagaaccacatttaccagtaacctta 537

                                                 
Query: 493 cagggcacggtgtggggcatgccgatcttgttccccca 530
           || ||||| ||||| ||| | || ||||| ||||||||
Sbjct: 536 caaggcacagtgtgtggcttcccaatcttattccccca 499

---

>ref|NM_104640.3| Arabidopsis thaliana structural constituent of ribosome AT1G59359
           mRNA, complete cds
          Length = 1004

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 175/218 (80%)
 Strand = Plus / Minus

                                                                       
Query: 313 tcgaaggttgccttgacgaagttgccaagggtcttggtggatccacgcgaggaagtgaag 372
           ||||| || |||||||| ||||| |||||||| ||||| ||||| |  || ||||| |||
Sbjct: 704 tcgaatgtagccttgacaaagtttccaagggttttggtagatcctcttgaagaagtaaag 645

                                                                       
Query: 373 acatcatcaataccagcgaactggagcaccttcttggggacccgggcggcgacgattcca 432
           ||||||||||||||||||||||| || |||||||| || ||||  || || || || |||
Sbjct: 644 acatcatcaataccagcgaactgaagaaccttcttaggaaccctagcagcaacaatacca 585

                                                                       
Query: 433 gaacccctcggggcgggcaccatacgcacggtgacagagccgcacttgccggtgaccttg 492
           ||||| ||||| || || ||||| | ||| || ||||| || || || || || ||||| 
Sbjct: 584 gaacctctcggagcaggaaccattctcacagtaacagaaccacatttaccagtaacctta 525

                                                 
Query: 493 cagggcacggtgtggggcatgccgatcttgttccccca 530
           || ||||| ||||| ||| | || ||||| ||||||||
Sbjct: 524 caaggcacagtgtgtggcttcccaatcttattccccca 487

---

>gb|AY486481.1| Capsicum annuum 40S ribosomal protein S2 mRNA, partial sequence
          Length = 737

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 70/78 (89%)
 Strand = Plus / Minus

                                                                       
Query: 327 gacgaagttgccaagggtcttggtggatccacgcgaggaagtgaagacatcatcaatacc 386
           |||||||||||||||||| |||||||||||||| || || ||||||||||| ||||||||
Sbjct: 737 gacgaagttgccaagggttttggtggatccacgagaagaggtgaagacatcttcaatacc 678

                             
Query: 387 agcgaactggagcacctt 404
           ||| ||||| || |||||
Sbjct: 677 agcaaactgaagaacctt 660

---

>gb|AY133659.1| Arabidopsis thaliana At1g59359/T4M14_3 mRNA, complete cds
          Length = 855

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 175/218 (80%)
 Strand = Plus / Minus

                                                                       
Query: 313 tcgaaggttgccttgacgaagttgccaagggtcttggtggatccacgcgaggaagtgaag 372
           ||||| || |||||||| ||||| |||||||| ||||| ||||| |  || ||||| |||
Sbjct: 704 tcgaatgtagccttgacaaagtttccaagggttttggtagatcctcttgaagaagtaaag 645

                                                                       
Query: 373 acatcatcaataccagcgaactggagcaccttcttggggacccgggcggcgacgattcca 432
           ||||||||||||||||||||||| || |||||||| || ||||  || || || || |||
Sbjct: 644 acatcatcaataccagcgaactgaagaaccttcttaggaaccctagcagcaacaatacca 585

                                                                       
Query: 433 gaacccctcggggcgggcaccatacgcacggtgacagagccgcacttgccggtgaccttg 492
           ||||| ||||| || || ||||| | ||| || ||||| || || || || || ||||| 
Sbjct: 584 gaacctctcggagcaggaaccattctcacagtaacagaaccacatttaccagtaacctta 525

                                                 
Query: 493 cagggcacggtgtggggcatgccgatcttgttccccca 530
           || ||||| ||||| ||| | || ||||| ||||||||
Sbjct: 524 caaggcacagtgtgtggcttcccaatcttattccccca 487

---

>gb|AY065030.1| Arabidopsis thaliana At1g59359/T4M14_3 mRNA, complete cds
          Length = 1073

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 175/218 (80%)
 Strand = Plus / Minus

                                                                       
Query: 313 tcgaaggttgccttgacgaagttgccaagggtcttggtggatccacgcgaggaagtgaag 372
           ||||| || |||||||| ||||| |||||||| ||||| ||||| |  || ||||| |||
Sbjct: 716 tcgaatgtagccttgacaaagtttccaagggttttggtagatcctcttgaagaagtaaag 657

                                                                       
Query: 373 acatcatcaataccagcgaactggagcaccttcttggggacccgggcggcgacgattcca 432
           ||||||||||||||||||||||| || |||||||| || ||||  || || || || |||
Sbjct: 656 acatcatcaataccagcgaactgaagaaccttcttaggaaccctagcagcaacaatacca 597

                                                                       
Query: 433 gaacccctcggggcgggcaccatacgcacggtgacagagccgcacttgccggtgaccttg 492
           ||||| ||||| || || ||||| | ||| || ||||| || || || || || ||||| 
Sbjct: 596 gaacctctcggagcaggaaccattctcacagtaacagaaccacatttaccagtaacctta 537

                                                 
Query: 493 cagggcacggtgtggggcatgccgatcttgttccccca 530
           || ||||| ||||| ||| | || ||||| ||||||||
Sbjct: 536 caaggcacagtgtgtggcttcccaatcttattccccca 499

---

>dbj|AK220575.1| Arabidopsis thaliana mRNA for ribosomal protein S2, complete cds,
           clone: RAFL14-92-C03
          Length = 1058

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 175/218 (80%)
 Strand = Plus / Minus

                                                                       
Query: 313 tcgaaggttgccttgacgaagttgccaagggtcttggtggatccacgcgaggaagtgaag 372
           ||||| || |||||||| ||||| |||||||| ||||| ||||| |  || ||||| |||
Sbjct: 716 tcgaatgtagccttgacaaagtttccaagggttttggtagatcctcttgaagaagtaaag 657

                                                                       
Query: 373 acatcatcaataccagcgaactggagcaccttcttggggacccgggcggcgacgattcca 432
           ||||||||||||||||||||||| || |||||||| || ||||  || || || || |||
Sbjct: 656 acatcatcaataccagcgaactgaagaaccttcttaggaaccctagcagcaacaatacca 597

                                                                       
Query: 433 gaacccctcggggcgggcaccatacgcacggtgacagagccgcacttgccggtgaccttg 492
           ||||| ||||| || || ||||| | ||| || ||||| || || || || || ||||| 
Sbjct: 596 gaacctctcggagcaggaaccattctcacagtaacagaaccacatttaccagtaacctta 537

                                                 
Query: 493 cagggcacggtgtggggcatgccgatcttgttccccca 530
           || ||||| ||||| ||| | || ||||| ||||||||
Sbjct: 536 caaggcacagtgtgtggcttcccaatcttattccccca 499

---

>emb|BX815169.1|CNS0ABBY Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS3ZB03 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 989

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 175/218 (80%)
 Strand = Plus / Minus

                                                                       
Query: 313 tcgaaggttgccttgacgaagttgccaagggtcttggtggatccacgcgaggaagtgaag 372
           ||||| || |||||||| ||||| |||||||| ||||| ||||| |  || ||||| |||
Sbjct: 698 tcgaatgtagccttgacaaagtttccaagggttttggtagatcctcttgaagaagtaaag 639

                                                                       
Query: 373 acatcatcaataccagcgaactggagcaccttcttggggacccgggcggcgacgattcca 432
           ||||||||||||||||||||||| || |||||||| || ||||  || || || || |||
Sbjct: 638 acatcatcaataccagcgaactgaagaaccttcttaggaaccctagcagcaacaatacca 579

                                                                       
Query: 433 gaacccctcggggcgggcaccatacgcacggtgacagagccgcacttgccggtgaccttg 492
           ||||| ||||| || || ||||| | ||| || ||||| || || || || || ||||| 
Sbjct: 578 gaacctctcggagcaggaaccattctcacagtaacagaaccacatttaccagtaacctta 519

                                                 
Query: 493 cagggcacggtgtggggcatgccgatcttgttccccca 530
           || ||||| ||||| ||| | || ||||| ||||||||
Sbjct: 518 caaggcacagtgtgtggcttcccaatcttattccccca 481

---

>emb|BX817373.1|CNS0AAYC Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL19ZC05 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 1002

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 175/218 (80%)
 Strand = Plus / Minus

                                                                       
Query: 313 tcgaaggttgccttgacgaagttgccaagggtcttggtggatccacgcgaggaagtgaag 372
           ||||| || |||||||| ||||| |||||||| ||||| ||||| |  || ||||| |||
Sbjct: 698 tcgaatgtagccttgacaaagtttccaagggttttggtagatcctcttgaagaagtaaag 639

                                                                       
Query: 373 acatcatcaataccagcgaactggagcaccttcttggggacccgggcggcgacgattcca 432
           ||||||||||||||||||||||| || |||||||| || ||||  || || || || |||
Sbjct: 638 acatcatcaataccagcgaactgaagaaccttcttaggaaccctagcagcaacaatacca 579

                                                                       
Query: 433 gaacccctcggggcgggcaccatacgcacggtgacagagccgcacttgccggtgaccttg 492
           ||||| ||||| || || ||||| | ||| || ||||| || || || || || ||||| 
Sbjct: 578 gaacctctcggagcaggaaccattctcacagtaacagaaccacatttaccagtaacctta 519

                                                 
Query: 493 cagggcacggtgtggggcatgccgatcttgttccccca 530
           || ||||| ||||| ||| | || ||||| ||||||||
Sbjct: 518 caaggcacagtgtgtggcttcccaatcttattccccca 481

---

>dbj|AB008017.1| Arabidopsis thaliana RF12 mRNA, partial cds
          Length = 1052

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 175/218 (80%)
 Strand = Plus / Minus

                                                                       
Query: 313 tcgaaggttgccttgacgaagttgccaagggtcttggtggatccacgcgaggaagtgaag 372
           ||||| || |||||||| ||||| |||||||| ||||| ||||| |  || ||||| |||
Sbjct: 700 tcgaatgtagccttgacaaagtttccaagggttttggtagatcctcttgaagaagtaaag 641

                                                                       
Query: 373 acatcatcaataccagcgaactggagcaccttcttggggacccgggcggcgacgattcca 432
           ||||||||||||||||||||||| || |||||||| || ||||  || || || || |||
Sbjct: 640 acatcatcaataccagcgaactgaagaaccttcttaggaaccctagcagcaacaatacca 581

                                                                       
Query: 433 gaacccctcggggcgggcaccatacgcacggtgacagagccgcacttgccggtgaccttg 492
           ||||| ||||| || || ||||| | ||| || ||||| || || || || || ||||| 
Sbjct: 580 gaacctctcggagcaggaaccattctcacagtaacagaaccacatttaccagtaacctta 521

                                                 
Query: 493 cagggcacggtgtggggcatgccgatcttgttccccca 530
           || ||||| ||||| ||| | || ||||| ||||||||
Sbjct: 520 caaggcacagtgtgtggcttcccaatcttattccccca 483

---

>gb|AY292470.1| Gadus ogac S2 ribosomal protein (S2) gene, partial cds
          Length = 899

 Score = 89.7 bits (45), Expect = 9e-15
 Identities = 51/53 (96%)
 Strand = Plus / Minus

                                                                
Query: 481 ccggtgaccttgcagggcacggtgtggggcatgccgatcttgttcccccagta 533
           |||||||||||||||||||||||||||||| ||||||||||||| ||||||||
Sbjct: 252 ccggtgaccttgcagggcacggtgtggggcttgccgatcttgttaccccagta 200

---

>gb|AY292469.1| Gadus macrocephalus S2 ribosomal protein (S2) gene, partial cds
          Length = 902

 Score = 89.7 bits (45), Expect = 9e-15
 Identities = 51/53 (96%)
 Strand = Plus / Minus

                                                                
Query: 481 ccggtgaccttgcagggcacggtgtggggcatgccgatcttgttcccccagta 533
           |||||||||||||||||||||||||||||| ||||||||||||| ||||||||
Sbjct: 252 ccggtgaccttgcagggcacggtgtggggcttgccgatcttgttaccccagta 200

---

>gb|AY088743.1| Arabidopsis thaliana clone 93867 mRNA, complete sequence
          Length = 1106

 Score = 89.7 bits (45), Expect = 9e-15
 Identities = 180/225 (80%)
 Strand = Plus / Minus

                                                                       
Query: 309 gcagtcgaaggttgccttgacgaagttgccaagggtcttggtggatccacgcgaggaagt 368
           |||||| || || |||||||| ||||| || || || ||||| ||||| |  || |||||
Sbjct: 792 gcagtcaaatgtcgccttgacaaagtttccgagtgttttggtagatcctctagaagaagt 733

                                                                       
Query: 369 gaagacatcatcaataccagcgaactggagcaccttcttggggacccgggcggcgacgat 428
            |||||||||||||||||||||||||| || |||||||| || ||||  || || || ||
Sbjct: 732 aaagacatcatcaataccagcgaactgaagaaccttcttaggaaccctagcagcaacaat 673

                                                                       
Query: 429 tccagaacccctcggggcgggcaccatacgcacggtgacagagccgcacttgccggtgac 488
            |||||||| ||||| || || ||||| | ||| || ||||| || ||||| || || ||
Sbjct: 672 accagaacctctcggagcaggaaccattctcacagtaacagaaccacacttcccagtaac 613

                                                        
Query: 489 cttgcagggcacggtgtggggcatgccgatcttgttcccccagta 533
           ||| || ||||| ||||| ||| | || ||||| |||||||||||
Sbjct: 612 cttacaaggcacagtgtgtggcttcccaatcttattcccccagta 568

---

>ref|NM_115609.2| Arabidopsis thaliana structural constituent of ribosome AT3G57490
           mRNA, complete cds
          Length = 1050

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 122/148 (82%)
 Strand = Plus / Minus

                                                                       
Query: 260 tcgtctccctccagaagtcaggggtgaggaatccataggtcttcatcaggcagtcgaagg 319
           |||||||  ||||||| || || || |||||||| || ||||||  ||| || || || |
Sbjct: 794 tcgtctctttccagaattccggtgtaaggaatccgtatgtcttctgcagacaatcaaatg 735

                                                                       
Query: 320 ttgccttgacgaagttgccaagggtcttggtggatccacgcgaggaagtgaagacatcat 379
           |||||||||||||||| ||||| || ||||||||||| |  || ||||| ||||||||||
Sbjct: 734 ttgccttgacgaagtttccaagagttttggtggatcctctagaagaagtaaagacatcat 675

                                       
Query: 380 caataccagcgaactggagcaccttctt 407
           |||| |||||||| || || ||||||||
Sbjct: 674 caattccagcgaattgaagaaccttctt 647

---

>gb|BT006200.1| Arabidopsis thaliana At3g57490 mRNA, complete cds
          Length = 831

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 122/148 (82%)
 Strand = Plus / Minus

                                                                       
Query: 260 tcgtctccctccagaagtcaggggtgaggaatccataggtcttcatcaggcagtcgaagg 319
           |||||||  ||||||| || || || |||||||| || ||||||  ||| || || || |
Sbjct: 733 tcgtctctttccagaattccggtgtaaggaatccgtatgtcttctgcagacaatcaaatg 674

                                                                       
Query: 320 ttgccttgacgaagttgccaagggtcttggtggatccacgcgaggaagtgaagacatcat 379
           |||||||||||||||| ||||| || ||||||||||| |  || ||||| ||||||||||
Sbjct: 673 ttgccttgacgaagtttccaagagttttggtggatcctctagaagaagtaaagacatcat 614

                                       
Query: 380 caataccagcgaactggagcaccttctt 407
           |||| |||||||| || || ||||||||
Sbjct: 613 caattccagcgaattgaagaaccttctt 586

---

>gb|AC027036.12|AC027036 Arabidopsis thaliana chromosome 1 BAC T4M14 genomic sequence, complete
             sequence
          Length = 89737

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 167/208 (80%)
 Strand = Plus / Plus

                                                                         
Query: 323   ccttgacgaagttgccaagggtcttggtggatccacgcgaggaagtgaagacatcatcaa 382
             ||||||| ||||| |||||||| ||||| ||||| |  || ||||| |||||||||||||
Sbjct: 48999 ccttgacaaagtttccaagggttttggtagatcctcttgaagaagtaaagacatcatcaa 49058

                                                                         
Query: 383   taccagcgaactggagcaccttcttggggacccgggcggcgacgattccagaacccctcg 442
             ||||||||||||| || |||||||| || ||||  || || || || |||||||| ||||
Sbjct: 49059 taccagcgaactgaagaaccttcttaggaaccctagcagcaacaataccagaacctctcg 49118

                                                                         
Query: 443   gggcgggcaccatacgcacggtgacagagccgcacttgccggtgaccttgcagggcacgg 502
             | || || ||||| | ||| || ||||| || || || || || ||||| || ||||| |
Sbjct: 49119 gagcaggaaccattctcacagtaacagaaccacatttaccagtaaccttacaaggcacag 49178

                                         
Query: 503   tgtggggcatgccgatcttgttccccca 530
             |||| ||| | || ||||| ||||||||
Sbjct: 49179 tgtgtggcttcccaatcttattccccca 49206



 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 167/208 (80%)
 Strand = Plus / Plus

                                                                         
Query: 323   ccttgacgaagttgccaagggtcttggtggatccacgcgaggaagtgaagacatcatcaa 382
             ||||||| ||||| |||||||| ||||| ||||| |  || ||||| |||||||||||||
Sbjct: 12741 ccttgacaaagtttccaagggttttggtagatcctcttgaagaagtaaagacatcatcaa 12800

                                                                         
Query: 383   taccagcgaactggagcaccttcttggggacccgggcggcgacgattccagaacccctcg 442
             ||||||||||||| || |||||||| || ||||  || || || || |||||||| ||||
Sbjct: 12801 taccagcgaactgaagaaccttcttaggaaccctagcagcaacaataccagaacctctcg 12860

                                                                         
Query: 443   gggcgggcaccatacgcacggtgacagagccgcacttgccggtgaccttgcagggcacgg 502
             | || || ||||| | ||| || ||||| || || || || || ||||| || ||||| |
Sbjct: 12861 gagcaggaaccattctcacagtaacagaaccacatttaccagtaaccttacaaggcacag 12920

                                         
Query: 503   tgtggggcatgccgatcttgttccccca 530
             |||| ||| | || ||||| ||||||||
Sbjct: 12921 tgtgtggcttcccaatcttattccccca 12948

---

>gb|AY084252.1| Arabidopsis thaliana clone 101250 mRNA, complete sequence
          Length = 1048

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 122/148 (82%)
 Strand = Plus / Minus

                                                                       
Query: 260 tcgtctccctccagaagtcaggggtgaggaatccataggtcttcatcaggcagtcgaagg 319
           |||||||  ||||||| || || || |||||||| || ||||||  ||| || || || |
Sbjct: 794 tcgtctctttccagaattccggtgtaaggaatccgtatgtcttctgcagacaatcaaatg 735

                                                                       
Query: 320 ttgccttgacgaagttgccaagggtcttggtggatccacgcgaggaagtgaagacatcat 379
           |||||||||||||||| ||||| || ||||||||||| |  || ||||| ||||||||||
Sbjct: 734 ttgccttgacgaagtttccaagagttttggtggatcctctagaagaagtaaagacatcat 675

                                       
Query: 380 caataccagcgaactggagcaccttctt 407
           |||| |||||||| || || ||||||||
Sbjct: 674 caattccagcgaattgaagaaccttctt 647

---

>dbj|AB078516.1| Arabidopsis thaliana genomic DNA, chromosome 1, P1 clone:R18I, complete
             sequence
          Length = 83408

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 167/208 (80%)
 Strand = Plus / Plus

                                                                         
Query: 323   ccttgacgaagttgccaagggtcttggtggatccacgcgaggaagtgaagacatcatcaa 382
             ||||||| ||||| |||||||| ||||| ||||| |  || ||||| |||||||||||||
Sbjct: 71310 ccttgacaaagtttccaagggttttggtagatcctcttgaagaagtaaagacatcatcaa 71369

                                                                         
Query: 383   taccagcgaactggagcaccttcttggggacccgggcggcgacgattccagaacccctcg 442
             ||||||||||||| || |||||||| || ||||  || || || || |||||||| ||||
Sbjct: 71370 taccagcgaactgaagaaccttcttaggaaccctagcagcaacaataccagaacctctcg 71429

                                                                         
Query: 443   gggcgggcaccatacgcacggtgacagagccgcacttgccggtgaccttgcagggcacgg 502
             | || || ||||| | ||| || ||||| || || || || || ||||| || ||||| |
Sbjct: 71430 gagcaggaaccattctcacagtaacagaaccacatttaccagtaaccttacaaggcacag 71489

                                         
Query: 503   tgtggggcatgccgatcttgttccccca 530
             |||| ||| | || ||||| ||||||||
Sbjct: 71490 tgtgtggcttcccaatcttattccccca 71517



 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 167/208 (80%)
 Strand = Plus / Plus

                                                                         
Query: 323   ccttgacgaagttgccaagggtcttggtggatccacgcgaggaagtgaagacatcatcaa 382
             ||||||| ||||| |||||||| ||||| ||||| |  || ||||| |||||||||||||
Sbjct: 35052 ccttgacaaagtttccaagggttttggtagatcctcttgaagaagtaaagacatcatcaa 35111

                                                                         
Query: 383   taccagcgaactggagcaccttcttggggacccgggcggcgacgattccagaacccctcg 442
             ||||||||||||| || |||||||| || ||||  || || || || |||||||| ||||
Sbjct: 35112 taccagcgaactgaagaaccttcttaggaaccctagcagcaacaataccagaacctctcg 35171

                                                                         
Query: 443   gggcgggcaccatacgcacggtgacagagccgcacttgccggtgaccttgcagggcacgg 502
             | || || ||||| | ||| || ||||| || || || || || ||||| || ||||| |
Sbjct: 35172 gagcaggaaccattctcacagtaacagaaccacatttaccagtaaccttacaaggcacag 35231

                                         
Query: 503   tgtggggcatgccgatcttgttccccca 530
             |||| ||| | || ||||| ||||||||
Sbjct: 35232 tgtgtggcttcccaatcttattccccca 35259

---

>dbj|AB076984.1| Arabidopsis thaliana DNA, chromosome 1, clone:P1-C15J, partial
            sequence
          Length = 24538

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 167/208 (80%)
 Strand = Plus / Plus

                                                                        
Query: 323  ccttgacgaagttgccaagggtcttggtggatccacgcgaggaagtgaagacatcatcaa 382
            ||||||| ||||| |||||||| ||||| ||||| |  || ||||| |||||||||||||
Sbjct: 1845 ccttgacaaagtttccaagggttttggtagatcctcttgaagaagtaaagacatcatcaa 1904

                                                                        
Query: 383  taccagcgaactggagcaccttcttggggacccgggcggcgacgattccagaacccctcg 442
            ||||||||||||| || |||||||| || ||||  || || || || |||||||| ||||
Sbjct: 1905 taccagcgaactgaagaaccttcttaggaaccctagcagcaacaataccagaacctctcg 1964

                                                                        
Query: 443  gggcgggcaccatacgcacggtgacagagccgcacttgccggtgaccttgcagggcacgg 502
            | || || ||||| | ||| || ||||| || || || || || ||||| || ||||| |
Sbjct: 1965 gagcaggaaccattctcacagtaacagaaccacatttaccagtaaccttacaaggcacag 2024

                                        
Query: 503  tgtggggcatgccgatcttgttccccca 530
            |||| ||| | || ||||| ||||||||
Sbjct: 2025 tgtgtggcttcccaatcttattccccca 2052

---

>gb|AC091305.9| Homo sapiens chromosome 18, clone RP11-644A7, complete sequence
          Length = 118401

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 64/71 (90%)
 Strand = Plus / Plus

                                                                         
Query: 466   acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 525
             ||||||||||| | ||| || |||||||| || |||||||||||| ||||||||||||||
Sbjct: 79450 acagagccgcagtggcctgtcaccttgcaagggacggtgtggggcttgccgatcttgttc 79509

                        
Query: 526   ccccagtagcc 536
             |||||||||||
Sbjct: 79510 ccccagtagcc 79520

---

>gb|AC012618.7| Homo sapiens chromosome 19 clone CTD-2666L21, complete sequence
          Length = 159451

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 64/71 (90%)
 Strand = Plus / Minus

                                                                          
Query: 466    acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 525
              ||||||||||| | ||| || |||||||| || |||||||||||| ||||||||||||||
Sbjct: 100934 acagagccgcagtggcctgtcaccttgcaagggacggtgtggggcttgccgatcttgttc 100875

                         
Query: 526    ccccagtagcc 536
              |||||||||||
Sbjct: 100874 ccccagtagcc 100864

---

>gb|AY120723.1| Arabidopsis thaliana ribosomal protein S2, putative (At1g59359)
           mRNA, complete cds
          Length = 1038

 Score = 83.8 bits (42), Expect = 5e-13
 Identities = 174/218 (79%)
 Strand = Plus / Minus

                                                                       
Query: 313 tcgaaggttgccttgacgaagttgccaagggtcttggtggatccacgcgaggaagtgaag 372
           ||||| || |||||||| || || |||||||| ||||| ||||| |  || ||||| |||
Sbjct: 711 tcgaatgtagccttgacaaactttccaagggttttggtagatcctcttgaagaagtaaag 652

                                                                       
Query: 373 acatcatcaataccagcgaactggagcaccttcttggggacccgggcggcgacgattcca 432
           ||||||||||||||||||||||| || |||||||| || ||||  || || || || |||
Sbjct: 651 acatcatcaataccagcgaactgaagaaccttcttaggaaccctagcagcaacaatacca 592

                                                                       
Query: 433 gaacccctcggggcgggcaccatacgcacggtgacagagccgcacttgccggtgaccttg 492
           ||||| ||||| || || ||||| | ||| || ||||| || || || || || ||||| 
Sbjct: 591 gaacctctcggagcaggaaccattctcacagtaacagaaccacatttaccagtaacctta 532

                                                 
Query: 493 cagggcacggtgtggggcatgccgatcttgttccccca 530
           || ||||| ||||| ||| | || ||||| ||||||||
Sbjct: 531 caaggcacagtgtgtggcttcccaatcttattccccca 494

---

>gb|AY292483.1| Brosme brosme S2 ribosomal protein (S2) gene, partial cds
          Length = 910

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 50/53 (94%)
 Strand = Plus / Minus

                                                                
Query: 481 ccggtgaccttgcagggcacggtgtggggcatgccgatcttgttcccccagta 533
           ||||| |||||||||||||||||||||||| ||||||||||||| ||||||||
Sbjct: 252 ccggtcaccttgcagggcacggtgtggggcttgccgatcttgttaccccagta 200

---

>gb|AY292479.1| Eleginus gracilis S2 ribosomal protein (S2) gene, partial cds
          Length = 901

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 50/53 (94%)
 Strand = Plus / Minus

                                                                
Query: 481 ccggtgaccttgcagggcacggtgtggggcatgccgatcttgttcccccagta 533
           ||||| |||||||||||||||||||||||| ||||||||||||| ||||||||
Sbjct: 252 ccggtcaccttgcagggcacggtgtggggcttgccgatcttgttaccccagta 200

---

>gb|AY292478.1| Microgadus proximus S2 ribosomal protein (S2) gene, partial cds
          Length = 901

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 50/53 (94%)
 Strand = Plus / Minus

                                                                
Query: 481 ccggtgaccttgcagggcacggtgtggggcatgccgatcttgttcccccagta 533
           ||||| |||||||||||||||||||||||| ||||||||||||| ||||||||
Sbjct: 252 ccggtcaccttgcagggcacggtgtggggcttgccgatcttgttaccccagta 200

---

>gb|AY292477.1| Microgadus tomcod S2 ribosomal protein (S2) gene, partial cds
          Length = 900

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 50/53 (94%)
 Strand = Plus / Minus

                                                                
Query: 481 ccggtgaccttgcagggcacggtgtggggcatgccgatcttgttcccccagta 533
           ||||| |||||||||||||||||||||||| ||||||||||||| ||||||||
Sbjct: 252 ccggtcaccttgcagggcacggtgtggggcttgccgatcttgttaccccagta 200

---

>gb|AY292475.1| Pollachius virens S2 ribosomal protein (S2) gene, partial cds
          Length = 904

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 50/53 (94%)
 Strand = Plus / Minus

                                                                
Query: 481 ccggtgaccttgcagggcacggtgtggggcatgccgatcttgttcccccagta 533
           ||||| |||||||||||||||||||||||| ||||||||||||| ||||||||
Sbjct: 252 ccggtcaccttgcagggcacggtgtggggcttgccgatcttgttaccccagta 200

---

>gb|AY292474.1| Merlangius merlangus S2 ribosomal protein (S2) gene, partial cds
          Length = 903

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 50/53 (94%)
 Strand = Plus / Minus

                                                                
Query: 481 ccggtgaccttgcagggcacggtgtggggcatgccgatcttgttcccccagta 533
           ||||| |||||||||||||||||||||||| ||||||||||||| ||||||||
Sbjct: 252 ccggtcaccttgcagggcacggtgtggggcttgccgatcttgttaccccagta 200

---

>gb|AY292473.1| Melanogrammus aeglefinus S2 ribosomal protein (S2) gene, partial
           cds
          Length = 902

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 50/53 (94%)
 Strand = Plus / Minus

                                                                
Query: 481 ccggtgaccttgcagggcacggtgtggggcatgccgatcttgttcccccagta 533
           ||||| |||||||||||||||||||||||| ||||||||||||| ||||||||
Sbjct: 252 ccggtcaccttgcagggcacggtgtggggcttgccgatcttgttaccccagta 200

---

>gb|AY292472.1| Boreogadus saida S2 ribosomal protein (S2) gene, partial cds
          Length = 897

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 50/53 (94%)
 Strand = Plus / Minus

                                                                
Query: 481 ccggtgaccttgcagggcacggtgtggggcatgccgatcttgttcccccagta 533
           ||||| |||||||||||||||||||||||| ||||||||||||| ||||||||
Sbjct: 252 ccggtcaccttgcagggcacggtgtggggcttgccgatcttgttaccccagta 200

---

>gb|AY292471.1| Theragra chalcogramma S2 ribosomal protein (S2) gene, partial cds
          Length = 896

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 50/53 (94%)
 Strand = Plus / Minus

                                                                
Query: 481 ccggtgaccttgcagggcacggtgtggggcatgccgatcttgttcccccagta 533
           ||||| |||||||||||||||||||||||| ||||||||||||| ||||||||
Sbjct: 252 ccggtcaccttgcagggcacggtgtggggcttgccgatcttgttaccccagta 200

---

>gb|AY292468.1| Gadus morhua S2 ribosomal protein (S2) gene, partial cds
          Length = 902

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 50/53 (94%)
 Strand = Plus / Minus

                                                                
Query: 481 ccggtgaccttgcagggcacggtgtggggcatgccgatcttgttcccccagta 533
           ||||| |||||||||||||||||||||||| ||||||||||||| ||||||||
Sbjct: 252 ccggtcaccttgcagggcacggtgtggggcttgccgatcttgttaccccagta 200

---

>gb|AY292467.1| Arctogadus glacialis S2 ribosomal protein (S2) gene, partial cds
          Length = 893

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 50/53 (94%)
 Strand = Plus / Minus

                                                                
Query: 481 ccggtgaccttgcagggcacggtgtggggcatgccgatcttgttcccccagta 533
           ||||| |||||||||||||||||||||||| ||||||||||||| ||||||||
Sbjct: 252 ccggtcaccttgcagggcacggtgtggggcttgccgatcttgttaccccagta 200

---

>gb|AC140104.22| Medicago truncatula clone mth2-10g22, complete sequence
          Length = 127043

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 65/73 (89%)
 Strand = Plus / Plus

                                                                         
Query: 323   ccttgacgaagttgccaagggtcttggtggatccacgcgaggaagtgaagacatcatcaa 382
             |||||||||| || |||||||| ||||||||||| |  ||||||||||| ||||||||||
Sbjct: 97512 ccttgacgaaatttccaagggttttggtggatcccctagaggaagtgaaaacatcatcaa 97571

                          
Query: 383   taccagcgaactg 395
             ||||||| |||||
Sbjct: 97572 taccagcaaactg 97584

---

>gb|AC142395.41| Medicago truncatula clone mth2-18g1, complete sequence
          Length = 110556

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 65/73 (89%)
 Strand = Plus / Plus

                                                                         
Query: 323   ccttgacgaagttgccaagggtcttggtggatccacgcgaggaagtgaagacatcatcaa 382
             |||||||||| || |||||||| ||||||||||| |  ||||||||||| ||||||||||
Sbjct: 57040 ccttgacgaaatttccaagggttttggtggatcccctagaggaagtgaaaacatcatcaa 57099

                          
Query: 383   taccagcgaactg 395
             ||||||| |||||
Sbjct: 57100 taccagcaaactg 57112

---

>gb|AC002339.3| Arabidopsis thaliana chromosome 2 clone T11A7 map CIC11C08, complete
             sequence
          Length = 91071

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 74/85 (87%)
 Strand = Plus / Minus

                                                                         
Query: 323   ccttgacgaagttgccaagggtcttggtggatccacgcgaggaagtgaagacatcatcaa 382
             ||||||||||||| ||||| || ||||||||||| |  ||||||||||| ||||||||||
Sbjct: 19834 ccttgacgaagtttccaagagttttggtggatcccctggaggaagtgaaaacatcatcaa 19775

                                      
Query: 383   taccagcgaactggagcaccttctt 407
             | |||||||| || || ||||||||
Sbjct: 19774 ttccagcgaattgaagaaccttctt 19750

---

>ref|XM_523967.1| PREDICTED: Pan troglodytes similar to 40S ribosomal protein S2
           (LOC468578), mRNA
          Length = 765

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 63/71 (88%)
 Strand = Plus / Minus

                                                                       
Query: 466 acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 525
           |||||||||||   ||| || |||||||| || |||||||||||| ||||||||||||||
Sbjct: 581 acagagccgcagcggcctgtcaccttgcaagggacggtgtggggcttgccgatcttgttc 522

                      
Query: 526 ccccagtagcc 536
           |||||||||||
Sbjct: 521 ccccagtagcc 511

---

>ref|XM_517458.1| PREDICTED: Pan troglodytes similar to GRB2-associated binding
           protein 1 isoform a (LOC461516), mRNA
          Length = 3270

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 63/71 (88%)
 Strand = Plus / Plus

                                                                       
Query: 466 acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 525
           |||||||||||   ||| || |||||||| || |||||||||||| ||||||||||||||
Sbjct: 866 acagagccgcagcggcctgtcaccttgcaagggacggtgtggggcttgccgatcttgttc 925

                      
Query: 526 ccccagtagcc 536
           |||||||||||
Sbjct: 926 ccccagtagcc 936

---

>ref|XM_515580.1| PREDICTED: Pan troglodytes LOC459356 (LOC459356), mRNA
          Length = 844

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 63/71 (88%)
 Strand = Plus / Minus

                                                                       
Query: 466 acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 525
           |||||||||||   ||| || |||||||| || |||||||||||| ||||||||||||||
Sbjct: 582 acagagccgcagcggcctgtcaccttgcaagggacggtgtggggcttgccgatcttgttc 523

                      
Query: 526 ccccagtagcc 536
           |||||||||||
Sbjct: 522 ccccagtagcc 512

---

>gb|AY292480.1| Micromesistius poutassou S2 ribosomal protein (S2) gene, partial
           cds
          Length = 915

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 45/47 (95%)
 Strand = Plus / Minus

                                                          
Query: 487 accttgcagggcacggtgtggggcatgccgatcttgttcccccagta 533
           |||||||||||||||||||||||| ||||||||||||| ||||||||
Sbjct: 246 accttgcagggcacggtgtggggcttgccgatcttgttaccccagta 200

---

>gb|AY292476.1| Pollachius pollachius S2 ribosomal protein (S2) gene, partial cds
          Length = 920

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 45/47 (95%)
 Strand = Plus / Minus

                                                          
Query: 487 accttgcagggcacggtgtggggcatgccgatcttgttcccccagta 533
           |||||||||||||||||||||||| ||||||||||||| ||||||||
Sbjct: 246 accttgcagggcacggtgtggggcttgccgatcttgttaccccagta 200

---

>emb|AL137072.8| Human DNA sequence from clone RP11-29B11 on chromosome 9 Contains the 5'
              end of the TXNDC4 gene for thioredoxin domain containing 4
              (endoplasmic reticulum) (ERP44, ERp44,KIAA0573), the 5' end
              of the INVS gene for inversin, a ribosomal protein S2
              (RPS2) pseudogene, a novel pseudogene and two CpG islands,
              complete sequence
          Length = 172830

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 63/71 (88%)
 Strand = Plus / Plus

                                                                          
Query: 466    acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 525
              |||||||||||   ||| || |||||||| || |||||||||||| ||||||||||||||
Sbjct: 109204 acagagccgcagcggcctgtcaccttgcaagggacggtgtggggcttgccgatcttgttc 109263

                         
Query: 526    ccccagtagcc 536
              |||||||||||
Sbjct: 109264 ccccagtagcc 109274

---

>emb|X17206.1|HSLLREP3 Human mRNA for LLRep3
          Length = 934

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 63/71 (88%)
 Strand = Plus / Minus

                                                                       
Query: 466 acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 525
           |||||||||||   ||| || ||||||||||| || ||||||||| ||||||||||||||
Sbjct: 596 acagagccgcagcggcctgtcaccttgcaggggacagtgtggggcttgccgatcttgttc 537

                      
Query: 526 ccccagtagcc 536
           |||||||||||
Sbjct: 536 ccccagtagcc 526

---

>gb|AC097658.2| Homo sapiens BAC clone RP11-364L4 from 4, complete sequence
          Length = 165247

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 63/71 (88%)
 Strand = Plus / Plus

                                                                          
Query: 466    acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 525
              |||||||||||   ||| || |||||||| || |||||||||||| ||||||||||||||
Sbjct: 122195 acagagccgcagcggcctgtcaccttgcaagggacggtgtggggcttgccgatcttgttc 122254

                         
Query: 526    ccccagtagcc 536
              |||||||||||
Sbjct: 122255 ccccagtagcc 122265

---

>ref|XM_938104.1| PREDICTED: Homo sapiens similar to ribosomal protein S2
           (LOC648114), mRNA
          Length = 1037

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 63/71 (88%)
 Strand = Plus / Minus

                                                                       
Query: 466 acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 525
           |||||||||||   ||| || |||||||| || |||||||||||| ||||||||||||||
Sbjct: 555 acagagccgcagcggcctgtcaccttgcaagggacggtgtggggcttgccgatcttgttc 496

                      
Query: 526 ccccagtagcc 536
           |||||||||||
Sbjct: 495 ccccagtagcc 485

---

>ref|XM_930178.1| PREDICTED: Homo sapiens similar to ribosomal protein S2
           (LOC645018), mRNA
          Length = 1037

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 63/71 (88%)
 Strand = Plus / Minus

                                                                       
Query: 466 acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 525
           |||||||||||   ||| || |||||||| || |||||||||||| ||||||||||||||
Sbjct: 555 acagagccgcagcggcctgtcaccttgcaagggacggtgtggggcttgccgatcttgttc 496

                      
Query: 526 ccccagtagcc 536
           |||||||||||
Sbjct: 495 ccccagtagcc 485

---

>ref|XM_946024.1| PREDICTED: Homo sapiens similar to ribosomal protein S2, transcript
           variant 8 (LOC650901), mRNA
          Length = 871

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 63/71 (88%)
 Strand = Plus / Minus

                                                                       
Query: 466 acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 525
           |||||||||||   ||| || |||||||| || |||||||||||| ||||||||||||||
Sbjct: 509 acagagccgcagcggcctgtcaccttgcaagggacggtgtggggcttgccgatcttgttc 450

                      
Query: 526 ccccagtagcc 536
           |||||||||||
Sbjct: 449 ccccagtagcc 439

---

>ref|XM_946023.1| PREDICTED: Homo sapiens similar to ribosomal protein S2, transcript
           variant 7 (LOC650901), mRNA
          Length = 778

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 63/71 (88%)
 Strand = Plus / Minus

                                                                       
Query: 466 acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 525
           |||||||||||   ||| || |||||||| || |||||||||||| ||||||||||||||
Sbjct: 416 acagagccgcagcggcctgtcaccttgcaagggacggtgtggggcttgccgatcttgttc 357

                      
Query: 526 ccccagtagcc 536
           |||||||||||
Sbjct: 356 ccccagtagcc 346

---

>ref|XM_946022.1| PREDICTED: Homo sapiens similar to ribosomal protein S2, transcript
           variant 6 (LOC650901), mRNA
          Length = 721

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 63/71 (88%)
 Strand = Plus / Minus

                                                                       
Query: 466 acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 525
           |||||||||||   ||| || |||||||| || |||||||||||| ||||||||||||||
Sbjct: 356 acagagccgcagcggcctgtcaccttgcaagggacggtgtggggcttgccgatcttgttc 297

                      
Query: 526 ccccagtagcc 536
           |||||||||||
Sbjct: 296 ccccagtagcc 286

---

>ref|XM_946021.1| PREDICTED: Homo sapiens similar to ribosomal protein S2, transcript
           variant 5 (LOC650901), mRNA
          Length = 843

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 63/71 (88%)
 Strand = Plus / Minus

                                                                       
Query: 466 acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 525
           |||||||||||   ||| || |||||||| || |||||||||||| ||||||||||||||
Sbjct: 485 acagagccgcagcggcctgtcaccttgcaagggacggtgtggggcttgccgatcttgttc 426

                      
Query: 526 ccccagtagcc 536
           |||||||||||
Sbjct: 425 ccccagtagcc 415

---

>ref|XM_946020.1| PREDICTED: Homo sapiens similar to ribosomal protein S2, transcript
           variant 4 (LOC650901), mRNA
          Length = 658

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 63/71 (88%)
 Strand = Plus / Minus

                                                                       
Query: 466 acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 525
           |||||||||||   ||| || |||||||| || |||||||||||| ||||||||||||||
Sbjct: 300 acagagccgcagcggcctgtcaccttgcaagggacggtgtggggcttgccgatcttgttc 241

                      
Query: 526 ccccagtagcc 536
           |||||||||||
Sbjct: 240 ccccagtagcc 230

---

>ref|XM_942473.1| PREDICTED: Homo sapiens similar to ribosomal protein S2, transcript
           variant 1 (LOC650901), mRNA
          Length = 970

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 63/71 (88%)
 Strand = Plus / Minus

                                                                       
Query: 466 acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 525
           |||||||||||   ||| || |||||||| || |||||||||||| ||||||||||||||
Sbjct: 601 acagagccgcagcggcctgtcaccttgcaagggacggtgtggggcttgccgatcttgttc 542

                      
Query: 526 ccccagtagcc 536
           |||||||||||
Sbjct: 541 ccccagtagcc 531

---

>ref|NG_002522.1| Homo sapiens ribosomal protein S2 pseudogene 4 (RPS2P4) on
           chromosome 14
          Length = 1142

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 63/71 (88%)
 Strand = Plus / Minus

                                                                       
Query: 466 acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 525
           |||||||||||   ||| || |||||||| || |||||||||||| ||||||||||||||
Sbjct: 704 acagagccgcagcggcctgtcaccttgcaagggacggtgtggggcttgccgatcttgttc 645

                      
Query: 526 ccccagtagcc 536
           |||||||||||
Sbjct: 644 ccccagtagcc 634

---

>gb|DQ021880.1| Homo sapiens GRB2-associated binding protein 1 (GAB1) gene, complete
             cds
          Length = 135764

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 63/71 (88%)
 Strand = Plus / Plus

                                                                         
Query: 466   acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 525
             |||||||||||   ||| || |||||||| || |||||||||||| ||||||||||||||
Sbjct: 13249 acagagccgcagcggcctgtcaccttgcaagggacggtgtggggcttgccgatcttgttc 13308

                        
Query: 526   ccccagtagcc 536
             |||||||||||
Sbjct: 13309 ccccagtagcc 13319

---

>gb|AC022210.8| Homo sapiens BAC clone RP11-617F9 from 2, complete sequence
          Length = 164846

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 63/71 (88%)
 Strand = Plus / Minus

                                                                         
Query: 466   acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 525
             |||||||||||   ||| || |||||||| || |||||||||||| ||||||||||||||
Sbjct: 31572 acagagccgcagcggcctgtcaccttgcaagggacggtgtggggcttgccgatcttgttc 31513

                        
Query: 526   ccccagtagcc 536
             |||||||||||
Sbjct: 31512 ccccagtagcc 31502

---

>emb|AL590326.3|CNS07EG7 Human chromosome 14 DNA sequence BAC R-477I4 of library RPCI-11 from
             chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 31184

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 63/71 (88%)
 Strand = Plus / Plus

                                                                         
Query: 466   acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 525
             |||||||||||   ||| || |||||||| || |||||||||||| ||||||||||||||
Sbjct: 23403 acagagccgcagcggcctgtcaccttgcaagggacggtgtggggcttgccgatcttgttc 23462

                        
Query: 526   ccccagtagcc 536
             |||||||||||
Sbjct: 23463 ccccagtagcc 23473

---

>emb|AL583810.5|CNS07EFZ Human chromosome 14 DNA sequence BAC C-3051D23 of library CalTech-D
           from chromosome 14 of Homo sapiens (Human), complete
           sequence
          Length = 94227

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 63/71 (88%)
 Strand = Plus / Plus

                                                                       
Query: 466 acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 525
           |||||||||||   ||| || |||||||| || |||||||||||| ||||||||||||||
Sbjct: 236 acagagccgcagcggcctgtcaccttgcaagggacggtgtggggcttgccgatcttgttc 295

                      
Query: 526 ccccagtagcc 536
           |||||||||||
Sbjct: 296 ccccagtagcc 306

---

>emb|AL596275.10| Human DNA sequence from clone RP11-183G22 on chromosome 1 Contains a
             ribosomal protein S2 (RPS2) pseudogene, a high-mobility
             group box 1 (HMGB1) pseudogene and a chromosome 14 open
             reading frame 111 (C14orf111) pseudogene, complete
             sequence
          Length = 139273

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 47/50 (94%)
 Strand = Plus / Minus

                                                               
Query: 487   accttgcagggcacggtgtggggcatgccgatcttgttcccccagtagcc 536
             |||||||| || |||||||||||| |||||||||||||||||||||||||
Sbjct: 53558 accttgcaagggacggtgtggggcttgccgatcttgttcccccagtagcc 53509

---

>emb|AL355802.13| Human DNA sequence from clone RP3-337H4 on chromosome 6 Contains the 3'
             part of a novel gene, three novel genes, the gene for RNA
             polymerase I 40 kDa subunit (RPA40) (RPA39), the gene for
             exportin 5 (KIAA1291) (XPO5), a 40S ribosomal protein S2
             (RPS2) pseudogene, the 5' part of the POLH gene for DNA
             directed polymerase eta and four CpG islands, complete
             sequence
          Length = 105935

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 47/50 (94%)
 Strand = Plus / Plus

                                                               
Query: 487   accttgcagggcacggtgtggggcatgccgatcttgttcccccagtagcc 536
             ||||||||||| |||||||||||| ||||||||||||||||| |||||||
Sbjct: 51909 accttgcaggggacggtgtggggcttgccgatcttgttcccctagtagcc 51958

---

>ref|XM_215498.3| PREDICTED: Rattus norvegicus similar to Hypothetical protein FLJ25422
            (predicted) (LOC294789), mRNA
          Length = 3773

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 53/58 (91%)
 Strand = Plus / Plus

                                                                      
Query: 484  gtgaccttgcagggcacggtgtggggcatgccgatcttgttcccccagtagcccctcc 541
            ||||||||||| ||||| ||||||||| |||| |||||||||||||||||||| ||||
Sbjct: 1616 gtgaccttgcatggcacagtgtggggcttgccaatcttgttcccccagtagcctctcc 1673

---

>gb|AY826151.1| Aedes albopictus clone AL_364 ribosomal protein S2 mRNA, complete
           cds
          Length = 822

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 58/65 (89%)
 Strand = Plus / Minus

                                                                       
Query: 472 ccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttcccccag 531
           ||||||||||||  ||||||||| || |||||||||||| | ||||||||||| ||||||
Sbjct: 527 ccgcacttgccgaagaccttgcacgggacggtgtggggctttccgatcttgttaccccag 468

                
Query: 532 tagcc 536
           |||||
Sbjct: 467 tagcc 463

---

>gb|AY741679.1| Aedes aegypti 40S ribosomal protein S2 (40sRpS2) mRNA, complete cds
          Length = 916

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 58/65 (89%)
 Strand = Plus / Minus

                                                                       
Query: 472 ccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttcccccag 531
           |||||||||||   ||||||||||||||||||||||||  | ||||||||||| ||||||
Sbjct: 573 ccgcacttgccaaagaccttgcagggcacggtgtggggtttaccgatcttgttaccccag 514

                
Query: 532 tagcc 536
           |||||
Sbjct: 513 tagcc 509

---

>gb|DQ439993.1| Aedes aegypti clone AE-155 ribosomal protein S2 mRNA, complete cds
          Length = 828

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 58/65 (89%)
 Strand = Plus / Minus

                                                                       
Query: 472 ccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttcccccag 531
           |||||||||||   ||||||||||||||||||||||||  | ||||||||||| ||||||
Sbjct: 533 ccgcacttgccaaagaccttgcagggcacggtgtggggtttaccgatcttgttaccccag 474

                
Query: 532 tagcc 536
           |||||
Sbjct: 473 tagcc 469

---

>gb|AY292484.1| Molva molva S2 ribosomal protein (S2) gene, partial cds
          Length = 913

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 49/53 (92%)
 Strand = Plus / Minus

                                                                
Query: 481 ccggtgaccttgcagggcacggtgtggggcatgccgatcttgttcccccagta 533
           ||||| |||||||||||||||||||||||| | ||||||||||| ||||||||
Sbjct: 252 ccggtcaccttgcagggcacggtgtggggcttaccgatcttgttaccccagta 200

---

>emb|AL133248.1|ATT8H10 Arabidopsis thaliana DNA chromosome 3, BAC clone T8H10
          Length = 87503

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 73/85 (85%)
 Strand = Plus / Plus

                                                                         
Query: 323   ccttgacgaagttgccaagggtcttggtggatccacgcgaggaagtgaagacatcatcaa 382
             ||||||||||||| ||||| || ||||||||||| |  || ||||| |||||||||||||
Sbjct: 34054 ccttgacgaagtttccaagagttttggtggatcctctagaagaagtaaagacatcatcaa 34113

                                      
Query: 383   taccagcgaactggagcaccttctt 407
             | |||||||| || || ||||||||
Sbjct: 34114 ttccagcgaattgaagaaccttctt 34138

---

>emb|CR938517.1| Single read from an extremity of a full-length cDNA clone made from
           Aedes aegypti total adult females. 5-prime end of clone
           KW0AAA1YK05AAM1 from strain Liverpool of Aedes aegypti
           (yellow fever mosquito)
          Length = 665

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 58/65 (89%)
 Strand = Plus / Minus

                                                                       
Query: 472 ccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttcccccag 531
           |||||||||||   ||||||||||||||||||||||||  | ||||||||||| ||||||
Sbjct: 578 ccgcacttgccaaagaccttgcagggcacggtgtggggtttaccgatcttgttaccccag 519

                
Query: 532 tagcc 536
           |||||
Sbjct: 518 tagcc 514

---

>emb|CR938367.1| Single read from an extremity of a full-length cDNA clone made from
           Aedes aegypti total adult females. 5-prime end of clone
           KW0AAA2YB14AAM1 from strain Liverpool of Aedes aegypti
           (yellow fever mosquito)
          Length = 831

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 58/65 (89%)
 Strand = Plus / Minus

                                                                       
Query: 472 ccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttcccccag 531
           |||||||| |||  ||||||||||||||||||||||||  | ||||||||||| ||||||
Sbjct: 576 ccgcacttaccgaagaccttgcagggcacggtgtggggtttaccgatcttgttaccccag 517

                
Query: 532 tagcc 536
           |||||
Sbjct: 516 tagcc 512



 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 233 actcctggtacggagtcttg 252
           ||||||||||||||||||||
Sbjct: 815 actcctggtacggagtcttg 796

---

>emb|CR938322.1| Single read from an extremity of a full-length cDNA clone made from
           Aedes aegypti total adult females. 5-prime end of clone
           KW0AAA2YD04AAM1 from strain Liverpool of Aedes aegypti
           (yellow fever mosquito)
          Length = 832

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 58/65 (89%)
 Strand = Plus / Minus

                                                                       
Query: 472 ccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttcccccag 531
           |||||||||||   ||||||||||||||||||||||||  | ||||||||||| ||||||
Sbjct: 576 ccgcacttgccaaagaccttgcagggcacggtgtggggtttaccgatcttgttaccccag 517

                
Query: 532 tagcc 536
           |||||
Sbjct: 516 tagcc 512

---

>emb|CR938321.1| Single read from an extremity of a full-length cDNA clone made from
           Aedes aegypti total adult females. 3-prime end of clone
           KW0AAA2YD04BBM1 from strain Liverpool of Aedes aegypti
           (yellow fever mosquito)
          Length = 693

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 58/65 (89%)
 Strand = Plus / Plus

                                                                       
Query: 472 ccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttcccccag 531
           |||||||||||   ||||||||||||||||||||||||  | ||||||||||| ||||||
Sbjct: 386 ccgcacttgccaaagaccttgcagggcacggtgtggggtttaccgatcttgttaccccag 445

                
Query: 532 tagcc 536
           |||||
Sbjct: 446 tagcc 450

---

>emb|CR938259.1| Single read from an extremity of a full-length cDNA clone made from
           Aedes aegypti total adult females. 5-prime end of clone
           KW0AAA2YF08AAM1 from strain Liverpool of Aedes aegypti
           (yellow fever mosquito)
          Length = 812

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 58/65 (89%)
 Strand = Plus / Minus

                                                                       
Query: 472 ccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttcccccag 531
           |||||||||||   ||||||||||||||||||||||||  | ||||||||||| ||||||
Sbjct: 576 ccgcacttgccaaagaccttgcagggcacggtgtggggtttaccgatcttgttaccccag 517

                
Query: 532 tagcc 536
           |||||
Sbjct: 516 tagcc 512

---

>emb|CR938258.1| Single read from an extremity of a full-length cDNA clone made from
           Aedes aegypti total adult females. 3-prime end of clone
           KW0AAA2YF08BBM1 from strain Liverpool of Aedes aegypti
           (yellow fever mosquito)
          Length = 833

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 58/65 (89%)
 Strand = Plus / Plus

                                                                       
Query: 472 ccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttcccccag 531
           |||||||||||   ||||||||||||||||||||||||  | ||||||||||| ||||||
Sbjct: 374 ccgcacttgccaaagaccttgcagggcacggtgtggggtttaccgatcttgttaccccag 433

                
Query: 532 tagcc 536
           |||||
Sbjct: 434 tagcc 438

---

>emb|CR938129.1| Single read from an extremity of a full-length cDNA clone made from
           Aedes aegypti total adult females. 5-prime end of clone
           KW0AAA2YJ12AAM1 from strain Liverpool of Aedes aegypti
           (yellow fever mosquito)
          Length = 831

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 58/65 (89%)
 Strand = Plus / Minus

                                                                       
Query: 472 ccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttcccccag 531
           |||||||| |||  ||||||||||||||||||||||||  | ||||||||||| ||||||
Sbjct: 576 ccgcacttaccgaagaccttgcagggcacggtgtggggtttaccgatcttgttaccccag 517

                
Query: 532 tagcc 536
           |||||
Sbjct: 516 tagcc 512



 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 233 actcctggtacggagtcttg 252
           ||||||||||||||||||||
Sbjct: 815 actcctggtacggagtcttg 796

---

>emb|CR938020.1| Single read from an extremity of a full-length cDNA clone made from
           Aedes aegypti total adult females. 5-prime end of clone
           KW0AAA2YN04AAM1 from strain Liverpool of Aedes aegypti
           (yellow fever mosquito)
          Length = 689

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 58/65 (89%)
 Strand = Plus / Minus

                                                                       
Query: 472 ccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttcccccag 531
           |||||||| |||  ||||||||||||||||||||||||  | ||||||||||| ||||||
Sbjct: 596 ccgcacttaccgaagaccttgcagggcacggtgtggggtttaccgatcttgttaccccag 537

                
Query: 532 tagcc 536
           |||||
Sbjct: 536 tagcc 532

---

>emb|CR937910.1| Single read from an extremity of a cDNA clone made from Aedes
           aegypti total adult females. 5-prime end of clone
           KW0AAB1YA15AAM1 from strain Liverpool of Aedes aegypti
           (yellow fever mosquito)
          Length = 787

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 58/65 (89%)
 Strand = Plus / Minus

                                                                       
Query: 472 ccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttcccccag 531
           |||||||||||   ||||||||||||||||||||||||  | ||||||||||| ||||||
Sbjct: 576 ccgcacttgccaaagaccttgcagggcacggtgtggggtttaccgatcttgttaccccag 517

                
Query: 532 tagcc 536
           |||||
Sbjct: 516 tagcc 512

---

>emb|CR937909.1| Single read from an extremity of a cDNA clone made from Aedes
           aegypti total adult females. 3-prime end of clone
           KW0AAB1YA15BBM1 from strain Liverpool of Aedes aegypti
           (yellow fever mosquito)
          Length = 633

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 58/65 (89%)
 Strand = Plus / Plus

                                                                       
Query: 472 ccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttcccccag 531
           |||||||||||   ||||||||||||||||||||||||  | ||||||||||| ||||||
Sbjct: 387 ccgcacttgccaaagaccttgcagggcacggtgtggggtttaccgatcttgttaccccag 446

                
Query: 532 tagcc 536
           |||||
Sbjct: 447 tagcc 451

---

>ref|XM_946019.1| PREDICTED: Homo sapiens similar to ribosomal protein S2, transcript
           variant 3 (LOC650901), mRNA
          Length = 904

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 46/49 (93%)
 Strand = Plus / Minus

                                                            
Query: 488 ccttgcagggcacggtgtggggcatgccgatcttgttcccccagtagcc 536
           ||||||| || |||||||||||| |||||||||||||||||||||||||
Sbjct: 574 ccttgcaagggacggtgtggggcttgccgatcttgttcccccagtagcc 526

---

>gb|DQ214052.1| Taeniopygia guttata clone 0058P0045G10 ribosomal protein S2-like
           mRNA, complete sequence
          Length = 890

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 51/56 (91%)
 Strand = Plus / Minus

                                                                   
Query: 481 ccggtgaccttgcagggcacggtgtggggcatgccgatcttgttcccccagtagcc 536
           |||||||||||||||||||| ||||| ||| | ||||||||||| |||||||||||
Sbjct: 512 ccggtgaccttgcagggcaccgtgtgtggcttcccgatcttgttgccccagtagcc 457



 Score = 44.1 bits (22), Expect = 0.47
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 229 gtgaactcctggtacggagtcttggtgaag 258
           |||||||||||||| |||| ||||||||||
Sbjct: 764 gtgaactcctggtaaggagacttggtgaag 735

---

>gb|DQ214051.1| Taeniopygia guttata clone 0058P0017F05 ribosomal protein S2-like
           mRNA, complete sequence
          Length = 931

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 51/56 (91%)
 Strand = Plus / Minus

                                                                   
Query: 481 ccggtgaccttgcagggcacggtgtggggcatgccgatcttgttcccccagtagcc 536
           |||||||||||||||||||| ||||| ||| | ||||||||||| |||||||||||
Sbjct: 562 ccggtgaccttgcagggcaccgtgtgtggcttcccgatcttgttgccccagtagcc 507



 Score = 44.1 bits (22), Expect = 0.47
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 229 gtgaactcctggtacggagtcttggtgaag 258
           |||||||||||||| |||| ||||||||||
Sbjct: 814 gtgaactcctggtaaggagacttggtgaag 785

---

>gb|DQ214050.1| Taeniopygia guttata clone 0061P0020E02 ribosomal protein S2-like
           mRNA, complete sequence
          Length = 939

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 51/56 (91%)
 Strand = Plus / Minus

                                                                   
Query: 481 ccggtgaccttgcagggcacggtgtggggcatgccgatcttgttcccccagtagcc 536
           |||||||||||||||||||| ||||| ||| | ||||||||||| |||||||||||
Sbjct: 562 ccggtgaccttgcagggcaccgtgtgtggcttcccgatcttgttgccccagtagcc 507



 Score = 44.1 bits (22), Expect = 0.47
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 229 gtgaactcctggtacggagtcttggtgaag 258
           |||||||||||||| |||| ||||||||||
Sbjct: 815 gtgaactcctggtaaggagacttggtgaag 786

---

>gb|AY769315.1| Bombyx mori ribosomal protein S2 (RpS2) mRNA, complete cds
          Length = 885

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 60/68 (88%)
 Strand = Plus / Minus

                                                                       
Query: 466 acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 525
           ||||| || |||||||||||||||||||| || |||||||| ||| | ||||||||||| 
Sbjct: 569 acagaaccacacttgccggtgaccttgcaagggacggtgtgtggctttccgatcttgtta 510

                   
Query: 526 ccccagta 533
           ||||||||
Sbjct: 509 ccccagta 502

---

>gb|AY292481.1| Trisopterus esmarkii S2 ribosomal protein (S2) gene, partial cds
          Length = 907

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 42/44 (95%)
 Strand = Plus / Minus

                                                       
Query: 487 accttgcagggcacggtgtggggcatgccgatcttgttccccca 530
           |||||||||||||||||||||||| ||||||||||||| |||||
Sbjct: 246 accttgcagggcacggtgtggggcttgccgatcttgttacccca 203

---

>dbj|AP003745.5| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC
              clone:OJ1123_B01
          Length = 105736

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 75/88 (85%)
 Strand = Plus / Minus

                                                                          
Query: 323    ccttgacgaagttgccaagggtcttggtggatccacgcgaggaagtgaagacatcatcaa 382
              |||||||||||||||  |||||||||||||| ||||| || || |||||||| || || |
Sbjct: 102303 ccttgacgaagttgctgagggtcttggtggagccacgtgacgaggtgaagacgtcctcga 102244

                                          
Query: 383    taccagcgaactggagcaccttcttggg 410
              | || |||||||  ||||||||||||||
Sbjct: 102243 tgccggcgaacttaagcaccttcttggg 102216



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 39/45 (86%)
 Strand = Plus / Minus

                                                           
Query: 466    acagagccgcacttgccggtgaccttgcagggcacggtgtggggc 510
              ||||||||| ||||| |||  |||||||| | |||||||||||||
Sbjct: 102160 acagagccgtacttgtcggcaaccttgcacgacacggtgtggggc 102116

---

>dbj|AP004349.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC
             clone:P0684A03
          Length = 64705

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 75/88 (85%)
 Strand = Plus / Minus

                                                                         
Query: 323   ccttgacgaagttgccaagggtcttggtggatccacgcgaggaagtgaagacatcatcaa 382
             |||||||||||||||  |||||||||||||| ||||| || || |||||||| || || |
Sbjct: 13624 ccttgacgaagttgctgagggtcttggtggagccacgtgacgaggtgaagacgtcctcga 13565

                                         
Query: 383   taccagcgaactggagcaccttcttggg 410
             | || |||||||  ||||||||||||||
Sbjct: 13564 tgccggcgaacttaagcaccttcttggg 13537



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 39/45 (86%)
 Strand = Plus / Minus

                                                          
Query: 466   acagagccgcacttgccggtgaccttgcagggcacggtgtggggc 510
             ||||||||| ||||| |||  |||||||| | |||||||||||||
Sbjct: 13481 acagagccgtacttgtcggcaaccttgcacgacacggtgtggggc 13437

---

>gb|BC105985.1| Homo sapiens ribosomal protein S2, mRNA (cDNA clone MGC:102851
           IMAGE:5114688), complete cds
          Length = 956

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 62/71 (87%)
 Strand = Plus / Minus

                                                                       
Query: 466 acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 525
           |||||||||||   ||| || |||||||| || || ||||||||| ||||||||||||||
Sbjct: 584 acagagccgcagcggcctgtcaccttgcaagggacagtgtggggcttgccgatcttgttc 525

                      
Query: 526 ccccagtagcc 536
           |||||||||||
Sbjct: 524 ccccagtagcc 514

---

>gb|BC106060.1| Homo sapiens ribosomal protein S2, mRNA (cDNA clone MGC:117345
           IMAGE:6471612), complete cds
          Length = 998

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 62/71 (87%)
 Strand = Plus / Minus

                                                                       
Query: 466 acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 525
           |||||||||||   ||| || |||||||| || || ||||||||| ||||||||||||||
Sbjct: 583 acagagccgcagcggcctgtcaccttgcaagggacagtgtggggcttgccgatcttgttc 524

                      
Query: 526 ccccagtagcc 536
           |||||||||||
Sbjct: 523 ccccagtagcc 513

---

>gb|BC103756.1| Homo sapiens ribosomal protein S2, mRNA (cDNA clone MGC:117344
           IMAGE:6008803), complete cds
          Length = 990

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 62/71 (87%)
 Strand = Plus / Minus

                                                                       
Query: 466 acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 525
           |||||||||||   ||| || |||||||| || || ||||||||| ||||||||||||||
Sbjct: 608 acagagccgcagcggcctgtcaccttgcaagggacagtgtggggcttgccgatcttgttc 549

                      
Query: 526 ccccagtagcc 536
           |||||||||||
Sbjct: 548 ccccagtagcc 538

---

>gb|BC098726.1| Rattus norvegicus ribosomal protein S2, mRNA (cDNA clone MGC:112718
           IMAGE:7378399), complete cds
          Length = 949

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 50/55 (90%)
 Strand = Plus / Minus

                                                                  
Query: 487 accttgcagggcacggtgtggggcatgccgatcttgttcccccagtagcccctcc 541
           |||||||| ||||| ||||||||| |||| |||||||||||||||||||| ||||
Sbjct: 554 accttgcatggcacagtgtggggcttgccaatcttgttcccccagtagcctctcc 500

---

>ref|XM_514839.1| PREDICTED: Pan troglodytes similar to ribosomal protein S2
           (LOC458481), mRNA
          Length = 956

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 62/71 (87%)
 Strand = Plus / Minus

                                                                       
Query: 466 acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 525
           |||||||||||   ||| || |||||||| || || ||||||||| ||||||||||||||
Sbjct: 589 acagagccgcagcggcctgtcaccttgcaagggacagtgtggggcttgccgatcttgttc 530

                      
Query: 526 ccccagtagcc 536
           |||||||||||
Sbjct: 529 ccccagtagcc 519

---

>ref|XM_511195.1| PREDICTED: Pan troglodytes LOC454344 (LOC454344), mRNA
          Length = 945

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 62/71 (87%)
 Strand = Plus / Minus

                                                                       
Query: 466 acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 525
           |||||||||||   ||| || |||||||| || || ||||||||| ||||||||||||||
Sbjct: 581 acagagccgcagcggcctgtcaccttgcaagggacagtgtggggcttgccgatcttgttc 522

                      
Query: 526 ccccagtagcc 536
           |||||||||||
Sbjct: 521 ccccagtagcc 511

---

>ref|XM_510798.1| PREDICTED: Pan troglodytes similar to ribosomal protein S2; 40S
           ribosomal protein S2 (LOC453897), mRNA
          Length = 877

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 62/71 (87%)
 Strand = Plus / Minus

                                                                       
Query: 466 acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 525
           |||||||||||   ||| || |||||||| || || ||||||||| ||||||||||||||
Sbjct: 570 acagagccgcagcggcctgtcaccttgcaagggacagtgtggggcttgccgatcttgttc 511

                      
Query: 526 ccccagtagcc 536
           |||||||||||
Sbjct: 510 ccccagtagcc 500

---

>ref|XM_520152.1| PREDICTED: Pan troglodytes similar to ribosomal protein S2; 40S
           ribosomal protein S2 (LOC464617), mRNA
          Length = 774

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 62/71 (87%)
 Strand = Plus / Minus

                                                                       
Query: 466 acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 525
           |||||||||||   ||| || |||||||| || |||||||||||  ||||||||||||||
Sbjct: 452 acagagccgcagcggcctgtcaccttgcaagggacggtgtggggtttgccgatcttgttc 393

                      
Query: 526 ccccagtagcc 536
           |||||||||||
Sbjct: 392 ccccagtagcc 382

---

>ref|XM_527688.1| PREDICTED: Pan troglodytes similar to MGC27348 protein (LOC472313),
           mRNA
          Length = 555

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 62/71 (87%)
 Strand = Plus / Minus

                                                                       
Query: 466 acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 525
           |||||||||||   ||| || |||||||| || ||||||||| || ||||||||||||||
Sbjct: 390 acagagccgcagcggcctgtcaccttgcaagggacggtgtggagcttgccgatcttgttc 331

                      
Query: 526 ccccagtagcc 536
           |||||||||||
Sbjct: 330 ccccagtagcc 320

---

>gb|BC016178.1| Homo sapiens ribosomal protein S2, mRNA (cDNA clone MGC:17896
           IMAGE:3909865), complete cds
          Length = 950

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 62/71 (87%)
 Strand = Plus / Minus

                                                                       
Query: 466 acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 525
           |||||||||||   ||| || |||||||| || || ||||||||| ||||||||||||||
Sbjct: 575 acagagccgcagcggcctgtcaccttgcaagggacagtgtggggcttgccgatcttgttc 516

                      
Query: 526 ccccagtagcc 536
           |||||||||||
Sbjct: 515 ccccagtagcc 505

---

>gb|AC092268.4| Homo sapiens chromosome X clone RP11-185O17 map p11.4, complete
             sequence
          Length = 183539

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 62/71 (87%)
 Strand = Plus / Plus

                                                                         
Query: 466   acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 525
             |||||||||||   ||| || |||||||| || |||||||||||| ||||||||||||||
Sbjct: 78747 acagagccgcagcggcctgtcaccttgcaagggacggtgtggggcttgccgatcttgttc 78806

                        
Query: 526   ccccagtagcc 536
             | |||||||||
Sbjct: 78807 ctccagtagcc 78817

---

>gb|BC075830.1| Homo sapiens ribosomal protein S2, mRNA (cDNA clone MGC:88606
           IMAGE:5441508), complete cds
          Length = 948

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 62/71 (87%)
 Strand = Plus / Minus

                                                                       
Query: 466 acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 525
           |||||||||||   ||| || |||||||| || || ||||||||| ||||||||||||||
Sbjct: 583 acagagccgcagcggcctgtcaccttgcaagggacagtgtggggcttgccgatcttgttc 524

                      
Query: 526 ccccagtagcc 536
           |||||||||||
Sbjct: 523 ccccagtagcc 513

---

>gb|BC073966.1| Homo sapiens ribosomal protein S2, mRNA (cDNA clone MGC:87875
           IMAGE:6047887), complete cds
          Length = 962

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 62/71 (87%)
 Strand = Plus / Minus

                                                                       
Query: 466 acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 525
           |||||||||||   ||| || |||||||| || || ||||||||| ||||||||||||||
Sbjct: 582 acagagccgcagcggcctgtcaccttgcaagggacagtgtggggcttgccgatcttgttc 523

                      
Query: 526 ccccagtagcc 536
           |||||||||||
Sbjct: 522 ccccagtagcc 512

---

>gb|BC012354.1| Homo sapiens ribosomal protein S2, mRNA (cDNA clone MGC:20390
           IMAGE:4564801), complete cds
          Length = 945

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 62/71 (87%)
 Strand = Plus / Minus

                                                                       
Query: 466 acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 525
           |||||||||||   ||| || |||||||| || || ||||||||| ||||||||||||||
Sbjct: 578 acagagccgcagcggcctgtcaccttgcaagggacagtgtggggcttgccgatcttgttc 519

                      
Query: 526 ccccagtagcc 536
           |||||||||||
Sbjct: 518 ccccagtagcc 508

---

>gb|BC010165.2| Homo sapiens ribosomal protein S2, mRNA (cDNA clone MGC:19832
           IMAGE:4040679), complete cds
          Length = 976

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 62/71 (87%)
 Strand = Plus / Minus

                                                                       
Query: 466 acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 525
           |||||||||||   ||| || |||||||| || || ||||||||| ||||||||||||||
Sbjct: 578 acagagccgcagcggcctgtcaccttgcaagggacagtgtggggcttgccgatcttgttc 519

                      
Query: 526 ccccagtagcc 536
           |||||||||||
Sbjct: 518 ccccagtagcc 508

---

>gb|BC025677.1| Homo sapiens ribosomal protein S2, mRNA (cDNA clone MGC:35569
           IMAGE:5203563), complete cds
          Length = 966

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 62/71 (87%)
 Strand = Plus / Minus

                                                                       
Query: 466 acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 525
           |||||||||||   ||| || |||||||| || || ||||||||| ||||||||||||||
Sbjct: 576 acagagccgcagcggcctgtcaccttgcaagggacagtgtggggcttgccgatcttgttc 517

                      
Query: 526 ccccagtagcc 536
           |||||||||||
Sbjct: 516 ccccagtagcc 506

---

>gb|BC001795.1| Homo sapiens ribosomal protein S2, mRNA (cDNA clone MGC:3141
           IMAGE:3353508), complete cds
          Length = 978

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 62/71 (87%)
 Strand = Plus / Minus

                                                                       
Query: 466 acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 525
           |||||||||||   ||| || |||||||| || || ||||||||| ||||||||||||||
Sbjct: 583 acagagccgcagcggcctgtcaccttgcaagggacagtgtggggcttgccgatcttgttc 524

                      
Query: 526 ccccagtagcc 536
           |||||||||||
Sbjct: 523 ccccagtagcc 513

---

>gb|BC016951.2| Homo sapiens ribosomal protein S2, mRNA (cDNA clone MGC:21506
           IMAGE:3883854), complete cds
          Length = 945

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 62/71 (87%)
 Strand = Plus / Minus

                                                                       
Query: 466 acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 525
           |||||||||||   ||| || |||||||| || || ||||||||| ||||||||||||||
Sbjct: 583 acagagccgcagcggcctgtcaccttgcaagggacagtgtggggcttgccgatcttgttc 524

                      
Query: 526 ccccagtagcc 536
           |||||||||||
Sbjct: 523 ccccagtagcc 513

---

>gb|BC021545.1| Homo sapiens ribosomal protein S2, mRNA (cDNA clone MGC:15956
           IMAGE:3538227), complete cds
          Length = 952

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 62/71 (87%)
 Strand = Plus / Minus

                                                                       
Query: 466 acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 525
           |||||||||||   ||| || |||||||| || || ||||||||| ||||||||||||||
Sbjct: 583 acagagccgcagcggcctgtcaccttgcaagggacagtgtggggcttgccgatcttgttc 524

                      
Query: 526 ccccagtagcc 536
           |||||||||||
Sbjct: 523 ccccagtagcc 513

---

>gb|BC023541.1| Homo sapiens ribosomal protein S2, mRNA (cDNA clone MGC:15421
           IMAGE:4120795), complete cds
          Length = 980

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 62/71 (87%)
 Strand = Plus / Minus

                                                                       
Query: 466 acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 525
           |||||||||||   ||| || |||||||| || || ||||||||| ||||||||||||||
Sbjct: 578 acagagccgcagcggcctgtcaccttgcaagggacagtgtggggcttgccgatcttgttc 519

                      
Query: 526 ccccagtagcc 536
           |||||||||||
Sbjct: 518 ccccagtagcc 508

---

>ref|NM_031838.3| Rattus norvegicus ribosomal protein S2 (Rps2), mRNA
          Length = 952

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 50/55 (90%)
 Strand = Plus / Minus

                                                                  
Query: 487 accttgcagggcacggtgtggggcatgccgatcttgttcccccagtagcccctcc 541
           |||||||| ||||| ||||||||| |||| |||||||||||||||||||| ||||
Sbjct: 565 accttgcatggcacagtgtggggcttgccaatcttgttcccccagtagcctctcc 511

---

>gb|BC061291.1| Xenopus tropicalis cDNA clone IMAGE:5381631, containing frame-shift
           errors
          Length = 936

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 44/47 (93%)
 Strand = Plus / Minus

                                                          
Query: 487 accttgcagggcacggtgtggggcatgccgatcttgttcccccagta 533
           |||||||||||||| ||||||||| ||||||||||||| ||||||||
Sbjct: 523 accttgcagggcacagtgtggggcttgccgatcttgttaccccagta 477

---

>ref|XR_003219.1| PREDICTED: Mus musculus similar to ribosomal protein S2
           (LOC670968), mRNA
          Length = 953

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 50/55 (90%)
 Strand = Plus / Minus

                                                                  
Query: 487 accttgcagggcacggtgtggggcatgccgatcttgttcccccagtagcccctcc 541
           |||||||| ||||| ||||||||| |||| |||||||||||||||||||| ||||
Sbjct: 558 accttgcatggcacagtgtggggcttgccaatcttgttcccccagtagcctctcc 504

---

>gb|BC019021.2| Homo sapiens ribosomal protein S2, mRNA (cDNA clone IMAGE:4547162)
          Length = 933

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 62/71 (87%)
 Strand = Plus / Minus

                                                                       
Query: 466 acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 525
           |||||||||||   ||| || |||||||| || || ||||||||| ||||||||||||||
Sbjct: 568 acagagccgcagcggcctgtcaccttgcaagggacagtgtggggcttgccgatcttgttc 509

                      
Query: 526 ccccagtagcc 536
           |||||||||||
Sbjct: 508 ccccagtagcc 498

---

>gb|BC005824.1| Homo sapiens cDNA clone IMAGE:2823381, **** WARNING: chimeric clone
           ****
          Length = 3287

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 62/71 (87%)
 Strand = Plus / Minus

                                                                       
Query: 466 acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 525
           |||||||||||   ||| || |||||||| || || ||||||||| ||||||||||||||
Sbjct: 593 acagagccgcagcggcctgtcaccttgcaagggacagtgtggggcttgccgatcttgttc 534

                      
Query: 526 ccccagtagcc 536
           |||||||||||
Sbjct: 533 ccccagtagcc 523

---

>gb|BC005129.1| Homo sapiens PDZ domain containing 7, mRNA (cDNA clone
            IMAGE:3842021), **** WARNING: chimeric clone ****
          Length = 2929

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 62/71 (87%)
 Strand = Plus / Minus

                                                                        
Query: 466  acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 525
            |||||||||||   ||| || |||||||| || || ||||||||| ||||||||||||||
Sbjct: 2564 acagagccgcagcggcctgtcaccttgcaagggacagtgtggggcttgccgatcttgttc 2505

                       
Query: 526  ccccagtagcc 536
            |||||||||||
Sbjct: 2504 ccccagtagcc 2494

---

>gb|BC020336.1| Homo sapiens ribosomal protein S2, mRNA (cDNA clone IMAGE:3857902)
          Length = 956

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 62/71 (87%)
 Strand = Plus / Plus

                                                                       
Query: 466 acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 525
           |||||||||||   ||| || |||||||| || || ||||||||| ||||||||||||||
Sbjct: 370 acagagccgcagcggcctgtcaccttgcaagggacagtgtggggcttgccgatcttgttc 429

                      
Query: 526 ccccagtagcc 536
           |||||||||||
Sbjct: 430 ccccagtagcc 440

---

>gb|AC023105.7| Homo sapiens BAC clone GS1-13M19 from 7, complete sequence
          Length = 70876

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 62/71 (87%)
 Strand = Plus / Minus

                                                                        
Query: 466  acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 525
            |||||||||||   ||| || |||||||| || ||||||||| || ||||||||||||||
Sbjct: 2986 acagagccgcagcggcctgtcaccttgcaagggacggtgtggagcttgccgatcttgttc 2927

                       
Query: 526  ccccagtagcc 536
            |||||||||||
Sbjct: 2926 ccccagtagcc 2916

---

>ref|NG_002360.1| Homo sapiens ribosomal protein S2 pseudogene (LOC125208) on
           chromosome 17
          Length = 1111

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 62/71 (87%)
 Strand = Plus / Minus

                                                                       
Query: 466 acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 525
           |||||||||||   ||| || |||||||| || || ||||||||| ||||||||||||||
Sbjct: 664 acagagccgcagcagcctgtcaccttgcaagggacagtgtggggcttgccgatcttgttc 605

                      
Query: 526 ccccagtagcc 536
           |||||||||||
Sbjct: 604 ccccagtagcc 594

---

>gb|AC004448.4| Homo sapiens chromosome 17, clone CTB-187M2, complete sequence
          Length = 149157

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 62/71 (87%)
 Strand = Plus / Minus

                                                                         
Query: 466   acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 525
             |||||||||||   ||| || |||||||| || || ||||||||| ||||||||||||||
Sbjct: 70615 acagagccgcagcagcctgtcaccttgcaagggacagtgtggggcttgccgatcttgttc 70556

                        
Query: 526   ccccagtagcc 536
             |||||||||||
Sbjct: 70555 ccccagtagcc 70545

---

>gb|BC021002.1| Homo sapiens cDNA clone IMAGE:3841858, **** WARNING: chimeric clone
            ****
          Length = 3491

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 62/71 (87%)
 Strand = Plus / Minus

                                                                        
Query: 466  acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 525
            |||||||||||   ||| || |||||||| || || ||||||||| ||||||||||||||
Sbjct: 3126 acagagccgcagcggcctgtcaccttgcaagggacagtgtggggcttgccgatcttgttc 3067

                       
Query: 526  ccccagtagcc 536
            |||||||||||
Sbjct: 3066 ccccagtagcc 3056

---

>gb|BC063508.1| Homo sapiens cDNA clone IMAGE:3861495, **** WARNING: chimeric clone
            ****
          Length = 1451

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 62/71 (87%)
 Strand = Plus / Minus

                                                                        
Query: 466  acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 525
            |||||||||||   ||| || |||||||| || || ||||||||| ||||||||||||||
Sbjct: 1089 acagagccgcagcggcctgtcaccttgcaagggacagtgtggggcttgccgatcttgttc 1030

                       
Query: 526  ccccagtagcc 536
            |||||||||||
Sbjct: 1029 ccccagtagcc 1019

---

>gb|BC044628.1| Homo sapiens mRNA similar to collagen, type XVII, alpha 1 (cDNA clone
            IMAGE:5431129)
          Length = 4175

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 62/71 (87%)
 Strand = Plus / Minus

                                                                        
Query: 466  acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 525
            |||||||||||   ||| || |||||||| || || ||||||||| ||||||||||||||
Sbjct: 3810 acagagccgcagcggcctgtcaccttgcaagggacagtgtggggcttgccgatcttgttc 3751

                       
Query: 526  ccccagtagcc 536
            |||||||||||
Sbjct: 3750 ccccagtagcc 3740

---

>gb|BC011850.1| Homo sapiens mRNA similar to delta (Drosophila)-like 3 (cDNA clone
            IMAGE:4136318)
          Length = 2960

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 62/71 (87%)
 Strand = Plus / Minus

                                                                        
Query: 466  acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 525
            |||||||||||   ||| || |||||||| || || ||||||||| ||||||||||||||
Sbjct: 2594 acagagccgcagcggcctgtcaccttgcaagggacagtgtggggcttgccgatcttgttc 2535

                       
Query: 526  ccccagtagcc 536
            |||||||||||
Sbjct: 2534 ccccagtagcc 2524

---

>gb|BC011661.1| Homo sapiens cDNA clone IMAGE:4130973, **** WARNING: chimeric clone
            ****
          Length = 1766

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 62/71 (87%)
 Strand = Plus / Minus

                                                                        
Query: 466  acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 525
            |||||||||||   ||| || |||||||| || || ||||||||| ||||||||||||||
Sbjct: 1401 acagagccgcagcggcctgtcaccttgcaagggacagtgtggggcttgccgatcttgttc 1342

                       
Query: 526  ccccagtagcc 536
            |||||||||||
Sbjct: 1341 ccccagtagcc 1331

---

>gb|BC012773.1| Homo sapiens cDNA clone IMAGE:3837950, **** WARNING: chimeric clone
            ****
          Length = 2181

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 62/71 (87%)
 Strand = Plus / Minus

                                                                        
Query: 466  acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 525
            |||||||||||   ||| || |||||||| || || ||||||||| ||||||||||||||
Sbjct: 1815 acagagccgcagcggcctgtcaccttgcaagggacagtgtggggcttgccgatcttgttc 1756

                       
Query: 526  ccccagtagcc 536
            |||||||||||
Sbjct: 1755 ccccagtagcc 1745

---

>gb|BC004120.1| Homo sapiens mRNA similar to ribosomal protein S2 (cDNA clone
            IMAGE:3925714)
          Length = 1693

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 62/71 (87%)
 Strand = Plus / Minus

                                                                        
Query: 466  acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 525
            |||||||||||   ||| || |||||||| || || ||||||||| ||||||||||||||
Sbjct: 1312 acagagccgcagcggcctgtcaccttgcaagggacagtgtggggcttgccgatcttgttc 1253

                       
Query: 526  ccccagtagcc 536
            |||||||||||
Sbjct: 1252 ccccagtagcc 1242

---

>gb|BC013970.1| Homo sapiens mRNA similar to makorin, ring finger protein, 3 (cDNA
            clone IMAGE:3958123)
          Length = 3291

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 62/71 (87%)
 Strand = Plus / Minus

                                                                        
Query: 466  acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 525
            |||||||||||   ||| || |||||||| || || ||||||||| ||||||||||||||
Sbjct: 2920 acagagccgcagcggcctgtcaccttgcaagggacagtgtggggcttgccgatcttgttc 2861

                       
Query: 526  ccccagtagcc 536
            |||||||||||
Sbjct: 2860 ccccagtagcc 2850

---

>emb|AL663070.15| Human DNA sequence from clone RP3-342P20 on chromosome 1 Contains the
             gene for a novel protein (FLJ90702, FLJ14997 and
             FLJ35904), a ribosomal protein S2 (RPS2) pseudogene and
             two CpG islands, complete sequence
          Length = 115043

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 62/71 (87%)
 Strand = Plus / Minus

                                                                         
Query: 466   acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 525
             |||||||||||   ||| || |||||||| || |||||||||||| ||| ||||||||||
Sbjct: 39151 acagagccgcagcggcctgtcaccttgcaagggacggtgtggggcttgctgatcttgttc 39092

                        
Query: 526   ccccagtagcc 536
             |||||||||||
Sbjct: 39091 ccccagtagcc 39081

---

>emb|AL590383.6| Human DNA sequence from clone RP11-213N20 on chromosome 6 Contains a
            ribosomal protein S2 pseudogene, the 3' end of the gene
            for an endocrine regulator (HRIHFB2436) and a CpG island,
            complete sequence
          Length = 24232

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 62/71 (87%)
 Strand = Plus / Minus

                                                                        
Query: 466  acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 525
            ||||||||||| | ||| || |||||||| || |||||||||||| ||  ||||||||||
Sbjct: 1767 acagagccgcagtagcctgtcaccttgcaaggaacggtgtggggcttgtggatcttgttc 1708

                       
Query: 526  ccccagtagcc 536
            |||||||||||
Sbjct: 1707 ccccagtagcc 1697

---

>emb|AL583834.6| Human DNA sequence from clone RP11-480N24 on chromosome 6 Contains the
             SLC22A7 gene for solute carrier family 22 (organic anion
             transporter) member 7, a novel protein  similar to M.
             musculus thymus LIM protein TLP-A (LOC168153), a ribosomal
             protein L12 (RPL12) pseudogene, a ribosomal protein L34
             (RPL34) pseudogene, the 3' end of a gene for an endocrine
             regulator (HRIHFB2436) and a ribosomal protein S2 (RPS2)
             pseudogene, complete sequence
          Length = 69535

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 62/71 (87%)
 Strand = Plus / Minus

                                                                         
Query: 466   acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 525
             ||||||||||| | ||| || |||||||| || |||||||||||| ||  ||||||||||
Sbjct: 69302 acagagccgcagtagcctgtcaccttgcaaggaacggtgtggggcttgtggatcttgttc 69243

                        
Query: 526   ccccagtagcc 536
             |||||||||||
Sbjct: 69242 ccccagtagcc 69232

---

>gb|AC026366.20| Homo sapiens 12 BAC RP11-139O18 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 164429

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 62/71 (87%)
 Strand = Plus / Minus

                                                                          
Query: 466    acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 525
              |||||||||||   ||| || |||||||| || || ||||||||| ||||||||||||||
Sbjct: 146135 acagagccgcagcggcctgtcaccttgcaagggacagtgtggggcttgccgatcttgttc 146076

                         
Query: 526    ccccagtagcc 536
              |||||||||||
Sbjct: 146075 ccccagtagcc 146065

---

>emb|X57432.1|RRRPS2 R.rattus mRNA for ribosomal protein S2
          Length = 922

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 50/55 (90%)
 Strand = Plus / Minus

                                                                  
Query: 487 accttgcagggcacggtgtggggcatgccgatcttgttcccccagtagcccctcc 541
           |||||||| ||||| ||||||||| |||| |||||||||||||||||||| ||||
Sbjct: 575 accttgcatggcacagtgtggggcttgccaatcttgttcccccagtagcctctcc 521

---

>gb|BC066321.1| Homo sapiens ribosomal protein S2, mRNA (cDNA clone MGC:87212
           IMAGE:5296344), complete cds
          Length = 957

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 62/71 (87%)
 Strand = Plus / Minus

                                                                       
Query: 466 acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 525
           |||||||||||   ||| || |||||||| || || ||||||||| ||||||||||||||
Sbjct: 595 acagagccgcagcggcctgtcaccttgcaagggacagtgtggggcttgccgatcttgttc 536

                      
Query: 526 ccccagtagcc 536
           |||||||||||
Sbjct: 535 ccccagtagcc 525

---

>emb|AL832857.1|HSM804168 Homo sapiens genomic DNA; cDNA DKFZp667P2125 (from clone
           DKFZp667P2125)
          Length = 963

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 62/71 (87%)
 Strand = Plus / Minus

                                                                       
Query: 466 acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 525
           |||||||||||   ||| || |||||||| || || ||||||||| ||||||||||||||
Sbjct: 581 acagagccgcagcggcctgtcaccttgcaagggacagtgtggggcttgccgatcttgttc 522

                      
Query: 526 ccccagtagcc 536
           |||||||||||
Sbjct: 521 ccccagtagcc 511

---

>gb|BC008862.2| Homo sapiens ribosomal protein S2, mRNA (cDNA clone MGC:16692
           IMAGE:4126765), complete cds
          Length = 949

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 62/71 (87%)
 Strand = Plus / Minus

                                                                       
Query: 466 acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 525
           |||||||||||   ||| || |||||||| || || ||||||||| ||||||||||||||
Sbjct: 583 acagagccgcagcggcctgtcaccttgcaagggacagtgtggggcttgccgatcttgttc 524

                      
Query: 526 ccccagtagcc 536
           |||||||||||
Sbjct: 523 ccccagtagcc 513

---

>emb|BX649539.6| Mouse DNA sequence from clone RP24-371A24 on chromosome 4 Contains a
              ribosomal protein S2 (Rps2) pseudogene, complete sequence
          Length = 198964

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 50/55 (90%)
 Strand = Plus / Minus

                                                                     
Query: 487    accttgcagggcacggtgtggggcatgccgatcttgttcccccagtagcccctcc 541
              |||||||| ||||| ||||||||| |||| |||||||||||||||||||| ||||
Sbjct: 163817 accttgcatggcacagtgtggggcttgccaatcttgttcccccagtagcctctcc 163763

---

>gb|BC006559.2| Homo sapiens ribosomal protein S2, mRNA (cDNA clone MGC:2778
           IMAGE:2959602), complete cds
          Length = 951

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 62/71 (87%)
 Strand = Plus / Minus

                                                                       
Query: 466 acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 525
           |||||||||||   ||| || |||||||| || || ||||||||| ||||||||||||||
Sbjct: 583 acagagccgcagcggcctgtcaccttgcaagggacagtgtggggcttgccgatcttgttc 524

                      
Query: 526 ccccagtagcc 536
           |||||||||||
Sbjct: 523 ccccagtagcc 513

---

>gb|BC035504.1| Homo sapiens, clone IMAGE:4636047, mRNA
          Length = 3228

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 62/71 (87%)
 Strand = Plus / Plus

                                                                       
Query: 466 acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 525
           |||||||||||   ||| || |||||||| || || ||||||||| ||||||||||||||
Sbjct: 297 acagagccgcagcggcctgtcaccttgcaagggacagtgtggggcttgccgatcttgttc 356

                      
Query: 526 ccccagtagcc 536
           |||||||||||
Sbjct: 357 ccccagtagcc 367

---

>gb|BC026177.1| Homo sapiens ribosomal protein S2 pseudogene, mRNA (cDNA clone
           MGC:27348 IMAGE:4671259), complete cds
          Length = 862

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 62/71 (87%)
 Strand = Plus / Minus

                                                                       
Query: 466 acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 525
           |||||||||||   ||| || |||||||| || ||||||||| || ||||||||||||||
Sbjct: 471 acagagccgcagcggcctgtcaccttgcaagggacggtgtggagcttgccgatcttgttc 412

                      
Query: 526 ccccagtagcc 536
           |||||||||||
Sbjct: 411 ccccagtagcc 401

---

>emb|CR626574.1| full-length cDNA clone CS0DJ014YK12 of T cells (Jurkat cell line)
           Cot 10-normalized of Homo sapiens (human)
          Length = 899

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 62/71 (87%)
 Strand = Plus / Minus

                                                                       
Query: 466 acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 525
           |||||||||||   ||| || |||||||| || || ||||||||| ||||||||||||||
Sbjct: 584 acagagccgcagcagcctgtcaccttgcaagggacagtgtggggcttgccgatcttgttc 525

                      
Query: 526 ccccagtagcc 536
           |||||||||||
Sbjct: 524 ccccagtagcc 514

---

>emb|CR625501.1| full-length cDNA clone CS0DI080YC10 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 925

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 62/71 (87%)
 Strand = Plus / Minus

                                                                       
Query: 466 acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 525
           |||||||||||   ||| || |||||||| || || ||||||||| ||||||||||||||
Sbjct: 579 acagagccgcagcagcctgtcaccttgcaagggacagtgtggggcttgccgatcttgttc 520

                      
Query: 526 ccccagtagcc 536
           |||||||||||
Sbjct: 519 ccccagtagcc 509

---

>emb|CR624847.1| full-length cDNA clone CS0DH002YK09 of T cells (Jurkat cell line) of
            Homo sapiens (human)
          Length = 1548

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 62/71 (87%)
 Strand = Plus / Minus

                                                                        
Query: 466  acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 525
            |||||||||||   ||| || |||||||| || || ||||||||| ||||||||||||||
Sbjct: 1201 acagagccgcagcggcctgtcaccttgcaagggacagtgtggggcttgccgatcttgttc 1142

                       
Query: 526  ccccagtagcc 536
            |||||||||||
Sbjct: 1141 ccccagtagcc 1131

---

>emb|CR622407.1| full-length cDNA clone CS0DI084YM13 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 907

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 62/71 (87%)
 Strand = Plus / Minus

                                                                       
Query: 466 acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 525
           |||||||||||   ||| || |||||||| || || ||||||||| ||||||||||||||
Sbjct: 561 acagagccgcagcggcctgtcaccttgcaagggacagtgtggggcttgccgatcttgttc 502

                      
Query: 526 ccccagtagcc 536
           |||||||||||
Sbjct: 501 ccccagtagcc 491

---

>emb|CR620130.1| full-length cDNA clone CS0DA002YB15 of Neuroblastoma of Homo
           sapiens (human)
          Length = 929

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 62/71 (87%)
 Strand = Plus / Minus

                                                                       
Query: 466 acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 525
           |||||||||||   ||| || |||||||| || || ||||||||| ||||||||||||||
Sbjct: 582 acagagccgcagcggcctgtcaccttgcaagggacagtgtggggcttgccgatcttgttc 523

                      
Query: 526 ccccagtagcc 536
           |||||||||||
Sbjct: 522 ccccagtagcc 512

---

>emb|CR617837.1| full-length cDNA clone CS0DC019YM02 of Neuroblastoma Cot
           25-normalized of Homo sapiens (human)
          Length = 919

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 62/71 (87%)
 Strand = Plus / Minus

                                                                       
Query: 466 acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 525
           |||||||||||   ||| || |||||||| || || ||||||||| ||||||||||||||
Sbjct: 572 acagagccgcagcggcctgtcaccttgcaagggacagtgtggggcttgccgatcttgttc 513

                      
Query: 526 ccccagtagcc 536
           |||||||||||
Sbjct: 512 ccccagtagcc 502

---

>emb|CR617024.1| full-length cDNA clone CS0DI020YA19 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 933

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 62/71 (87%)
 Strand = Plus / Minus

                                                                       
Query: 466 acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 525
           |||||||||||   ||| || |||||||| || || ||||||||| ||||||||||||||
Sbjct: 586 acagagccgcagcagcctgtcaccttgcaagggacagtgtggggcttgccgatcttgttc 527

                      
Query: 526 ccccagtagcc 536
           |||||||||||
Sbjct: 526 ccccagtagcc 516

---

>emb|CR616773.1| full-length cDNA clone CS0DA001YA14 of Neuroblastoma of Homo
           sapiens (human)
          Length = 923

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 62/71 (87%)
 Strand = Plus / Minus

                                                                       
Query: 466 acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 525
           |||||||||||   ||| || |||||||| || || ||||||||| ||||||||||||||
Sbjct: 576 acagagccgcagcagcctgtcaccttgcaagggacagtgtggggcttgccgatcttgttc 517

                      
Query: 526 ccccagtagcc 536
           |||||||||||
Sbjct: 516 ccccagtagcc 506

---

>emb|CR616346.1| full-length cDNA clone CS0DA003YB13 of Neuroblastoma of Homo
           sapiens (human)
          Length = 982

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 62/71 (87%)
 Strand = Plus / Minus

                                                                       
Query: 466 acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 525
           |||||||||||   ||| || |||||||| || || ||||||||| ||||||||||||||
Sbjct: 635 acagagccgcagcagcctgtcaccttgcaagggacagtgtggggcttgccgatcttgttc 576

                      
Query: 526 ccccagtagcc 536
           |||||||||||
Sbjct: 575 ccccagtagcc 565

---

>emb|CR613584.1| full-length cDNA clone CS0DH005YA07 of T cells (Jurkat cell line)
           of Homo sapiens (human)
          Length = 921

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 62/71 (87%)
 Strand = Plus / Minus

                                                                       
Query: 466 acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 525
           |||||||||||   ||| || |||||||| || || ||||||||| ||||||||||||||
Sbjct: 574 acagagccgcagcggcctgtcaccttgcaagggacagtgtggggcttgccgatcttgttc 515

                      
Query: 526 ccccagtagcc 536
           |||||||||||
Sbjct: 514 ccccagtagcc 504

---

>emb|CR613101.1| full-length cDNA clone CS0DI021YI17 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 915

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 62/71 (87%)
 Strand = Plus / Minus

                                                                       
Query: 466 acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 525
           |||||||||||   ||| || |||||||| || || ||||||||| ||||||||||||||
Sbjct: 568 acagagccgcagcggcctgtcaccttgcaagggacagtgtggggcttgccgatcttgttc 509

                      
Query: 526 ccccagtagcc 536
           |||||||||||
Sbjct: 508 ccccagtagcc 498

---

>emb|CR612811.1| full-length cDNA clone CS0DF034YC19 of Fetal brain of Homo sapiens
           (human)
          Length = 924

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 62/71 (87%)
 Strand = Plus / Minus

                                                                       
Query: 466 acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 525
           |||||||||||   ||| || |||||||| || || ||||||||| ||||||||||||||
Sbjct: 578 acagagccgcagcggcctgtcaccttgcaagggacagtgtggggcttgccgatcttgttc 519

                      
Query: 526 ccccagtagcc 536
           |||||||||||
Sbjct: 518 ccccagtagcc 508

---

>emb|CR610190.1| full-length cDNA clone CS0CAP004YA17 of Thymus of Homo sapiens
           (human)
          Length = 923

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 62/71 (87%)
 Strand = Plus / Minus

                                                                       
Query: 466 acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 525
           |||||||||||   ||| || |||||||| || || ||||||||| ||||||||||||||
Sbjct: 576 acagagccgcagcggcctgtcaccttgcaagggacagtgtggggcttgccgatcttgttc 517

                      
Query: 526 ccccagtagcc 536
           |||||||||||
Sbjct: 516 ccccagtagcc 506

---

>emb|CR609604.1| full-length cDNA clone CS0CAP007YC22 of Thymus of Homo sapiens
           (human)
          Length = 891

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 62/71 (87%)
 Strand = Plus / Minus

                                                                       
Query: 466 acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 525
           |||||||||||   ||| || |||||||| || || ||||||||| ||||||||||||||
Sbjct: 575 acagagccgcagcggcctgtcaccttgcaagggacagtgtggggcttgccgatcttgttc 516

                      
Query: 526 ccccagtagcc 536
           |||||||||||
Sbjct: 515 ccccagtagcc 505

---

>emb|CR608509.1| full-length cDNA clone CS0DG001YB20 of B cells (Ramos cell line) of
           Homo sapiens (human)
          Length = 531

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 62/71 (87%)
 Strand = Plus / Minus

                                                                       
Query: 466 acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 525
           |||||||||||   ||| || |||||||| || || ||||||||| ||||||||||||||
Sbjct: 184 acagagccgcagcggcctgtcaccttgcaagggacagtgtggggcttgccgatcttgttc 125

                      
Query: 526 ccccagtagcc 536
           |||||||||||
Sbjct: 124 ccccagtagcc 114

---

>emb|CR608345.1| full-length cDNA clone CS0DE007YL08 of Placenta of Homo sapiens
           (human)
          Length = 926

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 62/71 (87%)
 Strand = Plus / Minus

                                                                       
Query: 466 acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 525
           |||||||||||   ||| || |||||||| || || ||||||||| ||||||||||||||
Sbjct: 579 acagagccgcagcagcctgtcaccttgcaagggacagtgtggggcttgccgatcttgttc 520

                      
Query: 526 ccccagtagcc 536
           |||||||||||
Sbjct: 519 ccccagtagcc 509

---

>emb|CR608202.1| full-length cDNA clone CS0DK001YN08 of HeLa cells Cot 25-normalized
           of Homo sapiens (human)
          Length = 651

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 62/71 (87%)
 Strand = Plus / Minus

                                                                       
Query: 466 acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 525
           |||||||||||   ||| || |||||||| || || ||||||||| ||||||||||||||
Sbjct: 304 acagagccgcagcggcctgtcaccttgcaagggacagtgtggggcttgccgatcttgttc 245

                      
Query: 526 ccccagtagcc 536
           |||||||||||
Sbjct: 244 ccccagtagcc 234

---

>emb|CR607747.1| full-length cDNA clone CS0CAP007YB09 of Thymus of Homo sapiens
           (human)
          Length = 894

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 62/71 (87%)
 Strand = Plus / Minus

                                                                       
Query: 466 acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 525
           |||||||||||   ||| || |||||||| || || ||||||||| ||||||||||||||
Sbjct: 578 acagagccgcagcggcctgtcaccttgcaagggacagtgtggggcttgccgatcttgttc 519

                      
Query: 526 ccccagtagcc 536
           |||||||||||
Sbjct: 518 ccccagtagcc 508

---

>emb|CR607612.1| full-length cDNA clone CS0DE002YJ03 of Placenta of Homo sapiens
           (human)
          Length = 895

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 62/71 (87%)
 Strand = Plus / Minus

                                                                       
Query: 466 acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 525
           |||||||||||   ||| || |||||||| || || ||||||||| ||||||||||||||
Sbjct: 575 acagagccgcagcggcctgtcaccttgcaagggacagtgtggggcttgccgatcttgttc 516

                      
Query: 526 ccccagtagcc 536
           |||||||||||
Sbjct: 515 ccccagtagcc 505

---

>emb|CR607006.1| full-length cDNA clone CS0DL005YN02 of B cells (Ramos cell line)
           Cot 25-normalized of Homo sapiens (human)
          Length = 919

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 62/71 (87%)
 Strand = Plus / Minus

                                                                       
Query: 466 acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 525
           |||||||||||   ||| || |||||||| || || ||||||||| ||||||||||||||
Sbjct: 572 acagagccgcagcggcctgtcaccttgcaagggacagtgtggggcttgccgatcttgttc 513

                      
Query: 526 ccccagtagcc 536
           |||||||||||
Sbjct: 512 ccccagtagcc 502

---

>emb|CR606602.1| full-length cDNA clone CS0DE002YD08 of Placenta of Homo sapiens
           (human)
          Length = 925

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 62/71 (87%)
 Strand = Plus / Minus

                                                                       
Query: 466 acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 525
           |||||||||||   ||| || |||||||| || || ||||||||| ||||||||||||||
Sbjct: 578 acagagccgcagcggcctgtcaccttgcaagggacagtgtggggcttgccgatcttgttc 519

                      
Query: 526 ccccagtagcc 536
           |||||||||||
Sbjct: 518 ccccagtagcc 508

---

>emb|CR605226.1| full-length cDNA clone CS0DA001YI08 of Neuroblastoma of Homo
           sapiens (human)
          Length = 925

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 62/71 (87%)
 Strand = Plus / Minus

                                                                       
Query: 466 acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 525
           |||||||||||   ||| || |||||||| || || ||||||||| ||||||||||||||
Sbjct: 578 acagagccgcagcggcctgtcaccttgcaagggacagtgtggggcttgccgatcttgttc 519

                      
Query: 526 ccccagtagcc 536
           |||||||||||
Sbjct: 518 ccccagtagcc 508

---

>emb|CR603246.1| full-length cDNA clone CS0DE002YA17 of Placenta of Homo sapiens
           (human)
          Length = 921

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 62/71 (87%)
 Strand = Plus / Minus

                                                                       
Query: 466 acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 525
           |||||||||||   ||| || |||||||| || || ||||||||| ||||||||||||||
Sbjct: 579 acagagccgcagcagcctgtcaccttgcaagggacagtgtggggcttgccgatcttgttc 520

                      
Query: 526 ccccagtagcc 536
           |||||||||||
Sbjct: 519 ccccagtagcc 509

---

>emb|CR602473.1| full-length cDNA clone CS0DM013YC17 of Fetal liver of Homo sapiens
           (human)
          Length = 894

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 62/71 (87%)
 Strand = Plus / Minus

                                                                       
Query: 466 acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 525
           |||||||||||   ||| || |||||||| || || ||||||||| ||||||||||||||
Sbjct: 584 acagagccgcagcagcctgtcaccttgcaagggacagtgtggggcttgccgatcttgttc 525

                      
Query: 526 ccccagtagcc 536
           |||||||||||
Sbjct: 524 ccccagtagcc 514

---

>emb|CR600325.1| full-length cDNA clone CS0DJ011YG17 of T cells (Jurkat cell line)
           Cot 10-normalized of Homo sapiens (human)
          Length = 943

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 62/71 (87%)
 Strand = Plus / Minus

                                                                       
Query: 466 acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 525
           |||||||||||   ||| || |||||||| || || ||||||||| ||||||||||||||
Sbjct: 611 acagagccgcagcagcctgtcaccttgcaagggacagtgtggggcttgccgatcttgttc 552

                      
Query: 526 ccccagtagcc 536
           |||||||||||
Sbjct: 551 ccccagtagcc 541

---

>emb|CR600119.1| full-length cDNA clone CS0DH004YP15 of T cells (Jurkat cell line)
           of Homo sapiens (human)
          Length = 913

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 62/71 (87%)
 Strand = Plus / Minus

                                                                       
Query: 466 acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 525
           |||||||||||   ||| || |||||||| || || ||||||||| ||||||||||||||
Sbjct: 570 acagagccgcagcagcctgtcaccttgcaagggacagtgtggggcttgccgatcttgttc 511

                      
Query: 526 ccccagtagcc 536
           |||||||||||
Sbjct: 510 ccccagtagcc 500

---

>emb|CR598755.1| full-length cDNA clone CS0DH007YG11 of T cells (Jurkat cell line)
           of Homo sapiens (human)
          Length = 906

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 62/71 (87%)
 Strand = Plus / Minus

                                                                       
Query: 466 acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 525
           |||||||||||   ||| || |||||||| || || ||||||||| ||||||||||||||
Sbjct: 562 acagagccgcagcagcctgtcaccttgcaagggacagtgtggggcttgccgatcttgttc 503

                      
Query: 526 ccccagtagcc 536
           |||||||||||
Sbjct: 502 ccccagtagcc 492

---

>emb|CR596231.1| full-length cDNA clone CS0CAP001YL18 of Thymus of Homo sapiens
           (human)
          Length = 884

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 62/71 (87%)
 Strand = Plus / Minus

                                                                       
Query: 466 acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 525
           |||||||||||   ||| || |||||||| || || ||||||||| ||||||||||||||
Sbjct: 542 acagagccgcagcggcctgtcaccttgcaagggacagtgtggggcttgccgatcttgttc 483

                      
Query: 526 ccccagtagcc 536
           |||||||||||
Sbjct: 482 ccccagtagcc 472

---

>emb|CR595621.1| full-length cDNA clone CS0DJ003YI21 of T cells (Jurkat cell line)
           Cot 10-normalized of Homo sapiens (human)
          Length = 922

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 62/71 (87%)
 Strand = Plus / Minus

                                                                       
Query: 466 acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 525
           |||||||||||   ||| || |||||||| || || ||||||||| ||||||||||||||
Sbjct: 579 acagagccgcagcagcctgtcaccttgcaagggacagtgtggggcttgccgatcttgttc 520

                      
Query: 526 ccccagtagcc 536
           |||||||||||
Sbjct: 519 ccccagtagcc 509

---

>emb|CR594414.1| full-length cDNA clone CS0DF019YI05 of Fetal brain of Homo sapiens
           (human)
          Length = 895

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 62/71 (87%)
 Strand = Plus / Minus

                                                                       
Query: 466 acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 525
           |||||||||||   ||| || |||||||| || || ||||||||| ||||||||||||||
Sbjct: 569 acagagccgcagcggcctgtcaccttgcaagggacagtgtggggcttgccgatcttgttc 510

                      
Query: 526 ccccagtagcc 536
           |||||||||||
Sbjct: 509 ccccagtagcc 499

---

>emb|CR593677.1| full-length cDNA clone CS0DI020YA20 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 902

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 62/71 (87%)
 Strand = Plus / Minus

                                                                       
Query: 466 acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 525
           |||||||||||   ||| || |||||||| || || ||||||||| ||||||||||||||
Sbjct: 586 acagagccgcagcagcctgtcaccttgcaagggacagtgtggggcttgccgatcttgttc 527

                      
Query: 526 ccccagtagcc 536
           |||||||||||
Sbjct: 526 ccccagtagcc 516

---

>emb|CR593327.1| full-length cDNA clone CS0DJ011YJ17 of T cells (Jurkat cell line)
           Cot 10-normalized of Homo sapiens (human)
          Length = 893

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 62/71 (87%)
 Strand = Plus / Minus

                                                                       
Query: 466 acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 525
           |||||||||||   ||| || |||||||| || || ||||||||| ||||||||||||||
Sbjct: 573 acagagccgcagcagcctgtcaccttgcaagggacagtgtggggcttgccgatcttgttc 514

                      
Query: 526 ccccagtagcc 536
           |||||||||||
Sbjct: 513 ccccagtagcc 503

---

>emb|CR593005.1| full-length cDNA clone CS0DC023YC03 of Neuroblastoma Cot
           25-normalized of Homo sapiens (human)
          Length = 925

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 62/71 (87%)
 Strand = Plus / Minus

                                                                       
Query: 466 acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 525
           |||||||||||   ||| || |||||||| || || ||||||||| ||||||||||||||
Sbjct: 578 acagagccgcagcggcctgtcaccttgcaagggacagtgtggggcttgccgatcttgttc 519

                      
Query: 526 ccccagtagcc 536
           |||||||||||
Sbjct: 518 ccccagtagcc 508

---

>emb|CR591765.1| full-length cDNA clone CS0DF026YI06 of Fetal brain of Homo sapiens
           (human)
          Length = 901

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 62/71 (87%)
 Strand = Plus / Minus

                                                                       
Query: 466 acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 525
           |||||||||||   ||| || |||||||| || || ||||||||| ||||||||||||||
Sbjct: 575 acagagccgcagcggcctgtcaccttgcaagggacagtgtggggcttgccgatcttgttc 516

                      
Query: 526 ccccagtagcc 536
           |||||||||||
Sbjct: 515 ccccagtagcc 505

---

>emb|CR590936.1| full-length cDNA clone CS0DJ001YF12 of T cells (Jurkat cell line)
           Cot 10-normalized of Homo sapiens (human)
          Length = 920

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 62/71 (87%)
 Strand = Plus / Minus

                                                                       
Query: 466 acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 525
           |||||||||||   ||| || |||||||| || || ||||||||| ||||||||||||||
Sbjct: 570 acagagccgcagcggcctgtcaccttgcaagggacagtgtggggcttgccgatcttgttc 511

                      
Query: 526 ccccagtagcc 536
           |||||||||||
Sbjct: 510 ccccagtagcc 500

---

>gb|AC073596.40| Homo sapiens 12 BAC RP11-385C6 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 203395

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 62/71 (87%)
 Strand = Plus / Plus

                                                                         
Query: 466   acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 525
             |||||||||||   ||| || |||||||| || || ||||||||| ||||||||||||||
Sbjct: 64512 acagagccgcagcggcctgtcaccttgcaagggacagtgtggggcttgccgatcttgttc 64571

                        
Query: 526   ccccagtagcc 536
             |||||||||||
Sbjct: 64572 ccccagtagcc 64582

---

>ref|XM_937623.1| PREDICTED: Homo sapiens similar to ribosomal protein S2; 40S
           ribosomal protein S2 (MGC27348), mRNA
          Length = 947

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 62/71 (87%)
 Strand = Plus / Minus

                                                                       
Query: 466 acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 525
           |||||||||||   ||| || |||||||| || ||||||||| || ||||||||||||||
Sbjct: 573 acagagccgcagcggcctgtcaccttgcaagggacggtgtggagcttgccgatcttgttc 514

                      
Query: 526 ccccagtagcc 536
           |||||||||||
Sbjct: 513 ccccagtagcc 503

---

>ref|XM_499270.2| PREDICTED: Homo sapiens similar to ribosomal protein S2; 40S
           ribosomal protein S2 (MGC27348), mRNA
          Length = 946

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 62/71 (87%)
 Strand = Plus / Minus

                                                                       
Query: 466 acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 525
           |||||||||||   ||| || |||||||| || ||||||||| || ||||||||||||||
Sbjct: 573 acagagccgcagcggcctgtcaccttgcaagggacggtgtggagcttgccgatcttgttc 514

                      
Query: 526 ccccagtagcc 536
           |||||||||||
Sbjct: 513 ccccagtagcc 503

---

>ref|XM_171158.5| PREDICTED: Homo sapiens similar to ribosomal protein S2; 40S
           ribosomal protein S2 (MGC27348), mRNA
          Length = 946

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 62/71 (87%)
 Strand = Plus / Minus

                                                                       
Query: 466 acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 525
           |||||||||||   ||| || |||||||| || ||||||||| || ||||||||||||||
Sbjct: 573 acagagccgcagcggcctgtcaccttgcaagggacggtgtggagcttgccgatcttgttc 514

                      
Query: 526 ccccagtagcc 536
           |||||||||||
Sbjct: 513 ccccagtagcc 503

---

>ref|XM_945419.1| PREDICTED: Homo sapiens similar to ribosomal protein S2, transcript
           variant 6 (LOC650149), mRNA
          Length = 823

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 62/71 (87%)
 Strand = Plus / Minus

                                                                       
Query: 466 acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 525
           |||||||||||   ||| || |||||||| || |||||||||||| ||| ||||||||||
Sbjct: 466 acagagccgcagcggcctgtcaccttgcaagggacggtgtggggcttgctgatcttgttc 407

                      
Query: 526 ccccagtagcc 536
           |||||||||||
Sbjct: 406 ccccagtagcc 396

---

>ref|XM_945418.1| PREDICTED: Homo sapiens similar to ribosomal protein S2, transcript
            variant 5 (LOC650149), mRNA
          Length = 1547

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 62/71 (87%)
 Strand = Plus / Minus

                                                                        
Query: 466  acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 525
            |||||||||||   ||| || |||||||| || |||||||||||| ||| ||||||||||
Sbjct: 1187 acagagccgcagcggcctgtcaccttgcaagggacggtgtggggcttgctgatcttgttc 1128

                       
Query: 526  ccccagtagcc 536
            |||||||||||
Sbjct: 1127 ccccagtagcc 1117

---

>ref|XM_945417.1| PREDICTED: Homo sapiens similar to ribosomal protein S2, transcript
            variant 4 (LOC650149), mRNA
          Length = 1536

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 62/71 (87%)
 Strand = Plus / Minus

                                                                        
Query: 466  acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 525
            |||||||||||   ||| || |||||||| || |||||||||||| ||| ||||||||||
Sbjct: 1187 acagagccgcagcggcctgtcaccttgcaagggacggtgtggggcttgctgatcttgttc 1128

                       
Query: 526  ccccagtagcc 536
            |||||||||||
Sbjct: 1127 ccccagtagcc 1117

---

>ref|XM_945415.1| PREDICTED: Homo sapiens similar to ribosomal protein S2, transcript
            variant 3 (LOC650149), mRNA
          Length = 1548

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 62/71 (87%)
 Strand = Plus / Minus

                                                                        
Query: 466  acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 525
            |||||||||||   ||| || |||||||| || |||||||||||| ||| ||||||||||
Sbjct: 1187 acagagccgcagcggcctgtcaccttgcaagggacggtgtggggcttgctgatcttgttc 1128

                       
Query: 526  ccccagtagcc 536
            |||||||||||
Sbjct: 1127 ccccagtagcc 1117

---

>ref|XM_941738.1| PREDICTED: Homo sapiens similar to ribosomal protein S2, transcript
            variant 1 (LOC650149), mRNA
          Length = 1548

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 62/71 (87%)
 Strand = Plus / Minus

                                                                        
Query: 466  acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 525
            |||||||||||   ||| || |||||||| || |||||||||||| ||| ||||||||||
Sbjct: 1187 acagagccgcagcggcctgtcaccttgcaagggacggtgtggggcttgctgatcttgttc 1128

                       
Query: 526  ccccagtagcc 536
            |||||||||||
Sbjct: 1127 ccccagtagcc 1117

---

>ref|XM_934189.1| PREDICTED: Homo sapiens similar to ribosomal protein S2, transcript
            variant 7 (LOC91561), mRNA
          Length = 1549

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 62/71 (87%)
 Strand = Plus / Minus

                                                                        
Query: 466  acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 525
            |||||||||||   ||| || |||||||| || |||||||||||| ||| ||||||||||
Sbjct: 1188 acagagccgcagcggcctgtcaccttgcaagggacggtgtggggcttgctgatcttgttc 1129

                       
Query: 526  ccccagtagcc 536
            |||||||||||
Sbjct: 1128 ccccagtagcc 1118

---

>ref|XM_934185.1| PREDICTED: Homo sapiens similar to ribosomal protein S2, transcript
            variant 6 (LOC91561), mRNA
          Length = 1537

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 62/71 (87%)
 Strand = Plus / Minus

                                                                        
Query: 466  acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 525
            |||||||||||   ||| || |||||||| || |||||||||||| ||| ||||||||||
Sbjct: 1188 acagagccgcagcggcctgtcaccttgcaagggacggtgtggggcttgctgatcttgttc 1129

                       
Query: 526  ccccagtagcc 536
            |||||||||||
Sbjct: 1128 ccccagtagcc 1118

---

>ref|XM_934183.1| PREDICTED: Homo sapiens similar to ribosomal protein S2, transcript
            variant 5 (LOC91561), mRNA
          Length = 1548

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 62/71 (87%)
 Strand = Plus / Minus

                                                                        
Query: 466  acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 525
            |||||||||||   ||| || |||||||| || |||||||||||| ||| ||||||||||
Sbjct: 1188 acagagccgcagcggcctgtcaccttgcaagggacggtgtggggcttgctgatcttgttc 1129

                       
Query: 526  ccccagtagcc 536
            |||||||||||
Sbjct: 1128 ccccagtagcc 1118

---

>ref|XM_934180.1| PREDICTED: Homo sapiens similar to ribosomal protein S2, transcript
            variant 4 (LOC91561), mRNA
          Length = 1558

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 62/71 (87%)
 Strand = Plus / Minus

                                                                        
Query: 466  acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 525
            |||||||||||   ||| || |||||||| || |||||||||||| ||| ||||||||||
Sbjct: 1188 acagagccgcagcggcctgtcaccttgcaagggacggtgtggggcttgctgatcttgttc 1129

                       
Query: 526  ccccagtagcc 536
            |||||||||||
Sbjct: 1128 ccccagtagcc 1118

---

>ref|XM_934176.1| PREDICTED: Homo sapiens similar to ribosomal protein S2, transcript
           variant 3 (LOC91561), mRNA
          Length = 839

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 62/71 (87%)
 Strand = Plus / Minus

                                                                       
Query: 466 acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 525
           |||||||||||   ||| || |||||||| || |||||||||||| ||| ||||||||||
Sbjct: 482 acagagccgcagcggcctgtcaccttgcaagggacggtgtggggcttgctgatcttgttc 423

                      
Query: 526 ccccagtagcc 536
           |||||||||||
Sbjct: 422 ccccagtagcc 412

---

>ref|XM_039218.13| PREDICTED: Homo sapiens similar to ribosomal protein S2, transcript
            variant 1 (LOC91561), mRNA
          Length = 1549

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 62/71 (87%)
 Strand = Plus / Minus

                                                                        
Query: 466  acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 525
            |||||||||||   ||| || |||||||| || |||||||||||| ||| ||||||||||
Sbjct: 1188 acagagccgcagcggcctgtcaccttgcaagggacggtgtggggcttgctgatcttgttc 1129

                       
Query: 526  ccccagtagcc 536
            |||||||||||
Sbjct: 1128 ccccagtagcc 1118

---

>gb|BC068051.1| Homo sapiens ribosomal protein S2, mRNA (cDNA clone MGC:78476
           IMAGE:4853351), complete cds
          Length = 951

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 62/71 (87%)
 Strand = Plus / Minus

                                                                       
Query: 466 acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 525
           |||||||||||   ||| || |||||||| || || ||||||||| ||||||||||||||
Sbjct: 584 acagagccgcagcggcctgtcaccttgcaagggacagtgtggggcttgccgatcttgttc 525

                      
Query: 526 ccccagtagcc 536
           |||||||||||
Sbjct: 524 ccccagtagcc 514

---

>gb|AC129342.5| Rattus norvegicus  BAC CH230-229B21 (Children's Hospital Oakland
             Research Institute Rat (BN/SsNHsd/MCW) BAC library)
             complete sequence
          Length = 224257

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 50/55 (90%)
 Strand = Plus / Minus

                                                                    
Query: 487   accttgcagggcacggtgtggggcatgccgatcttgttcccccagtagcccctcc 541
             |||||||| ||||| ||||||||| |||| |||||||||||||||||||| ||||
Sbjct: 17215 accttgcatggcacagtgtggggcttgccaatcttgttcccccagtagcctctcc 17161

---

>ref|NM_001007868.1| Xenopus tropicalis MGC89305 protein (MGC89305), mRNA
          Length = 925

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 44/47 (93%)
 Strand = Plus / Minus

                                                          
Query: 487 accttgcagggcacggtgtggggcatgccgatcttgttcccccagta 533
           |||||||||||||| ||||||||| ||||||||||||| ||||||||
Sbjct: 523 accttgcagggcacagtgtggggcttgccgatcttgttaccccagta 477

---

>gb|BC017252.1| Homo sapiens, clone IMAGE:2905229, mRNA
          Length = 2739

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 62/71 (87%)
 Strand = Plus / Minus

                                                                        
Query: 466  acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 525
            |||||||||||   ||| || |||||||| || || ||||||||| ||||||||||||||
Sbjct: 2374 acagagccgcagcggcctgtcaccttgcaagggacagtgtggggcttgccgatcttgttc 2315

                       
Query: 526  ccccagtagcc 536
            |||||||||||
Sbjct: 2314 ccccagtagcc 2304

---

>gb|BC007700.1| Homo sapiens, clone IMAGE:3954272, mRNA
          Length = 1568

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 62/71 (87%)
 Strand = Plus / Minus

                                                                       
Query: 466 acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 525
           |||||||||||   ||| || |||||||| || || ||||||||| ||||||||||||||
Sbjct: 579 acagagccgcagcggcctgtcaccttgcaagggacagtgtggggcttgccgatcttgttc 520

                      
Query: 526 ccccagtagcc 536
           |||||||||||
Sbjct: 519 ccccagtagcc 509

---

>ref|XM_573268.1| PREDICTED: Rattus norvegicus similar to ribosomal protein S2
           (LOC498068), mRNA
          Length = 989

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 50/55 (90%)
 Strand = Plus / Minus

                                                                  
Query: 487 accttgcagggcacggtgtggggcatgccgatcttgttcccccagtagcccctcc 541
           |||||||| ||||| ||||||||| |||| |||||||||||||||||||| ||||
Sbjct: 553 accttgcatggcacagtgtggggcttgccaatcttgttcccccagtagcctctcc 499

---

>gb|AY161272.1| Spodoptera frugiperda ribosomal protein S2 mRNA, complete cds
          Length = 877

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 53/59 (89%)
 Strand = Plus / Minus

                                                                      
Query: 475 cacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttcccccagta 533
           ||||| |||||||||||||| || || ||||||||| ||||||||||||| ||||||||
Sbjct: 567 cactttccggtgaccttgcaaggtactgtgtggggcttgccgatcttgttaccccagta 509

---

>gb|AC107956.8| Homo sapiens chromosome 11, clone RP11-452G18, complete sequence
          Length = 188571

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 62/71 (87%)
 Strand = Plus / Minus

                                                                         
Query: 466   acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 525
             |||||||||||   ||| || |||||||| || |||||||||||| ||| ||||||||||
Sbjct: 58718 acagagccgcagcggcctgtcaccttgcaagggacggtgtggggcttgctgatcttgttc 58659

                        
Query: 526   ccccagtagcc 536
             |||||||||||
Sbjct: 58658 ccccagtagcc 58648

---

>gb|AY892474.1| Synthetic construct Homo sapiens clone FLH028028.01L ribosomal
           protein S2 (RPS2) mRNA, partial cds
          Length = 882

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 62/71 (87%)
 Strand = Plus / Minus

                                                                       
Query: 466 acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 525
           |||||||||||   ||| || |||||||| || || ||||||||| ||||||||||||||
Sbjct: 572 acagagccgcagcggcctgtcaccttgcaagggacagtgtggggcttgccgatcttgttc 513

                      
Query: 526 ccccagtagcc 536
           |||||||||||
Sbjct: 512 ccccagtagcc 502

---

>gb|AY889989.1| Synthetic construct Homo sapiens clone FLH028029.01X ribosomal
           protein S2 (RPS2) mRNA, complete cds
          Length = 882

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 62/71 (87%)
 Strand = Plus / Minus

                                                                       
Query: 466 acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 525
           |||||||||||   ||| || |||||||| || || ||||||||| ||||||||||||||
Sbjct: 572 acagagccgcagcggcctgtcaccttgcaagggacagtgtggggcttgccgatcttgttc 513

                      
Query: 526 ccccagtagcc 536
           |||||||||||
Sbjct: 512 ccccagtagcc 502

---

>gb|BC071923.1| Homo sapiens ribosomal protein S2, mRNA (cDNA clone MGC:88608
           IMAGE:5477295), complete cds
          Length = 950

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 62/71 (87%)
 Strand = Plus / Minus

                                                                       
Query: 466 acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 525
           |||||||||||   ||| || |||||||| || || ||||||||| ||||||||||||||
Sbjct: 582 acagagccgcagcggcctgtcaccttgcaagggacagtgtggggcttgccgatcttgttc 523

                      
Query: 526 ccccagtagcc 536
           |||||||||||
Sbjct: 522 ccccagtagcc 512

---

>gb|BC080133.1| Xenopus tropicalis MGC89305 protein, mRNA (cDNA clone MGC:89305
           IMAGE:6983379), complete cds
          Length = 925

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 44/47 (93%)
 Strand = Plus / Minus

                                                          
Query: 487 accttgcagggcacggtgtggggcatgccgatcttgttcccccagta 533
           |||||||||||||| ||||||||| ||||||||||||| ||||||||
Sbjct: 523 accttgcagggcacagtgtggggcttgccgatcttgttaccccagta 477

---

>gb|BC071924.1| Homo sapiens ribosomal protein S2, mRNA (cDNA clone MGC:88609
           IMAGE:6729920), complete cds
          Length = 947

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 62/71 (87%)
 Strand = Plus / Minus

                                                                       
Query: 466 acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 525
           |||||||||||   ||| || |||||||| || || ||||||||| ||||||||||||||
Sbjct: 578 acagagccgcagcggcctgtcaccttgcaagggacagtgtggggcttgccgatcttgttc 519

                      
Query: 526 ccccagtagcc 536
           |||||||||||
Sbjct: 518 ccccagtagcc 508

---

>gb|BC071922.1| Homo sapiens ribosomal protein S2, mRNA (cDNA clone MGC:88607
           IMAGE:5455280), complete cds
          Length = 982

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 62/71 (87%)
 Strand = Plus / Minus

                                                                       
Query: 466 acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 525
           |||||||||||   ||| || |||||||| || || ||||||||| ||||||||||||||
Sbjct: 577 acagagccgcagcggcctgtcaccttgcaagggacagtgtggggcttgccgatcttgttc 518

                      
Query: 526 ccccagtagcc 536
           |||||||||||
Sbjct: 517 ccccagtagcc 507

---

>gb|BC071673.1| Homo sapiens ribosomal protein S2, mRNA (cDNA clone MGC:87874
           IMAGE:4540360), complete cds
          Length = 992

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 62/71 (87%)
 Strand = Plus / Minus

                                                                       
Query: 466 acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 525
           |||||||||||   ||| || |||||||| || || ||||||||| ||||||||||||||
Sbjct: 583 acagagccgcagcggcctgtcaccttgcaagggacagtgtggggcttgccgatcttgttc 524

                      
Query: 526 ccccagtagcc 536
           |||||||||||
Sbjct: 523 ccccagtagcc 513

---

>gb|BC018993.2| Homo sapiens ribosomal protein S2, mRNA (cDNA clone MGC:20302
           IMAGE:4127411), complete cds
          Length = 944

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 62/71 (87%)
 Strand = Plus / Minus

                                                                       
Query: 466 acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 525
           |||||||||||   ||| || |||||||| || || ||||||||| ||||||||||||||
Sbjct: 578 acagagccgcagcggcctgtcaccttgcaagggacagtgtggggcttgccgatcttgttc 519

                      
Query: 526 ccccagtagcc 536
           |||||||||||
Sbjct: 518 ccccagtagcc 508

---

>gb|BC032129.2| Homo sapiens ribosomal protein S2, mRNA (cDNA clone MGC:29707
           IMAGE:5019977), complete cds
          Length = 961

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 62/71 (87%)
 Strand = Plus / Minus

                                                                       
Query: 466 acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 525
           |||||||||||   ||| || |||||||| || || ||||||||| ||||||||||||||
Sbjct: 583 acagagccgcagcggcctgtcaccttgcaagggacagtgtggggcttgccgatcttgttc 524

                      
Query: 526 ccccagtagcc 536
           |||||||||||
Sbjct: 523 ccccagtagcc 513

---

>ref|NM_002952.3| Homo sapiens ribosomal protein S2 (RPS2), mRNA
          Length = 962

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 62/71 (87%)
 Strand = Plus / Minus

                                                                       
Query: 466 acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 525
           |||||||||||   ||| || |||||||| || || ||||||||| ||||||||||||||
Sbjct: 595 acagagccgcagcggcctgtcaccttgcaagggacagtgtggggcttgccgatcttgttc 536

                      
Query: 526 ccccagtagcc 536
           |||||||||||
Sbjct: 535 ccccagtagcc 525

---

>emb|CR855816.2| Xenopus tropicalis finished cDNA, clone TTpA011p12
          Length = 961

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 44/47 (93%)
 Strand = Plus / Minus

                                                          
Query: 487 accttgcagggcacggtgtggggcatgccgatcttgttcccccagta 533
           |||||||||||||| ||||||||| ||||||||||||| ||||||||
Sbjct: 521 accttgcagggcacagtgtggggcttgccgatcttgttaccccagta 475

---

>dbj|AB082925.1| Homo sapiens rps2 mRNA for ribosomal protein S2, complete cds
          Length = 821

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 62/71 (87%)
 Strand = Plus / Minus

                                                                       
Query: 466 acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 525
           |||||||||||   ||| || |||||||| || || ||||||||| ||||||||||||||
Sbjct: 448 acagagccgcagcggcctgtcaccttgcaagggacagtgtggggcttgccgatcttgttc 389

                      
Query: 526 ccccagtagcc 536
           |||||||||||
Sbjct: 388 ccccagtagcc 378

---

>gb|BC008329.2| Homo sapiens ribosomal protein S2, mRNA (cDNA clone IMAGE:3504130)
          Length = 943

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 62/71 (87%)
 Strand = Plus / Minus

                                                                       
Query: 466 acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 525
           |||||||||||   ||| || |||||||| || || ||||||||| ||||||||||||||
Sbjct: 576 acagagccgcagcggcctgtcaccttgcaagggacagtgtggggcttgccgatcttgttc 517

                      
Query: 526 ccccagtagcc 536
           |||||||||||
Sbjct: 516 ccccagtagcc 506

---

>gb|BC029979.1| Homo sapiens ribosomal protein S2, mRNA (cDNA clone IMAGE:4389294)
          Length = 968

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 62/71 (87%)
 Strand = Plus / Minus

                                                                       
Query: 466 acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 525
           |||||||||||   ||| || |||||||| || || ||||||||| ||||||||||||||
Sbjct: 583 acagagccgcagcggcctgtcaccttgcaagggacagtgtggggcttgccgatcttgttc 524

                      
Query: 526 ccccagtagcc 536
           |||||||||||
Sbjct: 523 ccccagtagcc 513

---

>gb|BC013833.1| Homo sapiens ribosomal protein S2, mRNA (cDNA clone IMAGE:4149435)
          Length = 947

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 62/71 (87%)
 Strand = Plus / Minus

                                                                       
Query: 466 acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 525
           |||||||||||   ||| || |||||||| || || ||||||||| ||||||||||||||
Sbjct: 577 acagagccgcagcggcctgtcaccttgcaagggacagtgtggggcttgccgatcttgttc 518

                      
Query: 526 ccccagtagcc 536
           |||||||||||
Sbjct: 517 ccccagtagcc 507

---

>gb|BC035427.1| Homo sapiens ribosomal protein S2, mRNA (cDNA clone IMAGE:3446871)
          Length = 947

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 62/71 (87%)
 Strand = Plus / Minus

                                                                       
Query: 466 acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 525
           |||||||||||   ||| || |||||||| || || ||||||||| ||||||||||||||
Sbjct: 578 acagagccgcagcggcctgtcaccttgcaagggacagtgtggggcttgccgatcttgttc 519

                      
Query: 526 ccccagtagcc 536
           |||||||||||
Sbjct: 518 ccccagtagcc 508

---

>gb|U92700.1|RNU92700 Rattus norvegicus ribosomal protein S2 mRNA, complete cds
          Length = 766

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 50/55 (90%)
 Strand = Plus / Minus

                                                                  
Query: 487 accttgcagggcacggtgtggggcatgccgatcttgttcccccagtagcccctcc 541
           |||||||| ||||| ||||||||| |||| |||||||||||||||||||| ||||
Sbjct: 430 accttgcatggcacagtgtggggcttgccaatcttgttcccccagtagcctctcc 376

---

>gb|U92699.1|RNU92699 Rattus norvegicus ribosomal protein S2 mRNA, complete cds
          Length = 793

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 50/55 (90%)
 Strand = Plus / Minus

                                                                  
Query: 487 accttgcagggcacggtgtggggcatgccgatcttgttcccccagtagcccctcc 541
           |||||||| ||||| ||||||||| |||| |||||||||||||||||||| ||||
Sbjct: 457 accttgcatggcacagtgtggggcttgccaatcttgttcccccagtagcctctcc 403

---

>gb|U92698.1|RNU92698 Rattus norvegicus ribosomal protein S2 mRNA, complete cds
          Length = 819

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 50/55 (90%)
 Strand = Plus / Minus

                                                                  
Query: 487 accttgcagggcacggtgtggggcatgccgatcttgttcccccagtagcccctcc 541
           |||||||| ||||| ||||||||| |||| |||||||||||||||||||| ||||
Sbjct: 483 accttgcatggcacagtgtggggcttgccaatcttgttcccccagtagcctctcc 429

---

>gb|U92697.1|RNU92697 Rattus norvegicus ribosomal protein S2 mRNA, complete cds
          Length = 817

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 50/55 (90%)
 Strand = Plus / Minus

                                                                  
Query: 487 accttgcagggcacggtgtggggcatgccgatcttgttcccccagtagcccctcc 541
           |||||||| ||||| ||||||||| |||| |||||||||||||||||||| ||||
Sbjct: 481 accttgcatggcacagtgtggggcttgccaatcttgttcccccagtagcctctcc 427

---

>gb|U92696.1|RNU92696 Rattus norvegicus ribosomal protein S2 mRNA, complete cds
          Length = 794

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 50/55 (90%)
 Strand = Plus / Minus

                                                                  
Query: 487 accttgcagggcacggtgtggggcatgccgatcttgttcccccagtagcccctcc 541
           |||||||| ||||| ||||||||| |||| |||||||||||||||||||| ||||
Sbjct: 458 accttgcatggcacagtgtggggcttgccaatcttgttcccccagtagcctctcc 404

---

>dbj|AB065088.1| Homo sapiens OK/KNS-cl.6 mRNA for ribosomal protein S2, complete
           cds
          Length = 677

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 62/71 (87%)
 Strand = Plus / Minus

                                                                       
Query: 466 acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 525
           |||||||||||   ||| || |||||||| || || ||||||||| ||||||||||||||
Sbjct: 239 acagagccgcagcggcctgtcaccttgcaagggacagtgtggggcttgccgatcttgttc 180

                      
Query: 526 ccccagtagcc 536
           |||||||||||
Sbjct: 179 ccccagtagcc 169


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,351,855
Number of Sequences: 3902068
Number of extensions: 4351855
Number of successful extensions: 82860
Number of sequences better than 10.0: 2013
Number of HSP's better than 10.0 without gapping: 2008
Number of HSP's successfully gapped in prelim test: 6
Number of HSP's that attempted gapping in prelim test: 78428
Number of HSP's gapped (non-prelim): 3628
length of query: 542
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 519
effective length of database: 17,143,297,704
effective search space: 8897371508376
effective search space used: 8897371508376
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)

---