Clone Name	rbags13n10
Clone Library Name	barley_pub

---

No.	Definition	Score (bits)	E Value
1	ref|XM_465282.1| Oryza sativa (japonica cultivar-group), mRNA	599	e-168
2	dbj|AK071476.1| Oryza sativa (japonica cultivar-group) cDNA clon...	599	e-168
3	dbj|AB070253.1| Oryza sativa (japonica cultivar-group) OsRPT3 mR...	599	e-168
4	dbj|AK059237.1| Oryza sativa (japonica cultivar-group) cDNA clon...	591	e-165
5	gb|AY530962.1| Zea mays 26S proteasome regulatory complex ATPase...	509	e-141
6	gb|AY104317.1| Zea mays PCO132144 mRNA sequence	496	e-137
7	gb|BT016898.1| Zea mays clone Contig731 mRNA sequence	452	e-124
8	emb|AJ006095.1|CAR6095 Cicer arietinum mRNA for putative 26S pro...	264	4e-67
9	gb|BT012705.1| Lycopersicon esculentum clone 113583F, mRNA sequence	218	2e-53
10	dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D...	218	2e-53
11	dbj|AP004789.3| Oryza sativa (japonica cultivar-group) genomic D...	218	2e-53
12	ref|NM_125214.4| Arabidopsis thaliana RPT3; ATPase AT5G58290 (RP...	198	2e-47
13	gb|BT020373.1| Arabidopsis thaliana At5g58290 gene, complete cds	198	2e-47
14	gb|AY070466.1| Arabidopsis thaliana AT4g10340/F24G24_140 mRNA, c...	198	2e-47
15	gb|AF123392.1|AF123392 Arabidopsis thaliana 26S proteasome AAA-A...	198	2e-47
16	emb|BX831143.1|CNS09ZD2 Arabidopsis thaliana Full-length cDNA Co...	184	3e-43
17	emb|BX831136.1|CNS09ZEE Arabidopsis thaliana Full-length cDNA Co...	184	3e-43
18	emb|BX831437.1|CNS09ZEY Arabidopsis thaliana Full-length cDNA Co...	176	6e-41
19	gb|U43398.1|STU43398 Solanum tuberosum POTATP1 mRNA, complete cds	155	2e-34
20	dbj|AK117042.1| Ciona intestinalis cDNA, clone:cits021e02, full ...	125	2e-25
21	dbj|AB019228.1| Arabidopsis thaliana genomic DNA, chromosome 5, ...	107	5e-20
22	dbj|AK174288.1| Ciona intestinalis cDNA, clone:cicl025a20, full ...	94	7e-16
23	gb|AY112326.1| Zea mays CL40761_1 mRNA sequence	94	7e-16
24	ref|NM_001008009.1| Xenopus tropicalis rpt3 protein (rpt3), mRNA	86	2e-13
25	gb|BC080888.1| Xenopus tropicalis rpt3 protein, mRNA (cDNA clone...	86	2e-13
26	ref|XM_679369.1| PREDICTED: Danio rerio similar to B4galt3-prov ...	84	7e-13
27	gb|AC147002.20| Medicago truncatula clone mth2-151m16, complete ...	80	1e-11
28	gb|BC060362.1| Xenopus laevis proteasome 26S ATPase subunit 4 is...	78	4e-11
29	dbj|AK153991.1| Mus musculus 2 days neonate thymus thymic cells ...	78	4e-11
30	dbj|AK167528.1| Mus musculus 13 days pregnant adult female place...	78	4e-11
31	dbj|AK160718.1| Mus musculus 12 days embryo head cDNA, RIKEN ful...	78	4e-11
32	dbj|AK160644.1| Mus musculus 10, 11 days embryo whole body cDNA,...	78	4e-11
33	dbj|AK167041.1| Mus musculus blastocyst blastocyst cDNA, RIKEN f...	78	4e-11
34	dbj|AK169224.1| Mus musculus 17 days pregnant adult female amnio...	78	4e-11
35	dbj|AK077507.1| Mus musculus 8 days embryo whole body cDNA, RIKE...	78	4e-11
36	gb|BC055215.1| Danio rerio proteasome (prosome, macropain) 26S s...	78	4e-11
37	ref|NM_199750.1| Danio rerio proteasome (prosome, macropain) 26S...	78	4e-11
38	ref|XM_452488.1| Kluyveromyces lactis NRRL Y-1140, KLLA0C06534g ...	76	2e-10
39	emb|CR382123.1| Kluyveromyces lactis strain NRRL Y-1140 chromoso...	76	2e-10
40	dbj|AK050677.1| Mus musculus 9 days embryo whole body cDNA, RIKE...	76	2e-10
41	ref|NM_153001.1| Homo sapiens proteasome (prosome, macropain) 26...	74	7e-10
42	ref|NM_006503.2| Homo sapiens proteasome (prosome, macropain) 26...	74	7e-10
43	gb|BC010396.1| Homo sapiens proteasome (prosome, macropain) 26S ...	74	7e-10
44	gb|BC014488.1| Homo sapiens proteasome (prosome, macropain) 26S ...	74	7e-10
45	gb|BC000343.2| Homo sapiens proteasome (prosome, macropain) 26S ...	74	7e-10
46	gb|BT008218.1| Synthetic construct Homo sapiens proteasome (pros...	74	7e-10
47	gb|BT007232.1| Homo sapiens proteasome (prosome, macropain) 26S ...	74	7e-10
48	emb|CR624768.1| full-length cDNA clone CS0DB003YP08 of Neuroblas...	74	7e-10
49	emb|CR624681.1| full-length cDNA clone CS0DI024YO05 of Placenta ...	74	7e-10
50	emb|CR621309.1| full-length cDNA clone CS0DD009YP22 of Neuroblas...	74	7e-10
51	emb|CR619473.1| full-length cDNA clone CS0DH005YK15 of T cells (...	74	7e-10
52	emb|CR616731.1| full-length cDNA clone CS0DI027YF12 of Placenta ...	74	7e-10
53	emb|CR607304.1| full-length cDNA clone CS0DI054YC02 of Placenta ...	74	7e-10
54	emb|CR606858.1| full-length cDNA clone CS0DI008YH10 of Placenta ...	74	7e-10
55	emb|CR604327.1| full-length cDNA clone CS0DE011YH14 of Placenta ...	74	7e-10
56	emb|CR603370.1| full-length cDNA clone CS0DI020YH15 of Placenta ...	74	7e-10
57	emb|CR602157.1| full-length cDNA clone CS0DI077YD19 of Placenta ...	74	7e-10
58	emb|CR597394.1| full-length cDNA clone CS0DJ014YC04 of T cells (...	74	7e-10
59	emb|CR594223.1| full-length cDNA clone CS0DJ006YJ24 of T cells (...	74	7e-10
60	emb|CR591096.1| full-length cDNA clone CS0DB007YG13 of Neuroblas...	74	7e-10
61	ref|XM_942509.1| PREDICTED: Homo sapiens similar to 26S protease...	74	7e-10
62	gb|AF038965.1| Homo sapiens 26S proteasome ATPase subunit mRNA, ...	74	7e-10
63	gb|AY891402.1| Synthetic construct Homo sapiens clone FLH025948....	74	7e-10
64	gb|AY891401.1| Synthetic construct Homo sapiens clone FLH025947....	74	7e-10
65	gb|AY888748.1| Synthetic construct Homo sapiens clone FLH025951....	74	7e-10
66	gb|U27515.1|HSU27515 Human MIP224 (MIP224) mRNA, complete cds	74	7e-10
67	gb|AF020736.1|AF020736 Homo sapiens ATPase homolog mRNA, complet...	74	7e-10
68	gb|BC018811.2| Homo sapiens proteasome (prosome, macropain) 26S ...	74	7e-10
69	ref|XM_631330.1| Dictyostelium discoideum HIV1 TAT-binding prote...	70	1e-08
70	gb|BC012708.1| Mus musculus proteasome (prosome, macropain) 26S ...	70	1e-08
71	emb|CR611800.1| full-length cDNA clone CS0DF038YP01 of Fetal bra...	70	1e-08
72	dbj|AK150989.1| Mus musculus bone marrow macrophage cDNA, RIKEN ...	70	1e-08
73	dbj|AK169244.1| Mus musculus 13 days embryo liver cDNA, RIKEN fu...	70	1e-08
74	gb|BC094063.1| Mus musculus proteasome (prosome, macropain) 26S ...	70	1e-08
75	gb|BC092265.1| Mus musculus proteasome (prosome, macropain) 26S ...	70	1e-08
76	ref|NM_011874.1| Mus musculus proteasome (prosome, macropain) 26...	70	1e-08
77	gb|L76223.1|MUSCIP21R Mus musculus 26S proteasome ATPase (CIP21)...	70	1e-08
78	gb|L16578.1|DDITATBPA Dictyostelium discoideum HIV1 TAT-binding ...	70	1e-08
79	ref|XM_512659.1| PREDICTED: Pan troglodytes similar to proteasom...	68	4e-08
80	ref|XM_662535.1| Cryptosporidium hominis TU502 26S proteasome AA...	68	4e-08
81	ref|XM_625842.1| Cryptosporidium parvum Iowa II 26S proteasome r...	68	4e-08
82	gb|AY809946.1| Schistosoma japonicum clone SJCHGC01629 unknown mRNA	68	4e-08
83	gb|BC012411.1| Mus musculus proteasome (prosome, macropain) 26S ...	66	2e-07
84	gb|AY431597.1| Aedes aegypti ASAP ID: 36999 proteasome regulator...	66	2e-07
85	gb|AC158220.4| Mus musculus chromosome 7, clone RP23-278M8, comp...	66	2e-07
86	emb|BX049202.1|CNS09A4M Single read from an extremity of a full-...	66	2e-07
87	emb|BX009899.1|CNS08FSV Single read from an extremity of a full-...	66	2e-07
88	dbj|AB168803.1| Macaca fascicularis testis cDNA, clone: QtsA-149...	66	2e-07
89	emb|CR622224.1| full-length cDNA clone CS0DK006YK15 of HeLa cell...	62	3e-06
90	dbj|AP007155.1| Aspergillus oryzae RIB40 genomic DNA, SC003	60	1e-05
91	emb|BX064829.1|CNS09M6P Single read from an extremity of a full-...	58	4e-05
92	emb|BX064588.1|CNS09M00 Single read from an extremity of a full-...	58	4e-05
93	ref|XM_311871.2| Anopheles gambiae str. PEST ENSANGP00000023984 ...	58	4e-05
94	ref|XM_311870.2| Anopheles gambiae str. PEST ENSANGP00000017654 ...	58	4e-05
95	gb|AC007842.1|AC007842 Homo sapiens chromosome 19, BAC 331191 (C...	58	4e-05
96	ref|XM_817508.1| Trypanosoma brucei TREU927 protease regulatory ...	56	2e-04
97	gb|BC063145.1| Rattus norvegicus proteasome (prosome, macropain)...	56	2e-04
98	gb|AF227502.1| Trypanosoma brucei proteasome regulatory ATPase s...	56	2e-04
99	ref|NM_057122.1| Rattus norvegicus proteasome (prosome, macropai...	56	2e-04
100	gb|AC158188.2| Selaginella moellendorffii clone JGIASXY-5I4, com...	56	2e-04
101	dbj|D50695.1|RATTBP7B Rattus norvegicus mRNA for proteasomal ATP...	56	2e-04
102	ref|XM_749387.1| Aspergillus fumigatus Af293 proteasome regulato...	54	6e-04
103	ref|XM_861948.1| PREDICTED: Canis familiaris similar to 26S prot...	54	6e-04
104	ref|XM_861938.1| PREDICTED: Canis familiaris similar to 26S prot...	54	6e-04
105	ref|XM_861928.1| PREDICTED: Canis familiaris similar to 26S prot...	54	6e-04
106	ref|XM_533670.2| PREDICTED: Canis familiaris similar to 26S prot...	54	6e-04
107	ref|XM_502714.1| Yarrowia lipolytica CLIB122, YALI0D11770g predi...	54	6e-04
108	ref|XM_393513.2| PREDICTED: Apis mellifera similar to DEAD-box A...	54	6e-04
109	emb|CR382130.1| Yarrowia lipolytica chromosome D of strain CLIB1...	54	6e-04
110	ref|XM_509951.1| PREDICTED: Pan troglodytes similar to Psmc6 pro...	52	0.003
111	ref|XM_710241.1| Candida albicans SC5314 putative 26S proteasome...	52	0.003
112	ref|XM_710176.1| Candida albicans SC5314 putative 26S proteasome...	52	0.003
113	emb|BX049214.1|CNS09A4Y Single read from an extremity of a full-...	52	0.003
114	emb|BX031109.1|CNS08W61 Single read from an extremity of a full-...	52	0.003
115	gb|BT007531.1| Synthetic construct Homo sapiens proteasome (pros...	52	0.003
116	gb|BT006843.1| Homo sapiens proteasome (prosome, macropain) 26S ...	52	0.003
117	gb|BC005390.1| Homo sapiens proteasome (prosome, macropain) 26S ...	52	0.003
118	emb|CR615895.1| full-length cDNA clone CS0DI024YJ06 of Placenta ...	52	0.003
119	ref|NM_002806.2| Homo sapiens proteasome (prosome, macropain) 26...	52	0.003
120	emb|CR624028.1| full-length cDNA clone CS0DE008YC13 of Placenta ...	52	0.003
121	emb|CR623246.1| full-length cDNA clone CS0DI074YH03 of Placenta ...	52	0.003
122	emb|CR622035.1| full-length cDNA clone CS0DA002YJ02 of Neuroblas...	52	0.003
123	emb|CR621047.1| full-length cDNA clone CS0DI018YK19 of Placenta ...	52	0.003
124	emb|CR617697.1| full-length cDNA clone CS0DL004YH06 of B cells (...	52	0.003
125	emb|CR611308.1| full-length cDNA clone CS0DE005YE03 of Placenta ...	52	0.003
126	emb|CR608774.1| full-length cDNA clone CS0DI016YM01 of Placenta ...	52	0.003
127	emb|CR602871.1| full-length cDNA clone CS0DI005YB20 of Placenta ...	52	0.003
128	emb|CR595318.1| full-length cDNA clone CS0DI061YK22 of Placenta ...	52	0.003
129	emb|CR590720.1| full-length cDNA clone CS0DI025YI08 of Placenta ...	52	0.003
130	emb|CR456709.1| Homo sapiens full open reading frame cDNA clone ...	52	0.003
131	dbj|AB040869.2| Mus musculus TBP7/PSMC4 gene for proteasomal ATP...	52	0.003
132	gb|AY892558.1| Synthetic construct Homo sapiens clone FLH013619....	52	0.003
133	gb|AY890076.1| Synthetic construct Homo sapiens clone FLH013623....	52	0.003
134	gb|AY890075.1| Synthetic construct Homo sapiens clone FLH013622....	52	0.003
135	emb|AL133453.3|CNS01DV4 Human chromosome 14 DNA sequence BAC R-8...	52	0.003
136	gb|AF006305.1|AF006305 Homo sapiens 26S proteasome regulatory su...	52	0.003
137	dbj|D78275.1| Homo sapiens mRNA for proteasome subunit p42, comp...	52	0.003
138	gb|BC083283.1| Danio rerio proteasome (prosome, macropain) 26S s...	50	0.010
139	gb|AY648827.1| Danio rerio 26S protease regulatory subunit S10B ...	50	0.010
140	ref|XM_368336.1| Magnaporthe grisea 70-15 chromosome VI hypothet...	50	0.010
141	ref|XM_868959.1| PREDICTED: Bos taurus similar to proteasome 26S...	50	0.010
142	ref|XM_813480.1| Trypanosoma cruzi strain CL Brener proteasome r...	50	0.010
143	ref|XM_390945.1| Gibberella zeae PH-1 chromosome 3 PRS6_ASPNG 26...	50	0.010
144	ref|XM_815076.1| Trypanosoma cruzi strain CL Brener proteasome r...	50	0.010
145	gb|BC112482.1| Bos taurus similar to proteasome 26S ATPase subun...	50	0.010
146	emb|CR318611.4| Zebrafish DNA sequence from clone DKEY-199F5 in ...	50	0.010
147	ref|NM_001003832.1| Danio rerio proteasome (prosome, macropain) ...	50	0.010
148	emb|AL954679.7| Zebrafish DNA sequence from clone DKEY-63J12 in ...	50	0.010
149	emb|AL954724.9| Zebrafish DNA sequence from clone CH211-265P12, ...	50	0.010
150	gb|U15601.1|ANU15601 Aspergillus niger 26S proteasome subunit (t...	50	0.010
151	gb|BC073644.1| Xenopus laevis similar to proteasome 26S ATPase s...	48	0.039
152	gb|DQ440313.1| Aedes aegypti clone AET-397 26S proteasome regula...	48	0.039
153	ref|XM_655416.1| Aspergillus nidulans FGSC A4 26S protease regul...	48	0.039
154	gb|BC045087.1| Xenopus laevis similar to proteasome 26S ATPase s...	48	0.039
155	gb|AF475102.1| Triticum aestivum tat binding protein mRNA, parti...	48	0.039
156	gb|AE016819.2| Ashbya gossypii (= Eremothecium gossypii) ATCC 10...	48	0.039
157	ref|NM_211296.1| Eremothecium gossypii AFR394Wp (AFR394W), mRNA	48	0.039
158	ref|XM_643629.1| Entamoeba histolytica HM-1:IMSS 26s proteasome ...	46	0.16
159	emb|AL590447.1|CNS07EGE chromosome VII of strain GB-M1 of Enceph...	46	0.16
160	emb|AJ719962.1| Gallus gallus mRNA for hypothetical protein, clo...	46	0.16
161	ref|NM_001006494.1| Gallus gallus proteasome (prosome, macropain...	46	0.16
162	emb|CR386272.1| Gallus gallus finished cDNA, clone ChEST60c2	46	0.16
163	gb|AY609898.1| Sus scrofa clone Clu_40992.scr.msk.p1.Contig1, mR...	46	0.16
164	emb|AL590449.1|CNS07EGG chromosome X of strain GB-M1 of Encephal...	46	0.16
165	ref|XM_637738.1| Dictyostelium discoideum hypothetical protein (...	44	0.61
166	ref|XM_509208.1| PREDICTED: Pan troglodytes similar to conserved...	44	0.61
167	ref|XM_519765.1| PREDICTED: Pan troglodytes similar to conserved...	44	0.61
168	gb|AY348237.1| Drosophila insignita RPT4 (Rpt4) gene, partial cds	44	0.61
169	gb|AY348236.1| Drosophila bipolita RPT4 (Rpt4) gene, partial cds	44	0.61
170	gb|AY348235.1| Drosophila canipolita RPT4 (Rpt4) gene, partial cds	44	0.61
171	gb|AF165146.6| Homo sapiens chromosome 8 clone CTA-397H3 map q12...	44	0.61
172	ref|XM_535701.2| PREDICTED: Canis familiaris similar to proteaso...	44	0.61
173	ref|XM_758573.1| Theileria parva strain Muguga chromosome 4 26S ...	44	0.61
174	emb|BX067090.1|CNS09NXI Single read from an extremity of a full-...	44	0.61
175	emb|Z38135.1|MSDBATPMR M.sexta mRNA for DEAD-box ATPase	44	0.61
176	gb|AC046176.13| Homo sapiens chromosome 8, clone RP11-446E9, com...	44	0.61
177	gb|AC091671.28| Papio anubis clone rp41-192i11, complete sequence	44	0.61
178	gb|AC107376.7| Homo sapiens chromosome 8, clone CTA-397H3, compl...	44	0.61
179	gb|BC102595.1| Bos taurus proteasome (prosome, macropain) 26S su...	44	0.61
180	gb|AC008971.6| Homo sapiens chromosome 5 clone CTD-2376B17, comp...	44	0.61
181	gb|AC008954.6|AC008954 Homo sapiens chromosome 5 clone CTD-2340N...	44	0.61
182	ref|NG_002379.1| Homo sapiens proteasome (prosome, macropain) 26...	44	0.61
183	ref|NG_001564.1| Homo sapiens proteasome (prosome, macropain) 26...	44	0.61
184	gb|AC139783.3| Homo sapiens chromosome 5 clone RP11-1084J3, comp...	44	0.61
185	gb|AC008033.9| Homo sapiens 12 BAC RP11-81H14 (Roswell Park Canc...	44	0.61
186	gb|AC116987.2| Dictyostelium discoideum chromosome 2 map 3527441...	44	0.61
187	gb|AY609771.1| Sus scrofa clone Clu_3050.scr.msk.p1.Contig3, mRN...	44	0.61
188	gb|U36395.1|STU36395 Spermophilus tridecemlineatus 26S Proteasom...	44	0.61
189	ref|NM_001035083.1| Bos taurus proteasome (prosome, macropain) 2...	44	0.61
190	gb|DQ222507.1| Solanum tuberosum clone 115D06 26S proteasome sub...	42	2.4
191	gb|CP000069.1| Trypanosoma brucei chromosome 6, complete sequence	42	2.4
192	gb|AC073906.6| Trypanosoma brucei chromosome 6 clone RPCI93-3A7,...	42	2.4
193	gb|AY915912.1| Schistosoma japonicum Tat binding protein 7, TBP-...	42	2.4
194	ref|XM_821194.1| Trypanosoma brucei TREU927 clone RPCI93-3A7 pro...	42	2.4
195	emb|BX067091.1|CNS09NXJ Single read from an extremity of a full-...	42	2.4
196	emb|BX057192.1|CNS09GAK Single read from an extremity of a full-...	42	2.4
197	emb|BX048935.1|CNS099X7 Single read from an extremity of a full-...	42	2.4
198	emb|BX047011.1|CNS098FR Single read from an extremity of a full-...	42	2.4
199	emb|BX030223.1|CNS08VHF Single read from an extremity of a full-...	42	2.4
200	emb|AL049728.1|SPCC306 S.pombe chromosome III cosmid c306	42	2.4
201	gb|AC103559.2| Homo sapiens chromosome 3 clone RP11-286L5, compl...	42	2.4
202	gb|AC159893.2| Mus musculus BAC clone RP23-365N23 from chromosom...	42	2.4
203	gb|AC098481.2| Homo sapiens chromosome 3 clone RP11-349E16, comp...	42	2.4
204	gb|AC087269.5| Homo sapiens chromosome 8, clone RP11-211C9, comp...	42	2.4
205	gb|AF227501.1| Trypanosoma brucei proteasome regulatory ATPase s...	42	2.4
206	ref|NM_001022802.1| Schizosaccharomyces pombe 972h- 19S proteaso...	42	2.4
207	gb|AC154832.2| Mus musculus BAC clone RP24-568D4 from chromosome...	42	2.4
208	emb|BX936454.25| Zebrafish DNA sequence from clone DKEY-29M11 in...	42	2.4
209	gb|AC174644.2| Mus musculus BAC clone RP23-432C18 from chromosom...	42	2.4
210	gb|AY609476.1| Sus scrofa clone Clu_12870.scr.msk.p1.Contig3, mR...	42	2.4
211	gb|AC158981.2| Mus musculus BAC clone RP23-230C10 from chromosom...	42	2.4
212	ref|NM_111819.3| Arabidopsis thaliana CDC48 (CELL DIVISION CYCLE...	40	9.6
213	ref|NM_103934.3| Arabidopsis thaliana unknown protein AT1G50510 ...	40	9.6
214	ref|NM_179641.1| Arabidopsis thaliana ATP binding / ATPase/ nucl...	40	9.6
215	ref|XM_520776.1| PREDICTED: Pan troglodytes similar to protease ...	40	9.6
216	ref|XM_510114.1| PREDICTED: Pan troglodytes similar to protease ...	40	9.6
217	ref|XM_464508.1| Oryza sativa (japonica cultivar-group), mRNA	40	9.6
218	gb|BC061627.1| Xenopus tropicalis 26S protease regulatory subuni...	40	9.6
219	gb|BC073818.1| Homo sapiens proteasome (prosome, macropain) 26S ...	40	9.6
220	gb|BC016368.1| Homo sapiens proteasome (prosome, macropain) 26S ...	40	9.6
221	gb|BC000512.2| Homo sapiens proteasome (prosome, macropain) 26S ...	40	9.6
222	gb|DQ440423.1| Aedes aegypti clone AET-5666 26S proteasome regul...	40	9.6
223	gb|BC054143.1| Xenopus laevis xMSS1 protein, mRNA (cDNA clone MG...	40	9.6
224	gb|AC015985.10|ATAC015985 Arabidopsis thaliana chromosome III BA...	40	9.6
225	gb|AC114549.9| Mus musculus chromosome 19, clone RP24-216P17, co...	40	9.6
226	gb|BC021001.1| Homo sapiens cDNA clone IMAGE:3839998, **** WARNI...	40	9.6
227	ref|NM_002802.2| Homo sapiens proteasome (prosome, macropain) 26...	40	9.6
228	gb|BT009826.1| Homo sapiens proteasome (prosome, macropain) 26S ...	40	9.6
229	ref|XM_791312.1| PREDICTED: Strongylocentrotus purpuratus simila...	40	9.6
230	ref|XM_777098.1| PREDICTED: Strongylocentrotus purpuratus simila...	40	9.6
231	ref|XM_789501.1| PREDICTED: Strongylocentrotus purpuratus simila...	40	9.6
232	emb|BX842654.1| Bdellovibrio bacteriovorus complete genome, stra...	40	9.6
233	ref|NM_204011.1| Xenopus tropicalis proteasome (prosome, macropa...	40	9.6
234	gb|BC067741.1| Homo sapiens proteasome (prosome, macropain) 26S ...	40	9.6
235	emb|AJ223384.1|MSE223384 Manduca sexta mRNA for 26S proteasome r...	40	9.6
236	gb|AC160129.2| Mus musculus BAC clone RP23-253N17 from chromosom...	40	9.6
237	gb|AC091991.2| Homo sapiens chromosome 5 clone RP11-86C20, compl...	40	9.6
238	dbj|AK124201.1| Homo sapiens cDNA FLJ42207 fis, clone THYMU20362...	40	9.6
239	emb|CR620708.1| full-length cDNA clone CS0DF001YL06 of Fetal bra...	40	9.6
240	emb|CR614875.1| full-length cDNA clone CS0DF036YN10 of Fetal bra...	40	9.6
241	emb|CR612999.1| full-length cDNA clone CS0DA002YA20 of Neuroblas...	40	9.6
242	emb|CR607057.1| full-length cDNA clone CS0DA004YA22 of Neuroblas...	40	9.6
243	emb|CR606549.1| full-length cDNA clone CS0DA010YK18 of Neuroblas...	40	9.6
244	gb|AC009373.7| Drosophila melanogaster 3L BAC RP98-22B18 (Roswel...	40	9.6
245	emb|CR603948.1| full-length cDNA clone CS0DJ011YA20 of T cells (...	40	9.6
246	emb|CR601231.1| full-length cDNA clone CS0DE006YF19 of Placenta ...	40	9.6
247	emb|CR599996.1| full-length cDNA clone CS0DI024YK20 of Placenta ...	40	9.6
248	emb|CR596533.1| full-length cDNA clone CS0DA012YH17 of Neuroblas...	40	9.6
249	emb|CR592984.1| full-length cDNA clone CS0DI065YE14 of Placenta ...	40	9.6
250	emb|CR591570.1| full-length cDNA clone CS0DE013YN23 of Placenta ...	40	9.6
251	emb|CR590391.1| full-length cDNA clone CL0BB024ZA05 of Neuroblas...	40	9.6
252	gb|AY094434.1| Arabidopsis thaliana AT3g09840/F8A24_11 mRNA, com...	40	9.6
253	ref|NM_140719.2| Drosophila melanogaster CG3885-RA (CG3885), mRNA	40	9.6
254	ref|NM_140268.1| Drosophila melanogaster CG7257-RA (CG7257), mRNA	40	9.6
255	gb|AC007212.7| Arabidopsis thaliana chromosome 2 clone F8D23 map...	40	9.6
256	gb|AC010698.7| Drosophila melanogaster 3L BAC RP98-15K18 (Roswel...	40	9.6
257	gb|AY089267.1| Drosophila melanogaster AT06668 full insert cDNA	40	9.6
258	gb|AC010202.6| Homo sapiens 12q BAC RP11-210L7 (Roswell Park Can...	40	9.6
259	gb|AC093875.1| Homo sapiens BAC clone RP11-625B21 from 4, comple...	40	9.6
260	gb|AC096922.2| Homo sapiens chromosome 3 clone RP11-436J20, comp...	40	9.6
261	ref|NG_001556.1| Homo sapiens proteasome (prosome, macropain) 26...	40	9.6
262	ref|XM_941575.1| PREDICTED: Homo sapiens similar to peptidase (p...	40	9.6
263	ref|XM_945272.1| PREDICTED: Homo sapiens similar to peptidase (p...	40	9.6
264	ref|XM_941569.1| PREDICTED: Homo sapiens similar to peptidase (p...	40	9.6
265	ref|XM_928643.1| PREDICTED: Homo sapiens similar to peptidase (p...	40	9.6
266	ref|XM_933007.1| PREDICTED: Homo sapiens similar to peptidase (p...	40	9.6
267	ref|XM_928629.1| PREDICTED: Homo sapiens similar to peptidase (p...	40	9.6
268	gb|AY065076.1| Arabidopsis thaliana putative transitional endopl...	40	9.6
269	gb|AY061578.1| Drosophila melanogaster SD02883 full length cDNA	40	9.6
270	emb|CR457044.1| Homo sapiens full open reading frame cDNA clone ...	40	9.6
271	dbj|AB169562.1| Macaca fascicularis brain cDNA, clone: QflA-1316...	40	9.6
272	dbj|AK222120.1| Arabidopsis thaliana mRNA for putative transitio...	40	9.6
273	gb|AC010244.6| Homo sapiens chromosome 5 clone CTC-364B20, compl...	40	9.6
274	emb|BX814123.1|CNS0AEBL Arabidopsis thaliana Full-length cDNA Co...	40	9.6
275	emb|BX814920.1|CNS0AE2A Arabidopsis thaliana Full-length cDNA Co...	40	9.6
276	gb|AC008089.3|AC008089 Drosophila melanogaster, chromosome 3R, r...	40	9.6
277	gb|AC007822.4|AC007822 Drosophila melanogaster, chromosome 3R, r...	40	9.6
278	emb|BX841857.1|CNS09Y38 Arabidopsis thaliana Full-length cDNA Co...	40	9.6
279	gb|AC096765.3| Homo sapiens BAC clone RP11-678F16 from 2, comple...	40	9.6
280	dbj|AK222668.1| Homo sapiens mRNA for proteasome 26S ATPase subu...	40	9.6
281	gb|AC079279.4|AC079279 Arabidopsis thaliana chromosome 1 BAC F17...	40	9.6
282	ref|NM_203824.1| Xenopus tropicalis 26S protease regulatory subu...	40	9.6
283	gb|AC021058.16|AC021058 Homo sapiens 12 BAC RP11-373H1 (Roswell ...	40	9.6
284	gb|BT004358.1| Arabidopsis thaliana clone U20176 unknown protein...	40	9.6
285	gb|BT002789.1| Arabidopsis thaliana clone RAFL15-04-J16 (R20176)...	40	9.6
286	gb|AC012561.2|AC012561 Arabidopsis thaliana chromosome I BAC F11...	40	9.6
287	dbj|AK176580.1| Arabidopsis thaliana mRNA for AAA-type ATPase li...	40	9.6
288	dbj|AK175325.1| Arabidopsis thaliana mRNA for AAA-type ATPase li...	40	9.6
289	dbj|AK175187.1| Arabidopsis thaliana mRNA for AAA-type ATPase li...	40	9.6
290	dbj|AK175116.1| Arabidopsis thaliana mRNA for AAA-type ATPase li...	40	9.6
291	dbj|AP004812.3| Oryza sativa (japonica cultivar-group) genomic D...	40	9.6
292	gb|AY888761.1| Synthetic construct Homo sapiens clone FLH110001....	40	9.6
293	gb|AY888760.1| Synthetic construct Homo sapiens clone FLH110000....	40	9.6
294	gb|AY888759.1| Synthetic construct Homo sapiens clone FLH109996....	40	9.6
295	dbj|AP004869.3| Oryza sativa (japonica cultivar-group) genomic D...	40	9.6
296	emb|AL663098.8| Mouse DNA sequence from clone RP23-24L23 on chro...	40	9.6
297	dbj|AK118992.1| Arabidopsis thaliana At2g18190 mRNA for putative...	40	9.6
298	dbj|AK104698.1| Oryza sativa (japonica cultivar-group) cDNA clon...	40	9.6
299	gb|BC064227.1| Xenopus tropicalis proteasome (prosome, macropain...	40	9.6
300	dbj|AK067026.1| Oryza sativa (japonica cultivar-group) cDNA clon...	40	9.6
301	emb|CR533570.6| Zebrafish DNA sequence from clone DKEY-288J18 in...	40	9.6
302	gb|AE003687.3| Drosophila melanogaster chromosome 3R, section 25...	40	9.6
303	emb|AL161662.6|CNS01RH6 Human chromosome 14 DNA sequence BAC R-4...	40	9.6
304	gb|AE003543.4| Drosophila melanogaster chromosome 3L, section 42...	40	9.6
305	emb|CR760112.2| Xenopus tropicalis finished cDNA, clone TNeu106h10	40	9.6
306	gb|AE003524.5| Drosophila melanogaster chromosome 3L, section 61...	40	9.6
307	emb|CR761560.2| Xenopus tropicalis finished cDNA, clone TGas131c05	40	9.6
308	emb|AL355074.5|CNS05TC8 Human chromosome 14 DNA sequence BAC R-7...	40	9.6
309	gb|AE004969.1| Neisseria gonorrhoeae FA 1090, complete genome	40	9.6
310	dbj|AP002372.4| Homo sapiens genomic DNA, chromosome 11 clone:RP...	40	9.6
311	gb|AC101745.9| Mus musculus chromosome 19, clone RP23-473I8, com...	40	9.6
312	gb|AE015451.1| Pseudomonas putida KT2440 complete genome	40	9.6
313	dbj|AP003383.2| Homo sapiens genomic DNA, chromosome 11q clone:R...	40	9.6
314	gb|AY609681.1| Sus scrofa clone Clu_25236.scr.msk.p1.Contig3, mR...	40	9.6
315	gb|U37587.1|ATU37587 Arabidopsis thaliana cell division cycle pr...	40	9.6
316	gb|BC018859.2| Homo sapiens proteasome (prosome, macropain) 26S ...	40	9.6
317	gb|U40861.1|NGU40861 Neisseria gonorrhoeae hemoglobin receptor (...	40	9.6
318	gb|L02426.1|HUM26SPSIV Human 26S protease (S4) regulatory subuni...	40	9.6
319	gb|AC087242.10| Homo sapiens 12 BAC RP11-361I14 (Roswell Park Ca...	40	9.6
320	dbj|AB033536.1| Oryza sativa (japonica cultivar-group) OsRPT4 mR...	40	9.6

---

>ref|XM_465282.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1517

 Score =  599 bits (302), Expect = e-168
 Identities = 404/438 (92%)
 Strand = Plus / Minus

                                                                        
Query: 263  tgttgcctcatttgtagaagtcaaagtctgactcaggcttcttgacattggttcggtaac 322
            |||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||
Sbjct: 1315 tgttgcctcatttgtagaagtcaaagtcagtctcaggcttcttgacattggttcggtaac 1256

                                                                        
Query: 323  ccttctcgaagtccttggggaggataacataccgatttttgcggacagcatgcatgccag 382
            ||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||
Sbjct: 1255 ccttctcgaagtccttggggaggataacataccgatttttgcgcacagcatgcataccag 1196

                                                                        
Query: 383  cttcctggcaaatagcagtgatatcagcagcactgattttatcaggtctggagacataat 442
            |||| || || |||||||  |||||||||||||| |||||||| |||||||| |||||||
Sbjct: 1195 cttcttgacagatagcagcaatatcagcagcactaattttatctggtctggaaacataat 1136

                                                                        
Query: 443  cttccaaatcaacctcatcactcaagttcatcttagcagtacaaacttggaaaacaagcc 502
            ||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||
Sbjct: 1135 cttccaaatcaacctcatcactcaagttcattttagcagtacagacttggaaaacaagcc 1076

                                                                        
Query: 503  tcttctgcctccgatccggcagagggaactcaattttcctgtccagtcttcctggacgca 562
            |||||||||  ||||| || ||||||||||| ||||||||||||| ||| |||||||| |
Sbjct: 1075 tcttctgccgacgatctggaagagggaactcgattttcctgtccaatctacctggacgta 1016

                                                                        
Query: 563  gcagagcaggatctagagtatctgcccgattggttgccattataaccttcacattcactg 622
             ||||||||| ||||| ||||| ||||  ||||| |||||||||||||||||||||||||
Sbjct: 1015 acagagcagggtctagggtatccgccctgttggtcgccattataaccttcacattcactg 956

                                                                        
Query: 623  tctgatcaaatccatccatctgattcagtagttccatcagaatacgctgaacttctcggt 682
            | ||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||
Sbjct: 955  tttgatcaaatccatccatctgattgagtagttccataagaatacgctgaacttctcggt 896

                              
Query: 683  cagccccggtctgagcat 700
            |||| || ||||||||||
Sbjct: 895  cagcaccagtctgagcat 878

---

>dbj|AK071476.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023091H23, full
            insert sequence
          Length = 1518

 Score =  599 bits (302), Expect = e-168
 Identities = 404/438 (92%)
 Strand = Plus / Minus

                                                                        
Query: 263  tgttgcctcatttgtagaagtcaaagtctgactcaggcttcttgacattggttcggtaac 322
            |||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||
Sbjct: 1315 tgttgcctcatttgtagaagtcaaagtcagtctcaggcttcttgacattggttcggtaac 1256

                                                                        
Query: 323  ccttctcgaagtccttggggaggataacataccgatttttgcggacagcatgcatgccag 382
            ||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||
Sbjct: 1255 ccttctcgaagtccttggggaggataacataccgatttttgcgcacagcatgcataccag 1196

                                                                        
Query: 383  cttcctggcaaatagcagtgatatcagcagcactgattttatcaggtctggagacataat 442
            |||| || || |||||||  |||||||||||||| |||||||| |||||||| |||||||
Sbjct: 1195 cttcttgacagatagcagcaatatcagcagcactaattttatctggtctggaaacataat 1136

                                                                        
Query: 443  cttccaaatcaacctcatcactcaagttcatcttagcagtacaaacttggaaaacaagcc 502
            ||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||
Sbjct: 1135 cttccaaatcaacctcatcactcaagttcattttagcagtacagacttggaaaacaagcc 1076

                                                                        
Query: 503  tcttctgcctccgatccggcagagggaactcaattttcctgtccagtcttcctggacgca 562
            |||||||||  ||||| || ||||||||||| ||||||||||||| ||| |||||||| |
Sbjct: 1075 tcttctgccgacgatctggaagagggaactcgattttcctgtccaatctacctggacgta 1016

                                                                        
Query: 563  gcagagcaggatctagagtatctgcccgattggttgccattataaccttcacattcactg 622
             ||||||||| ||||| ||||| ||||  ||||| |||||||||||||||||||||||||
Sbjct: 1015 acagagcagggtctagggtatccgccctgttggtcgccattataaccttcacattcactg 956

                                                                        
Query: 623  tctgatcaaatccatccatctgattcagtagttccatcagaatacgctgaacttctcggt 682
            | ||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||
Sbjct: 955  tttgatcaaatccatccatctgattgagtagttccataagaatacgctgaacttctcggt 896

                              
Query: 683  cagccccggtctgagcat 700
            |||| || ||||||||||
Sbjct: 895  cagcaccagtctgagcat 878

---

>dbj|AB070253.1| Oryza sativa (japonica cultivar-group) OsRPT3 mRNA for 26S proteasome
            regulatory particle triple-A ATPase subunit3, partial cds
          Length = 1375

 Score =  599 bits (302), Expect = e-168
 Identities = 404/438 (92%)
 Strand = Plus / Minus

                                                                        
Query: 263  tgttgcctcatttgtagaagtcaaagtctgactcaggcttcttgacattggttcggtaac 322
            |||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||
Sbjct: 1114 tgttgcctcatttgtagaagtcaaagtcagtctcaggcttcttgacattggttcggtaac 1055

                                                                        
Query: 323  ccttctcgaagtccttggggaggataacataccgatttttgcggacagcatgcatgccag 382
            ||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||
Sbjct: 1054 ccttctcgaagtccttggggaggataacataccgatttttgcgcacagcatgcataccag 995

                                                                        
Query: 383  cttcctggcaaatagcagtgatatcagcagcactgattttatcaggtctggagacataat 442
            |||| || || |||||||  |||||||||||||| |||||||| |||||||| |||||||
Sbjct: 994  cttcttgacagatagcagcaatatcagcagcactaattttatctggtctggaaacataat 935

                                                                        
Query: 443  cttccaaatcaacctcatcactcaagttcatcttagcagtacaaacttggaaaacaagcc 502
            ||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||
Sbjct: 934  cttccaaatcaacctcatcactcaagttcattttagcagtacagacttggaaaacaagcc 875

                                                                        
Query: 503  tcttctgcctccgatccggcagagggaactcaattttcctgtccagtcttcctggacgca 562
            |||||||||  ||||| || ||||||||||| ||||||||||||| ||| |||||||| |
Sbjct: 874  tcttctgccgacgatctggaagagggaactcgattttcctgtccaatctacctggacgta 815

                                                                        
Query: 563  gcagagcaggatctagagtatctgcccgattggttgccattataaccttcacattcactg 622
             ||||||||| ||||| ||||| ||||  ||||| |||||||||||||||||||||||||
Sbjct: 814  acagagcagggtctagggtatccgccctgttggtcgccattataaccttcacattcactg 755

                                                                        
Query: 623  tctgatcaaatccatccatctgattcagtagttccatcagaatacgctgaacttctcggt 682
            | ||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||
Sbjct: 754  tttgatcaaatccatccatctgattgagtagttccataagaatacgctgaacttctcggt 695

                              
Query: 683  cagccccggtctgagcat 700
            |||| || ||||||||||
Sbjct: 694  cagcaccagtctgagcat 677

---

>dbj|AK059237.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-024-F02, full
            insert sequence
          Length = 1293

 Score =  591 bits (298), Expect = e-165
 Identities = 403/438 (92%)
 Strand = Plus / Minus

                                                                        
Query: 263  tgttgcctcatttgtagaagtcaaagtctgactcaggcttcttgacattggttcggtaac 322
            |||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||
Sbjct: 1066 tgttgcctcatttgtagaagtcaaagtcagtctcaggcttcttgacattggttcggtaac 1007

                                                                        
Query: 323  ccttctcgaagtccttggggaggataacataccgatttttgcggacagcatgcatgccag 382
            ||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||
Sbjct: 1006 ccttctcgaagtccttggggaggataacataccgatttttgcgcacagcatgcataccag 947

                                                                        
Query: 383  cttcctggcaaatagcagtgatatcagcagcactgattttatcaggtctggagacataat 442
            |||| || || |||||||  |||||||||||||| |||||||| |||||||| |||||||
Sbjct: 946  cttcttgacagatagcagcaatatcagcagcactaattttatctggtctggaaacataat 887

                                                                        
Query: 443  cttccaaatcaacctcatcactcaagttcatcttagcagtacaaacttggaaaacaagcc 502
            ||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||
Sbjct: 886  cttccaaatcaacctcatcactcaagttcattttagcagtacagacttggaaaacaagcc 827

                                                                        
Query: 503  tcttctgcctccgatccggcagagggaactcaattttcctgtccagtcttcctggacgca 562
            |||||||||  ||||| || ||||||||||| ||||||||||||| ||| |||||||| |
Sbjct: 826  tcttctgccgacgatctggaagagggaactcgattttcctgtccaatctacctggacgta 767

                                                                        
Query: 563  gcagagcaggatctagagtatctgcccgattggttgccattataaccttcacattcactg 622
             ||||||||| ||||| ||||| ||||  ||||| |||||||||||||||||||||||||
Sbjct: 766  acagagcagggtctagggtatccgccctgttggtcgccattataaccttcacattcactg 707

                                                                        
Query: 623  tctgatcaaatccatccatctgattcagtagttccatcagaatacgctgaacttctcggt 682
            | ||||||||||||||||||||||| ||||||||||| ||||||||||||||| ||||||
Sbjct: 706  tttgatcaaatccatccatctgattgagtagttccataagaatacgctgaactcctcggt 647

                              
Query: 683  cagccccggtctgagcat 700
            |||| || ||||||||||
Sbjct: 646  cagcaccagtctgagcat 629

---

>gb|AY530962.1| Zea mays 26S proteasome regulatory complex ATPase RPT3 mRNA, complete
            cds
          Length = 1251

 Score =  509 bits (257), Expect = e-141
 Identities = 392/437 (89%)
 Strand = Plus / Minus

                                                                        
Query: 264  gttgcctcatttgtagaagtcaaagtctgactcaggcttcttgacattggttcggtaacc 323
            |||| ||||||||||||| |||||||||| ||| |||||||| || ||||||||||| ||
Sbjct: 1068 gttgactcatttgtagaaatcaaagtctgtctcgggcttcttcacgttggttcggtagcc 1009

                                                                        
Query: 324  cttctcgaagtccttggggaggataacataccgatttttgcggacagcatgcatgccagc 383
            ||| || ||||||||||||||||| ||||| || ||||||||||||||||||||||||||
Sbjct: 1008 cttttcaaagtccttggggaggatgacatatcggtttttgcggacagcatgcatgccagc 949

                                                                        
Query: 384  ttcctggcaaatagcagtgatatcagcagcactgattttatcaggtctggagacataatc 443
             || ||||| |||||||  ||||||||||||||||| ||||| |||||||| ||||||||
Sbjct: 948  ctcttggcagatagcagcaatatcagcagcactgatcttatccggtctggaaacataatc 889

                                                                        
Query: 444  ttccaaatcaacctcatcactcaagttcatcttagcagtacaaacttggaaaacaagcct 503
            |||||||||||||||||| |||| |||||| || ||||| |||||||| |||||||||||
Sbjct: 888  ttccaaatcaacctcatcgctcaggttcattttggcagtgcaaacttgaaaaacaagcct 829

                                                                        
Query: 504  cttctgcctccgatccggcagagggaactcaattttcctgtccagtcttcctggacgcag 563
            |||||| | ||| || |||||||||||||||||||||||||| ||||| || ||||||| 
Sbjct: 828  cttctgacgccggtctggcagagggaactcaattttcctgtcaagtctaccaggacgcaa 769

                                                                        
Query: 564  cagagcaggatctagagtatctgcccgattggttgccattataaccttcacattcactgt 623
            || ||||||||||||||| ||||||||||| ||||||||||||||||||||||| |||||
Sbjct: 768  caaagcaggatctagagtgtctgcccgattagttgccattataaccttcacattgactgt 709

                                                                        
Query: 624  ctgatcaaatccatccatctgattcagtagttccatcagaatacgctgaacttctcggtc 683
             |||||||| |||||||||||||| ||||| ||||| |||||||||||||||||||||||
Sbjct: 708  ttgatcaaacccatccatctgattgagtagctccataagaatacgctgaacttctcggtc 649

                             
Query: 684  agccccggtctgagcat 700
            ||| || ||||||||||
Sbjct: 648  agcaccagtctgagcat 632

---

>gb|AY104317.1| Zea mays PCO132144 mRNA sequence
          Length = 1654

 Score =  496 bits (250), Expect = e-137
 Identities = 392/438 (89%), Gaps = 1/438 (0%)
 Strand = Plus / Minus

                                                                        
Query: 264  gttgcctcatttgtagaagtcaaagtctgactcaggcttcttgacattggttcggtaacc 323
            |||| ||||||||||||| |||||||||| ||| |||||||| || ||||||||||| ||
Sbjct: 1379 gttgactcatttgtagaaatcaaagtctgtctcgggcttcttcacgttggttcggtagcc 1320

                                                                        
Query: 324  cttctcgaagtccttggggaggataacataccgatttttgcggacagcatgcatgccagc 383
            ||| || ||||||||||||||||| ||||| || ||||||||||||||||||||||||||
Sbjct: 1319 cttttcaaagtccttggggaggatgacatatcggtttttgcggacagcatgcatgccagc 1260

                                                                        
Query: 384  ttcctggcaaatagcagtgatatcagcagcactgattttatcaggtctggagacataatc 443
             || ||||| |||||||  ||||||||||||||||| ||||| |||||||| ||||||||
Sbjct: 1259 ctcttggcagatagcagcaatatcagcagcactgatcttatccggtctggaaacataatc 1200

                                                                        
Query: 444  ttccaaatcaacctcatcactcaagttcatcttagcagtacaaacttggaaaacaagcct 503
            |||||||||||||||||| |||| |||||| || ||||| |||||||| |||||||||||
Sbjct: 1199 ttccaaatcaacctcatcgctcaggttcattttggcagtgcaaacttgaaaaacaagcct 1140

                                                                        
Query: 504  cttctgcctccgatccgg-cagagggaactcaattttcctgtccagtcttcctggacgca 562
            |||||| | ||| || || |||||||||||||||||||||||| ||||| || |||||||
Sbjct: 1139 cttctgacgccggtctggccagagggaactcaattttcctgtcaagtctaccaggacgca 1080

                                                                        
Query: 563  gcagagcaggatctagagtatctgcccgattggttgccattataaccttcacattcactg 622
             || ||||||||||||||| ||||||||||| ||||||||||||||||||||||| ||||
Sbjct: 1079 acaaagcaggatctagagtgtctgcccgattagttgccattataaccttcacattgactg 1020

                                                                        
Query: 623  tctgatcaaatccatccatctgattcagtagttccatcagaatacgctgaacttctcggt 682
            | |||||||| |||||||||||||| ||||| ||||| ||||||||||||||||||||||
Sbjct: 1019 tttgatcaaacccatccatctgattgagtagctccataagaatacgctgaacttctcggt 960

                              
Query: 683  cagccccggtctgagcat 700
            |||| || ||||||||||
Sbjct: 959  cagcaccagtctgagcat 942

---

>gb|BT016898.1| Zea mays clone Contig731 mRNA sequence
          Length = 1066

 Score =  452 bits (228), Expect = e-124
 Identities = 354/396 (89%)
 Strand = Plus / Minus

                                                                       
Query: 264 gttgcctcatttgtagaagtcaaagtctgactcaggcttcttgacattggttcggtaacc 323
           |||||||||||||||||| || ||||| | ||||||||| || || ||||||||||| ||
Sbjct: 397 gttgcctcatttgtagaaatcgaagtccgtctcaggctttttcacgttggttcggtagcc 338

                                                                       
Query: 324 cttctcgaagtccttggggaggataacataccgatttttgcggacagcatgcatgccagc 383
           |||||| ||||||||||||||||| ||||| || ||||||||||||||||||||||||||
Sbjct: 337 cttctcaaagtccttggggaggatgacatatcggtttttgcggacagcatgcatgccagc 278

                                                                       
Query: 384 ttcctggcaaatagcagtgatatcagcagcactgattttatcaggtctggagacataatc 443
           ||| || || |||||||  ||||||||||||||||| ||||| |||||||| ||||| ||
Sbjct: 277 ttcttgacagatagcagcaatatcagcagcactgatcttatccggtctggaaacatagtc 218

                                                                       
Query: 444 ttccaaatcaacctcatcactcaagttcatcttagcagtacaaacttggaaaacaagcct 503
           ||||||||||||||| ||||||| |||||| || ||||| || |||||||||||||||||
Sbjct: 217 ttccaaatcaacctcgtcactcaggttcattttggcagtgcagacttggaaaacaagcct 158

                                                                       
Query: 504 cttctgcctccgatccggcagagggaactcaattttcctgtccagtcttcctggacgcag 563
           |||||| | ||| || |||| ||||||||||||||||||||| ||||| || ||||||| 
Sbjct: 157 cttctgacgccggtctggcaaagggaactcaattttcctgtcaagtctaccaggacgcaa 98

                                                                       
Query: 564 cagagcaggatctagagtatctgcccgattggttgccattataaccttcacattcactgt 623
           |||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||
Sbjct: 97  cagagcaggatctagagtgtctgcccgattagttgccattataaccttcacattcactgt 38

                                               
Query: 624 ctgatcaaatccatccatctgattcagtagttccat 659
            |||||||| |||||||||||||| ||||| |||||
Sbjct: 37  ttgatcaaacccatccatctgattgagtagctccat 2

---

>emb|AJ006095.1|CAR6095 Cicer arietinum mRNA for putative 26S protease regulatory subunit
           6, partial
          Length = 763

 Score =  264 bits (133), Expect = 4e-67
 Identities = 343/413 (83%)
 Strand = Plus / Minus

                                                                       
Query: 274 ttgtagaagtcaaagtctgactcaggcttcttgacattggttcggtaacccttctcgaag 333
           ||||| || |||||||| |  ||||||||||| ||||| || | ||||||||||||||||
Sbjct: 531 ttgtaaaattcaaagtccgtatcaggcttcttcacatttgtcctgtaacccttctcgaag 472

                                                                       
Query: 334 tccttggggaggataacataccgatttttgcggacagcatgcatgccagcttcctggcaa 393
           ||||| || || || ||||| | ||| || || ||||||||||| || ||||| || |||
Sbjct: 471 tccttcggcagtatgacatatctattcttacgaacagcatgcattcctgcttcttgacaa 412

                                                                       
Query: 394 atagcagtgatatcagcagcactgattttatcaggtctggagacataatcttccaaatca 453
           |||||||  || ||||||||||| ||||| ||||| | ||| |||||||| ||||  || 
Sbjct: 411 atagcagatatctcagcagcactaattttgtcaggacgggaaacataatcctccaggtcc 352

                                                                       
Query: 454 acctcatcactcaagttcatcttagcagtacaaacttggaaaacaagcctcttctgcctc 513
           |||||||||||||||||||| || || || ||||| || || ||||||||||| ||||  
Sbjct: 351 acctcatcactcaagttcattttggctgtgcaaacctgaaatacaagcctcttttgccgt 292

                                                                       
Query: 514 cgatccggcagagggaactcaattttcctgtccagtcttcctggacgcagcagagcagga 573
           | ||| |||| ||||||||||||||| |  || || ||||| |||||||  || ||||||
Sbjct: 291 ctatcaggcaaagggaactcaattttgcgatcaagccttccaggacgcaagagggcagga 232

                                                                       
Query: 574 tctagagtatctgcccgattggttgccattataaccttcacattcactgtctgatcaaat 633
           || | ||| ||||||||||||||||||||||| ||||| ||||||||||||||||| || 
Sbjct: 231 tccaaagtgtctgcccgattggttgccattatgaccttaacattcactgtctgatcgaaa 172

                                                                
Query: 634 ccatccatctgattcagtagttccatcagaatacgctgaacttctcggtcagc 686
           ||||||||||||||||  |||||||| || ||||| || ||||||| ||||||
Sbjct: 171 ccatccatctgattcaaaagttccatgaggatacgttgtacttctctgtcagc 119

---

>gb|BT012705.1| Lycopersicon esculentum clone 113583F, mRNA sequence
          Length = 1608

 Score =  218 bits (110), Expect = 2e-53
 Identities = 290/350 (82%)
 Strand = Plus / Minus

                                                                        
Query: 298  ggcttcttgacattggttcggtaacccttctcgaagtccttggggaggataacataccga 357
            |||||||| |||||||| | ||||||||| || |||||||||||||| || ||||| |||
Sbjct: 1269 ggcttcttcacattggtcctgtaacccttttcaaagtccttggggagtatgacatatcga 1210

                                                                        
Query: 358  tttttgcggacagcatgcatgccagcttcctggcaaatagcagtgatatcagcagcactg 417
            || || || || |||||||| || |||||||| || ||||| |  || ||||||||||| 
Sbjct: 1209 ttctttcgcactgcatgcatacctgcttcctgacatatagctgcaatctcagcagcacta 1150

                                                                        
Query: 418  attttatcaggtctggagacataatcttccaaatcaacctcatcactcaagttcatctta 477
            ||||||||||| |  || |||||||||||||| |||||||| ||||  ||||||||||||
Sbjct: 1149 attttatcagggcgagaaacataatcttccaagtcaacctcgtcacctaagttcatctta 1090

                                                                        
Query: 478  gcagtacaaacttggaaaacaagcctcttctgcctccgatccggcagagggaactcaatt 537
            |||||||| || || |||||||||||||| || | || ||| |||| ||| || ||||| 
Sbjct: 1089 gcagtacagacctgaaaaacaagcctcttttgacgcctatcaggcaaaggaaattcaatc 1030

                                                                        
Query: 538  ttcctgtccagtcttcctggacgcagcagagcaggatctagagtatctgcccgattggtt 597
            ||||  || || ||||| |||||||| || |||||||| | |||||| || |  || |||
Sbjct: 1029 ttccgatcaagccttccaggacgcagaagtgcaggatccaaagtatcagctctgttagtt 970

                                                              
Query: 598  gccattataaccttcacattcactgtctgatcaaatccatccatctgatt 647
            ||||| ||||| ||||||||||| ||||| |||||||||||||| |||||
Sbjct: 969  gccatgataactttcacattcacagtctggtcaaatccatccatttgatt 920

---

>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
                sequence
          Length = 35954743

 Score =  218 bits (110), Expect = 2e-53
 Identities = 131/138 (94%)
 Strand = Plus / Minus

                                                                            
Query: 263      tgttgcctcatttgtagaagtcaaagtctgactcaggcttcttgacattggttcggtaac 322
                |||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||
Sbjct: 13062628 tgttgcctcatttgtagaagtcaaagtcagtctcaggcttcttgacattggttcggtaac 13062569

                                                                            
Query: 323      ccttctcgaagtccttggggaggataacataccgatttttgcggacagcatgcatgccag 382
                ||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||
Sbjct: 13062568 ccttctcgaagtccttggggaggataacataccgatttttgcgcacagcatgcataccag 13062509

                                  
Query: 383      cttcctggcaaatagcag 400
                |||| || || |||||||
Sbjct: 13062508 cttcttgacagatagcag 13062491



 Score =  186 bits (94), Expect = 7e-44
 Identities = 142/158 (89%)
 Strand = Plus / Minus

                                                                            
Query: 487      acttggaaaacaagcctcttctgcctccgatccggcagagggaactcaattttcctgtcc 546
                |||||||||||||||||||||||||  ||||| || ||||||||||| ||||||||||||
Sbjct: 13060637 acttggaaaacaagcctcttctgccgacgatctggaagagggaactcgattttcctgtcc 13060578

                                                                            
Query: 547      agtcttcctggacgcagcagagcaggatctagagtatctgcccgattggttgccattata 606
                | ||| |||||||| | ||||||||| ||||| ||||| ||||  ||||| |||||||||
Sbjct: 13060577 aatctacctggacgtaacagagcagggtctagggtatccgccctgttggtcgccattata 13060518

                                                      
Query: 607      accttcacattcactgtctgatcaaatccatccatctg 644
                ||||||||||||||||| ||||||||||||||||||||
Sbjct: 13060517 accttcacattcactgtttgatcaaatccatccatctg 13060480



 Score =  133 bits (67), Expect = 9e-28
 Identities = 85/91 (93%)
 Strand = Plus / Minus

                                                                            
Query: 405      atcagcagcactgattttatcaggtctggagacataatcttccaaatcaacctcatcact 464
                |||||||||||| |||||||| |||||||| |||||||||||||||||||||||||||||
Sbjct: 13061702 atcagcagcactaattttatctggtctggaaacataatcttccaaatcaacctcatcact 13061643

                                               
Query: 465      caagttcatcttagcagtacaaacttggaaa 495
                ||||||||| ||||||||||| || ||||||
Sbjct: 13061642 caagttcattttagcagtacagacctggaaa 13061612



 Score = 85.7 bits (43), Expect = 2e-13
 Identities = 55/59 (93%)
 Strand = Plus / Minus

                                                                           
Query: 642      ctgattcagtagttccatcagaatacgctgaacttctcggtcagccccggtctgagcat 700
                |||||| ||||||||||| |||||||||||||||||||||||||| || ||||||||||
Sbjct: 13060241 ctgattgagtagttccataagaatacgctgaacttctcggtcagcaccagtctgagcat 13060183



 Score = 40.1 bits (20), Expect = 9.6
 Identities = 32/36 (88%)
 Strand = Plus / Plus

                                                   
Query: 627     atcaaatccatccatctgattcagtagttccatcag 662
               |||||||||||| | |||||| || |||||||||||
Sbjct: 5597004 atcaaatccatctaactgatttagcagttccatcag 5597039

---

>dbj|AP004789.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC
             clone:P0476C12
          Length = 157570

 Score =  218 bits (110), Expect = 2e-53
 Identities = 131/138 (94%)
 Strand = Plus / Minus

                                                                         
Query: 263   tgttgcctcatttgtagaagtcaaagtctgactcaggcttcttgacattggttcggtaac 322
             |||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||
Sbjct: 39205 tgttgcctcatttgtagaagtcaaagtcagtctcaggcttcttgacattggttcggtaac 39146

                                                                         
Query: 323   ccttctcgaagtccttggggaggataacataccgatttttgcggacagcatgcatgccag 382
             ||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||
Sbjct: 39145 ccttctcgaagtccttggggaggataacataccgatttttgcgcacagcatgcataccag 39086

                               
Query: 383   cttcctggcaaatagcag 400
             |||| || || |||||||
Sbjct: 39085 cttcttgacagatagcag 39068



 Score =  186 bits (94), Expect = 7e-44
 Identities = 142/158 (89%)
 Strand = Plus / Minus

                                                                         
Query: 487   acttggaaaacaagcctcttctgcctccgatccggcagagggaactcaattttcctgtcc 546
             |||||||||||||||||||||||||  ||||| || ||||||||||| ||||||||||||
Sbjct: 37214 acttggaaaacaagcctcttctgccgacgatctggaagagggaactcgattttcctgtcc 37155

                                                                         
Query: 547   agtcttcctggacgcagcagagcaggatctagagtatctgcccgattggttgccattata 606
             | ||| |||||||| | ||||||||| ||||| ||||| ||||  ||||| |||||||||
Sbjct: 37154 aatctacctggacgtaacagagcagggtctagggtatccgccctgttggtcgccattata 37095

                                                   
Query: 607   accttcacattcactgtctgatcaaatccatccatctg 644
             ||||||||||||||||| ||||||||||||||||||||
Sbjct: 37094 accttcacattcactgtttgatcaaatccatccatctg 37057



 Score =  133 bits (67), Expect = 9e-28
 Identities = 85/91 (93%)
 Strand = Plus / Minus

                                                                         
Query: 405   atcagcagcactgattttatcaggtctggagacataatcttccaaatcaacctcatcact 464
             |||||||||||| |||||||| |||||||| |||||||||||||||||||||||||||||
Sbjct: 38279 atcagcagcactaattttatctggtctggaaacataatcttccaaatcaacctcatcact 38220

                                            
Query: 465   caagttcatcttagcagtacaaacttggaaa 495
             ||||||||| ||||||||||| || ||||||
Sbjct: 38219 caagttcattttagcagtacagacctggaaa 38189



 Score = 85.7 bits (43), Expect = 2e-13
 Identities = 55/59 (93%)
 Strand = Plus / Minus

                                                                        
Query: 642   ctgattcagtagttccatcagaatacgctgaacttctcggtcagccccggtctgagcat 700
             |||||| ||||||||||| |||||||||||||||||||||||||| || ||||||||||
Sbjct: 36818 ctgattgagtagttccataagaatacgctgaacttctcggtcagcaccagtctgagcat 36760

---

>ref|NM_125214.4| Arabidopsis thaliana RPT3; ATPase AT5G58290 (RPT3) mRNA, complete cds
          Length = 1518

 Score =  198 bits (100), Expect = 2e-47
 Identities = 310/380 (81%)
 Strand = Plus / Minus

                                                                        
Query: 298  ggcttcttgacattggttcggtaacccttctcgaagtccttggggaggataacataccga 357
            |||||||| ||||| |  ||||| ||||||||||| ||||| || || || ||||| |  
Sbjct: 1276 ggcttcttaacatttgcgcggtagcccttctcgaaatccttaggtagtatcacatatctg 1217

                                                                        
Query: 358  tttttgcggacagcatgcatgccagcttcctggcaaatagcagtgatatcagcagcactg 417
            || || || || |||||||| ||||||||||||||||| || |  || |||||||| || 
Sbjct: 1216 ttctttcgcaccgcatgcataccagcttcctggcaaattgctgctatctcagcagcgcta 1157

                                                                        
Query: 418  attttatcaggtctggagacataatcttccaaatcaacctcatcactcaagttcatctta 477
            ||||||||||| |  || ||||| |||||||| ||||||||||| || | |||||| || 
Sbjct: 1156 attttatcaggccgtgaaacatagtcttccaagtcaacctcatcgctaaggttcattttg 1097

                                                                        
Query: 478  gcagtacaaacttggaaaacaagcctcttctgcctccgatccggcagagggaactcaatt 537
            |  || || || ||||||||||||||||| || |  | ||| || || ||||||||||| 
Sbjct: 1096 gaggtgcatacctggaaaacaagcctcttttgacgtctatcaggaagggggaactcaatc 1037

                                                                        
Query: 538  ttcctgtccagtcttcctggacgcagcagagcaggatctagagtatctgcccgattggtt 597
            || |  || |||||||| ||||| |  ||||||||||||||||| |||||||  || |||
Sbjct: 1036 ttacgatcaagtcttccaggacgtaagagagcaggatctagagtgtctgccctgtttgtt 977

                                                                        
Query: 598  gccattataaccttcacattcactgtctgatcaaatccatccatctgattcagtagttcc 657
            |||||||| ||||| |||||||| ||||| |||||||||||||||||||| || || |||
Sbjct: 976  gccattatgaccttgacattcacggtctggtcaaatccatccatctgattaagaagctcc 917

                                
Query: 658  atcagaatacgctgaacttc 677
            || |||||||||||||||||
Sbjct: 916  atgagaatacgctgaacttc 897

---

>gb|BT020373.1| Arabidopsis thaliana At5g58290 gene, complete cds
          Length = 1227

 Score =  198 bits (100), Expect = 2e-47
 Identities = 310/380 (81%)
 Strand = Plus / Minus

                                                                        
Query: 298  ggcttcttgacattggttcggtaacccttctcgaagtccttggggaggataacataccga 357
            |||||||| ||||| |  ||||| ||||||||||| ||||| || || || ||||| |  
Sbjct: 1199 ggcttcttaacatttgcgcggtagcccttctcgaaatccttaggtagtatcacatatctg 1140

                                                                        
Query: 358  tttttgcggacagcatgcatgccagcttcctggcaaatagcagtgatatcagcagcactg 417
            || || || || |||||||| ||||||||||||||||| || |  || |||||||| || 
Sbjct: 1139 ttctttcgcaccgcatgcataccagcttcctggcaaattgctgctatctcagcagcgcta 1080

                                                                        
Query: 418  attttatcaggtctggagacataatcttccaaatcaacctcatcactcaagttcatctta 477
            ||||||||||| |  || ||||| |||||||| ||||||||||| || | |||||| || 
Sbjct: 1079 attttatcaggccgtgaaacatagtcttccaagtcaacctcatcgctaaggttcattttg 1020

                                                                        
Query: 478  gcagtacaaacttggaaaacaagcctcttctgcctccgatccggcagagggaactcaatt 537
            |  || || || ||||||||||||||||| || |  | ||| || || ||||||||||| 
Sbjct: 1019 gaggtgcatacctggaaaacaagcctcttttgacgtctatcaggaagggggaactcaatc 960

                                                                        
Query: 538  ttcctgtccagtcttcctggacgcagcagagcaggatctagagtatctgcccgattggtt 597
            || |  || |||||||| ||||| |  ||||||||||||||||| |||||||  || |||
Sbjct: 959  ttacgatcaagtcttccaggacgtaagagagcaggatctagagtgtctgccctgtttgtt 900

                                                                        
Query: 598  gccattataaccttcacattcactgtctgatcaaatccatccatctgattcagtagttcc 657
            |||||||| ||||| |||||||| ||||| |||||||||||||||||||| || || |||
Sbjct: 899  gccattatgaccttgacattcacggtctggtcaaatccatccatctgattaagaagctcc 840

                                
Query: 658  atcagaatacgctgaacttc 677
            || |||||||||||||||||
Sbjct: 839  atgagaatacgctgaacttc 820

---

>gb|AY070466.1| Arabidopsis thaliana AT4g10340/F24G24_140 mRNA, complete cds
          Length = 1950

 Score =  198 bits (100), Expect = 2e-47
 Identities = 310/380 (81%)
 Strand = Plus / Minus

                                                                        
Query: 298  ggcttcttgacattggttcggtaacccttctcgaagtccttggggaggataacataccga 357
            |||||||| ||||| |  ||||| ||||||||||| ||||| || || || ||||| |  
Sbjct: 1715 ggcttcttaacatttgcgcggtagcccttctcgaaatccttaggtagtatcacatatctg 1656

                                                                        
Query: 358  tttttgcggacagcatgcatgccagcttcctggcaaatagcagtgatatcagcagcactg 417
            || || || || |||||||| ||||||||||||||||| || |  || |||||||| || 
Sbjct: 1655 ttctttcgcaccgcatgcataccagcttcctggcaaattgctgctatctcagcagcgcta 1596

                                                                        
Query: 418  attttatcaggtctggagacataatcttccaaatcaacctcatcactcaagttcatctta 477
            ||||||||||| |  || ||||| |||||||| ||||||||||| || | |||||| || 
Sbjct: 1595 attttatcaggccgtgaaacatagtcttccaagtcaacctcatcgctaaggttcattttg 1536

                                                                        
Query: 478  gcagtacaaacttggaaaacaagcctcttctgcctccgatccggcagagggaactcaatt 537
            |  || || || ||||||||||||||||| || |  | ||| || || ||||||||||| 
Sbjct: 1535 gaggtgcatacctggaaaacaagcctcttttgacgtctatcaggaagggggaactcaatc 1476

                                                                        
Query: 538  ttcctgtccagtcttcctggacgcagcagagcaggatctagagtatctgcccgattggtt 597
            || |  || |||||||| ||||| |  ||||||||||||||||| |||||||  || |||
Sbjct: 1475 ttacgatcaagtcttccaggacgtaagagagcaggatctagagtgtctgccctgtttgtt 1416

                                                                        
Query: 598  gccattataaccttcacattcactgtctgatcaaatccatccatctgattcagtagttcc 657
            |||||||| ||||| |||||||| ||||| |||||||||||||||||||| || || |||
Sbjct: 1415 gccattatgaccttgacattcacggtctggtcaaatccatccatctgattaagaagctcc 1356

                                
Query: 658  atcagaatacgctgaacttc 677
            || |||||||||||||||||
Sbjct: 1355 atgagaatacgctgaacttc 1336

---

>gb|AF123392.1|AF123392 Arabidopsis thaliana 26S proteasome AAA-ATPase subunit RPT3 (RPT3)
            mRNA, complete cds
          Length = 1301

 Score =  198 bits (100), Expect = 2e-47
 Identities = 310/380 (81%)
 Strand = Plus / Minus

                                                                        
Query: 298  ggcttcttgacattggttcggtaacccttctcgaagtccttggggaggataacataccga 357
            |||||||| ||||| |  ||||| ||||||||||| ||||| || || || ||||| |  
Sbjct: 1240 ggcttcttaacatttgcgcggtagcccttctcgaaatccttaggtagtatcacatatctg 1181

                                                                        
Query: 358  tttttgcggacagcatgcatgccagcttcctggcaaatagcagtgatatcagcagcactg 417
            || || || || |||||||| ||||||||||||||||| || |  || |||||||| || 
Sbjct: 1180 ttctttcgcaccgcatgcataccagcttcctggcaaattgctgctatctcagcagcgcta 1121

                                                                        
Query: 418  attttatcaggtctggagacataatcttccaaatcaacctcatcactcaagttcatctta 477
            ||||||||||| |  || ||||| |||||||| ||||||||||| || | |||||| || 
Sbjct: 1120 attttatcaggccgtgaaacatagtcttccaagtcaacctcatcgctaaggttcattttg 1061

                                                                        
Query: 478  gcagtacaaacttggaaaacaagcctcttctgcctccgatccggcagagggaactcaatt 537
            |  || || || ||||||||||||||||| || |  | ||| || || ||||||||||| 
Sbjct: 1060 gaggtgcatacctggaaaacaagcctcttttgacgtctatcaggaagggggaactcaatc 1001

                                                                        
Query: 538  ttcctgtccagtcttcctggacgcagcagagcaggatctagagtatctgcccgattggtt 597
            || |  || |||||||| ||||| |  ||||||||||||||||| |||||||  || |||
Sbjct: 1000 ttacgatcaagtcttccaggacgtaagagagcaggatctagagtgtctgccctgtttgtt 941

                                                                        
Query: 598  gccattataaccttcacattcactgtctgatcaaatccatccatctgattcagtagttcc 657
            |||||||| ||||| |||||||| ||||| |||||||||||||||||||| || || |||
Sbjct: 940  gccattatgaccttgacattcacggtctggtcaaatccatccatctgattaagaagctcc 881

                                
Query: 658  atcagaatacgctgaacttc 677
            || |||||||||||||||||
Sbjct: 880  atgagaatacgctgaacttc 861

---

>emb|BX831143.1|CNS09ZD2 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
            GSLTLS60ZH10 of Adult vegetative tissue of strain col-0
            of Arabidopsis thaliana (thale cress)
          Length = 1426

 Score =  184 bits (93), Expect = 3e-43
 Identities = 310/381 (81%), Gaps = 1/381 (0%)
 Strand = Plus / Minus

                                                                        
Query: 298  ggcttcttgacattggttcggtaacccttctcgaagtccttggggaggataacataccga 357
            |||||||| ||||| |  ||||| ||||||||||| ||||| || || || ||||| |  
Sbjct: 1250 ggcttcttaacatttgcgcggtagcccttctcgaaatccttaggtagtatcacatatctg 1191

                                                                        
Query: 358  tttttgcggacagcatgcatgccagcttcctggcaaatagcagtgatatcagcagcactg 417
            || || || || |||||||| ||||||||||||||||| || |  || |||||||| || 
Sbjct: 1190 ttctttcgcaccgcatgcataccagcttcctggcaaattgctgctatctcagcagcgcta 1131

                                                                        
Query: 418  attttatcaggtctggagac-ataatcttccaaatcaacctcatcactcaagttcatctt 476
            ||||||||||| |  || || ||| |||||||| ||||||||||| || | |||||| ||
Sbjct: 1130 attttatcaggccgtgaaacgatagtcttccaagtcaacctcatcgctaaggttcatttt 1071

                                                                        
Query: 477  agcagtacaaacttggaaaacaagcctcttctgcctccgatccggcagagggaactcaat 536
             |  || || || ||||||||||||||||| || |  | ||| || || |||||||||||
Sbjct: 1070 ggaggtgcatacctggaaaacaagcctcttttgacgtctatcaggaagggggaactcaat 1011

                                                                        
Query: 537  tttcctgtccagtcttcctggacgcagcagagcaggatctagagtatctgcccgattggt 596
             || |  || |||||||| ||||| |  ||||||||||||||||| |||||||  || ||
Sbjct: 1010 cttacgatcaagtcttccaggacgtaagagagcaggatctagagtgtctgccctgtttgt 951

                                                                        
Query: 597  tgccattataaccttcacattcactgtctgatcaaatccatccatctgattcagtagttc 656
            ||||||||| ||||| |||||||| ||||| |||||||||||||||||||| || || ||
Sbjct: 950  tgccattatgaccttgacattcacggtctggtcaaatccatccatctgattaagaagctc 891

                                 
Query: 657  catcagaatacgctgaacttc 677
            ||| |||||||||||||||||
Sbjct: 890  catgagaatacgctgaacttc 870

---

>emb|BX831136.1|CNS09ZEE Arabidopsis thaliana Full-length cDNA Complete sequence from clone
            GSLTLS60ZB05 of Adult vegetative tissue of strain col-0
            of Arabidopsis thaliana (thale cress)
          Length = 1414

 Score =  184 bits (93), Expect = 3e-43
 Identities = 310/381 (81%), Gaps = 1/381 (0%)
 Strand = Plus / Minus

                                                                        
Query: 298  ggcttcttgacattggttcggtaacccttctcgaagtccttggggaggataacataccga 357
            |||||||| ||||| |  ||||| ||||||||||| ||||| || || || ||||| |  
Sbjct: 1230 ggcttcttaacatttgcgcggtagcccttctcgaaatccttaggtagtatcacatatctg 1171

                                                                        
Query: 358  tttttgcggacagcatgcatgccagcttcctggcaaatagcagtgatatcagcagcactg 417
            || || || || |||||||| ||||||||||||||||| || |  || |||||||| || 
Sbjct: 1170 ttctttcgcaccgcatgcataccagcttcctggcaaattgctgctatctcagcagcgcta 1111

                                                                        
Query: 418  attttatcaggtctggagac-ataatcttccaaatcaacctcatcactcaagttcatctt 476
            ||||||||||| |  || || ||| |||||||| ||||||||||| || | |||||| ||
Sbjct: 1110 attttatcaggccgtgaaacgatagtcttccaagtcaacctcatcgctaaggttcatttt 1051

                                                                        
Query: 477  agcagtacaaacttggaaaacaagcctcttctgcctccgatccggcagagggaactcaat 536
             |  || || || ||||||||||||||||| || |  | ||| || || |||||||||||
Sbjct: 1050 ggaggtgcatacctggaaaacaagcctcttttgacgtctatcaggaagggggaactcaat 991

                                                                        
Query: 537  tttcctgtccagtcttcctggacgcagcagagcaggatctagagtatctgcccgattggt 596
             || |  || |||||||| ||||| |  ||||||||||||||||| |||||||  || ||
Sbjct: 990  cttacgatcaagtcttccaggacgtaagagagcaggatctagagtgtctgccctgtttgt 931

                                                                        
Query: 597  tgccattataaccttcacattcactgtctgatcaaatccatccatctgattcagtagttc 656
            ||||||||| ||||| |||||||| ||||| |||||||||||||||||||| || || ||
Sbjct: 930  tgccattatgaccttgacattcacggtctggtcaaatccatccatctgattaagaagctc 871

                                 
Query: 657  catcagaatacgctgaacttc 677
            ||| |||||||||||||||||
Sbjct: 870  catgagaatacgctgaacttc 850

---

>emb|BX831437.1|CNS09ZEY Arabidopsis thaliana Full-length cDNA Complete sequence from clone
            GSLTLS90ZD08 of Adult vegetative tissue of strain col-0
            of Arabidopsis thaliana (thale cress)
          Length = 1389

 Score =  176 bits (89), Expect = 6e-41
 Identities = 309/381 (81%), Gaps = 1/381 (0%)
 Strand = Plus / Minus

                                                                        
Query: 298  ggcttcttgacattggttcggtaacccttctcgaagtccttggggaggataacataccga 357
            |||||||| ||||| |  ||||| ||||||||||| ||||| || || || ||||| |  
Sbjct: 1305 ggcttcttaacatttgcgcggtagcccttctcgaaatccttaggtagtatcacatatctg 1246

                                                                        
Query: 358  tttttgcggacagcatgcatgccagcttcctggcaaatagcagtgatatcagcagcactg 417
            || || || || |||||||| ||||||||||||||||| || |  || |||||||| || 
Sbjct: 1245 ttctttcgcaccgcatgcataccagcttcctggcaaattgctgctatctcagcagcgcta 1186

                                                                        
Query: 418  attttatcaggtctggagac-ataatcttccaaatcaacctcatcactcaagttcatctt 476
            ||||||||||| |  ||||| ||| |||||||| ||||||||||| || | |||||| ||
Sbjct: 1185 attttatcaggccgtgagacgatagtcttccaagtcaacctcatcgctaaggttcatttt 1126

                                                                        
Query: 477  agcagtacaaacttggaaaacaagcctcttctgcctccgatccggcagagggaactcaat 536
             |  || || || |||||||| |||||||| || |  | ||| || || |||||||||||
Sbjct: 1125 ggaggtgcatacctggaaaacgagcctcttttgacgtctatcaggaagggggaactcaat 1066

                                                                        
Query: 537  tttcctgtccagtcttcctggacgcagcagagcaggatctagagtatctgcccgattggt 596
             || |  || |||||||| ||||| |  ||||||||||||||||| |||||||  || ||
Sbjct: 1065 cttacgatcaagtcttccaggacgtaagagagcaggatctagagtgtctgccctgtttgt 1006

                                                                        
Query: 597  tgccattataaccttcacattcactgtctgatcaaatccatccatctgattcagtagttc 656
            ||||||||| ||||| |||||||| ||||| ||| |||||||||||||||| || || ||
Sbjct: 1005 tgccattatgaccttgacattcacggtctggtcagatccatccatctgattgagaagctc 946

                                 
Query: 657  catcagaatacgctgaacttc 677
            ||| |||||||||||||||||
Sbjct: 945  catgagaatacgctgaacttc 925

---

>gb|U43398.1|STU43398 Solanum tuberosum POTATP1 mRNA, complete cds
          Length = 1473

 Score =  155 bits (78), Expect = 2e-34
 Identities = 174/206 (84%)
 Strand = Plus / Minus

                                                                        
Query: 274  ttgtagaagtcaaagtctgactcaggcttcttgacattggttcggtaacccttctcgaag 333
            |||||||| |||||||| |  ||||||||||| || || || | ||||||||| || |||
Sbjct: 1260 ttgtagaattcaaagtcagtgtcaggcttcttcacgtttgtcctgtaacccttttcaaag 1201

                                                                        
Query: 334  tccttggggaggataacataccgatttttgcggacagcatgcatgccagcttcctggcaa 393
            ||||| || ||||| ||||| ||||| ||||| || |||||||| |||||||| || || 
Sbjct: 1200 tcctttggaaggatgacatatcgattcttgcgcactgcatgcataccagcttcttgacag 1141

                                                                        
Query: 394  atagcagtgatatcagcagcactgattttatcaggtctggagacataatcttccaaatca 453
            ||||| || || ||||||||||||||||||||||| |  || |||||||||||||| |||
Sbjct: 1140 atagccgtaatctcagcagcactgattttatcagggcgagaaacataatcttccaagtca 1081

                                      
Query: 454  acctcatcactcaagttcatcttagc 479
            ||||||||||  ||||||||||||||
Sbjct: 1080 acctcatcacctaagttcatcttagc 1055



 Score = 99.6 bits (50), Expect = 1e-17
 Identities = 95/110 (86%)
 Strand = Plus / Minus

                                                                       
Query: 591 attggttgccattataaccttcacattcactgtctgatcaaatccatccatctgattcag 650
           |||||||||||| ||||| |||||||||||||| || ||||| |||||||||||||| ||
Sbjct: 943 attggttgccataataactttcacattcactgtttggtcaaacccatccatctgatttag 884

                                                             
Query: 651 tagttccatcagaatacgctgaacttctcggtcagccccggtctgagcat 700
           ||| ||||| || |||||||| || ||||  ||||| || ||||||||||
Sbjct: 883 tagctccatgaggatacgctggacctctctatcagctccagtctgagcat 834

---

>dbj|AK117042.1| Ciona intestinalis cDNA, clone:cits021e02, full insert sequence
          Length = 1474

 Score =  125 bits (63), Expect = 2e-25
 Identities = 251/311 (80%), Gaps = 2/311 (0%)
 Strand = Plus / Minus

                                                                        
Query: 349  acataccgatttttgcggacagcatgcatgccagcttcctggcaaatagcagtgatatca 408
            |||||||| ||||  || || ||| ||||||| ||||| |||||||| ||| | ||||||
Sbjct: 1219 acataccggttttcacgaactgcaagcatgcctgcttcttggcaaattgcatttatatca 1160

                                                                        
Query: 409  gcagcactgattttatcaggtctggagacataatcttccaaatcaacctcatcactcaag 468
            ||| || ||||||| ||||||| ||  ||||||||||||||||| || ||||| || | |
Sbjct: 1159 gcaccagtgattttgtcaggtcgggcaacataatcttccaaatccacttcatcgctgagg 1100

                                                                        
Query: 469  ttcatcttagcagtacaaacttg-gaaaacaagcctcttctgcctccgatccggcagagg 527
            ||||||||  ||||| | | | | ||| || || | |||||| ||||||||||| || ||
Sbjct: 1099 ttcatcttcccagta-atagtggagaagacgagacgcttctgtctccgatccggaagcgg 1041

                                                                        
Query: 528  gaactcaattttcctgtccagtcttcctggacgcagcagagcaggatctagagtatctgc 587
            ||| ||||| ||||  ||||| |  || |||||||||||||||||||| || || || ||
Sbjct: 1040 gaattcaatcttccgatccagacgaccaggacgcagcagagcaggatcgagcgtgtcagc 981

                                                                        
Query: 588  ccgattggttgccattataaccttcacattcactgtctgatcaaatccatccatctgatt 647
             || ||||| ||||| |||||||| ||||| || || ||||| || ||||||||||| ||
Sbjct: 980  tcggttggtggccataataaccttaacattaacagtttgatcgaagccatccatctggtt 921

                       
Query: 648  cagtagttcca 658
             ||||||||||
Sbjct: 920  aagtagttcca 910

---

>dbj|AB019228.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MCK7
          Length = 87090

 Score =  107 bits (54), Expect = 5e-20
 Identities = 129/154 (83%)
 Strand = Plus / Minus

                                                                         
Query: 490   tggaaaacaagcctcttctgcctccgatccggcagagggaactcaattttcctgtccagt 549
             ||||||||||||||||| || |  | ||| || || ||||||||||| || |  || |||
Sbjct: 43576 tggaaaacaagcctcttttgacgtctatcaggaagggggaactcaatcttacgatcaagt 43517

                                                                         
Query: 550   cttcctggacgcagcagagcaggatctagagtatctgcccgattggttgccattataacc 609
             ||||| ||||| |  ||||||||||||||||| |||||||  || ||||||||||| |||
Sbjct: 43516 cttccaggacgtaagagagcaggatctagagtgtctgccctgtttgttgccattatgacc 43457

                                               
Query: 610   ttcacattcactgtctgatcaaatccatccatct 643
             || |||||||| ||||| ||||||||||||||||
Sbjct: 43456 ttgacattcacggtctggtcaaatccatccatct 43423



 Score = 52.0 bits (26), Expect = 0.003
 Identities = 80/98 (81%)
 Strand = Plus / Minus

                                                                         
Query: 298   ggcttcttgacattggttcggtaacccttctcgaagtccttggggaggataacataccga 357
             |||||||| ||||| |  ||||| ||||||||||| ||||| || || || ||||| |  
Sbjct: 44216 ggcttcttaacatttgcgcggtagcccttctcgaaatccttaggtagtatcacatatctg 44157

                                                   
Query: 358   tttttgcggacagcatgcatgccagcttcctggcaaat 395
             || || || || |||||||| |||||||||||||||||
Sbjct: 44156 ttctttcgcaccgcatgcataccagcttcctggcaaat 44119



 Score = 48.1 bits (24), Expect = 0.039
 Identities = 48/56 (85%)
 Strand = Plus / Minus

                                                                     
Query: 406   tcagcagcactgattttatcaggtctggagacataatcttccaaatcaacctcatc 461
             |||||||| || ||||||||||| |  || ||||| |||||||| |||||||||||
Sbjct: 43785 tcagcagcgctaattttatcaggccgtgaaacatagtcttccaagtcaacctcatc 43730



 Score = 40.1 bits (20), Expect = 9.6
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                                 
Query: 642   ctgattcagtagttccatcagaatacgctgaacttc 677
             |||||| || || ||||| |||||||||||||||||
Sbjct: 43324 ctgattaagaagctccatgagaatacgctgaacttc 43289

---

>dbj|AK174288.1| Ciona intestinalis cDNA, clone:cicl025a20, full insert sequence
          Length = 1481

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 128/155 (82%)
 Strand = Plus / Minus

                                                                        
Query: 504  cttctgcctccgatccggcagagggaactcaattttcctgtccagtcttcctggacgcag 563
            |||||| ||||||||||| || ||||| ||||| ||||  ||||| |  || ||||||||
Sbjct: 1071 cttctgtctccgatccggaagcgggaattcaatcttccgatccagacgaccaggacgcag 1012

                                                                        
Query: 564  cagagcaggatctagagtatctgcccgattggttgccattataaccttcacattcactgt 623
            |||||||||||| || || || || || ||||| ||||| |||||||| ||||| || ||
Sbjct: 1011 cagagcaggatcgagcgtgtcagctcggttggtggccataataaccttaacattaacagt 952

                                               
Query: 624  ctgatcaaatccatccatctgattcagtagttcca 658
             ||||| || ||||||||||| || ||||||||||
Sbjct: 951  ttgatcgaagccatccatctggttaagtagttcca 917



 Score = 87.7 bits (44), Expect = 5e-14
 Identities = 107/128 (83%)
 Strand = Plus / Minus

                                                                        
Query: 349  acataccgatttttgcggacagcatgcatgccagcttcctggcaaatagcagtgatatca 408
            |||||||| ||||  || || ||| ||||||| ||||| |||||||| ||| | ||||||
Sbjct: 1226 acataccggttttcacgaactgcaagcatgcctgcttcttggcaaattgcatttatatca 1167

                                                                        
Query: 409  gcagcactgattttatcaggtctggagacataatcttccaaatcaacctcatcactcaag 468
            ||| || ||||||| ||||||||||  ||||||||||||||||| || ||||| || | |
Sbjct: 1166 gcaccagtgattttgtcaggtctggcaacataatcttccaaatccacttcatcgctgagg 1107

                    
Query: 469  ttcatctt 476
            ||||||||
Sbjct: 1106 ttcatctt 1099

---

>gb|AY112326.1| Zea mays CL40761_1 mRNA sequence
          Length = 1098

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 71/79 (89%)
 Strand = Plus / Plus

                                                                       
Query: 405 atcagcagcactgattttatcaggtctggagacataatcttccaaatcaacctcatcact 464
           ||||| ||||||||| ||||| |||||| | |||||||||||||||||| ||||||||||
Sbjct: 575 atcagtagcactgatcttatccggtctgcaaacataatcttccaaatcagcctcatcact 634

                              
Query: 465 caagttcatcttagcagta 483
           ||| | |||||||||||||
Sbjct: 635 caaatccatcttagcagta 653

---

>ref|NM_001008009.1| Xenopus tropicalis rpt3 protein (rpt3), mRNA
          Length = 1567

 Score = 85.7 bits (43), Expect = 2e-13
 Identities = 142/175 (81%)
 Strand = Plus / Minus

                                                                        
Query: 526  gggaactcaattttcctgtccagtcttcctggacgcagcagagcaggatctagagtatct 585
            ||||| || ||||||||||| || |  || ||||||||||| || |||||||| || |||
Sbjct: 1185 gggaattctattttcctgtcgagacgcccgggacgcagcagtgccggatctagtgtgtct 1126

                                                                        
Query: 586  gcccgattggttgccattataaccttcacattcactgtctgatcaaatccatccatctga 645
            ||||| ||||| ||||| || ||||| ||||||||  |||| |||||||| |||||||| 
Sbjct: 1125 gcccggttggtggccatgattacctttacattcacgttctggtcaaatccgtccatctgg 1066

                                                                   
Query: 646  ttcagtagttccatcagaatacgctgaacttctcggtcagccccggtctgagcat 700
            || || || |||| |||||| ||||| || || ||||| || || ||||| ||||
Sbjct: 1065 ttaaggagctccagcagaattcgctgcacctcgcggtcggctcctgtctgggcat 1011

---

>gb|BC080888.1| Xenopus tropicalis rpt3 protein, mRNA (cDNA clone MGC:79492
            IMAGE:6976743), complete cds
          Length = 1567

 Score = 85.7 bits (43), Expect = 2e-13
 Identities = 142/175 (81%)
 Strand = Plus / Minus

                                                                        
Query: 526  gggaactcaattttcctgtccagtcttcctggacgcagcagagcaggatctagagtatct 585
            ||||| || ||||||||||| || |  || ||||||||||| || |||||||| || |||
Sbjct: 1185 gggaattctattttcctgtcgagacgcccgggacgcagcagtgccggatctagtgtgtct 1126

                                                                        
Query: 586  gcccgattggttgccattataaccttcacattcactgtctgatcaaatccatccatctga 645
            ||||| ||||| ||||| || ||||| ||||||||  |||| |||||||| |||||||| 
Sbjct: 1125 gcccggttggtggccatgattacctttacattcacgttctggtcaaatccgtccatctgg 1066

                                                                   
Query: 646  ttcagtagttccatcagaatacgctgaacttctcggtcagccccggtctgagcat 700
            || || || |||| |||||| ||||| || || ||||| || || ||||| ||||
Sbjct: 1065 ttaaggagctccagcagaattcgctgcacctcgcggtcggctcctgtctgggcat 1011

---

>ref|XM_679369.1| PREDICTED: Danio rerio similar to B4galt3-prov protein (LOC556544),
            mRNA
          Length = 4364

 Score = 83.8 bits (42), Expect = 7e-13
 Identities = 102/122 (83%)
 Strand = Plus / Minus

                                                                        
Query: 526  gggaactcaattttcctgtccagtcttcctggacgcagcagagcaggatctagagtatct 585
            ||||||||||| || | ||||| ||| |||||||||||||| ||||| || || || || 
Sbjct: 1190 gggaactcaatcttacggtccaatctacctggacgcagcagggcagggtccagtgtgtca 1131

                                                                        
Query: 586  gcccgattggttgccattataaccttcacattcactgtctgatcaaatccatccatctga 645
            ||||  ||||| ||||| ||||||||||| |||||  |||||||||| |||||||| |||
Sbjct: 1130 gccctgttggtggccatgataaccttcacgttcacattctgatcaaacccatccatttga 1071

              
Query: 646  tt 647
            ||
Sbjct: 1070 tt 1069

---

>gb|AC147002.20| Medicago truncatula clone mth2-151m16, complete sequence
          Length = 128621

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 121/148 (81%)
 Strand = Plus / Plus

                                                                        
Query: 496  acaagcctcttctgcctccgatccggcagagggaactcaattttcctgtccagtcttcct 555
            ||||||||||| || |  | ||| |||| ||||||||||||||| |  || |||||||| 
Sbjct: 7391 acaagcctcttttggcgtctatcaggcaaagggaactcaattttgcgatcaagtcttcca 7450

                                                                        
Query: 556  ggacgcagcagagcaggatctagagtatctgcccgattggttgccattataaccttcaca 615
            |||||||  || |||||||| | ||| ||||| ||||| ||||||||||| || || |||
Sbjct: 7451 ggacgcaagagggcaggatccaaagtgtctgcacgatttgttgccattatgactttaaca 7510

                                        
Query: 616  ttcactgtctgatcaaatccatccatct 643
            ||||| ||||| ||||| || |||||||
Sbjct: 7511 ttcacggtctggtcaaaaccgtccatct 7538



 Score = 50.1 bits (25), Expect = 0.010
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                        
Query: 409  gcagcactgattttatcaggtctggagacataatcttccaaatcaacctcatcactcaag 468
            |||||||| ||||| ||||| | ||| |||||||||||||  || || ||||||||||| 
Sbjct: 6321 gcagcactaattttgtcagggcgggaaacataatcttccaggtccacttcatcactcaaa 6380

                 
Query: 469  ttcat 473
            |||||
Sbjct: 6381 ttcat 6385



 Score = 46.1 bits (23), Expect = 0.16
 Identities = 83/103 (80%)
 Strand = Plus / Plus

                                                                        
Query: 298  ggcttcttgacattggttcggtaacccttctcgaagtccttggggaggataacataccga 357
            |||||||| || ||||| |  ||||| ||||| |||||||| || || || ||||| | |
Sbjct: 5605 ggcttcttcacgttggtcctataacctttctcaaagtcctttggtagtatgacatatcta 5664

                                                       
Query: 358  tttttgcggacagcatgcatgccagcttcctggcaaatagcag 400
            || || || ||||||||||| || ||||| || ||||||||||
Sbjct: 5665 ttcttacgaacagcatgcattcctgcttcttgacaaatagcag 5707

---

>gb|BC060362.1| Xenopus laevis proteasome 26S ATPase subunit 4 isoform 1, mRNA
           (cDNA clone MGC:68784 IMAGE:4202064), complete cds
          Length = 1397

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 108/131 (82%)
 Strand = Plus / Minus

                                                                       
Query: 556 ggacgcagcagagcaggatctagagtatctgcccgattggttgccattataaccttcaca 615
           |||||||||||||| ||||| |  || || ||||  ||||| ||||| || || || |||
Sbjct: 991 ggacgcagcagagccggatccaatgtgtccgccctgttggtggccatgattacttttaca 932

                                                                       
Query: 616 ttcactgtctgatcaaatccatccatctgattcagtagttccatcagaatacgctgaact 675
           |||||  |||| ||||||||||||||||| || || ||||||| |||||| | |||||| 
Sbjct: 931 ttcacgttctggtcaaatccatccatctggttaagaagttccagcagaattctctgaacc 872

                      
Query: 676 tctcggtcagc 686
           |||||||||||
Sbjct: 871 tctcggtcagc 861

---

>dbj|AK153991.1| Mus musculus 2 days neonate thymus thymic cells cDNA, RIKEN
            full-length enriched library, clone:E430019J12
            product:proteasome (prosome, macropain) 26S subunit,
            ATPase, 4, full insert sequence
          Length = 1409

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 141/175 (80%)
 Strand = Plus / Minus

                                                                        
Query: 526  gggaactcaattttcctgtccagtcttcctggacgcagcagagcaggatctagagtatct 585
            ||||| |||||||| | |||||| | |||||| ||||| ||||| ||||| |  || |||
Sbjct: 1058 gggaattcaatttttcggtccaggcgtcctggccgcagtagagctggatccaaggtgtct 999

                                                                        
Query: 586  gcccgattggttgccattataaccttcacattcactgtctgatcaaatccatccatctga 645
            || |  || || ||||| || ||||||||||| ||  |||| |||||||||||||| |||
Sbjct: 998  gctctgtttgtggccatgattaccttcacattgacgttctggtcaaatccatccatttga 939

                                                                   
Query: 646  ttcagtagttccatcagaatacgctgaacttctcggtcagccccggtctgagcat 700
            ||||||||||||| ||| || | |||||| || | |||||| || ||||| ||||
Sbjct: 938  ttcagtagttccagcaggatcctctgaacctccctgtcagctcctgtctgggcat 884

---

>dbj|AK167528.1| Mus musculus 13 days pregnant adult female placenta cDNA, RIKEN
            full-length enriched library, clone:I530018N08
            product:proteasome (prosome, macropain) 26S subunit,
            ATPase, 4, full insert sequence
          Length = 1380

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 141/175 (80%)
 Strand = Plus / Minus

                                                                        
Query: 526  gggaactcaattttcctgtccagtcttcctggacgcagcagagcaggatctagagtatct 585
            ||||| |||||||| | |||||| | |||||| ||||| ||||| ||||| |  || |||
Sbjct: 1030 gggaattcaatttttcggtccaggcgtcctggccgcagtagagctggatccaaggtgtct 971

                                                                        
Query: 586  gcccgattggttgccattataaccttcacattcactgtctgatcaaatccatccatctga 645
            || |  || || ||||| || ||||||||||| ||  |||| |||||||||||||| |||
Sbjct: 970  gctctgtttgtggccatgattaccttcacattgacgttctggtcaaatccatccatttga 911

                                                                   
Query: 646  ttcagtagttccatcagaatacgctgaacttctcggtcagccccggtctgagcat 700
            ||||||||||||| ||| || | |||||| || | |||||| || ||||| ||||
Sbjct: 910  ttcagtagttccagcaggatcctctgaacctccctgtcagctcctgtctgggcat 856

---

>dbj|AK160718.1| Mus musculus 12 days embryo head cDNA, RIKEN full-length enriched
            library, clone:3010086G18 product:proteasome (prosome,
            macropain) 26S subunit, ATPase, 4, full insert sequence
          Length = 1375

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 141/175 (80%)
 Strand = Plus / Minus

                                                                        
Query: 526  gggaactcaattttcctgtccagtcttcctggacgcagcagagcaggatctagagtatct 585
            ||||| |||||||| | |||||| | |||||| ||||| ||||| ||||| |  || |||
Sbjct: 1029 gggaattcaatttttcggtccaggcgtcctggccgcagtagagctggatccaaggtgtct 970

                                                                        
Query: 586  gcccgattggttgccattataaccttcacattcactgtctgatcaaatccatccatctga 645
            || |  || || ||||| || ||||||||||| ||  |||| |||||||||||||| |||
Sbjct: 969  gctctgtttgtggccatgattaccttcacattgacgttctggtcaaatccatccatttga 910

                                                                   
Query: 646  ttcagtagttccatcagaatacgctgaacttctcggtcagccccggtctgagcat 700
            ||||||||||||| ||| || | |||||| || | |||||| || ||||| ||||
Sbjct: 909  ttcagtagttccagcaggatcctctgaacctccctgtcagctcctgtctgggcat 855

---

>dbj|AK160644.1| Mus musculus 10, 11 days embryo whole body cDNA, RIKEN full-length
            enriched library, clone:2810035H13 product:proteasome
            (prosome, macropain) 26S subunit, ATPase, 4, full insert
            sequence
          Length = 1382

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 141/175 (80%)
 Strand = Plus / Minus

                                                                        
Query: 526  gggaactcaattttcctgtccagtcttcctggacgcagcagagcaggatctagagtatct 585
            ||||| |||||||| | |||||| | |||||| ||||| ||||| ||||| |  || |||
Sbjct: 1037 gggaattcaatttttcggtccaggcgtcctggccgcagtagagctggatccaaggtgtct 978

                                                                        
Query: 586  gcccgattggttgccattataaccttcacattcactgtctgatcaaatccatccatctga 645
            || |  || || ||||| || ||||||||||| ||  |||| |||||||||||||| |||
Sbjct: 977  gctctgtttgtggccatgattaccttcacattgacgttctggtcaaatccatccatttga 918

                                                                   
Query: 646  ttcagtagttccatcagaatacgctgaacttctcggtcagccccggtctgagcat 700
            ||||||||||||| ||| || | |||||| || | |||||| || ||||| ||||
Sbjct: 917  ttcagtagttccagcaggatcctctgaacctccctgtcagctcctgtctgggcat 863

---

>dbj|AK167041.1| Mus musculus blastocyst blastocyst cDNA, RIKEN full-length enriched
            library, clone:I1C0028L02 product:proteasome (prosome,
            macropain) 26S subunit, ATPase, 4, full insert sequence
          Length = 1374

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 141/175 (80%)
 Strand = Plus / Minus

                                                                        
Query: 526  gggaactcaattttcctgtccagtcttcctggacgcagcagagcaggatctagagtatct 585
            ||||| |||||||| | |||||| | |||||| ||||| ||||| ||||| |  || |||
Sbjct: 1020 gggaattcaatttttcggtccaggcgtcctggccgcagtagagctggatccaaggtgtct 961

                                                                        
Query: 586  gcccgattggttgccattataaccttcacattcactgtctgatcaaatccatccatctga 645
            || |  || || ||||| || ||||||||||| ||  |||| |||||||||||||| |||
Sbjct: 960  gctctgtttgtggccatgattaccttcacattgacgttctggtcaaatccatccatttga 901

                                                                   
Query: 646  ttcagtagttccatcagaatacgctgaacttctcggtcagccccggtctgagcat 700
            ||||||||||||| ||| || | |||||| || | |||||| || ||||| ||||
Sbjct: 900  ttcagtagttccagcaggatcctctgaacctccctgtcagctcctgtctgggcat 846

---

>dbj|AK169224.1| Mus musculus 17 days pregnant adult female amnion cDNA, RIKEN
            full-length enriched library, clone:I920092H04
            product:proteasome (prosome, macropain) 26S subunit,
            ATPase, 4, full insert sequence
          Length = 1388

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 141/175 (80%)
 Strand = Plus / Minus

                                                                        
Query: 526  gggaactcaattttcctgtccagtcttcctggacgcagcagagcaggatctagagtatct 585
            ||||| |||||||| | |||||| | |||||| ||||| ||||| ||||| |  || |||
Sbjct: 1038 gggaattcaatttttcggtccaggcgtcctggccgcagtagagctggatccaaggtgtct 979

                                                                        
Query: 586  gcccgattggttgccattataaccttcacattcactgtctgatcaaatccatccatctga 645
            || |  || || ||||| || ||||||||||| ||  |||| |||||||||||||| |||
Sbjct: 978  gctctgtttgtggccatgattaccttcacattgacgttctggtcaaatccatccatttga 919

                                                                   
Query: 646  ttcagtagttccatcagaatacgctgaacttctcggtcagccccggtctgagcat 700
            ||||||||||||| ||| || | |||||| || | |||||| || ||||| ||||
Sbjct: 918  ttcagtagttccagcaggatcctctgaacctccctgtcagctcctgtctgggcat 864

---

>dbj|AK077507.1| Mus musculus 8 days embryo whole body cDNA, RIKEN full-length
            enriched library, clone:5730428I01 product:proteasome
            (prosome, macropain) 26S subunit, ATPase, 4, full insert
            sequence
          Length = 1388

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 141/175 (80%)
 Strand = Plus / Minus

                                                                        
Query: 526  gggaactcaattttcctgtccagtcttcctggacgcagcagagcaggatctagagtatct 585
            ||||| |||||||| | |||||| | |||||| ||||| ||||| ||||| |  || |||
Sbjct: 1038 gggaattcaatttttcggtccaggcgtcctggccgcagtagagctggatccaaggtgtct 979

                                                                        
Query: 586  gcccgattggttgccattataaccttcacattcactgtctgatcaaatccatccatctga 645
            || |  || || ||||| || ||||||||||| ||  |||| |||||||||||||| |||
Sbjct: 978  gctctgtttgtggccatgattaccttcacattgacgttctggtcaaatccatccatttga 919

                                                                   
Query: 646  ttcagtagttccatcagaatacgctgaacttctcggtcagccccggtctgagcat 700
            ||||||||||||| ||| || | |||||| || | |||||| || ||||| ||||
Sbjct: 918  ttcagtagttccagcaggatcctctgaacctccctgtcagctcctgtctgggcat 864

---

>gb|BC055215.1| Danio rerio proteasome (prosome, macropain) 26S subunit, ATPase, 4,
            mRNA (cDNA clone MGC:63709 IMAGE:2601666), complete cds
          Length = 1630

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 141/175 (80%)
 Strand = Plus / Minus

                                                                        
Query: 526  gggaactcaattttcctgtccagtcttcctggacgcagcagagcaggatctagagtatct 585
            ||||||||||| || | ||||| ||| ||||||| |||||| ||||| || || || || 
Sbjct: 1016 gggaactcaatcttacggtccaatctacctggacacagcagggcagggtccagtgtgtca 957

                                                                        
Query: 586  gcccgattggttgccattataaccttcacattcactgtctgatcaaatccatccatctga 645
            ||||  ||||| ||||| ||||||||||| |||||  |||||||||| |||||||| |||
Sbjct: 956  gccctgttggtggccatgataaccttcacgttcacattctgatcaaacccatccatttga 897

                                                                   
Query: 646  ttcagtagttccatcagaatacgctgaacttctcggtcagccccggtctgagcat 700
            || || || || | ||| || | ||| ||||||| |||||| || ||||| ||||
Sbjct: 896  ttgagaagctcaagcaggattctctgtacttctctgtcagctccagtctgtgcat 842

---

>ref|NM_199750.1| Danio rerio proteasome (prosome, macropain) 26S subunit, ATPase, 4
            (psmc4), mRNA
          Length = 1630

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 141/175 (80%)
 Strand = Plus / Minus

                                                                        
Query: 526  gggaactcaattttcctgtccagtcttcctggacgcagcagagcaggatctagagtatct 585
            ||||||||||| || | ||||| ||| ||||||| |||||| ||||| || || || || 
Sbjct: 1016 gggaactcaatcttacggtccaatctacctggacacagcagggcagggtccagtgtgtca 957

                                                                        
Query: 586  gcccgattggttgccattataaccttcacattcactgtctgatcaaatccatccatctga 645
            ||||  ||||| ||||| ||||||||||| |||||  |||||||||| |||||||| |||
Sbjct: 956  gccctgttggtggccatgataaccttcacgttcacattctgatcaaacccatccatttga 897

                                                                   
Query: 646  ttcagtagttccatcagaatacgctgaacttctcggtcagccccggtctgagcat 700
            || || || || | ||| || | ||| ||||||| |||||| || ||||| ||||
Sbjct: 896  ttgagaagctcaagcaggattctctgtacttctctgtcagctccagtctgtgcat 842

---

>ref|XM_452488.1| Kluyveromyces lactis NRRL Y-1140, KLLA0C06534g predicted mRNA
          Length = 1287

 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 107/130 (82%)
 Strand = Plus / Minus

                                                                       
Query: 571 ggatctagagtatctgcccgattggttgccattataaccttcacattcactgtctgatca 630
           |||||||||||||| || |||||||||||||||||||| || |||||   || |||||||
Sbjct: 977 ggatctagagtatcagcacgattggttgccattataactttaacatttgttgactgatca 918

                                                                       
Query: 631 aatccatccatctgattcagtagttccatcagaatacgctgaacttctcggtcagccccg 690
           || |||||||| ||| | ||||  || ||||  ||||| || ||||| || |||| ||| 
Sbjct: 917 aaaccatccatttgagtaagtaactcaatcaatatacgttggacttcacgatcagaccct 858

                     
Query: 691 gtctgagcat 700
           ||||||||||
Sbjct: 857 gtctgagcat 848

---

>emb|CR382123.1| Kluyveromyces lactis strain NRRL Y-1140 chromosome C of strain NRRL
              Y-1140 of Kluyveromyces lactis
          Length = 1753957

 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 107/130 (82%)
 Strand = Plus / Minus

                                                                          
Query: 571    ggatctagagtatctgcccgattggttgccattataaccttcacattcactgtctgatca 630
              |||||||||||||| || |||||||||||||||||||| || |||||   || |||||||
Sbjct: 573195 ggatctagagtatcagcacgattggttgccattataactttaacatttgttgactgatca 573136

                                                                          
Query: 631    aatccatccatctgattcagtagttccatcagaatacgctgaacttctcggtcagccccg 690
              || |||||||| ||| | ||||  || ||||  ||||| || ||||| || |||| ||| 
Sbjct: 573135 aaaccatccatttgagtaagtaactcaatcaatatacgttggacttcacgatcagaccct 573076

                        
Query: 691    gtctgagcat 700
              ||||||||||
Sbjct: 573075 gtctgagcat 573066

---

>dbj|AK050677.1| Mus musculus 9 days embryo whole body cDNA, RIKEN full-length
            enriched library, clone:D030002E20 product:proteasome
            (prosome, macropain) 26S subunit, ATPase, 4, full insert
            sequence
          Length = 1403

 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 137/170 (80%)
 Strand = Plus / Minus

                                                                        
Query: 526  gggaactcaattttcctgtccagtcttcctggacgcagcagagcaggatctagagtatct 585
            ||||| |||||||| | |||||| | |||||| ||||| ||||| ||||| |  || |||
Sbjct: 1053 gggaattcaatttttcggtccaggcgtcctggccgcagtagagctggatccaaggtgtct 994

                                                                        
Query: 586  gcccgattggttgccattataaccttcacattcactgtctgatcaaatccatccatctga 645
            || |  || || ||||| || ||||||||||| ||  |||| |||||||||||||| |||
Sbjct: 993  gctctgtttgtggccatgattaccttcacattgacgttctggtcaaatccatccatttga 934

                                                              
Query: 646  ttcagtagttccatcagaatacgctgaacttctcggtcagccccggtctg 695
            ||||||||||||| ||| || | |||||| || | |||||| || |||||
Sbjct: 933  ttcagtagttccagcaggatcctctgaacctccctgtcagctcctgtctg 884

---

>ref|NM_153001.1| Homo sapiens proteasome (prosome, macropain) 26S subunit, ATPase, 4
           (PSMC4), transcript variant 2, mRNA
          Length = 1363

 Score = 73.8 bits (37), Expect = 7e-10
 Identities = 136/169 (80%)
 Strand = Plus / Minus

                                                                       
Query: 532 tcaattttcctgtccagtcttcctggacgcagcagagcaggatctagagtatctgcccga 591
           |||||||| | |||||| | |||||| || ||||| || ||||| || || ||||| |  
Sbjct: 939 tcaattttacggtccagccgtcctggccgtagcagggccggatccagggtgtctgctctg 880

                                                                       
Query: 592 ttggttgccattataaccttcacattcactgtctgatcaaatccatccatctgattcagt 651
           || || ||||| || ||||| ||||| ||  |||||||||||||||||||||||||||| 
Sbjct: 879 tttgtggccatgattaccttgacattgacattctgatcaaatccatccatctgattcagc 820

                                                            
Query: 652 agttccatcagaatacgctgaacttctcggtcagccccggtctgagcat 700
           || |||| ||| || | |||||| || | ||| ||||| ||||||||||
Sbjct: 819 agctccagcaggatcctctgaacctccctgtcggcccctgtctgagcat 771

---

>ref|NM_006503.2| Homo sapiens proteasome (prosome, macropain) 26S subunit, ATPase, 4
            (PSMC4), transcript variant 1, mRNA
          Length = 1450

 Score = 73.8 bits (37), Expect = 7e-10
 Identities = 136/169 (80%)
 Strand = Plus / Minus

                                                                        
Query: 532  tcaattttcctgtccagtcttcctggacgcagcagagcaggatctagagtatctgcccga 591
            |||||||| | |||||| | |||||| || ||||| || ||||| || || ||||| |  
Sbjct: 1032 tcaattttacggtccagccgtcctggccgtagcagggccggatccagggtgtctgctctg 973

                                                                        
Query: 592  ttggttgccattataaccttcacattcactgtctgatcaaatccatccatctgattcagt 651
            || || ||||| || ||||| ||||| ||  |||||||||||||||||||||||||||| 
Sbjct: 972  tttgtggccatgattaccttgacattgacattctgatcaaatccatccatctgattcagc 913

                                                             
Query: 652  agttccatcagaatacgctgaacttctcggtcagccccggtctgagcat 700
            || |||| ||| || | |||||| || | ||| ||||| ||||||||||
Sbjct: 912  agctccagcaggatcctctgaacctccctgtcggcccctgtctgagcat 864

---

>gb|BC010396.1| Homo sapiens proteasome (prosome, macropain) 26S subunit, ATPase,
           4, transcript variant 2, mRNA (cDNA clone MGC:13687
           IMAGE:4046205), complete cds
          Length = 1363

 Score = 73.8 bits (37), Expect = 7e-10
 Identities = 136/169 (80%)
 Strand = Plus / Minus

                                                                       
Query: 532 tcaattttcctgtccagtcttcctggacgcagcagagcaggatctagagtatctgcccga 591
           |||||||| | |||||| | |||||| || ||||| || ||||| || || ||||| |  
Sbjct: 939 tcaattttacggtccagccgtcctggccgtagcagggccggatccagggtgtctgctctg 880

                                                                       
Query: 592 ttggttgccattataaccttcacattcactgtctgatcaaatccatccatctgattcagt 651
           || || ||||| || ||||| ||||| ||  |||||||||||||||||||||||||||| 
Sbjct: 879 tttgtggccatgattaccttgacattgacattctgatcaaatccatccatctgattcagc 820

                                                            
Query: 652 agttccatcagaatacgctgaacttctcggtcagccccggtctgagcat 700
           || |||| ||| || | |||||| || | ||| ||||| ||||||||||
Sbjct: 819 agctccagcaggatcctctgaacctccctgtcggcccctgtctgagcat 771

---

>gb|BC014488.1| Homo sapiens proteasome (prosome, macropain) 26S subunit, ATPase, 4,
            transcript variant 1, mRNA (cDNA clone MGC:23214
            IMAGE:4899042), complete cds
          Length = 1433

 Score = 73.8 bits (37), Expect = 7e-10
 Identities = 136/169 (80%)
 Strand = Plus / Minus

                                                                        
Query: 532  tcaattttcctgtccagtcttcctggacgcagcagagcaggatctagagtatctgcccga 591
            |||||||| | |||||| | |||||| || ||||| || ||||| || || ||||| |  
Sbjct: 1015 tcaattttacggtccagccgtcctggccgtagcagggccggatccagggtgtctgctctg 956

                                                                        
Query: 592  ttggttgccattataaccttcacattcactgtctgatcaaatccatccatctgattcagt 651
            || || ||||| || ||||| ||||| ||  |||||||||||||||||||||||||||| 
Sbjct: 955  tttgtggccatgattaccttgacattgacattctgatcaaatccatccatctgattcagc 896

                                                             
Query: 652  agttccatcagaatacgctgaacttctcggtcagccccggtctgagcat 700
            || |||| ||| || | |||||| || | ||| ||||| ||||||||||
Sbjct: 895  agctccagcaggatcctctgaacctccctgtcggcccctgtctgagcat 847

---

>gb|BC000343.2| Homo sapiens proteasome (prosome, macropain) 26S subunit, ATPase, 4,
            transcript variant 1, mRNA (cDNA clone MGC:8570
            IMAGE:2823007), complete cds
          Length = 1426

 Score = 73.8 bits (37), Expect = 7e-10
 Identities = 136/169 (80%)
 Strand = Plus / Minus

                                                                        
Query: 532  tcaattttcctgtccagtcttcctggacgcagcagagcaggatctagagtatctgcccga 591
            |||||||| | |||||| | |||||| || ||||| || ||||| || || ||||| |  
Sbjct: 1015 tcaattttacggtccagccgtcctggccgtagcagggccggatccagggtgtctgctctg 956

                                                                        
Query: 592  ttggttgccattataaccttcacattcactgtctgatcaaatccatccatctgattcagt 651
            || || ||||| || ||||| ||||| ||  |||||||||||||||||||||||||||| 
Sbjct: 955  tttgtggccatgattaccttgacattgacattctgatcaaatccatccatctgattcagc 896

                                                             
Query: 652  agttccatcagaatacgctgaacttctcggtcagccccggtctgagcat 700
            || |||| ||| || | |||||| || | ||| ||||| ||||||||||
Sbjct: 895  agctccagcaggatcctctgaacctccctgtcggcccctgtctgagcat 847

---

>gb|BT008218.1| Synthetic construct Homo sapiens proteasome (prosome, macropain)
           26S subunit, ATPase, 4 mRNA, partial cds
          Length = 1257

 Score = 73.8 bits (37), Expect = 7e-10
 Identities = 136/169 (80%)
 Strand = Plus / Minus

                                                                       
Query: 532 tcaattttcctgtccagtcttcctggacgcagcagagcaggatctagagtatctgcccga 591
           |||||||| | |||||| | |||||| || ||||| || ||||| || || ||||| |  
Sbjct: 995 tcaattttacggtccagccgtcctggccgtagcagggccggatccagggtgtctgctctg 936

                                                                       
Query: 592 ttggttgccattataaccttcacattcactgtctgatcaaatccatccatctgattcagt 651
           || || ||||| || ||||| ||||| ||  |||||||||||||||||||||||||||| 
Sbjct: 935 tttgtggccatgattaccttgacattgacattctgatcaaatccatccatctgattcagc 876

                                                            
Query: 652 agttccatcagaatacgctgaacttctcggtcagccccggtctgagcat 700
           || |||| ||| || | |||||| || | ||| ||||| ||||||||||
Sbjct: 875 agctccagcaggatcctctgaacctccctgtcggcccctgtctgagcat 827

---

>gb|BT007232.1| Homo sapiens proteasome (prosome, macropain) 26S subunit, ATPase, 4
           mRNA, complete cds
          Length = 1257

 Score = 73.8 bits (37), Expect = 7e-10
 Identities = 136/169 (80%)
 Strand = Plus / Minus

                                                                       
Query: 532 tcaattttcctgtccagtcttcctggacgcagcagagcaggatctagagtatctgcccga 591
           |||||||| | |||||| | |||||| || ||||| || ||||| || || ||||| |  
Sbjct: 995 tcaattttacggtccagccgtcctggccgtagcagggccggatccagggtgtctgctctg 936

                                                                       
Query: 592 ttggttgccattataaccttcacattcactgtctgatcaaatccatccatctgattcagt 651
           || || ||||| || ||||| ||||| ||  |||||||||||||||||||||||||||| 
Sbjct: 935 tttgtggccatgattaccttgacattgacattctgatcaaatccatccatctgattcagc 876

                                                            
Query: 652 agttccatcagaatacgctgaacttctcggtcagccccggtctgagcat 700
           || |||| ||| || | |||||| || | ||| ||||| ||||||||||
Sbjct: 875 agctccagcaggatcctctgaacctccctgtcggcccctgtctgagcat 827

---

>emb|CR624768.1| full-length cDNA clone CS0DB003YP08 of Neuroblastoma Cot
           10-normalized of Homo sapiens (human)
          Length = 1094

 Score = 73.8 bits (37), Expect = 7e-10
 Identities = 136/169 (80%)
 Strand = Plus / Minus

                                                                       
Query: 532 tcaattttcctgtccagtcttcctggacgcagcagagcaggatctagagtatctgcccga 591
           |||||||| | |||||| | |||||| || ||||| || ||||| || || ||||| |  
Sbjct: 709 tcaattttacggtccagccgtcctggccgtagcagggccggatccagggtgtctgctctg 650

                                                                       
Query: 592 ttggttgccattataaccttcacattcactgtctgatcaaatccatccatctgattcagt 651
           || || ||||| || ||||| ||||| ||  |||||||||||||||||||||||||||| 
Sbjct: 649 tttgtggccatgattaccttgacattgacattctgatcaaatccatccatctgattcagc 590

                                                            
Query: 652 agttccatcagaatacgctgaacttctcggtcagccccggtctgagcat 700
           || |||| ||| || | |||||| || | ||| ||||| ||||||||||
Sbjct: 589 agctccagcaggatcctctgaacctccctgtcggcccctgtctgagcat 541

---

>emb|CR624681.1| full-length cDNA clone CS0DI024YO05 of Placenta Cot 25-normalized of
            Homo sapiens (human)
          Length = 1392

 Score = 73.8 bits (37), Expect = 7e-10
 Identities = 136/169 (80%)
 Strand = Plus / Minus

                                                                        
Query: 532  tcaattttcctgtccagtcttcctggacgcagcagagcaggatctagagtatctgcccga 591
            |||||||| | |||||| | |||||| || ||||| || ||||| || || ||||| |  
Sbjct: 1012 tcaattttacggtccagccgtcctggccgtagcagggccggatccagggtgtctgctctg 953

                                                                        
Query: 592  ttggttgccattataaccttcacattcactgtctgatcaaatccatccatctgattcagt 651
            || || ||||| || ||||| ||||| ||  |||||||||||||||||||||||||||| 
Sbjct: 952  tttgtggccatgattaccttgacattgacattctgatcaaatccatccatctgattcagc 893

                                                             
Query: 652  agttccatcagaatacgctgaacttctcggtcagccccggtctgagcat 700
            || |||| ||| || | |||||| || | ||| ||||| ||||||||||
Sbjct: 892  agctccagcaggatcctctgaacctccctgtcggcccctgtctgagcat 844

---

>emb|CR621309.1| full-length cDNA clone CS0DD009YP22 of Neuroblastoma Cot
            50-normalized of Homo sapiens (human)
          Length = 1375

 Score = 73.8 bits (37), Expect = 7e-10
 Identities = 136/169 (80%)
 Strand = Plus / Minus

                                                                        
Query: 532  tcaattttcctgtccagtcttcctggacgcagcagagcaggatctagagtatctgcccga 591
            |||||||| | |||||| | |||||| || ||||| || ||||| || || ||||| |  
Sbjct: 1009 tcaattttacggtccagccgtcctggccgtagcagggccggatccagggtgtctgctctg 950

                                                                        
Query: 592  ttggttgccattataaccttcacattcactgtctgatcaaatccatccatctgattcagt 651
            || || ||||| || ||||| ||||| ||  |||||||||||||||||||||||||||| 
Sbjct: 949  tttgtggccatgattaccttgacattgacattctgatcaaatccatccatctgattcagc 890

                                                             
Query: 652  agttccatcagaatacgctgaacttctcggtcagccccggtctgagcat 700
            || |||| ||| || | |||||| || | ||| ||||| ||||||||||
Sbjct: 889  agctccagcaggatcctctgaacctccctgtcggcccctgtctgagcat 841

---

>emb|CR619473.1| full-length cDNA clone CS0DH005YK15 of T cells (Jurkat cell line) of
            Homo sapiens (human)
          Length = 1393

 Score = 73.8 bits (37), Expect = 7e-10
 Identities = 136/169 (80%)
 Strand = Plus / Minus

                                                                        
Query: 532  tcaattttcctgtccagtcttcctggacgcagcagagcaggatctagagtatctgcccga 591
            |||||||| | |||||| | |||||| || ||||| || ||||| || || ||||| |  
Sbjct: 1028 tcaattttacggtccagccgtcctggccgtagcagggccggatccagggtgtctgctctg 969

                                                                        
Query: 592  ttggttgccattataaccttcacattcactgtctgatcaaatccatccatctgattcagt 651
            || || ||||| || ||||| ||||| ||  |||||||||||||||||||||||||||| 
Sbjct: 968  tttgtggccatgattaccttgacattgacattctgatcaaatccatccatctgattcagc 909

                                                             
Query: 652  agttccatcagaatacgctgaacttctcggtcagccccggtctgagcat 700
            || |||| ||| || | |||||| || | ||| ||||| ||||||||||
Sbjct: 908  agctccagcaggatcctctgaacctccctgtcggcccctgtctgagcat 860

---

>emb|CR616731.1| full-length cDNA clone CS0DI027YF12 of Placenta Cot 25-normalized of
            Homo sapiens (human)
          Length = 1374

 Score = 73.8 bits (37), Expect = 7e-10
 Identities = 136/169 (80%)
 Strand = Plus / Minus

                                                                        
Query: 532  tcaattttcctgtccagtcttcctggacgcagcagagcaggatctagagtatctgcccga 591
            |||||||| | |||||| | |||||| || ||||| || ||||| || || ||||| |  
Sbjct: 1015 tcaattttacggtccagccgtcctggccgtagcagggccggatccagggtgtctgctctg 956

                                                                        
Query: 592  ttggttgccattataaccttcacattcactgtctgatcaaatccatccatctgattcagt 651
            || || ||||| || ||||| ||||| ||  |||||||||||||||||||||||||||| 
Sbjct: 955  tttgtggccatgattaccttgacattgacattctgatcaaatccatccatctgattcagc 896

                                                             
Query: 652  agttccatcagaatacgctgaacttctcggtcagccccggtctgagcat 700
            || |||| ||| || | |||||| || | ||| ||||| ||||||||||
Sbjct: 895  agctccagcaggatcctctgaacctccctgtcggcccctgtctgagcat 847

---

>emb|CR607304.1| full-length cDNA clone CS0DI054YC02 of Placenta Cot 25-normalized of
            Homo sapiens (human)
          Length = 1371

 Score = 73.8 bits (37), Expect = 7e-10
 Identities = 136/169 (80%)
 Strand = Plus / Minus

                                                                        
Query: 532  tcaattttcctgtccagtcttcctggacgcagcagagcaggatctagagtatctgcccga 591
            |||||||| | |||||| | |||||| || ||||| || ||||| || || ||||| |  
Sbjct: 1028 tcaattttacggtccagccgtcctggccgtagcagggccggatccagggtgtctgctctg 969

                                                                        
Query: 592  ttggttgccattataaccttcacattcactgtctgatcaaatccatccatctgattcagt 651
            || || ||||| || ||||| ||||| ||  |||||||||||||||||||||||||||| 
Sbjct: 968  tttgtggccatgattaccttgacattgacattctgatcaaatccatccatctgattcagc 909

                                                             
Query: 652  agttccatcagaatacgctgaacttctcggtcagccccggtctgagcat 700
            || |||| ||| || | |||||| || | ||| ||||| ||||||||||
Sbjct: 908  agctccagcaggatcctctgaacctccctgtcggcccctgtctgagcat 860

---

>emb|CR606858.1| full-length cDNA clone CS0DI008YH10 of Placenta Cot 25-normalized of
            Homo sapiens (human)
          Length = 1355

 Score = 73.8 bits (37), Expect = 7e-10
 Identities = 136/169 (80%)
 Strand = Plus / Minus

                                                                        
Query: 532  tcaattttcctgtccagtcttcctggacgcagcagagcaggatctagagtatctgcccga 591
            |||||||| | |||||| | |||||| || ||||| || ||||| || || ||||| |  
Sbjct: 1005 tcaattttacggtccagccgtcctggccgtagcagggccggatccagggtgtctgctctg 946

                                                                        
Query: 592  ttggttgccattataaccttcacattcactgtctgatcaaatccatccatctgattcagt 651
            || || ||||| || ||||| ||||| ||  |||||||||||||||||||||||||||| 
Sbjct: 945  tttgtggccatgattaccttgacattgacattctgatcaaatccatccatctgattcagc 886

                                                             
Query: 652  agttccatcagaatacgctgaacttctcggtcagccccggtctgagcat 700
            || |||| ||| || | |||||| || | ||| ||||| ||||||||||
Sbjct: 885  agctccagcaggatcctctgaacctccctgtcggcccctgtctgagcat 837

---

>emb|CR604327.1| full-length cDNA clone CS0DE011YH14 of Placenta of Homo sapiens
            (human)
          Length = 1403

 Score = 73.8 bits (37), Expect = 7e-10
 Identities = 136/169 (80%)
 Strand = Plus / Minus

                                                                        
Query: 532  tcaattttcctgtccagtcttcctggacgcagcagagcaggatctagagtatctgcccga 591
            |||||||| | |||||| | |||||| || ||||| || ||||| || || ||||| |  
Sbjct: 1027 tcaattttacggtccagccgtcctggccgtagcagggccggatccagggtgtctgctctg 968

                                                                        
Query: 592  ttggttgccattataaccttcacattcactgtctgatcaaatccatccatctgattcagt 651
            || || ||||| || ||||| ||||| ||  |||||||||||||||||||||||||||| 
Sbjct: 967  tttgtggccatgattaccttgacattgacattctgatcaaatccatccatctgattcagc 908

                                                             
Query: 652  agttccatcagaatacgctgaacttctcggtcagccccggtctgagcat 700
            || |||| ||| || | |||||| || | ||| ||||| ||||||||||
Sbjct: 907  agctccagcaggatcctctgaacctccctgtcggcccctgtctgagcat 859

---

>emb|CR603370.1| full-length cDNA clone CS0DI020YH15 of Placenta Cot 25-normalized of
            Homo sapiens (human)
          Length = 1351

 Score = 73.8 bits (37), Expect = 7e-10
 Identities = 136/169 (80%)
 Strand = Plus / Minus

                                                                        
Query: 532  tcaattttcctgtccagtcttcctggacgcagcagagcaggatctagagtatctgcccga 591
            |||||||| | |||||| | |||||| || ||||| || ||||| || || ||||| |  
Sbjct: 1027 tcaattttacggtccagccgtcctggccgtagcagggccggatccagggtgtctgctctg 968

                                                                        
Query: 592  ttggttgccattataaccttcacattcactgtctgatcaaatccatccatctgattcagt 651
            || || ||||| || ||||| ||||| ||  |||||||||||||||||||||||||||| 
Sbjct: 967  tttgtggccatgattaccttgacattgacattctgatcaaatccatccatctgattcagc 908

                                                             
Query: 652  agttccatcagaatacgctgaacttctcggtcagccccggtctgagcat 700
            || |||| ||| || | |||||| || | ||| ||||| ||||||||||
Sbjct: 907  agctccagcaggatcctctgaacctccctgtcggcccctgtctgagcat 859

---

>emb|CR602157.1| full-length cDNA clone CS0DI077YD19 of Placenta Cot 25-normalized of
            Homo sapiens (human)
          Length = 1387

 Score = 73.8 bits (37), Expect = 7e-10
 Identities = 136/169 (80%)
 Strand = Plus / Minus

                                                                        
Query: 532  tcaattttcctgtccagtcttcctggacgcagcagagcaggatctagagtatctgcccga 591
            |||||||| | |||||| | |||||| || ||||| || ||||| || || ||||| |  
Sbjct: 1011 tcaattttacggtccagccgtcctggccgtagcagggccggatccagggtgtctgctctg 952

                                                                        
Query: 592  ttggttgccattataaccttcacattcactgtctgatcaaatccatccatctgattcagt 651
            || || ||||| || ||||| ||||| ||  |||||||||||||||||||||||||||| 
Sbjct: 951  tttgtggccatgattaccttgacattgacattctgatcaaatccatccatctgattcagc 892

                                                             
Query: 652  agttccatcagaatacgctgaacttctcggtcagccccggtctgagcat 700
            || |||| ||| || | |||||| || | ||| ||||| ||||||||||
Sbjct: 891  agctccagcaggatcctctgaacctccctgtcggcccctgtctgagcat 843

---

>emb|CR597394.1| full-length cDNA clone CS0DJ014YC04 of T cells (Jurkat cell line) Cot
            10-normalized of Homo sapiens (human)
          Length = 1414

 Score = 73.8 bits (37), Expect = 7e-10
 Identities = 136/169 (80%)
 Strand = Plus / Minus

                                                                        
Query: 532  tcaattttcctgtccagtcttcctggacgcagcagagcaggatctagagtatctgcccga 591
            |||||||| | |||||| | |||||| || ||||| || ||||| || || ||||| |  
Sbjct: 1028 tcaattttacggtccagccgtcctggccgtagcagggccggatccagggtgtctgctctg 969

                                                                        
Query: 592  ttggttgccattataaccttcacattcactgtctgatcaaatccatccatctgattcagt 651
            || || ||||| || ||||| ||||| ||  |||||||||||||||||||||||||||| 
Sbjct: 968  tttgtggccatgattaccttgacattgacattctgatcaaatccatccatctgattcagc 909

                                                             
Query: 652  agttccatcagaatacgctgaacttctcggtcagccccggtctgagcat 700
            || |||| ||| || | |||||| || | ||| ||||| ||||||||||
Sbjct: 908  agctccagcaggatcctctgaacctccctgtcggcccctgtctgagcat 860

---

>emb|CR594223.1| full-length cDNA clone CS0DJ006YJ24 of T cells (Jurkat cell line) Cot
            10-normalized of Homo sapiens (human)
          Length = 1351

 Score = 73.8 bits (37), Expect = 7e-10
 Identities = 136/169 (80%)
 Strand = Plus / Minus

                                                                        
Query: 532  tcaattttcctgtccagtcttcctggacgcagcagagcaggatctagagtatctgcccga 591
            |||||||| | |||||| | |||||| || ||||| || ||||| || || ||||| |  
Sbjct: 1014 tcaattttacggtccagccgtcctggccgtagcagggccggatccagggtgtctgctctg 955

                                                                        
Query: 592  ttggttgccattataaccttcacattcactgtctgatcaaatccatccatctgattcagt 651
            || || ||||| || ||||| ||||| ||  |||||||||||||||||||||||||||| 
Sbjct: 954  tttgtggccatgattaccttgacattgacattctgatcaaatccatccatctgattcagc 895

                                                             
Query: 652  agttccatcagaatacgctgaacttctcggtcagccccggtctgagcat 700
            || |||| ||| || | |||||| || | ||| ||||| ||||||||||
Sbjct: 894  agctccagcaggatcctctgaacctccctgtcggcccctgtctgagcat 846

---

>emb|CR591096.1| full-length cDNA clone CS0DB007YG13 of Neuroblastoma Cot
            10-normalized of Homo sapiens (human)
          Length = 1385

 Score = 73.8 bits (37), Expect = 7e-10
 Identities = 136/169 (80%)
 Strand = Plus / Minus

                                                                        
Query: 532  tcaattttcctgtccagtcttcctggacgcagcagagcaggatctagagtatctgcccga 591
            |||||||| | |||||| | |||||| || ||||| || ||||| || || ||||| |  
Sbjct: 1005 tcaattttacggtccagccgtcctggccgtagcagggccggatccagggtgtctgctctg 946

                                                                        
Query: 592  ttggttgccattataaccttcacattcactgtctgatcaaatccatccatctgattcagt 651
            || || ||||| || ||||| ||||| ||  |||||||||||||||||||||||||||| 
Sbjct: 945  tttgtggccatgattaccttgacattgacattctgatcaaatccatccatctgattcagc 886

                                                             
Query: 652  agttccatcagaatacgctgaacttctcggtcagccccggtctgagcat 700
            || |||| ||| || | |||||| || | ||| ||||| ||||||||||
Sbjct: 885  agctccagcaggatcctctgaacctccctgtcggcccctgtctgagcat 837

---

>ref|XM_942509.1| PREDICTED: Homo sapiens similar to 26S protease regulatory subunit
           6B (MIP224) (MB67-interacting protein) (TAT-binding
           protein 7) (TBP-7) (LOC652826), mRNA
          Length = 1396

 Score = 73.8 bits (37), Expect = 7e-10
 Identities = 136/169 (80%)
 Strand = Plus / Minus

                                                                       
Query: 532 tcaattttcctgtccagtcttcctggacgcagcagagcaggatctagagtatctgcccga 591
           |||||||| | |||||| | |||||| || ||||| || ||||| || || ||||| |  
Sbjct: 983 tcaattttacggtccagccgtcctggccgtagcagggccggatccagggtgtctgctctg 924

                                                                       
Query: 592 ttggttgccattataaccttcacattcactgtctgatcaaatccatccatctgattcagt 651
           || || ||||| || ||||| ||||| ||  |||||||||||||||||||||||||||| 
Sbjct: 923 tttgtggccatgattaccttgacattgacattctgatcaaatccatccatctgattcagc 864

                                                            
Query: 652 agttccatcagaatacgctgaacttctcggtcagccccggtctgagcat 700
           || |||| ||| || | |||||| || | ||| ||||| ||||||||||
Sbjct: 863 agctccagcaggatcctctgaacctccctgtcggcccctgtctgagcat 815

---

>gb|AF038965.1| Homo sapiens 26S proteasome ATPase subunit mRNA, complete cds
          Length = 1439

 Score = 73.8 bits (37), Expect = 7e-10
 Identities = 136/169 (80%)
 Strand = Plus / Minus

                                                                        
Query: 532  tcaattttcctgtccagtcttcctggacgcagcagagcaggatctagagtatctgcccga 591
            |||||||| | |||||| | |||||| || ||||| || ||||| || || ||||| |  
Sbjct: 1017 tcaattttacggtccagccgtcctggccgtagcagggccggatccagggtgtctgctctg 958

                                                                        
Query: 592  ttggttgccattataaccttcacattcactgtctgatcaaatccatccatctgattcagt 651
            || || ||||| || ||||| ||||| ||  |||||||||||||||||||||||||||| 
Sbjct: 957  tttgtggccatgattaccttgacattgacattctgatcaaatccatccatctgattcagc 898

                                                             
Query: 652  agttccatcagaatacgctgaacttctcggtcagccccggtctgagcat 700
            || |||| ||| || | |||||| || | ||| ||||| ||||||||||
Sbjct: 897  agctccagcaggatcctctgaacctccctgtcggcccctgtctgagcat 849

---

>gb|AY891402.1| Synthetic construct Homo sapiens clone FLH025948.01L proteasome 26S
           subunit 4 (PSMC4) mRNA, partial cds
          Length = 1257

 Score = 73.8 bits (37), Expect = 7e-10
 Identities = 136/169 (80%)
 Strand = Plus / Minus

                                                                       
Query: 532 tcaattttcctgtccagtcttcctggacgcagcagagcaggatctagagtatctgcccga 591
           |||||||| | |||||| | |||||| || ||||| || ||||| || || ||||| |  
Sbjct: 995 tcaattttacggtccagccgtcctggccgtagcagggccggatccagggtgtctgctctg 936

                                                                       
Query: 592 ttggttgccattataaccttcacattcactgtctgatcaaatccatccatctgattcagt 651
           || || ||||| || ||||| ||||| ||  |||||||||||||||||||||||||||| 
Sbjct: 935 tttgtggccatgattaccttgacattgacattctgatcaaatccatccatctgattcagc 876

                                                            
Query: 652 agttccatcagaatacgctgaacttctcggtcagccccggtctgagcat 700
           || |||| ||| || | |||||| || | ||| ||||| ||||||||||
Sbjct: 875 agctccagcaggatcctctgaacctccctgtcggcccctgtctgagcat 827

---

>gb|AY891401.1| Synthetic construct Homo sapiens clone FLH025947.01L proteasome 26S
           subunit 4 (PSMC4) mRNA, partial cds
          Length = 1257

 Score = 73.8 bits (37), Expect = 7e-10
 Identities = 136/169 (80%)
 Strand = Plus / Minus

                                                                       
Query: 532 tcaattttcctgtccagtcttcctggacgcagcagagcaggatctagagtatctgcccga 591
           |||||||| | |||||| | |||||| || ||||| || ||||| || || ||||| |  
Sbjct: 995 tcaattttacggtccagccgtcctggccgtagcagggccggatccagggtgtctgctctg 936

                                                                       
Query: 592 ttggttgccattataaccttcacattcactgtctgatcaaatccatccatctgattcagt 651
           || || ||||| || ||||| ||||| ||  |||||||||||||||||||||||||||| 
Sbjct: 935 tttgtggccatgattaccttgacattgacattctgatcaaatccatccatctgattcagc 876

                                                            
Query: 652 agttccatcagaatacgctgaacttctcggtcagccccggtctgagcat 700
           || |||| ||| || | |||||| || | ||| ||||| ||||||||||
Sbjct: 875 agctccagcaggatcctctgaacctccctgtcggcccctgtctgagcat 827

---

>gb|AY888748.1| Synthetic construct Homo sapiens clone FLH025951.01X proteasome 26S
           subunit 4 (PSMC4) mRNA, complete cds
          Length = 1257

 Score = 73.8 bits (37), Expect = 7e-10
 Identities = 136/169 (80%)
 Strand = Plus / Minus

                                                                       
Query: 532 tcaattttcctgtccagtcttcctggacgcagcagagcaggatctagagtatctgcccga 591
           |||||||| | |||||| | |||||| || ||||| || ||||| || || ||||| |  
Sbjct: 995 tcaattttacggtccagccgtcctggccgtagcagggccggatccagggtgtctgctctg 936

                                                                       
Query: 592 ttggttgccattataaccttcacattcactgtctgatcaaatccatccatctgattcagt 651
           || || ||||| || ||||| ||||| ||  |||||||||||||||||||||||||||| 
Sbjct: 935 tttgtggccatgattaccttgacattgacattctgatcaaatccatccatctgattcagc 876

                                                            
Query: 652 agttccatcagaatacgctgaacttctcggtcagccccggtctgagcat 700
           || |||| ||| || | |||||| || | ||| ||||| ||||||||||
Sbjct: 875 agctccagcaggatcctctgaacctccctgtcggcccctgtctgagcat 827

---

>gb|U27515.1|HSU27515 Human MIP224 (MIP224) mRNA, complete cds
          Length = 1425

 Score = 73.8 bits (37), Expect = 7e-10
 Identities = 136/169 (80%)
 Strand = Plus / Minus

                                                                        
Query: 532  tcaattttcctgtccagtcttcctggacgcagcagagcaggatctagagtatctgcccga 591
            |||||||| | |||||| | |||||| || ||||| || ||||| || || ||||| |  
Sbjct: 1007 tcaattttacggtccagccgtcctggccgtagcagggccggatccagggtgtctgctctg 948

                                                                        
Query: 592  ttggttgccattataaccttcacattcactgtctgatcaaatccatccatctgattcagt 651
            || || ||||| || ||||| ||||| ||  |||||||||||||||||||||||||||| 
Sbjct: 947  tttgtggccatgattaccttgacattgacattctgatcaaatccatccatctgattcagc 888

                                                             
Query: 652  agttccatcagaatacgctgaacttctcggtcagccccggtctgagcat 700
            || |||| ||| || | |||||| || | ||| ||||| ||||||||||
Sbjct: 887  agctccagcaggatcctctgaacctccctgtcggcccctgtctgagcat 839

---

>gb|AF020736.1|AF020736 Homo sapiens ATPase homolog mRNA, complete cds
          Length = 1463

 Score = 73.8 bits (37), Expect = 7e-10
 Identities = 136/169 (80%)
 Strand = Plus / Minus

                                                                        
Query: 532  tcaattttcctgtccagtcttcctggacgcagcagagcaggatctagagtatctgcccga 591
            |||||||| | |||||| | |||||| || ||||| || ||||| || || ||||| |  
Sbjct: 1035 tcaattttacggtccagccgtcctggccgtagcagggccggatccagggtgtctgctctg 976

                                                                        
Query: 592  ttggttgccattataaccttcacattcactgtctgatcaaatccatccatctgattcagt 651
            || || ||||| || ||||| ||||| ||  |||||||||||||||||||||||||||| 
Sbjct: 975  tttgtggccatgattaccttgacattgacattctgatcaaatccatccatctgattcagc 916

                                                             
Query: 652  agttccatcagaatacgctgaacttctcggtcagccccggtctgagcat 700
            || |||| ||| || | |||||| || | ||| ||||| ||||||||||
Sbjct: 915  agctccagcaggatcctctgaacctccctgtcggcccctgtctgagcat 867

---

>gb|BC018811.2| Homo sapiens proteasome (prosome, macropain) 26S subunit, ATPase, 4,
            transcript variant 1, mRNA (cDNA clone IMAGE:2961362)
          Length = 1426

 Score = 73.8 bits (37), Expect = 7e-10
 Identities = 136/169 (80%)
 Strand = Plus / Minus

                                                                        
Query: 532  tcaattttcctgtccagtcttcctggacgcagcagagcaggatctagagtatctgcccga 591
            |||||||| | |||||| | |||||| || ||||| || ||||| || || ||||| |  
Sbjct: 1015 tcaattttacggtccagccgtcctggccgtagcagggccggatccagggtgtctgctctg 956

                                                                        
Query: 592  ttggttgccattataaccttcacattcactgtctgatcaaatccatccatctgattcagt 651
            || || ||||| || ||||| ||||| ||  |||||||||||||||||||||||||||| 
Sbjct: 955  tttgtggccatgattaccttgacattgacattctgatcaaatccatccatctgattcagc 896

                                                             
Query: 652  agttccatcagaatacgctgaacttctcggtcagccccggtctgagcat 700
            || |||| ||| || | |||||| || | ||| ||||| ||||||||||
Sbjct: 895  agctccagcaggatcctctgaacctccctgtcggcccctgtctgagcat 847

---

>ref|XM_631330.1| Dictyostelium discoideum HIV1 TAT-binding protein (DDB0191435),
           partial mRNA
          Length = 1212

 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 98/119 (82%)
 Strand = Plus / Minus

                                                                       
Query: 568 gcaggatctagagtatctgcccgattggttgccattataaccttcacattcactgtctga 627
           |||||||||| |||||||   |||||||||||||| || ||||| ||||| || |    |
Sbjct: 914 gcaggatctaaagtatcttgacgattggttgccataattacctttacatttacagataca 855

                                                                      
Query: 628 tcaaatccatccatctgattcagtagttccatcagaatacgctgaacttctcggtcagc 686
           ||||| |||||||| ||||||| || |||||| |||||||| |||||||| || |||||
Sbjct: 854 tcaaaaccatccatttgattcaataattccataagaatacgttgaacttcacgatcagc 796

---

>gb|BC012708.1| Mus musculus proteasome (prosome, macropain) 26S subunit, ATPase, 4,
            mRNA (cDNA clone MGC:13997 IMAGE:4211677), complete cds
          Length = 1406

 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 140/175 (80%)
 Strand = Plus / Minus

                                                                        
Query: 526  gggaactcaattttcctgtccagtcttcctggacgcagcagagcaggatctagagtatct 585
            ||||| |||||||| | |||||| | |||||| ||||| ||||| ||||| |  || |||
Sbjct: 1036 gggaattcaatttttcggtccaggcgtcctggccgcagtagagctggatccaaggtgtct 977

                                                                        
Query: 586  gcccgattggttgccattataaccttcacattcactgtctgatcaaatccatccatctga 645
            || |  || || ||||| || ||||||||||| ||  |||| |||||||||||||| |||
Sbjct: 976  gctctgtttgtggccatgattaccttcacattgacgttctggtcaaatccatccatttga 917

                                                                   
Query: 646  ttcagtagttccatcagaatacgctgaacttctcggtcagccccggtctgagcat 700
            |||||||| |||| ||| || | |||||| || | |||||| || ||||| ||||
Sbjct: 916  ttcagtagctccagcaggatcctctgaacctccctgtcagctcctgtctgggcat 862

---

>emb|CR611800.1| full-length cDNA clone CS0DF038YP01 of Fetal brain of Homo sapiens
           (human)
          Length = 1532

 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 80/95 (84%)
 Strand = Plus / Minus

                                                                       
Query: 606 aaccttcacattcactgtctgatcaaatccatccatctgattcagtagttccatcagaat 665
           |||||| ||||| ||  |||||||||||||||||||||||||||| || |||| ||| ||
Sbjct: 954 aaccttgacattgacattctgatcaaatccatccatctgattcagcagctccagcaggat 895

                                              
Query: 666 acgctgaacttctcggtcagccccggtctgagcat 700
            | |||||| || | ||| ||||| ||||||||||
Sbjct: 894 cctctgaacctccctgtcggcccctgtctgagcat 860

---

>dbj|AK150989.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length
           enriched library, clone:I830019K15 product:proteasome
           (prosome, macropain) 26S subunit, ATPase, 4, full insert
           sequence
          Length = 972

 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 86/103 (83%)
 Strand = Plus / Minus

                                                                       
Query: 598 gccattataaccttcacattcactgtctgatcaaatccatccatctgattcagtagttcc 657
           ||||| || ||||||||||| ||  |||| |||||||||||||| |||||||||||||||
Sbjct: 958 gccatgattaccttcacattgacgttctggtcaaatccatccatttgattcagtagttcc 899

                                                      
Query: 658 atcagaatacgctgaacttctcggtcagccccggtctgagcat 700
           | ||| || | |||||| || | |||||| || ||||| ||||
Sbjct: 898 agcaggatcctctgaacctccctgtcagctcctgtctgggcat 856

---

>dbj|AK169244.1| Mus musculus 13 days embryo liver cDNA, RIKEN full-length enriched
            library, clone:I920097L15 product:proteasome (prosome,
            macropain) 26S subunit, ATPase, 4, full insert sequence
          Length = 1883

 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 86/103 (83%)
 Strand = Plus / Minus

                                                                        
Query: 598  gccattataaccttcacattcactgtctgatcaaatccatccatctgattcagtagttcc 657
            ||||| || ||||||||||| ||  |||| |||||||||||||| |||||||||||||||
Sbjct: 1466 gccatgattaccttcacattgacgttctggtcaaatccatccatttgattcagtagttcc 1407

                                                       
Query: 658  atcagaatacgctgaacttctcggtcagccccggtctgagcat 700
            | ||| || | |||||| || | |||||| || ||||| ||||
Sbjct: 1406 agcaggatcctctgaacctccctgtcagctcctgtctgggcat 1364

---

>gb|BC094063.1| Mus musculus proteasome (prosome, macropain) 26S subunit, ATPase,
           4, mRNA (cDNA clone IMAGE:4160213), partial cds
          Length = 777

 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 140/175 (80%)
 Strand = Plus / Minus

                                                                       
Query: 526 gggaactcaattttcctgtccagtcttcctggacgcagcagagcaggatctagagtatct 585
           ||||| |||||||| | |||||| | |||||| ||||| ||||| ||||| |  || |||
Sbjct: 393 gggaattcaatttttcggtccaggcgtcctggccgcagtagagctggatccaaggtgtct 334

                                                                       
Query: 586 gcccgattggttgccattataaccttcacattcactgtctgatcaaatccatccatctga 645
           || |  || || ||||| || ||||||||||| ||  |||| |||||||||||||| |||
Sbjct: 333 gctctgtttgtggccatgattaccttcacattgacgttctggtcaaatccatccatttga 274

                                                                  
Query: 646 ttcagtagttccatcagaatacgctgaacttctcggtcagccccggtctgagcat 700
           |||||||| |||| ||| || | |||||| || | |||||| || ||||| ||||
Sbjct: 273 ttcagtagctccagcaggatcctctgaacctccctgtcagctcctgtctgggcat 219

---

>gb|BC092265.1| Mus musculus proteasome (prosome, macropain) 26S subunit, ATPase, 4,
            mRNA (cDNA clone MGC:103150 IMAGE:3671250), complete cds
          Length = 1411

 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 140/175 (80%)
 Strand = Plus / Minus

                                                                        
Query: 526  gggaactcaattttcctgtccagtcttcctggacgcagcagagcaggatctagagtatct 585
            ||||| |||||||| | |||||| | |||||| ||||| ||||| ||||| |  || |||
Sbjct: 1019 gggaattcaatttttcggtccaggcgtcctggccgcagtagagctggatccaaggtgtct 960

                                                                        
Query: 586  gcccgattggttgccattataaccttcacattcactgtctgatcaaatccatccatctga 645
            || |  || || ||||| || ||||||||||| ||  |||| |||||||||||||| |||
Sbjct: 959  gctctgtttgtggccatgattaccttcacattgacgttctggtcaaatccatccatttga 900

                                                                   
Query: 646  ttcagtagttccatcagaatacgctgaacttctcggtcagccccggtctgagcat 700
            |||||||| |||| ||| || | |||||| || | |||||| || ||||| ||||
Sbjct: 899  ttcagtagctccagcaggatcctctgaacctccctgtcagctcctgtctgggcat 845

---

>ref|NM_011874.1| Mus musculus proteasome (prosome, macropain) 26S subunit, ATPase, 4
            (Psmc4), mRNA
          Length = 1371

 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 140/175 (80%)
 Strand = Plus / Minus

                                                                        
Query: 526  gggaactcaattttcctgtccagtcttcctggacgcagcagagcaggatctagagtatct 585
            ||||| |||||||| | |||||| | |||||| ||||| ||||| ||||| |  || |||
Sbjct: 1026 gggaattcaatttttcggtccaggcgtcctggccgcagtagagctggatccaaggtgtct 967

                                                                        
Query: 586  gcccgattggttgccattataaccttcacattcactgtctgatcaaatccatccatctga 645
            || |  || || ||||| || ||||||||||| ||  |||| |||||||||||||| |||
Sbjct: 966  gctctgtttgtggccatgattaccttcacattgacgttctggtcaaatccatccatttga 907

                                                                   
Query: 646  ttcagtagttccatcagaatacgctgaacttctcggtcagccccggtctgagcat 700
            |||||||| |||| ||| || | |||||| || | |||||| || ||||| ||||
Sbjct: 906  ttcagtagctccagcaggatcctctgaacctccctgtcagctcctgtctgggcat 852

---

>gb|L76223.1|MUSCIP21R Mus musculus 26S proteasome ATPase (CIP21) mRNA, complete cds
          Length = 1371

 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 140/175 (80%)
 Strand = Plus / Minus

                                                                        
Query: 526  gggaactcaattttcctgtccagtcttcctggacgcagcagagcaggatctagagtatct 585
            ||||| |||||||| | |||||| | |||||| ||||| ||||| ||||| |  || |||
Sbjct: 1026 gggaattcaatttttcggtccaggcgtcctggccgcagtagagctggatccaaggtgtct 967

                                                                        
Query: 586  gcccgattggttgccattataaccttcacattcactgtctgatcaaatccatccatctga 645
            || |  || || ||||| || ||||||||||| ||  |||| |||||||||||||| |||
Sbjct: 966  gctctgtttgtggccatgattaccttcacattgacgttctggtcaaatccatccatttga 907

                                                                   
Query: 646  ttcagtagttccatcagaatacgctgaacttctcggtcagccccggtctgagcat 700
            |||||||| |||| ||| || | |||||| || | |||||| || ||||| ||||
Sbjct: 906  ttcagtagctccagcaggatcctctgaacctccctgtcagctcctgtctgggcat 852

---

>gb|L16578.1|DDITATBPA Dictyostelium discoideum HIV1 TAT-binding protein homologous protein
            mRNA, complete cds
          Length = 1383

 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 98/119 (82%)
 Strand = Plus / Minus

                                                                        
Query: 568  gcaggatctagagtatctgcccgattggttgccattataaccttcacattcactgtctga 627
            |||||||||| |||||||   |||||||||||||| || ||||| ||||| || |    |
Sbjct: 1084 gcaggatctaaagtatcttgacgattggttgccataattacctttacatttacagataca 1025

                                                                       
Query: 628  tcaaatccatccatctgattcagtagttccatcagaatacgctgaacttctcggtcagc 686
            ||||| |||||||| ||||||| || |||||| |||||||| |||||||| || |||||
Sbjct: 1024 tcaaaaccatccatttgattcaataattccataagaatacgttgaacttcacgatcagc 966

---

>ref|XM_512659.1| PREDICTED: Pan troglodytes similar to proteasome 26S ATPase subunit 4
            isoform 2; protease 26S subunit 6; Tat-binding protein 7;
            MB67 interacting protein (LOC456032), mRNA
          Length = 1506

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 67/78 (85%)
 Strand = Plus / Minus

                                                                        
Query: 623  tctgatcaaatccatccatctgattcagtagttccatcagaatacgctgaacttctcggt 682
            |||||||||||||||||||||||||||| || |||| ||| || | |||||| || | ||
Sbjct: 1378 tctgatcaaatccatccatctgattcagcagctccagcaggatcctctgaacctccctgt 1319

                              
Query: 683  cagccccggtctgagcat 700
            | ||||| ||||||||||
Sbjct: 1318 cggcccctgtctgagcat 1301

---

>ref|XM_662535.1| Cryptosporidium hominis TU502 26S proteasome AAA-ATPase subunit RPT3
            (Chro.40284) partial mRNA
          Length = 1206

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 58/66 (87%)
 Strand = Plus / Minus

                                                                        
Query: 418  attttatcaggtctggagacataatcttccaaatcaacctcatcactcaagttcatctta 477
            ||||| || |||||||||||||| ||||| | |||||| || ||||||||||||||||| 
Sbjct: 1055 attttttctggtctggagacatattcttcaagatcaacttcttcactcaagttcatcttt 996

                  
Query: 478  gcagta 483
            ||||||
Sbjct: 995  gcagta 990

---

>ref|XM_625842.1| Cryptosporidium parvum Iowa II 26S proteasome regulatory subunit 26b
            like AAA ATpase (cgd4_2540), partial mRNA
          Length = 1206

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 58/66 (87%)
 Strand = Plus / Minus

                                                                        
Query: 418  attttatcaggtctggagacataatcttccaaatcaacctcatcactcaagttcatctta 477
            ||||| || |||||||||||||| ||||| | |||||| || ||||||||||||||||| 
Sbjct: 1055 attttttctggtctggagacatattcttcaagatcaacttcttcactcaagttcatcttt 996

                  
Query: 478  gcagta 483
            ||||||
Sbjct: 995  gcagta 990

---

>gb|AY809946.1| Schistosoma japonicum clone SJCHGC01629 unknown mRNA
          Length = 590

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 106/130 (81%)
 Strand = Plus / Minus

                                                                       
Query: 571 ggatctagagtatctgcccgattggttgccattataaccttcacattcactgtctgatca 630
           ||||||||||| || || |||||||| ||||| |||||||| || || ||  |||| || 
Sbjct: 191 ggatctagagtgtcagcacgattggtagccatgataacctttacgttgacattctggtcg 132

                                                                       
Query: 631 aatccatccatctgattcagtagttccatcagaatacgctgaacttctcggtcagccccg 690
           ||||||||||| || ||||  ||||| | || ||||||||| ||||| |||||||| || 
Sbjct: 131 aatccatccatttggttcaacagttctaacaaaatacgctgtacttcacggtcagctcca 72

                     
Query: 691 gtctgagcat 700
           || |||||||
Sbjct: 71  gtttgagcat 62

---

>gb|BC012411.1| Mus musculus proteasome (prosome, macropain) 26S subunit, ATPase,
           4, mRNA (cDNA clone IMAGE:3501138), complete cds
          Length = 660

 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 48/53 (90%)
 Strand = Plus / Minus

                                                                
Query: 606 aaccttcacattcactgtctgatcaaatccatccatctgattcagtagttcca 658
           |||||||||||| ||  |||| |||||||||||||| ||||||||||||||||
Sbjct: 75  aaccttcacattgacgttctggtcaaatccatccatttgattcagtagttcca 23

---

>gb|AY431597.1| Aedes aegypti ASAP ID: 36999 proteasome regulatory particle subunit
            mRNA sequence
          Length = 1252

 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 117/145 (80%)
 Strand = Plus / Minus

                                                                        
Query: 514  cgatccggcagagggaactcaattttcctgtccagtcttcctggacgcagcagagcagga 573
            ||||| |||| ||| || || |||||||| ||||  | ||||||||||||||| || |||
Sbjct: 1019 cgatcgggcaaaggaaattcgattttcctatccaaacgtcctggacgcagcagtgcggga 960

                                                                        
Query: 574  tctagagtatctgcccgattggttgccattataaccttcacattcactgtctgatcaaat 633
            ||||| ||||| || |||||||| ||||| ||||| || || ||    || |||||||||
Sbjct: 959  tctagtgtatcagcacgattggtagccatgataactttaacgttggtcgtttgatcaaat 900

                                     
Query: 634  ccatccatctgattcagtagttcca 658
            || ||||| ||||||| || |||||
Sbjct: 899  ccgtccatttgattcaataattcca 875



 Score = 50.1 bits (25), Expect = 0.010
 Identities = 46/53 (86%)
 Strand = Plus / Minus

                                                                 
Query: 352  taccgatttttgcggacagcatgcatgccagcttcctggcaaatagcagtgat 404
            |||| ||||| ||| ||||| ||||||||||||||||| ||||| ||| ||||
Sbjct: 1181 tacctattttcgcgcacagcgtgcatgccagcttcctgacaaattgcattgat 1129

---

>gb|AC158220.4| Mus musculus chromosome 7, clone RP23-278M8, complete sequence
          Length = 189304

 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 48/53 (90%)
 Strand = Plus / Minus

                                                                   
Query: 606    aaccttcacattcactgtctgatcaaatccatccatctgattcagtagttcca 658
              |||||||||||| ||  |||| |||||||||||||| ||||||||||||||||
Sbjct: 118782 aaccttcacattgacgttctggtcaaatccatccatttgattcagtagttcca 118730

---

>emb|BX049202.1|CNS09A4M Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC24DH05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 498

 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 117/145 (80%)
 Strand = Plus / Plus

                                                                       
Query: 556 ggacgcagcagagcaggatctagagtatctgcccgattggttgccattataaccttcaca 615
           |||||||||||||| ||||| || ||||| ||||| || || ||||| || |||||||| 
Sbjct: 238 ggacgcagcagagccggatcgagcgtatcggcccggttagtggccatgatcaccttcacg 297

                                                                       
Query: 616 ttcactgtctgatcaaatccatccatctgattcagtagttccatcagaatacgctgaact 675
           |||   |||||||| || ||||||||||| || || || || | |||||||||||| || 
Sbjct: 298 ttcgtcgtctgatcgaacccatccatctggttgagcagctcgagcagaatacgctgcacc 357

                                    
Query: 676 tctcggtcagccccggtctgagcat 700
           || || || || |||||||| ||||
Sbjct: 358 tcccgatcggcaccggtctgcgcat 382

---

>emb|BX009899.1|CNS08FSV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA15DH11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 367

 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 117/145 (80%)
 Strand = Plus / Plus

                                                                       
Query: 556 ggacgcagcagagcaggatctagagtatctgcccgattggttgccattataaccttcaca 615
           |||||||||||||| ||||| || ||||| ||||| || || ||||| || |||||||| 
Sbjct: 172 ggacgcagcagagccggatcgagcgtatcggcccggttagtggccatgatcaccttcacg 231

                                                                       
Query: 616 ttcactgtctgatcaaatccatccatctgattcagtagttccatcagaatacgctgaact 675
           |||   |||||||| || ||||||||||| || || || || | |||||||||||| || 
Sbjct: 232 ttcgtcgtctgatcgaacccatccatctggttgagcagctcgagcagaatacgctgcacc 291

                                    
Query: 676 tctcggtcagccccggtctgagcat 700
           || || || || |||||||| ||||
Sbjct: 292 tcccgatcggcaccggtctgcgcat 316

---

>dbj|AB168803.1| Macaca fascicularis testis cDNA, clone: QtsA-14940, similar to human
            proteasome (prosome, macropain) 26S subunit, ATPase,
            4(PSMC4), transcript variant 1, mRNA, RefSeq: NM_006503.2
          Length = 1654

 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 135/169 (79%)
 Strand = Plus / Minus

                                                                        
Query: 532  tcaattttcctgtccagtcttcctggacgcagcagagcaggatctagagtatctgcccga 591
            |||||||| | |||||| | |||||| || ||||| || ||||| || || ||||| |  
Sbjct: 1173 tcaattttacggtccagccgtcctggccgtagcagggctggatccagggtgtctgctctg 1114

                                                                        
Query: 592  ttggttgccattataaccttcacattcactgtctgatcaaatccatccatctgattcagt 651
            || || ||||| || ||||| ||||| ||  |||||||||||||||||||||||||||| 
Sbjct: 1113 tttgtggccatgatcaccttgacattgacattctgatcaaatccatccatctgattcagc 1054

                                                             
Query: 652  agttccatcagaatacgctgaacttctcggtcagccccggtctgagcat 700
            || |||| ||| || | |||||| || | ||| || || ||||||||||
Sbjct: 1053 agctccagcaggatcctctgaacctccctgtcggctcccgtctgagcat 1005

---

>emb|CR622224.1| full-length cDNA clone CS0DK006YK15 of HeLa cells Cot 25-normalized
           of Homo sapiens (human)
          Length = 549

 Score = 61.9 bits (31), Expect = 3e-06
 Identities = 97/119 (81%)
 Strand = Plus / Minus

                                                                       
Query: 532 tcaattttcctgtccagtcttcctggacgcagcagagcaggatctagagtatctgcccga 591
           |||||||| | |||||| | |||||| || ||||| || ||||| || || ||||| |  
Sbjct: 155 tcaattttacggtccagccgtcctggccgtagcagggccggatccagggtgtctgctctg 96

                                                                      
Query: 592 ttggttgccattataaccttcacattcactgtctgatcaaatccatccatctgattcag 650
           || || ||||| || ||||| ||||| ||  ||||||||||||||||||||||||||||
Sbjct: 95  tttgtggccatgattaccttgacattgacattctgatcaaatccatccatctgattcag 37

---

>dbj|AP007155.1| Aspergillus oryzae RIB40 genomic DNA, SC003
          Length = 4170692

 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 99/122 (81%)
 Strand = Plus / Minus

                                                                           
Query: 553     cctggacgcagcagagcaggatctagagtatctgcccgattggttgccattataaccttc 612
               ||||||||||||||||||||||| | |||||| ||||| || || ||||| || ||||| 
Sbjct: 1872792 cctggacgcagcagagcaggatccaaagtatcggcccggttagtagccataatgacctta 1872733

                                                                           
Query: 613     acattcactgtctgatcaaatccatccatctgattcagtagttccatcagaatacgctga 672
               |||||    |  || ||||| ||||||||||| || || |||||||  |||||||| |||
Sbjct: 1872732 acattgctcgattgctcaaaaccatccatctggttgaggagttccagaagaatacgttga 1872673

                 
Query: 673     ac 674
               ||
Sbjct: 1872672 ac 1872671

---

>emb|BX064829.1|CNS09M6P Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC48BH02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 655

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 116/145 (80%)
 Strand = Plus / Plus

                                                                       
Query: 556 ggacgcagcagagcaggatctagagtatctgcccgattggttgccattataaccttcaca 615
           ||||||||||| || ||||| || ||||| ||||| || || ||||| || |||||||| 
Sbjct: 412 ggacgcagcagggccggatcgagcgtatcggcccggttagtggccatgatcaccttcacg 471

                                                                       
Query: 616 ttcactgtctgatcaaatccatccatctgattcagtagttccatcagaatacgctgaact 675
           |||   |||||||| || ||||||||||| || || || || | |||||||||||| || 
Sbjct: 472 ttcgtcgtctgatcgaacccatccatctggttgagcagctcgagcagaatacgctgcacc 531

                                    
Query: 676 tctcggtcagccccggtctgagcat 700
           || || || || |||||||| ||||
Sbjct: 532 tcccgatcggcaccggtctgcgcat 556



 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 318 gtaacccttctcgaagtcctt 338
           |||||||||||||||||||||
Sbjct: 173 gtaacccttctcgaagtcctt 193

---

>emb|BX064588.1|CNS09M00 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC46DG01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 522

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 74/89 (83%)
 Strand = Plus / Plus

                                                                       
Query: 556 ggacgcagcagagcaggatctagagtatctgcccgattggttgccattataaccttcaca 615
           |||||||||||||| ||||| || ||||| ||||| || || ||||| || |||||||| 
Sbjct: 412 ggacgcagcagagccggatcgagcgtatcggcccggttagtggccatgatcaccttcacg 471

                                        
Query: 616 ttcactgtctgatcaaatccatccatctg 644
           |||   |||||||| || |||||||||||
Sbjct: 472 ttcgtcgtctgatcgaacccatccatctg 500



 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 318 gtaacccttctcgaagtcctt 338
           |||||||||||||||||||||
Sbjct: 174 gtaacccttctcgaagtcctt 194

---

>ref|XM_311871.2| Anopheles gambiae str. PEST ENSANGP00000023984
           (ENSANGG00000015165), partial mRNA
          Length = 1374

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 116/145 (80%)
 Strand = Plus / Minus

                                                                       
Query: 556 ggacgcagcagagcaggatctagagtatctgcccgattggttgccattataaccttcaca 615
           ||||||||||| || ||||| || ||||| ||||| || || ||||| || |||||||| 
Sbjct: 959 ggacgcagcagggccggatcgagcgtatcggcccggttagtggccatgatcaccttcacg 900

                                                                       
Query: 616 ttcactgtctgatcaaatccatccatctgattcagtagttccatcagaatacgctgaact 675
           |||   |||||||| || ||||||||||| || || || || | |||||||||||| || 
Sbjct: 899 ttcgtcgtctgatcgaacccatccatctggttgagcagctcgagcagaatacgctgcacc 840

                                    
Query: 676 tctcggtcagccccggtctgagcat 700
           || || || || |||||||| ||||
Sbjct: 839 tcccgatcggcaccggtctgcgcat 815



 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 318  gtaacccttctcgaagtcctt 338
            |||||||||||||||||||||
Sbjct: 1197 gtaacccttctcgaagtcctt 1177

---

>ref|XM_311870.2| Anopheles gambiae str. PEST ENSANGP00000017654 (ENSANGG00000015165),
            partial mRNA
          Length = 1449

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 116/145 (80%)
 Strand = Plus / Minus

                                                                        
Query: 556  ggacgcagcagagcaggatctagagtatctgcccgattggttgccattataaccttcaca 615
            ||||||||||| || ||||| || ||||| ||||| || || ||||| || |||||||| 
Sbjct: 1034 ggacgcagcagggccggatcgagcgtatcggcccggttagtggccatgatcaccttcacg 975

                                                                        
Query: 616  ttcactgtctgatcaaatccatccatctgattcagtagttccatcagaatacgctgaact 675
            |||   |||||||| || ||||||||||| || || || || | |||||||||||| || 
Sbjct: 974  ttcgtcgtctgatcgaacccatccatctggttgagcagctcgagcagaatacgctgcacc 915

                                     
Query: 676  tctcggtcagccccggtctgagcat 700
            || || || || |||||||| ||||
Sbjct: 914  tcccgatcggcaccggtctgcgcat 890



 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 318  gtaacccttctcgaagtcctt 338
            |||||||||||||||||||||
Sbjct: 1272 gtaacccttctcgaagtcctt 1252

---

>gb|AC007842.1|AC007842 Homo sapiens chromosome 19, BAC 331191 (CIT-B-471f3), complete sequence
          Length = 174009

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                          
Query: 606   aaccttcacattcactgtctgatcaaatccatccatctgattcag 650
             |||||| ||||| ||  ||||||||||||||||||||||||||||
Sbjct: 98391 aaccttgacattgacattctgatcaaatccatccatctgattcag 98347

---

>ref|XM_817508.1| Trypanosoma brucei TREU927 protease regulatory ATPase subunit 4
           (Tb10.70.3930) partial mRNA
          Length = 1200

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                   
Query: 628 tcaaatccatccatctgattcagtagttccatcagaatacgctgaacttctcggtc 683
           ||||| ||||||||||||| |||||||||||| ||  |||||||||| || |||||
Sbjct: 830 tcaaagccatccatctgatgcagtagttccattagcgtacgctgaacctcgcggtc 775

---

>gb|BC063145.1| Rattus norvegicus proteasome (prosome, macropain) 26S subunit,
            ATPase, 4, mRNA (cDNA clone MGC:72664 IMAGE:6889167),
            complete cds
          Length = 1401

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 157/200 (78%)
 Strand = Plus / Minus

                                                                        
Query: 501  cctcttctgcctccgatccggcagagggaactcaattttcctgtccagtcttcctggacg 560
            ||||||||| |  ||||| || || ||||| |||||||| | |||||| | |||||| ||
Sbjct: 1048 cctcttctggcgacgatcagggagtgggaattcaattttgcggtccaggcgtcctggccg 989

                                                                        
Query: 561  cagcagagcaggatctagagtatctgcccgattggttgccattataaccttcacattcac 620
             || ||||| ||||| |  || ||||| |  || || ||||| || ||||||||||| ||
Sbjct: 988  aagtagagctggatccaaggtgtctgctctgtttgtggccatgattaccttcacattgac 929

                                                                        
Query: 621  tgtctgatcaaatccatccatctgattcagtagttccatcagaatacgctgaacttctcg 680
              | || |||||||||||||| ||||||||||| |||| ||| || | |||||| || | 
Sbjct: 928  gttttggtcaaatccatccatttgattcagtagctccagcaggatcctctgaacctccct 869

                                
Query: 681  gtcagccccggtctgagcat 700
            |||||| || ||||| ||||
Sbjct: 868  gtcagctcctgtctgggcat 849

---

>gb|AF227502.1| Trypanosoma brucei proteasome regulatory ATPase subunit 4 (Rpt4)
           gene, complete cds
          Length = 1637

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                   
Query: 628 tcaaatccatccatctgattcagtagttccatcagaatacgctgaacttctcggtc 683
           ||||| ||||||||||||| |||||||||||| ||  |||||||||| || |||||
Sbjct: 960 tcaaagccatccatctgatgcagtagttccattagcgtacgctgaacctcgcggtc 905

---

>ref|NM_057122.1| Rattus norvegicus proteasome (prosome, macropain) 26S subunit,
            ATPase, 4 (Psmc4), mRNA
          Length = 1376

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 157/200 (78%)
 Strand = Plus / Minus

                                                                        
Query: 501  cctcttctgcctccgatccggcagagggaactcaattttcctgtccagtcttcctggacg 560
            ||||||||| |  ||||| || || ||||| |||||||| | |||||| | |||||| ||
Sbjct: 1038 cctcttctggcgacgatcagggagtgggaattcaattttgcggtccaggcgtcctggccg 979

                                                                        
Query: 561  cagcagagcaggatctagagtatctgcccgattggttgccattataaccttcacattcac 620
             || ||||| ||||| |  || ||||| |  || || ||||| || ||||||||||| ||
Sbjct: 978  aagtagagctggatccaaggtgtctgctctgtttgtggccatgattaccttcacattgac 919

                                                                        
Query: 621  tgtctgatcaaatccatccatctgattcagtagttccatcagaatacgctgaacttctcg 680
              | || |||||||||||||| ||||||||||| |||| ||| || | |||||| || | 
Sbjct: 918  gttttggtcaaatccatccatttgattcagtagctccagcaggatcctctgaacctccct 859

                                
Query: 681  gtcagccccggtctgagcat 700
            |||||| || ||||| ||||
Sbjct: 858  gtcagctcctgtctgggcat 839

---

>gb|AC158188.2| Selaginella moellendorffii clone JGIASXY-5I4, complete sequence
          Length = 37581

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 76/92 (82%)
 Strand = Plus / Minus

                                                                         
Query: 526   gggaactcaattttcctgtccagtcttcctggacgcagcagagcaggatctagagtatct 585
             |||||||| || |||||||| |||| ||| || | ||| |||||||| || | |||||| 
Sbjct: 21463 gggaactcgatcttcctgtcgagtcgtccaggcctcagtagagcagggtccaaagtatcg 21404

                                             
Query: 586   gcccgattggttgccattataaccttcacatt 617
             || ||||| || ||||| ||||||||||||||
Sbjct: 21403 gcacgatttgtagccatgataaccttcacatt 21372



 Score = 42.1 bits (21), Expect = 2.4
 Identities = 72/89 (80%)
 Strand = Plus / Minus

                                                                         
Query: 526   gggaactcaattttcctgtccagtcttcctggacgcagcagagcaggatctagagtatct 585
             |||||||| || |||||||| |||||||| || | ||| ||||| || || | |||||| 
Sbjct: 10612 gggaactcgatcttcctgtcgagtcttccaggcctcagtagagcggggtccaaagtatca 10553

                                          
Query: 586   gcccgattggttgccattataaccttcac 614
             || || || || ||||| |||||||||||
Sbjct: 10552 gcacggtttgtagccatgataaccttcac 10524

---

>dbj|D50695.1|RATTBP7B Rattus norvegicus mRNA for proteasomal ATPase (Tat-binding protein7),
            complete cds
          Length = 1397

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 157/200 (78%)
 Strand = Plus / Minus

                                                                        
Query: 501  cctcttctgcctccgatccggcagagggaactcaattttcctgtccagtcttcctggacg 560
            ||||||||| |  ||||| || || ||||| |||||||| | |||||| | |||||| ||
Sbjct: 1038 cctcttctggcgacgatcagggagtgggaattcaattttgcggtccaggcgtcctggccg 979

                                                                        
Query: 561  cagcagagcaggatctagagtatctgcccgattggttgccattataaccttcacattcac 620
             || ||||| ||||| |  || ||||| |  || || ||||| || ||||||||||| ||
Sbjct: 978  aagtagagctggatccaaggtgtctgctctgtttgtggccatgattaccttcacattgac 919

                                                                        
Query: 621  tgtctgatcaaatccatccatctgattcagtagttccatcagaatacgctgaacttctcg 680
              | || |||||||||||||| ||||||||||| |||| ||| || | |||||| || | 
Sbjct: 918  gttttggtcaaatccatccatttgattcagtagctccagcaggatcctctgaacctccct 859

                                
Query: 681  gtcagccccggtctgagcat 700
            |||||| || ||||| ||||
Sbjct: 858  gtcagctcctgtctgggcat 839

---

>ref|XM_749387.1| Aspergillus fumigatus Af293 proteasome regulatory particle subunit
           Rpt3 (Afu3g11390) partial mRNA
          Length = 1398

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 87/107 (81%)
 Strand = Plus / Minus

                                                                       
Query: 571 ggatctagagtatctgcccgattggttgccattataaccttcacattcactgtctgatca 630
           ||||| |||||||| || || ||||| ||||| || |||||||||||   |||||| || 
Sbjct: 956 ggatccagagtatccgctcggttggtggccatgatgaccttcacattgcttgtctgttcg 897

                                                          
Query: 631 aatccatccatctgattcagtagttccatcagaatacgctgaacttc 677
           || || ||||||||||| || || || | ||| ||||||||||||||
Sbjct: 896 aagccgtccatctgattgaggagctcaagcaggatacgctgaacttc 850

---

>ref|XM_861948.1| PREDICTED: Canis familiaris similar to 26S protease regulatory
           subunit 6B (MIP224) (MB67 interacting protein)
           (TAT-binding protein-7) (TBP-7), transcript variant 4
           (LOC476459), mRNA
          Length = 1413

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 84/103 (81%)
 Strand = Plus / Minus

                                                                       
Query: 598 gccattataaccttcacattcactgtctgatcaaatccatccatctgattcagtagttcc 657
           ||||| || ||||| ||||| ||  |||| |||||||||||||| ||||||||||| |||
Sbjct: 961 gccatgatcaccttgacattaacgttctggtcaaatccatccatttgattcagtagctcc 902

                                                      
Query: 658 atcagaatacgctgaacttctcggtcagccccggtctgagcat 700
           | ||| || | |||||| || | |||||| || ||||| ||||
Sbjct: 901 agcaggattctctgaacctccctgtcagctcctgtctgggcat 859

---

>ref|XM_861938.1| PREDICTED: Canis familiaris similar to 26S protease regulatory
            subunit 6B (MIP224) (MB67 interacting protein)
            (TAT-binding protein-7) (TBP-7), transcript variant 3
            (LOC476459), mRNA
          Length = 1455

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 84/103 (81%)
 Strand = Plus / Minus

                                                                        
Query: 598  gccattataaccttcacattcactgtctgatcaaatccatccatctgattcagtagttcc 657
            ||||| || ||||| ||||| ||  |||| |||||||||||||| ||||||||||| |||
Sbjct: 1003 gccatgatcaccttgacattaacgttctggtcaaatccatccatttgattcagtagctcc 944

                                                       
Query: 658  atcagaatacgctgaacttctcggtcagccccggtctgagcat 700
            | ||| || | |||||| || | |||||| || ||||| ||||
Sbjct: 943  agcaggattctctgaacctccctgtcagctcctgtctgggcat 901

---

>ref|XM_861928.1| PREDICTED: Canis familiaris similar to 26S protease regulatory
           subunit 6B (MIP224) (MB67 interacting protein)
           (TAT-binding protein-7) (TBP-7), transcript variant 2
           (LOC476459), mRNA
          Length = 1307

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 84/103 (81%)
 Strand = Plus / Minus

                                                                       
Query: 598 gccattataaccttcacattcactgtctgatcaaatccatccatctgattcagtagttcc 657
           ||||| || ||||| ||||| ||  |||| |||||||||||||| ||||||||||| |||
Sbjct: 855 gccatgatcaccttgacattaacgttctggtcaaatccatccatttgattcagtagctcc 796

                                                      
Query: 658 atcagaatacgctgaacttctcggtcagccccggtctgagcat 700
           | ||| || | |||||| || | |||||| || ||||| ||||
Sbjct: 795 agcaggattctctgaacctccctgtcagctcctgtctgggcat 753

---

>ref|XM_533670.2| PREDICTED: Canis familiaris similar to 26S protease regulatory
           subunit 6B (MIP224) (MB67 interacting protein)
           (TAT-binding protein-7) (TBP-7), transcript variant 1
           (LOC476459), mRNA
          Length = 1411

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 84/103 (81%)
 Strand = Plus / Minus

                                                                       
Query: 598 gccattataaccttcacattcactgtctgatcaaatccatccatctgattcagtagttcc 657
           ||||| || ||||| ||||| ||  |||| |||||||||||||| ||||||||||| |||
Sbjct: 959 gccatgatcaccttgacattaacgttctggtcaaatccatccatttgattcagtagctcc 900

                                                      
Query: 658 atcagaatacgctgaacttctcggtcagccccggtctgagcat 700
           | ||| || | |||||| || | |||||| || ||||| ||||
Sbjct: 899 agcaggattctctgaacctccctgtcagctcctgtctgggcat 857

---

>ref|XM_502714.1| Yarrowia lipolytica CLIB122, YALI0D11770g predicted mRNA
          Length = 1215

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 138/175 (78%)
 Strand = Plus / Minus

                                                                       
Query: 526 gggaactcaattttcctgtccagtcttcctggacgcagcagagcaggatctagagtatct 585
           |||||||| || || | ||||||||  || |||||||||||||||||||| || || |||
Sbjct: 950 gggaactcgatctttcggtccagtcgaccgggacgcagcagagcaggatccagtgtgtct 891

                                                                       
Query: 586 gcccgattggttgccattataaccttcacattcactgtctgatcaaatccatccatctga 645
           || || ||||| ||||| || ||||| || ||    ||||| || || || |||||||| 
Sbjct: 890 gctcggttggtggccatgatcaccttgacgttggaggtctggtcgaaaccgtccatctgg 831

                                                                  
Query: 646 ttcagtagttccatcagaatacgctgaacttctcggtcagccccggtctgagcat 700
           || || || |||| ||| |||||||| || |||| ||| || |||||||| ||||
Sbjct: 830 ttgagcagctccagcaggatacgctggacctctctgtcggcaccggtctgtgcat 776

---

>ref|XM_393513.2| PREDICTED: Apis mellifera similar to DEAD-box ATPase (LOC410026),
           mRNA
          Length = 1399

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 105/131 (80%)
 Strand = Plus / Minus

                                                                       
Query: 568 gcaggatctagagtatctgcccgattggttgccattataaccttcacattcactgtctga 627
           ||||||||||  ||||| || | ||| |||||||||||||| || |||||    || |||
Sbjct: 997 gcaggatctaatgtatcagctctattcgttgccattataactttaacattagtagtttga 938

                                                                       
Query: 628 tcaaatccatccatctgattcagtagttccatcagaatacgctgaacttctcggtcagcc 687
           ||||| |||||||| ||||| || | |||||  |||||||| || ||||| || ||||| 
Sbjct: 937 tcaaaaccatccatttgattaagcaattccaaaagaatacgttgcacttcacgatcagca 878

                      
Query: 688 ccggtctgagc 698
           || ||||||||
Sbjct: 877 ccagtctgagc 867

---

>emb|CR382130.1| Yarrowia lipolytica chromosome D of strain CLIB122 of Yarrowia lipolytica
          Length = 3633272

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 138/175 (78%)
 Strand = Plus / Plus

                                                                           
Query: 526     gggaactcaattttcctgtccagtcttcctggacgcagcagagcaggatctagagtatct 585
               |||||||| || || | ||||||||  || |||||||||||||||||||| || || |||
Sbjct: 1459650 gggaactcgatctttcggtccagtcgaccgggacgcagcagagcaggatccagtgtgtct 1459709

                                                                           
Query: 586     gcccgattggttgccattataaccttcacattcactgtctgatcaaatccatccatctga 645
               || || ||||| ||||| || ||||| || ||    ||||| || || || |||||||| 
Sbjct: 1459710 gctcggttggtggccatgatcaccttgacgttggaggtctggtcgaaaccgtccatctgg 1459769

                                                                      
Query: 646     ttcagtagttccatcagaatacgctgaacttctcggtcagccccggtctgagcat 700
               || || || |||| ||| |||||||| || |||| ||| || |||||||| ||||
Sbjct: 1459770 ttgagcagctccagcaggatacgctggacctctctgtcggcaccggtctgtgcat 1459824

---

>ref|XM_509951.1| PREDICTED: Pan troglodytes similar to Psmc6 protein (LOC452909),
           mRNA
          Length = 1167

 Score = 52.0 bits (26), Expect = 0.003
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 549 tcttcctggacgcagcagagcaggatctagagtatctg 586
           ||||||||||||||||| ||||||||| || |||||||
Sbjct: 879 tcttcctggacgcagcaaagcaggatccagtgtatctg 842



 Score = 44.1 bits (22), Expect = 0.61
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 627 atcaaatccatccatctgattcagta 652
           ||||||||||||||| ||||||||||
Sbjct: 801 atcaaatccatccatttgattcagta 776

---

>ref|XM_710241.1| Candida albicans SC5314 putative 26S proteasome regulatory particle
           ATPase Rpt3p (CaO19_5793), mRNA
          Length = 1236

 Score = 52.0 bits (26), Expect = 0.003
 Identities = 68/82 (82%)
 Strand = Plus / Minus

                                                                       
Query: 568 gcaggatctagagtatctgcccgattggttgccattataaccttcacattcactgtctga 627
           |||||||||| ||||||||| |  || || ||||||||||| || ||| |   |||||||
Sbjct: 929 gcaggatctaaagtatctgctctgttagtagccattataactttgacagtggatgtctga 870

                                 
Query: 628 tcaaatccatccatctgattca 649
           ||||| |||||||| |||||||
Sbjct: 869 tcaaacccatccatttgattca 848

---

>ref|XM_710176.1| Candida albicans SC5314 putative 26S proteasome regulatory particle
           ATPase Rpt3p (CaO19.13215), mRNA
          Length = 1236

 Score = 52.0 bits (26), Expect = 0.003
 Identities = 68/82 (82%)
 Strand = Plus / Minus

                                                                       
Query: 568 gcaggatctagagtatctgcccgattggttgccattataaccttcacattcactgtctga 627
           |||||||||| ||||||||| |  || || ||||||||||| || ||| |   |||||||
Sbjct: 929 gcaggatctaaagtatctgctctgttagtagccattataactttgacagtggatgtctga 870

                                 
Query: 628 tcaaatccatccatctgattca 649
           ||||| |||||||| |||||||
Sbjct: 869 tcaaacccatccatttgattca 848

---

>emb|BX049214.1|CNS09A4Y Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC24DH11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 452

 Score = 52.0 bits (26), Expect = 0.003
 Identities = 117/146 (80%), Gaps = 1/146 (0%)
 Strand = Plus / Plus

                                                                       
Query: 556 ggacgcagcagagca-ggatctagagtatctgcccgattggttgccattataaccttcac 614
           ||||||||||||||  ||||| || ||||| ||||| || || ||||| || ||||||||
Sbjct: 160 ggacgcagcagagcctggatcgagcgtatcggcccggttagtggccatgatcaccttcac 219

                                                                       
Query: 615 attcactgtctgatcaaatccatccatctgattcagtagttccatcagaatacgctgaac 674
            |||   |||||||| || ||||||||||| || || || || | |||||||||||| ||
Sbjct: 220 gttcgtcgtctgatcgaacccatccatctggttgagcagctcgagcagaatacgctgcac 279

                                     
Query: 675 ttctcggtcagccccggtctgagcat 700
            || || || || |||||||| ||||
Sbjct: 280 ctcccgatcggcaccggtctgcgcat 305

---

>emb|BX031109.1|CNS08W61 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA46BG01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 794

 Score = 52.0 bits (26), Expect = 0.003
 Identities = 117/146 (80%), Gaps = 1/146 (0%)
 Strand = Plus / Plus

                                                                       
Query: 556 ggacgcagcagagcaggatctagagtatctgccc-gattggttgccattataaccttcac 614
           |||||||||||||| ||||| || ||||| |||| | || || ||||| || ||||||||
Sbjct: 416 ggacgcagcagagccggatcgagcgtatcggccccggttagtggccatgatcaccttcac 475

                                                                       
Query: 615 attcactgtctgatcaaatccatccatctgattcagtagttccatcagaatacgctgaac 674
            |||   |||||||| || ||||||||||| || || || || | |||||||||||| ||
Sbjct: 476 gttcgtcgtctgatcgaacccatccatctggttgagcagctcgagcagaatacgctgcac 535

                                     
Query: 675 ttctcggtcagccccggtctgagcat 700
            || || || || |||||||| ||||
Sbjct: 536 ctcccgatcggcaccggtctgcgcat 561



 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 318 gtaacccttctcgaagtcctt 338
           |||||||||||||||||||||
Sbjct: 178 gtaacccttctcgaagtcctt 198

---

>gb|BT007531.1| Synthetic construct Homo sapiens proteasome (prosome, macropain)
           26S subunit, ATPase, 6 mRNA, partial cds
          Length = 1170

 Score = 52.0 bits (26), Expect = 0.003
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 549 tcttcctggacgcagcagagcaggatctagagtatctg 586
           ||||||||||||||||| ||||||||| || |||||||
Sbjct: 882 tcttcctggacgcagcaaagcaggatccagtgtatctg 845



 Score = 44.1 bits (22), Expect = 0.61
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 627 atcaaatccatccatctgattcagta 652
           ||||||||||||||| ||||||||||
Sbjct: 804 atcaaatccatccatttgattcagta 779

---

>gb|BT006843.1| Homo sapiens proteasome (prosome, macropain) 26S subunit, ATPase, 6
           mRNA, complete cds
          Length = 1170

 Score = 52.0 bits (26), Expect = 0.003
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 549 tcttcctggacgcagcagagcaggatctagagtatctg 586
           ||||||||||||||||| ||||||||| || |||||||
Sbjct: 882 tcttcctggacgcagcaaagcaggatccagtgtatctg 845



 Score = 44.1 bits (22), Expect = 0.61
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 627 atcaaatccatccatctgattcagta 652
           ||||||||||||||| ||||||||||
Sbjct: 804 atcaaatccatccatttgattcagta 779

---

>gb|BC005390.1| Homo sapiens proteasome (prosome, macropain) 26S subunit, ATPase,
           6, mRNA (cDNA clone MGC:12520 IMAGE:3996906), complete
           cds
          Length = 1595

 Score = 52.0 bits (26), Expect = 0.003
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 549 tcttcctggacgcagcagagcaggatctagagtatctg 586
           ||||||||||||||||| ||||||||| || |||||||
Sbjct: 902 tcttcctggacgcagcaaagcaggatccagtgtatctg 865



 Score = 44.1 bits (22), Expect = 0.61
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 627 atcaaatccatccatctgattcagta 652
           ||||||||||||||| ||||||||||
Sbjct: 824 atcaaatccatccatttgattcagta 799

---

>emb|CR615895.1| full-length cDNA clone CS0DI024YJ06 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1509

 Score = 52.0 bits (26), Expect = 0.003
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 549 tcttcctggacgcagcagagcaggatctagagtatctg 586
           ||||||||||||||||| ||||||||| || |||||||
Sbjct: 871 tcttcctggacgcagcaaagcaggatccagtgtatctg 834



 Score = 44.1 bits (22), Expect = 0.61
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 627 atcaaatccatccatctgattcagta 652
           ||||||||||||||| ||||||||||
Sbjct: 793 atcaaatccatccatttgattcagta 768

---

>ref|NM_002806.2| Homo sapiens proteasome (prosome, macropain) 26S subunit, ATPase, 6
           (PSMC6), mRNA
          Length = 1590

 Score = 52.0 bits (26), Expect = 0.003
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 549 tcttcctggacgcagcagagcaggatctagagtatctg 586
           ||||||||||||||||| ||||||||| || |||||||
Sbjct: 902 tcttcctggacgcagcaaagcaggatccagtgtatctg 865



 Score = 44.1 bits (22), Expect = 0.61
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 627 atcaaatccatccatctgattcagta 652
           ||||||||||||||| ||||||||||
Sbjct: 824 atcaaatccatccatttgattcagta 799

---

>emb|CR624028.1| full-length cDNA clone CS0DE008YC13 of Placenta of Homo sapiens
           (human)
          Length = 1507

 Score = 52.0 bits (26), Expect = 0.003
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 549 tcttcctggacgcagcagagcaggatctagagtatctg 586
           ||||||||||||||||| ||||||||| || |||||||
Sbjct: 877 tcttcctggacgcagcaaagcaggatccagtgtatctg 840



 Score = 44.1 bits (22), Expect = 0.61
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 627 atcaaatccatccatctgattcagta 652
           ||||||||||||||| ||||||||||
Sbjct: 799 atcaaatccatccatttgattcagta 774

---

>emb|CR623246.1| full-length cDNA clone CS0DI074YH03 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1511

 Score = 52.0 bits (26), Expect = 0.003
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 549 tcttcctggacgcagcagagcaggatctagagtatctg 586
           ||||||||||||||||| ||||||||| || |||||||
Sbjct: 878 tcttcctggacgcagcaaagcaggatccagtgtatctg 841



 Score = 44.1 bits (22), Expect = 0.61
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 627 atcaaatccatccatctgattcagta 652
           ||||||||||||||| ||||||||||
Sbjct: 800 atcaaatccatccatttgattcagta 775

---

>emb|CR622035.1| full-length cDNA clone CS0DA002YJ02 of Neuroblastoma of Homo
           sapiens (human)
          Length = 1498

 Score = 52.0 bits (26), Expect = 0.003
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 549 tcttcctggacgcagcagagcaggatctagagtatctg 586
           ||||||||||||||||| ||||||||| || |||||||
Sbjct: 868 tcttcctggacgcagcaaagcaggatccagtgtatctg 831



 Score = 44.1 bits (22), Expect = 0.61
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 627 atcaaatccatccatctgattcagta 652
           ||||||||||||||| ||||||||||
Sbjct: 790 atcaaatccatccatttgattcagta 765

---

>emb|CR621047.1| full-length cDNA clone CS0DI018YK19 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1536

 Score = 52.0 bits (26), Expect = 0.003
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 549 tcttcctggacgcagcagagcaggatctagagtatctg 586
           ||||||||||||||||| ||||||||| || |||||||
Sbjct: 879 tcttcctggacgcagcaaagcaggatccagtgtatctg 842



 Score = 44.1 bits (22), Expect = 0.61
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 627 atcaaatccatccatctgattcagta 652
           ||||||||||||||| ||||||||||
Sbjct: 801 atcaaatccatccatttgattcagta 776

---

>emb|CR617697.1| full-length cDNA clone CS0DL004YH06 of B cells (Ramos cell line)
           Cot 25-normalized of Homo sapiens (human)
          Length = 1663

 Score = 52.0 bits (26), Expect = 0.003
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 549 tcttcctggacgcagcagagcaggatctagagtatctg 586
           ||||||||||||||||| ||||||||| || |||||||
Sbjct: 862 tcttcctggacgcagcaaagcaggatccagtgtatctg 825



 Score = 44.1 bits (22), Expect = 0.61
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 627 atcaaatccatccatctgattcagta 652
           ||||||||||||||| ||||||||||
Sbjct: 784 atcaaatccatccatttgattcagta 759

---

>emb|CR611308.1| full-length cDNA clone CS0DE005YE03 of Placenta of Homo sapiens
           (human)
          Length = 1459

 Score = 52.0 bits (26), Expect = 0.003
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 549 tcttcctggacgcagcagagcaggatctagagtatctg 586
           ||||||||||||||||| ||||||||| || |||||||
Sbjct: 878 tcttcctggacgcagcaaagcaggatccagtgtatctg 841



 Score = 44.1 bits (22), Expect = 0.61
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 627 atcaaatccatccatctgattcagta 652
           ||||||||||||||| ||||||||||
Sbjct: 800 atcaaatccatccatttgattcagta 775

---

>emb|CR608774.1| full-length cDNA clone CS0DI016YM01 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1528

 Score = 52.0 bits (26), Expect = 0.003
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 549 tcttcctggacgcagcagagcaggatctagagtatctg 586
           ||||||||||||||||| ||||||||| || |||||||
Sbjct: 878 tcttcctggacgcagcaaagcaggatccagtgtatctg 841



 Score = 44.1 bits (22), Expect = 0.61
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 627 atcaaatccatccatctgattcagta 652
           ||||||||||||||| ||||||||||
Sbjct: 800 atcaaatccatccatttgattcagta 775

---

>emb|CR602871.1| full-length cDNA clone CS0DI005YB20 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1511

 Score = 52.0 bits (26), Expect = 0.003
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 549 tcttcctggacgcagcagagcaggatctagagtatctg 586
           ||||||||||||||||| ||||||||| || |||||||
Sbjct: 877 tcttcctggacgcagcaaagcaggatccagtgtatctg 840



 Score = 44.1 bits (22), Expect = 0.61
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 627 atcaaatccatccatctgattcagta 652
           ||||||||||||||| ||||||||||
Sbjct: 799 atcaaatccatccatttgattcagta 774

---

>emb|CR595318.1| full-length cDNA clone CS0DI061YK22 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1506

 Score = 52.0 bits (26), Expect = 0.003
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 549 tcttcctggacgcagcagagcaggatctagagtatctg 586
           ||||||||||||||||| ||||||||| || |||||||
Sbjct: 869 tcttcctggacgcagcaaagcaggatccagtgtatctg 832



 Score = 44.1 bits (22), Expect = 0.61
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 627 atcaaatccatccatctgattcagta 652
           ||||||||||||||| ||||||||||
Sbjct: 791 atcaaatccatccatttgattcagta 766

---

>emb|CR590720.1| full-length cDNA clone CS0DI025YI08 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1514

 Score = 52.0 bits (26), Expect = 0.003
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 549 tcttcctggacgcagcagagcaggatctagagtatctg 586
           ||||||||||||||||| ||||||||| || |||||||
Sbjct: 861 tcttcctggacgcagcaaagcaggatccagtgtatctg 824



 Score = 44.1 bits (22), Expect = 0.61
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 627 atcaaatccatccatctgattcagta 652
           ||||||||||||||| ||||||||||
Sbjct: 783 atcaaatccatccatttgattcagta 758

---

>emb|CR456709.1| Homo sapiens full open reading frame cDNA clone RZPDo834G013D for
           gene PSMC6, proteasome (prosome, macropain) 26S subunit,
           ATPase, 6; complete cds, incl. stopcodon
          Length = 1170

 Score = 52.0 bits (26), Expect = 0.003
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 549 tcttcctggacgcagcagagcaggatctagagtatctg 586
           ||||||||||||||||| ||||||||| || |||||||
Sbjct: 882 tcttcctggacgcagcaaagcaggatccagtgtatctg 845



 Score = 44.1 bits (22), Expect = 0.61
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 627 atcaaatccatccatctgattcagta 652
           ||||||||||||||| ||||||||||
Sbjct: 804 atcaaatccatccatttgattcagta 779

---

>dbj|AB040869.2| Mus musculus TBP7/PSMC4 gene for proteasomal ATPase, complete cds
          Length = 2371

 Score = 52.0 bits (26), Expect = 0.003
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                              
Query: 609  cttcacattcactgtctgatcaaatccatccatctgattcagtagttcca 658
            ||||||||| ||  |||| |||||||||||||| ||||||||||| ||||
Sbjct: 1643 cttcacattgacgttctggtcaaatccatccatttgattcagtagctcca 1594

---

>gb|AY892558.1| Synthetic construct Homo sapiens clone FLH013619.01L proteasome 26S
           subunit 6 (PSMC6) mRNA, partial cds
          Length = 1170

 Score = 52.0 bits (26), Expect = 0.003
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 549 tcttcctggacgcagcagagcaggatctagagtatctg 586
           ||||||||||||||||| ||||||||| || |||||||
Sbjct: 882 tcttcctggacgcagcaaagcaggatccagtgtatctg 845



 Score = 44.1 bits (22), Expect = 0.61
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 627 atcaaatccatccatctgattcagta 652
           ||||||||||||||| ||||||||||
Sbjct: 804 atcaaatccatccatttgattcagta 779

---

>gb|AY890076.1| Synthetic construct Homo sapiens clone FLH013623.01X proteasome 26S
           subunit 6 (PSMC6) mRNA, complete cds
          Length = 1170

 Score = 52.0 bits (26), Expect = 0.003
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 549 tcttcctggacgcagcagagcaggatctagagtatctg 586
           ||||||||||||||||| ||||||||| || |||||||
Sbjct: 882 tcttcctggacgcagcaaagcaggatccagtgtatctg 845



 Score = 44.1 bits (22), Expect = 0.61
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 627 atcaaatccatccatctgattcagta 652
           ||||||||||||||| ||||||||||
Sbjct: 804 atcaaatccatccatttgattcagta 779

---

>gb|AY890075.1| Synthetic construct Homo sapiens clone FLH013622.01X proteasome 26S
           subunit 6 (PSMC6) mRNA, complete cds
          Length = 1170

 Score = 52.0 bits (26), Expect = 0.003
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 549 tcttcctggacgcagcagagcaggatctagagtatctg 586
           ||||||||||||||||| ||||||||| || |||||||
Sbjct: 882 tcttcctggacgcagcaaagcaggatccagtgtatctg 845



 Score = 44.1 bits (22), Expect = 0.61
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 627 atcaaatccatccatctgattcagta 652
           ||||||||||||||| ||||||||||
Sbjct: 804 atcaaatccatccatttgattcagta 779

---

>emb|AL133453.3|CNS01DV4 Human chromosome 14 DNA sequence BAC R-841O20 of library RPCI-11 from
              chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 212103

 Score = 52.0 bits (26), Expect = 0.003
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                    
Query: 549    tcttcctggacgcagcagagcaggatctagagtatctg 586
              ||||||||||||||||| ||||||||| || |||||||
Sbjct: 184117 tcttcctggacgcagcaaagcaggatccagtgtatctg 184080



 Score = 44.1 bits (22), Expect = 0.61
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                        
Query: 627    atcaaatccatccatctgattcagta 652
              ||||||||||||||| ||||||||||
Sbjct: 184039 atcaaatccatccatttgattcagta 184014

---

>gb|AF006305.1|AF006305 Homo sapiens 26S proteasome regulatory subunit (SUG2) mRNA,
           complete cds
          Length = 1579

 Score = 52.0 bits (26), Expect = 0.003
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 549 tcttcctggacgcagcagagcaggatctagagtatctg 586
           ||||||||||||||||| ||||||||| || |||||||
Sbjct: 897 tcttcctggacgcagcaaagcaggatccagtgtatctg 860



 Score = 44.1 bits (22), Expect = 0.61
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 627 atcaaatccatccatctgattcagta 652
           ||||||||||||||| ||||||||||
Sbjct: 819 atcaaatccatccatttgattcagta 794

---

>dbj|D78275.1| Homo sapiens mRNA for proteasome subunit p42, complete cds
          Length = 1560

 Score = 52.0 bits (26), Expect = 0.003
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 549 tcttcctggacgcagcagagcaggatctagagtatctg 586
           ||||||||||||||||| ||||||||| || |||||||
Sbjct: 898 tcttcctggacgcagcaaagcaggatccagtgtatctg 861



 Score = 44.1 bits (22), Expect = 0.61
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 627 atcaaatccatccatctgattcagta 652
           ||||||||||||||| ||||||||||
Sbjct: 820 atcaaatccatccatttgattcagta 795

---

>gb|BC083283.1| Danio rerio proteasome (prosome, macropain) 26S subunit, ATPase, 6,
           mRNA (cDNA clone MGC:101799 IMAGE:7231258), complete cds
          Length = 1561

 Score = 50.1 bits (25), Expect = 0.010
 Identities = 58/69 (84%)
 Strand = Plus / Minus

                                                                       
Query: 534 aattttcctgtccagtcttcctggacgcagcagagcaggatctagagtatctgcccgatt 593
           |||||| | |||||| | ||| ||||||||||| |||||||||| ||| |||| ||| ||
Sbjct: 930 aatttttcggtccagacgtccaggacgcagcagggcaggatctaaagtgtctggccggtt 871

                    
Query: 594 ggttgccat 602
           ||| |||||
Sbjct: 870 ggtggccat 862



 Score = 48.1 bits (24), Expect = 0.039
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                           
Query: 631 aatccatccatctgattcagtagttccatcag 662
           |||||||||||||||||||| || ||||||||
Sbjct: 833 aatccatccatctgattcagcagctccatcag 802

---

>gb|AY648827.1| Danio rerio 26S protease regulatory subunit S10B mRNA, complete cds
          Length = 1554

 Score = 50.1 bits (25), Expect = 0.010
 Identities = 58/69 (84%)
 Strand = Plus / Minus

                                                                       
Query: 534 aattttcctgtccagtcttcctggacgcagcagagcaggatctagagtatctgcccgatt 593
           |||||| | |||||| | ||| ||||||||||| |||||||||| ||| |||| ||| ||
Sbjct: 920 aatttttcggtccagacgtccaggacgcagcagggcaggatctaaagtgtctggccggtt 861

                    
Query: 594 ggttgccat 602
           ||| |||||
Sbjct: 860 ggtggccat 852



 Score = 48.1 bits (24), Expect = 0.039
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                           
Query: 631 aatccatccatctgattcagtagttccatcag 662
           |||||||||||||||||||| || ||||||||
Sbjct: 823 aatccatccatctgattcagcagctccatcag 792

---

>ref|XM_368336.1| Magnaporthe grisea 70-15 chromosome VI hypothetical protein
            (MG00908.4) partial mRNA
          Length = 1266

 Score = 50.1 bits (25), Expect = 0.010
 Identities = 118/149 (79%)
 Strand = Plus / Minus

                                                                        
Query: 526  gggaactcaattttcctgtccagtcttcctggacgcagcagagcaggatctagagtatct 585
            ||||||||||| || | ||||| ||  || ||||| || || |||||||| ||||| || 
Sbjct: 1001 gggaactcaatcttacggtccaatcgaccgggacggagaagggcaggatcgagagtgtcg 942

                                                                        
Query: 586  gcccgattggttgccattataaccttcacattcactgtctgatcaaatccatccatctga 645
            ||||  ||||||||||| || ||||| || ||  | ||||| || || || |||||||| 
Sbjct: 941  gccctgttggttgccataatgaccttgacgttggcagtctggtcgaaaccgtccatctgg 882

                                         
Query: 646  ttcagtagttccatcagaatacgctgaac 674
            ||||| || || | |||||||||||||||
Sbjct: 881  ttcagaagctcgagcagaatacgctgaac 853

---

>ref|XM_868959.1| PREDICTED: Bos taurus similar to proteasome 26S ATPase subunit 6
           (LOC518637), mRNA
          Length = 1948

 Score = 50.1 bits (25), Expect = 0.010
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                            
Query: 627 atcaaatccatccatctgattcagtagttccat 659
           ||||||||||||||| ||||||||||| |||||
Sbjct: 846 atcaaatccatccatttgattcagtagctccat 814

---

>ref|XM_813480.1| Trypanosoma cruzi strain CL Brener proteasome regulatory ATPase
           subunit 3 (Tc00.1047053507603.200) partial mRNA
          Length = 1212

 Score = 50.1 bits (25), Expect = 0.010
 Identities = 46/53 (86%)
 Strand = Plus / Minus

                                                                
Query: 589 cgattggttgccattataaccttcacattcactgtctgatcaaatccatccat 641
           ||||| |||||||| |||||||||||||||   ||||| ||||| ||||||||
Sbjct: 890 cgatttgttgccatgataaccttcacattcgtcgtctggtcaaagccatccat 838

---

>ref|XM_390945.1| Gibberella zeae PH-1 chromosome 3 PRS6_ASPNG 26S PROTEASE
           REGULATORY SUBUNIT 6B HOMOLOG (FG10769.1) partial mRNA
          Length = 1266

 Score = 50.1 bits (25), Expect = 0.010
 Identities = 106/133 (79%)
 Strand = Plus / Minus

                                                                       
Query: 568 gcaggatctagagtatctgcccgattggttgccattataaccttcacattcactgtctga 627
           ||||| || |||||||| || || ||||| ||||| || ||||| || ||  | ||||| 
Sbjct: 959 gcagggtccagagtatcagctcggttggtggccatgatgaccttgacgttagcagtctgg 900

                                                                       
Query: 628 tcaaatccatccatctgattcagtagttccatcagaatacgctgaacttctcggtcagcc 687
           || || ||||||||||| || ||||| || | |||||||||||| ||||||| ||| || 
Sbjct: 899 tcgaaaccatccatctggttgagtagctcaagcagaatacgctggacttctctgtcggca 840

                        
Query: 688 ccggtctgagcat 700
           || || |||||||
Sbjct: 839 ccagtttgagcat 827

---

>ref|XM_815076.1| Trypanosoma cruzi strain CL Brener proteasome regulatory ATPase
           subunit 3 (Tc00.1047053509429.270) partial mRNA
          Length = 1212

 Score = 50.1 bits (25), Expect = 0.010
 Identities = 46/53 (86%)
 Strand = Plus / Minus

                                                                
Query: 589 cgattggttgccattataaccttcacattcactgtctgatcaaatccatccat 641
           ||||| |||||||| |||||||||||||||   ||||| ||||| ||||||||
Sbjct: 890 cgatttgttgccatgataaccttcacattcgtcgtctggtcaaagccatccat 838

---

>gb|BC112482.1| Bos taurus similar to proteasome 26S ATPase subunit 6, mRNA (cDNA
           clone MGC:137217 IMAGE:8014462), complete cds
          Length = 1605

 Score = 50.1 bits (25), Expect = 0.010
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                            
Query: 627 atcaaatccatccatctgattcagtagttccat 659
           ||||||||||||||| ||||||||||| |||||
Sbjct: 841 atcaaatccatccatttgattcagtagctccat 809

---

>emb|CR318611.4| Zebrafish DNA sequence from clone DKEY-199F5 in linkage group 16,
             complete sequence
          Length = 162349

 Score = 50.1 bits (25), Expect = 0.010
 Identities = 70/85 (82%)
 Strand = Plus / Plus

                                                                         
Query: 526   gggaactcaattttcctgtccagtcttcctggacgcagcagagcaggatctagagtatct 585
             ||||||||||| || | ||||| ||| |||||||||||||| ||||| || || || || 
Sbjct: 58291 gggaactcaatcttacggtccaatctacctggacgcagcagggcagggtccagtgtgtca 58350

                                      
Query: 586   gcccgattggttgccattataacct 610
             ||||  ||||| ||||| |||||||
Sbjct: 58351 gccctgttggtggccatgataacct 58375

---

>ref|NM_001003832.1| Danio rerio proteasome (prosome, macropain) 26S subunit, ATPase, 6
           (psmc6), mRNA
          Length = 1554

 Score = 50.1 bits (25), Expect = 0.010
 Identities = 58/69 (84%)
 Strand = Plus / Minus

                                                                       
Query: 534 aattttcctgtccagtcttcctggacgcagcagagcaggatctagagtatctgcccgatt 593
           |||||| | |||||| | ||| ||||||||||| |||||||||| ||| |||| ||| ||
Sbjct: 920 aatttttcggtccagacgtccaggacgcagcagggcaggatctaaagtgtctggccggtt 861

                    
Query: 594 ggttgccat 602
           ||| |||||
Sbjct: 860 ggtggccat 852



 Score = 48.1 bits (24), Expect = 0.039
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                           
Query: 631 aatccatccatctgattcagtagttccatcag 662
           |||||||||||||||||||| || ||||||||
Sbjct: 823 aatccatccatctgattcagcagctccatcag 792

---

>emb|AL954679.7| Zebrafish DNA sequence from clone DKEY-63J12 in linkage group 20,
             complete sequence
          Length = 132218

 Score = 50.1 bits (25), Expect = 0.010
 Identities = 58/69 (84%)
 Strand = Plus / Plus

                                                                         
Query: 534   aattttcctgtccagtcttcctggacgcagcagagcaggatctagagtatctgcccgatt 593
             |||||| | |||||| | ||| ||||||||||| |||||||||| ||| |||| ||| ||
Sbjct: 95321 aatttttcggtccagacgtccaggacgcagcagggcaggatctaaagtgtctggccggtt 95380

                      
Query: 594   ggttgccat 602
             ||| |||||
Sbjct: 95381 ggtggccat 95389



 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 631   aatccatccatctgattcag 650
             ||||||||||||||||||||
Sbjct: 95418 aatccatccatctgattcag 95437

---

>emb|AL954724.9| Zebrafish DNA sequence from clone CH211-265P12, complete sequence
          Length = 136892

 Score = 50.1 bits (25), Expect = 0.010
 Identities = 70/85 (82%)
 Strand = Plus / Minus

                                                                          
Query: 526    gggaactcaattttcctgtccagtcttcctggacgcagcagagcaggatctagagtatct 585
              ||||||||||| || | ||||| ||| |||||||||||||| ||||| || || || || 
Sbjct: 105952 gggaactcaatcttacggtccaatctacctggacgcagcagggcagggtccagtgtgtca 105893

                                       
Query: 586    gcccgattggttgccattataacct 610
              ||||  ||||| ||||| |||||||
Sbjct: 105892 gccctgttggtggccatgataacct 105868

---

>gb|U15601.1|ANU15601 Aspergillus niger 26S proteasome subunit (tbpA) gene, complete cds
          Length = 2120

 Score = 50.1 bits (25), Expect = 0.010
 Identities = 55/65 (84%)
 Strand = Plus / Minus

                                                                        
Query: 631  aatccatccatctgattcagtagttccatcagaatacgctgaacttctcggtcagccccg 690
            |||||||||||||| || || || |||| |||||||||||| || || ||||| || |||
Sbjct: 1352 aatccatccatctggttgagaagctccagcagaatacgctgcacctcacggtctgcaccg 1293

                 
Query: 691  gtctg 695
            |||||
Sbjct: 1292 gtctg 1288

---

>gb|BC073644.1| Xenopus laevis similar to proteasome 26S ATPase subunit 6, mRNA
           (cDNA clone IMAGE:5515801), partial cds
          Length = 1552

 Score = 48.1 bits (24), Expect = 0.039
 Identities = 51/60 (85%)
 Strand = Plus / Minus

                                                                       
Query: 627 atcaaatccatccatctgattcagtagttccatcagaatacgctgaacttctcggtcagc 686
           |||||||||||||||||| ||||| |  ||||| ||| | | ||||| ||||||||||||
Sbjct: 814 atcaaatccatccatctggttcagcaactccattagagttctctgaatttctcggtcagc 755

---

>gb|DQ440313.1| Aedes aegypti clone AET-397 26S proteasome regulatory chain 4 mRNA,
           complete cds
          Length = 1317

 Score = 48.1 bits (24), Expect = 0.039
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                       
Query: 589 cgattggttgccattataaccttcacat 616
           |||||||||||||| |||||||||||||
Sbjct: 992 cgattggttgccataataaccttcacat 965

---

>ref|XM_655416.1| Aspergillus nidulans FGSC A4 26S protease regulatory subunit 6B
           (AN2904.2), mRNA
          Length = 1293

 Score = 48.1 bits (24), Expect = 0.039
 Identities = 84/104 (80%)
 Strand = Plus / Minus

                                                                       
Query: 571 ggatctagagtatctgcccgattggttgccattataaccttcacattcactgtctgatca 630
           ||||| || |||||||| || || || ||||| || |||||||||||    ||||| || 
Sbjct: 983 ggatccagggtatctgctcggttagtggccatgatgaccttcacattgctagtctgctcg 924

                                                       
Query: 631 aatccatccatctgattcagtagttccatcagaatacgctgaac 674
           || || |||||||| ||||| |||||||  ||||||||||||||
Sbjct: 923 aaaccgtccatctggttcagaagttccaggagaatacgctgaac 880

---

>gb|BC045087.1| Xenopus laevis similar to proteasome 26S ATPase subunit 6, mRNA
           (cDNA clone IMAGE:5542937), partial cds
          Length = 1585

 Score = 48.1 bits (24), Expect = 0.039
 Identities = 51/60 (85%)
 Strand = Plus / Minus

                                                                       
Query: 627 atcaaatccatccatctgattcagtagttccatcagaatacgctgaacttctcggtcagc 686
           |||||||||||||||||| ||||| |  ||||| ||| | | ||||| ||||||||||||
Sbjct: 847 atcaaatccatccatctggttcagcaactccattagagttctctgaatttctcggtcagc 788

---

>gb|AF475102.1| Triticum aestivum tat binding protein mRNA, partial cds
          Length = 564

 Score = 48.1 bits (24), Expect = 0.039
 Identities = 63/76 (82%)
 Strand = Plus / Minus

                                                                       
Query: 524 gagggaactcaattttcctgtccagtcttcctggacgcagcagagcaggatctagagtat 583
           ||||||||||||| || |||||||| |  || | ||| || | ||||||||| ||| |||
Sbjct: 484 gagggaactcaatctttctgtccaggcgaccagaacggagtaaagcaggatcgagaatat 425

                           
Query: 584 ctgcccgattggttgc 599
           |||| |||||||||||
Sbjct: 424 ctgcacgattggttgc 409

---

>gb|AE016819.2| Ashbya gossypii (= Eremothecium gossypii) ATCC 10895 chromosome VI,
               complete sequence
          Length = 1813164

 Score = 48.1 bits (24), Expect = 0.039
 Identities = 121/148 (81%), Gaps = 4/148 (2%)
 Strand = Plus / Minus

                                                                           
Query: 526     gggaactcaattttcctgtccagtcttcctggacgcagcagagcaggatctagagtatc- 584
               |||||||||||||||||||| ||||| || || | || || |||||| || || ||||| 
Sbjct: 1145024 gggaactcaattttcctgtcaagtctaccaggtctcaacaaagcagggtccagcgtatca 1144965

                                                                           
Query: 585     tgcccgattggttgccattataaccttcacattcactg-tctgatcaaatccatccatct 643
               || | | ||||||||||| ||||| || ||||| | || |||||||||| |||||||| |
Sbjct: 1144964 tgtctg-ttggttgccatgataactttgacatt-agtgctctgatcaaagccatccattt 1144907

                                           
Query: 644     gattcagtagttccatcagaatacgctg 671
               |  | ||||| || ||||||||||||||
Sbjct: 1144906 gtgttagtagctcgatcagaatacgctg 1144879

---

>ref|NM_211296.1| Eremothecium gossypii AFR394Wp (AFR394W), mRNA
          Length = 1419

 Score = 48.1 bits (24), Expect = 0.039
 Identities = 121/148 (81%), Gaps = 4/148 (2%)
 Strand = Plus / Minus

                                                                        
Query: 526  gggaactcaattttcctgtccagtcttcctggacgcagcagagcaggatctagagtatc- 584
            |||||||||||||||||||| ||||| || || | || || |||||| || || ||||| 
Sbjct: 1139 gggaactcaattttcctgtcaagtctaccaggtctcaacaaagcagggtccagcgtatca 1080

                                                                        
Query: 585  tgcccgattggttgccattataaccttcacattcactg-tctgatcaaatccatccatct 643
            || | | ||||||||||| ||||| || ||||| | || |||||||||| |||||||| |
Sbjct: 1079 tgtctg-ttggttgccatgataactttgacatt-agtgctctgatcaaagccatccattt 1022

                                        
Query: 644  gattcagtagttccatcagaatacgctg 671
            |  | ||||| || ||||||||||||||
Sbjct: 1021 gtgttagtagctcgatcagaatacgctg 994

---

>ref|XM_643629.1| Entamoeba histolytica HM-1:IMSS 26s proteasome subunit P45 family
            protein (402.t00003) partial mRNA
          Length = 1170

 Score = 46.1 bits (23), Expect = 0.16
 Identities = 50/59 (84%)
 Strand = Plus / Minus

                                                                       
Query: 370  gcatgcatgccagcttcctggcaaatagcagtgatatcagcagcactgattttatcagg 428
            |||||||| |||||||| || ||||||| ||  || || ||| ||||||||||||||||
Sbjct: 1070 gcatgcataccagcttcttgacaaatagaagctatttctgcaccactgattttatcagg 1012

---

>emb|AL590447.1|CNS07EGE chromosome VII of strain GB-M1 of Encephalitozoon cuniculi (Microspora)
          Length = 226576

 Score = 46.1 bits (23), Expect = 0.16
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                                
Query: 541   ctgtccagtcttcctggacgcagcagagcaggatc 575
             |||||||||||||||||||| || || ||||||||
Sbjct: 25103 ctgtccagtcttcctggacgtagaagcgcaggatc 25137

---

>emb|AJ719962.1| Gallus gallus mRNA for hypothetical protein, clone 8n6
          Length = 1570

 Score = 46.1 bits (23), Expect = 0.16
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 627 atcaaatccatccatctgattca 649
           |||||||||||||||||||||||
Sbjct: 822 atcaaatccatccatctgattca 800

---

>ref|NM_001006494.1| Gallus gallus proteasome (prosome, macropain) 26S subunit, ATPase,
           6 (PSMC6), mRNA
          Length = 1570

 Score = 46.1 bits (23), Expect = 0.16
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 627 atcaaatccatccatctgattca 649
           |||||||||||||||||||||||
Sbjct: 822 atcaaatccatccatctgattca 800

---

>emb|CR386272.1| Gallus gallus finished cDNA, clone ChEST60c2
          Length = 1546

 Score = 46.1 bits (23), Expect = 0.16
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 627 atcaaatccatccatctgattca 649
           |||||||||||||||||||||||
Sbjct: 813 atcaaatccatccatctgattca 791

---

>gb|AY609898.1| Sus scrofa clone Clu_40992.scr.msk.p1.Contig1, mRNA sequence
          Length = 1412

 Score = 46.1 bits (23), Expect = 0.16
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 436  acataatcttccaaatcaacctc 458
            |||||||||||||||||||||||
Sbjct: 1131 acataatcttccaaatcaacctc 1109

---

>emb|AL590449.1|CNS07EGG chromosome X of strain GB-M1 of Encephalitozoon cuniculi (Microspora)
          Length = 262797

 Score = 46.1 bits (23), Expect = 0.16
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                                 
Query: 520    ggcagagggaactcaattttcctgtccagtcttcc 554
              ||||||||||||||||| |||||||| || |||||
Sbjct: 201203 ggcagagggaactcaatcttcctgtcgagccttcc 201237

---

>ref|XM_637738.1| Dictyostelium discoideum hypothetical protein (DDB0168337), partial
           mRNA
          Length = 1287

 Score = 44.1 bits (22), Expect = 0.61
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                             
Query: 553 cctggacgcagcagagcaggatctagagtatctgcccgattggttgccat 602
           |||||||| || ||||| ||||| | ||||||||  ||||||||||||||
Sbjct: 989 cctggacgaagaagagctggatccaaagtatctggacgattggttgccat 940

---

>ref|XM_509208.1| PREDICTED: Pan troglodytes similar to conserved ATPase domain
           protein 44 (LOC452063), mRNA
          Length = 927

 Score = 44.1 bits (22), Expect = 0.61
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 627 atcaaatccatccatctgattcagta 652
           ||||||||||||||| ||||||||||
Sbjct: 747 atcaaatccatccatttgattcagta 722

---

>ref|XM_519765.1| PREDICTED: Pan troglodytes similar to conserved ATPase domain
           protein 44 (LOC464183), mRNA
          Length = 1458

 Score = 44.1 bits (22), Expect = 0.61
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 549 tcttcctggacgcagcagagcaggatctagagtatctg 586
           ||||||||||| ||||| ||||||||| || |||||||
Sbjct: 828 tcttcctggacacagcaaagcaggatccagtgtatctg 791



 Score = 44.1 bits (22), Expect = 0.61
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 627 atcaaatccatccatctgattcagta 652
           ||||||||||||||| ||||||||||
Sbjct: 750 atcaaatccatccatttgattcagta 725

---

>gb|AY348237.1| Drosophila insignita RPT4 (Rpt4) gene, partial cds
          Length = 458

 Score = 44.1 bits (22), Expect = 0.61
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                             
Query: 553 cctggacgcagcagagcaggatctagagtatctgcccgattggttgccat 602
           ||||||||||  || ||||| |||||||| ||||  ||||||||||||||
Sbjct: 237 cctggacgcaatagggcagggtctagagtgtctggacgattggttgccat 188

---

>gb|AY348236.1| Drosophila bipolita RPT4 (Rpt4) gene, partial cds
          Length = 458

 Score = 44.1 bits (22), Expect = 0.61
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                             
Query: 553 cctggacgcagcagagcaggatctagagtatctgcccgattggttgccat 602
           ||||||||||  || ||||| |||||||| ||||  ||||||||||||||
Sbjct: 227 cctggacgcaatagggcagggtctagagtgtctggacgattggttgccat 178

---

>gb|AY348235.1| Drosophila canipolita RPT4 (Rpt4) gene, partial cds
          Length = 466

 Score = 44.1 bits (22), Expect = 0.61
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                             
Query: 553 cctggacgcagcagagcaggatctagagtatctgcccgattggttgccat 602
           ||||||||||  || ||||| |||||||| ||||  ||||||||||||||
Sbjct: 234 cctggacgcaatagggcagggtctagagtgtctggacgattggttgccat 185

---

>gb|AF165146.6| Homo sapiens chromosome 8 clone CTA-397H3 map q12.1, complete sequence
          Length = 110554

 Score = 44.1 bits (22), Expect = 0.61
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 627   atcaaatccatccatctgattcagta 652
             ||||||||||||||| ||||||||||
Sbjct: 20845 atcaaatccatccatttgattcagta 20870



 Score = 44.1 bits (22), Expect = 0.61
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                   
Query: 549   tcttcctggacgcagcagagcaggatctagagtatctg 586
             ||||||||||| ||||| ||||||||| || |||||||
Sbjct: 20767 tcttcctggacacagcaaagcaggatccagtgtatctg 20804

---

>ref|XM_535701.2| PREDICTED: Canis familiaris similar to proteasome 26S ATPase
           subunit 6 (LOC478522), mRNA
          Length = 1893

 Score = 44.1 bits (22), Expect = 0.61
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 549 tcttcctggacgcagcagagcaggatctagagtatctg 586
           |||||||||||| |||| ||||||||| || |||||||
Sbjct: 924 tcttcctggacgaagcaaagcaggatccagtgtatctg 887

---

>ref|XM_758573.1| Theileria parva strain Muguga chromosome 4 26S proteasome
           aaa-ATPase subunit Rpt3 (TP04_0031) partial mRNA
          Length = 1191

 Score = 44.1 bits (22), Expect = 0.61
 Identities = 31/34 (91%)
 Strand = Plus / Minus

                                             
Query: 625 tgatcaaatccatccatctgattcagtagttcca 658
           ||||||||||||||||| || ||||| |||||||
Sbjct: 833 tgatcaaatccatccatttggttcagaagttcca 800

---

>emb|BX067090.1|CNS09NXI Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC50CE06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1015

 Score = 44.1 bits (22), Expect = 0.61
 Identities = 70/86 (81%)
 Strand = Plus / Minus

                                                                       
Query: 556 ggacgcagcagagcaggatctagagtatctgcccgattggttgccattataaccttcaca 615
           ||||||||||| || ||||| || ||||| ||||| || || ||||| || |||||||| 
Sbjct: 981 ggacgcagcagggccggatcgagcgtatcggcccggttagtggccatgatcaccttcacg 922

                                     
Query: 616 ttcactgtctgatcaaatccatccat 641
           |||   |||||||| || ||||||||
Sbjct: 921 ttcgtcgtctgatcgaacccatccat 896

---

>emb|Z38135.1|MSDBATPMR M.sexta mRNA for DEAD-box ATPase
          Length = 1341

 Score = 44.1 bits (22), Expect = 0.61
 Identities = 97/122 (79%)
 Strand = Plus / Minus

                                                                        
Query: 523  agagggaactcaattttcctgtccagtcttcctggacgcagcagagcaggatctagagta 582
            |||||||||||||||||||| ||||  | ||| || |  || ||||| |||||||  |||
Sbjct: 1027 agagggaactcaattttcctatccaaacgtccaggtctaagtagagcgggatctaaggta 968

                                                                        
Query: 583  tctgcccgattggttgccattataaccttcacattcactgtctgatcaaatccatccatc 642
            || || ||||| || ||||| || || || |||||   ||| |||||||| |||||||||
Sbjct: 967  tcagcacgatttgtggccataattactttaacattggttgtttgatcaaagccatccatc 908

              
Query: 643  tg 644
            ||
Sbjct: 907  tg 906

---

>gb|AC046176.13| Homo sapiens chromosome 8, clone RP11-446E9, complete sequence
          Length = 184349

 Score = 44.1 bits (22), Expect = 0.61
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                  
Query: 549  tcttcctggacgcagcagagcaggatctagagtatctg 586
            ||||||||||| ||||| ||||||||| || |||||||
Sbjct: 4320 tcttcctggacacagcaaagcaggatccagtgtatctg 4283



 Score = 44.1 bits (22), Expect = 0.61
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                      
Query: 627  atcaaatccatccatctgattcagta 652
            ||||||||||||||| ||||||||||
Sbjct: 4242 atcaaatccatccatttgattcagta 4217

---

>gb|AC091671.28| Papio anubis clone rp41-192i11, complete sequence
          Length = 173021

 Score = 44.1 bits (22), Expect = 0.61
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                        
Query: 627    atcaaatccatccatctgattcagta 652
              ||||||||||||||| ||||||||||
Sbjct: 104682 atcaaatccatccatttgattcagta 104707



 Score = 44.1 bits (22), Expect = 0.61
 Identities = 31/34 (91%)
 Strand = Plus / Plus

                                                
Query: 553    cctggacgcagcagagcaggatctagagtatctg 586
              ||||||||||||| ||||||||| || |||||||
Sbjct: 104608 cctggacgcagcaaagcaggatccagtgtatctg 104641

---

>gb|AC107376.7| Homo sapiens chromosome 8, clone CTA-397H3, complete sequence
          Length = 110554

 Score = 44.1 bits (22), Expect = 0.61
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 627   atcaaatccatccatctgattcagta 652
             ||||||||||||||| ||||||||||
Sbjct: 20846 atcaaatccatccatttgattcagta 20871



 Score = 44.1 bits (22), Expect = 0.61
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                   
Query: 549   tcttcctggacgcagcagagcaggatctagagtatctg 586
             ||||||||||| ||||| ||||||||| || |||||||
Sbjct: 20768 tcttcctggacacagcaaagcaggatccagtgtatctg 20805

---

>gb|BC102595.1| Bos taurus proteasome (prosome, macropain) 26S subunit, ATPase, 4,
           mRNA (cDNA clone MGC:127979 IMAGE:7961736), complete cds
          Length = 1498

 Score = 44.1 bits (22), Expect = 0.61
 Identities = 58/70 (82%)
 Strand = Plus / Minus

                                                                       
Query: 631 aatccatccatctgattcagtagttccatcagaatacgctgaacttctcggtcagccccg 690
           ||||||||||| ||||||||||| ||||  || || | |||||| || | ||||||||| 
Sbjct: 938 aatccatccatttgattcagtagctccagtaggattctctgaacctccctgtcagcccct 879

                     
Query: 691 gtctgagcat 700
           ||||| ||||
Sbjct: 878 gtctgggcat 869

---

>gb|AC008971.6| Homo sapiens chromosome 5 clone CTD-2376B17, complete sequence
          Length = 131856

 Score = 44.1 bits (22), Expect = 0.61
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 627   atcaaatccatccatctgattcagta 652
             ||||||||||||||| ||||||||||
Sbjct: 23345 atcaaatccatccatttgattcagta 23370

---

>gb|AC008954.6|AC008954 Homo sapiens chromosome 5 clone CTD-2340N2, complete sequence
          Length = 90111

 Score = 44.1 bits (22), Expect = 0.61
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 627   atcaaatccatccatctgattcagta 652
             ||||||||||||||| ||||||||||
Sbjct: 58861 atcaaatccatccatttgattcagta 58886

---

>ref|NG_002379.1| Homo sapiens proteasome (prosome, macropain) 26S subunit, ATPase, 6
           pseudogene (PSMC6P) on chromosome 8
          Length = 1736

 Score = 44.1 bits (22), Expect = 0.61
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 549 tcttcctggacgcagcagagcaggatctagagtatctg 586
           ||||||||||| ||||| ||||||||| || |||||||
Sbjct: 991 tcttcctggacacagcaaagcaggatccagtgtatctg 954



 Score = 44.1 bits (22), Expect = 0.61
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 627 atcaaatccatccatctgattcagta 652
           ||||||||||||||| ||||||||||
Sbjct: 913 atcaaatccatccatttgattcagta 888

---

>ref|NG_001564.1| Homo sapiens proteasome (prosome, macropain) 26S subunit, ATPase, 6
           pseudogene (LOC160410) on chromosome 12
          Length = 1181

 Score = 44.1 bits (22), Expect = 0.61
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 627 atcaaatccatccatctgattcagta 652
           ||||||||||||||| ||||||||||
Sbjct: 901 atcaaatccatccatttgattcagta 876

---

>gb|AC139783.3| Homo sapiens chromosome 5 clone RP11-1084J3, complete sequence
          Length = 189108

 Score = 44.1 bits (22), Expect = 0.61
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 627   atcaaatccatccatctgattcagta 652
             ||||||||||||||| ||||||||||
Sbjct: 82123 atcaaatccatccatttgattcagta 82098

---

>gb|AC008033.9| Homo sapiens 12 BAC RP11-81H14 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 149136

 Score = 44.1 bits (22), Expect = 0.61
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 627   atcaaatccatccatctgattcagta 652
             ||||||||||||||| ||||||||||
Sbjct: 54379 atcaaatccatccatttgattcagta 54404

---

>gb|AC116987.2| Dictyostelium discoideum chromosome 2 map 3527441-3568052 strain AX4,
             complete sequence
          Length = 40611

 Score = 44.1 bits (22), Expect = 0.61
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                               
Query: 553   cctggacgcagcagagcaggatctagagtatctgcccgattggttgccat 602
             |||||||| || ||||| ||||| | ||||||||  ||||||||||||||
Sbjct: 39082 cctggacgaagaagagctggatccaaagtatctggacgattggttgccat 39033

---

>gb|AY609771.1| Sus scrofa clone Clu_3050.scr.msk.p1.Contig3, mRNA sequence
          Length = 2107

 Score = 44.1 bits (22), Expect = 0.61
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                  
Query: 549  tcttcctggacgcagcagagcaggatctagagtatctg 586
            |||||||||||| |||| ||||||||| || |||||||
Sbjct: 1422 tcttcctggacgaagcaaagcaggatccagtgtatctg 1385

---

>gb|U36395.1|STU36395 Spermophilus tridecemlineatus 26S Proteasome S.U. CADp44 - a
           conserved  ATPase domain protein of 44kDa (CADp44) gene,
           complete cds
          Length = 1566

 Score = 44.1 bits (22), Expect = 0.61
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 627 atcaaatccatccatctgattcagta 652
           ||||||||||||||| ||||||||||
Sbjct: 813 atcaaatccatccatttgattcagta 788

---

>ref|NM_001035083.1| Bos taurus proteasome (prosome, macropain) 26S subunit, ATPase, 4
           (PSMC4), mRNA
          Length = 1498

 Score = 44.1 bits (22), Expect = 0.61
 Identities = 58/70 (82%)
 Strand = Plus / Minus

                                                                       
Query: 631 aatccatccatctgattcagtagttccatcagaatacgctgaacttctcggtcagccccg 690
           ||||||||||| ||||||||||| ||||  || || | |||||| || | ||||||||| 
Sbjct: 938 aatccatccatttgattcagtagctccagtaggattctctgaacctccctgtcagcccct 879

                     
Query: 691 gtctgagcat 700
           ||||| ||||
Sbjct: 878 gtctgggcat 869

---

>gb|DQ222507.1| Solanum tuberosum clone 115D06 26S proteasome subunit 4-like mRNA,
            complete cds
          Length = 1581

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 45/53 (84%)
 Strand = Plus / Minus

                                                                 
Query: 523  agagggaactcaattttcctgtccagtcttcctggacgcagcagagcaggatc 575
            |||||||||||||| |||||||| | ||| || || ||||| || ||||||||
Sbjct: 1113 agagggaactcaatcttcctgtctattctaccaggtcgcagtagggcaggatc 1061

---

>gb|CP000069.1| Trypanosoma brucei chromosome 6, complete sequence
          Length = 1618915

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 45/53 (84%)
 Strand = Plus / Plus

                                                                   
Query: 589    cgattggttgccattataaccttcacattcactgtctgatcaaatccatccat 641
              |||||||| ||||| ||||| ||||| ||   |||||||||||| ||||||||
Sbjct: 430310 cgattggtcgccatgataactttcacgttagttgtctgatcaaaaccatccat 430362

---

>gb|AC073906.6| Trypanosoma brucei chromosome 6 clone RPCI93-3A7, complete sequence
          Length = 175357

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 45/53 (84%)
 Strand = Plus / Plus

                                                                  
Query: 589   cgattggttgccattataaccttcacattcactgtctgatcaaatccatccat 641
             |||||||| ||||| ||||| ||||| ||   |||||||||||| ||||||||
Sbjct: 82126 cgattggtcgccatgataactttcacgttagttgtctgatcaaaaccatccat 82178

---

>gb|AY915912.1| Schistosoma japonicum Tat binding protein 7, TBP-7 mRNA, complete
           cds
          Length = 592

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 571 ggatctagagtatctgcccgattggttgccattataacctt 611
           ||||||||||| || || |||||||| ||||| ||||||||
Sbjct: 44  ggatctagagtgtcagcacgattggtagccatgataacctt 4

---

>ref|XM_821194.1| Trypanosoma brucei TREU927 clone RPCI93-3A7 proteasome regulatory
           ATPase subunit 3 (Tb927.6.1090) partial mRNA
          Length = 1212

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 45/53 (84%)
 Strand = Plus / Minus

                                                                
Query: 589 cgattggttgccattataaccttcacattcactgtctgatcaaatccatccat 641
           |||||||| ||||| ||||| ||||| ||   |||||||||||| ||||||||
Sbjct: 890 cgattggtcgccatgataactttcacgttagttgtctgatcaaaaccatccat 838

---

>emb|BX067091.1|CNS09NXJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC50CE06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 832

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 72/89 (80%)
 Strand = Plus / Plus

                                                                       
Query: 556 ggacgcagcagagcaggatctagagtatctgcccgattggttgccattataaccttcaca 615
           ||||||||||| || ||||| || ||||| ||||| || || ||||| || |||||||| 
Sbjct: 402 ggacgcagcagggccggatcgagcgtatcggcccggttagtggccatgatcaccttcacg 461

                                        
Query: 616 ttcactgtctgatcaaatccatccatctg 644
           |||   |||||| | || |||||||||||
Sbjct: 462 ttcgtcgtctgaacgaacccatccatctg 490



 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 318 gtaacccttctcgaagtcctt 338
           |||||||||||||||||||||
Sbjct: 165 gtaacccttctcgaagtcctt 185

---

>emb|BX057192.1|CNS09GAK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC37AB06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 379

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 318 gtaacccttctcgaagtcctt 338
           |||||||||||||||||||||
Sbjct: 178 gtaacccttctcgaagtcctt 198

---

>emb|BX048935.1|CNS099X7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC24BG11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 153

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 318 gtaacccttctcgaagtcctt 338
           |||||||||||||||||||||
Sbjct: 117 gtaacccttctcgaagtcctt 137

---

>emb|BX047011.1|CNS098FR Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC20DH12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 127

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 318 gtaacccttctcgaagtcctt 338
           |||||||||||||||||||||
Sbjct: 92  gtaacccttctcgaagtcctt 112

---

>emb|BX030223.1|CNS08VHF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA45AE10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 138

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 318 gtaacccttctcgaagtcctt 338
           |||||||||||||||||||||
Sbjct: 114 gtaacccttctcgaagtcctt 134

---

>emb|AL049728.1|SPCC306 S.pombe chromosome III cosmid c306
          Length = 25465

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 45/53 (84%)
 Strand = Plus / Minus

                                                                
Query: 634 ccatccatctgattcagtagttccatcagaatacgctgaacttctcggtcagc 686
           |||||||||||||||| || ||||||||   ||||||||| ||| || |||||
Sbjct: 181 ccatccatctgattcaataattccatcaatgtacgctgaatttcacgatcagc 129

---

>gb|AC103559.2| Homo sapiens chromosome 3 clone RP11-286L5, complete sequence
          Length = 184133

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 595   gttgccattataaccttcaca 615
             |||||||||||||||||||||
Sbjct: 79977 gttgccattataaccttcaca 79957

---

>gb|AC159893.2| Mus musculus BAC clone RP23-365N23 from chromosome 9, complete
            sequence
          Length = 196765

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                     
Query: 111  acagacaagtagcttaacaaggatg 135
            |||||||| ||||||||||||||||
Sbjct: 6261 acagacaattagcttaacaaggatg 6285

---

>gb|AC098481.2| Homo sapiens chromosome 3 clone RP11-349E16, complete sequence
          Length = 227137

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 595    gttgccattataaccttcaca 615
              |||||||||||||||||||||
Sbjct: 203731 gttgccattataaccttcaca 203711

---

>gb|AC087269.5| Homo sapiens chromosome 8, clone RP11-211C9, complete sequence
          Length = 187924

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 453    aacctcatcactcaagttcat 473
              |||||||||||||||||||||
Sbjct: 159050 aacctcatcactcaagttcat 159070

---

>gb|AF227501.1| Trypanosoma brucei proteasome regulatory ATPase subunit 3 (Rpt3)
            gene, complete cds
          Length = 1789

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 45/53 (84%)
 Strand = Plus / Minus

                                                                 
Query: 589  cgattggttgccattataaccttcacattcactgtctgatcaaatccatccat 641
            |||||||| ||||| ||||| ||||| ||   |||||||||||| ||||||||
Sbjct: 1283 cgattggtcgccatgataactttcacgttagttgtctgatcaaaaccatccat 1231

---

>ref|NM_001022802.1| Schizosaccharomyces pombe 972h- 19S proteasome regulatory subunit
           (SPCC1682.16), partial mRNA
          Length = 1167

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 45/53 (84%)
 Strand = Plus / Minus

                                                                
Query: 634 ccatccatctgattcagtagttccatcagaatacgctgaacttctcggtcagc 686
           |||||||||||||||| || ||||||||   ||||||||| ||| || |||||
Sbjct: 794 ccatccatctgattcaataattccatcaatgtacgctgaatttcacgatcagc 742

---

>gb|AC154832.2| Mus musculus BAC clone RP24-568D4 from chromosome 14, complete sequence
          Length = 134900

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 234   gtagaaaataaagcatcctct 254
             |||||||||||||||||||||
Sbjct: 99844 gtagaaaataaagcatcctct 99864

---

>emb|BX936454.25| Zebrafish DNA sequence from clone DKEY-29M11 in linkage group 20,
              complete sequence
          Length = 225683

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 57/69 (82%)
 Strand = Plus / Minus

                                                                          
Query: 534    aattttcctgtccagtcttcctggacgcagcagagcaggatctagagtatctgcccgatt 593
              |||||| | |||||| | ||| ||||||||||| |||||||||| ||| || | ||| ||
Sbjct: 111470 aatttttcggtccagacgtccaggacgcagcagggcaggatctaaagtgtcaggccggtt 111411

                       
Query: 594    ggttgccat 602
              ||| |||||
Sbjct: 111410 ggtggccat 111402



 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 631    aatccatccatctgattcag 650
              ||||||||||||||||||||
Sbjct: 111373 aatccatccatctgattcag 111354

---

>gb|AC174644.2| Mus musculus BAC clone RP23-432C18 from chromosome 9, complete sequence
          Length = 199707

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 111   acagacaagtagcttaacaaggatg 135
             |||||||| ||||||||||||||||
Sbjct: 58112 acagacaattagcttaacaaggatg 58136

---

>gb|AY609476.1| Sus scrofa clone Clu_12870.scr.msk.p1.Contig3, mRNA sequence
          Length = 1571

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                         
Query: 529  aactcaattttcctgtccagtcttcctgg 557
            |||||||| |||||||||||||| |||||
Sbjct: 1099 aactcaatcttcctgtccagtctccctgg 1071

---

>gb|AC158981.2| Mus musculus BAC clone RP23-230C10 from chromosome 14, complete
             sequence
          Length = 213277

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 84    agagaaactttaggaagaaggaatt 108
             |||| ||||||||||||||||||||
Sbjct: 21303 agagcaactttaggaagaaggaatt 21327

---

>ref|NM_111819.3| Arabidopsis thaliana CDC48 (CELL DIVISION CYCLE 48); ATP binding /
            ATPase/ hydrolase/ nucleoside-triphosphatase/ nucleotide
            binding AT3G09840 (CDC48) mRNA, complete cds
          Length = 2797

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                            
Query: 387  ctggcaaatagcagtgatatcagcagcactga 418
            |||||||||  |||||||||||||| ||||||
Sbjct: 2242 ctggcaaatctcagtgatatcagcaccactga 2211

---

>ref|NM_103934.3| Arabidopsis thaliana unknown protein AT1G50510 mRNA, complete cds
          Length = 1363

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 393 aatagcagtgatatcagcag 412
           ||||||||||||||||||||
Sbjct: 630 aatagcagtgatatcagcag 649

---

>ref|NM_179641.1| Arabidopsis thaliana ATP binding / ATPase/ nucleoside-triphosphatase/
            nucleotide binding AT2G18193 mRNA, complete cds
          Length = 1697

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                            
Query: 544  tccagtcttcctggacgcagcagagcaggatc 575
            |||| |||||| ||||| ||||||||||||||
Sbjct: 1199 tccattcttccaggacgtagcagagcaggatc 1168

---

>ref|XM_520776.1| PREDICTED: Pan troglodytes similar to protease (prosome, macropain)
           26S subunit, ATPase 1 (LOC465322), mRNA
          Length = 711

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 627 atcaaatccatccatctgattcagtagttcca 658
           |||||||||||||| ||| ||||| |||||||
Sbjct: 348 atcaaatccatccaactggttcagcagttcca 317

---

>ref|XM_510114.1| PREDICTED: Pan troglodytes similar to protease (prosome, macropain)
            26S subunit, ATPase 1 (LOC453097), mRNA
          Length = 3270

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                            
Query: 627  atcaaatccatccatctgattcagtagttcca 658
            |||||||||||||| ||| ||||| |||||||
Sbjct: 2736 atcaaatccatccaactggttcagcagttcca 2705

---

>ref|XM_464508.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1693

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 627 atcaaatccatccatctgattcagtagttccatcag 662
           |||||||||||| | |||||| || |||||||||||
Sbjct: 902 atcaaatccatctaactgatttagcagttccatcag 867

---

>gb|BC061627.1| Xenopus tropicalis 26S protease regulatory subunit 7, mRNA (cDNA
            clone MGC:76296 IMAGE:5379538), complete cds
          Length = 1418

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 38/44 (86%)
 Strand = Plus / Minus

                                                        
Query: 532  tcaattttcctgtccagtcttcctggacgcagcagagcaggatc 575
            |||||||| |||||||||||||| || | ||  |||||||||||
Sbjct: 1039 tcaatttttctgtccagtcttccaggtctcataagagcaggatc 996

---

>gb|BC073818.1| Homo sapiens proteasome (prosome, macropain) 26S subunit, ATPase,
           1, mRNA (cDNA clone MGC:88853 IMAGE:5456334), complete
           cds
          Length = 1565

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 627 atcaaatccatccatctgattcagtagttcca 658
           |||||||||||||| ||| ||||| |||||||
Sbjct: 966 atcaaatccatccaactggttcagcagttcca 935

---

>gb|BC016368.1| Homo sapiens proteasome (prosome, macropain) 26S subunit, ATPase,
           1, mRNA (cDNA clone MGC:24583 IMAGE:4133348), complete
           cds
          Length = 1590

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 627 atcaaatccatccatctgattcagtagttcca 658
           |||||||||||||| ||| ||||| |||||||
Sbjct: 988 atcaaatccatccaactggttcagcagttcca 957

---

>gb|BC000512.2| Homo sapiens proteasome (prosome, macropain) 26S subunit, ATPase,
           1, mRNA (cDNA clone MGC:8541 IMAGE:2822718), complete
           cds
          Length = 1604

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 627 atcaaatccatccatctgattcagtagttcca 658
           |||||||||||||| ||| ||||| |||||||
Sbjct: 994 atcaaatccatccaactggttcagcagttcca 963

---

>gb|DQ440423.1| Aedes aegypti clone AET-5666 26S proteasome regulatory complex
           ATPase RPT4 mRNA, complete cds
          Length = 1182

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 56/68 (82%)
 Strand = Plus / Minus

                                                                       
Query: 535 attttcctgtccagtcttcctggacgcagcagagcaggatctagagtatctgcccgattg 594
           |||||||| ||||  | ||| |||||||||||||| ||||| |  ||||| | |||||||
Sbjct: 908 attttcctatccaaacgtccaggacgcagcagagcgggatccaacgtatccggccgattg 849

                   
Query: 595 gttgccat 602
           || |||||
Sbjct: 848 gtggccat 841

---

>gb|BC054143.1| Xenopus laevis xMSS1 protein, mRNA (cDNA clone MGC:64244
            IMAGE:6872349), complete cds
          Length = 1492

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 38/44 (86%)
 Strand = Plus / Minus

                                                        
Query: 532  tcaattttcctgtccagtcttcctggacgcagcagagcaggatc 575
            |||||||| |||||||||||||| || | ||  |||||||||||
Sbjct: 1103 tcaatttttctgtccagtcttccaggcctcataagagcaggatc 1060

---

>gb|AC015985.10|ATAC015985 Arabidopsis thaliana chromosome III BAC F8A24 genomic sequence,
             complete sequence
          Length = 72902

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                             
Query: 387   ctggcaaatagcagtgatatcagcagcactga 418
             |||||||||  |||||||||||||| ||||||
Sbjct: 44321 ctggcaaatctcagtgatatcagcaccactga 44352

---

>gb|AC114549.9| Mus musculus chromosome 19, clone RP24-216P17, complete sequence
          Length = 200425

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 609    cttcacattcactgtctgatcaaa 632
              ||||||||||||||||| ||||||
Sbjct: 154671 cttcacattcactgtctaatcaaa 154648

---

>gb|BC021001.1| Homo sapiens cDNA clone IMAGE:3839998, **** WARNING: chimeric clone
            ****
          Length = 2938

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                            
Query: 627  atcaaatccatccatctgattcagtagttcca 658
            |||||||||||||| ||| ||||| |||||||
Sbjct: 1615 atcaaatccatccaactggttcagcagttcca 1646

---

>ref|NM_002802.2| Homo sapiens proteasome (prosome, macropain) 26S subunit, ATPase, 1
            (PSMC1), mRNA
          Length = 1586

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                            
Query: 627  atcaaatccatccatctgattcagtagttcca 658
            |||||||||||||| ||| ||||| |||||||
Sbjct: 1008 atcaaatccatccaactggttcagcagttcca 977

---

>gb|BT009826.1| Homo sapiens proteasome (prosome, macropain) 26S subunit, ATPase, 1
           mRNA, complete cds
          Length = 1323

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 627 atcaaatccatccatctgattcagtagttcca 658
           |||||||||||||| ||| ||||| |||||||
Sbjct: 960 atcaaatccatccaactggttcagcagttcca 929

---

>ref|XM_791312.1| PREDICTED: Strongylocentrotus purpuratus similar to proteasome 26S
           ATPase subunit 6 (LOC591760), mRNA
          Length = 1176

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 628 tcaaatccatccatctgatt 647
           ||||||||||||||||||||
Sbjct: 809 tcaaatccatccatctgatt 790

---

>ref|XM_777098.1| PREDICTED: Strongylocentrotus purpuratus similar to 26S protease
           regulatory subunit 6A (TAT-binding protein 1) (TBP-1)
           (Spermatogenic cell/sperm-associated TAT-binding protein
           homolog SATA) (LOC576830), mRNA
          Length = 1164

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 525 agggaactcaattttcctgtccagtcttcctg 556
           |||||| ||||| ||||||||||| |||||||
Sbjct: 789 agggaattcaatcttcctgtccagccttcctg 758

---

>ref|XM_789501.1| PREDICTED: Strongylocentrotus purpuratus similar to 26S protease
           regulatory subunit 7 (MSS1 protein) (LOC589870), mRNA
          Length = 1239

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 538 ttcctgtccagtcttcctgg 557
           ||||||||||||||||||||
Sbjct: 956 ttcctgtccagtcttcctgg 937

---

>emb|BX842654.1| Bdellovibrio bacteriovorus complete genome, strain HD100; segment 9/11
          Length = 344249

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 610    ttcacattcactgtctgatc 629
              ||||||||||||||||||||
Sbjct: 156098 ttcacattcactgtctgatc 156117

---

>ref|NM_204011.1| Xenopus tropicalis proteasome (prosome, macropain) 26S subunit,
           ATPase, 6 (psmc6), mRNA
          Length = 1605

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 627 atcaaatccatccatctgattcag 650
           |||||| |||||||||||||||||
Sbjct: 817 atcaaacccatccatctgattcag 794

---

>gb|BC067741.1| Homo sapiens proteasome (prosome, macropain) 26S subunit, ATPase,
           1, mRNA (cDNA clone MGC:86994 IMAGE:5264945), complete
           cds
          Length = 1577

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 627 atcaaatccatccatctgattcagtagttcca 658
           |||||||||||||| ||| ||||| |||||||
Sbjct: 981 atcaaatccatccaactggttcagcagttcca 950

---

>emb|AJ223384.1|MSE223384 Manduca sexta mRNA for 26S proteasome regulatory ATPase subunit 10b
           (S10b)
          Length = 1346

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 628 tcaaatccatccatctgattcagtagttccat 659
           ||||| || ||||||||||||||||| |||||
Sbjct: 913 tcaaagccgtccatctgattcagtagctccat 882

---

>gb|AC160129.2| Mus musculus BAC clone RP23-253N17 from chromosome 9, complete sequence
          Length = 205094

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 372    atgcatgccagcttcctggc 391
              ||||||||||||||||||||
Sbjct: 100096 atgcatgccagcttcctggc 100077

---

>gb|AC091991.2| Homo sapiens chromosome 5 clone RP11-86C20, complete sequence
          Length = 170219

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 262    ttgttgcctcatttgtagaagtca 285
              ||||| ||||||||||||||||||
Sbjct: 129683 ttgtttcctcatttgtagaagtca 129660

---

>dbj|AK124201.1| Homo sapiens cDNA FLJ42207 fis, clone THYMU2036207, highly  similar
            to Mus musculus protease (prosome, macropain) 26S
            subunit, ATPase 1 (Psmc1)
          Length = 2248

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                            
Query: 627  atcaaatccatccatctgattcagtagttcca 658
            |||||||||||||| ||| ||||| |||||||
Sbjct: 1019 atcaaatccatccaactggttcagcagttcca 988

---

>emb|CR620708.1| full-length cDNA clone CS0DF001YL06 of Fetal brain of Homo sapiens
           (human)
          Length = 1362

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 627 atcaaatccatccatctgattcagtagttcca 658
           |||||||||||||| ||| ||||| |||||||
Sbjct: 883 atcaaatccatccaactggttcagcagttcca 852

---

>emb|CR614875.1| full-length cDNA clone CS0DF036YN10 of Fetal brain of Homo sapiens
           (human)
          Length = 1498

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 627 atcaaatccatccatctgattcagtagttcca 658
           |||||||||||||| ||| ||||| |||||||
Sbjct: 978 atcaaatccatccaactggttcagcagttcca 947

---

>emb|CR612999.1| full-length cDNA clone CS0DA002YA20 of Neuroblastoma of Homo
           sapiens (human)
          Length = 1544

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 627 atcaaatccatccatctgattcagtagttcca 658
           |||||||||||||| ||| ||||| |||||||
Sbjct: 980 atcaaatccatccaactggttcagcagttcca 949

---

>emb|CR607057.1| full-length cDNA clone CS0DA004YA22 of Neuroblastoma of Homo
           sapiens (human)
          Length = 1499

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 627 atcaaatccatccatctgattcagtagttcca 658
           |||||||||||||| ||| ||||| |||||||
Sbjct: 958 atcaaatccatccaactggttcagcagttcca 927

---

>emb|CR606549.1| full-length cDNA clone CS0DA010YK18 of Neuroblastoma of Homo
           sapiens (human)
          Length = 1530

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 627 atcaaatccatccatctgattcagtagttcca 658
           |||||||||||||| ||| ||||| |||||||
Sbjct: 980 atcaaatccatccaactggttcagcagttcca 949

---

>gb|AC009373.7| Drosophila melanogaster 3L BAC RP98-22B18 (Roswell Park Cancer Institute
              Drosophila BAC Library) complete sequence
          Length = 167630

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 558    acgcagcagagcaggatcta 577
              ||||||||||||||||||||
Sbjct: 105334 acgcagcagagcaggatcta 105353

---

>emb|CR603948.1| full-length cDNA clone CS0DJ011YA20 of T cells (Jurkat cell line)
           Cot 10-normalized of Homo sapiens (human)
          Length = 1485

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 627 atcaaatccatccatctgattcagtagttcca 658
           |||||||||||||| ||| ||||| |||||||
Sbjct: 958 atcaaatccatccaactggttcagcagttcca 927

---

>emb|CR601231.1| full-length cDNA clone CS0DE006YF19 of Placenta of Homo sapiens
           (human)
          Length = 1514

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 627 atcaaatccatccatctgattcagtagttcca 658
           |||||||||||||| ||| ||||| |||||||
Sbjct: 958 atcaaatccatccaactggttcagcagttcca 927

---

>emb|CR599996.1| full-length cDNA clone CS0DI024YK20 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1509

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 627 atcaaatccatccatctgattcagtagttcca 658
           |||||||||||||| ||| ||||| |||||||
Sbjct: 958 atcaaatccatccaactggttcagcagttcca 927

---

>emb|CR596533.1| full-length cDNA clone CS0DA012YH17 of Neuroblastoma of Homo
           sapiens (human)
          Length = 1531

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 627 atcaaatccatccatctgattcagtagttcca 658
           |||||||||||||| ||| ||||| |||||||
Sbjct: 958 atcaaatccatccaactggttcagcagttcca 927

---

>emb|CR592984.1| full-length cDNA clone CS0DI065YE14 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1506

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 627 atcaaatccatccatctgattcagtagttcca 658
           |||||||||||||| ||| ||||| |||||||
Sbjct: 958 atcaaatccatccaactggttcagcagttcca 927

---

>emb|CR591570.1| full-length cDNA clone CS0DE013YN23 of Placenta of Homo sapiens
           (human)
          Length = 1543

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 627 atcaaatccatccatctgattcagtagttcca 658
           |||||||||||||| ||| ||||| |||||||
Sbjct: 979 atcaaatccatccaactggttcagcagttcca 948


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 6,804,528
Number of Sequences: 3902068
Number of extensions: 6804528
Number of successful extensions: 115743
Number of sequences better than 10.0: 320
Number of HSP's better than 10.0 without gapping: 320
Number of HSP's successfully gapped in prelim test: 1
Number of HSP's that attempted gapping in prelim test: 114909
Number of HSP's gapped (non-prelim): 801
length of query: 700
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 677
effective length of database: 17,143,297,704
effective search space: 11606012545608
effective search space used: 11606012545608
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)

---