ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | rbags13j24 |
|---|---|
| Clone Library Name | barley_pub |
>gb|AF139814.1|AF139814 Triticum aestivum plasma membrane intrinsic protein 1 (PIP1) mRNA, complete cds Length = 1283 Score = 981 bits (495), Expect = 0.0 Identities = 637/678 (93%), Gaps = 16/678 (2%) Strand = Plus / Minus Query: 1 cgttgggtcgatcatacatatggtcgctaaattaaaaca------ggaaaaggaatgcgg 54 |||||| |||||||||||||||||||||||||| ||| | ||||||| ||||||| Sbjct: 1233 cgttggatcgatcatacatatggtcgctaaatttaaatacaagtaggaaaagcaatgcgg 1174 Query: 55 gctaattaagacaagcgatcccatggaccgaattacaacacacggcacgcatgactgggc 114 |||||||||||||||||||||||||||||||||||||| |||||||||||||||| || | Sbjct: 1173 gctaattaagacaagcgatcccatggaccgaattacaagacacggcacgcatgaccggac 1114 Query: 115 -acatac---gcatatgcagctgccgacacataaataacacgaccattgcagcggcc-aa 169 || ||| |||||||||||||||||||||||| ||||||||||||||| |||||| || Sbjct: 1113 cacgtactacgcatatgcagctgccgacacataa-taacacgaccattgcggcggccgaa 1055 Query: 170 ctgaactgtcgagaagttgcaaaagcggctttctctttggatggatggacacagcacagg 229 ||||||||||||||||||||||||||| ||||||| |||||||||||||||| ||| || Sbjct: 1054 ctgaactgtcgagaagttgcaaaagcgcatttctctctggatggatggacacaacacggg 995 Query: 230 tcgccattgcttcaatcttgcatgcacatcacatggat---aactcgttacgcgttgctc 286 |||||||||||||| |||||||| || || |||||||| |||| |||||||||||||| Sbjct: 994 tcgccattgcttcagtcttgcatacagatgacatggatgataacttgttacgcgttgctc 935 Query: 287 ctgaaggagccgagggccttgatggcgccggccctgagtatgtactggtggtagaaggcc 346 |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| Sbjct: 934 ctgaaggagccgagggccttgatggcgccggccctgaggatgtactggtggtagaaggcc 875 Query: 347 gcgatcgccgcgccgatcatggggccgacccagaagatccactgatcatcccaggccttg 406 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 874 gcgatcgccgcgccgatcatggggccgacccagaagatccactgatcatcccaggccttg 815 Query: 407 tccttgttgtagatgacggcggcccccaggctcctggccgggttgatgccggtgccggtg 466 |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| Sbjct: 814 tccttgttgtagatgacggcggcccccaggctccgggccgggttgatgccggtgccggtg 755 Query: 467 atcgggatggtggccaggtggaccatgaacacggcgaagccgatcgggaggggcgccaac 526 || ||||||||||||||||||||||||||||||||||||||||||||||||||||||| | Sbjct: 754 atggggatggtggccaggtggaccatgaacacggcgaagccgatcgggaggggcgccagc 695 Query: 527 accgggacgtgagagtcgcgtgcgctgcgcttggggtcggtggcggagaagacggtgtag 586 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 694 accgggacgtgagagtcgcgtgcgctgcgcttggggtcggtggcggagaagacggtgtag 635 Query: 587 acgagcacgaaggtg-ccgatgatctccgcggcgaggccggtgcccttggagtatccggc 645 ||||||||||||||| |||||||||||||| ||||||||||||||||||||||| ||||| Sbjct: 634 acgagcacgaaggtgcccgatgatctccgcagcgaggccggtgcccttggagtagccggc 575 Query: 646 ggcgagcgtgttggcgcc 663 |||||||||||||||||| Sbjct: 574 ggcgagcgtgttggcgcc 557
>gb|BT016583.1| Zea mays clone Contig416 mRNA sequence Length = 1348 Score = 507 bits (256), Expect = e-140 Identities = 355/388 (91%) Strand = Plus / Minus Query: 276 acgcgttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggt 335 |||||||||||||||||||||||||||||||||||||||| |||| ||| |||||||||| Sbjct: 924 acgcgttgctcctgaaggagccgagggccttgatggcgccagcccggaggatgtactggt 865 Query: 336 ggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactgatcat 395 |||||||||||||||| || ||||| | | |||||| |||||||||||||| || || | Sbjct: 864 ggtagaaggccgcgatggcagcgcccacgagggggcccacccagaagatccagtggtcgt 805 Query: 396 cccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttgatgc 455 |||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||| Sbjct: 804 cccagggcttgtccttgttgtagatgacggcggcgcccaggctcctggccgggttgatgc 745 Query: 456 cggtgccggtgatcgggatggtggccaggtggaccatgaacacggcgaagccgatcggga 515 |||||||||||| ||||||||||||||||| ||||||||||||||||||||||| |||| Sbjct: 744 cggtgccggtgacggggatggtggccaggtgcaccatgaacacggcgaagccgatgggga 685 Query: 516 ggggcgccaacaccgggacgtgagagtcgcgtgcgctgcgcttggggtcggtggcggaga 575 |||| |||| ||||||||||| |||||||| ||| |||||||||||||||||||||||| Sbjct: 684 ggggagccagaaccgggacgtgggagtcgcgggcgttgcgcttggggtcggtggcggaga 625 Query: 576 agacggtgtagacgagcacgaaggtgccgatgatctccgcggcgaggccggtgcccttgg 635 ||||||||||||||||||||||||||||||||||||| ||| ||||||||||||| || Sbjct: 624 agacggtgtagacgagcacgaaggtgccgatgatctcggcgccgaggccggtgccgcggg 565 Query: 636 agtatccggcggcgagcgtgttggcgcc 663 |||| |||| |||||||| ||||||||| Sbjct: 564 agtagccggaggcgagcgagttggcgcc 537
>gb|AF326491.1|AF326491 Zea mays plasma membrane integral protein ZmPIP2-1 mRNA, complete cds Length = 1171 Score = 492 bits (248), Expect = e-136 Identities = 353/388 (90%) Strand = Plus / Minus Query: 276 acgcgttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggt 335 ||||||||||||||||||||||||||||||||||||| || |||| ||| |||||||||| Sbjct: 943 acgcgttgctcctgaaggagccgagggccttgatggccccagcccggaggatgtactggt 884 Query: 336 ggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactgatcat 395 |||||||||||||||| || ||||| | | ||||| |||||||||||||| || || | Sbjct: 883 ggtagaaggccgcgatggcagcgcccacgagagggcccacccagaagatccagtggtcgt 824 Query: 396 cccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttgatgc 455 |||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||| Sbjct: 823 cccagggcttgtccttgttgtagatgacggcggcgcccaggctcctggccgggttgatgc 764 Query: 456 cggtgccggtgatcgggatggtggccaggtggaccatgaacacggcgaagccgatcggga 515 |||||||||||| ||||||||||||||||| ||||||||||||||||||||||| |||| Sbjct: 763 cggtgccggtgacggggatggtggccaggtgcaccatgaacacggcgaagccgatgggga 704 Query: 516 ggggcgccaacaccgggacgtgagagtcgcgtgcgctgcgcttggggtcggtggcggaga 575 |||| |||| ||||||||||| |||||||| ||| |||||||||||||||||||||||| Sbjct: 703 ggggagccagaaccgggacgtgggagtcgcgggcgttgcgcttggggtcggtggcggaga 644 Query: 576 agacggtgtagacgagcacgaaggtgccgatgatctccgcggcgaggccggtgcccttgg 635 ||||||||||||||||||||||||||||||||||||| ||| ||||||||||||| || Sbjct: 643 agacggtgtagacgagcacgaaggtgccgatgatctcggcgccgaggccggtgccgcggg 584 Query: 636 agtatccggcggcgagcgtgttggcgcc 663 |||| |||| |||||||| ||||||||| Sbjct: 583 agtagccggaggcgagcgagttggcgcc 556
>gb|AF062393.1|AF062393 Oryza sativa aquaporin (PIP2a) mRNA, complete cds Length = 1328 Score = 492 bits (248), Expect = e-136 Identities = 353/388 (90%) Strand = Plus / Minus Query: 276 acgcgttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggt 335 ||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||| Sbjct: 968 acgcgttgctcctgaaggagccgagggccttgatggcgccggcccggaggatgtactggt 909 Query: 336 ggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactgatcat 395 ||||||| |||||||| || ||||||| | |||||||||||||||||||| || | | Sbjct: 908 ggtagaacgccgcgatggcggcgccgacgaacgggccgacccagaagatccaatggttgt 849 Query: 396 cccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttgatgc 455 ||| ||||| || |||||| |||||||||| || || | |||||||||||||||||||| Sbjct: 848 gccacgccttctcgttgttgaagatgacggccgctccgatgctcctggccgggttgatgc 789 Query: 456 cggtgccggtgatcgggatggtggccaggtggaccatgaacacggcgaagccgatcggga 515 ||||||||||||||||||| || |||||||||||||||||||||||||||||||| || | Sbjct: 788 cggtgccggtgatcgggatcgtcgccaggtggaccatgaacacggcgaagccgattggca 729 Query: 516 ggggcgccaacaccgggacgtgagagtcgcgtgcgctgcgcttggggtcggtggcggaga 575 | |||||||| |||||||| || |||||||| ||| |||||||||||||||||||||||| Sbjct: 728 gcggcgccaagaccgggacatgtgagtcgcgggcgttgcgcttggggtcggtggcggaga 669 Query: 576 agacggtgtagacgagcacgaaggtgccgatgatctccgcggcgaggccggtgcccttgg 635 ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| Sbjct: 668 agacggtgtagacgagcacgaaggtgccgatgatctcggcggcgaggccggtgcccttgg 609 Query: 636 agtatccggcggcgagcgtgttggcgcc 663 |||| ||||||||||| ||||||||||| Sbjct: 608 agtagccggcggcgagggtgttggcgcc 581
>ref|NM_187092.2| Oryza sativa (japonica cultivar-group), mRNA Length = 1242 Score = 484 bits (244), Expect = e-133 Identities = 352/388 (90%) Strand = Plus / Minus Query: 276 acgcgttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggt 335 |||||||||||||||||||||||||||| |||||||||||||||| ||| |||||||||| Sbjct: 978 acgcgttgctcctgaaggagccgagggctttgatggcgccggcccggaggatgtactggt 919 Query: 336 ggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactgatcat 395 ||||||| |||||||| || ||||||| | |||||||||||||||||||| || | | Sbjct: 918 ggtagaacgccgcgatggcggcgccgacgaacgggccgacccagaagatccaatggttgt 859 Query: 396 cccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttgatgc 455 ||| ||||| || |||||| |||||||||| || || | |||||||||||||||||||| Sbjct: 858 gccacgccttctcgttgttgaagatgacggccgctccgatgctcctggccgggttgatgc 799 Query: 456 cggtgccggtgatcgggatggtggccaggtggaccatgaacacggcgaagccgatcggga 515 ||||||||||||||||||| || |||||||||||||||||||||||||||||||| || | Sbjct: 798 cggtgccggtgatcgggatcgtcgccaggtggaccatgaacacggcgaagccgattggca 739 Query: 516 ggggcgccaacaccgggacgtgagagtcgcgtgcgctgcgcttggggtcggtggcggaga 575 | |||||||| |||||||| || |||||||| ||| |||||||||||||||||||||||| Sbjct: 738 gcggcgccaagaccgggacatgtgagtcgcgggcgttgcgcttggggtcggtggcggaga 679 Query: 576 agacggtgtagacgagcacgaaggtgccgatgatctccgcggcgaggccggtgcccttgg 635 ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| Sbjct: 678 agacggtgtagacgagcacgaaggtgccgatgatctcggcggcgaggccggtgcccttgg 619 Query: 636 agtatccggcggcgagcgtgttggcgcc 663 |||| ||||||||||| ||||||||||| Sbjct: 618 agtagccggcggcgagggtgttggcgcc 591
>ref|XM_507363.1| PREDICTED Oryza sativa (japonica cultivar-group), OJ1047_A06.117 mRNA Length = 1257 Score = 484 bits (244), Expect = e-133 Identities = 352/388 (90%) Strand = Plus / Minus Query: 276 acgcgttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggt 335 |||||||||||||||||||||||||||| |||||||||||||||| ||| |||||||||| Sbjct: 980 acgcgttgctcctgaaggagccgagggctttgatggcgccggcccggaggatgtactggt 921 Query: 336 ggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactgatcat 395 ||||||| |||||||| || ||||||| | |||||||||||||||||||| || | | Sbjct: 920 ggtagaacgccgcgatggcggcgccgacgaacgggccgacccagaagatccaatggttgt 861 Query: 396 cccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttgatgc 455 ||| ||||| || |||||| |||||||||| || || | |||||||||||||||||||| Sbjct: 860 gccacgccttctcgttgttgaagatgacggccgctccgatgctcctggccgggttgatgc 801 Query: 456 cggtgccggtgatcgggatggtggccaggtggaccatgaacacggcgaagccgatcggga 515 ||||||||||||||||||| || |||||||||||||||||||||||||||||||| || | Sbjct: 800 cggtgccggtgatcgggatcgtcgccaggtggaccatgaacacggcgaagccgattggca 741 Query: 516 ggggcgccaacaccgggacgtgagagtcgcgtgcgctgcgcttggggtcggtggcggaga 575 | |||||||| |||||||| || |||||||| ||| |||||||||||||||||||||||| Sbjct: 740 gcggcgccaagaccgggacatgtgagtcgcgggcgttgcgcttggggtcggtggcggaga 681 Query: 576 agacggtgtagacgagcacgaaggtgccgatgatctccgcggcgaggccggtgcccttgg 635 ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| Sbjct: 680 agacggtgtagacgagcacgaaggtgccgatgatctcggcggcgaggccggtgcccttgg 621 Query: 636 agtatccggcggcgagcgtgttggcgcc 663 |||| ||||||||||| ||||||||||| Sbjct: 620 agtagccggcggcgagggtgttggcgcc 593
>ref|XM_506304.2| PREDICTED Oryza sativa (japonica cultivar-group), OJ1047_A06.117 mRNA Length = 1298 Score = 484 bits (244), Expect = e-133 Identities = 352/388 (90%) Strand = Plus / Minus Query: 276 acgcgttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggt 335 |||||||||||||||||||||||||||| |||||||||||||||| ||| |||||||||| Sbjct: 981 acgcgttgctcctgaaggagccgagggctttgatggcgccggcccggaggatgtactggt 922 Query: 336 ggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactgatcat 395 ||||||| |||||||| || ||||||| | |||||||||||||||||||| || | | Sbjct: 921 ggtagaacgccgcgatggcggcgccgacgaacgggccgacccagaagatccaatggttgt 862 Query: 396 cccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttgatgc 455 ||| ||||| || |||||| |||||||||| || || | |||||||||||||||||||| Sbjct: 861 gccacgccttctcgttgttgaagatgacggccgctccgatgctcctggccgggttgatgc 802 Query: 456 cggtgccggtgatcgggatggtggccaggtggaccatgaacacggcgaagccgatcggga 515 ||||||||||||||||||| || |||||||||||||||||||||||||||||||| || | Sbjct: 801 cggtgccggtgatcgggatcgtcgccaggtggaccatgaacacggcgaagccgattggca 742 Query: 516 ggggcgccaacaccgggacgtgagagtcgcgtgcgctgcgcttggggtcggtggcggaga 575 | |||||||| |||||||| || |||||||| ||| |||||||||||||||||||||||| Sbjct: 741 gcggcgccaagaccgggacatgtgagtcgcgggcgttgcgcttggggtcggtggcggaga 682 Query: 576 agacggtgtagacgagcacgaaggtgccgatgatctccgcggcgaggccggtgcccttgg 635 ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| Sbjct: 681 agacggtgtagacgagcacgaaggtgccgatgatctcggcggcgaggccggtgcccttgg 622 Query: 636 agtatccggcggcgagcgtgttggcgcc 663 |||| ||||||||||| ||||||||||| Sbjct: 621 agtagccggcggcgagggtgttggcgcc 594
>gb|AY243801.1| Zea mays aquaporin (PIP2-1) mRNA, complete cds Length = 1133 Score = 484 bits (244), Expect = e-133 Identities = 352/388 (90%) Strand = Plus / Minus Query: 276 acgcgttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggt 335 |||||||||||||||||||||||||||||||||||||||| |||| ||| |||||||||| Sbjct: 872 acgcgttgctcctgaaggagccgagggccttgatggcgccagcccggaggatgtactggt 813 Query: 336 ggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactgatcat 395 |||||||||||||||| || ||||| | | ||||| |||||||||||||| || || | Sbjct: 812 ggtagaaggccgcgatggcagcgcccacgagagggcccacccagaagatccagtggtcgt 753 Query: 396 cccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttgatgc 455 |||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||| Sbjct: 752 cccagggcttgtccttgttgtagatgacggcggcgcccaggctcctggccgggttgatgc 693 Query: 456 cggtgccggtgatcgggatggtggccaggtggaccatgaacacggcgaagccgatcggga 515 |||||||||||| ||||||||||||||||| ||||||||||||||||||||||| |||| Sbjct: 692 cggtgccggtgacggggatggtggccaggtgcaccatgaacacggcgaagccgatgggga 633 Query: 516 ggggcgccaacaccgggacgtgagagtcgcgtgcgctgcgcttggggtcggtggcggaga 575 |||| |||| ||||||||||| |||||||| ||| |||||||||||||||||||||||| Sbjct: 632 ggggagccagaaccgggacgtgggagtcgcgggcgttgcgcttggggtcggtggcggaga 573 Query: 576 agacggtgtagacgagcacgaaggtgccgatgatctccgcggcgaggccggtgcccttgg 635 ||||||||||||||||||||||||||||||||||||| ||| ||| ||||||||| || Sbjct: 572 agacggtgtagacgagcacgaaggtgccgatgatctcggcgccgaagccggtgccgcggg 513 Query: 636 agtatccggcggcgagcgtgttggcgcc 663 |||| |||| |||||||| |||||||| Sbjct: 512 agtagccggaggcgagcgaattggcgcc 485
>dbj|AK119656.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-130-H04, full insert sequence Length = 1216 Score = 484 bits (244), Expect = e-133 Identities = 352/388 (90%) Strand = Plus / Minus Query: 276 acgcgttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggt 335 |||||||||||||||||||||||||||| |||||||||||||||| ||| |||||||||| Sbjct: 978 acgcgttgctcctgaaggagccgagggctttgatggcgccggcccggaggatgtactggt 919 Query: 336 ggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactgatcat 395 ||||||| |||||||| || ||||||| | |||||||||||||||||||| || | | Sbjct: 918 ggtagaacgccgcgatggcggcgccgacgaacgggccgacccagaagatccaatggttgt 859 Query: 396 cccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttgatgc 455 ||| ||||| || |||||| |||||||||| || || | |||||||||||||||||||| Sbjct: 858 gccacgccttctcgttgttgaagatgacggccgctccgatgctcctggccgggttgatgc 799 Query: 456 cggtgccggtgatcgggatggtggccaggtggaccatgaacacggcgaagccgatcggga 515 ||||||||||||||||||| || |||||||||||||||||||||||||||||||| || | Sbjct: 798 cggtgccggtgatcgggatcgtcgccaggtggaccatgaacacggcgaagccgattggca 739 Query: 516 ggggcgccaacaccgggacgtgagagtcgcgtgcgctgcgcttggggtcggtggcggaga 575 | |||||||| |||||||| || |||||||| ||| |||||||||||||||||||||||| Sbjct: 738 gcggcgccaagaccgggacatgtgagtcgcgggcgttgcgcttggggtcggtggcggaga 679 Query: 576 agacggtgtagacgagcacgaaggtgccgatgatctccgcggcgaggccggtgcccttgg 635 ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| Sbjct: 678 agacggtgtagacgagcacgaaggtgccgatgatctcggcggcgaggccggtgcccttgg 619 Query: 636 agtatccggcggcgagcgtgttggcgcc 663 |||| ||||||||||| ||||||||||| Sbjct: 618 agtagccggcggcgagggtgttggcgcc 591
>dbj|AK105524.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-127-G02, full insert sequence Length = 1451 Score = 484 bits (244), Expect = e-133 Identities = 352/388 (90%) Strand = Plus / Minus Query: 276 acgcgttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggt 335 |||||||||||||||||||||||||||| |||||||||||||||| ||| |||||||||| Sbjct: 572 acgcgttgctcctgaaggagccgagggctttgatggcgccggcccggaggatgtactggt 513 Query: 336 ggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactgatcat 395 ||||||| |||||||| || ||||||| | |||||||||||||||||||| || | | Sbjct: 512 ggtagaacgccgcgatggcggcgccgacgaacgggccgacccagaagatccaatggttgt 453 Query: 396 cccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttgatgc 455 ||| ||||| || |||||| |||||||||| || || | |||||||||||||||||||| Sbjct: 452 gccacgccttctcgttgttgaagatgacggccgctccgatgctcctggccgggttgatgc 393 Query: 456 cggtgccggtgatcgggatggtggccaggtggaccatgaacacggcgaagccgatcggga 515 ||||||||||||||||||| || |||||||||||||||||||||||||||||||| || | Sbjct: 392 cggtgccggtgatcgggatcgtcgccaggtggaccatgaacacggcgaagccgattggca 333 Query: 516 ggggcgccaacaccgggacgtgagagtcgcgtgcgctgcgcttggggtcggtggcggaga 575 | |||||||| |||||||| || |||||||| ||| |||||||||||||||||||||||| Sbjct: 332 gcggcgccaagaccgggacatgtgagtcgcgggcgttgcgcttggggtcggtggcggaga 273 Query: 576 agacggtgtagacgagcacgaaggtgccgatgatctccgcggcgaggccggtgcccttgg 635 ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| Sbjct: 272 agacggtgtagacgagcacgaaggtgccgatgatctcggcggcgaggccggtgcccttgg 213 Query: 636 agtatccggcggcgagcgtgttggcgcc 663 |||| ||||||||||| ||||||||||| Sbjct: 212 agtagccggcggcgagggtgttggcgcc 185
>dbj|AK103970.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-016-B05, full insert sequence Length = 1242 Score = 484 bits (244), Expect = e-133 Identities = 352/388 (90%) Strand = Plus / Minus Query: 276 acgcgttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggt 335 |||||||||||||||||||||||||||| |||||||||||||||| ||| |||||||||| Sbjct: 978 acgcgttgctcctgaaggagccgagggctttgatggcgccggcccggaggatgtactggt 919 Query: 336 ggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactgatcat 395 ||||||| |||||||| || ||||||| | |||||||||||||||||||| || | | Sbjct: 918 ggtagaacgccgcgatggcggcgccgacgaacgggccgacccagaagatccaatggttgt 859 Query: 396 cccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttgatgc 455 ||| ||||| || |||||| |||||||||| || || | |||||||||||||||||||| Sbjct: 858 gccacgccttctcgttgttgaagatgacggccgctccgatgctcctggccgggttgatgc 799 Query: 456 cggtgccggtgatcgggatggtggccaggtggaccatgaacacggcgaagccgatcggga 515 ||||||||||||||||||| || |||||||||||||||||||||||||||||||| || | Sbjct: 798 cggtgccggtgatcgggatcgtcgccaggtggaccatgaacacggcgaagccgattggca 739 Query: 516 ggggcgccaacaccgggacgtgagagtcgcgtgcgctgcgcttggggtcggtggcggaga 575 | |||||||| |||||||| || |||||||| ||| |||||||||||||||||||||||| Sbjct: 738 gcggcgccaagaccgggacatgtgagtcgcgggcgttgcgcttggggtcggtggcggaga 679 Query: 576 agacggtgtagacgagcacgaaggtgccgatgatctccgcggcgaggccggtgcccttgg 635 ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| Sbjct: 678 agacggtgtagacgagcacgaaggtgccgatgatctcggcggcgaggccggtgcccttgg 619 Query: 636 agtatccggcggcgagcgtgttggcgcc 663 |||| ||||||||||| ||||||||||| Sbjct: 618 agtagccggcggcgagggtgttggcgcc 591
>dbj|AK072519.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023128K12, full insert sequence Length = 1298 Score = 484 bits (244), Expect = e-133 Identities = 352/388 (90%) Strand = Plus / Minus Query: 276 acgcgttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggt 335 |||||||||||||||||||||||||||| |||||||||||||||| ||| |||||||||| Sbjct: 981 acgcgttgctcctgaaggagccgagggctttgatggcgccggcccggaggatgtactggt 922 Query: 336 ggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactgatcat 395 ||||||| |||||||| || ||||||| | |||||||||||||||||||| || | | Sbjct: 921 ggtagaacgccgcgatggcggcgccgacgaacgggccgacccagaagatccaatggttgt 862 Query: 396 cccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttgatgc 455 ||| ||||| || |||||| |||||||||| || || | |||||||||||||||||||| Sbjct: 861 gccacgccttctcgttgttgaagatgacggccgctccgatgctcctggccgggttgatgc 802 Query: 456 cggtgccggtgatcgggatggtggccaggtggaccatgaacacggcgaagccgatcggga 515 ||||||||||||||||||| || |||||||||||||||||||||||||||||||| || | Sbjct: 801 cggtgccggtgatcgggatcgtcgccaggtggaccatgaacacggcgaagccgattggca 742 Query: 516 ggggcgccaacaccgggacgtgagagtcgcgtgcgctgcgcttggggtcggtggcggaga 575 | |||||||| |||||||| || |||||||| ||| |||||||||||||||||||||||| Sbjct: 741 gcggcgccaagaccgggacatgtgagtcgcgggcgttgcgcttggggtcggtggcggaga 682 Query: 576 agacggtgtagacgagcacgaaggtgccgatgatctccgcggcgaggccggtgcccttgg 635 ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| Sbjct: 681 agacggtgtagacgagcacgaaggtgccgatgatctcggcggcgaggccggtgcccttgg 622 Query: 636 agtatccggcggcgagcgtgttggcgcc 663 |||| ||||||||||| ||||||||||| Sbjct: 621 agtagccggcggcgagggtgttggcgcc 594
>dbj|AK103938.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-013-G03, full insert sequence Length = 1257 Score = 476 bits (240), Expect = e-131 Identities = 351/388 (90%) Strand = Plus / Minus Query: 276 acgcgttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggt 335 ||||||||||||||| |||||||||||| |||||||||||||||| ||| |||||||||| Sbjct: 980 acgcgttgctcctgagggagccgagggctttgatggcgccggcccggaggatgtactggt 921 Query: 336 ggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactgatcat 395 ||||||| |||||||| || ||||||| | |||||||||||||||||||| || | | Sbjct: 920 ggtagaacgccgcgatggcggcgccgacgaacgggccgacccagaagatccaatggttgt 861 Query: 396 cccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttgatgc 455 ||| ||||| || |||||| |||||||||| || || | |||||||||||||||||||| Sbjct: 860 gccacgccttctcgttgttgaagatgacggccgctccgatgctcctggccgggttgatgc 801 Query: 456 cggtgccggtgatcgggatggtggccaggtggaccatgaacacggcgaagccgatcggga 515 ||||||||||||||||||| || |||||||||||||||||||||||||||||||| || | Sbjct: 800 cggtgccggtgatcgggatcgtcgccaggtggaccatgaacacggcgaagccgattggca 741 Query: 516 ggggcgccaacaccgggacgtgagagtcgcgtgcgctgcgcttggggtcggtggcggaga 575 | |||||||| |||||||| || |||||||| ||| |||||||||||||||||||||||| Sbjct: 740 gcggcgccaagaccgggacatgtgagtcgcgggcgttgcgcttggggtcggtggcggaga 681 Query: 576 agacggtgtagacgagcacgaaggtgccgatgatctccgcggcgaggccggtgcccttgg 635 ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| Sbjct: 680 agacggtgtagacgagcacgaaggtgccgatgatctcggcggcgaggccggtgcccttgg 621 Query: 636 agtatccggcggcgagcgtgttggcgcc 663 |||| ||||||||||| ||||||||||| Sbjct: 620 agtagccggcggcgagggtgttggcgcc 593
>gb|AF326492.1|AF326492 Zea mays plasma membrane integral protein ZmPIP2-2 mRNA, complete cds Length = 1268 Score = 436 bits (220), Expect = e-119 Identities = 346/388 (89%) Strand = Plus / Minus Query: 276 acgcgttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggt 335 ||||||||||||||||||||||||| |||||||||||||| |||| ||| |||||||||| Sbjct: 996 acgcgttgctcctgaaggagccgagagccttgatggcgcccgcccggaggatgtactggt 937 Query: 336 ggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactgatcat 395 |||||||||||||||| || ||||| | | ||||| |||||||| ||||| || |||| Sbjct: 936 ggtagaaggccgcgatggcagcgcccaggagcgggcccacccagaaaatccagtggtcat 877 Query: 396 cccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttgatgc 455 |||| | ||||||||||||||||| ||||||||| ||||||||||||||||||||||||| Sbjct: 876 cccatggcttgtccttgttgtagacgacggcggcgcccaggctcctggccgggttgatgc 817 Query: 456 cggtgccggtgatcgggatggtggccaggtggaccatgaacacggcgaagccgatcggga 515 |||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||| Sbjct: 816 cggtgccggtgacggggatggtggccaggtggaccatgaacacggcgaagccgatgggga 757 Query: 516 ggggcgccaacaccgggacgtgagagtcgcgtgcgctgcgcttggggtcggtggcggaga 575 |||| |||| ||||||||||| |||||||| ||| |||||||||||||||||||||||| Sbjct: 756 ggggagccagaaccgggacgtgggagtcgcgggcgttgcgcttggggtcggtggcggaga 697 Query: 576 agacggtgtagacgagcacgaaggtgccgatgatctccgcggcgaggccggtgcccttgg 635 |||||||||| ||||||||||||||||||| |||||| ||| |||| || | ||| || Sbjct: 696 agacggtgtacacgagcacgaaggtgccgacgatctcggcgccgagccccgcgccgcggg 637 Query: 636 agtatccggcggcgagcgtgttggcgcc 663 |||| |||| ||||||| ||||||||| Sbjct: 636 agtagccggacgcgagcgagttggcgcc 609
>dbj|AB029446.1| Oryza sativa (indica cultivar-group) rwc-2 mRNA for water channel protein, partial cds Length = 880 Score = 436 bits (220), Expect = e-119 Identities = 346/388 (89%) Strand = Plus / Minus Query: 276 acgcgttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggt 335 |||||||||||||||||||||||||||||||||||| |||||||| ||| |||||||||| Sbjct: 544 acgcgttgctcctgaaggagccgagggccttgatggggccggcccggaggatgtactggt 485 Query: 336 ggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactgatcat 395 ||||||| |||||||| || ||||||| | |||||||||||||||||||| || | | Sbjct: 484 ggtagaacgccgcgatggcggcgccgacgaacgggccgacccagaagatccattggttgt 425 Query: 396 cccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttgatgc 455 ||||||||| || |||||| |||||||||| | || | |||||||||||||||||| Sbjct: 424 gccaggccttctcgttgttgaagatgacggccggtccggtggtcctggccgggttgatgc 365 Query: 456 cggtgccggtgatcgggatggtggccaggtggaccatgaacacggcgaagccgatcggga 515 ||||||||||||||||||| || ||||| |||||||||||| ||||||||||| || | Sbjct: 364 cggtgccggtgatcgggatcgtcgccagttggaccatgaaccacgcgaagccgattggca 305 Query: 516 ggggcgccaacaccgggacgtgagagtcgcgtgcgctgcgcttggggtcggtggcggaga 575 | |||||||| |||||||| || |||||||| ||| |||||||||||||||||||||||| Sbjct: 304 gcggcgccaagaccgggacatgtgagtcgcgggcgttgcgcttggggtcggtggcggaga 245 Query: 576 agacggtgtagacgagcacgaaggtgccgatgatctccgcggcgaggccggtgcccttgg 635 ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| Sbjct: 244 agacggtgtagacgagcacgaaggtgccgatgatctcggcggcgaggccggtgcccttgg 185 Query: 636 agtatccggcggcgagcgtgttggcgcc 663 |||| ||||||||||| ||||||||||| Sbjct: 184 agtagccggcggcgagggtgttggcgcc 157
>gb|AY109332.1| Zea mays CL502_5 mRNA sequence Length = 1969 Score = 426 bits (215), Expect = e-116 Identities = 305/335 (91%) Strand = Plus / Minus Query: 276 acgcgttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggt 335 ||||||||||||||||||||||||| |||||||||||||| |||| ||| |||||||||| Sbjct: 1646 acgcgttgctcctgaaggagccgagagccttgatggcgcccgcccggaggatgtactggt 1587 Query: 336 ggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactgatcat 395 |||||||||||||||| || ||||| | | ||||| |||||||| ||||| || |||| Sbjct: 1586 ggtagaaggccgcgatggcagcgcccaggagcgggcccacccagaaaatccagtggtcat 1527 Query: 396 cccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttgatgc 455 |||| | ||||||||||||||||| ||||||||| ||||||||||||||||||||||||| Sbjct: 1526 cccatggcttgtccttgttgtagacgacggcggcgcccaggctcctggccgggttgatgc 1467 Query: 456 cggtgccggtgatcgggatggtggccaggtggaccatgaacacggcgaagccgatcggga 515 |||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||| Sbjct: 1466 cggtgccggtgacggggatggtggccaggtggaccatgaacacggcgaagccgatgggga 1407 Query: 516 ggggcgccaacaccgggacgtgagagtcgcgtgcgctgcgcttggggtcggtggcggaga 575 |||| |||| ||||||||||| |||||||| ||| |||||||||||||||||||||||| Sbjct: 1406 ggggagccagaaccgggacgtgggagtcgcgggcgttgcgcttggggtcggtggcggaga 1347 Query: 576 agacggtgtagacgagcacgaaggtgccgatgatc 610 |||||||||| ||||||||||||||||||| |||| Sbjct: 1346 agacggtgtacacgagcacgaaggtgccgacgatc 1312 Score = 404 bits (204), Expect = e-109 Identities = 285/312 (91%) Strand = Plus / Minus Query: 328 gtactggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatcca 387 ||||||||||||| ||| ||||| || |||||||||| ||||| |||||||||||||| Sbjct: 321 gtactggtggtaggcggcggcgatggcggcgccgatcagtgggcccacccagaagatcca 262 Query: 388 ctgatcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgg 447 || || ||||||||||||||||||||||||||||| ||||| |||| |||||| ||||| Sbjct: 261 ttggtcgtcccaggccttgtccttgttgtagatgaccgcggctcccaagctcctcgccgg 202 Query: 448 gttgatgccggtgccggtgatcgggatggtggccaggtggaccatgaacacggcgaagcc 507 ||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||| || Sbjct: 201 gttgatgccggtgccggtgatggggatggtggccaggtgcaccatgaacacggcgaaccc 142 Query: 508 gatcgggaggggcgccaacaccgggacgtgagagtcgcgtgcgctgcgcttggggtcggt 567 ||||| || || ||||||||||||||||| ||||| || || ||||||||||||||||| Sbjct: 141 aatcggaagaggggccaacaccgggacgtgggagtcacgggcactgcgcttggggtcggt 82 Query: 568 ggcggagaagacggtgtagacgagcacgaaggtgccgatgatctccgcggcgaggccggt 627 ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| Sbjct: 81 ggcggagaagacggtgtagacgagcacgaaggtgccgatgatctcggcggcgaggccggt 22 Query: 628 gcccttggagta 639 |||||||||||| Sbjct: 21 gcccttggagta 10
>gb|AF326493.1|AF326493 Zea mays plasma membrane integral protein ZmPIP2-3 mRNA, complete cds Length = 1156 Score = 404 bits (204), Expect = e-109 Identities = 285/312 (91%) Strand = Plus / Minus Query: 328 gtactggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatcca 387 ||||||||||||| ||| ||||| || |||||||||| ||||| |||||||||||||| Sbjct: 893 gtactggtggtaggcggcggcgatggcggcgccgatcagtgggcccacccagaagatcca 834 Query: 388 ctgatcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgg 447 || || ||||||||||||||||||||||||||||| ||||| |||| |||||| ||||| Sbjct: 833 ttggtcgtcccaggccttgtccttgttgtagatgaccgcggctcccaagctcctcgccgg 774 Query: 448 gttgatgccggtgccggtgatcgggatggtggccaggtggaccatgaacacggcgaagcc 507 ||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||| || Sbjct: 773 gttgatgccggtgccggtgatggggatggtggccaggtgcaccatgaacacggcgaaccc 714 Query: 508 gatcgggaggggcgccaacaccgggacgtgagagtcgcgtgcgctgcgcttggggtcggt 567 ||||| || || ||||||||||||||||| ||||| || || ||||||||||||||||| Sbjct: 713 aatcggaagaggggccaacaccgggacgtgggagtcacgggcactgcgcttggggtcggt 654 Query: 568 ggcggagaagacggtgtagacgagcacgaaggtgccgatgatctccgcggcgaggccggt 627 ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| Sbjct: 653 ggcggagaagacggtgtagacgagcacgaaggtgccgatgatctcggcggcgaggccggt 594 Query: 628 gcccttggagta 639 |||||||||||| Sbjct: 593 gcccttggagta 582
>ref|XM_466869.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1214 Score = 392 bits (198), Expect = e-106 Identities = 297/330 (90%) Strand = Plus / Minus Query: 310 ggcgccggccctgagtatgtactggtggtagaaggccgcgatcgccgcgccgatcatggg 369 ||||| |||||| || | ||||||||||||| ||| ||||| || |||||||||| ||| Sbjct: 901 ggcgctggccctcagcacgtactggtggtaggcggcggcgatggcggcgccgatcagggg 842 Query: 370 gccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggc 429 ||| |||||||||||||| || ||||||||||||||||||||||||||||| || |||| Sbjct: 841 gcccacccagaagatccattggtcatcccaggccttgtccttgttgtagataaccgcggt 782 Query: 430 ccccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggac 489 |||| |||||| |||||||| ||||||||||||||||| |||||||||||||| ||||| Sbjct: 781 tcccaagctcctcgccgggttaatgccggtgccggtgatggggatggtggccagatggac 722 Query: 490 catgaacacggcgaagccgatcgggaggggcgccaacaccgggacgtgagagtcgcgtgc 549 ||||||||| ||||| || || ||||| || ||||||||||||| ||| |||||||| || Sbjct: 721 catgaacaccgcgaatccaattgggagaggagccaacaccgggatgtgggagtcgcgggc 662 Query: 550 gctgcgcttggggtcggtggcggagaagacggtgtagacgagcacgaaggtgccgatgat 609 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 661 gttgcgcttggggtcggtggcggagaagacggtgtagacgagcacgaaggtgccgatgat 602 Query: 610 ctccgcggcgaggccggtgcccttggagta 639 ||||||| |||||||||||||||||||||| Sbjct: 601 ctccgcgccgaggccggtgcccttggagta 572
>dbj|AK061782.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-039-E03, full insert sequence Length = 1214 Score = 392 bits (198), Expect = e-106 Identities = 297/330 (90%) Strand = Plus / Minus Query: 310 ggcgccggccctgagtatgtactggtggtagaaggccgcgatcgccgcgccgatcatggg 369 ||||| |||||| || | ||||||||||||| ||| ||||| || |||||||||| ||| Sbjct: 901 ggcgctggccctcagcacgtactggtggtaggcggcggcgatggcggcgccgatcagggg 842 Query: 370 gccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggc 429 ||| |||||||||||||| || ||||||||||||||||||||||||||||| || |||| Sbjct: 841 gcccacccagaagatccattggtcatcccaggccttgtccttgttgtagataaccgcggt 782 Query: 430 ccccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggac 489 |||| |||||| |||||||| ||||||||||||||||| |||||||||||||| ||||| Sbjct: 781 tcccaagctcctcgccgggttaatgccggtgccggtgatggggatggtggccagatggac 722 Query: 490 catgaacacggcgaagccgatcgggaggggcgccaacaccgggacgtgagagtcgcgtgc 549 ||||||||| ||||| || || ||||| || ||||||||||||| ||| |||||||| || Sbjct: 721 catgaacaccgcgaatccaattgggagaggagccaacaccgggatgtgggagtcgcgggc 662 Query: 550 gctgcgcttggggtcggtggcggagaagacggtgtagacgagcacgaaggtgccgatgat 609 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 661 gttgcgcttggggtcggtggcggagaagacggtgtagacgagcacgaaggtgccgatgat 602 Query: 610 ctccgcggcgaggccggtgcccttggagta 639 ||||||| |||||||||||||||||||||| Sbjct: 601 ctccgcgccgaggccggtgcccttggagta 572
>gb|AF326494.1|AF326494 Zea mays plasma membrane integral protein ZmPIP2-4 mRNA, complete cds Length = 1171 Score = 381 bits (192), Expect = e-102 Identities = 300/336 (89%) Strand = Plus / Minus Query: 304 cttgatggcgccggccctgagtatgtactggtggtagaaggccgcgatcgccgcgccgat 363 |||| |||||| |||||| || | ||||||||||||| ||| ||||| || ||||| || Sbjct: 927 cttggtggcgctggccctcagcacgtactggtggtaggcggcggcgatggcggcgccaat 868 Query: 364 catggggccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgac 423 || ||||| |||||||||||||| || || ||||||||||||||||||||||||||||| Sbjct: 867 cagtgggcccacccagaagatccattggtcgtcccaggccttgtccttgttgtagatgac 808 Query: 424 ggcggcccccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccag 483 ||||| ||||||||||| |||||||||||||||||||||||||| |||||||||||||| Sbjct: 807 cgcggctcccaggctcctcgccgggttgatgccggtgccggtgatggggatggtggccag 748 Query: 484 gtggaccatgaacacggcgaagccgatcgggaggggcgccaacaccgggacgtgagagtc 543 ||| ||||||||||||||||| || || ||||| || || | |||||| ||||| ||||| Sbjct: 747 gtgcaccatgaacacggcgaacccaattgggagaggagctagcaccggaacgtgggagtc 688 Query: 544 gcgtgcgctgcgcttggggtcggtggcggagaagacggtgtagacgagcacgaaggtgcc 603 || || ||||||||||||||||||||||||||||||||||||||||||||||| ||||| Sbjct: 687 acgggcactgcgcttggggtcggtggcggagaagacggtgtagacgagcacgaacgtgcc 628 Query: 604 gatgatctccgcggcgaggccggtgcccttggagta 639 ||||||||| |||||||||||||||||||||||||| Sbjct: 627 gatgatctcggcggcgaggccggtgcccttggagta 592
>ref|NM_187084.1| Oryza sativa (japonica cultivar-group), mRNA Length = 852 Score = 375 bits (189), Expect = e-100 Identities = 285/317 (89%) Strand = Plus / Minus Query: 347 gcgatcgccgcgccgatcatggggccgacccagaagatccactgatcatcccaggccttg 406 ||||||||||| ||||| | || || ||||||||||||||||||||| ||| |||||| Sbjct: 782 gcgatcgccgccccgatgaacggcccaacccagaagatccactgatcactccatgccttg 723 Query: 407 tccttgttgtagatgacggcggcccccaggctcctggccgggttgatgccggtgccggtg 466 |||||||||| ||||||||| || |||||||| |||||||||||||||||||||||| Sbjct: 722 ctgttgttgtagacgacggcggcgccgaggctcctcgccgggttgatgccggtgccggtg 663 Query: 467 atcgggatggtggccaggtggaccatgaacacggcgaagccgatcgggaggggcgccaac 526 | |||||||| |||||||| ||||||||||||||||| |||||||| || ||||||||| Sbjct: 662 acggggatggtcgccaggtgcaccatgaacacggcgaacccgatcggcagcggcgccaac 603 Query: 527 accgggacgtgagagtcgcgtgcgctgcgcttggggtcggtggcggagaagacggtgtag 586 |||||||| || |||||||| ||| |||||||||||||||||||||||||||||||||| Sbjct: 602 accgggacatgggagtcgcgggcgttgcgcttggggtcggtggcggagaagacggtgtac 543 Query: 587 acgagcacgaaggtgccgatgatctccgcggcgaggccggtgcccttggagtatccggcg 646 |||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||| Sbjct: 542 acgagcacgaaggtgccgatgatctcggcggcgaggccggtgcccttggagtagccggcg 483 Query: 647 gcgagcgtgttggcgcc 663 |||||| ||||||||| Sbjct: 482 gcgagctcgttggcgcc 466
>dbj|AB219525.1| Hordeum vulgare HvPIP2;4 mRNA for PIP aquaporin isoform, complete cds Length = 1343 Score = 357 bits (180), Expect = 3e-95 Identities = 315/360 (87%) Strand = Plus / Minus Query: 304 cttgatggcgccggccctgagtatgtactggtggtagaaggccgcgatcgccgcgccgat 363 |||| |||||| |||||| || | |||||||||||| ||||| ||||| || || ||||| Sbjct: 913 cttggtggcgctggccctcagcacgtactggtggtacaaggcggcgatggcggccccgat 854 Query: 364 catggggccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgac 423 | || || |||||||| ||||| || |||||||||||||| || ||||||||||| || Sbjct: 853 gaatggccccacccagaacatccagtggtcatcccaggccttctcgttgttgtagatcac 794 Query: 424 ggcggcccccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccag 483 ||| || || | |||||| |||||||||||||||||||||||||||||||| ||||||| Sbjct: 793 ggcagctccgaagctcctcgccgggttgatgccggtgccggtgatcgggatagtggccaa 734 Query: 484 gtggaccatgaacacggcgaagccgatcgggaggggcgccaacaccgggacgtgagagtc 543 ||| ||||||||||| ||||||||||| || ||||| |||| || |||||||| ||||| Sbjct: 733 gtgcaccatgaacaccgcgaagccgattggcaggggagccaggactgggacgtgggagtc 674 Query: 544 gcgtgcgctgcgcttggggtcggtggcggagaagacggtgtagacgagcacgaaggtgcc 603 || |||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 673 acgggcgctgcgcttggggtcggtggcggagaagacggtgtagacgagcacgaaggtgcc 614 Query: 604 gatgatctccgcggcgaggccggtgcccttggagtatccggcggcgagcgtgttggcgcc 663 ||||||||| |||||||||||||||||||||||||| |||||| |||| ||||||||| Sbjct: 613 gatgatctcggcggcgaggccggtgcccttggagtagccggcgctgagctcgttggcgcc 554
>gb|AY243802.1| Zea mays aquaporin (PIP2-5) mRNA, complete cds Length = 1104 Score = 353 bits (178), Expect = 5e-94 Identities = 310/354 (87%) Strand = Plus / Minus Query: 310 ggcgccggccctgagtatgtactggtggtagaaggccgcgatcgccgcgccgatcatggg 369 ||||| |||||| || | |||||||||||| || ||||| || |||||||| | || Sbjct: 825 ggcgctggccctcagcacgtactggtggtacgccgcggcgatggcggcgccgatgaatgg 766 Query: 370 gccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggc 429 || |||||||||||||| || ||||||||||||||||| |||||||||||||| || || Sbjct: 765 acccacccagaagatccagtggtcatcccaggccttgtcgttgttgtagatgacagcagc 706 Query: 430 ccccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggac 489 |||| ||||||||||||||||||||||||||||||||| ||||| |||||||| ||||| Sbjct: 705 gcccaagctcctggccgggttgatgccggtgccggtgatggggatcgtggccagatggac 646 Query: 490 catgaacacggcgaagccgatcgggaggggcgccaacaccgggacgtgagagtcgcgtgc 549 ||||||||| || || ||||| ||||| || || | ||| ||||| |||||||| || || Sbjct: 645 catgaacaccgcaaacccgatggggagaggggcaagcacggggacatgagagtcacgggc 586 Query: 550 gctgcgcttggggtcggtggcggagaagacggtgtagacgagcacgaaggtgccgatgat 609 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 585 gttgcgcttggggtcggtggcggagaagacggtgtagacgagcacgaaggtgccgatgat 526 Query: 610 ctccgcggcgaggccggtgcccttggagtatccggcggcgagcgtgttggcgcc 663 |||||||||||||||||||||||||||||| |||||| |||| ||||||||| Sbjct: 525 ctccgcggcgaggccggtgcccttggagtagccggcgctgagctcgttggcgcc 472
>gb|AF130975.1|AF130975 Zea mays plasma membrane intrinsic protein (pip2-5) mRNA, complete cds Length = 1207 Score = 353 bits (178), Expect = 5e-94 Identities = 310/354 (87%) Strand = Plus / Minus Query: 310 ggcgccggccctgagtatgtactggtggtagaaggccgcgatcgccgcgccgatcatggg 369 ||||| |||||| || | |||||||||||| || ||||| || |||||||| | || Sbjct: 880 ggcgctggccctcagcacgtactggtggtacgccgcggcgatggcggcgccgatgaatgg 821 Query: 370 gccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggc 429 || |||||||||||||| || ||||||||||||||||| |||||||||||||| || || Sbjct: 820 acccacccagaagatccagtggtcatcccaggccttgtcgttgttgtagatgacagcagc 761 Query: 430 ccccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggac 489 |||| ||||||||||||||||||||||||||||||||| ||||| |||||||| ||||| Sbjct: 760 gcccaagctcctggccgggttgatgccggtgccggtgatggggatcgtggccagatggac 701 Query: 490 catgaacacggcgaagccgatcgggaggggcgccaacaccgggacgtgagagtcgcgtgc 549 ||||||||| || || ||||| ||||| || || | ||| ||||| |||||||| || || Sbjct: 700 catgaacaccgcaaacccgatggggagaggggcaagcacggggacatgagagtcacgggc 641 Query: 550 gctgcgcttggggtcggtggcggagaagacggtgtagacgagcacgaaggtgccgatgat 609 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 640 gttgcgcttggggtcggtggcggagaagacggtgtagacgagcacgaaggtgccgatgat 581 Query: 610 ctccgcggcgaggccggtgcccttggagtatccggcggcgagcgtgttggcgcc 663 |||||||||||||||||||||||||||||| |||||| |||| ||||||||| Sbjct: 580 ctccgcggcgaggccggtgcccttggagtagccggcgctgagctcgttggcgcc 527
>ref|NM_187081.2| Oryza sativa (japonica cultivar-group), mRNA Length = 1215 Score = 343 bits (173), Expect = 5e-91 Identities = 293/333 (87%) Strand = Plus / Minus Query: 331 ctggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactg 390 ||||||||| | |||||||||||||||||||| | || || ||||||||||||||||| Sbjct: 901 ctggtggtacagcgccgcgatcgccgcgccgatgaacggcccaacccagaagatccactg 842 Query: 391 atcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggtt 450 |||| ||||||||||| |||||||||| |||||| | || ||||||||||||||||| Sbjct: 841 atcactccaggccttgttgttgttgtagaccacggcgacgccgaggctcctggccgggtt 782 Query: 451 gatgccggtgccggtgatcgggatggtggccaggtggaccatgaacacggcgaagccgat 510 |||||||||||||||||||||||| || |||||||| ||||||||||| ||||| ||||| Sbjct: 781 gatgccggtgccggtgatcgggatcgtcgccaggtgcaccatgaacaccgcgaacccgat 722 Query: 511 cgggaggggcgccaacaccgggacgtgagagtcgcgtgcgctgcgcttggggtcggtggc 570 || || || |||||||| || || || |||||||| ||| |||||||||| |||||||| Sbjct: 721 tggcagcggagccaacacgggaacatgtgagtcgcgggcgttgcgcttgggatcggtggc 662 Query: 571 ggagaagacggtgtagacgagcacgaaggtgccgatgatctccgcggcgaggccggtgcc 630 ||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||| Sbjct: 661 ggagaagacggtgtacacgagcacgaaggtgccgatgatctcggcggcgaggccggtgcc 602 Query: 631 cttggagtatccggcggcgagcgtgttggcgcc 663 ||||||| |||||||||||| ||||||||| Sbjct: 601 ggtggagtagccggcggcgagctcgttggcgcc 569 Score = 40.1 bits (20), Expect = 9.1 Identities = 23/24 (95%) Strand = Plus / Minus Query: 275 tacgcgttgctcctgaaggagccg 298 ||||||||||||| |||||||||| Sbjct: 954 tacgcgttgctccggaaggagccg 931
>dbj|AK072632.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023132K03, full insert sequence Length = 1215 Score = 343 bits (173), Expect = 5e-91 Identities = 293/333 (87%) Strand = Plus / Minus Query: 331 ctggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactg 390 ||||||||| | |||||||||||||||||||| | || || ||||||||||||||||| Sbjct: 901 ctggtggtacagcgccgcgatcgccgcgccgatgaacggcccaacccagaagatccactg 842 Query: 391 atcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggtt 450 |||| ||||||||||| |||||||||| |||||| | || ||||||||||||||||| Sbjct: 841 atcactccaggccttgttgttgttgtagaccacggcgacgccgaggctcctggccgggtt 782 Query: 451 gatgccggtgccggtgatcgggatggtggccaggtggaccatgaacacggcgaagccgat 510 |||||||||||||||||||||||| || |||||||| ||||||||||| ||||| ||||| Sbjct: 781 gatgccggtgccggtgatcgggatcgtcgccaggtgcaccatgaacaccgcgaacccgat 722 Query: 511 cgggaggggcgccaacaccgggacgtgagagtcgcgtgcgctgcgcttggggtcggtggc 570 || || || |||||||| || || || |||||||| ||| |||||||||| |||||||| Sbjct: 721 tggcagcggagccaacacgggaacatgtgagtcgcgggcgttgcgcttgggatcggtggc 662 Query: 571 ggagaagacggtgtagacgagcacgaaggtgccgatgatctccgcggcgaggccggtgcc 630 ||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||| Sbjct: 661 ggagaagacggtgtacacgagcacgaaggtgccgatgatctcggcggcgaggccggtgcc 602 Query: 631 cttggagtatccggcggcgagcgtgttggcgcc 663 ||||||| |||||||||||| ||||||||| Sbjct: 601 ggtggagtagccggcggcgagctcgttggcgcc 569 Score = 40.1 bits (20), Expect = 9.1 Identities = 23/24 (95%) Strand = Plus / Minus Query: 275 tacgcgttgctcctgaaggagccg 298 ||||||||||||| |||||||||| Sbjct: 954 tacgcgttgctccggaaggagccg 931
>gb|BT018182.1| Zea mays clone EL01N0557H10.c mRNA sequence Length = 1215 Score = 341 bits (172), Expect = 2e-90 Identities = 295/336 (87%) Strand = Plus / Minus Query: 304 cttgatggcgccggccctgagtatgtactggtggtagaaggccgcgatcgccgcgccgat 363 |||| |||||| |||||| || | ||||||||||||| ||| ||||| || ||||| || Sbjct: 935 cttggtggcgctggccctcagcacgtactggtggtaggcggcggcgatggcggcgccaat 876 Query: 364 catggggccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgac 423 || || || |||||||||||||| || || ||||||||||||||||||||||||||||| Sbjct: 875 cagtggacccacccagaagatccattggtcgtcccaggccttgtccttgttgtagatgac 816 Query: 424 ggcggcccccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccag 483 ||||| |||||| |||| |||||||||||||||||||||||||| |||||||| |||| Sbjct: 815 cgcggctcccaggatcctcgccgggttgatgccggtgccggtgatgcggatggtgtccag 756 Query: 484 gtggaccatgaacacggcgaagccgatcgggaggggcgccaacaccgggacgtgagagtc 543 ||| ||||||||||||||||| || || ||||| || || | |||||| ||||| ||||| Sbjct: 755 gtgcaccatgaacacggcgaacccaattgggagaggagctagcaccggaacgtgggagtc 696 Query: 544 gcgtgcgctgcgcttggggtcggtggcggagaagacggtgtagacgagcacgaaggtgcc 603 || || |||||||||||||||||| |||||||||||||||||||||||||||| ||||| Sbjct: 695 acgggcactgcgcttggggtcggtgtcggagaagacggtgtagacgagcacgaacgtgcc 636 Query: 604 gatgatctccgcggcgaggccggtgcccttggagta 639 ||||||||| |||||||||||||||||||||||||| Sbjct: 635 gatgatctcggcggcgaggccggtgcccttggagta 600
>ref|XM_473219.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 873 Score = 321 bits (162), Expect = 2e-84 Identities = 288/330 (87%) Strand = Plus / Minus Query: 310 ggcgccggccctgagtatgtactggtggtagaaggccgcgatcgccgcgccgatcatggg 369 ||||| |||||| || | ||||||||||||| ||| ||||| || |||||||| | ||| Sbjct: 837 ggcgctggccctcaggacgtactggtggtaggcggcggcgatggcggcgccgatgagggg 778 Query: 370 gccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggc 429 || |||||||||||||| || |||| ||| ||||||| || ||||||||| || || || Sbjct: 777 ccccacccagaagatccagtggtcatgccatgccttgtgctggttgtagatcaccgcagc 718 Query: 430 ccccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggac 489 |||| |||||| |||||||||||||||||||||||||||||||| ||||||| ||| || Sbjct: 717 tcccaagctccttgccgggttgatgccggtgccggtgatcgggatcgtggccaagtgaac 658 Query: 490 catgaacacggcgaagccgatcgggaggggcgccaacaccgggacgtgagagtcgcgtgc 549 ||||||||| ||||| || || || || || || | ||| |||||||| |||||||| || Sbjct: 657 catgaacaccgcgaacccaattggaagaggagcaagcacggggacgtgggagtcgcgggc 598 Query: 550 gctgcgcttggggtcggtggcggagaagacggtgtagacgagcacgaaggtgccgatgat 609 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 597 gttgcgcttggggtcggtggcggagaagacggtgtagacgagcacgaaggtgccgatgat 538 Query: 610 ctccgcggcgaggccggtgcccttggagta 639 ||| |||||||||||||||||||||||||| Sbjct: 537 ctcggcggcgaggccggtgcccttggagta 508
>dbj|AK107700.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-132-C10, full insert sequence Length = 618 Score = 305 bits (154), Expect = 1e-79 Identities = 238/266 (89%) Strand = Plus / Minus Query: 347 gcgatcgccgcgccgatcatggggccgacccagaagatccactgatcatcccaggccttg 406 ||||||||||| ||||| | || || ||||||||||||||||||||| ||| |||||| Sbjct: 339 gcgatcgccgccccgatgaacggcccaacccagaagatccactgatcactccatgccttg 280 Query: 407 tccttgttgtagatgacggcggcccccaggctcctggccgggttgatgccggtgccggtg 466 |||||||||| ||||||||| || |||||||| |||||||||||||||||||||||| Sbjct: 279 ctgttgttgtagacgacggcggcgccgaggctcctcgccgggttgatgccggtgccggtg 220 Query: 467 atcgggatggtggccaggtggaccatgaacacggcgaagccgatcgggaggggcgccaac 526 | |||||||| |||||||| ||||||||||||||||| |||||||| || ||||||||| Sbjct: 219 acggggatggtcgccaggtgcaccatgaacacggcgaacccgatcggcagcggcgccaac 160 Query: 527 accgggacgtgagagtcgcgtgcgctgcgcttggggtcggtggcggagaagacggtgtag 586 |||||||| || |||||||| ||| |||||||||||||||||||||||||||||||||| Sbjct: 159 accgggacatgggagtcgcgggcgttgcgcttggggtcggtggcggagaagacggtgtac 100 Query: 587 acgagcacgaaggtgccgatgatctc 612 |||||||||||||||||||||||||| Sbjct: 99 acgagcacgaaggtgccgatgatctc 74
>gb|AF388171.1|AF388171 Triticum boeoticum plasma membrane intrinsic protein 2 (PIP2) mRNA, partial cds Length = 411 Score = 301 bits (152), Expect = 2e-78 Identities = 224/248 (90%) Strand = Plus / Minus Query: 392 tcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttg 451 |||| ||||||| |||| |||||||||||||| || || |||| ||| || ||||||||| Sbjct: 407 tcattccaggccctgtctttgttgtagatgacagcagctcccaagcttctcgccgggttg 348 Query: 452 atgccggtgccggtgatcgggatggtggccaggtggaccatgaacacggcgaagccgatc 511 ||||||||||||||||| ||||||||||| ||||||||||||||||||||||| ||||| Sbjct: 347 atgccggtgccggtgatggggatggtggctaggtggaccatgaacacggcgaatccgatt 288 Query: 512 gggaggggcgccaacaccgggacgtgagagtcgcgtgcgctgcgcttggggtcggtggcg 571 ||||| || |||| |||||||| ||| ||||| || ||| |||||||||||||||||||| Sbjct: 287 gggagaggagccagcaccgggatgtgggagtcacgagcgttgcgcttggggtcggtggcg 228 Query: 572 gagaagacggtgtagacgagcacgaaggtgccgatgatctccgcggcgaggccggtgccc 631 ||||||||||||||||||||||||||||||||||||||||| || ||||| ||||||||| Sbjct: 227 gagaagacggtgtagacgagcacgaaggtgccgatgatctcggccgcgagcccggtgccc 168 Query: 632 ttggagta 639 |||||||| Sbjct: 167 ttggagta 160
>ref|XM_506303.1| PREDICTED Oryza sativa (japonica cultivar-group), P0475E07.134 mRNA Length = 619 Score = 299 bits (151), Expect = 6e-78 Identities = 235/263 (89%) Strand = Plus / Minus Query: 347 gcgatcgccgcgccgatcatggggccgacccagaagatccactgatcatcccaggccttg 406 ||||||||||| ||||| | || || ||||||||||||||||||||| ||| |||||| Sbjct: 340 gcgatcgccgccccgatgaacggcccaacccagaagatccactgatcactccatgccttg 281 Query: 407 tccttgttgtagatgacggcggcccccaggctcctggccgggttgatgccggtgccggtg 466 |||||||||| ||||||||| || |||||||| |||||||||||||||||||||||| Sbjct: 280 ctgttgttgtagacgacggcggcgccgaggctcctcgccgggttgatgccggtgccggtg 221 Query: 467 atcgggatggtggccaggtggaccatgaacacggcgaagccgatcgggaggggcgccaac 526 | |||||||| |||||||| ||||||||||||||||| |||||||| || ||||||||| Sbjct: 220 acggggatggtcgccaggtgcaccatgaacacggcgaacccgatcggcagcggcgccaac 161 Query: 527 accgggacgtgagagtcgcgtgcgctgcgcttggggtcggtggcggagaagacggtgtag 586 |||||||| || |||||||| ||| |||||||||||||||||||||||||||||||||| Sbjct: 160 accgggacatgggagtcgcgggcgttgcgcttggggtcggtggcggagaagacggtgtac 101 Query: 587 acgagcacgaaggtgccgatgat 609 ||||||||||||||||||||||| Sbjct: 100 acgagcacgaaggtgccgatgat 78
>dbj|AB219366.1| Hordeum vulgare HvPIP2;1 mRNA for PIP aquaporin, complete cds Length = 1318 Score = 299 bits (151), Expect = 6e-78 Identities = 271/311 (87%) Strand = Plus / Minus Query: 329 tactggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccac 388 |||||||||||| ||| || || || |||||||||| || || |||||||||||||| Sbjct: 944 tactggtggtaggcggcggcaatggcggcgccgatcagtggccccacccagaagatccat 885 Query: 389 tgatcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccggg 448 || ||||||||||||||||| ||||||||||||| || || |||| ||| || || ||| Sbjct: 884 tggtcatcccaggccttgtcagtgttgtagatgacagcagctcccaagcttctcgcgggg 825 Query: 449 ttgatgccggtgccggtgatcgggatggtggccaggtggaccatgaacacggcgaagccg 508 |||||||||||||||||||| ||||||||||||| ||||||||||||||| ||||| ||| Sbjct: 824 ttgatgccggtgccggtgatggggatggtggccaagtggaccatgaacacagcgaatccg 765 Query: 509 atcgggaggggcgccaacaccgggacgtgagagtcgcgtgcgctgcgcttggggtcggtg 568 || ||||| || |||| |||||||| ||| || || || ||| ||||||||||||||||| Sbjct: 764 attgggagaggagccagcaccgggatgtgggaatcacgggcgttgcgcttggggtcggtg 705 Query: 569 gcggagaagacggtgtagacgagcacgaaggtgccgatgatctccgcggcgaggccggtg 628 ||||||||||| |||||||||||||||||||||||||||||||| || || || |||||| Sbjct: 704 gcggagaagaccgtgtagacgagcacgaaggtgccgatgatctcggccgctagaccggtg 645 Query: 629 cccttggagta 639 ||||||||||| Sbjct: 644 cccttggagta 634
>gb|AF139815.1|AF139815 Triticum aestivum plasma membrane intrinsic protein 2 (PIP2) mRNA, complete cds Length = 1235 Score = 297 bits (150), Expect = 2e-77 Identities = 289/330 (87%), Gaps = 4/330 (1%) Strand = Plus / Minus Query: 310 ggcgccggccctgagtatgtactggtggtagaaggccgcgatcgccgcgccgatcatggg 369 ||||| |||||| || | ||||||||||||| ||| ||||| || |||||||||| || Sbjct: 875 ggcgctggccctcagcacgtactggtggtaggcggcggcgatggcggcgccgatcagcgg 816 Query: 370 gccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggc 429 || |||||||||||||| || ||||||||||||||||| |||||||||||||| || || Sbjct: 815 ccccacccagaagatccattggtcatcccaggccttgtctttgttgtagatgacagcagc 756 Query: 430 ccccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggac 489 |||| ||| || |||||||||||||||||||||||||| |||||||||| ||||||||| Sbjct: 755 tcccaagcttctcgccgggttgatgccggtgccggtgatggggatggtgg-caggtggac 697 Query: 490 catgaacacggcgaagccgatcgggaggggcgccaacaccgggacgtgagagtcgcgtgc 549 ||||||||||||||| ||||| ||||| || |||| |||||||| ||| ||||| || || Sbjct: 696 catgaacacggcgaatccgattgggagaggagccagcaccgggatgtgggagtcacgggc 637 Query: 550 gctgcgcttggggtcggtggcggagaagacggtgtagacgagcacgaaggtgccgatgat 609 | |||||||||||||||||||||||||||||| ||| |||||||||||||| |||||||| Sbjct: 636 gttgcgcttggggtcggtggcggagaagacgg-gta-acgagcacgaaggt-ccgatgat 580 Query: 610 ctccgcggcgaggccggtgcccttggagta 639 ||| || || || ||||||||||||||||| Sbjct: 579 ctcggccgcaagcccggtgcccttggagta 550
>dbj|AB009307.1| Hordeum vulgare HvPIP2;1 mRNA, complete cd Length = 1251 Score = 291 bits (147), Expect = 1e-75 Identities = 270/311 (86%) Strand = Plus / Minus Query: 329 tactggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccac 388 |||||||||||| ||| || || || |||||||||| || || |||||||||||||| Sbjct: 864 tactggtggtaggcggcggcaatggcggcgccgatcagtggccccacccagaagatccat 805 Query: 389 tgatcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccggg 448 || ||||||||||||||||| ||||||||||||| || || |||| ||| || || ||| Sbjct: 804 tggtcatcccaggccttgtcagtgttgtagatgacagcagctcccaagcttctcgcgggg 745 Query: 449 ttgatgccggtgccggtgatcgggatggtggccaggtggaccatgaacacggcgaagccg 508 |||||||||||||||||||| ||||||||||||| ||||||||||||||| ||||| ||| Sbjct: 744 ttgatgccggtgccggtgatggggatggtggccaagtggaccatgaacacagcgaatccg 685 Query: 509 atcgggaggggcgccaacaccgggacgtgagagtcgcgtgcgctgcgcttggggtcggtg 568 || ||||| || |||| |||||||| ||| || || || ||| ||||||||||||||||| Sbjct: 684 attgggagaggagccagcaccgggatgtgggaatcacgggcgttgcgcttggggtcggtg 625 Query: 569 gcggagaagacggtgtagacgagcacgaaggtgccgatgatctccgcggcgaggccggtg 628 ||||||||||| |||||||||||||||||||||||||||||||| || || || || ||| Sbjct: 624 gcggagaagaccgtgtagacgagcacgaaggtgccgatgatctcggccgctagaccagtg 565 Query: 629 cccttggagta 639 ||||||||||| Sbjct: 564 cccttggagta 554
>gb|AF326495.1|AF326495 Zea mays plasma membrane integral protein ZmPIP2-6 mRNA, complete cds Length = 1257 Score = 285 bits (144), Expect = 9e-74 Identities = 261/300 (87%) Strand = Plus / Minus Query: 347 gcgatcgccgcgccgatcatggggccgacccagaagatccactgatcatcccaggccttg 406 ||||||||||| ||||| | ||||| ||||||||||||||||| || |||||| ||| Sbjct: 884 gcgatcgccgctccgatgaacgggcccacccagaagatccactggtcgctccaggctttg 825 Query: 407 tccttgttgtagatgacggcggcccccaggctcctggccgggttgatgccggtgccggtg 466 |||||||| | ||||||||| || |||||||| ||||||||||| |||||||| ||| Sbjct: 824 ctgttgttgtacacgacggcggcgccgaggctcctcgccgggttgataccggtgccagtg 765 Query: 467 atcgggatggtggccaggtggaccatgaacacggcgaagccgatcgggaggggcgccaac 526 |||||||| || |||||||| ||||||||||| ||||| |||||||| || ||||||| | Sbjct: 764 atcgggatcgtcgccaggtgcaccatgaacacagcgaacccgatcggaagcggcgccagc 705 Query: 527 accgggacgtgagagtcgcgtgcgctgcgcttggggtcggtggcggagaagacggtgtag 586 ||||| ||||| |||||||| ||| ||||||||||||||||||||||||||||||||||| Sbjct: 704 accggaacgtgggagtcgcgagcgttgcgcttggggtcggtggcggagaagacggtgtag 645 Query: 587 acgagcacgaaggtgccgatgatctccgcggcgaggccggtgcccttggagtatccggcg 646 |||||||||||||| ||||||||||| |||||||| || ||||| ||||||| |||||| Sbjct: 644 acgagcacgaaggtaccgatgatctcggcggcgagccccgtgccggtggagtacccggcg 585
>ref|XM_475029.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 849 Score = 264 bits (133), Expect = 3e-67 Identities = 232/265 (87%) Strand = Plus / Minus Query: 375 cccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccca 434 ||||||||||||| || || ||||| ||||| | || |||||||||||||||||| || | Sbjct: 742 cccagaagatccagtggtcgtcccatgccttcttctggttgtagatgacggcggcgccga 683 Query: 435 ggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatga 494 ||||| ||| ||||||||||| ||||||||||| ||||||||||||||||| ||||||| Sbjct: 682 tgctccgggcagggttgatgcccgtgccggtgatggggatggtggccaggtgcaccatga 623 Query: 495 acacggcgaagccgatcgggaggggcgccaacaccgggacgtgagagtcgcgtgcgctgc 554 |||||||||| ||||| || || ||||| | |||||||||||| |||||||| || ||| Sbjct: 622 acacggcgaacccgatgggcagcggcgcgagcaccgggacgtgggagtcgcgggcattgc 563 Query: 555 gcttggggtcggtggcggagaagacggtgtagacgagcacgaaggtgccgatgatctccg 614 |||| |||||||||||||||||||||||||||||||| ||||||||||||||||| || | Sbjct: 562 gctttgggtcggtggcggagaagacggtgtagacgaggacgaaggtgccgatgatttcgg 503 Query: 615 cggcgaggccggtgcccttggagta 639 || ||||| ||||||| ||||||| Sbjct: 502 cgccgagggcggtgccggtggagta 478 Score = 50.1 bits (25), Expect = 0.009 Identities = 49/57 (85%) Strand = Plus / Minus Query: 280 gttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggtg 336 |||||||| ||||||||| || ||||||||||| | |||| ||| ||||||||||| Sbjct: 837 gttgctccggaaggagcccagcgccttgatggctgccgcccggaggatgtactggtg 781
>dbj|AK119661.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-141-B01, full insert sequence Length = 1067 Score = 264 bits (133), Expect = 3e-67 Identities = 232/265 (87%) Strand = Plus / Minus Query: 375 cccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccca 434 ||||||||||||| || || ||||| ||||| | || |||||||||||||||||| || | Sbjct: 728 cccagaagatccagtggtcgtcccatgccttcttctggttgtagatgacggcggcgccga 669 Query: 435 ggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatga 494 ||||| ||| ||||||||||| ||||||||||| ||||||||||||||||| ||||||| Sbjct: 668 tgctccgggcagggttgatgcccgtgccggtgatggggatggtggccaggtgcaccatga 609 Query: 495 acacggcgaagccgatcgggaggggcgccaacaccgggacgtgagagtcgcgtgcgctgc 554 |||||||||| ||||| || || ||||| | |||||||||||| |||||||| || ||| Sbjct: 608 acacggcgaacccgatgggcagcggcgcgagcaccgggacgtgggagtcgcgggcattgc 549 Query: 555 gcttggggtcggtggcggagaagacggtgtagacgagcacgaaggtgccgatgatctccg 614 |||| |||||||||||||||||||||||||||||||| ||||||||||||||||| || | Sbjct: 548 gctttgggtcggtggcggagaagacggtgtagacgaggacgaaggtgccgatgatttcgg 489 Query: 615 cggcgaggccggtgcccttggagta 639 || ||||| ||||||| ||||||| Sbjct: 488 cgccgagggcggtgccggtggagta 464 Score = 46.1 bits (23), Expect = 0.15 Identities = 47/55 (85%) Strand = Plus / Minus Query: 282 tgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggtg 336 |||||| ||||||||| || ||||||||||| | |||| ||| ||||||||||| Sbjct: 821 tgctccggaaggagcccagcgccttgatggctgccgcccggaggatgtactggtg 767
>dbj|AK102155.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033086E18, full insert sequence Length = 1308 Score = 264 bits (133), Expect = 3e-67 Identities = 232/265 (87%) Strand = Plus / Minus Query: 375 cccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccca 434 ||||||||||||| || || ||||| ||||| | || |||||||||||||||||| || | Sbjct: 841 cccagaagatccagtggtcgtcccatgccttcttctggttgtagatgacggcggcgccga 782 Query: 435 ggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatga 494 ||||| ||| ||||||||||| ||||||||||| ||||||||||||||||| ||||||| Sbjct: 781 tgctccgggcagggttgatgcccgtgccggtgatggggatggtggccaggtgcaccatga 722 Query: 495 acacggcgaagccgatcgggaggggcgccaacaccgggacgtgagagtcgcgtgcgctgc 554 |||||||||| ||||| || || ||||| | |||||||||||| |||||||| || ||| Sbjct: 721 acacggcgaacccgatgggcagcggcgcgagcaccgggacgtgggagtcgcgggcattgc 662 Query: 555 gcttggggtcggtggcggagaagacggtgtagacgagcacgaaggtgccgatgatctccg 614 |||| |||||||||||||||||||||||||||||||| ||||||||||||||||| || | Sbjct: 661 gctttgggtcggtggcggagaagacggtgtagacgaggacgaaggtgccgatgatttcgg 602 Query: 615 cggcgaggccggtgcccttggagta 639 || ||||| ||||||| ||||||| Sbjct: 601 cgccgagggcggtgccggtggagta 577 Score = 50.1 bits (25), Expect = 0.009 Identities = 49/57 (85%) Strand = Plus / Minus Query: 280 gttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggtg 336 |||||||| ||||||||| || ||||||||||| | |||| ||| ||||||||||| Sbjct: 936 gttgctccggaaggagcccagcgccttgatggctgccgcccggaggatgtactggtg 880
>dbj|AK061491.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-309-B05, full insert sequence Length = 1309 Score = 264 bits (133), Expect = 3e-67 Identities = 232/265 (87%) Strand = Plus / Minus Query: 375 cccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccca 434 ||||||||||||| || || ||||| ||||| | || |||||||||||||||||| || | Sbjct: 835 cccagaagatccagtggtcgtcccatgccttcttctggttgtagatgacggcggcgccga 776 Query: 435 ggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatga 494 ||||| ||| ||||||||||| ||||||||||| ||||||||||||||||| ||||||| Sbjct: 775 tgctccgggcagggttgatgcccgtgccggtgatggggatggtggccaggtgcaccatga 716 Query: 495 acacggcgaagccgatcgggaggggcgccaacaccgggacgtgagagtcgcgtgcgctgc 554 |||||||||| ||||| || || ||||| | |||||||||||| |||||||| || ||| Sbjct: 715 acacggcgaacccgatgggcagcggcgcgagcaccgggacgtgggagtcgcgggcattgc 656 Query: 555 gcttggggtcggtggcggagaagacggtgtagacgagcacgaaggtgccgatgatctccg 614 |||| |||||||||||||||||||||||||||||||| ||||||||||||||||| || | Sbjct: 655 gctttgggtcggtggcggagaagacggtgtagacgaggacgaaggtgccgatgatttcgg 596 Query: 615 cggcgaggccggtgcccttggagta 639 || ||||| ||||||| ||||||| Sbjct: 595 cgccgagggcggtgccggtggagta 571 Score = 50.1 bits (25), Expect = 0.009 Identities = 49/57 (85%) Strand = Plus / Minus Query: 280 gttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggtg 336 |||||||| ||||||||| || ||||||||||| | |||| ||| ||||||||||| Sbjct: 930 gttgctccggaaggagcccagcgccttgatggctgccgcccggaggatgtactggtg 874
>dbj|AK061312.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-302-B10, full insert sequence Length = 1296 Score = 264 bits (133), Expect = 3e-67 Identities = 232/265 (87%) Strand = Plus / Minus Query: 375 cccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccca 434 ||||||||||||| || || ||||| ||||| | || |||||||||||||||||| || | Sbjct: 829 cccagaagatccagtggtcgtcccatgccttcttctggttgtagatgacggcggcgccga 770 Query: 435 ggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatga 494 ||||| ||| ||||||||||| ||||||||||| ||||||||||||||||| ||||||| Sbjct: 769 tgctccgggcagggttgatgcccgtgccggtgatggggatggtggccaggtgcaccatga 710 Query: 495 acacggcgaagccgatcgggaggggcgccaacaccgggacgtgagagtcgcgtgcgctgc 554 |||||||||| ||||| || || ||||| | |||||||||||| |||||||| || ||| Sbjct: 709 acacggcgaacccgatgggcagcggcgcgagcaccgggacgtgggagtcgcgggcattgc 650 Query: 555 gcttggggtcggtggcggagaagacggtgtagacgagcacgaaggtgccgatgatctccg 614 |||| |||||||||||||||||||||||||||||||| ||||||||||||||||| || | Sbjct: 649 gctttgggtcggtggcggagaagacggtgtagacgaggacgaaggtgccgatgatttcgg 590 Query: 615 cggcgaggccggtgcccttggagta 639 || ||||| ||||||| ||||||| Sbjct: 589 cgccgagggcggtgccggtggagta 565 Score = 50.1 bits (25), Expect = 0.009 Identities = 49/57 (85%) Strand = Plus / Minus Query: 280 gttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggtg 336 |||||||| ||||||||| || ||||||||||| | |||| ||| ||||||||||| Sbjct: 924 gttgctccggaaggagcccagcgccttgatggctgccgcccggaggatgtactggtg 868
>ref|NM_197034.1| Oryza sativa (japonica cultivar-group) putative aquaporin (OSJNBa0093B11.9), mRNA Length = 729 Score = 234 bits (118), Expect = 3e-58 Identities = 229/266 (86%) Strand = Plus / Minus Query: 374 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 433 |||||||||||||||||||| | ||| || ||| || |||||||| ||||||||| || Sbjct: 626 acccagaagatccactgatcgtgccaagcattgggctggttgtagacgacggcggcgccg 567 Query: 434 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 493 | |||||| ||||| |||||||| ||||||||||||||||||||||| ||||| |||| | Sbjct: 566 aagctcctcgccggattgatgcccgtgccggtgatcgggatggtggcgaggtgcaccacg 507 Query: 494 aacacggcgaagccgatcgggaggggcgccaacaccgggacgtgagagtcgcgtgcgctg 553 ||||| ||||| ||||| || | |||||||||||||||| ||| |||||| |||||| Sbjct: 506 aacaccgcgaaaccgatgggcaatggcgccaacaccgggatgtggctgtcgcgcgcgctg 447 Query: 554 cgcttggggtcggtggcggagaagacggtgtagacgagcacgaaggtgccgatgatctcc 613 ||||||| |||||||||||||||||||||||| ||||||||||| |||||| || ||| Sbjct: 446 cgcttggcgtcggtggcggagaagacggtgtacacgagcacgaacgtgccggcgacctcg 387 Query: 614 gcggcgaggccggtgcccttggagta 639 |||||||| |||| |||||||||||| Sbjct: 386 gcggcgagcccggcgcccttggagta 361
>emb|X76911.1|HVEMIP H.vulgare mRNA for transmembrane protein Length = 1225 Score = 234 bits (118), Expect = 3e-58 Identities = 265/314 (84%) Strand = Plus / Minus Query: 331 ctggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactg 390 ||||||||||| ||| || | ||| |||||||| | ||||||||||||||||||||| || Sbjct: 898 ctggtggtagatggcggccagcgcggcgccgatgaaggggccgacccagaagatccagtg 839 Query: 391 atcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggtt 450 || |||||| | ||| |||||||||||| ||| || || |||||||| |||||||| Sbjct: 838 gtctgaccaggcgtgctccctgttgtagatgatggccgcgccgaggctcctcgccgggtt 779 Query: 451 gatgccggtgccggtgatcgggatggtggccaggtggaccatgaacacggcgaagccgat 510 |||||||||||||||||| |||||||||||||||||||||| |||||||||||| ||||| Sbjct: 778 gatgccggtgccggtgatggggatggtggccaggtggaccaggaacacggcgaacccgat 719 Query: 511 cgggaggggcgccaacaccgggacgtgagagtcgcgtgcgctgcgcttggggtcggtggc 570 || || || || | | || ||||| ||||| | ||| | | ||||| ||||||||| Sbjct: 718 gggcagcggggcgaggatgggaacgtgggagtccctggcgttcctcttggcgtcggtggc 659 Query: 571 ggagaagacggtgtagacgagcacgaaggtgccgatgatctccgcggcgaggccggtgcc 630 ||||||||||||||||||||| |||||||||||||||||||| ||| |||| |||| ||| Sbjct: 658 ggagaagacggtgtagacgaggacgaaggtgccgatgatctcggcgccgagcccggagcc 599 Query: 631 cttggagtatccgg 644 ||||| ||| |||| Sbjct: 598 cttggtgtagccgg 585
>dbj|AK106746.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-115-C02, full insert sequence Length = 1232 Score = 234 bits (118), Expect = 3e-58 Identities = 229/266 (86%) Strand = Plus / Minus Query: 374 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 433 |||||||||||||||||||| | ||| || ||| || |||||||| ||||||||| || Sbjct: 808 acccagaagatccactgatcgtgccaagcattgggctggttgtagacgacggcggcgccg 749 Query: 434 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 493 | |||||| ||||| |||||||| ||||||||||||||||||||||| ||||| |||| | Sbjct: 748 aagctcctcgccggattgatgcccgtgccggtgatcgggatggtggcgaggtgcaccacg 689 Query: 494 aacacggcgaagccgatcgggaggggcgccaacaccgggacgtgagagtcgcgtgcgctg 553 ||||| ||||| ||||| || | |||||||||||||||| ||| |||||| |||||| Sbjct: 688 aacaccgcgaaaccgatgggcaatggcgccaacaccgggatgtggctgtcgcgcgcgctg 629 Query: 554 cgcttggggtcggtggcggagaagacggtgtagacgagcacgaaggtgccgatgatctcc 613 ||||||| |||||||||||||||||||||||| ||||||||||| |||||| || ||| Sbjct: 628 cgcttggcgtcggtggcggagaagacggtgtacacgagcacgaacgtgccggcgacctcg 569 Query: 614 gcggcgaggccggtgcccttggagta 639 |||||||| |||| |||||||||||| Sbjct: 568 gcggcgagcccggcgcccttggagta 543
>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete sequence Length = 29644043 Score = 216 bits (109), Expect = 7e-53 Identities = 130/137 (94%) Strand = Plus / Minus Query: 527 accgggacgtgagagtcgcgtgcgctgcgcttggggtcggtggcggagaagacggtgtag 586 |||||||| || |||||||| ||| ||||||||||||||||||||||||||||||||||| Sbjct: 15353591 accgggacatgtgagtcgcgggcgttgcgcttggggtcggtggcggagaagacggtgtag 15353532 Query: 587 acgagcacgaaggtgccgatgatctccgcggcgaggccggtgcccttggagtatccggcg 646 |||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||| Sbjct: 15353531 acgagcacgaaggtgccgatgatctcggcggcgaggccggtgcccttggagtagccggcg 15353472 Query: 647 gcgagcgtgttggcgcc 663 ||||| ||||||||||| Sbjct: 15353471 gcgagggtgttggcgcc 15353455 Score = 200 bits (101), Expect = 4e-48 Identities = 128/137 (93%) Strand = Plus / Minus Query: 527 accgggacgtgagagtcgcgtgcgctgcgcttggggtcggtggcggagaagacggtgtag 586 |||||||| || |||||||| ||| |||||||||||||||||||||||||||||||||| Sbjct: 15324024 accgggacatgggagtcgcgggcgttgcgcttggggtcggtggcggagaagacggtgtac 15323965 Query: 587 acgagcacgaaggtgccgatgatctccgcggcgaggccggtgcccttggagtatccggcg 646 |||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||| Sbjct: 15323964 acgagcacgaaggtgccgatgatctcggcggcgaggccggtgcccttggagtagccggcg 15323905 Query: 647 gcgagcgtgttggcgcc 663 |||||| ||||||||| Sbjct: 15323904 gcgagctcgttggcgcc 15323888 Score = 176 bits (89), Expect = 6e-41 Identities = 116/125 (92%) Strand = Plus / Minus Query: 539 gagtcgcgtgcgctgcgcttggggtcggtggcggagaagacggtgtagacgagcacgaag 598 |||||||| ||| |||||||||||||||||||||||||||||||||| || |||||||| Sbjct: 15316144 gagtcgcgggcgttgcgcttggggtcggtggcggagaagacggtgtacaccagcacgaac 15316085 Query: 599 gtgccgatgatctccgcggcgaggccggtgcccttggagtatccggcggcgagcgtgttg 658 ||||||||||||||||||||||||||||||||| ||||||| |||||||||||| |||| Sbjct: 15316084 gtgccgatgatctccgcggcgaggccggtgcccgtggagtagccggcggcgagctcgttg 15316025 Query: 659 gcgcc 663 ||||| Sbjct: 15316024 gcgcc 15316020 Score = 168 bits (85), Expect = 1e-38 Identities = 115/125 (92%) Strand = Plus / Minus Query: 539 gagtcgcgtgcgctgcgcttggggtcggtggcggagaagacggtgtagacgagcacgaag 598 |||||||| ||| |||||||||| ||||||||||||||||||||||| |||||||||||| Sbjct: 15306072 gagtcgcgggcgttgcgcttgggatcggtggcggagaagacggtgtacacgagcacgaag 15306013 Query: 599 gtgccgatgatctccgcggcgaggccggtgcccttggagtatccggcggcgagcgtgttg 658 |||||||||||||| ||||||||||||||||| ||||||| |||||||||||| |||| Sbjct: 15306012 gtgccgatgatctcggcggcgaggccggtgccggtggagtagccggcggcgagctcgttg 15305953 Query: 659 gcgcc 663 ||||| Sbjct: 15305952 gcgcc 15305948 Score = 153 bits (77), Expect = 9e-34 Identities = 113/125 (90%) Strand = Plus / Minus Query: 401 gccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttgatgccggtg 460 ||||| || |||||| |||||||||| || || | ||||||||||||||||||||||||| Sbjct: 15355603 gccttctcgttgttgaagatgacggccgctccgatgctcctggccgggttgatgccggtg 15355544 Query: 461 ccggtgatcgggatggtggccaggtggaccatgaacacggcgaagccgatcgggaggggc 520 |||||||||||||| || |||||||||||||||||||||||||||||||| || || ||| Sbjct: 15355543 ccggtgatcgggatcgtcgccaggtggaccatgaacacggcgaagccgattggcagcggc 15355484 Query: 521 gccaa 525 ||||| Sbjct: 15355483 gccaa 15355479 Score = 151 bits (76), Expect = 3e-33 Identities = 109/120 (90%) Strand = Plus / Minus Query: 410 ttgttgtagatgacggcggcccccaggctcctggccgggttgatgccggtgccggtgatc 469 |||||||||| ||||||||| || |||||||| ||||||||||||||||||||||||| Sbjct: 15324236 ttgttgtagacgacggcggcgccgaggctcctcgccgggttgatgccggtgccggtgacg 15324177 Query: 470 gggatggtggccaggtggaccatgaacacggcgaagccgatcgggaggggcgccaacacc 529 |||||||| |||||||| ||||||||||||||||| |||||||| || |||||||||||| Sbjct: 15324176 gggatggtcgccaggtgcaccatgaacacggcgaacccgatcggcagcggcgccaacacc 15324117 Score = 151 bits (76), Expect = 3e-33 Identities = 109/120 (90%) Strand = Plus / Minus Query: 410 ttgttgtagatgacggcggcccccaggctcctggccgggttgatgccggtgccggtgatc 469 |||||||| ||||||||||| || |||||||| ||||||||||||||||||||||||||| Sbjct: 15316356 ttgttgtacatgacggcggcgccgaggctcctcgccgggttgatgccggtgccggtgatc 15316297 Query: 470 gggatggtggccaggtggaccatgaacacggcgaagccgatcgggaggggcgccaacacc 529 ||||| || |||||||| ||||||||||| ||||| |||||||| || |||||||||||| Sbjct: 15316296 gggatcgtcgccaggtgcaccatgaacaccgcgaacccgatcggcagcggcgccaacacc 15316237 Score = 149 bits (75), Expect = 1e-32 Identities = 105/115 (91%) Strand = Plus / Minus Query: 276 acgcgttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggt 335 |||||||||||||||||||||||||||| |||||||||||||||| ||| |||||||||| Sbjct: 15355852 acgcgttgctcctgaaggagccgagggctttgatggcgccggcccggaggatgtactggt 15355793 Query: 336 ggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactg 390 ||||||| |||||||| || ||||||| | ||||||||||||||||||||||| Sbjct: 15355792 ggtagaacgccgcgatggcggcgccgacgaacgggccgacccagaagatccactg 15355738 Score = 139 bits (70), Expect = 1e-29 Identities = 124/142 (87%) Strand = Plus / Minus Query: 388 ctgatcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgg 447 ||||||| ||||||||||| |||||||||| |||||| | || |||||||||||||| Sbjct: 15306327 ctgatcactccaggccttgttgttgttgtagaccacggcgacgccgaggctcctggccgg 15306268 Query: 448 gttgatgccggtgccggtgatcgggatggtggccaggtggaccatgaacacggcgaagcc 507 ||||||||||||||||||||||||||| || |||||||| ||||||||||| ||||| || Sbjct: 15306267 gttgatgccggtgccggtgatcgggatcgtcgccaggtgcaccatgaacaccgcgaaccc 15306208 Query: 508 gatcgggaggggcgccaacacc 529 ||| || || || ||||||||| Sbjct: 15306207 gattggcagcggagccaacacc 15306186 Score = 56.0 bits (28), Expect = 2e-04 Identities = 52/60 (86%) Strand = Plus / Minus Query: 331 ctggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactg 390 ||||||||| | |||||||||||||| ||||| | || |||||||||||||||||||| Sbjct: 15316534 ctggtggtacagcgccgcgatcgccgccccgatgaacggcccgacccagaagatccactg 15316475 Score = 56.0 bits (28), Expect = 2e-04 Identities = 52/60 (86%) Strand = Plus / Minus Query: 331 ctggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactg 390 ||||||||| | |||||||||||||||||||| | || || ||||||||||||||||| Sbjct: 15306498 ctggtggtacagcgccgcgatcgccgcgccgatgaacggcccaacccagaagatccactg 15306439 Score = 40.1 bits (20), Expect = 9.1 Identities = 38/44 (86%) Strand = Plus / Minus Query: 347 gcgatcgccgcgccgatcatggggccgacccagaagatccactg 390 ||||||||||| ||||| | || || ||||||||||||||||| Sbjct: 15324431 gcgatcgccgccccgatgaacggcccaacccagaagatccactg 15324388 Score = 40.1 bits (20), Expect = 9.1 Identities = 23/24 (95%) Strand = Plus / Minus Query: 275 tacgcgttgctcctgaaggagccg 298 ||||||||||||| |||||||||| Sbjct: 15306551 tacgcgttgctccggaaggagccg 15306528
>dbj|AP003802.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OJ1047_A06 Length = 111673 Score = 216 bits (109), Expect = 7e-53 Identities = 130/137 (94%) Strand = Plus / Minus Query: 527 accgggacgtgagagtcgcgtgcgctgcgcttggggtcggtggcggagaagacggtgtag 586 |||||||| || |||||||| ||| ||||||||||||||||||||||||||||||||||| Sbjct: 60590 accgggacatgtgagtcgcgggcgttgcgcttggggtcggtggcggagaagacggtgtag 60531 Query: 587 acgagcacgaaggtgccgatgatctccgcggcgaggccggtgcccttggagtatccggcg 646 |||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||| Sbjct: 60530 acgagcacgaaggtgccgatgatctcggcggcgaggccggtgcccttggagtagccggcg 60471 Query: 647 gcgagcgtgttggcgcc 663 ||||| ||||||||||| Sbjct: 60470 gcgagggtgttggcgcc 60454 Score = 200 bits (101), Expect = 4e-48 Identities = 128/137 (93%) Strand = Plus / Minus Query: 527 accgggacgtgagagtcgcgtgcgctgcgcttggggtcggtggcggagaagacggtgtag 586 |||||||| || |||||||| ||| |||||||||||||||||||||||||||||||||| Sbjct: 31023 accgggacatgggagtcgcgggcgttgcgcttggggtcggtggcggagaagacggtgtac 30964 Query: 587 acgagcacgaaggtgccgatgatctccgcggcgaggccggtgcccttggagtatccggcg 646 |||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||| Sbjct: 30963 acgagcacgaaggtgccgatgatctcggcggcgaggccggtgcccttggagtagccggcg 30904 Query: 647 gcgagcgtgttggcgcc 663 |||||| ||||||||| Sbjct: 30903 gcgagctcgttggcgcc 30887 Score = 176 bits (89), Expect = 6e-41 Identities = 116/125 (92%) Strand = Plus / Minus Query: 539 gagtcgcgtgcgctgcgcttggggtcggtggcggagaagacggtgtagacgagcacgaag 598 |||||||| ||| |||||||||||||||||||||||||||||||||| || |||||||| Sbjct: 23143 gagtcgcgggcgttgcgcttggggtcggtggcggagaagacggtgtacaccagcacgaac 23084 Query: 599 gtgccgatgatctccgcggcgaggccggtgcccttggagtatccggcggcgagcgtgttg 658 ||||||||||||||||||||||||||||||||| ||||||| |||||||||||| |||| Sbjct: 23083 gtgccgatgatctccgcggcgaggccggtgcccgtggagtagccggcggcgagctcgttg 23024 Query: 659 gcgcc 663 ||||| Sbjct: 23023 gcgcc 23019 Score = 168 bits (85), Expect = 1e-38 Identities = 115/125 (92%) Strand = Plus / Minus Query: 539 gagtcgcgtgcgctgcgcttggggtcggtggcggagaagacggtgtagacgagcacgaag 598 |||||||| ||| |||||||||| ||||||||||||||||||||||| |||||||||||| Sbjct: 13071 gagtcgcgggcgttgcgcttgggatcggtggcggagaagacggtgtacacgagcacgaag 13012 Query: 599 gtgccgatgatctccgcggcgaggccggtgcccttggagtatccggcggcgagcgtgttg 658 |||||||||||||| ||||||||||||||||| ||||||| |||||||||||| |||| Sbjct: 13011 gtgccgatgatctcggcggcgaggccggtgccggtggagtagccggcggcgagctcgttg 12952 Query: 659 gcgcc 663 ||||| Sbjct: 12951 gcgcc 12947 Score = 153 bits (77), Expect = 9e-34 Identities = 113/125 (90%) Strand = Plus / Minus Query: 401 gccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttgatgccggtg 460 ||||| || |||||| |||||||||| || || | ||||||||||||||||||||||||| Sbjct: 62602 gccttctcgttgttgaagatgacggccgctccgatgctcctggccgggttgatgccggtg 62543 Query: 461 ccggtgatcgggatggtggccaggtggaccatgaacacggcgaagccgatcgggaggggc 520 |||||||||||||| || |||||||||||||||||||||||||||||||| || || ||| Sbjct: 62542 ccggtgatcgggatcgtcgccaggtggaccatgaacacggcgaagccgattggcagcggc 62483 Query: 521 gccaa 525 ||||| Sbjct: 62482 gccaa 62478 Score = 151 bits (76), Expect = 3e-33 Identities = 109/120 (90%) Strand = Plus / Minus Query: 410 ttgttgtagatgacggcggcccccaggctcctggccgggttgatgccggtgccggtgatc 469 |||||||||| ||||||||| || |||||||| ||||||||||||||||||||||||| Sbjct: 31235 ttgttgtagacgacggcggcgccgaggctcctcgccgggttgatgccggtgccggtgacg 31176 Query: 470 gggatggtggccaggtggaccatgaacacggcgaagccgatcgggaggggcgccaacacc 529 |||||||| |||||||| ||||||||||||||||| |||||||| || |||||||||||| Sbjct: 31175 gggatggtcgccaggtgcaccatgaacacggcgaacccgatcggcagcggcgccaacacc 31116 Score = 151 bits (76), Expect = 3e-33 Identities = 109/120 (90%) Strand = Plus / Minus Query: 410 ttgttgtagatgacggcggcccccaggctcctggccgggttgatgccggtgccggtgatc 469 |||||||| ||||||||||| || |||||||| ||||||||||||||||||||||||||| Sbjct: 23355 ttgttgtacatgacggcggcgccgaggctcctcgccgggttgatgccggtgccggtgatc 23296 Query: 470 gggatggtggccaggtggaccatgaacacggcgaagccgatcgggaggggcgccaacacc 529 ||||| || |||||||| ||||||||||| ||||| |||||||| || |||||||||||| Sbjct: 23295 gggatcgtcgccaggtgcaccatgaacaccgcgaacccgatcggcagcggcgccaacacc 23236 Score = 149 bits (75), Expect = 1e-32 Identities = 105/115 (91%) Strand = Plus / Minus Query: 276 acgcgttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggt 335 |||||||||||||||||||||||||||| |||||||||||||||| ||| |||||||||| Sbjct: 62851 acgcgttgctcctgaaggagccgagggctttgatggcgccggcccggaggatgtactggt 62792 Query: 336 ggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactg 390 ||||||| |||||||| || ||||||| | ||||||||||||||||||||||| Sbjct: 62791 ggtagaacgccgcgatggcggcgccgacgaacgggccgacccagaagatccactg 62737 Score = 139 bits (70), Expect = 1e-29 Identities = 124/142 (87%) Strand = Plus / Minus Query: 388 ctgatcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgg 447 ||||||| ||||||||||| |||||||||| |||||| | || |||||||||||||| Sbjct: 13326 ctgatcactccaggccttgttgttgttgtagaccacggcgacgccgaggctcctggccgg 13267 Query: 448 gttgatgccggtgccggtgatcgggatggtggccaggtggaccatgaacacggcgaagcc 507 ||||||||||||||||||||||||||| || |||||||| ||||||||||| ||||| || Sbjct: 13266 gttgatgccggtgccggtgatcgggatcgtcgccaggtgcaccatgaacaccgcgaaccc 13207 Query: 508 gatcgggaggggcgccaacacc 529 ||| || || || ||||||||| Sbjct: 13206 gattggcagcggagccaacacc 13185 Score = 56.0 bits (28), Expect = 2e-04 Identities = 52/60 (86%) Strand = Plus / Minus Query: 331 ctggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactg 390 ||||||||| | |||||||||||||| ||||| | || |||||||||||||||||||| Sbjct: 23533 ctggtggtacagcgccgcgatcgccgccccgatgaacggcccgacccagaagatccactg 23474 Score = 56.0 bits (28), Expect = 2e-04 Identities = 52/60 (86%) Strand = Plus / Minus Query: 331 ctggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactg 390 ||||||||| | |||||||||||||||||||| | || || ||||||||||||||||| Sbjct: 13497 ctggtggtacagcgccgcgatcgccgcgccgatgaacggcccaacccagaagatccactg 13438 Score = 40.1 bits (20), Expect = 9.1 Identities = 38/44 (86%) Strand = Plus / Minus Query: 347 gcgatcgccgcgccgatcatggggccgacccagaagatccactg 390 ||||||||||| ||||| | || || ||||||||||||||||| Sbjct: 31430 gcgatcgccgccccgatgaacggcccaacccagaagatccactg 31387 Score = 40.1 bits (20), Expect = 9.1 Identities = 23/24 (95%) Strand = Plus / Minus Query: 275 tacgcgttgctcctgaaggagccg 298 ||||||||||||| |||||||||| Sbjct: 13550 tacgcgttgctccggaaggagccg 13527
>dbj|AP004668.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC clone:P0475E07 Length = 139961 Score = 216 bits (109), Expect = 7e-53 Identities = 130/137 (94%) Strand = Plus / Minus Query: 527 accgggacgtgagagtcgcgtgcgctgcgcttggggtcggtggcggagaagacggtgtag 586 |||||||| || |||||||| ||| ||||||||||||||||||||||||||||||||||| Sbjct: 139604 accgggacatgtgagtcgcgggcgttgcgcttggggtcggtggcggagaagacggtgtag 139545 Query: 587 acgagcacgaaggtgccgatgatctccgcggcgaggccggtgcccttggagtatccggcg 646 |||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||| Sbjct: 139544 acgagcacgaaggtgccgatgatctcggcggcgaggccggtgcccttggagtagccggcg 139485 Query: 647 gcgagcgtgttggcgcc 663 ||||| ||||||||||| Sbjct: 139484 gcgagggtgttggcgcc 139468 Score = 200 bits (101), Expect = 4e-48 Identities = 128/137 (93%) Strand = Plus / Minus Query: 527 accgggacgtgagagtcgcgtgcgctgcgcttggggtcggtggcggagaagacggtgtag 586 |||||||| || |||||||| ||| |||||||||||||||||||||||||||||||||| Sbjct: 110037 accgggacatgggagtcgcgggcgttgcgcttggggtcggtggcggagaagacggtgtac 109978 Query: 587 acgagcacgaaggtgccgatgatctccgcggcgaggccggtgcccttggagtatccggcg 646 |||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||| Sbjct: 109977 acgagcacgaaggtgccgatgatctcggcggcgaggccggtgcccttggagtagccggcg 109918 Query: 647 gcgagcgtgttggcgcc 663 |||||| ||||||||| Sbjct: 109917 gcgagctcgttggcgcc 109901 Score = 176 bits (89), Expect = 6e-41 Identities = 116/125 (92%) Strand = Plus / Minus Query: 539 gagtcgcgtgcgctgcgcttggggtcggtggcggagaagacggtgtagacgagcacgaag 598 |||||||| ||| |||||||||||||||||||||||||||||||||| || |||||||| Sbjct: 102157 gagtcgcgggcgttgcgcttggggtcggtggcggagaagacggtgtacaccagcacgaac 102098 Query: 599 gtgccgatgatctccgcggcgaggccggtgcccttggagtatccggcggcgagcgtgttg 658 ||||||||||||||||||||||||||||||||| ||||||| |||||||||||| |||| Sbjct: 102097 gtgccgatgatctccgcggcgaggccggtgcccgtggagtagccggcggcgagctcgttg 102038 Query: 659 gcgcc 663 ||||| Sbjct: 102037 gcgcc 102033 Score = 168 bits (85), Expect = 1e-38 Identities = 115/125 (92%) Strand = Plus / Minus Query: 539 gagtcgcgtgcgctgcgcttggggtcggtggcggagaagacggtgtagacgagcacgaag 598 |||||||| ||| |||||||||| ||||||||||||||||||||||| |||||||||||| Sbjct: 92085 gagtcgcgggcgttgcgcttgggatcggtggcggagaagacggtgtacacgagcacgaag 92026 Query: 599 gtgccgatgatctccgcggcgaggccggtgcccttggagtatccggcggcgagcgtgttg 658 |||||||||||||| ||||||||||||||||| ||||||| |||||||||||| |||| Sbjct: 92025 gtgccgatgatctcggcggcgaggccggtgccggtggagtagccggcggcgagctcgttg 91966 Query: 659 gcgcc 663 ||||| Sbjct: 91965 gcgcc 91961 Score = 151 bits (76), Expect = 3e-33 Identities = 109/120 (90%) Strand = Plus / Minus Query: 410 ttgttgtagatgacggcggcccccaggctcctggccgggttgatgccggtgccggtgatc 469 |||||||||| ||||||||| || |||||||| ||||||||||||||||||||||||| Sbjct: 110249 ttgttgtagacgacggcggcgccgaggctcctcgccgggttgatgccggtgccggtgacg 110190 Query: 470 gggatggtggccaggtggaccatgaacacggcgaagccgatcgggaggggcgccaacacc 529 |||||||| |||||||| ||||||||||||||||| |||||||| || |||||||||||| Sbjct: 110189 gggatggtcgccaggtgcaccatgaacacggcgaacccgatcggcagcggcgccaacacc 110130 Score = 151 bits (76), Expect = 3e-33 Identities = 109/120 (90%) Strand = Plus / Minus Query: 410 ttgttgtagatgacggcggcccccaggctcctggccgggttgatgccggtgccggtgatc 469 |||||||| ||||||||||| || |||||||| ||||||||||||||||||||||||||| Sbjct: 102369 ttgttgtacatgacggcggcgccgaggctcctcgccgggttgatgccggtgccggtgatc 102310 Query: 470 gggatggtggccaggtggaccatgaacacggcgaagccgatcgggaggggcgccaacacc 529 ||||| || |||||||| ||||||||||| ||||| |||||||| || |||||||||||| Sbjct: 102309 gggatcgtcgccaggtgcaccatgaacaccgcgaacccgatcggcagcggcgccaacacc 102250 Score = 139 bits (70), Expect = 1e-29 Identities = 124/142 (87%) Strand = Plus / Minus Query: 388 ctgatcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgg 447 ||||||| ||||||||||| |||||||||| |||||| | || |||||||||||||| Sbjct: 92340 ctgatcactccaggccttgttgttgttgtagaccacggcgacgccgaggctcctggccgg 92281 Query: 448 gttgatgccggtgccggtgatcgggatggtggccaggtggaccatgaacacggcgaagcc 507 ||||||||||||||||||||||||||| || |||||||| ||||||||||| ||||| || Sbjct: 92280 gttgatgccggtgccggtgatcgggatcgtcgccaggtgcaccatgaacaccgcgaaccc 92221 Query: 508 gatcgggaggggcgccaacacc 529 ||| || || || ||||||||| Sbjct: 92220 gattggcagcggagccaacacc 92199 Score = 56.0 bits (28), Expect = 2e-04 Identities = 52/60 (86%) Strand = Plus / Minus Query: 331 ctggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactg 390 ||||||||| | |||||||||||||| ||||| | || |||||||||||||||||||| Sbjct: 102547 ctggtggtacagcgccgcgatcgccgccccgatgaacggcccgacccagaagatccactg 102488 Score = 56.0 bits (28), Expect = 2e-04 Identities = 52/60 (86%) Strand = Plus / Minus Query: 331 ctggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactg 390 ||||||||| | |||||||||||||||||||| | || || ||||||||||||||||| Sbjct: 92511 ctggtggtacagcgccgcgatcgccgcgccgatgaacggcccaacccagaagatccactg 92452 Score = 40.1 bits (20), Expect = 9.1 Identities = 38/44 (86%) Strand = Plus / Minus Query: 347 gcgatcgccgcgccgatcatggggccgacccagaagatccactg 390 ||||||||||| ||||| | || || ||||||||||||||||| Sbjct: 110444 gcgatcgccgccccgatgaacggcccaacccagaagatccactg 110401 Score = 40.1 bits (20), Expect = 9.1 Identities = 23/24 (95%) Strand = Plus / Minus Query: 275 tacgcgttgctcctgaaggagccg 298 ||||||||||||| |||||||||| Sbjct: 92564 tacgcgttgctccggaaggagccg 92541
>dbj|AB009308.2| Hordeum vulgare HvPIP1;3 mRNA, complete cds Length = 1285 Score = 204 bits (103), Expect = 3e-49 Identities = 235/279 (84%) Strand = Plus / Minus Query: 334 gtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactgatc 393 |||||||| ||||| | |||||||||||| | || || |||||||||||||| || || Sbjct: 914 gtggtagatcgccgccagcgccgcgccgatgaacggtcccacccagaagatccagtggtc 855 Query: 394 atcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttgat 453 ||||| |||| | |||||||||||||| |||||| || ||| ||| ||||||||||| Sbjct: 854 gtcccacgcctgcttcttgttgtagatgatggcggcgccgagggacctcgccgggttgat 795 Query: 454 gccggtgccggtgatcgggatggtggccaggtggaccatgaacacggcgaagccgatcgg 513 ||||||||| ||||| ||||| || |||||||| |||| |||||| ||||| |||||||| Sbjct: 794 gccggtgcccgtgatggggatcgtcgccaggtgcaccaggaacaccgcgaacccgatcgg 735 Query: 514 gaggggcgccaacaccgggacgtgagagtcgcgtgcgctgcgcttggggtcggtggcgga 573 || |||||||| | |||||||| ||||| | ||||||||||||| |||||||||||| Sbjct: 734 aagcggcgccaaaatggggacgtgggagtctctggcgctgcgcttggcgtcggtggcgga 675 Query: 574 gaagacggtgtagacgagcacgaaggtgccgatgatctc 612 |||||||||||| || |||||||| ||||||| |||||| Sbjct: 674 gaagacggtgtacaccagcacgaacgtgccgacgatctc 636
>gb|BT017668.1| Zea mays clone EL01N0441H09.c mRNA sequence Length = 698 Score = 202 bits (102), Expect = 1e-48 Identities = 261/314 (83%) Strand = Plus / Minus Query: 331 ctggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactg 390 ||||||||||| ||| || | ||| |||||||| | ||||||||||||||||||||| || Sbjct: 397 ctggtggtagatggcagccagcgcagcgccgatgaaggggccgacccagaagatccagtg 338 Query: 391 atcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggtt 450 ||| ||||||| | || || |||||| || |||||||| || ||||||| || ||||| Sbjct: 337 gtcagcccaggcatggtgctggttgtaaattacggcggcgccaaggctccgcgcggggtt 278 Query: 451 gatgccggtgccggtgatcgggatggtggccaggtggaccatgaacacggcgaagccgat 510 |||||||||||||||||| |||||||||||||||||||| | ||||||||| || ||||| Sbjct: 277 gatgccggtgccggtgatagggatggtggccaggtggacgaggaacacggcaaacccgat 218 Query: 511 cgggaggggcgccaacaccgggacgtgagagtcgcgtgcgctgcgcttggggtcggtggc 570 || || || || | | ||| || || ||||| | ||| | | ||||| ||||||||| Sbjct: 217 tggaagaggggcgaggatcggcacatgggagtccctggcgttcctcttggcgtcggtggc 158 Query: 571 ggagaagacggtgtagacgagcacgaaggtgccgatgatctccgcggcgaggccggtgcc 630 ||||||||||||||||||||| | ||||||||||| |||||| ||| |||||||| ||| Sbjct: 157 ggagaagacggtgtagacgaggatgaaggtgccgacgatctcggcgccgaggccgtcgcc 98 Query: 631 cttggagtatccgg 644 ||||| ||| |||| Sbjct: 97 cttggtgtagccgg 84
>gb|AY243800.1| Zea mays plasma membrane intrinsic protein (PIP1-1) mRNA, complete cds Length = 1086 Score = 202 bits (102), Expect = 1e-48 Identities = 261/314 (83%) Strand = Plus / Minus Query: 331 ctggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactg 390 ||||||||||| ||| || | ||| |||||||| | ||||||||||||||||||||| || Sbjct: 828 ctggtggtagatggcagccagcgcagcgccgatgaaggggccgacccagaagatccagtg 769 Query: 391 atcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggtt 450 ||| ||||||| | || || |||||| || |||||||| || ||||||| || ||||| Sbjct: 768 gtcagcccaggcatggtgctggttgtaaattacggcggcgccaaggctccgcgcggggtt 709 Query: 451 gatgccggtgccggtgatcgggatggtggccaggtggaccatgaacacggcgaagccgat 510 |||||||||||||||||| |||||||||||||||||||| | ||||||||| || ||||| Sbjct: 708 gatgccggtgccggtgatagggatggtggccaggtggacgaggaacacggcaaacccgat 649 Query: 511 cgggaggggcgccaacaccgggacgtgagagtcgcgtgcgctgcgcttggggtcggtggc 570 || || || || | | ||| || || ||||| | ||| | | ||||| ||||||||| Sbjct: 648 tggaagaggggcgaggatcggcacatgggagtccctggcgttcctcttggcgtcggtggc 589 Query: 571 ggagaagacggtgtagacgagcacgaaggtgccgatgatctccgcggcgaggccggtgcc 630 ||||||||||||||||||||| | ||||||||||| |||||| ||| |||||||| ||| Sbjct: 588 ggagaagacggtgtagacgaggatgaaggtgccgacgatctcggcgccgaggccgtcgcc 529 Query: 631 cttggagtatccgg 644 ||||| ||| |||| Sbjct: 528 cttggtgtagccgg 515
>emb|X82633.1|ZMTRAPRO Z.mays mRNA for transmembrane protein Length = 1169 Score = 202 bits (102), Expect = 1e-48 Identities = 261/314 (83%) Strand = Plus / Minus Query: 331 ctggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactg 390 ||||||||||| ||| || | ||| |||||||| | ||||||||||||||||||||| || Sbjct: 885 ctggtggtagatggcagccagcgcagcgccgatgaaggggccgacccagaagatccagtg 826 Query: 391 atcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggtt 450 ||| ||||||| | || || |||||| || |||||||| || ||||||| || ||||| Sbjct: 825 gtcagcccaggcatggtgctggttgtaaattacggcggcgccaaggctccgcgcggggtt 766 Query: 451 gatgccggtgccggtgatcgggatggtggccaggtggaccatgaacacggcgaagccgat 510 |||||||||||||||||| ||||||||||||||||| | ||||||||| || ||||| Sbjct: 765 gatgccggtgccggtgatacccatggtggccaggtggacgaggaacacggcaaacccgat 706 Query: 511 cgggaggggcgccaacaccgggacgtgagagtcgcgtgcgctgcgcttggggtcggtggc 570 || || || |||| | ||| || || ||||| | ||| || | ||||| ||||||||| Sbjct: 705 tggaagaggggccaggatcggcacatgggagtcccttgccctcctcttggcgtcggtggc 646 Query: 571 ggagaagacggtgtagacgagcacgaaggtgccgatgatctccgcggcgaggccggtgcc 630 ||||||||||||||||||||| | ||||||||||| |||||||||| |||||||| ||| Sbjct: 645 ggagaagacggtgtagacgaggatgaaggtgccgacgatctccgcgccgaggccgtcgcc 586 Query: 631 cttggagtatccgg 644 ||||| ||| |||| Sbjct: 585 cttggtgtagccgg 572
>gb|AF326490.1|AF326490 Zea mays plasma membrane integral protein ZmPIP1-6 mRNA, complete cds Length = 1325 Score = 196 bits (99), Expect = 7e-47 Identities = 201/235 (85%) Strand = Plus / Minus Query: 410 ttgttgtagatgacggcggcccccaggctcctggccgggttgatgccggtgccggtgatc 469 |||| |||||||| |||||| || ||||||||||| ||||||||||||||||||||||| Sbjct: 968 ttgtcgtagatgatggcggcgccgaggctcctggcggggttgatgccggtgccggtgatg 909 Query: 470 gggatggtggccaggtggaccatgaacacggcgaagccgatcgggaggggcgccaacacc 529 ||||||||||| ||||| |||| ||| |||||||||||||| || || || |||| | | Sbjct: 908 gggatggtggcgaggtgcaccaggaatacggcgaagccgatgggcagcggggccagcgcg 849 Query: 530 gggacgtgagagtcgcgtgcgctgcgcttggggtcggtggcggagaagacggtgtagacg 589 |||||||| ||||| | ||| ||||||||| |||||||||||||||||||||||| ||| Sbjct: 848 gggacgtgggagtccctggcggtgcgcttggcgtcggtggcggagaagacggtgtacacg 789 Query: 590 agcacgaaggtgccgatgatctccgcggcgaggccggtgcccttggagtatccgg 644 |||||||| ||||| | || ||| ||| |||||||| |||||||| ||| |||| Sbjct: 788 agcacgaacgtgcccacgacctcggcgccgaggccgtcgcccttggtgtacccgg 734
>ref|XM_473480.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 849 Score = 194 bits (98), Expect = 3e-46 Identities = 233/278 (83%) Strand = Plus / Minus Query: 367 ggggccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggc 426 |||||| |||||||||||||| || ||||||||||| | | || |||||||||||| ||| Sbjct: 774 ggggccaacccagaagatccaatggtcatcccaggcatggcccctgttgtagatgatggc 715 Query: 427 ggcccccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtg 486 || || |||||||| || ||||||||||||||||||||||| ||||||||||||||||| Sbjct: 714 agcgccaaggctcctcgctgggttgatgccggtgccggtgatggggatggtggccaggtg 655 Query: 487 gaccatgaacacggcgaagccgatcgggaggggcgccaacaccgggacgtgagagtcgcg 546 |||| |||||| || || ||||| || || || || | | ||| ||||| ||||| | Sbjct: 654 aaccaagaacaccgcaaacccgattggcagtggggcaaggatcggaacgtgggagtccct 595 Query: 547 tgcgctgcgcttggggtcggtggcggagaagacggtgtagacgagcacgaaggtgccgat 606 ||| | | ||||| |||||||||||||||||||||||||||||| | ||||||||||| Sbjct: 594 ggcgttcctcttggcgtcggtggcggagaagacggtgtagacgaggatgaaggtgccgac 535 Query: 607 gatctccgcggcgaggccggtgcccttggagtatccgg 644 |||||| ||| |||||||| |||||||| ||| |||| Sbjct: 534 gatctcggcgccgaggccgtcgcccttggtgtagccgg 497
>emb|AJ271796.1|ZMA271796 Zea mays mRNA for plasma membrane intrinsic protein (pip4 gene) Length = 1364 Score = 194 bits (98), Expect = 3e-46 Identities = 200/234 (85%) Strand = Plus / Minus Query: 411 tgttgtagatgacggcggcccccaggctcctggccgggttgatgccggtgccggtgatcg 470 ||||||||| || |||||| || ||||| | || ||||||||||||||||||||||| | Sbjct: 829 tgttgtagacgatggcggcgccgaggctgcgcgcggggttgatgccggtgccggtgatgg 770 Query: 471 ggatggtggccaggtggaccatgaacacggcgaagccgatcgggaggggcgccaacaccg 530 ||||||| |||||||| || | ||| ||||||||||| || ||||| ||||| | | | Sbjct: 769 ggatggtcgccaggtgcacgaggaagacggcgaagcctatggggagcggcgcgaggatgg 710 Query: 531 ggacgtgagagtcgcgtgcgctgcgcttggggtcggtggcggagaagacggtgtagacga 590 | ||||| |||||||| ||||||||||||| ||||||||||||||||||||||||||||| Sbjct: 709 gcacgtgggagtcgcgggcgctgcgcttggcgtcggtggcggagaagacggtgtagacga 650 Query: 591 gcacgaaggtgccgatgatctccgcggcgaggccggtgcccttggagtatccgg 644 ||||||||||||||| ||||||||| |||| ||| |||||||| ||| |||| Sbjct: 649 gcacgaaggtgccgacgatctccgccccgagcccgtcgcccttggtgtacccgg 596
>emb|AJ001294.1|CPPIPC Craterostigma plantagineum mRNA for major intrinsic protein PIPc Length = 800 Score = 194 bits (98), Expect = 3e-46 Identities = 242/290 (83%) Strand = Plus / Minus Query: 374 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 433 |||||||| ||||| || |||||||| || || | |||||| |||| |||||||| || Sbjct: 501 acccagaaaatccaatggtcatcccaagcttttccgttgttgaagatcacggcggcgccg 442 Query: 434 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 493 | |||||| |||||||| || ||||||||||||||||| || || |||| ||| |||||| Sbjct: 441 aagctcctcgccgggttaatcccggtgccggtgatcggaatagttgccaagtgtaccatg 382 Query: 494 aacacggcgaagccgatcgggaggggcgccaacaccgggacgtgagagtcgcgtgcgctg 553 ||||| || || || || ||||| ||||||||||| || ||||||||||| || ||||| Sbjct: 381 aacaccgcaaaacctattgggagaggcgccaacacgggaacgtgagagtcacgcgcgctc 322 Query: 554 cgcttggggtcggtggcggagaagacggtgtagacgagcacgaaggtgccgatgatctcc 613 | ||| |||||||||||||||||||||||||||||||| ||||| ||||||||||| || Sbjct: 321 ctctttgggtcggtggcggagaagacggtgtagacgaggacgaacgtgccgatgatttcg 262 Query: 614 gcggcgaggccggtgcccttggagtatccggcggcgagcgtgttggcgcc 663 || ||||| ||||||||||| ||| |||| ||||| ||||| ||||| Sbjct: 261 gctccgagggcggtgcccttgttgtagccgggggcgacggtgttcgcgcc 212
>gb|AF326489.1|AF326489 Zea mays plasma membrane integral protein ZmPIP1-5 mRNA, complete cds Length = 1338 Score = 194 bits (98), Expect = 3e-46 Identities = 200/234 (85%) Strand = Plus / Minus Query: 411 tgttgtagatgacggcggcccccaggctcctggccgggttgatgccggtgccggtgatcg 470 ||||||||| || |||||| || ||||| | || ||||||||||||||||||||||| | Sbjct: 820 tgttgtagacgatggcggcgccgaggctgcgcgcggggttgatgccggtgccggtgatgg 761 Query: 471 ggatggtggccaggtggaccatgaacacggcgaagccgatcgggaggggcgccaacaccg 530 ||||||| |||||||| || | ||| ||||||||||| || ||||| ||||| | | | Sbjct: 760 ggatggtcgccaggtgcacgaggaagacggcgaagcctatggggagcggcgcgaggatgg 701 Query: 531 ggacgtgagagtcgcgtgcgctgcgcttggggtcggtggcggagaagacggtgtagacga 590 | ||||| |||||||| ||||||||||||| ||||||||||||||||||||||||||||| Sbjct: 700 gcacgtgggagtcgcgggcgctgcgcttggcgtcggtggcggagaagacggtgtagacga 641 Query: 591 gcacgaaggtgccgatgatctccgcggcgaggccggtgcccttggagtatccgg 644 ||||||||||||||| ||||||||| |||| ||| |||||||| ||| |||| Sbjct: 640 gcacgaaggtgccgacgatctccgccccgagcccgtcgcccttggtgtacccgg 587
>dbj|AK104736.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-038-D02, full insert sequence Length = 1163 Score = 194 bits (98), Expect = 3e-46 Identities = 233/278 (83%) Strand = Plus / Minus Query: 367 ggggccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggc 426 |||||| |||||||||||||| || ||||||||||| | | || |||||||||||| ||| Sbjct: 851 ggggccaacccagaagatccaatggtcatcccaggcatggcccctgttgtagatgatggc 792 Query: 427 ggcccccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtg 486 || || |||||||| || ||||||||||||||||||||||| ||||||||||||||||| Sbjct: 791 agcgccaaggctcctcgctgggttgatgccggtgccggtgatggggatggtggccaggtg 732 Query: 487 gaccatgaacacggcgaagccgatcgggaggggcgccaacaccgggacgtgagagtcgcg 546 |||| |||||| || || ||||| || || || || | | ||| ||||| ||||| | Sbjct: 731 aaccaagaacaccgcaaacccgattggcagtggggcaaggatcggaacgtgggagtccct 672 Query: 547 tgcgctgcgcttggggtcggtggcggagaagacggtgtagacgagcacgaaggtgccgat 606 ||| | | ||||| |||||||||||||||||||||||||||||| | ||||||||||| Sbjct: 671 ggcgttcctcttggcgtcggtggcggagaagacggtgtagacgaggatgaaggtgccgac 612 Query: 607 gatctccgcggcgaggccggtgcccttggagtatccgg 644 |||||| ||| |||||||| |||||||| ||| |||| Sbjct: 611 gatctcggcgccgaggccgtcgcccttggtgtagccgg 574
>dbj|AK098849.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013000E16, full insert sequence Length = 1164 Score = 194 bits (98), Expect = 3e-46 Identities = 260/314 (82%) Strand = Plus / Minus Query: 331 ctggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactg 390 ||||||||||| ||| || | || ||||| || | |||||| |||||||||||||| || Sbjct: 888 ctggtggtagatggcagcaagggcagcgccaatgaaggggccaacccagaagatccaatg 829 Query: 391 atcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggtt 450 ||||||||||| | | || |||||||||||| ||| || || |||||||| || ||||| Sbjct: 828 gtcatcccaggcatggcccctgttgtagatgatggcagcgccaaggctcctcgctgggtt 769 Query: 451 gatgccggtgccggtgatcgggatggtggccaggtggaccatgaacacggcgaagccgat 510 |||||||||||||||||| ||||||||||||||||| |||| |||||| || || ||||| Sbjct: 768 gatgccggtgccggtgatggggatggtggccaggtgaaccaagaacaccgcaaacccgat 709 Query: 511 cgggaggggcgccaacaccgggacgtgagagtcgcgtgcgctgcgcttggggtcggtggc 570 || || || || | | ||| ||||| ||||| | ||| | | ||||| ||||||||| Sbjct: 708 tggcagtggggcaaggatcggaacgtgggagtccctggcgttcctcttggcgtcggtggc 649 Query: 571 ggagaagacggtgtagacgagcacgaaggtgccgatgatctccgcggcgaggccggtgcc 630 ||||||||||||||||||||| | ||||||||||| |||||| ||| |||||||| ||| Sbjct: 648 ggagaagacggtgtagacgaggatgaaggtgccgacgatctcggcgccgaggccgtcgcc 589 Query: 631 cttggagtatccgg 644 ||||| ||| |||| Sbjct: 588 cttggtgtagccgg 575
>dbj|AK065188.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013002E02, full insert sequence Length = 1167 Score = 194 bits (98), Expect = 3e-46 Identities = 233/278 (83%) Strand = Plus / Minus Query: 367 ggggccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggc 426 |||||| |||||||||||||| || ||||||||||| | | || |||||||||||| ||| Sbjct: 854 ggggccaacccagaagatccaatggtcatcccaggcatggcccctgttgtagatgatggc 795 Query: 427 ggcccccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtg 486 || || |||||||| || ||||||||||||||||||||||| ||||||||||||||||| Sbjct: 794 agcgccaaggctcctcgctgggttgatgccggtgccggtgatggggatggtggccaggtg 735 Query: 487 gaccatgaacacggcgaagccgatcgggaggggcgccaacaccgggacgtgagagtcgcg 546 |||| |||||| || || ||||| || || || || | | ||| ||||| ||||| | Sbjct: 734 aaccaagaacaccgcaaacccgattggcagtggggcaaggatcggaacgtgggagtccct 675 Query: 547 tgcgctgcgcttggggtcggtggcggagaagacggtgtagacgagcacgaaggtgccgat 606 ||| | | ||||| |||||||||||||||||||||||||||||| | ||||||||||| Sbjct: 674 ggcgttcctcttggcgtcggtggcggagaagacggtgtagacgaggatgaaggtgccgac 615 Query: 607 gatctccgcggcgaggccggtgcccttggagtatccgg 644 |||||| ||| |||||||| |||||||| ||| |||| Sbjct: 614 gatctcggcgccgaggccgtcgcccttggtgtagccgg 577
>gb|AY107675.1| Zea mays PCO112712 mRNA sequence Length = 791 Score = 194 bits (98), Expect = 3e-46 Identities = 200/234 (85%) Strand = Plus / Minus Query: 411 tgttgtagatgacggcggcccccaggctcctggccgggttgatgccggtgccggtgatcg 470 ||||||||| || |||||| || ||||| | || ||||||||||||||||||||||| | Sbjct: 253 tgttgtagacgatggcggcgccgaggctgcgcgcggggttgatgccggtgccggtgatgg 194 Query: 471 ggatggtggccaggtggaccatgaacacggcgaagccgatcgggaggggcgccaacaccg 530 ||||||| |||||||| || | ||| ||||||||||| || ||||| ||||| | | | Sbjct: 193 ggatggtcgccaggtgcacgaggaagacggcgaagcctatggggagcggcgcgaggatgg 134 Query: 531 ggacgtgagagtcgcgtgcgctgcgcttggggtcggtggcggagaagacggtgtagacga 590 | ||||| |||||||| ||||||||||||| ||||||||||||||||||||||||||||| Sbjct: 133 gcacgtgggagtcgcgggcgctgcgcttggcgtcggtggcggagaagacggtgtagacga 74 Query: 591 gcacgaaggtgccgatgatctccgcggcgaggccggtgcccttggagtatccgg 644 ||||||||||||||| ||||||||| |||| ||| |||||||| ||| |||| Sbjct: 73 gcacgaaggtgccgacgatctccgccccgagcccgtcgcccttggtgtacccgg 20
>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete sequence Length = 35498469 Score = 186 bits (94), Expect = 6e-44 Identities = 106/110 (96%) Strand = Plus / Minus Query: 530 gggacgtgagagtcgcgtgcgctgcgcttggggtcggtggcggagaagacggtgtagacg 589 |||||||| |||||||| ||| |||||||||||||||||||||||||||||||||||||| Sbjct: 26073390 gggacgtgggagtcgcgggcgttgcgcttggggtcggtggcggagaagacggtgtagacg 26073331 Query: 590 agcacgaaggtgccgatgatctccgcggcgaggccggtgcccttggagta 639 ||||||||||||||||||||||| |||||||||||||||||||||||||| Sbjct: 26073330 agcacgaaggtgccgatgatctcggcggcgaggccggtgcccttggagta 26073281 Score = 129 bits (65), Expect = 1e-26 Identities = 101/113 (89%) Strand = Plus / Plus Query: 527 accgggacgtgagagtcgcgtgcgctgcgcttggggtcggtggcggagaagacggtgtag 586 ||||||||||| |||||||| || ||||||| ||||||||||||||||||||||||||| Sbjct: 8907138 accgggacgtgggagtcgcgggcattgcgctttgggtcggtggcggagaagacggtgtag 8907197 Query: 587 acgagcacgaaggtgccgatgatctccgcggcgaggccggtgcccttggagta 639 ||||| ||||||||||||||||| || ||| ||||| ||||||| ||||||| Sbjct: 8907198 acgaggacgaaggtgccgatgatttcggcgccgagggcggtgccggtggagta 8907250 Score = 127 bits (64), Expect = 5e-26 Identities = 103/116 (88%) Strand = Plus / Plus Query: 395 tcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttgatg 454 ||||| ||||| | || |||||||||||||||||| || | ||||| ||| ||||||||| Sbjct: 8906901 tcccatgccttcttctggttgtagatgacggcggcgccgatgctccgggcagggttgatg 8906960 Query: 455 ccggtgccggtgatcgggatggtggccaggtggaccatgaacacggcgaagccgat 510 || ||||||||||| ||||||||||||||||| ||||||||||||||||| ||||| Sbjct: 8906961 cccgtgccggtgatggggatggtggccaggtgcaccatgaacacggcgaacccgat 8907016 Score = 113 bits (57), Expect = 8e-22 Identities = 99/113 (87%) Strand = Plus / Minus Query: 392 tcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttg 451 |||| ||| ||||||| || ||||||||| || || || |||| |||||| ||||||||| Sbjct: 26074238 tcatgccatgccttgtgctggttgtagatcaccgcagctcccaagctccttgccgggttg 26074179 Query: 452 atgccggtgccggtgatcgggatggtggccaggtggaccatgaacacggcgaa 504 ||||||||||||||||||||||| ||||||| ||| ||||||||||| ||||| Sbjct: 26074178 atgccggtgccggtgatcgggatcgtggccaagtgaaccatgaacaccgcgaa 26074126 Score = 109 bits (55), Expect = 1e-20 Identities = 94/107 (87%) Strand = Plus / Minus Query: 392 tcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttg 451 ||||||||||| | | || |||||||||||| ||| || || |||||||| || |||||| Sbjct: 28020793 tcatcccaggcatggcccctgttgtagatgatggcagcgccaaggctcctcgctgggttg 28020734 Query: 452 atgccggtgccggtgatcgggatggtggccaggtggaccatgaacac 498 ||||||||||||||||| ||||||||||||||||| |||| |||||| Sbjct: 28020733 atgccggtgccggtgatggggatggtggccaggtgaaccaagaacac 28020687 Score = 97.6 bits (49), Expect = 4e-17 Identities = 79/89 (88%) Strand = Plus / Minus Query: 556 cttggggtcggtggcggagaagacggtgtagacgagcacgaaggtgccgatgatctccgc 615 ||||| |||||||||||||||||||||||||||||| | ||||||||||| |||||| || Sbjct: 28020526 cttggcgtcggtggcggagaagacggtgtagacgaggatgaaggtgccgacgatctcggc 28020467 Query: 616 ggcgaggccggtgcccttggagtatccgg 644 | |||||||| |||||||| ||| |||| Sbjct: 28020466 gccgaggccgtcgcccttggtgtagccgg 28020438 Score = 56.0 bits (28), Expect = 2e-04 Identities = 67/80 (83%) Strand = Plus / Minus Query: 310 ggcgccggccctgagtatgtactggtggtagaaggccgcgatcgccgcgccgatcatggg 369 ||||| |||||| || | ||||||||||||| ||| ||||| || |||||||| | ||| Sbjct: 26074829 ggcgctggccctcaggacgtactggtggtaggcggcggcgatggcggcgccgatgagggg 26074770 Query: 370 gccgacccagaagatccact 389 || |||||||||||||||| Sbjct: 26074769 ccccacccagaagatccact 26074750 Score = 50.1 bits (25), Expect = 0.009 Identities = 49/57 (85%) Strand = Plus / Plus Query: 280 gttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggtg 336 |||||||| ||||||||| || ||||||||||| | |||| ||| ||||||||||| Sbjct: 8906703 gttgctccggaaggagcccagcgccttgatggctgccgcccggaggatgtactggtg 8906759 Score = 40.1 bits (20), Expect = 9.1 Identities = 23/24 (95%) Strand = Plus / Minus Query: 367 ggggccgacccagaagatccactg 390 |||||| ||||||||||||||||| Sbjct: 28021379 ggggccaacccagaagatccactg 28021356
>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete sequence Length = 35954743 Score = 186 bits (94), Expect = 6e-44 Identities = 109/114 (95%) Strand = Plus / Minus Query: 526 caccgggacgtgagagtcgcgtgcgctgcgcttggggtcggtggcggagaagacggtgta 585 |||||||| ||| |||||||| ||| |||||||||||||||||||||||||||||||||| Sbjct: 25182163 caccgggatgtgggagtcgcgggcgttgcgcttggggtcggtggcggagaagacggtgta 25182104 Query: 586 gacgagcacgaaggtgccgatgatctccgcggcgaggccggtgcccttggagta 639 ||||||||||||||||||||||||||||||| |||||||||||||||||||||| Sbjct: 25182103 gacgagcacgaaggtgccgatgatctccgcgccgaggccggtgcccttggagta 25182050 Score = 182 bits (92), Expect = 1e-42 Identities = 167/192 (86%) Strand = Plus / Minus Query: 424 ggcggcccccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccag 483 |||||| || ||||| | ||| ||||||||||||||||||||||| ||||||||||| || Sbjct: 35369049 ggcggcgccgaggctgcgggcggggttgatgccggtgccggtgatggggatggtggcgag 35368990 Query: 484 gtggaccatgaacacggcgaagccgatcgggaggggcgccaacaccgggacgtgagagtc 543 |||||| | ||| |||||||||||||| ||||| ||||||| | |||||||| ||||| Sbjct: 35368989 gtggacgaggaagacggcgaagccgatggggagcggcgccaggatggggacgtgggagtc 35368930 Query: 544 gcgtgcgctgcgcttggggtcggtggcggagaagacggtgtagacgagcacgaaggtgcc 603 | ||| ||||||||| |||||||||||||||||||||||||||||| ||||||||||| Sbjct: 35368929 cctggcgttgcgcttggcgtcggtggcggagaagacggtgtagacgaggacgaaggtgcc 35368870 Query: 604 gatgatctccgc 615 | ||||||||| Sbjct: 35368869 cacgatctccgc 35368858 Score = 155 bits (78), Expect = 2e-34 Identities = 123/138 (89%) Strand = Plus / Minus Query: 392 tcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttg 451 ||||||||||||||||||||||||||||| || |||| |||| |||||| |||||||| Sbjct: 25184038 tcatcccaggccttgtccttgttgtagataaccgcggttcccaagctcctcgccgggtta 25183979 Query: 452 atgccggtgccggtgatcgggatggtggccaggtggaccatgaacacggcgaagccgatc 511 ||||||||||||||||| |||||||||||||| |||||||||||||| ||||| || || Sbjct: 25183978 atgccggtgccggtgatggggatggtggccagatggaccatgaacaccgcgaatccaatt 25183919 Query: 512 gggaggggcgccaacacc 529 ||||| || ||||||||| Sbjct: 25183918 gggagaggagccaacacc 25183901 Score = 117 bits (59), Expect = 5e-23 Identities = 95/107 (88%) Strand = Plus / Minus Query: 392 tcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttg 451 |||| |||||| | ||||||||||||||||| ||| || || ||||||||||| |||||| Sbjct: 27065064 tcattccaggcatggtccttgttgtagatgatggcagcgccaaggctcctggctgggttg 27065005 Query: 452 atgccggtgccggtgatcgggatggtggccaggtggaccatgaacac 498 ||||| || |||||||| |||||||||||||||||||||| |||||| Sbjct: 27065004 atgccagtaccggtgatggggatggtggccaggtggaccaggaacac 27064958 Score = 75.8 bits (38), Expect = 2e-10 Identities = 71/82 (86%) Strand = Plus / Minus Query: 310 ggcgccggccctgagtatgtactggtggtagaaggccgcgatcgccgcgccgatcatggg 369 ||||| |||||| || | ||||||||||||| ||| ||||| || |||||||||| ||| Sbjct: 25184682 ggcgctggccctcagcacgtactggtggtaggcggcggcgatggcggcgccgatcagggg 25184623 Query: 370 gccgacccagaagatccactga 391 ||| |||||||||||||||||| Sbjct: 25184622 gcccacccagaagatccactga 25184601 Score = 44.1 bits (22), Expect = 0.58 Identities = 34/38 (89%) Strand = Plus / Minus Query: 566 gtggcggagaagacggtgtagacgagcacgaaggtgcc 603 ||||| ||||||||||||||||| || | ||||||||| Sbjct: 27064531 gtggctgagaagacggtgtagaccaggatgaaggtgcc 27064494 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 29 aaattaaaacaggaaaagga 48 |||||||||||||||||||| Sbjct: 751943 aaattaaaacaggaaaagga 751962
>dbj|AP006168.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:B1469H02 Length = 136602 Score = 186 bits (94), Expect = 6e-44 Identities = 109/114 (95%) Strand = Plus / Minus Query: 526 caccgggacgtgagagtcgcgtgcgctgcgcttggggtcggtggcggagaagacggtgta 585 |||||||| ||| |||||||| ||| |||||||||||||||||||||||||||||||||| Sbjct: 82556 caccgggatgtgggagtcgcgggcgttgcgcttggggtcggtggcggagaagacggtgta 82497 Query: 586 gacgagcacgaaggtgccgatgatctccgcggcgaggccggtgcccttggagta 639 ||||||||||||||||||||||||||||||| |||||||||||||||||||||| Sbjct: 82496 gacgagcacgaaggtgccgatgatctccgcgccgaggccggtgcccttggagta 82443 Score = 155 bits (78), Expect = 2e-34 Identities = 123/138 (89%) Strand = Plus / Minus Query: 392 tcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttg 451 ||||||||||||||||||||||||||||| || |||| |||| |||||| |||||||| Sbjct: 84431 tcatcccaggccttgtccttgttgtagataaccgcggttcccaagctcctcgccgggtta 84372 Query: 452 atgccggtgccggtgatcgggatggtggccaggtggaccatgaacacggcgaagccgatc 511 ||||||||||||||||| |||||||||||||| |||||||||||||| ||||| || || Sbjct: 84371 atgccggtgccggtgatggggatggtggccagatggaccatgaacaccgcgaatccaatt 84312 Query: 512 gggaggggcgccaacacc 529 ||||| || ||||||||| Sbjct: 84311 gggagaggagccaacacc 84294 Score = 75.8 bits (38), Expect = 2e-10 Identities = 71/82 (86%) Strand = Plus / Minus Query: 310 ggcgccggccctgagtatgtactggtggtagaaggccgcgatcgccgcgccgatcatggg 369 ||||| |||||| || | ||||||||||||| ||| ||||| || |||||||||| ||| Sbjct: 85075 ggcgctggccctcagcacgtactggtggtaggcggcggcgatggcggcgccgatcagggg 85016 Query: 370 gccgacccagaagatccactga 391 ||| |||||||||||||||||| Sbjct: 85015 gcccacccagaagatccactga 84994
>dbj|AK058323.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-014-B07, full insert sequence Length = 1462 Score = 186 bits (94), Expect = 6e-44 Identities = 232/278 (83%) Strand = Plus / Minus Query: 367 ggggccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggc 426 |||||| |||||||||||||| || ||||||||||| | | || |||||||||||| ||| Sbjct: 1150 ggggccaacccagaagatccaatggtcatcccaggcatggcccctgttgtagatgatggc 1091 Query: 427 ggcccccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtg 486 || || |||||||| || ||||||||||||||||||||||| ||||||||||||||||| Sbjct: 1090 agcgccaaggctcctcgctgggttgatgccggtgccggtgatggggatggtggccaggtg 1031 Query: 487 gaccatgaacacggcgaagccgatcgggaggggcgccaacaccgggacgtgagagtcgcg 546 |||| |||||| || || ||||| || || || || | | ||| ||||| ||||| | Sbjct: 1030 aaccaagaacaccgcaaacccgattggcagtggggcaaggatcggaacgtgggagtccct 971 Query: 547 tgcgctgcgcttggggtcggtggcggagaagacggtgtagacgagcacgaaggtgccgat 606 ||| | | ||||| |||||||||||||||||||||||||||||| | ||||||||||| Sbjct: 970 ggcgttcctcttggcgtcggtggcggagaagacggtgtagacgaggatgaaggtgccgac 911 Query: 607 gatctccgcggcgaggccggtgcccttggagtatccgg 644 |||||| || |||||||| |||||||| ||| |||| Sbjct: 910 gatctcggcaccgaggccgtcgcccttggtgtagccgg 873
>emb|AL662958.3|OSJN00156 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0019D11, complete sequence Length = 163039 Score = 186 bits (94), Expect = 6e-44 Identities = 106/110 (96%) Strand = Plus / Minus Query: 530 gggacgtgagagtcgcgtgcgctgcgcttggggtcggtggcggagaagacggtgtagacg 589 |||||||| |||||||| ||| |||||||||||||||||||||||||||||||||||||| Sbjct: 107717 gggacgtgggagtcgcgggcgttgcgcttggggtcggtggcggagaagacggtgtagacg 107658 Query: 590 agcacgaaggtgccgatgatctccgcggcgaggccggtgcccttggagta 639 ||||||||||||||||||||||| |||||||||||||||||||||||||| Sbjct: 107657 agcacgaaggtgccgatgatctcggcggcgaggccggtgcccttggagta 107608 Score = 113 bits (57), Expect = 8e-22 Identities = 99/113 (87%) Strand = Plus / Minus Query: 392 tcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttg 451 |||| ||| ||||||| || ||||||||| || || || |||| |||||| ||||||||| Sbjct: 108565 tcatgccatgccttgtgctggttgtagatcaccgcagctcccaagctccttgccgggttg 108506 Query: 452 atgccggtgccggtgatcgggatggtggccaggtggaccatgaacacggcgaa 504 ||||||||||||||||||||||| ||||||| ||| ||||||||||| ||||| Sbjct: 108505 atgccggtgccggtgatcgggatcgtggccaagtgaaccatgaacaccgcgaa 108453 Score = 56.0 bits (28), Expect = 2e-04 Identities = 67/80 (83%) Strand = Plus / Minus Query: 310 ggcgccggccctgagtatgtactggtggtagaaggccgcgatcgccgcgccgatcatggg 369 ||||| |||||| || | ||||||||||||| ||| ||||| || |||||||| | ||| Sbjct: 109156 ggcgctggccctcaggacgtactggtggtaggcggcggcgatggcggcgccgatgagggg 109097 Query: 370 gccgacccagaagatccact 389 || |||||||||||||||| Sbjct: 109096 ccccacccagaagatccact 109077
>ref|XM_468463.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1319 Score = 182 bits (92), Expect = 1e-42 Identities = 167/192 (86%) Strand = Plus / Minus Query: 424 ggcggcccccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccag 483 |||||| || ||||| | ||| ||||||||||||||||||||||| ||||||||||| || Sbjct: 887 ggcggcgccgaggctgcgggcggggttgatgccggtgccggtgatggggatggtggcgag 828 Query: 484 gtggaccatgaacacggcgaagccgatcgggaggggcgccaacaccgggacgtgagagtc 543 |||||| | ||| |||||||||||||| ||||| ||||||| | |||||||| ||||| Sbjct: 827 gtggacgaggaagacggcgaagccgatggggagcggcgccaggatggggacgtgggagtc 768 Query: 544 gcgtgcgctgcgcttggggtcggtggcggagaagacggtgtagacgagcacgaaggtgcc 603 | ||| ||||||||| |||||||||||||||||||||||||||||| ||||||||||| Sbjct: 767 cctggcgttgcgcttggcgtcggtggcggagaagacggtgtagacgaggacgaaggtgcc 708 Query: 604 gatgatctccgc 615 | ||||||||| Sbjct: 707 cacgatctccgc 696
>dbj|AP004026.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ1136_C04 Length = 103194 Score = 182 bits (92), Expect = 1e-42 Identities = 167/192 (86%) Strand = Plus / Minus Query: 424 ggcggcccccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccag 483 |||||| || ||||| | ||| ||||||||||||||||||||||| ||||||||||| || Sbjct: 29597 ggcggcgccgaggctgcgggcggggttgatgccggtgccggtgatggggatggtggcgag 29538 Query: 484 gtggaccatgaacacggcgaagccgatcgggaggggcgccaacaccgggacgtgagagtc 543 |||||| | ||| |||||||||||||| ||||| ||||||| | |||||||| ||||| Sbjct: 29537 gtggacgaggaagacggcgaagccgatggggagcggcgccaggatggggacgtgggagtc 29478 Query: 544 gcgtgcgctgcgcttggggtcggtggcggagaagacggtgtagacgagcacgaaggtgcc 603 | ||| ||||||||| |||||||||||||||||||||||||||||| ||||||||||| Sbjct: 29477 cctggcgttgcgcttggcgtcggtggcggagaagacggtgtagacgaggacgaaggtgcc 29418 Query: 604 gatgatctccgc 615 | ||||||||| Sbjct: 29417 cacgatctccgc 29406
>dbj|AK102174.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033086K14, full insert sequence Length = 1318 Score = 182 bits (92), Expect = 1e-42 Identities = 167/192 (86%) Strand = Plus / Minus Query: 424 ggcggcccccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccag 483 |||||| || ||||| | ||| ||||||||||||||||||||||| ||||||||||| || Sbjct: 886 ggcggcgccgaggctgcgggcggggttgatgccggtgccggtgatggggatggtggcgag 827 Query: 484 gtggaccatgaacacggcgaagccgatcgggaggggcgccaacaccgggacgtgagagtc 543 |||||| | ||| |||||||||||||| ||||| ||||||| | |||||||| ||||| Sbjct: 826 gtggacgaggaagacggcgaagccgatggggagcggcgccaggatggggacgtgggagtc 767 Query: 544 gcgtgcgctgcgcttggggtcggtggcggagaagacggtgtagacgagcacgaaggtgcc 603 | ||| ||||||||| |||||||||||||||||||||||||||||| ||||||||||| Sbjct: 766 cctggcgttgcgcttggcgtcggtggcggagaagacggtgtagacgaggacgaaggtgcc 707 Query: 604 gatgatctccgc 615 | ||||||||| Sbjct: 706 cacgatctccgc 695
>gb|AF141900.1|AF141900 Vitis berlandieri x Vitis rupestris putative aquaporin PIP2-2 (PIP2-2) mRNA, complete cds Length = 1171 Score = 180 bits (91), Expect = 4e-42 Identities = 202/239 (84%) Strand = Plus / Minus Query: 371 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcc 430 |||||||||||||||||||| || ||||| | || || |||||||||||||||||||| Sbjct: 787 ccgacccagaagatccactggtcgtcccaaactttttcattgttgtagatgacggcggcg 728 Query: 431 cccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggacc 490 || | ||||||||| ||||||||||||||||||||||| ||||||||||| ||||||||| Sbjct: 727 ccgaagctcctggcggggttgatgccggtgccggtgatggggatggtggcaaggtggacc 668 Query: 491 atgaacacggcgaagccgatcgggaggggcgccaacaccgggacgtgagagtcgcgtgcg 550 ||||| || || || || || || || || ||||| || |||||||| || || | ||| Sbjct: 667 atgaagacagcaaacccaatgggcagtggagccaaaacagggacgtgggaatctctggcg 608 Query: 551 ctgcgcttggggtcggtggcggagaagacggtgtagacgagcacgaaggtgccgatgat 609 || | ||||||||| ||||| ||||| || ||||| ||||||||||| ||||||||||| Sbjct: 607 cttctcttggggtcagtggctgagaaaacagtgtacacgagcacgaaagtgccgatgat 549
>gb|AF366564.1| Triticum aestivum aquaporin PIP1 (Pip1) mRNA, complete cds Length = 1248 Score = 180 bits (91), Expect = 4e-42 Identities = 232/279 (83%) Strand = Plus / Minus Query: 334 gtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactgatc 393 |||||||| |||||| | |||||| ||||| | || || |||||||||||||| || || Sbjct: 899 gtggtagatggccgccagcgccgcaccgatgaacggaccaacccagaagatccagtggtc 840 Query: 394 atcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttgat 453 ||||| |||| | |||||||||||||| |||||| || ||| ||| ||||||||||| Sbjct: 839 gtcccacgcctgcttcttgttgtagatgatggcggcgccgagggacctcgccgggttgat 780 Query: 454 gccggtgccggtgatcgggatggtggccaggtggaccatgaacacggcgaagccgatcgg 513 |||||| || ||||| ||||| || |||||||| |||| |||||| ||||| ||||| || Sbjct: 779 gccggtccccgtgatggggatcgtcgccaggtgcaccaggaacaccgcgaacccgatggg 720 Query: 514 gaggggcgccaacaccgggacgtgagagtcgcgtgcgctgcgcttggggtcggtggcgga 573 || |||||||| | |||||||| ||||| | ||||||||||||| ||||||||| || Sbjct: 719 aagcggcgccaaaatggggacgtgggagtctctggcgctgcgcttggcgtcggtggcaga 660 Query: 574 gaagacggtgtagacgagcacgaaggtgccgatgatctc 612 |||||||||||||| |||||||| ||||||| |||||| Sbjct: 659 aaagacggtgtagaccagcacgaacgtgccgacgatctc 621
>gb|DQ358107.1| Vitis vinifera aquaporin PIP2 (pip2) mRNA, complete cds Length = 901 Score = 163 bits (82), Expect = 9e-37 Identities = 202/242 (83%) Strand = Plus / Minus Query: 371 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcc 430 ||||||||||| ||||| || ||||||||||||||||| ||||| |||||||| || || Sbjct: 771 ccgacccagaacatccaatggtcatcccaggccttgtcgttgttatagatgacagcagct 712 Query: 431 cccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggacc 490 || | ||| || ||||||||||| |||||||||||||| || || || |||||||| ||| Sbjct: 711 ccgaagcttctagccgggttgataccggtgccggtgatgggaattgttgccaggtgaacc 652 Query: 491 atgaacacggcgaagccgatcgggaggggcgccaacaccgggacgtgagagtcgcgtgcg 550 |||||||| || || ||||| || || || ||||| || || || || ||||| || ||| Sbjct: 651 atgaacaccgcaaatccgatgggcagtggtgccaaaacaggaacatgggagtctcgggcg 592 Query: 551 ctgcgcttggggtcggtggcggagaagacggtgtagacgagcacgaaggtgccgatgatc 610 | | ||||||||| ||||| ||||||||||||||||| || || ||||||||||||||| Sbjct: 591 ttcctcttggggtcagtggcagagaagacggtgtagacaagaacaaaggtgccgatgatc 532 Query: 611 tc 612 || Sbjct: 531 tc 530
>gb|DQ149581.1| Xerophyta humilis PIP1 aquaporin mRNA, complete cds Length = 1262 Score = 163 bits (82), Expect = 9e-37 Identities = 172/202 (85%) Strand = Plus / Minus Query: 411 tgttgtagatgacggcggcccccaggctcctggccgggttgatgccggtgccggtgatcg 470 |||||||||||| ||| || ||||||||||| || ||||||||||||||||||||||||| Sbjct: 830 tgttgtagatgatggcagctcccaggctccttgcagggttgatgccggtgccggtgatcg 771 Query: 471 ggatggtggccaggtggaccatgaacacggcgaagccgatcgggaggggcgccaacaccg 530 |||| || |||| ||| |||| |||||| || || ||||| || | || ||||| | | Sbjct: 770 ggatcgtcgccaagtgcaccaagaacaccgcaaacccgatgggcaacggggccaagatag 711 Query: 531 ggacgtgagagtcgcgtgcgctgcgcttggggtcggtggcggagaagacggtgtagacga 590 | ||||| ||||| | ||||||||||| | |||||||||||||||||||||||||||| Sbjct: 710 gaacgtgggagtccctggcgctgcgcttagcatcggtggcggagaagacggtgtagacga 651 Query: 591 gcacgaaggtgccgatgatctc 612 | |||||||||||||||||||| Sbjct: 650 ggacgaaggtgccgatgatctc 629
>dbj|AB029325.1| Oryza sativa gene for water channel protein RWC3, promoter region and complete cds Length = 5325 Score = 155 bits (78), Expect = 2e-34 Identities = 164/192 (85%), Gaps = 3/192 (1%) Strand = Plus / Minus Query: 424 ggcggcccccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccag 483 |||||| || ||||| | ||| ||||||||||||||||||||||| ||||||||||| || Sbjct: 4551 ggcggcgccgaggctgcgggcggggttgatgccggtgccggtgatggggatggtggcgag 4492 Query: 484 gtggaccatgaacacggcgaagccgatcgggaggggcgccaacaccgggacgtgagagtc 543 |||||| | ||| ||||||||| || ||||| ||||||| | |||||||| ||||| Sbjct: 4491 gtggacgaggaagacggcgaag---atggggagcggcgccaggatggggacgtgggagtc 4435 Query: 544 gcgtgcgctgcgcttggggtcggtggcggagaagacggtgtagacgagcacgaaggtgcc 603 | ||| ||||||||| |||||||||||||||||||||||||||||| ||||||||||| Sbjct: 4434 cctggcgttgcgcttggcgtcggtggcggagaagacggtgtagacgaggacgaaggtgcc 4375 Query: 604 gatgatctccgc 615 | ||||||||| Sbjct: 4374 cacgatctccgc 4363
>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete sequence Length = 22696651 Score = 153 bits (77), Expect = 9e-34 Identities = 170/201 (84%) Strand = Plus / Minus Query: 422 acggcggcccccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggcc 481 |||||||| || |||||||| |||||||||||||| |||||||||||||| || || ||| Sbjct: 21009488 acggcggcgccgaggctcctcgccgggttgatgcccgtgccggtgatcggaatcgtcgcc 21009429 Query: 482 aggtggaccatgaacacggcgaagccgatcgggaggggcgccaacaccgggacgtgagag 541 ||||| || | |||||| ||||| |||||||| || ||| | | || |||| | ||| Sbjct: 21009428 aggtgcacgacgaacaccgcgaacccgatcggcagcggcacgagtacggggatgaaggag 21009369 Query: 542 tcgcgtgcgctgcgcttggggtcggtggcggagaagacggtgtagacgagcacgaaggtg 601 ||||| ||| |||||||||||||||||||||||||||||||||||||||| | ||| ||| Sbjct: 21009368 tcgcgggcggtgcgcttggggtcggtggcggagaagacggtgtagacgaggatgaacgtg 21009309 Query: 602 ccgatgatctccgcggcgagg 622 |||| |||||| ||| ||||| Sbjct: 21009308 ccgacgatctcggcgccgagg 21009288
>dbj|AP006149.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC clone:B1274F11 Length = 171257 Score = 153 bits (77), Expect = 9e-34 Identities = 170/201 (84%) Strand = Plus / Minus Query: 422 acggcggcccccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggcc 481 |||||||| || |||||||| |||||||||||||| |||||||||||||| || || ||| Sbjct: 101577 acggcggcgccgaggctcctcgccgggttgatgcccgtgccggtgatcggaatcgtcgcc 101518 Query: 482 aggtggaccatgaacacggcgaagccgatcgggaggggcgccaacaccgggacgtgagag 541 ||||| || | |||||| ||||| |||||||| || ||| | | || |||| | ||| Sbjct: 101517 aggtgcacgacgaacaccgcgaacccgatcggcagcggcacgagtacggggatgaaggag 101458 Query: 542 tcgcgtgcgctgcgcttggggtcggtggcggagaagacggtgtagacgagcacgaaggtg 601 ||||| ||| |||||||||||||||||||||||||||||||||||||||| | ||| ||| Sbjct: 101457 tcgcgggcggtgcgcttggggtcggtggcggagaagacggtgtagacgaggatgaacgtg 101398 Query: 602 ccgatgatctccgcggcgagg 622 |||| |||||| ||| ||||| Sbjct: 101397 ccgacgatctcggcgccgagg 101377
>dbj|AK109439.2| Oryza sativa (japonica cultivar-group) cDNA clone:006-310-H08, full insert sequence Length = 1247 Score = 153 bits (77), Expect = 9e-34 Identities = 170/201 (84%) Strand = Plus / Minus Query: 422 acggcggcccccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggcc 481 |||||||| || |||||||| |||||||||||||| |||||||||||||| || || ||| Sbjct: 750 acggcggcgccgaggctcctcgccgggttgatgcccgtgccggtgatcggaatcgtcgcc 691 Query: 482 aggtggaccatgaacacggcgaagccgatcgggaggggcgccaacaccgggacgtgagag 541 ||||| || | |||||| ||||| |||||||| || ||| | | || |||| | ||| Sbjct: 690 aggtgcacgacgaacaccgcgaacccgatcggcagcggcacgagtacggggatgaaggag 631 Query: 542 tcgcgtgcgctgcgcttggggtcggtggcggagaagacggtgtagacgagcacgaaggtg 601 ||||| ||| |||||||||||||||||||||||||||||||||||||||| | ||| ||| Sbjct: 630 tcgcgggcggtgcgcttggggtcggtggcggagaagacggtgtagacgaggatgaacgtg 571 Query: 602 ccgatgatctccgcggcgagg 622 |||| |||||| ||| ||||| Sbjct: 570 ccgacgatctcggcgccgagg 550
>dbj|AK104786.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-039-D11, full insert sequence Length = 1249 Score = 153 bits (77), Expect = 9e-34 Identities = 170/201 (84%) Strand = Plus / Minus Query: 422 acggcggcccccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggcc 481 |||||||| || |||||||| |||||||||||||| |||||||||||||| || || ||| Sbjct: 748 acggcggcgccgaggctcctcgccgggttgatgcccgtgccggtgatcggaatcgtcgcc 689 Query: 482 aggtggaccatgaacacggcgaagccgatcgggaggggcgccaacaccgggacgtgagag 541 ||||| || | |||||| ||||| |||||||| || ||| | | || |||| | ||| Sbjct: 688 aggtgcacgacgaacaccgcgaacccgatcggcagcggcacgagtacggggatgaaggag 629 Query: 542 tcgcgtgcgctgcgcttggggtcggtggcggagaagacggtgtagacgagcacgaaggtg 601 ||||| ||| |||||||||||||||||||||||||||||||||||||||| | ||| ||| Sbjct: 628 tcgcgggcggtgcgcttggggtcggtggcggagaagacggtgtagacgaggatgaacgtg 569 Query: 602 ccgatgatctccgcggcgagg 622 |||| |||||| ||| ||||| Sbjct: 568 ccgacgatctcggcgccgagg 548
>dbj|AK067792.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013118N06, full insert sequence Length = 1302 Score = 153 bits (77), Expect = 9e-34 Identities = 170/201 (84%) Strand = Plus / Minus Query: 422 acggcggcccccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggcc 481 |||||||| || |||||||| |||||||||||||| |||||||||||||| || || ||| Sbjct: 743 acggcggcgccgaggctcctcgccgggttgatgcccgtgccggtgatcggaatcgtcgcc 684 Query: 482 aggtggaccatgaacacggcgaagccgatcgggaggggcgccaacaccgggacgtgagag 541 ||||| || | |||||| ||||| |||||||| || ||| | | || |||| | ||| Sbjct: 683 aggtgcacgacgaacaccgcgaacccgatcggcagcggcacgagtacggggatgaaggag 624 Query: 542 tcgcgtgcgctgcgcttggggtcggtggcggagaagacggtgtagacgagcacgaaggtg 601 ||||| ||| |||||||||||||||||||||||||||||||||||||||| | ||| ||| Sbjct: 623 tcgcgggcggtgcgcttggggtcggtggcggagaagacggtgtagacgaggatgaacgtg 564 Query: 602 ccgatgatctccgcggcgagg 622 |||| |||||| ||| ||||| Sbjct: 563 ccgacgatctcggcgccgagg 543
>dbj|AB109206.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC clone: P0478E02 Length = 140715 Score = 153 bits (77), Expect = 9e-34 Identities = 170/201 (84%) Strand = Plus / Minus Query: 422 acggcggcccccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggcc 481 |||||||| || |||||||| |||||||||||||| |||||||||||||| || || ||| Sbjct: 30788 acggcggcgccgaggctcctcgccgggttgatgcccgtgccggtgatcggaatcgtcgcc 30729 Query: 482 aggtggaccatgaacacggcgaagccgatcgggaggggcgccaacaccgggacgtgagag 541 ||||| || | |||||| ||||| |||||||| || ||| | | || |||| | ||| Sbjct: 30728 aggtgcacgacgaacaccgcgaacccgatcggcagcggcacgagtacggggatgaaggag 30669 Query: 542 tcgcgtgcgctgcgcttggggtcggtggcggagaagacggtgtagacgagcacgaaggtg 601 ||||| ||| |||||||||||||||||||||||||||||||||||||||| | ||| ||| Sbjct: 30668 tcgcgggcggtgcgcttggggtcggtggcggagaagacggtgtagacgaggatgaacgtg 30609 Query: 602 ccgatgatctccgcggcgagg 622 |||| |||||| ||| ||||| Sbjct: 30608 ccgacgatctcggcgccgagg 30588
>dbj|AB100870.1| Malus x domestica MdPIP1b mRNA for plasma membrane intrinsic protein, complete cds Length = 1223 Score = 149 bits (75), Expect = 1e-32 Identities = 198/239 (82%) Strand = Plus / Minus Query: 374 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 433 |||||||| ||||| || ||||||||||| | |||||||||||||| ||| || || Sbjct: 874 acccagaatatccagtggtcatcccaggcatgccgcttgttgtagatgatggcagcgccg 815 Query: 434 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 493 || |||||||| ||||||||||| || ||||||| ||||||||||||| ||| |||| | Sbjct: 814 agactcctggctgggttgatgccagttccggtgacggggatggtggccaagtgcaccaag 755 Query: 494 aacacggcgaagccgatcgggaggggcgccaacaccgggacgtgagagtcgcgtgcgctg 553 ||||||||||| || || || | || ||||| | ||| ||||| ||||| | ||||| Sbjct: 754 aacacggcgaacccaattggcaacggagccaaaatcggaacgtgggagtctctggcgcta 695 Query: 554 cgcttggggtcggtggcggagaagacggtgtagacgagcacgaaggtgccgatgatctc 612 ||||| | ||||||||||||||| |||||||||||||| || ||||||||||||||||| Sbjct: 694 cgcttagcgtcggtggcggagaaaacggtgtagacgaggacaaaggtgccgatgatctc 636
>dbj|AB009309.2| Hordeum vulgare HvPIP1;5 mRNA, complete cds Length = 1147 Score = 149 bits (75), Expect = 1e-32 Identities = 129/147 (87%) Strand = Plus / Minus Query: 367 ggggccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggc 426 |||||| |||||||||||||| || |||| |||||| | |||| |||||||||||| ||| Sbjct: 877 ggggcccacccagaagatccaatggtcattccaggcatggtccctgttgtagatgatggc 818 Query: 427 ggcccccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtg 486 ||||| |||||||| || ||||||||||||||||||||||| || |||||||||||||| Sbjct: 817 agccccaaggctcctagctgggttgatgccggtgccggtgatgggaatggtggccaggtg 758 Query: 487 gaccatgaacacggcgaagccgatcgg 513 ||||| |||||| ||||| || ||||| Sbjct: 757 gaccaggaacaccgcgaacccaatcgg 731 Score = 69.9 bits (35), Expect = 1e-08 Identities = 44/47 (93%) Strand = Plus / Minus Query: 566 gtggcggagaagacggtgtagacgagcacgaaggtgccgatgatctc 612 ||||||||||||||||||||||| || ||||||||||| |||||||| Sbjct: 678 gtggcggagaagacggtgtagaccaggacgaaggtgccaatgatctc 632
>dbj|AB016623.1| Oryza sativa gene for RWC-3, complete cds Length = 1403 Score = 147 bits (74), Expect = 5e-32 Identities = 163/192 (84%), Gaps = 3/192 (1%) Strand = Plus / Minus Query: 424 ggcggcccccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccag 483 |||||| || ||||| | ||| ||||||||||||||||||||||| ||||||||||| || Sbjct: 864 ggcggcgccgaggctgcgggcggggttgatgccggtgccggtgatggggatggtggcgag 805 Query: 484 gtggaccatgaacacggcgaagccgatcgggaggggcgccaacaccgggacgtgagagtc 543 |||||| | ||| |||||||| || ||||| ||||||| | |||||||| ||||| Sbjct: 804 gtggacgaggaagacggcgaac---atggggagcggcgccaggatggggacgtgggagtc 748 Query: 544 gcgtgcgctgcgcttggggtcggtggcggagaagacggtgtagacgagcacgaaggtgcc 603 | ||| ||||||||| |||||||||||||||||||||||||||||| ||||||||||| Sbjct: 747 cctggcgttgcgcttggcgtcggtggcggagaagacggtgtagacgaggacgaaggtgcc 688 Query: 604 gatgatctccgc 615 | ||||||||| Sbjct: 687 cacgatctccgc 676
>gb|AF141642.1|AF141642 Vitis berlandieri x Vitis rupestris putative aquaporin PIP2-1 (PIP2-1) mRNA, complete cds Length = 1300 Score = 145 bits (73), Expect = 2e-31 Identities = 280/349 (80%) Strand = Plus / Minus Query: 282 tgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggtggtaga 341 |||||||||| || || || |||||||| || || || || | |||| |||||||||||| Sbjct: 912 tgctcctgaatgacccaagagccttgatagctccagctctcaatatgaactggtggtaga 853 Query: 342 aggccgcgatcgccgcgccgatcatggggccgacccagaagatccactgatcatcccagg 401 |||| || || || || || || | ||| || ||||| ||||||||||| |||||||||| Sbjct: 852 aggctgcaatggctgcaccaatgaagggtccaacccaaaagatccactggtcatcccagg 793 Query: 402 ccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttgatgccggtgc 461 |||| || ||||||||||| || || ||||||| |||||||| |||||||| ||||||| Sbjct: 792 ccttctcattgttgtagataacagcagcccccaaactcctggcagggttgataccggtgc 733 Query: 462 cggtgatcgggatggtggccaggtggaccatgaacacggcgaagccgatcgggaggggcg 521 | ||||| || || ||||||| ||| |||||||||||||| || || || || || || | Sbjct: 732 cagtgataggaatagtggccaagtgaaccatgaacacggcaaacccaattggaagaggtg 673 Query: 522 ccaacaccgggacgtgagagtcgcgtgcgctgcgcttggggtcggtggcggagaagacgg 581 ||| || || || || ||||| | || || | ||||||||| || || |||||||||| Sbjct: 672 ccagaacaggaacatgggagtctctggcactcctcttggggtcagttgcagagaagacgg 613 Query: 582 tgtagacgagcacgaaggtgccgatgatctccgcggcgaggccggtgcc 630 ||||||| || || || || ||||||||||| ||| | | ||||||||| Sbjct: 612 tgtagacaaggacaaaagttccgatgatctcagcgcccaagccggtgcc 564
>ref|NM_116268.2| Arabidopsis thaliana TMP-C; water channel AT4G00430 (TMP-C) transcript variant AT4G00430.1 mRNA, complete cds Length = 1643 Score = 143 bits (72), Expect = 8e-31 Identities = 195/236 (82%) Strand = Plus / Minus Query: 374 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 433 |||||||| ||||| || |||||||| | | ||||||||||||||| | ||||| || Sbjct: 868 acccagaaaatccaatggtcatcccaagagtggtccttgttgtagataattgcggctcca 809 Query: 434 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 493 || || || || |||||||| ||||| ||||||||||| || || |||| ||| |||| | Sbjct: 808 agacttctagctgggttgattccggtcccggtgatcggtattgttgccaagtgtaccaag 749 Query: 494 aacacggcgaagccgatcgggaggggcgccaacaccgggacgtgagagtcgcgtgcgctg 553 ||||| || || ||||| ||||| |||||||| | ||||||||| ||||| || ||||| Sbjct: 748 aacactgcaaatccgattgggagcggcgccaaaatcgggacgtgtgagtcacgggcgctt 689 Query: 554 cgcttggggtcggtggcggagaagacggtgtagacgagcacgaaggtgccgatgat 609 | ||||| |||||||||||||||||| ||||||||||| ||||| || |||||||| Sbjct: 688 ctcttggcgtcggtggcggagaagacagtgtagacgagaacgaatgttccgatgat 633
>gb|BT000330.1| Arabidopsis thaliana probable plasma membrane intrinsic protein 1c (At4g00430) mRNA, complete cds Length = 1331 Score = 143 bits (72), Expect = 8e-31 Identities = 195/236 (82%) Strand = Plus / Minus Query: 374 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 433 |||||||| ||||| || |||||||| | | ||||||||||||||| | ||||| || Sbjct: 782 acccagaaaatccaatggtcatcccaagagtggtccttgttgtagataattgcggctcca 723 Query: 434 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 493 || || || || |||||||| ||||| ||||||||||| || || |||| ||| |||| | Sbjct: 722 agacttctagctgggttgattccggtcccggtgatcggtattgttgccaagtgtaccaag 663 Query: 494 aacacggcgaagccgatcgggaggggcgccaacaccgggacgtgagagtcgcgtgcgctg 553 ||||| || || ||||| ||||| |||||||| | ||||||||| ||||| || ||||| Sbjct: 662 aacactgcaaatccgattgggagcggcgccaaaatcgggacgtgtgagtcacgggcgctt 603 Query: 554 cgcttggggtcggtggcggagaagacggtgtagacgagcacgaaggtgccgatgat 609 | ||||| |||||||||||||||||| ||||||||||| ||||| || |||||||| Sbjct: 602 ctcttggcgtcggtggcggagaagacagtgtagacgagaacgaatgttccgatgat 547
>gb|AY120785.1| Arabidopsis thaliana probable plasma membrane intrinsic protein 1c (At4g00430) mRNA, complete cds Length = 1083 Score = 143 bits (72), Expect = 8e-31 Identities = 195/236 (82%) Strand = Plus / Minus Query: 374 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 433 |||||||| ||||| || |||||||| | | ||||||||||||||| | ||||| || Sbjct: 860 acccagaaaatccaatggtcatcccaagagtggtccttgttgtagataattgcggctcca 801 Query: 434 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 493 || || || || |||||||| ||||| ||||||||||| || || |||| ||| |||| | Sbjct: 800 agacttctagctgggttgattccggtcccggtgatcggtattgttgccaagtgtaccaag 741 Query: 494 aacacggcgaagccgatcgggaggggcgccaacaccgggacgtgagagtcgcgtgcgctg 553 ||||| || || ||||| ||||| |||||||| | ||||||||| ||||| || ||||| Sbjct: 740 aacactgcaaatccgattgggagcggcgccaaaatcgggacgtgtgagtcacgggcgctt 681 Query: 554 cgcttggggtcggtggcggagaagacggtgtagacgagcacgaaggtgccgatgat 609 | ||||| |||||||||||||||||| ||||||||||| ||||| || |||||||| Sbjct: 680 ctcttggcgtcggtggcggagaagacagtgtagacgagaacgaatgttccgatgat 625
>gb|AY099825.1| Arabidopsis thaliana probable plasma membrane intrinsic protein 1c (At4g00430) mRNA, complete cds Length = 1631 Score = 143 bits (72), Expect = 8e-31 Identities = 195/236 (82%) Strand = Plus / Minus Query: 374 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 433 |||||||| ||||| || |||||||| | | ||||||||||||||| | ||||| || Sbjct: 856 acccagaaaatccaatggtcatcccaagagtggtccttgttgtagataattgcggctcca 797 Query: 434 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 493 || || || || |||||||| ||||| ||||||||||| || || |||| ||| |||| | Sbjct: 796 agacttctagctgggttgattccggtcccggtgatcggtattgttgccaagtgtaccaag 737 Query: 494 aacacggcgaagccgatcgggaggggcgccaacaccgggacgtgagagtcgcgtgcgctg 553 ||||| || || ||||| ||||| |||||||| | ||||||||| ||||| || ||||| Sbjct: 736 aacactgcaaatccgattgggagcggcgccaaaatcgggacgtgtgagtcacgggcgctt 677 Query: 554 cgcttggggtcggtggcggagaagacggtgtagacgagcacgaaggtgccgatgat 609 | ||||| |||||||||||||||||| ||||||||||| ||||| || |||||||| Sbjct: 676 ctcttggcgtcggtggcggagaagacagtgtagacgagaacgaatgttccgatgat 621
>gb|BT006313.1| Arabidopsis thaliana At4g00430 mRNA, complete cds Length = 864 Score = 143 bits (72), Expect = 8e-31 Identities = 195/236 (82%) Strand = Plus / Minus Query: 374 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 433 |||||||| ||||| || |||||||| | | ||||||||||||||| | ||||| || Sbjct: 782 acccagaaaatccaatggtcatcccaagagtggtccttgttgtagataattgcggctcca 723 Query: 434 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 493 || || || || |||||||| ||||| ||||||||||| || || |||| ||| |||| | Sbjct: 722 agacttctagctgggttgattccggtcccggtgatcggtattgttgccaagtgtaccaag 663 Query: 494 aacacggcgaagccgatcgggaggggcgccaacaccgggacgtgagagtcgcgtgcgctg 553 ||||| || || ||||| ||||| |||||||| | ||||||||| ||||| || ||||| Sbjct: 662 aacactgcaaatccgattgggagcggcgccaaaatcgggacgtgtgagtcacgggcgctt 603 Query: 554 cgcttggggtcggtggcggagaagacggtgtagacgagcacgaaggtgccgatgat 609 | ||||| |||||||||||||||||| ||||||||||| ||||| || |||||||| Sbjct: 602 ctcttggcgtcggtggcggagaagacagtgtagacgagaacgaatgttccgatgat 547
>dbj|AK119719.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-157-G06, full insert sequence Length = 1066 Score = 143 bits (72), Expect = 8e-31 Identities = 156/184 (84%) Strand = Plus / Minus Query: 422 acggcggcccccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggcc 481 |||||||| || |||||||| |||||||||||||| |||||||||||||| || || ||| Sbjct: 648 acggcggcgccgaggctcctcgccgggttgatgcccgtgccggtgatcggaatcgtcgcc 589 Query: 482 aggtggaccatgaacacggcgaagccgatcgggaggggcgccaacaccgggacgtgagag 541 ||||| || | |||||| ||||| |||||||| || ||| | | || |||| | ||| Sbjct: 588 aggtgcacgacgaacaccgcgaacccgatcggcagcggcacgagtacggggatgaaggag 529 Query: 542 tcgcgtgcgctgcgcttggggtcggtggcggagaagacggtgtagacgagcacgaaggtg 601 ||||| ||| |||||||||||||||||||||||||||||||||||||||| | ||| ||| Sbjct: 528 tcgcgggcggtgcgcttggggtcggtggcggagaagacggtgtagacgaggatgaacgtg 469 Query: 602 ccga 605 |||| Sbjct: 468 ccga 465
>dbj|D26609.1|ATHTMP Arabidopsis thaliana mRNA for transmembrane protein, complete cds Length = 1100 Score = 143 bits (72), Expect = 8e-31 Identities = 195/236 (82%) Strand = Plus / Minus Query: 374 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 433 |||||||| ||||| || |||||||| | | ||||||||||||||| | ||||| || Sbjct: 915 acccagaaaatccaatggtcatcccaagagtggtccttgttgtagataattgcggctcca 856 Query: 434 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 493 || || || || |||||||| ||||| ||||||||||| || || |||| ||| |||| | Sbjct: 855 agacttctagctgggttgattccggtcccggtgatcggtattgttgccaagtgtaccaag 796 Query: 494 aacacggcgaagccgatcgggaggggcgccaacaccgggacgtgagagtcgcgtgcgctg 553 ||||| || || ||||| ||||| |||||||| | ||||||||| ||||| || ||||| Sbjct: 795 aacactgcaaatccgattgggagcggcgccaaaatcgggacgtgtgagtcacgggcgctt 736 Query: 554 cgcttggggtcggtggcggagaagacggtgtagacgagcacgaaggtgccgatgat 609 | ||||| |||||||||||||||||| ||||||||||| ||||| || |||||||| Sbjct: 735 ctcttggcgtcggtggcggagaagacagtgtagacgagaacgaatgttccgatgat 680
>dbj|AB058679.1| Pyrus communis Py-PIP1-1 mRNA for plasma membrane intrinsic protein 1-1, complete cds Length = 1351 Score = 141 bits (71), Expect = 3e-30 Identities = 197/239 (82%) Strand = Plus / Minus Query: 374 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 433 |||||||| | ||| || ||||||||||| | | |||||||||||||| ||| || || Sbjct: 1015 acccagaaaacccagtggtcatcccaggcatgctgcttgttgtagatgatggcagcgcca 956 Query: 434 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 493 || |||||||| ||||||||||| || ||||||| ||||||||||||| ||| |||| | Sbjct: 955 agactcctggctgggttgatgccagttccggtgacggggatggtggccaagtgcaccaag 896 Query: 494 aacacggcgaagccgatcgggaggggcgccaacaccgggacgtgagagtcgcgtgcgctg 553 ||||||||||| || || || | || ||||| | ||| || || ||||| | ||||| Sbjct: 895 aacacggcgaacccaattggcaacggagccaaaatcggaacatgcgagtctctggcgcta 836 Query: 554 cgcttggggtcggtggcggagaagacggtgtagacgagcacgaaggtgccgatgatctc 612 ||||| | ||||||||||||||| |||||||||||||| || ||||||||||||||||| Sbjct: 835 cgcttagcgtcggtggcggagaaaacggtgtagacgaggacaaaggtgccgatgatctc 777
>emb|AJ849328.1| Populus tremula x Populus tremuloides mRNA for putative plasma membrane intrinsic protein (pip2.5 gene) Length = 1094 Score = 139 bits (70), Expect = 1e-29 Identities = 199/242 (82%) Strand = Plus / Minus Query: 371 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcc 430 ||||||||||||||||| || |||||||| |||||||| | |||||| || || || || Sbjct: 809 ccgacccagaagatccaatggtcatcccatgccttgtcttcgttgtatatcacagcagct 750 Query: 431 cccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggacc 490 || | |||||| ||||||||||| || || |||||||| ||||| ||||||||||| ||| Sbjct: 749 ccaaagctcctagccgggttgataccagttccggtgattgggatagtggccaggtgaacc 690 Query: 491 atgaacacggcgaagccgatcgggaggggcgccaacaccgggacgtgagagtcgcgtgcg 550 ||||| || || || ||||| || || || |||||||| || || || ||||| | |||| Sbjct: 689 atgaagacagcaaatccgatgggaagtggtgccaacacaggaacatgggagtcccttgcg 630 Query: 551 ctgcgcttggggtcggtggcggagaagacggtgtagacgagcacgaaggtgccgatgatc 610 | | ||| ||||| || ||||||||||| ||||||||||| || ||||| ||||||||| Sbjct: 629 ttcctctttgggtcagtagcggagaagacagtgtagacgagaacaaaggtaccgatgatc 570 Query: 611 tc 612 || Sbjct: 569 tc 568
>gb|AF141643.1|AF141643 Vitis berlandieri x Vitis rupestris putative aquaporin PIP1-1 (PIP1-1) mRNA, complete cds Length = 1115 Score = 139 bits (70), Expect = 1e-29 Identities = 190/230 (82%) Strand = Plus / Minus Query: 374 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 433 |||||||||||||| || || ||||| || | ||||||||||||||||| ||| || ||| Sbjct: 810 acccagaagatccagtggtcgtcccatgcgtggtccttgttgtagatgatggccgcaccc 751 Query: 434 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 493 ||||||| || |||||||||||||| ||||| || ||||||||||||| ||| |||| | Sbjct: 750 aggctccgagctgggttgatgccggttccggttatggggatggtggccaagtgcaccaag 691 Query: 494 aacacggcgaagccgatcgggaggggcgccaacaccgggacgtgagagtcgcgtgcgctg 553 ||||| ||||| ||||| || | || |||| | |||||||| ||||| | ||| | Sbjct: 690 aacactgcgaacccgattggcaacggtgccagtatagggacgtgggagtctctagcgtta 631 Query: 554 cgcttggggtcggtggcggagaagacggtgtagacgagcacgaaggtgcc 603 ||||||| ||| |||||||||||||| |||||||| || ||||||||||| Sbjct: 630 cgcttggcgtcagtggcggagaagacagtgtagacaaggacgaaggtgcc 581
>gb|DQ341104.1| Rhododendron catawbiense aquaporin PIP2-1 mRNA, complete cds Length = 1192 Score = 139 bits (70), Expect = 1e-29 Identities = 199/242 (82%) Strand = Plus / Minus Query: 371 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcc 430 |||||||| || ||||| ||||||||||||||||| ||||||||||| || || || Sbjct: 816 ccgacccaaaatatccattgatcatcccaggccttagaattgttgtagataaccgcagct 757 Query: 431 cccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggacc 490 || | ||| || || |||||||| |||||||| ||||| ||||||||||||||||| ||| Sbjct: 756 ccgaagcttctagcggggttgattccggtgcctgtgattgggatggtggccaggtgaacc 697 Query: 491 atgaacacggcgaagccgatcgggaggggcgccaacaccgggacgtgagagtcgcgtgcg 550 ||||| |||||||| ||||| ||||| || ||||| || || || |||||||| | ||| Sbjct: 696 atgaatacggcgaatccgattgggagcggagccaaaacgggaacatgagagtctctggcg 637 Query: 551 ctgcgcttggggtcggtggcggagaagacggtgtagacgagcacgaaggtgccgatgatc 610 || | ||| || |||||||| |||||||| |||||||| | || ||||| ||||||||| Sbjct: 636 ctcctcttaggatcggtggctgagaagacagtgtagaccaaaacaaaggtcccgatgatc 577 Query: 611 tc 612 || Sbjct: 576 tc 575
>gb|AY107589.1| Zea mays PCO085320 mRNA sequence Length = 569 Score = 139 bits (70), Expect = 1e-29 Identities = 145/170 (85%) Strand = Plus / Minus Query: 368 gggccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcg 427 |||||||||||||| ||||| ||||| ||||| ||||| || |||||| | ||||| Sbjct: 194 gggccgacccagaatatccagtgatcctcccacgcctttcgctggttgtacacaacggcc 135 Query: 428 gcccccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtgg 487 | |||||||||||| |||||||||||||| |||||||||| ||||||||||||||||| Sbjct: 134 ggccccaggctccttgccgggttgatgcccgtgccggtgacggggatggtggccaggtgc 75 Query: 488 accatgaacacggcgaagccgatcgggaggggcgccaacaccgggacgtg 537 ||||||||||| ||||| ||||| || || ||||||| ||||||||||| Sbjct: 74 accatgaacaccgcgaatccgatgggcagcggcgccaggaccgggacgtg 25
>ref|NM_129274.2| Arabidopsis thaliana RD28; water channel AT2G37180 (RD28) mRNA, complete cds Length = 1143 Score = 137 bits (69), Expect = 5e-29 Identities = 210/257 (81%) Strand = Plus / Minus Query: 374 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 433 |||||||| ||||| || |||||||| | |||| |||||| |||| |||||||| || Sbjct: 819 acccagaatatccagtggtcatcccatggcttgctcttgttaaagattacggcggctccg 760 Query: 434 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 493 | ||||| ||||||||||| ||||| ||||||||||| || ||||||| || ||||| Sbjct: 759 aaactcctagccgggttgataccggttccggtgatcggaatagtggccaaatgtaccata 700 Query: 494 aacacggcgaagccgatcgggaggggcgccaacaccgggacgtgagagtcgcgtgcgctg 553 ||||| || || || ||||| || |||||||| ||||| ||||| ||||| | ||| || Sbjct: 699 aacaccgcaaacccaatcggaagtggcgccaaaaccggaacgtgggagtctctagcgttg 640 Query: 554 cgcttggggtcggtggcggagaagacggtgtagacgagcacgaaggtgccgatgatctcc 613 || ||||| || || ||||||||||| |||||||| |||||||| || ||||||||||| Sbjct: 639 cgtttgggatcagtagcggagaagactgtgtagacaagcacgaatgttccgatgatctct 580 Query: 614 gcggcgaggccggtgcc 630 || ||||| |||||||| Sbjct: 579 gccgcgagtccggtgcc 563
>gb|AY096701.1| Arabidopsis thaliana putative aquaporin protein (At2g37180) mRNA, complete cds Length = 889 Score = 137 bits (69), Expect = 5e-29 Identities = 210/257 (81%) Strand = Plus / Minus Query: 374 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 433 |||||||| ||||| || |||||||| | |||| |||||| |||| |||||||| || Sbjct: 752 acccagaatatccagtggtcatcccatggcttgctcttgttaaagattacggcggctccg 693 Query: 434 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 493 | ||||| ||||||||||| ||||| ||||||||||| || ||||||| || ||||| Sbjct: 692 aaactcctagccgggttgataccggttccggtgatcggaatagtggccaaatgtaccata 633 Query: 494 aacacggcgaagccgatcgggaggggcgccaacaccgggacgtgagagtcgcgtgcgctg 553 ||||| || || || ||||| || |||||||| ||||| ||||| ||||| | ||| || Sbjct: 632 aacaccgcaaacccaatcggaagtggcgccaaaaccggaacgtgggagtctctagcgttg 573 Query: 554 cgcttggggtcggtggcggagaagacggtgtagacgagcacgaaggtgccgatgatctcc 613 || ||||| || || ||||||||||| |||||||| |||||||| || ||||||||||| Sbjct: 572 cgtttgggatcagtagcggagaagactgtgtagacaagcacgaatgttccgatgatctct 513 Query: 614 gcggcgaggccggtgcc 630 || ||||| |||||||| Sbjct: 512 gccgcgagtccggtgcc 496
>gb|AY064029.1| Arabidopsis thaliana putative aquaporin, plasma membrane intrinsic protein 2C (At2g37180) mRNA, complete cds Length = 1151 Score = 137 bits (69), Expect = 5e-29 Identities = 210/257 (81%) Strand = Plus / Minus Query: 374 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 433 |||||||| ||||| || |||||||| | |||| |||||| |||| |||||||| || Sbjct: 819 acccagaatatccagtggtcatcccatggcttgctcttgttaaagattacggcggctccg 760 Query: 434 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 493 | ||||| ||||||||||| ||||| ||||||||||| || ||||||| || ||||| Sbjct: 759 aaactcctagccgggttgataccggttccggtgatcggaatagtggccaaatgtaccata 700 Query: 494 aacacggcgaagccgatcgggaggggcgccaacaccgggacgtgagagtcgcgtgcgctg 553 ||||| || || || ||||| || |||||||| ||||| ||||| ||||| | ||| || Sbjct: 699 aacaccgcaaacccaatcggaagtggcgccaaaaccggaacgtgggagtctctagcgttg 640 Query: 554 cgcttggggtcggtggcggagaagacggtgtagacgagcacgaaggtgccgatgatctcc 613 || ||||| || || ||||||||||| |||||||| |||||||| || ||||||||||| Sbjct: 639 cgtttgggatcagtagcggagaagactgtgtagacaagcacgaatgttccgatgatctct 580 Query: 614 gcggcgaggccggtgcc 630 || ||||| |||||||| Sbjct: 579 gccgcgagtccggtgcc 563
>emb|AJ224327.1|OSAJ4327 Oryza sativa mRNA for aquaporin, complete CDS Length = 1139 Score = 137 bits (69), Expect = 5e-29 Identities = 111/125 (88%) Strand = Plus / Minus Query: 374 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 433 |||||||||||||| || |||| |||||| | ||||||||||||||||| ||| || || Sbjct: 812 acccagaagatccaatggtcattccaggcatggtccttgttgtagatgatggcagcgcca 753 Query: 434 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 493 ||||||||||| ||||||||||| || |||||||| |||||||||||||||||||||| | Sbjct: 752 aggctcctggctgggttgatgccagtaccggtgatggggatggtggccaggtggaccagg 693 Query: 494 aacac 498 ||||| Sbjct: 692 aacac 688 Score = 44.1 bits (22), Expect = 0.58 Identities = 34/38 (89%) Strand = Plus / Minus Query: 566 gtggcggagaagacggtgtagacgagcacgaaggtgcc 603 ||||| ||||||||||||||||| || | ||||||||| Sbjct: 620 gtggctgagaagacggtgtagaccaggatgaaggtgcc 583
>gb|AY084875.1| Arabidopsis thaliana clone 11998 mRNA, complete sequence Length = 1060 Score = 137 bits (69), Expect = 5e-29 Identities = 210/257 (81%) Strand = Plus / Minus Query: 374 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 433 |||||||| ||||| || |||||||| | |||| |||||| |||| |||||||| || Sbjct: 819 acccagaatatccagtggtcatcccatggcttgctcttgttaaagattacggcggctccg 760 Query: 434 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 493 | ||||| ||||||||||| ||||| ||||||||||| || ||||||| || ||||| Sbjct: 759 aaactcctagccgggttgataccggttccggtgatcggaatagtggccaaatgtaccata 700 Query: 494 aacacggcgaagccgatcgggaggggcgccaacaccgggacgtgagagtcgcgtgcgctg 553 ||||| || || || ||||| || |||||||| ||||| ||||| ||||| | ||| || Sbjct: 699 aacaccgcaaacccaatcggaagtggcgccaaaaccggaacgtgggagtctctagcgttg 640 Query: 554 cgcttggggtcggtggcggagaagacggtgtagacgagcacgaaggtgccgatgatctcc 613 || ||||| || || ||||||||||| |||||||| |||||||| || ||||||||||| Sbjct: 639 cgtttgggatcagtagcggagaagactgtgtagacaagcacgaatgttccgatgatctct 580 Query: 614 gcggcgaggccggtgcc 630 || ||||| |||||||| Sbjct: 579 gccgcgagtccggtgcc 563
>dbj|D13254.1|ATHRD28 Arabidopsis thaliana mRNA for putative transmenbrane channel protein Length = 1121 Score = 137 bits (69), Expect = 5e-29 Identities = 210/257 (81%) Strand = Plus / Minus Query: 374 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 433 |||||||| ||||| || |||||||| | |||| |||||| |||| |||||||| || Sbjct: 802 acccagaatatccagtggtcatcccatggcttgctcttgttaaagattacggcggctccg 743 Query: 434 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 493 | ||||| ||||||||||| ||||| ||||||||||| || ||||||| || ||||| Sbjct: 742 aaactcctagccgggttgataccggttccggtgatcggaatagtggccaaatgtaccata 683 Query: 494 aacacggcgaagccgatcgggaggggcgccaacaccgggacgtgagagtcgcgtgcgctg 553 ||||| || || || ||||| || |||||||| ||||| ||||| ||||| | ||| || Sbjct: 682 aacaccgcaaacccaatcggaagtggcgccaaaaccggaacgtgggagtctctagcgttg 623 Query: 554 cgcttggggtcggtggcggagaagacggtgtagacgagcacgaaggtgccgatgatctcc 613 || ||||| || || ||||||||||| |||||||| |||||||| || ||||||||||| Sbjct: 622 cgtttgggatcagtagcggagaagactgtgtagacaagcacgaatgttccgatgatctct 563 Query: 614 gcggcgaggccggtgcc 630 || ||||| |||||||| Sbjct: 562 gccgcgagtccggtgcc 546
>dbj|AK104658.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-311-D06, full insert sequence Length = 1128 Score = 137 bits (69), Expect = 5e-29 Identities = 111/125 (88%) Strand = Plus / Minus Query: 374 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 433 |||||||||||||| || |||| |||||| | ||||||||||||||||| ||| || || Sbjct: 845 acccagaagatccaatggtcattccaggcatggtccttgttgtagatgatggcagcgcca 786 Query: 434 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 493 ||||||||||| ||||||||||| || |||||||| |||||||||||||||||||||| | Sbjct: 785 aggctcctggctgggttgatgccagtaccggtgatggggatggtggccaggtggaccagg 726 Query: 494 aacac 498 ||||| Sbjct: 725 aacac 721 Score = 44.1 bits (22), Expect = 0.58 Identities = 34/38 (89%) Strand = Plus / Minus Query: 566 gtggcggagaagacggtgtagacgagcacgaaggtgcc 603 ||||| ||||||||||||||||| || | ||||||||| Sbjct: 653 gtggctgagaagacggtgtagaccaggatgaaggtgcc 616
>dbj|AK103807.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033147A07, full insert sequence Length = 1205 Score = 137 bits (69), Expect = 5e-29 Identities = 111/125 (88%) Strand = Plus / Minus Query: 374 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 433 |||||||||||||| || |||| |||||| | ||||||||||||||||| ||| || || Sbjct: 900 acccagaagatccaatggtcattccaggcatggtccttgttgtagatgatggcagcgcca 841 Query: 434 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 493 ||||||||||| ||||||||||| || |||||||| |||||||||||||||||||||| | Sbjct: 840 aggctcctggctgggttgatgccagtaccggtgatggggatggtggccaggtggaccagg 781 Query: 494 aacac 498 ||||| Sbjct: 780 aacac 776 Score = 44.1 bits (22), Expect = 0.58 Identities = 34/38 (89%) Strand = Plus / Minus Query: 566 gtggcggagaagacggtgtagacgagcacgaaggtgcc 603 ||||| ||||||||||||||||| || | ||||||||| Sbjct: 708 gtggctgagaagacggtgtagaccaggatgaaggtgcc 671
>dbj|AK061769.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-039-C05, full insert sequence Length = 1136 Score = 137 bits (69), Expect = 5e-29 Identities = 111/125 (88%) Strand = Plus / Minus Query: 374 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 433 |||||||||||||| || |||| |||||| | ||||||||||||||||| ||| || || Sbjct: 845 acccagaagatccaatggtcattccaggcatggtccttgttgtagatgatggcagcgcca 786 Query: 434 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 493 ||||||||||| ||||||||||| || |||||||| |||||||||||||||||||||| | Sbjct: 785 aggctcctggctgggttgatgccagtaccggtgatggggatggtggccaggtggaccagg 726 Query: 494 aacac 498 ||||| Sbjct: 725 aacac 721 Score = 44.1 bits (22), Expect = 0.58 Identities = 34/38 (89%) Strand = Plus / Minus Query: 566 gtggcggagaagacggtgtagacgagcacgaaggtgcc 603 ||||| ||||||||||||||||| || | ||||||||| Sbjct: 653 gtggctgagaagacggtgtagaccaggatgaaggtgcc 616
>gb|AF022737.1|AF022737 Oryza sativa transmembrane protein mRNA, complete cds Length = 1140 Score = 137 bits (69), Expect = 5e-29 Identities = 111/125 (88%) Strand = Plus / Minus Query: 374 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 433 |||||||||||||| || |||| |||||| | ||||||||||||||||| ||| || || Sbjct: 840 acccagaagatccaatggtcattccaggcatggtccttgttgtagatgatggcagcgcca 781 Query: 434 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 493 ||||||||||| ||||||||||| || |||||||| |||||||||||||||||||||| | Sbjct: 780 aggctcctggctgggttgatgccagtaccggtgatggggatggtggccaggtggaccagg 721 Query: 494 aacac 498 ||||| Sbjct: 720 aacac 716 Score = 44.1 bits (22), Expect = 0.58 Identities = 34/38 (89%) Strand = Plus / Minus Query: 566 gtggcggagaagacggtgtagacgagcacgaaggtgcc 603 ||||| ||||||||||||||||| || | ||||||||| Sbjct: 648 gtggctgagaagacggtgtagaccaggatgaaggtgcc 611
>dbj|AB009665.1| Oryza sativa (japonica cultivar-group) mRNA for water channel protein, complete cds Length = 1116 Score = 137 bits (69), Expect = 5e-29 Identities = 111/125 (88%) Strand = Plus / Minus Query: 374 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 433 |||||||||||||| || |||| |||||| | ||||||||||||||||| ||| || || Sbjct: 843 acccagaagatccaatggtcattccaggcatggtccttgttgtagatgatggcagcgcca 784 Query: 434 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 493 ||||||||||| ||||||||||| || |||||||| |||||||||||||||||||||| | Sbjct: 783 aggctcctggctgggttgatgccagtaccggtgatggggatggtggccaggtggaccagg 724 Query: 494 aacac 498 ||||| Sbjct: 723 aacac 719 Score = 44.1 bits (22), Expect = 0.58 Identities = 34/38 (89%) Strand = Plus / Minus Query: 566 gtggcggagaagacggtgtagacgagcacgaaggtgcc 603 ||||| ||||||||||||||||| || | ||||||||| Sbjct: 651 gtggctgagaagacggtgtagaccaggatgaaggtgcc 614
>emb|AJ310639.1|HVU310639 Hordeum vulgare partial pip1 gene for putative aquaporin Length = 1291 Score = 135 bits (68), Expect = 2e-28 Identities = 92/100 (92%) Strand = Plus / Minus Query: 411 tgttgtagatgacggcggcccccaggctcctggccgggttgatgccggtgccggtgatcg 470 |||||||||||| ||| || || |||||||| |||||||||||||||||||||||||| | Sbjct: 657 tgttgtagatgatggccgcgccgaggctcctcgccgggttgatgccggtgccggtgatgg 598 Query: 471 ggatggtggccaggtggaccatgaacacggcgaagccgat 510 ||||||||||||||||||||| |||||||||||| ||||| Sbjct: 597 ggatggtggccaggtggaccaggaacacggcgaacccgat 558 Score = 113 bits (57), Expect = 8e-22 Identities = 81/89 (91%) Strand = Plus / Minus Query: 556 cttggggtcggtggcggagaagacggtgtagacgagcacgaaggtgccgatgatctccgc 615 ||||| |||||||||||||||||||||||||||||| |||||||||||||||||||| || Sbjct: 390 cttggcgtcggtggcggagaagacggtgtagacgaggacgaaggtgccgatgatctcggc 331 Query: 616 ggcgaggccggtgcccttggagtatccgg 644 | |||| |||| |||||||| ||| |||| Sbjct: 330 gccgagcccggagcccttggtgtagccgg 302 Score = 63.9 bits (32), Expect = 6e-07 Identities = 53/60 (88%) Strand = Plus / Minus Query: 331 ctggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactg 390 ||||||||||| ||| || | ||| |||||||| | |||||||||||||||||||||||| Sbjct: 1291 ctggtggtagatggcggccagcgcggcgccgatgaaggggccgacccagaagatccactg 1232
>emb|BX829233.1|CNS0A3FQ Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTSIL83ZB07 of Silique of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1000 Score = 135 bits (68), Expect = 2e-28 Identities = 194/236 (82%) Strand = Plus / Minus Query: 374 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 433 |||||||| ||||| || |||||||| | | ||||||||||||||| | ||||| || Sbjct: 843 acccagaaaatccaatggtcatcccaagagtggtccttgttgtagataattgcggctcca 784 Query: 434 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 493 || || || || |||||||| ||||| ||||||||||| || || |||| ||| |||| | Sbjct: 783 agacttctagctgggttgattccggtcccggtgatcggtattgttgccaagtgtaccaag 724 Query: 494 aacacggcgaagccgatcgggaggggcgccaacaccgggacgtgagagtcgcgtgcgctg 553 ||||| || || ||||| ||||| |||||||| | ||||||||| |||| || ||||| Sbjct: 723 aacactgcaaatccgattgggagcggcgccaaaatcgggacgtgtgagtaacgggcgctt 664 Query: 554 cgcttggggtcggtggcggagaagacggtgtagacgagcacgaaggtgccgatgat 609 | ||||| |||||||||||||||||| ||||||||||| ||||| || |||||||| Sbjct: 663 ctcttggcgtcggtggcggagaagacagtgtagacgagaacgaatgttccgatgat 608
>gb|DQ269455.1| Stevia rebaudiana aquaporin mRNA, partial cds Length = 1070 Score = 135 bits (68), Expect = 2e-28 Identities = 194/236 (82%) Strand = Plus / Minus Query: 374 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 433 |||||||| ||||| ||||||||||| || ||||| ||||||||||| |||||||| || Sbjct: 746 acccagaaaatccattgatcatcccaagctttgtctttgttgtagattacggcggctccg 687 Query: 434 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 493 | ||| ||||| ||||| || ||||||||||||||||| |||||||| | ||| |||||| Sbjct: 686 aagcttctggcggggttaattccggtgccggtgatcggaatggtggctaagtgaaccatg 627 Query: 494 aacacggcgaagccgatcgggaggggcgccaacaccgggacgtgagagtcgcgtgcgctg 553 || ||||| || || || || || || |||||||| || || ||||||||||| || || Sbjct: 626 aagacggcaaaccctatgggtagtggtgccaacacgggaacatgagagtcgcgggcactt 567 Query: 554 cgcttggggtcggtggcggagaagacggtgtagacgagcacgaaggtgccgatgat 609 | ||| || || || || || ||||||||||| || || || |||||||||||||| Sbjct: 566 ctcttaggatcagtagccgaaaagacggtgtacacaagaacaaaggtgccgatgat 511
>gb|AY714381.1| Aegiceras corniculatum aquaporin 2 mRNA, partial cds Length = 740 Score = 133 bits (67), Expect = 8e-28 Identities = 184/223 (82%) Strand = Plus / Minus Query: 375 cccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccca 434 ||||||| ||||||||||||||||| | ||| | ||||||||||| || ||||| |||| Sbjct: 481 cccagaaaatccactgatcatcccatgtcttttttttgttgtagatcacagcggctccca 422 Query: 435 ggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatga 494 ||| | ||||||||| ||||| || |||||||||||||| ||||||| ||||||||| | Sbjct: 421 agctacgggccgggttaatgccagttccggtgatcgggatcgtggccaagtggaccataa 362 Query: 495 acacggcgaagccgatcgggaggggcgccaacaccgggacgtgagagtcgcgtgcgctgc 554 | ||||| || || || || || || ||||| ||||| || |||||||| || || || | Sbjct: 361 aaacggcaaatcctattggaagtggtgccaaaaccggtacatgagagtcacgggcacttc 302 Query: 555 gcttggggtcggtggcggagaagacggtgtagacgagcacgaa 597 ||||||||| || || |||||||||||||| || |||||||| Sbjct: 301 tcttggggtcagtagcagagaagacggtgtaaacaagcacgaa 259
>dbj|AB206102.1| Mimosa pudica pip2;4 mRNA for plasma membrane intrinsic protein 2;4, complete cds Length = 1263 Score = 133 bits (67), Expect = 8e-28 Identities = 169/203 (83%) Strand = Plus / Minus Query: 410 ttgttgtagatgacggcggcccccaggctcctggccgggttgatgccggtgccggtgatc 469 |||||||| ||||| || ||||| | |||||||||||||||||| || ||||| ||||| Sbjct: 759 ttgttgtacatgactgcagccccaaagctcctggccgggttgataccagtgccagtgatg 700 Query: 470 gggatggtggccaggtggaccatgaacacggcgaagccgatcgggaggggcgccaacacc 529 || ||||||| ||||| |||||||| ||||| || || || || || || ||||| || Sbjct: 699 ggaatggtggttaggtgaaccatgaaaacggcaaatccaataggaagaggagccaatacg 640 Query: 530 gggacgtgagagtcgcgtgcgctgcgcttggggtcggtggcggagaagacggtgtagacg 589 |||||||||||||| || || | || |||||||| ||||||||||| ||||||||||| Sbjct: 639 gggacgtgagagtctcgggcatttcgtttggggtcagtggcggagaaaacggtgtagaca 580 Query: 590 agcacgaaggtgccgatgatctc 612 || ||||||||||| |||||||| Sbjct: 579 aggacgaaggtgcctatgatctc 557
>dbj|AB100869.1| Malus x domestica MdPIP1a mRNA for plasma membrane intrinsic protein, complete cds Length = 1260 Score = 133 bits (67), Expect = 8e-28 Identities = 196/239 (82%) Strand = Plus / Minus Query: 374 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 433 |||||||| ||||| || ||||||||||| | | |||||||||||||| ||| || || Sbjct: 878 acccagaatatccagtggtcatcccaggcatgcttcttgttgtagatgatggcagcgcca 819 Query: 434 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 493 || || || || ||||||||||| || ||||||| ||||||||||||| ||| |||| | Sbjct: 818 agacttcttgctgggttgatgccagttccggtgacggggatggtggccaagtgcaccaag 759 Query: 494 aacacggcgaagccgatcgggaggggcgccaacaccgggacgtgagagtcgcgtgcgctg 553 ||||||||||| || || || | || ||||| | ||| ||||| ||||| | ||||| Sbjct: 758 aacacggcgaacccaattggcaacggagccaaaatcggaacgtgggagtctctggcgcta 699 Query: 554 cgcttggggtcggtggcggagaagacggtgtagacgagcacgaaggtgccgatgatctc 612 ||||| | ||| ||||||||||| |||||||||||||| || ||||||||||||||||| Sbjct: 698 cgcttagcgtcagtggcggagaaaacggtgtagacgaggacaaaggtgccgatgatctc 640
>gb|AY823263.1| Vitis vinifera aquaporin (PIP2-1) mRNA, complete cds Length = 1216 Score = 131 bits (66), Expect = 3e-27 Identities = 246/306 (80%) Strand = Plus / Minus Query: 325 tatgtactggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagat 384 |||| |||||||||||||||| || || || || || || | ||| || ||||| ||||| Sbjct: 873 tatgaactggtggtagaaggctgcaatggctgcaccaatgaagggtccaacccaaaagat 814 Query: 385 ccactgatcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggc 444 |||||| |||||||||||||| || ||||||||||| || || ||||||| |||||||| Sbjct: 813 ccactggtcatcccaggccttctcattgttgtagataacagcagcccccaaactcctggc 754 Query: 445 cgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatgaacacggcgaa 504 |||||||| |||||||| ||||| || || ||||||| ||| |||||||||||||| || Sbjct: 753 agggttgataccggtgccagtgataggaatagtggccaagtgaaccatgaacacggcaaa 694 Query: 505 gccgatcgggaggggcgccaacaccgggacgtgagagtcgcgtgcgctgcgcttggggtc 564 || || || || || |||| || || || || ||||| | || || | ||||||||| Sbjct: 693 cccaattggaagaggtgccagaacaggaacatgggagtctctggcactcctcttggggtc 634 Query: 565 ggtggcggagaagacggtgtagacgagcacgaaggtgccgatgatctccgcggcgaggcc 624 || || ||||||||||||||||| || || || || || |||||||| ||| | | ||| Sbjct: 633 agttgcagagaagacggtgtagacaaggacaaaagttccaatgatctcagcgcccaagcc 574 Query: 625 ggtgcc 630 |||||| Sbjct: 573 ggtgcc 568
>gb|AF326488.1|AF326488 Zea mays plasma membrane integral protein ZmPIP1-4 mRNA, complete cds Length = 1153 Score = 131 bits (66), Expect = 3e-27 Identities = 147/174 (84%) Strand = Plus / Minus Query: 331 ctggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactg 390 ||||||||||| ||| || | || |||||||| | ||||||||||||||||||||| || Sbjct: 940 ctggtggtagatggcagccagggcggcgccgatgaaggggccgacccagaagatccaatg 881 Query: 391 atcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggtt 450 || ||| || | ||| ||||||||||| |||||| || |||||||| |||||||| Sbjct: 880 gtcgctccacgcatgatcccggttgtagatgatggcggcgccaaggctcctagccgggtt 821 Query: 451 gatgccggtgccggtgatcgggatggtggccaggtggaccatgaacacggcgaa 504 |||||||||||||||||| ||||||||||| |||||||||| |||||| ||||| Sbjct: 820 gatgccggtgccggtgatggggatggtggcaaggtggaccaggaacaccgcgaa 767 Score = 56.0 bits (28), Expect = 2e-04 Identities = 67/80 (83%) Strand = Plus / Minus Query: 563 tcggtggcggagaagacggtgtagacgagcacgaaggtgccgatgatctccgcggcgagg 622 |||||||| ||||||||||||||||| || | ||||||||| | |||||| ||| | ||| Sbjct: 708 tcggtggccgagaagacggtgtagactaggatgaaggtgccaacgatctctgcgccaagg 649 Query: 623 ccggtgcccttggagtatcc 642 ||| ||||||| |||||| Sbjct: 648 ccgtcccccttggtgtatcc 629
>gb|AF326487.1|AF326487 Zea mays plasma membrane integral protein ZmPIP1-3 mRNA, complete cds Length = 1296 Score = 131 bits (66), Expect = 3e-27 Identities = 147/174 (84%) Strand = Plus / Minus Query: 331 ctggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactg 390 ||||||||||| ||| || | || |||||||| | ||||||||||||||||||||| || Sbjct: 935 ctggtggtagatggcagccagggcggcgccgatgaaggggccgacccagaagatccaatg 876 Query: 391 atcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggtt 450 || ||| || | ||| ||||||||||| |||||| || |||||||| |||||||| Sbjct: 875 gtcgctccacgcatgatcccggttgtagatgatggcggcgccaaggctcctagccgggtt 816 Query: 451 gatgccggtgccggtgatcgggatggtggccaggtggaccatgaacacggcgaa 504 |||||||||||||||||| ||||||||||| |||||||||| |||||| ||||| Sbjct: 815 gatgccggtgccggtgatggggatggtggcaaggtggaccaggaacaccgcgaa 762 Score = 56.0 bits (28), Expect = 2e-04 Identities = 73/88 (82%) Strand = Plus / Minus Query: 563 tcggtggcggagaagacggtgtagacgagcacgaaggtgccgatgatctccgcggcgagg 622 |||||||| ||||||||||||||||| || | ||||||||| | |||||| ||| | ||| Sbjct: 703 tcggtggccgagaagacggtgtagaccaggatgaaggtgccaacgatctcagcgccaagg 644 Query: 623 ccggtgcccttggagtatccggcggcga 650 || ||||||| |||||||| ||||| Sbjct: 643 ccatcccccttggtgtatccgggggcga 616
>gb|AY103580.1| Zea mays PCO072544 mRNA sequence Length = 1633 Score = 131 bits (66), Expect = 3e-27 Identities = 147/174 (84%) Strand = Plus / Minus Query: 331 ctggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactg 390 ||||||||||| ||| || | || |||||||| | ||||||||||||||||||||| || Sbjct: 1264 ctggtggtagatggcagccagggcggcgccgatgaaggggccgacccagaagatccaatg 1205 Query: 391 atcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggtt 450 || ||| || | ||| ||||||||||| |||||| || |||||||| |||||||| Sbjct: 1204 gtcgctccacgcatgatcccggttgtagatgatggcggcgccaaggctcctagccgggtt 1145 Query: 451 gatgccggtgccggtgatcgggatggtggccaggtggaccatgaacacggcgaa 504 |||||||||||||||||| ||||||||||| |||||||||| |||||| ||||| Sbjct: 1144 gatgccggtgccggtgatggggatggtggcaaggtggaccaggaacaccgcgaa 1091 Score = 56.0 bits (28), Expect = 2e-04 Identities = 67/80 (83%) Strand = Plus / Minus Query: 563 tcggtggcggagaagacggtgtagacgagcacgaaggtgccgatgatctccgcggcgagg 622 |||||||| ||||||||||||||||| || | ||||||||| | |||||| ||| | ||| Sbjct: 1032 tcggtggccgagaagacggtgtagactaggatgaaggtgccaacgatctctgcgccaagg 973 Query: 623 ccggtgcccttggagtatcc 642 ||| ||||||| |||||| Sbjct: 972 ccgtcccccttggtgtatcc 953
>ref|NM_129273.3| Arabidopsis thaliana PIP2B; water channel AT2G37170 (PIP2B) mRNA, complete cds Length = 1143 Score = 129 bits (65), Expect = 1e-26 Identities = 209/257 (81%) Strand = Plus / Minus Query: 374 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 433 |||||||| ||||| || |||||||| | |||| |||||| ||||| ||||| || || Sbjct: 815 acccagaatatccagtggtcatcccatggcttgctcttgttatagattacggcagctccg 756 Query: 434 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 493 | ||||| ||||||||||||||||| ||||||||||| || ||||||| || ||||| Sbjct: 755 aaactcctagccgggttgatgccggttccggtgatcggaatagtggccaaatgtaccata 696 Query: 494 aacacggcgaagccgatcgggaggggcgccaacaccgggacgtgagagtcgcgtgcgctg 553 ||||| || || || ||||| || |||||||| ||||| ||||| ||||| | ||| | Sbjct: 695 aacaccgcaaacccaatcggaagtggcgccaaaaccggaacgtgggagtctctagcgtta 636 Query: 554 cgcttggggtcggtggcggagaagacggtgtagacgagcacgaaggtgccgatgatctcc 613 || ||||| || || ||||||||||| ||||||||||| ||||| || || |||||||| Sbjct: 635 cgtttgggatcagtagcggagaagactgtgtagacgagaacgaatgttccaatgatctct 576 Query: 614 gcggcgaggccggtgcc 630 ||||| || |||||||| Sbjct: 575 gcggctagtccggtgcc 559
>emb|AL731636.3|OSJN00281 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0093G06, complete sequence Length = 127420 Score = 129 bits (65), Expect = 1e-26 Identities = 101/113 (89%) Strand = Plus / Plus Query: 527 accgggacgtgagagtcgcgtgcgctgcgcttggggtcggtggcggagaagacggtgtag 586 ||||||||||| |||||||| || ||||||| ||||||||||||||||||||||||||| Sbjct: 91447 accgggacgtgggagtcgcgggcattgcgctttgggtcggtggcggagaagacggtgtag 91506 Query: 587 acgagcacgaaggtgccgatgatctccgcggcgaggccggtgcccttggagta 639 ||||| ||||||||||||||||| || ||| ||||| ||||||| ||||||| Sbjct: 91507 acgaggacgaaggtgccgatgatttcggcgccgagggcggtgccggtggagta 91559 Score = 127 bits (64), Expect = 5e-26 Identities = 103/116 (88%) Strand = Plus / Plus Query: 395 tcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttgatg 454 ||||| ||||| | || |||||||||||||||||| || | ||||| ||| ||||||||| Sbjct: 91210 tcccatgccttcttctggttgtagatgacggcggcgccgatgctccgggcagggttgatg 91269 Query: 455 ccggtgccggtgatcgggatggtggccaggtggaccatgaacacggcgaagccgat 510 || ||||||||||| ||||||||||||||||| ||||||||||||||||| ||||| Sbjct: 91270 cccgtgccggtgatggggatggtggccaggtgcaccatgaacacggcgaacccgat 91325 Score = 50.1 bits (25), Expect = 0.009 Identities = 49/57 (85%) Strand = Plus / Plus Query: 280 gttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggtg 336 |||||||| ||||||||| || ||||||||||| | |||| ||| ||||||||||| Sbjct: 91012 gttgctccggaaggagcccagcgccttgatggctgccgcccggaggatgtactggtg 91068
>emb|BX820621.1|CNS0A9PE Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH53ZA12 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1078 Score = 129 bits (65), Expect = 1e-26 Identities = 209/257 (81%) Strand = Plus / Minus Query: 374 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 433 |||||||| ||||| || |||||||| | |||| |||||| ||||| ||||| || || Sbjct: 791 acccagaatatccagtggtcatcccatggcttgctcttgttatagattacggcagctccg 732 Query: 434 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 493 | ||||| ||||||||||||||||| ||||||||||| || ||||||| || ||||| Sbjct: 731 aaactcctagccgggttgatgccggttccggtgatcggaatagtggccaaatgtaccata 672 Query: 494 aacacggcgaagccgatcgggaggggcgccaacaccgggacgtgagagtcgcgtgcgctg 553 ||||| || || || ||||| || |||||||| ||||| ||||| ||||| | ||| | Sbjct: 671 aacaccgcaaacccaatcggaagtggcgccaaaaccggaacgtgggagtctctagcgtta 612 Query: 554 cgcttggggtcggtggcggagaagacggtgtagacgagcacgaaggtgccgatgatctcc 613 || ||||| || || ||||||||||| ||||||||||| ||||| || || |||||||| Sbjct: 611 cgtttgggatcagtagcggagaagactgtgtagacgagaacgaatgttccaatgatctct 552 Query: 614 gcggcgaggccggtgcc 630 ||||| || |||||||| Sbjct: 551 gcggctagtccggtgcc 535
>emb|BX820573.1|CNS0A9O0 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH49ZD05 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1074 Score = 129 bits (65), Expect = 1e-26 Identities = 209/257 (81%) Strand = Plus / Minus Query: 374 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 433 |||||||| ||||| || |||||||| | |||| |||||| ||||| ||||| || || Sbjct: 800 acccagaatatccagtggtcatcccatggcttgctcttgttatagattacggcagctccg 741 Query: 434 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 493 | ||||| ||||||||||||||||| ||||||||||| || ||||||| || ||||| Sbjct: 740 aaactcctagccgggttgatgccggttccggtgatcggaatagtggccaaatgtaccata 681 Query: 494 aacacggcgaagccgatcgggaggggcgccaacaccgggacgtgagagtcgcgtgcgctg 553 ||||| || || || ||||| || |||||||| ||||| ||||| ||||| | ||| | Sbjct: 680 aacaccgcaaacccaatcggaagtggcgccaaaaccggaacgtgggagtctctagcgtta 621 Query: 554 cgcttggggtcggtggcggagaagacggtgtagacgagcacgaaggtgccgatgatctcc 613 || ||||| || || ||||||||||| ||||||||||| ||||| || || |||||||| Sbjct: 620 cgtttgggatcagtagcggagaagactgtgtagacgagaacgaatgttccaatgatctct 561 Query: 614 gcggcgaggccggtgcc 630 ||||| || |||||||| Sbjct: 560 gcggctagtccggtgcc 544
>emb|BX820548.1|CNS0A9HO Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH47ZD11 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1095 Score = 129 bits (65), Expect = 1e-26 Identities = 209/257 (81%) Strand = Plus / Minus Query: 374 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 433 |||||||| ||||| || |||||||| | |||| |||||| ||||| ||||| || || Sbjct: 800 acccagaatatccagtggtcatcccatggcttgctcttgttatagattacggcagctccg 741 Query: 434 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 493 | ||||| ||||||||||||||||| ||||||||||| || ||||||| || ||||| Sbjct: 740 aaactcctagccgggttgatgccggttccggtgatcggaatagtggccaaatgtaccata 681 Query: 494 aacacggcgaagccgatcgggaggggcgccaacaccgggacgtgagagtcgcgtgcgctg 553 ||||| || || || ||||| || |||||||| ||||| ||||| ||||| | ||| | Sbjct: 680 aacaccgcaaacccaatcggaagtggcgccaaaaccggaacgtgggagtctctagcgtta 621 Query: 554 cgcttggggtcggtggcggagaagacggtgtagacgagcacgaaggtgccgatgatctcc 613 || ||||| || || ||||||||||| ||||||||||| ||||| || || |||||||| Sbjct: 620 cgtttgggatcagtagcggagaagactgtgtagacgagaacgaatgttccaatgatctct 561 Query: 614 gcggcgaggccggtgcc 630 ||||| || |||||||| Sbjct: 560 gcggctagtccggtgcc 544
>emb|BX820418.1|CNS0A81D Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH30ZA07 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1083 Score = 129 bits (65), Expect = 1e-26 Identities = 209/257 (81%) Strand = Plus / Minus Query: 374 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 433 |||||||| ||||| || |||||||| | |||| |||||| ||||| ||||| || || Sbjct: 801 acccagaatatccagtggtcatcccatggcttgctcttgttatagattacggcagctccg 742 Query: 434 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 493 | ||||| ||||||||||||||||| ||||||||||| || ||||||| || ||||| Sbjct: 741 aaactcctagccgggttgatgccggttccggtgatcggaatagtggccaaatgtaccata 682 Query: 494 aacacggcgaagccgatcgggaggggcgccaacaccgggacgtgagagtcgcgtgcgctg 553 ||||| || || || ||||| || |||||||| ||||| ||||| ||||| | ||| | Sbjct: 681 aacaccgcaaacccaatcggaagtggcgccaaaaccggaacgtgggagtctctagcgtta 622 Query: 554 cgcttggggtcggtggcggagaagacggtgtagacgagcacgaaggtgccgatgatctcc 613 || ||||| || || ||||||||||| ||||||||||| ||||| || || |||||||| Sbjct: 621 cgtttgggatcagtagcggagaagactgtgtagacgagaacgaatgttccaatgatctct 562 Query: 614 gcggcgaggccggtgcc 630 ||||| || |||||||| Sbjct: 561 gcggctagtccggtgcc 545
>gb|AY086460.1| Arabidopsis thaliana clone 25220 mRNA, complete sequence Length = 1104 Score = 129 bits (65), Expect = 1e-26 Identities = 209/257 (81%) Strand = Plus / Minus Query: 374 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 433 |||||||| ||||| || |||||||| | |||| |||||| ||||| ||||| || || Sbjct: 816 acccagaatatccagtggtcatcccatggcttgctcttgttatagattacggcagctccg 757 Query: 434 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 493 | ||||| ||||||||||||||||| ||||||||||| || ||||||| || ||||| Sbjct: 756 aaactcctagccgggttgatgccggttccggtgatcggaatagtggccaaatgtaccata 697 Query: 494 aacacggcgaagccgatcgggaggggcgccaacaccgggacgtgagagtcgcgtgcgctg 553 ||||| || || || ||||| || |||||||| ||||| ||||| ||||| | ||| | Sbjct: 696 aacaccgcaaacccaatcggaagtggcgccaaaaccggaacgtgggagtctctagcgtta 637 Query: 554 cgcttggggtcggtggcggagaagacggtgtagacgagcacgaaggtgccgatgatctcc 613 || ||||| || || ||||||||||| ||||||||||| ||||| || || |||||||| Sbjct: 636 cgtttgggatcagtagcggagaagactgtgtagacgagaacgaatgttccaatgatctct 577 Query: 614 gcggcgaggccggtgcc 630 ||||| || |||||||| Sbjct: 576 gcggctagtccggtgcc 560
>gb|AF366565.1| Triticum aestivum aquaporin PIP2 (Pip2) mRNA, complete cds Length = 1071 Score = 129 bits (65), Expect = 1e-26 Identities = 194/237 (81%) Strand = Plus / Minus Query: 368 gggccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcg 427 ||||| ||||||||||||||||| || ||||| |||||| | ||||| | |||||| Sbjct: 777 gggccaacccagaagatccactggtcgtcccaagccttgccgccattgtacaccacggcg 718 Query: 428 gcccccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtgg 487 || || | |||||| || || ||||| ||||| ||||||| ||||| ||||| ||||| Sbjct: 717 gcgccaaagctccttgctggattgatcccggttccggtgacggggatagtggcgaggtgc 658 Query: 488 accatgaacacggcgaagccgatcgggaggggcgccaacaccgggacgtgagagtcgcgt 547 |||||| ||||||||| ||||| | || ||||||| |||||||||||| | || || Sbjct: 657 gccatgagcacggcgaacccgatgagcagcggcgccagcaccgggacgtgtggatcccgg 598 Query: 548 gcgctgcgcttggggtcggtggcggagaagacggtgtagacgagcacgaaggtgccg 604 ||| ||||||| |||||||| || |||||||||||||| |||||||||||||||||| Sbjct: 597 gcgatgcgcttcgggtcggtcgctgagaagacggtgtacacgagcacgaaggtgccg 541
>dbj|AB058680.1| Pyrus communis Py-PIP2-2 mRNA for plasma membrane intrinsic protein 2-2, complete cds Length = 1051 Score = 129 bits (65), Expect = 1e-26 Identities = 227/281 (80%) Strand = Plus / Minus Query: 332 tggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactga 391 |||||||||||||| || || || || || || | ||| || |||||||| ||||| || Sbjct: 874 tggtggtagaaggctgcaattgctgctccaatgaagggtcctacccagaaaatccattgg 815 Query: 392 tcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttg 451 |||||||| |||||||| ||||||||||| || || || || || || || || |||||| Sbjct: 814 tcatcccaagccttgtctttgttgtagataacagcagctccaagacttctagcggggttg 755 Query: 452 atgccggtgccggtgatcgggatggtggccaggtggaccatgaacacggcgaagccgatc 511 ||||| ||||| ||||| ||||||||||||| |||||| |||||||| || || || || Sbjct: 754 atgccagtgccagtgattgggatggtggccaagtggacaatgaacacagcaaacccaatt 695 Query: 512 gggaggggcgccaacaccgggacgtgagagtcgcgtgcgctgcgcttggggtcggtggcg 571 || || || ||||| ||||| || || ||||| | || || | ||||||||| ||||| Sbjct: 694 ggcagtggagccaaaaccggaacatgggagtctctagcactcctcttggggtcagtggca 635 Query: 572 gagaagacggtgtagacgagcacgaaggtgccgatgatctc 612 |||||||||||||| || ||||| |||||||| || ||||| Sbjct: 634 gagaagacggtgtaaaccagcacaaaggtgccaataatctc 594
>gb|AF133530.1|AF133530 Mesembryanthemum crystallinum water channel protein MipH (MipH) mRNA, complete cds Length = 1347 Score = 127 bits (64), Expect = 5e-26 Identities = 211/260 (81%) Strand = Plus / Minus Query: 326 atgtactggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatc 385 ||||| |||||||||| ||| ||||| || || || || | || ||||||||||| ||| Sbjct: 890 atgtattggtggtagatggcggcgatggcagccccaatgaacggtccgacccagaaaatc 831 Query: 386 cactgatcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggcc 445 |||||||||||||||||||||| ||||||||||| || || || || || || | || Sbjct: 830 cactgatcatcccaggccttgttgttgttgtagatcacagcagcaccaagactacgagca 771 Query: 446 gggttgatgccggtgccggtgatcgggatggtggccaggtggaccatgaacacggcgaag 505 |||||||| || |||||||| || ||||||||||||| ||| |||||||||||||| || Sbjct: 770 gggttgatacctgtgccggtaattgggatggtggccaagtgaaccatgaacacggcaaac 711 Query: 506 ccgatcgggaggggcgccaacaccgggacgtgagagtcgcgtgcgctgcgcttggggtcg 565 || || || || || ||||| || || || |||||||| | || ||||| || ||||| Sbjct: 710 ccaattggaagaggtgccaatacgggcacatgagagtccctagcactgcgttttgggtca 651 Query: 566 gtggcggagaagacggtgta 585 ||||||||||| |||||||| Sbjct: 650 gtggcggagaaaacggtgta 631
>gb|DQ339464.1| Vitis pseudoreticulata aquaporin protein (PIP2-1) mRNA, complete cds Length = 480 Score = 127 bits (64), Expect = 5e-26 Identities = 181/220 (82%) Strand = Plus / Minus Query: 282 tgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggtggtaga 341 |||||||||| || || || |||||||| || || || || | |||| |||||||||||| Sbjct: 466 tgctcctgaatgacccaagagccttgatagctccagctctcaatatgaactggtggtaga 407 Query: 342 aggccgcgatcgccgcgccgatcatggggccgacccagaagatccactgatcatcccagg 401 |||| || || || || || || | ||| || ||||| ||||||||||| |||||||||| Sbjct: 406 aggctgcaatggctgcaccaatgaagggtccaacccaaaagatccactggtcatcccagg 347 Query: 402 ccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttgatgccggtgc 461 |||| || ||||||||||| || || ||||||| |||||||| |||||||| ||||| | Sbjct: 346 ccttctcattgttgtagataacagcagcccccaaactcctggcagggttgataccggtac 287 Query: 462 cggtgatcgggatggtggccaggtggaccatgaacacggc 501 | ||||| || || ||||||| ||| |||||||||||||| Sbjct: 286 cagtgataggaatagtggccaagtgaaccatgaacacggc 247 Score = 58.0 bits (29), Expect = 4e-05 Identities = 80/97 (82%) Strand = Plus / Minus Query: 556 cttggggtcggtggcggagaagacggtgtagacgagcacgaaggtgccgatgatctccgc 615 ||||||||| || || ||||||||||||||||| || || || || ||||||||||| || Sbjct: 192 cttggggtcagttgcagagaagacggtgtagacaaggacaaaagttccgatgatctcagc 133 Query: 616 ggcgaggccggtgcccttggagtatccggcggcgagc 652 | | | ||||||||| ||| ||| ||||||| |||| Sbjct: 132 gcccaagccggtgcctttgctgtagccggcggagagc 96
>dbj|D85192.1| Arabidopsis thaliana mRNA for transmembrane protein, complete cds Length = 1024 Score = 127 bits (64), Expect = 5e-26 Identities = 193/236 (81%) Strand = Plus / Minus Query: 374 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 433 |||||||| ||||| || |||||||| | | ||||||||||||||| | ||||| || Sbjct: 819 acccagaaaatccaatggtcatcccaagagtggtccttgttgtagataattgcggctcca 760 Query: 434 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 493 || || || || |||||||| ||||| ||||||||||| || || |||| ||| |||| | Sbjct: 759 agacttctagctgggttgattccggtcccggtgatcggtattgttgccaagtgtaccaag 700 Query: 494 aacacggcgaagccgatcgggaggggcgccaacaccgggacgtgagagtcgcgtgcgctg 553 ||||| || || ||||| ||||| |||||||| | ||||||||| ||||| || |||| Sbjct: 699 aacactgcaaatccgattgggagcggcgccaaaatcgggacgtgtgagtcacggacgctt 640 Query: 554 cgcttggggtcggtggcggagaagacggtgtagacgagcacgaaggtgccgatgat 609 | |||| |||||||||||||||||| ||||||||||| ||||| || |||||||| Sbjct: 639 ctcttgtcgtcggtggcggagaagacagtgtagacgagaacgaatgttccgatgat 584
>gb|U73467.1|MCU73467 Mesembryanthemum crystallinum water channel protein MipE mRNA, complete cds Length = 1179 Score = 127 bits (64), Expect = 5e-26 Identities = 148/176 (84%) Strand = Plus / Minus Query: 437 ctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatgaac 496 ||||| || ||||||||||||||||| ||||| ||||||||||||| || ||||||||| Sbjct: 808 ctcctagcagggttgatgccggtgccagtgatggggatggtggccaaatgaaccatgaac 749 Query: 497 acggcgaagccgatcgggaggggcgccaacaccgggacgtgagagtcgcgtgcgctgcgc 556 || || || || || || || || || | ||| || ||||||||||| || ||||| | | Sbjct: 748 acagcaaaaccaatgggaagaggggcaagcactggcacgtgagagtcacgcgcgctcctc 689 Query: 557 ttggggtcggtggcggagaagacggtgtagacgagcacgaaggtgccgatgatctc 612 || ||||| |||||||||||||| |||||||| ||||| ||||||||||||||||| Sbjct: 688 ttagggtcagtggcggagaagactgtgtagacaagcacaaaggtgccgatgatctc 633
>dbj|AB030698.1| Raphanus sativus PAQ2c mRNA for Plasma membrane aquaporin 2c, complete cds Length = 1065 Score = 127 bits (64), Expect = 5e-26 Identities = 202/248 (81%) Strand = Plus / Minus Query: 374 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 433 |||||||| ||||| || |||||||| | |||| || ||||||||| || ||||| || Sbjct: 788 acccagaatatccagtggtcatcccacggcttggactcgttgtagataaccgcggctccg 729 Query: 434 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 493 | |||||||||||||| || ||||| ||||||||||| || ||||||| ||| |||||| Sbjct: 728 aaactcctggccgggttaataccggttccggtgatcggaatagtggccaagtgaaccatg 669 Query: 494 aacacggcgaagccgatcgggaggggcgccaacaccgggacgtgagagtcgcgtgcgctg 553 ||||| || || || ||||| || ||||||||||| || ||||| ||||| ||||| | Sbjct: 668 aacaccgcaaatccaatcggaagtggcgccaacacgggaacgtgggagtcacgtgcattt 609 Query: 554 cgcttggggtcggtggcggagaagacggtgtagacgagcacgaaggtgccgatgatctcc 613 | |||||||| ||||||||||| || |||||||| || || || || || |||||||| Sbjct: 608 cttttggggtctgtggcggagaacacagtgtagacaagaacaaaagttccaatgatctct 549 Query: 614 gcggcgag 621 |||||||| Sbjct: 548 gcggcgag 541
>dbj|AB058678.1| Pyrus communis Py-PIP2-1 mRNA for plasma membrane intrinsic protein 2-1, complete cds Length = 1311 Score = 127 bits (64), Expect = 5e-26 Identities = 265/332 (79%) Strand = Plus / Minus Query: 281 ttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggtggtag 340 ||||| ||||| || || || ||||||||||| || || || || ||||| ||||||||| Sbjct: 907 ttgcttctgaaagatcccagagccttgatggctcctgctctcagaatgtattggtggtag 848 Query: 341 aaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactgatcatcccag 400 ||||| || || || || || || | || || | |||||||||||| || |||||||| Sbjct: 847 aaggcagcaatggcagctccaatgaaaggtccaagccagaagatccattggtcatcccaa 788 Query: 401 gccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttgatgccggtg 460 || ||||||||||| |||||||| || || || | ||||| || ||||||||||| || Sbjct: 787 gctttgtccttgttatagatgacagcagctcctaaactcctagcagggttgatgccagtt 728 Query: 461 ccggtgatcgggatggtggccaggtggaccatgaacacggcgaagccgatcgggaggggc 520 || ||||| || || ||||||| ||| || |||||||| || || || || || || || Sbjct: 727 ccagtgatgggaatagtggccaagtgaacaatgaacacagcaaatccaatgggaagtggg 668 Query: 521 gccaacaccgggacgtgagagtcgcgtgcgctgcgcttggggtcggtggcggagaagacg 580 ||||| || |||||||||||||| | || | | ||||||||| ||||||||||||||| Sbjct: 667 gccaagacagggacgtgagagtctctggcatttctcttggggtcagtggcggagaagacg 608 Query: 581 gtgtagacgagcacgaaggtgccgatgatctc 612 |||||||| || || ||||| ||||||||||| Sbjct: 607 gtgtagacaagaacaaaggtaccgatgatctc 576
>gb|AY333929.1| Pringlea antiscorbutica putative transmembrane protein mRNA, partial cds Length = 380 Score = 125 bits (63), Expect = 2e-25 Identities = 177/215 (82%) Strand = Plus / Minus Query: 371 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcc 430 ||||||||||| ||||| || || ||||| | | ||||||||||||||| | |||||| Sbjct: 219 ccgacccagaaaatccaatggtcgtcccaagagtggtccttgttgtagataatggcggct 160 Query: 431 cccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggacc 490 || ||||| || || |||||||| || || ||||| ||||| || || |||||||| ||| Sbjct: 159 ccaaggcttctagctgggttgattccagttccggttatcggaattgtcgccaggtgtacc 100 Query: 491 atgaacacggcgaagccgatcgggaggggcgccaacaccgggacgtgagagtcgcgtgcg 550 | |||||| || || ||||| ||||| |||||||| | ||| ||||| ||||| || ||| Sbjct: 99 aagaacactgcaaacccgattgggagtggcgccaaaatcggaacgtgtgagtcacgggcg 40 Query: 551 ctgcgcttggggtcggtggcggagaagacggtgta 585 || | ||||| |||||||||||||||||||||||| Sbjct: 39 cttctcttggcgtcggtggcggagaagacggtgta 5
>emb|AJ849325.1| Populus tremula x Populus tremuloides mRNA for putative plasma membrane intrinsic protein (pip2.2 gene) Length = 978 Score = 125 bits (63), Expect = 2e-25 Identities = 195/239 (81%) Strand = Plus / Minus Query: 374 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 433 |||||||| ||||| |||||||||||||| || || |||||| ||||||| || || || Sbjct: 826 acccagaaaatccaatgatcatcccaggctttttcattgttgaagatgacagcagcgcca 767 Query: 434 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 493 | ||||||||| ||||||||||| || || || || ||||| ||||||| ||| |||||| Sbjct: 766 aagctcctggcagggttgatgccagttccagttatagggattgtggccaagtgtaccatg 707 Query: 494 aacacggcgaagccgatcgggaggggcgccaacaccgggacgtgagagtcgcgtgcgctg 553 ||||| ||||| ||||| || || || |||||||| |||| ||| ||||| ||||| || Sbjct: 706 aacacagcgaacccgattggaagaggagccaacacagggatgtgggagtcacgtgcactt 647 Query: 554 cgcttggggtcggtggcggagaagacggtgtagacgagcacgaaggtgccgatgatctc 612 | ||| ||||| || || ||||| || |||||||| ||||| || ||||| || ||||| Sbjct: 646 ctcttagggtcagttgcagagaaaacagtgtagacaagcacaaaagtgcctataatctc 588
>dbj|AB030697.1| Raphanus sativus PAQ2b mRNA for Plasma membrane aquaporin 2b, complete cds Length = 1087 Score = 125 bits (63), Expect = 2e-25 Identities = 195/239 (81%) Strand = Plus / Minus Query: 374 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 433 |||||||| ||||| || |||||||| | |||| || ||||||||| || ||||| || Sbjct: 789 acccagaaaatccagtggtcatcccacggcttggactcgttgtagataaccgcggctcca 730 Query: 434 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 493 | |||||||||||||| || ||||| |||||||| || || ||||||| ||| |||||| Sbjct: 729 aaactcctggccgggttaatcccggttccggtgattggaatagtggccaagtgaaccatg 670 Query: 494 aacacggcgaagccgatcgggaggggcgccaacaccgggacgtgagagtcgcgtgcgctg 553 |||||||| || || || || || ||||||||||| |||||||| ||||| |||||| | Sbjct: 669 aacacggcaaatccaattggaagtggcgccaacacggggacgtgggagtctcgtgcgttt 610 Query: 554 cgcttggggtcggtggcggagaagacggtgtagacgagcacgaaggtgccgatgatctc 612 | ||||| || || |||||||| || |||||||| || ||||| || ||||||||||| Sbjct: 609 cttttgggatctgtagcggagaaaacagtgtagaccaggacgaatgttccgatgatctc 551
>ref|NM_115202.1| Arabidopsis thaliana PIP2A; water channel AT3G53420 (PIP2A) transcript variant AT3G53420.1 mRNA, complete cds Length = 1347 Score = 123 bits (62), Expect = 8e-25 Identities = 206/254 (81%) Strand = Plus / Minus Query: 374 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 433 ||||| || ||||| || |||||||| | |||| |||||||||||| ||||| || || Sbjct: 1017 acccaaaatatccagtggtcatcccatggcttgctcttgttgtagattacggcagctccg 958 Query: 434 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 493 | ||||| |||||||| || ||||| ||||| || || ||||| |||| || |||||| Sbjct: 957 aaactccttgccgggttaattccggttccggtaatgggaatggtagccaaatgtaccatg 898 Query: 494 aacacggcgaagccgatcgggaggggcgccaacaccgggacgtgagagtcgcgtgcgctg 553 |||||||| || ||||| || || |||||||||||||| ||||| ||||| | || || Sbjct: 897 aacacggcaaatccgattggaagtggcgccaacaccggaacgtgggagtctctggcacta 838 Query: 554 cgcttggggtcggtggcggagaagacggtgtagacgagcacgaaggtgccgatgatctcc 613 || |||||||| ||||| ||||||||||||||||| || ||||| || || |||||||| Sbjct: 837 cgtttggggtcagtggcagagaagacggtgtagacaagaacgaaagtaccaatgatctct 778 Query: 614 gcggcgaggccggt 627 ||||| || ||||| Sbjct: 777 gcggctagaccggt 764
>ref|NM_001035774.1| Arabidopsis thaliana PIP2A AT3G53420 (PIP2A) transcript variant AT3G53420.2 mRNA, complete cds Length = 1278 Score = 123 bits (62), Expect = 8e-25 Identities = 206/254 (81%) Strand = Plus / Minus Query: 374 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 433 ||||| || ||||| || |||||||| | |||| |||||||||||| ||||| || || Sbjct: 967 acccaaaatatccagtggtcatcccatggcttgctcttgttgtagattacggcagctccg 908 Query: 434 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 493 | ||||| |||||||| || ||||| ||||| || || ||||| |||| || |||||| Sbjct: 907 aaactccttgccgggttaattccggttccggtaatgggaatggtagccaaatgtaccatg 848 Query: 494 aacacggcgaagccgatcgggaggggcgccaacaccgggacgtgagagtcgcgtgcgctg 553 |||||||| || ||||| || || |||||||||||||| ||||| ||||| | || || Sbjct: 847 aacacggcaaatccgattggaagtggcgccaacaccggaacgtgggagtctctggcacta 788 Query: 554 cgcttggggtcggtggcggagaagacggtgtagacgagcacgaaggtgccgatgatctcc 613 || |||||||| ||||| ||||||||||||||||| || ||||| || || |||||||| Sbjct: 787 cgtttggggtcagtggcagagaagacggtgtagacaagaacgaaagtaccaatgatctct 728 Query: 614 gcggcgaggccggt 627 ||||| || ||||| Sbjct: 727 gcggctagaccggt 714
>emb|X75882.1|ATPIP1C A.thaliana mRNA for plasma membrane intrinsic protein 1c Length = 986 Score = 123 bits (62), Expect = 8e-25 Identities = 197/242 (81%) Strand = Plus / Minus Query: 371 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcc 430 ||||||||||| ||||| || || ||||| || | ||||||||||||||||| || || Sbjct: 814 ccgacccagaatatccagtggtcgtcccaagcgtggtccttgttgtagatgattgcagct 755 Query: 431 cccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggacc 490 || || ||||| || |||||||| || || |||||||| |||||| | |||| ||| ||| Sbjct: 754 ccaagactcctagctgggttgattcctgttccggtgattgggatgctcgccaagtgaacc 695 Query: 491 atgaacacggcgaagccgatcgggaggggcgccaacaccgggacgtgagagtcgcgtgcg 550 | |||||| ||||| ||||| ||||| || ||||| | ||| ||||| ||||| || ||| Sbjct: 694 aagaacaccgcgaatccgattgggagtggtgccaaaatcggaacgtgggagtcacgagcg 635 Query: 551 ctgcgcttggggtcggtggcggagaagacggtgtagacgagcacgaaggtgccgatgatc 610 || | ||||| ||| |||||||||||||| ||||||| || |||||||| ||||| ||| Sbjct: 634 cttctcttggcgtcagtggcggagaagaccgtgtagataaggacgaaggttccgattatc 575 Query: 611 tc 612 || Sbjct: 574 tc 573
>gb|AY072374.1| Arabidopsis thaliana plasma membrane intrinsic protein 2a (At3g53420) mRNA, complete cds Length = 1122 Score = 123 bits (62), Expect = 8e-25 Identities = 206/254 (81%) Strand = Plus / Minus Query: 374 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 433 ||||| || ||||| || |||||||| | |||| |||||||||||| ||||| || || Sbjct: 809 acccaaaatatccagtggtcatcccatggcttgctcttgttgtagattacggcagctccg 750 Query: 434 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 493 | ||||| |||||||| || ||||| ||||| || || ||||| |||| || |||||| Sbjct: 749 aaactccttgccgggttaattccggttccggtaatgggaatggtagccaaatgtaccatg 690 Query: 494 aacacggcgaagccgatcgggaggggcgccaacaccgggacgtgagagtcgcgtgcgctg 553 |||||||| || ||||| || || |||||||||||||| ||||| ||||| | || || Sbjct: 689 aacacggcaaatccgattggaagtggcgccaacaccggaacgtgggagtctctggcacta 630 Query: 554 cgcttggggtcggtggcggagaagacggtgtagacgagcacgaaggtgccgatgatctcc 613 || |||||||| ||||| ||||||||||||||||| || ||||| || || |||||||| Sbjct: 629 cgtttggggtcagtggcagagaagacggtgtagacaagaacgaaagtaccaatgatctct 570 Query: 614 gcggcgaggccggt 627 ||||| || ||||| Sbjct: 569 gcggctagaccggt 556
>gb|AF428426.1|AF428426 Arabidopsis thaliana AT3g53420/F4P12_120 mRNA, complete cds Length = 1112 Score = 123 bits (62), Expect = 8e-25 Identities = 206/254 (81%) Strand = Plus / Minus Query: 374 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 433 ||||| || ||||| || |||||||| | |||| |||||||||||| ||||| || || Sbjct: 817 acccaaaatatccagtggtcatcccatggcttgctcttgttgtagattacggcagctccg 758 Query: 434 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 493 | ||||| |||||||| || ||||| ||||| || || ||||| |||| || |||||| Sbjct: 757 aaactccttgccgggttaattccggttccggtaatgggaatggtagccaaatgtaccatg 698 Query: 494 aacacggcgaagccgatcgggaggggcgccaacaccgggacgtgagagtcgcgtgcgctg 553 |||||||| || ||||| || || |||||||||||||| ||||| ||||| | || || Sbjct: 697 aacacggcaaatccgattggaagtggcgccaacaccggaacgtgggagtctctggcacta 638 Query: 554 cgcttggggtcggtggcggagaagacggtgtagacgagcacgaaggtgccgatgatctcc 613 || |||||||| ||||| ||||||||||||||||| || ||||| || || |||||||| Sbjct: 637 cgtttggggtcagtggcagagaagacggtgtagacaagaacgaaagtaccaatgatctct 578 Query: 614 gcggcgaggccggt 627 ||||| || ||||| Sbjct: 577 gcggctagaccggt 564
>gb|AY056085.1| Arabidopsis thaliana AT3g53420/F4P12_120 mRNA, complete cds Length = 864 Score = 123 bits (62), Expect = 8e-25 Identities = 206/254 (81%) Strand = Plus / Minus Query: 374 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 433 ||||| || ||||| || |||||||| | |||| |||||||||||| ||||| || || Sbjct: 758 acccaaaatatccagtggtcatcccatggcttgctcttgttgtagattacggcagctccg 699 Query: 434 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 493 | ||||| |||||||| || ||||| ||||| || || ||||| |||| || |||||| Sbjct: 698 aaactccttgccgggttaattccggttccggtaatgggaatggtagccaaatgtaccatg 639 Query: 494 aacacggcgaagccgatcgggaggggcgccaacaccgggacgtgagagtcgcgtgcgctg 553 |||||||| || ||||| || || |||||||||||||| ||||| ||||| | || || Sbjct: 638 aacacggcaaatccgattggaagtggcgccaacaccggaacgtgggagtctctggcacta 579 Query: 554 cgcttggggtcggtggcggagaagacggtgtagacgagcacgaaggtgccgatgatctcc 613 || |||||||| ||||| ||||||||||||||||| || ||||| || || |||||||| Sbjct: 578 cgtttggggtcagtggcagagaagacggtgtagacaagaacgaaagtaccaatgatctct 519 Query: 614 gcggcgaggccggt 627 ||||| || ||||| Sbjct: 518 gcggctagaccggt 505
>gb|AY044327.1| Arabidopsis thaliana plasma membrane intrinsic protein 2a (F4P12.12) mRNA, complete cds Length = 956 Score = 123 bits (62), Expect = 8e-25 Identities = 206/254 (81%) Strand = Plus / Minus Query: 374 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 433 ||||| || ||||| || |||||||| | |||| |||||||||||| ||||| || || Sbjct: 758 acccaaaatatccagtggtcatcccatggcttgctcttgttgtagattacggcagctccg 699 Query: 434 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 493 | ||||| |||||||| || ||||| ||||| || || ||||| |||| || |||||| Sbjct: 698 aaactccttgccgggttaattccggttccggtaatgggaatggtagccaaatgtaccatg 639 Query: 494 aacacggcgaagccgatcgggaggggcgccaacaccgggacgtgagagtcgcgtgcgctg 553 |||||||| || ||||| || || |||||||||||||| ||||| ||||| | || || Sbjct: 638 aacacggcaaatccgattggaagtggcgccaacaccggaacgtgggagtctctggcacta 579 Query: 554 cgcttggggtcggtggcggagaagacggtgtagacgagcacgaaggtgccgatgatctcc 613 || |||||||| ||||| ||||||||||||||||| || ||||| || || |||||||| Sbjct: 578 cgtttggggtcagtggcagagaagacggtgtagacaagaacgaaagtaccaatgatctct 519 Query: 614 gcggcgaggccggt 627 ||||| || ||||| Sbjct: 518 gcggctagaccggt 505
>gb|AY039579.1| Arabidopsis thaliana AT3g53420/F4P12_120 mRNA, complete cds Length = 1129 Score = 123 bits (62), Expect = 8e-25 Identities = 206/254 (81%) Strand = Plus / Minus Query: 374 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 433 ||||| || ||||| || |||||||| | |||| |||||||||||| ||||| || || Sbjct: 817 acccaaaatatccagtggtcatcccatggcttgctcttgttgtagattacggcagctccg 758 Query: 434 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 493 | ||||| |||||||| || ||||| ||||| || || ||||| |||| || |||||| Sbjct: 757 aaactccttgccgggttaattccggttccggtaatgggaatggtagccaaatgtaccatg 698 Query: 494 aacacggcgaagccgatcgggaggggcgccaacaccgggacgtgagagtcgcgtgcgctg 553 |||||||| || ||||| || || |||||||||||||| ||||| ||||| | || || Sbjct: 697 aacacggcaaatccgattggaagtggcgccaacaccggaacgtgggagtctctggcacta 638 Query: 554 cgcttggggtcggtggcggagaagacggtgtagacgagcacgaaggtgccgatgatctcc 613 || |||||||| ||||| ||||||||||||||||| || ||||| || || |||||||| Sbjct: 637 cgtttggggtcagtggcagagaagacggtgtagacaagaacgaaagtaccaatgatctct 578 Query: 614 gcggcgaggccggt 627 ||||| || ||||| Sbjct: 577 gcggctagaccggt 564
>emb|BX823952.1|CNS0A4TL Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH10ZA03 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1071 Score = 123 bits (62), Expect = 8e-25 Identities = 206/254 (81%) Strand = Plus / Minus Query: 374 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 433 ||||| || ||||| || |||||||| | |||| |||||||||||| ||||| || || Sbjct: 805 acccaaaatatccagtggtcatcccatggcttgctcttgttgtagattacggcagctccg 746 Query: 434 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 493 | ||||| |||||||| || ||||| ||||| || || ||||| |||| || |||||| Sbjct: 745 aaactccttgccgggttaattccggttccggtaatgggaatggtagccaaatgtaccatg 686 Query: 494 aacacggcgaagccgatcgggaggggcgccaacaccgggacgtgagagtcgcgtgcgctg 553 |||||||| || ||||| || || |||||||||||||| ||||| ||||| | || || Sbjct: 685 aacacggcaaatccgattggaagtggcgccaacaccggaacgtgggagtctctggcacta 626 Query: 554 cgcttggggtcggtggcggagaagacggtgtagacgagcacgaaggtgccgatgatctcc 613 || |||||||| ||||| ||||||||||||||||| || ||||| || || |||||||| Sbjct: 625 cgtttggggtcagtggcagagaagacggtgtagacaagaacgaaagtaccaatgatctct 566 Query: 614 gcggcgaggccggt 627 ||||| || ||||| Sbjct: 565 gcggctagaccggt 552
>gb|AF067184.1|AF067184 Samanea saman aquaporin 1 (Aqp1) mRNA, complete cds Length = 1298 Score = 123 bits (62), Expect = 8e-25 Identities = 134/158 (84%) Strand = Plus / Minus Query: 446 gggttgatgccggtgccggtgatcgggatggtggccaggtggaccatgaacacggcgaag 505 |||||||||||||| |||||||| ||||||||||||| ||| |||| ||||| ||||| Sbjct: 774 gggttgatgccggttccggtgatggggatggtggccaagtgaaccaaaaacacagcgaac 715 Query: 506 ccgatcgggaggggcgccaacaccgggacgtgagagtcgcgtgcgctgcgcttggggtcg 565 || || || | |||||||| | |||||||| ||||| || ||||| ||||||| ||| Sbjct: 714 ccaataggcaacggcgccaaaatggggacgtgggagtcacgagcgctacgcttggcatcg 655 Query: 566 gtggcggagaagacggtgtagacgagcacgaaggtgcc 603 |||||||||||||||||||||||||| | ||||||||| Sbjct: 654 gtggcggagaagacggtgtagacgaggatgaaggtgcc 617
>emb|X75884.1|ATPIP2B A.thaliana mRNA for plasma membrane intrinsic protein 2b Length = 1095 Score = 121 bits (61), Expect = 3e-24 Identities = 208/257 (80%) Strand = Plus / Minus Query: 374 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 433 |||||||| ||||| || |||||||| | |||| |||||| ||||| |||| || || Sbjct: 767 acccagaatatccagtggtcatcccatggcttgctcttgttatagattacggacgctccg 708 Query: 434 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 493 | ||||| ||||||||||||||||| ||||||||||| || ||||||| || ||||| Sbjct: 707 aaactcctagccgggttgatgccggttccggtgatcggaatagtggccaaatgtaccata 648 Query: 494 aacacggcgaagccgatcgggaggggcgccaacaccgggacgtgagagtcgcgtgcgctg 553 ||||| || || || ||||| || |||||||| ||||| ||||| ||||| | ||| | Sbjct: 647 aacaccgcaaacccaatcggaagtggcgccaaaaccggaacgtgggagtctctagcgtta 588 Query: 554 cgcttggggtcggtggcggagaagacggtgtagacgagcacgaaggtgccgatgatctcc 613 || ||||| || || ||||||||||| ||||||||||| ||||| || || |||||||| Sbjct: 587 cgtttgggatcagtagcggagaagactgtgtagacgagaacgaatgttccaatgatctct 528 Query: 614 gcggcgaggccggtgcc 630 ||||| || |||||||| Sbjct: 527 gcggctagtccggtgcc 511
>emb|BX818826.1|CNS0A9YK Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB17ZB02 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1041 Score = 121 bits (61), Expect = 3e-24 Identities = 208/257 (80%) Strand = Plus / Minus Query: 374 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 433 |||||||| ||||| || |||||||| | |||| |||||| ||||| ||||| || || Sbjct: 800 acccagaatatccagtggtcatcccatggcttgctcttgttatagattacggcagctccg 741 Query: 434 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 493 | ||||| ||||||||||||||||| ||||||||||| || ||||||| || ||||| Sbjct: 740 aaactcctagccgggttgatgccggttccggtgatcggaatagtggccaaatgtaccata 681 Query: 494 aacacggcgaagccgatcgggaggggcgccaacaccgggacgtgagagtcgcgtgcgctg 553 ||||| || || || ||||| || |||||||| ||||| ||||| |||| | ||| | Sbjct: 680 aacaccgcaaacccaatcggaagtggcgccaaaaccggaacgtgggagtttctagcgtta 621 Query: 554 cgcttggggtcggtggcggagaagacggtgtagacgagcacgaaggtgccgatgatctcc 613 || ||||| || || ||||||||||| ||||||||||| ||||| || || |||||||| Sbjct: 620 cgtttgggatcagtagcggagaagactgtgtagacgagaacgaatgttccaatgatctct 561 Query: 614 gcggcgaggccggtgcc 630 ||||| || |||||||| Sbjct: 560 gcggctagtccggtgcc 544
>gb|AY902360.1| Triticum aestivum water channel protein PIP4 (AQP) gene, partial sequence Length = 645 Score = 121 bits (61), Expect = 3e-24 Identities = 82/89 (92%) Strand = Plus / Plus Query: 556 cttggggtcggtggcggagaagacggtgtagacgagcacgaaggtgccgatgatctccgc 615 ||||| |||||||||||||||||||||||||||||| |||||||||||||||||||| || Sbjct: 211 cttggcgtcggtggcggagaagacggtgtagacgaggacgaaggtgccgatgatctcggc 270 Query: 616 ggcgaggccggtgcccttggagtatccgg 644 | ||||||||| |||||||| ||| |||| Sbjct: 271 gccgaggccggagcccttggtgtagccgg 299
>gb|AY372191.1| Spinacia oleracea PIP1;2 (Pip1;2) mRNA, complete cds Length = 1248 Score = 117 bits (59), Expect = 5e-23 Identities = 158/191 (82%) Strand = Plus / Minus Query: 410 ttgttgtagatgacggcggcccccaggctcctggccgggttgatgccggtgccggtgatc 469 ||||||||||||| |||| || || ||||| || |||||||| ||||||||||| || Sbjct: 785 ttgttgtagatgatagcggtaccaagactcctagcagggttgataccggtgccggtaatg 726 Query: 470 gggatggtggccaggtggaccatgaacacggcgaagccgatcgggaggggcgccaacacc 529 ||||||||||||| ||| |||| |||||| ||||| ||||| |||||||| ||||| | Sbjct: 725 gggatggtggccaagtgaaccaagaacacagcgaacccgattgggaggggtgccaagata 666 Query: 530 gggacgtgagagtcgcgtgcgctgcgcttggggtcggtggcggagaagacggtgtagacg 589 || || |||||||| | ||||| | ||||| ||| ||||| ||||||||||||||||| Sbjct: 665 ggaacatgagagtccctagcgcttctcttggcgtcagtggcagagaagacggtgtagaca 606 Query: 590 agcacgaaggt 600 || |||||||| Sbjct: 605 aggacgaaggt 595
>gb|AC024594.9| Oryza sativa chromosome 10 BAC OSJNBa0093B11 genomic sequence, complete sequence Length = 178692 Score = 117 bits (59), Expect = 5e-23 Identities = 89/99 (89%) Strand = Plus / Plus Query: 541 gtcgcgtgcgctgcgcttggggtcggtggcggagaagacggtgtagacgagcacgaaggt 600 |||||| ||||||||||||| |||||||||||||||||||||||| ||||||||||| || Sbjct: 47870 gtcgcgcgcgctgcgcttggcgtcggtggcggagaagacggtgtacacgagcacgaacgt 47929 Query: 601 gccgatgatctccgcggcgaggccggtgcccttggagta 639 |||| || ||| |||||||| |||| |||||||||||| Sbjct: 47930 gccggcgacctcggcggcgagcccggcgcccttggagta 47968 Score = 107 bits (54), Expect = 5e-20 Identities = 102/118 (86%) Strand = Plus / Plus Query: 412 gttgtagatgacggcggcccccaggctcctggccgggttgatgccggtgccggtgatcgg 471 |||||||| ||||||||| || | |||||| ||||| |||||||| |||||||||||||| Sbjct: 47653 gttgtagacgacggcggcgccgaagctcctcgccggattgatgcccgtgccggtgatcgg 47712 Query: 472 gatggtggccaggtggaccatgaacacggcgaagccgatcgggaggggcgccaacacc 529 ||||||||| ||||| |||| |||||| ||||| ||||| || | |||||||||||| Sbjct: 47713 gatggtggcgaggtgcaccacgaacaccgcgaaaccgatgggcaatggcgccaacacc 47770
>gb|AY671950.1| Aegiceras corniculatum aquaporin 2 (PIP2) mRNA, complete cds Length = 855 Score = 117 bits (59), Expect = 5e-23 Identities = 182/223 (81%) Strand = Plus / Minus Query: 375 cccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccca 434 ||||||| ||||||||||||||||| | ||| | ||| |||||| || ||||| |||| Sbjct: 754 cccagaaaatccactgatcatcccatgtcttttttttgccgtagatcacagcggctccca 695 Query: 435 ggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatga 494 ||| | ||||||||| ||||| || |||||||||||||| ||||||| ||||||||| | Sbjct: 694 agctacgggccgggttaatgccagttccggtgatcgggatcgtggccaagtggaccataa 635 Query: 495 acacggcgaagccgatcgggaggggcgccaacaccgggacgtgagagtcgcgtgcgctgc 554 | ||||| || || || || || || ||||| ||||| || |||||||| || || || | Sbjct: 634 aaacggcaaatcctattggaagtggtgccaaaaccggtacatgagagtcacgggcacttc 575 Query: 555 gcttggggtcggtggcggagaagacggtgtagacgagcacgaa 597 ||||||||| || || |||||||||||||| || |||||||| Sbjct: 574 tcttggggtcagtagcagagaagacggtgtaaacaagcacgaa 532
>dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 10, complete sequence Length = 22685906 Score = 117 bits (59), Expect = 5e-23 Identities = 89/99 (89%) Strand = Plus / Minus Query: 541 gtcgcgtgcgctgcgcttggggtcggtggcggagaagacggtgtagacgagcacgaaggt 600 |||||| ||||||||||||| |||||||||||||||||||||||| ||||||||||| || Sbjct: 17626761 gtcgcgcgcgctgcgcttggcgtcggtggcggagaagacggtgtacacgagcacgaacgt 17626702 Query: 601 gccgatgatctccgcggcgaggccggtgcccttggagta 639 |||| || ||| |||||||| |||| |||||||||||| Sbjct: 17626701 gccggcgacctcggcggcgagcccggcgcccttggagta 17626663 Score = 107 bits (54), Expect = 5e-20 Identities = 102/118 (86%) Strand = Plus / Minus Query: 412 gttgtagatgacggcggcccccaggctcctggccgggttgatgccggtgccggtgatcgg 471 |||||||| ||||||||| || | |||||| ||||| |||||||| |||||||||||||| Sbjct: 17626978 gttgtagacgacggcggcgccgaagctcctcgccggattgatgcccgtgccggtgatcgg 17626919 Query: 472 gatggtggccaggtggaccatgaacacggcgaagccgatcgggaggggcgccaacacc 529 ||||||||| ||||| |||| |||||| ||||| ||||| || | |||||||||||| Sbjct: 17626918 gatggtggcgaggtgcaccacgaacaccgcgaaaccgatgggcaatggcgccaacacc 17626861 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 339 agaaggccgcgatcgccgcg 358 |||||||||||||||||||| Sbjct: 13136748 agaaggccgcgatcgccgcg 13136767
>dbj|AB206103.1| Mimosa pudica pip2;5 mRNA for plasma membrane intrinsic protein 2;5, complete cds Length = 1126 Score = 117 bits (59), Expect = 5e-23 Identities = 218/271 (80%) Strand = Plus / Minus Query: 374 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 433 |||||||||||||| || |||||||| |||||| | |||||||| || || || || || Sbjct: 786 acccagaagatccaatggtcatcccaagccttgccattgttgtaaataacagccgcacca 727 Query: 434 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 493 | ||||| |||||||| || || || || ||||| || ||||| |||| ||| |||||| Sbjct: 726 aaactcctagccgggttaatcccagttccagtgatgggaatggtagccaagtgaaccatg 667 Query: 494 aacacggcgaagccgatcgggaggggcgccaacaccgggacgtgagagtcgcgtgcgctg 553 || || || || || || || | || ||||| || || ||||||||||| |||||||| Sbjct: 666 aaaacagcaaatccaataggcaatggagccaaaacgggaacgtgagagtcacgtgcgcta 607 Query: 554 cgcttggggtcggtggcggagaagacggtgtagacgagcacgaaggtgccgatgatctcc 613 |||||||||||| |||| |||||||| |||||||| || || |||||||| |||||||| Sbjct: 606 cgcttggggtcgatggctgagaagacagtgtagacaagaacaaaggtgccaatgatctca 547 Query: 614 gcggcgaggccggtgcccttggagtatccgg 644 ||| | ||| | ||||| |||||||| |||| Sbjct: 546 gcgccaagggctgtgcctttggagtagccgg 516
>gb|AY547266.2| Ipomoea nil aquaporin-like protein (AQP1) mRNA, complete cds Length = 1189 Score = 117 bits (59), Expect = 5e-23 Identities = 218/271 (80%) Strand = Plus / Minus Query: 374 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 433 |||||||||||||| ||||||| ||| || | || ||||||||||||| ||| || || Sbjct: 867 acccagaagatccaatgatcattccatgcgtgttcattgttgtagatgatggctgcaccg 808 Query: 434 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 493 || || | ||||||||| || || |||||||||||||| ||||| |||| ||| |||| | Sbjct: 807 agacttcgggccgggttaatacccgtgccggtgatcggaatggtagccaagtgcaccaag 748 Query: 494 aacacggcgaagccgatcgggaggggcgccaacaccgggacgtgagagtcgcgtgcgctg 553 || |||||||| || || || | || |||||||| ||||| || ||||| | ||| || Sbjct: 747 aagacggcgaacccaatgggcaacggtgccaacacagggacatgggagtctctggcgttg 688 Query: 554 cgcttggggtcggtggcggagaagacggtgtagacgagcacgaaggtgccgatgatctcc 613 || |||| || |||||||||||||||||||| || || || |||||||||| ||||| Sbjct: 687 cgtttggcatcagtggcggagaagacggtgtaaacaagaacaaaggtgccgacaatctcg 628 Query: 614 gcggcgaggccggtgcccttggagtatccgg 644 ||| |||||||| ||| |||| |||||||| Sbjct: 627 gcgccgaggccgtcgcctttggtgtatccgg 597
>dbj|AP004139.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ1486_E07 Length = 110494 Score = 117 bits (59), Expect = 5e-23 Identities = 95/107 (88%) Strand = Plus / Minus Query: 392 tcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttg 451 |||| |||||| | ||||||||||||||||| ||| || || ||||||||||| |||||| Sbjct: 36713 tcattccaggcatggtccttgttgtagatgatggcagcgccaaggctcctggctgggttg 36654 Query: 452 atgccggtgccggtgatcgggatggtggccaggtggaccatgaacac 498 ||||| || |||||||| |||||||||||||||||||||| |||||| Sbjct: 36653 atgccagtaccggtgatggggatggtggccaggtggaccaggaacac 36607 Score = 44.1 bits (22), Expect = 0.58 Identities = 34/38 (89%) Strand = Plus / Minus Query: 566 gtggcggagaagacggtgtagacgagcacgaaggtgcc 603 ||||| ||||||||||||||||| || | ||||||||| Sbjct: 36180 gtggctgagaagacggtgtagaccaggatgaaggtgcc 36143
>dbj|AP005108.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P0461B08 Length = 153743 Score = 117 bits (59), Expect = 5e-23 Identities = 95/107 (88%) Strand = Plus / Minus Query: 392 tcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttg 451 |||| |||||| | ||||||||||||||||| ||| || || ||||||||||| |||||| Sbjct: 118266 tcattccaggcatggtccttgttgtagatgatggcagcgccaaggctcctggctgggttg 118207 Query: 452 atgccggtgccggtgatcgggatggtggccaggtggaccatgaacac 498 ||||| || |||||||| |||||||||||||||||||||| |||||| Sbjct: 118206 atgccagtaccggtgatggggatggtggccaggtggaccaggaacac 118160 Score = 44.1 bits (22), Expect = 0.58 Identities = 34/38 (89%) Strand = Plus / Minus Query: 566 gtggcggagaagacggtgtagacgagcacgaaggtgcc 603 ||||| ||||||||||||||||| || | ||||||||| Sbjct: 117733 gtggctgagaagacggtgtagaccaggatgaaggtgcc 117696
>gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence Length = 22698374 Score = 117 bits (59), Expect = 5e-23 Identities = 89/99 (89%) Strand = Plus / Minus Query: 541 gtcgcgtgcgctgcgcttggggtcggtggcggagaagacggtgtagacgagcacgaaggt 600 |||||| ||||||||||||| |||||||||||||||||||||||| ||||||||||| || Sbjct: 17635801 gtcgcgcgcgctgcgcttggcgtcggtggcggagaagacggtgtacacgagcacgaacgt 17635742 Query: 601 gccgatgatctccgcggcgaggccggtgcccttggagta 639 |||| || ||| |||||||| |||| |||||||||||| Sbjct: 17635741 gccggcgacctcggcggcgagcccggcgcccttggagta 17635703 Score = 107 bits (54), Expect = 5e-20 Identities = 102/118 (86%) Strand = Plus / Minus Query: 412 gttgtagatgacggcggcccccaggctcctggccgggttgatgccggtgccggtgatcgg 471 |||||||| ||||||||| || | |||||| ||||| |||||||| |||||||||||||| Sbjct: 17636018 gttgtagacgacggcggcgccgaagctcctcgccggattgatgcccgtgccggtgatcgg 17635959 Query: 472 gatggtggccaggtggaccatgaacacggcgaagccgatcgggaggggcgccaacacc 529 ||||||||| ||||| |||| |||||| ||||| ||||| || | |||||||||||| Sbjct: 17635958 gatggtggcgaggtgcaccacgaacaccgcgaaaccgatgggcaatggcgccaacacc 17635901 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 339 agaaggccgcgatcgccgcg 358 |||||||||||||||||||| Sbjct: 13144088 agaaggccgcgatcgccgcg 13144107
>ref|NM_129458.2| Arabidopsis thaliana PIP2;6/PIP2E; water channel AT2G39010 (PIP2;6/PIP2E) mRNA, complete cds Length = 1245 Score = 115 bits (58), Expect = 2e-22 Identities = 196/242 (80%) Strand = Plus / Minus Query: 371 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcc 430 ||||||||||||||||||||||||||||| ||||| | ||||||||||||||||| || Sbjct: 845 ccgacccagaagatccactgatcatcccaagccttttgattgttgtagatgacggcagct 786 Query: 431 cccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggacc 490 || | ||||| |||||||| || |||||||| || || || || ||||| | || ||| Sbjct: 785 ccaaaactcctagccgggtttattccggtgccagtaattggaattgtggctaaatgaacc 726 Query: 491 atgaacacggcgaagccgatcgggaggggcgccaacaccgggacgtgagagtcgcgtgcg 550 |||||||||| || || || || | || || || || || | ||||||||| || || Sbjct: 725 atgaacacggaaaatccaattggcaatggtgctaatacaggaatgtgagagtcacgggca 666 Query: 551 ctgcgcttggggtcggtggcggagaagacggtgtagacgagcacgaaggtgccgatgatc 610 | ||||| |||||||| ||||||||||||||||||||||| || || |||||||| ||| Sbjct: 665 tttcgcttagggtcggtagcggagaagacggtgtagacgaggacaaaagtgccgataatc 606 Query: 611 tc 612 || Sbjct: 605 tc 604
>ref|NM_100044.3| Arabidopsis thaliana PIP1C; water channel AT1G01620 (PIP1C) mRNA, complete cds Length = 1251 Score = 115 bits (58), Expect = 2e-22 Identities = 196/242 (80%) Strand = Plus / Minus Query: 371 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcc 430 ||||||||||| ||||| || || ||||| || | ||||||||||||||||| || || Sbjct: 908 ccgacccagaatatccagtggtcgtcccaagcgtggtccttgttgtagatgattgcagct 849 Query: 431 cccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggacc 490 || || ||||| || ||||| || || || |||||||| || || || |||| ||| ||| Sbjct: 848 ccaagactcctagctgggttaattcctgttccggtgattggaatcgtcgccaagtgaacc 789 Query: 491 atgaacacggcgaagccgatcgggaggggcgccaacaccgggacgtgagagtcgcgtgcg 550 | |||||| ||||| ||||| ||||| || ||||| | ||| ||||| ||||| || ||| Sbjct: 788 aagaacacagcgaatccgattgggagtggtgccaaaatcggaacgtgggagtcacgagcg 729 Query: 551 ctgcgcttggggtcggtggcggagaagacggtgtagacgagcacgaaggtgccgatgatc 610 || | ||||| ||| |||||||||||||| |||||||| || |||||||| ||||| ||| Sbjct: 728 cttctcttggcgtcagtggcggagaagaccgtgtagacaaggacgaaggttccgattatc 669 Query: 611 tc 612 || Sbjct: 668 tc 667
>emb|X69294.1|ATTMPB A.thaliana mRNA for transmembrane protein TMP-B Length = 1057 Score = 115 bits (58), Expect = 2e-22 Identities = 196/242 (80%) Strand = Plus / Minus Query: 371 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcc 430 ||||||||||| ||||| || || ||||| || | ||||||||||||||||| || || Sbjct: 795 ccgacccagaatatccagtggtcgtcccaagcgtggtccttgttgtagatgattgcagct 736 Query: 431 cccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggacc 490 || || ||||| || ||||| || || || |||||||| || || || |||| ||| ||| Sbjct: 735 ccaagactcctagctgggttaattcctgttccggtgattggaatcgtcgccaagtgaacc 676 Query: 491 atgaacacggcgaagccgatcgggaggggcgccaacaccgggacgtgagagtcgcgtgcg 550 | |||||| ||||| ||||| ||||| || ||||| | ||| ||||| ||||| || ||| Sbjct: 675 aagaacacagcgaatccgattgggagtggtgccaaaatcggaacgtgggagtcacgagcg 616 Query: 551 ctgcgcttggggtcggtggcggagaagacggtgtagacgagcacgaaggtgccgatgatc 610 || | ||||| ||| |||||||||||||| |||||||| || |||||||| ||||| ||| Sbjct: 615 cttctcttggcgtcagtggcggagaagaccgtgtagacaaggacgaaggttccgattatc 556 Query: 611 tc 612 || Sbjct: 555 tc 554
>gb|AY057559.1| Arabidopsis thaliana At2g39010/T7F6.18 mRNA, complete cds Length = 1201 Score = 115 bits (58), Expect = 2e-22 Identities = 196/242 (80%) Strand = Plus / Minus Query: 371 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcc 430 ||||||||||||||||||||||||||||| ||||| | ||||||||||||||||| || Sbjct: 840 ccgacccagaagatccactgatcatcccaagccttttgattgttgtagatgacggcagct 781 Query: 431 cccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggacc 490 || | ||||| |||||||| || |||||||| || || || || ||||| | || ||| Sbjct: 780 ccaaaactcctagccgggtttattccggtgccagtaattggaattgtggctaaatgaacc 721 Query: 491 atgaacacggcgaagccgatcgggaggggcgccaacaccgggacgtgagagtcgcgtgcg 550 |||||||||| || || || || | || || || || || | ||||||||| || || Sbjct: 720 atgaacacggaaaatccaattggcaatggtgctaatacaggaatgtgagagtcacgggca 661 Query: 551 ctgcgcttggggtcggtggcggagaagacggtgtagacgagcacgaaggtgccgatgatc 610 | ||||| |||||||| ||||||||||||||||||||||| || || |||||||| ||| Sbjct: 660 tttcgcttagggtcggtagcggagaagacggtgtagacgaggacaaaagtgccgataatc 601 Query: 611 tc 612 || Sbjct: 600 tc 599
>gb|AY054142.1| Arabidopsis thaliana At2g39010/T7F6.18 mRNA, complete cds Length = 870 Score = 115 bits (58), Expect = 2e-22 Identities = 196/242 (80%) Strand = Plus / Minus Query: 371 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcc 430 ||||||||||||||||||||||||||||| ||||| | ||||||||||||||||| || Sbjct: 758 ccgacccagaagatccactgatcatcccaagccttttgattgttgtagatgacggcagct 699 Query: 431 cccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggacc 490 || | ||||| |||||||| || |||||||| || || || || ||||| | || ||| Sbjct: 698 ccaaaactcctagccgggtttattccggtgccagtaattggaattgtggctaaatgaacc 639 Query: 491 atgaacacggcgaagccgatcgggaggggcgccaacaccgggacgtgagagtcgcgtgcg 550 |||||||||| || || || || | || || || || || | ||||||||| || || Sbjct: 638 atgaacacggaaaatccaattggcaatggtgctaatacaggaatgtgagagtcacgggca 579 Query: 551 ctgcgcttggggtcggtggcggagaagacggtgtagacgagcacgaaggtgccgatgatc 610 | ||||| |||||||| ||||||||||||||||||||||| || || |||||||| ||| Sbjct: 578 tttcgcttagggtcggtagcggagaagacggtgtagacgaggacaaaagtgccgataatc 519 Query: 611 tc 612 || Sbjct: 518 tc 517
>gb|AF348574.1| Arabidopsis thaliana clone C00104 (e) putative plasma membrane intrinsic protein 1c (At1g01620) mRNA, complete cds Length = 861 Score = 115 bits (58), Expect = 2e-22 Identities = 196/242 (80%) Strand = Plus / Minus Query: 371 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcc 430 ||||||||||| ||||| || || ||||| || | ||||||||||||||||| || || Sbjct: 782 ccgacccagaatatccagtggtcgtcccaagcgtggtccttgttgtagatgattgcagct 723 Query: 431 cccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggacc 490 || || ||||| || ||||| || || || |||||||| || || || |||| ||| ||| Sbjct: 722 ccaagactcctagctgggttaattcctgttccggtgattggaatcgtcgccaagtgaacc 663 Query: 491 atgaacacggcgaagccgatcgggaggggcgccaacaccgggacgtgagagtcgcgtgcg 550 | |||||| ||||| ||||| ||||| || ||||| | ||| ||||| ||||| || ||| Sbjct: 662 aagaacacagcgaatccgattgggagtggtgccaaaatcggaacgtgggagtcacgagcg 603 Query: 551 ctgcgcttggggtcggtggcggagaagacggtgtagacgagcacgaaggtgccgatgatc 610 || | ||||| ||| |||||||||||||| |||||||| || |||||||| ||||| ||| Sbjct: 602 cttctcttggcgtcagtggcggagaagaccgtgtagacaaggacgaaggttccgattatc 543 Query: 611 tc 612 || Sbjct: 542 tc 541
>gb|AY045690.1| Arabidopsis thaliana At2g39010/T7F6.18 mRNA, complete cds Length = 1169 Score = 115 bits (58), Expect = 2e-22 Identities = 196/242 (80%) Strand = Plus / Minus Query: 371 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcc 430 ||||||||||||||||||||||||||||| ||||| | ||||||||||||||||| || Sbjct: 842 ccgacccagaagatccactgatcatcccaagccttttgattgttgtagatgacggcagct 783 Query: 431 cccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggacc 490 || | ||||| |||||||| || |||||||| || || || || ||||| | || ||| Sbjct: 782 ccaaaactcctagccgggtttattccggtgccagtaattggaattgtggctaaatgaacc 723 Query: 491 atgaacacggcgaagccgatcgggaggggcgccaacaccgggacgtgagagtcgcgtgcg 550 |||||||||| || || || || | || || || || || | ||||||||| || || Sbjct: 722 atgaacacggaaaatccaattggcaatggtgctaatacaggaatgtgagagtcacgggca 663 Query: 551 ctgcgcttggggtcggtggcggagaagacggtgtagacgagcacgaaggtgccgatgatc 610 | ||||| |||||||| ||||||||||||||||||||||| || || |||||||| ||| Sbjct: 662 tttcgcttagggtcggtagcggagaagacggtgtagacgaggacaaaagtgccgataatc 603 Query: 611 tc 612 || Sbjct: 602 tc 601
>emb|BX816517.1|CNS0AD43 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH53ZE08 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress) Length = 963 Score = 115 bits (58), Expect = 2e-22 Identities = 196/242 (80%) Strand = Plus / Minus Query: 371 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcc 430 ||||||||||| ||||| || || ||||| || | ||||||||||||||||| || || Sbjct: 826 ccgacccagaatatccagtggtcgtcccaagcgtggtccttgttgtagatgattgcagct 767 Query: 431 cccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggacc 490 || || ||||| || ||||| || || || |||||||| || || || |||| ||| ||| Sbjct: 766 ccaagactcctagctgggttaattcctgttccggtgattggaatcgtcgccaagtgaacc 707 Query: 491 atgaacacggcgaagccgatcgggaggggcgccaacaccgggacgtgagagtcgcgtgcg 550 | |||||| ||||| ||||| ||||| || ||||| | ||| ||||| ||||| || ||| Sbjct: 706 aagaacacagcgaatccgattgggagtggtgccaaaatcggaacgtgggagtcacgagcg 647 Query: 551 ctgcgcttggggtcggtggcggagaagacggtgtagacgagcacgaaggtgccgatgatc 610 || | ||||| ||| |||||||||||||| |||||||| || |||||||| ||||| ||| Sbjct: 646 cttctcttggcgtcagtggcggagaagaccgtgtagacaaggacgaaggttccgattatc 587 Query: 611 tc 612 || Sbjct: 586 tc 585
>emb|BX819847.1|CNS0A9GD Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS38ZC08 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 821 Score = 115 bits (58), Expect = 2e-22 Identities = 209/258 (81%), Gaps = 1/258 (0%) Strand = Plus / Minus Query: 374 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 433 |||||||| ||||| || |||||||| | |||| |||||| ||||| ||||| || || Sbjct: 492 acccagaatatccagtggtcatcccatggcttgctcttgttatagattacggcagctccg 433 Query: 434 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 493 | ||||| ||||||||||||||||| ||||||||||| || ||||||| || ||||| Sbjct: 432 aaactcctagccgggttgatgccggttccggtgatcggaatagtggccaaatgtaccata 373 Query: 494 aacacggcgaagccgatcgggaggggcgccaacaccgggacgtgagagtcgcgtgcg-ct 552 ||||| || || || ||||| || |||||||| ||||| ||||| ||||| | ||| | Sbjct: 372 aacaccgcaaacccaatcggaagtggcgccaaaaccggaacgtgggagtctctagcgtat 313 Query: 553 gcgcttggggtcggtggcggagaagacggtgtagacgagcacgaaggtgccgatgatctc 612 || ||||| || || ||||||||||| ||||||||||| ||||| || || |||||||| Sbjct: 312 acgtttgggatcagtagcggagaagactgtgtagacgagaacgaatgttccaatgatctc 253 Query: 613 cgcggcgaggccggtgcc 630 ||||| || |||||||| Sbjct: 252 tgcggctagtccggtgcc 235
>emb|BX820104.1|CNS0A8J8 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS74ZC11 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1160 Score = 115 bits (58), Expect = 2e-22 Identities = 196/242 (80%) Strand = Plus / Minus Query: 371 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcc 430 ||||||||||||||||||||||||||||| ||||| | ||||||||||||||||| || Sbjct: 829 ccgacccagaagatccactgatcatcccaagccttttgattgttgtagatgacggcagct 770 Query: 431 cccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggacc 490 || | ||||| |||||||| || |||||||| || || || || ||||| | || ||| Sbjct: 769 ccaaaactcctagccgggtttattccggtgccagtaattggaattgtggctaaatgaacc 710 Query: 491 atgaacacggcgaagccgatcgggaggggcgccaacaccgggacgtgagagtcgcgtgcg 550 |||||||||| || || || || | || || || || || | ||||||||| || || Sbjct: 709 atgaacacggaaaatccaattggcaatggtgctaatacaggaatgtgagagtcacgggca 650 Query: 551 ctgcgcttggggtcggtggcggagaagacggtgtagacgagcacgaaggtgccgatgatc 610 | ||||| |||||||| ||||||||||||||||||||||| || || |||||||| ||| Sbjct: 649 tttcgcttagggtcggtagcggagaagacggtgtagacgaggacaaaagtgccgataatc 590 Query: 611 tc 612 || Sbjct: 589 tc 588
>emb|BX824010.1|CNS0A6YX Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH14ZC12 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1035 Score = 115 bits (58), Expect = 2e-22 Identities = 205/254 (80%) Strand = Plus / Minus Query: 374 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 433 ||||| || ||||| || |||||||| | |||| |||||||||||| ||||| || || Sbjct: 797 acccaaaatatccagtggtcatcccatggcttgctcttgttgtagattacggcagctccg 738 Query: 434 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 493 | ||||| |||||||| || ||||| ||||| || || ||||| |||| || |||||| Sbjct: 737 aaactccttgccgggttaattccggttccggtaatgggaatggtagccaaatgtaccatg 678 Query: 494 aacacggcgaagccgatcgggaggggcgccaacaccgggacgtgagagtcgcgtgcgctg 553 |||||||| || ||||| || || |||||||||||||| ||||| |||| | || || Sbjct: 677 aacacggcaaatccgattggaagtggcgccaacaccggaacgtgggagtatctggcacta 618 Query: 554 cgcttggggtcggtggcggagaagacggtgtagacgagcacgaaggtgccgatgatctcc 613 || |||||||| ||||| ||||||||||||||||| || ||||| || || |||||||| Sbjct: 617 cgtttggggtcagtggcagagaagacggtgtagacaagaacgaaagtaccaatgatctct 558 Query: 614 gcggcgaggccggt 627 ||||| || ||||| Sbjct: 557 gcggctagaccggt 544
>emb|BX842136.1|CNS09YDO Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS52ZB11 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1117 Score = 115 bits (58), Expect = 2e-22 Identities = 206/254 (81%), Gaps = 1/254 (0%) Strand = Plus / Minus Query: 374 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 433 ||||| || ||||| || |||||||| | |||| |||||||||||| ||||| || || Sbjct: 801 acccaaaatatccagtggtcatcccatggcttgctcttgttgtagattacggcagctccg 742 Query: 434 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 493 | ||||| |||||||| || ||||| ||||| || || ||||| |||| || |||||| Sbjct: 741 aaactccttgccgggttaattccggttccggtaatgggaatggtagccaaatgtaccatg 682 Query: 494 aacacggcgaagccgatcgggaggggcgccaacaccgggacgtgagagtcgcgtgcgctg 553 |||||||| || ||||| || || |||||||||||||| ||||| ||||| | || | | Sbjct: 681 aacacggcaaatccgattggaagtggcgccaacaccggaacgtgggagtctc-tgggata 623 Query: 554 cgcttggggtcggtggcggagaagacggtgtagacgagcacgaaggtgccgatgatctcc 613 || |||||||| ||||| ||||||||||||||||| || ||||| || || |||||||| Sbjct: 622 cgtttggggtcagtggcagagaagacggtgtagacaagaacgaaagtaccaatgatctct 563 Query: 614 gcggcgaggccggt 627 ||||| || ||||| Sbjct: 562 gcggctagaccggt 549
>gb|AY170841.1| Axonopus compressus plasma membrane MIP protein mRNA, partial cds Length = 423 Score = 115 bits (58), Expect = 2e-22 Identities = 145/174 (83%) Strand = Plus / Minus Query: 331 ctggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactg 390 ||||||||||| ||| || | || ||||| || | ||||||||||||||||||||| || Sbjct: 384 ctggtggtagatggcggctagggcagcgccaatgaaggggccgacccagaagatccaatg 325 Query: 391 atcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggtt 450 |||| |||||| | ||| |||||||||||| ||| || || |||||||| || ||||| Sbjct: 324 gtcattccaggcgtgctccctgttgtagatgatggcagcgccaaggctcctagctgggtt 265 Query: 451 gatgccggtgccggtgatcgggatggtggccaggtggaccatgaacacggcgaa 504 |||||| ||||| || || ||||||||||| |||||||||| |||||| ||||| Sbjct: 264 gatgccagtgccagtaatggggatggtggcaaggtggaccaagaacaccgcgaa 211
>emb|BX820743.1|CNS0A9N0 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH65ZF08 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1079 Score = 113 bits (57), Expect = 8e-22 Identities = 207/257 (80%) Strand = Plus / Minus Query: 374 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 433 |||||||| ||||| || |||||||| | |||| |||||| ||||| ||||| || || Sbjct: 800 acccagaatatccagtggtcatcccatggcttgctcttgttatagattacggcagctccg 741 Query: 434 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 493 | ||||| ||||||||||||||||| ||||||||||| || ||||||| || ||||| Sbjct: 740 aaactcctagccgggttgatgccggttccggtgatcggaatagtggccaaatgtaccata 681 Query: 494 aacacggcgaagccgatcgggaggggcgccaacaccgggacgtgagagtcgcgtgcgctg 553 ||||| || || || ||||| || |||||||| ||||| ||||| || || | ||| | Sbjct: 680 aacaccgcaaacccaatcggaagtggcgccaaaaccggaacgtgggaatctctagcgtta 621 Query: 554 cgcttggggtcggtggcggagaagacggtgtagacgagcacgaaggtgccgatgatctcc 613 || ||||| || || ||||||||||| ||||||||||| ||||| || || ||||| || Sbjct: 620 cgtttgggatcagtagcggagaagactgtgtagacgagaacgaatgttccaatgatgtct 561 Query: 614 gcggcgaggccggtgcc 630 ||||| || |||||||| Sbjct: 560 gcggctagtccggtgcc 544
>gb|AY087854.1| Arabidopsis thaliana clone 38965 mRNA, complete sequence Length = 1352 Score = 113 bits (57), Expect = 8e-22 Identities = 198/245 (80%) Strand = Plus / Minus Query: 374 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 433 ||||| || ||||| || |||||||| | |||| |||||||||||| ||||| || || Sbjct: 1019 acccaaaatatccagtggtcatcccatggcttgctcttgttgtagattacggcagctccg 960 Query: 434 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 493 | ||||| |||||||| || ||||| ||||| || || ||||| |||| || |||||| Sbjct: 959 aaactccttgccgggttaattccggttccggtaatgggaatggtagccaaatgtaccatg 900 Query: 494 aacacggcgaagccgatcgggaggggcgccaacaccgggacgtgagagtcgcgtgcgctg 553 |||||||| || ||||| || || |||||||||||||| ||||| ||||| | || || Sbjct: 899 aacacggcaaatccgattggaagtggcgccaacaccggaacgtgggagtctctagcacta 840 Query: 554 cgcttggggtcggtggcggagaagacggtgtagacgagcacgaaggtgccgatgatctcc 613 || |||||||| ||||| |||||||| |||||||| || ||||| || || |||||||| Sbjct: 839 cgtttggggtcagtggcagagaagacagtgtagacaagaacgaaagtaccaatgatctct 780 Query: 614 gcggc 618 ||||| Sbjct: 779 gcggc 775
>gb|AY903443.1| Astragalus membranaceus clone AM79 putative plasma membrane intrinsic protein mRNA, complete cds Length = 1120 Score = 113 bits (57), Expect = 8e-22 Identities = 108/125 (86%) Strand = Plus / Minus Query: 374 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 433 ||||||||||||||||| |||||||| ||||||||||||||||| || || || || || Sbjct: 746 acccagaagatccactggtcatcccatgccttgtccttgttgtaaattacagcagctccg 687 Query: 434 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 493 | |||||||| |||||||| ||||||||||| || ||||| ||||||| ||| |||||| Sbjct: 686 aaactcctggctgggttgataccggtgccggtaattgggatagtggccaagtgaaccatg 627 Query: 494 aacac 498 ||||| Sbjct: 626 aacac 622 Score = 48.1 bits (24), Expect = 0.037 Identities = 30/32 (93%) Strand = Plus / Minus Query: 281 ttgctcctgaaggagccgagggccttgatggc 312 |||||||||||||| ||||| ||||||||||| Sbjct: 839 ttgctcctgaaggatccgagagccttgatggc 808
>gb|AF067185.1|AF067185 Samanea saman aquaporin 2 (Aqp2) mRNA, complete cds Length = 1201 Score = 113 bits (57), Expect = 8e-22 Identities = 207/257 (80%) Strand = Plus / Minus Query: 374 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 433 |||||||||||||| || ||||||||||| || | | |||| |||| || || || || Sbjct: 814 acccagaagatccaatggtcatcccaggctttctgttggttgaagataacagcagctccg 755 Query: 434 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 493 || ||||||||||||||||||||||||||||||| ||||||||||||| ||| |||||| Sbjct: 754 agactcctggccgggttgatgccggtgccggtgactgggatggtggccaagtgaaccatg 695 Query: 494 aacacggcgaagccgatcgggaggggcgccaacaccgggacgtgagagtcgcgtgcgctg 553 ||||| || || || || || || || ||||| || || || || ||||| | ||||| Sbjct: 694 aacacagcaaatccaatgggaagtggagccaaaacaggcacatgggagtctctagcgctc 635 Query: 554 cgcttggggtcggtggcggagaagacggtgtagacgagcacgaaggtgccgatgatctcc 613 | |||||| || ||||||||||| || ||||| || | || ||||| ||||||||||| Sbjct: 634 ctcttgggatcagtggcggagaacacagtgtaaaccaaaacaaaggttccgatgatctca 575 Query: 614 gcggcgaggccggtgcc 630 ||| | | ||||||||| Sbjct: 574 gcgcctaagccggtgcc 558
>emb|AJ000031.1|CPPMIP1 Carica papaya mRNA for membrane channel protein, partial Length = 821 Score = 111 bits (56), Expect = 3e-21 Identities = 200/248 (80%) Strand = Plus / Minus Query: 374 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 433 |||||||| ||||| || |||||||| ||||||||| ||||| |||||| ||| || || Sbjct: 446 acccagaaaatccaatggtcatcccaagccttgtccctgttgaagatgatggctgcacca 387 Query: 434 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 493 || |||||||| ||||| || || || || ||||| || |||||||| | ||| |||| | Sbjct: 386 agactcctggctgggttaataccagttcctgtgattggaatggtggctaagtgcaccaag 327 Query: 494 aacacggcgaagccgatcgggaggggcgccaacaccgggacgtgagagtcgcgtgcgctg 553 ||||| ||||| || || || || || ||||| | || ||||| ||||| | ||| || Sbjct: 326 aacactgcgaacccaattggtagaggtgccaaaattggaacgtgggagtctctggcgttg 267 Query: 554 cgcttggggtcggtggcggagaagacggtgtagacgagcacgaaggtgccgatgatctcc 613 ||||||| ||| ||||| || |||||||||||||| || ||||||||||||| |||||| Sbjct: 266 cgcttggcgtcagtggccgacaagacggtgtagaccaggacgaaggtgccgacgatctca 207 Query: 614 gcggcgag 621 ||| |||| Sbjct: 206 gcgccgag 199
>gb|AF118383.1|AF118383 Brassica napus plasma membrane intrinsic protein 2 (PIP2) mRNA, complete cds Length = 1026 Score = 111 bits (56), Expect = 3e-21 Identities = 200/248 (80%) Strand = Plus / Minus Query: 374 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 433 |||||||| ||||| || |||||||| | |||| || ||||||||| || || || || Sbjct: 777 acccagaatatccagtggtcatcccacggcttggactcgttgtagataaccgcagctccg 718 Query: 434 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 493 | ||||| |||||||| || || || ||||||||||| || ||||||| ||| |||||| Sbjct: 717 aaactccttgccgggttaattcctgttccggtgatcggaatagtggccaagtgaaccatg 658 Query: 494 aacacggcgaagccgatcgggaggggcgccaacaccgggacgtgagagtcgcgtgcgctg 553 || || || || || ||||| || ||||||||||| || ||||| ||||| |||||| | Sbjct: 657 aagaccgcaaaccctatcggaagtggcgccaacacgggaacgtgggagtctcgtgcgttt 598 Query: 554 cgcttggggtcggtggcggagaagacggtgtagacgagcacgaaggtgccgatgatctcc 613 | |||||||| ||||| |||||||| |||||||| || || || || ||||||||||| Sbjct: 597 cttttggggtctgtggctgagaagacagtgtagaccaggacaaaagttccgatgatctct 538 Query: 614 gcggcgag 621 |||||||| Sbjct: 537 gcggcgag 530
>gb|U26538.1|MCU26538 Mesembryanthemum crystallinum major intrinsic protein homolog (mipE) mRNA, partial cds Length = 963 Score = 111 bits (56), Expect = 3e-21 Identities = 146/176 (82%) Strand = Plus / Minus Query: 437 ctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatgaac 496 ||||| || ||||||||||||||||| ||||| ||||||||||||| || ||||||||| Sbjct: 592 ctcctagcagggttgatgccggtgccagtgatggggatggtggccaaatgaaccatgaac 533 Query: 497 acggcgaagccgatcgggaggggcgccaacaccgggacgtgagagtcgcgtgcgctgcgc 556 || || || || || || || || || | ||| || ||||||||||| || ||||| | | Sbjct: 532 acagcaaaaccaatgggaagaggggcaagcactggcacgtgagagtcacgcgcgctcctc 473 Query: 557 ttggggtcggtggcggagaagacggtgtagacgagcacgaaggtgccgatgatctc 612 || ||||| |||||||||||||| |||||||| | || ||||||||||||||||| Sbjct: 472 ttagggtcagtggcggagaagactgtgtagacaacgacaaaggtgccgatgatctc 417
>gb|DQ451602.1| Salicornia bigelovii plasma membrane major intrinsic protein (PIP1) mRNA, complete cds Length = 1268 Score = 109 bits (55), Expect = 1e-20 Identities = 160/195 (82%) Strand = Plus / Minus Query: 411 tgttgtagatgacggcggcccccaggctcctggccgggttgatgccggtgccggtgatcg 470 |||||||||||| ||| | || || ||||| || |||||||| |||||||| || | | Sbjct: 824 tgttgtagatgatggcagtaccaagactcctagcagggttgataccggtgccagtaacgg 765 Query: 471 ggatggtggccaggtggaccatgaacacggcgaagccgatcgggaggggcgccaacaccg 530 |||||||||||| ||| |||| |||||||||||| || || || | ||| ||||| | | Sbjct: 764 ggatggtggccaagtgaaccaagaacacggcgaatccaataggcaagggagccaagatag 705 Query: 531 ggacgtgagagtcgcgtgcgctgcgcttggggtcggtggcggagaagacggtgtagacga 590 | || |||||||| | ||||| ||||||| ||| ||||| ||||||||||||||||||| Sbjct: 704 gaacatgagagtccctagcgcttcgcttggcgtcagtggcagagaagacggtgtagacga 645 Query: 591 gcacgaaggtgccga 605 | ||||||||||||| Sbjct: 644 gaacgaaggtgccga 630
>emb|AL606687.3|OSJN00087 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0084K11, complete sequence Length = 147806 Score = 109 bits (55), Expect = 1e-20 Identities = 94/107 (87%) Strand = Plus / Minus Query: 392 tcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttg 451 ||||||||||| | | || |||||||||||| ||| || || |||||||| || |||||| Sbjct: 28019 tcatcccaggcatggcccctgttgtagatgatggcagcgccaaggctcctcgctgggttg 27960 Query: 452 atgccggtgccggtgatcgggatggtggccaggtggaccatgaacac 498 ||||||||||||||||| ||||||||||||||||| |||| |||||| Sbjct: 27959 atgccggtgccggtgatggggatggtggccaggtgaaccaagaacac 27913 Score = 97.6 bits (49), Expect = 4e-17 Identities = 79/89 (88%) Strand = Plus / Minus Query: 556 cttggggtcggtggcggagaagacggtgtagacgagcacgaaggtgccgatgatctccgc 615 ||||| |||||||||||||||||||||||||||||| | ||||||||||| |||||| || Sbjct: 27752 cttggcgtcggtggcggagaagacggtgtagacgaggatgaaggtgccgacgatctcggc 27693 Query: 616 ggcgaggccggtgcccttggagtatccgg 644 | |||||||| |||||||| ||| |||| Sbjct: 27692 gccgaggccgtcgcccttggtgtagccgg 27664 Score = 40.1 bits (20), Expect = 9.1 Identities = 23/24 (95%) Strand = Plus / Minus Query: 367 ggggccgacccagaagatccactg 390 |||||| ||||||||||||||||| Sbjct: 28605 ggggccaacccagaagatccactg 28582
>emb|BX824659.1|CNS0A6W2 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH62ZH05 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1056 Score = 109 bits (55), Expect = 1e-20 Identities = 206/255 (80%), Gaps = 1/255 (0%) Strand = Plus / Minus Query: 374 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 433 ||||| || ||||| || |||||||| | |||| |||||||||||| ||||| || || Sbjct: 800 acccaaaatatccagtggtcatcccatggcttgctcttgttgtagattacggcagctccg 741 Query: 434 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 493 | ||||| |||||||| || ||||| ||||| || || ||||| |||| || |||||| Sbjct: 740 aaactccttgccgggttaattccggttccggtaatgggaatggtagccaaatgtaccatg 681 Query: 494 aacacggcgaagccgatcgggaggggcgccaacaccgggacgtgagagtcgc-gtgcgct 552 |||||||| || ||||| || || |||||||||||||| ||||| ||||| | | || || Sbjct: 680 aacacggcaaatccgattggaagtggcgccaacaccggaacgtgggagtctctgagcact 621 Query: 553 gcgcttggggtcggtggcggagaagacggtgtagacgagcacgaaggtgccgatgatctc 612 || |||||||| || || ||||||||||||||||| || ||||| || || |||||||| Sbjct: 620 acgtttggggtcagttgcagagaagacggtgtagacaagaacgaaagtaccaatgatctc 561 Query: 613 cgcggcgaggccggt 627 ||||| || ||||| Sbjct: 560 tgcggctagaccggt 546
>gb|U73466.1|MCU73466 Mesembryanthemum crystallinum water channel protein MipC mRNA, complete cds Length = 1066 Score = 109 bits (55), Expect = 1e-20 Identities = 193/239 (80%) Strand = Plus / Minus Query: 374 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 433 |||||||| ||||| ||||||||||||||||| | | ||||||||| ||||| || || Sbjct: 838 acccagaaaatccaatgatcatcccaggccttctgttggttgtagatcacggcagctccg 779 Query: 434 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 493 | || || || ||||||||||| ||||||||||| ||||||||||||| ||| |||||| Sbjct: 778 aaacttctagctgggttgatgccagtgccggtgattgggatggtggccaagtgaaccatg 719 Query: 494 aacacggcgaagccgatcgggaggggcgccaacaccgggacgtgagagtcgcgtgcgctg 553 ||||| ||||| || || || || || ||||| || || |||||||| || | ||| | Sbjct: 718 aacaccgcgaacccaataggaagtggtgccaatacaggaacgtgagaatctctagcgttt 659 Query: 554 cgcttggggtcggtggcggagaagacggtgtagacgagcacgaaggtgccgatgatctc 612 | |||||| || ||||| | ||||| |||||||| || ||||||||||| || ||||| Sbjct: 658 ctcttgggatcagtggcagcaaagacagtgtagacaagaacgaaggtgccaataatctc 600
>gb|L36096.1|CIPMIPC Mesembryanthemum crystallinum mipC mRNA Length = 582 Score = 109 bits (55), Expect = 1e-20 Identities = 193/239 (80%) Strand = Plus / Minus Query: 374 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 433 |||||||| ||||| ||||||||||||||||| | | ||||||||| ||||| || || Sbjct: 354 acccagaaaatccaatgatcatcccaggccttctgttggttgtagatcacggcagctccg 295 Query: 434 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 493 | || || || ||||||||||| ||||||||||| ||||||||||||| ||| |||||| Sbjct: 294 aaacttctagctgggttgatgccagtgccggtgattgggatggtggccaagtgaaccatg 235 Query: 494 aacacggcgaagccgatcgggaggggcgccaacaccgggacgtgagagtcgcgtgcgctg 553 ||||| ||||| || || || || || ||||| || || |||||||| || | ||| | Sbjct: 234 aacaccgcgaacccaataggaagtggtgccaatacaggaacgtgagaatctctagcgttt 175 Query: 554 cgcttggggtcggtggcggagaagacggtgtagacgagcacgaaggtgccgatgatctc 612 | |||||| || ||||| | ||||| |||||||| || ||||||||||| || ||||| Sbjct: 174 ctcttgggatcagtggcagcaaagacagtgtagacaagaacgaaggtgccaataatctc 116
>dbj|AB012045.1| Raphanus sativus mRNA for Plasma membrane aquaporin (PAQ2), complete cds Length = 1126 Score = 109 bits (55), Expect = 1e-20 Identities = 193/239 (80%) Strand = Plus / Minus Query: 374 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 433 ||||| || ||||| || |||||||||| |||| || |||| |||||||||| || || Sbjct: 804 acccaaaatatccagtggtcatcccagggcttgctctcgttgaagatgacggctgctccg 745 Query: 434 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 493 | ||||| |||||||| || || || |||||||| || ||||| |||| ||| |||||| Sbjct: 744 aaactccttgccgggttaataccagttccggtgatgggaatggtagccaagtgcaccatg 685 Query: 494 aacacggcgaagccgatcgggaggggcgccaacaccgggacgtgagagtcgcgtgcgctg 553 ||||| || || || || || || ||||||||||| || ||||| ||||| | || ||| Sbjct: 684 aacaccgcaaatccaattggaagtggcgccaacactggaacgtgggagtctctggcactg 625 Query: 554 cgcttggggtcggtggcggagaagacggtgtagacgagcacgaaggtgccgatgatctc 612 || || ||||| ||||||||||||||||||||||| || ||||| || || |||||||| Sbjct: 624 cgtttagggtcagtggcggagaagacggtgtagacaagaacgaaagtaccaatgatctc 566
>gb|BT018400.1| Zea mays clone EL01N0323H01.d mRNA sequence Length = 1154 Score = 107 bits (54), Expect = 5e-20 Identities = 144/174 (82%) Strand = Plus / Minus Query: 331 ctggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactg 390 ||||||||||| ||| || | || |||||||| | ||||||||||||||||||||| || Sbjct: 790 ctggtggtagatggcagccagggcggcgccgatgaaggggccgacccagaagatccaatg 731 Query: 391 atcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggtt 450 || ||| || | ||| ||||||||||| |||||| || |||||||| ||||| Sbjct: 730 gtcgctccacgcatgatcccggttgtagatgatggcggcgccaaggctcctaaaggggtt 671 Query: 451 gatgccggtgccggtgatcgggatggtggccaggtggaccatgaacacggcgaa 504 |||||||||||||||||| ||||||||||| |||||||||| |||||| ||||| Sbjct: 670 gatgccggtgccggtgatggggatggtggcaaggtggaccaggaacaccgcgaa 617 Score = 52.0 bits (26), Expect = 0.002 Identities = 44/50 (88%) Strand = Plus / Minus Query: 563 tcggtggcggagaagacggtgtagacgagcacgaaggtgccgatgatctc 612 |||||||| ||||||||||||||||| || | ||||||||| | |||||| Sbjct: 558 tcggtggccgagaagacggtgtagaccaggatgaaggtgccaacgatctc 509
>gb|DQ226558.1| Boechera divaricarpa isolate SLW-1-E08 mRNA sequence Length = 591 Score = 107 bits (54), Expect = 5e-20 Identities = 96/110 (87%) Strand = Plus / Plus Query: 488 accatgaacacggcgaagccgatcgggaggggcgccaacaccgggacgtgagagtcgcgt 547 ||||||||||||||||| |||||||| || |||||||||||||||||||| ||||| | Sbjct: 1 accatgaacacggcgaatccgatcggaagtggcgccaacaccgggacgtgggagtctctg 60 Query: 548 gcgctgcgcttggggtcggtggcggagaagacggtgtagacgagcacgaa 597 || || || |||||||| ||||| ||||||||||||||||| || ||||| Sbjct: 61 gcactacgtttggggtcagtggcagagaagacggtgtagactagaacgaa 110
>gb|AY062610.1| Arabidopsis thaliana plasma membrane intrinsic protein 1C (transmembrane protein B) (F22L4.16) mRNA, complete cds Length = 1031 Score = 107 bits (54), Expect = 5e-20 Identities = 195/242 (80%) Strand = Plus / Minus Query: 371 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcc 430 ||||||||||| ||||| || || ||||| || | ||||||||||||||||| || || Sbjct: 836 ccgacccagaatatccagtggtcgtcccaagcgtggtccttgttgtagatgattgcagct 777 Query: 431 cccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggacc 490 || || ||||| || ||||| || || || |||||||| || | || |||| ||| ||| Sbjct: 776 ccaagactcctagctgggttaattcctgttccggtgattggaaacgtcgccaagtgaacc 717 Query: 491 atgaacacggcgaagccgatcgggaggggcgccaacaccgggacgtgagagtcgcgtgcg 550 | |||||| ||||| ||||| ||||| || ||||| | ||| ||||| ||||| || ||| Sbjct: 716 aagaacacagcgaatccgattgggagtggtgccaaaatcggaacgtgggagtcacgagcg 657 Query: 551 ctgcgcttggggtcggtggcggagaagacggtgtagacgagcacgaaggtgccgatgatc 610 || | ||||| ||| |||||||||||||| |||||||| || |||||||| ||||| ||| Sbjct: 656 cttctcttggcgtcagtggcggagaagaccgtgtagacaaggacgaaggttccgattatc 597 Query: 611 tc 612 || Sbjct: 596 tc 595
>gb|BT002101.1| Arabidopsis thaliana plasma membrane intrinsic protein 1C (transmembrane protein B) (At1g01620) mRNA, complete cds Length = 903 Score = 107 bits (54), Expect = 5e-20 Identities = 195/242 (80%) Strand = Plus / Minus Query: 371 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcc 430 ||||||||||| ||||| || || ||||| || | ||||||||||||||||| || || Sbjct: 782 ccgacccagaatatccagtggtcgtcccaagcgtggtccttgttgtagatgattgcagct 723 Query: 431 cccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggacc 490 || || ||||| || ||||| || || || |||||||| || | || |||| ||| ||| Sbjct: 722 ccaagactcctagctgggttaattcctgttccggtgattggaaacgtcgccaagtgaacc 663 Query: 491 atgaacacggcgaagccgatcgggaggggcgccaacaccgggacgtgagagtcgcgtgcg 550 | |||||| ||||| ||||| ||||| || ||||| | ||| ||||| ||||| || ||| Sbjct: 662 aagaacacagcgaatccgattgggagtggtgccaaaatcggaacgtgggagtcacgagcg 603 Query: 551 ctgcgcttggggtcggtggcggagaagacggtgtagacgagcacgaaggtgccgatgatc 610 || | ||||| ||| |||||||||||||| |||||||| || |||||||| ||||| ||| Sbjct: 602 cttctcttggcgtcagtggcggagaagaccgtgtagacaaggacgaaggttccgattatc 543 Query: 611 tc 612 || Sbjct: 542 tc 541
>gb|AF131201.1| Zea mays plasma membrane MIP protein (pip1-2) mRNA, complete cds Length = 1280 Score = 107 bits (54), Expect = 5e-20 Identities = 117/138 (84%) Strand = Plus / Minus Query: 367 ggggccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggc 426 ||||||||||||||||||||| || || | |||||| | ||| |||||||||||| ||| Sbjct: 855 ggggccgacccagaagatccaatggtcgttccaggcgtgatccctgttgtagatgatggc 796 Query: 427 ggcccccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtg 486 || || |||||||| || ||||||||||| ||||| || || ||||||||||| ||||| Sbjct: 795 agcgccaaggctcctagctgggttgatgccagtgccagtaatggggatggtggcaaggtg 736 Query: 487 gaccatgaacacggcgaa 504 ||||| |||||| ||||| Sbjct: 735 gaccaggaacaccgcgaa 718 Score = 50.1 bits (25), Expect = 0.009 Identities = 37/41 (90%) Strand = Plus / Minus Query: 563 tcggtggcggagaagacggtgtagacgagcacgaaggtgcc 603 |||||||| ||||||||||||||||| || | ||||||||| Sbjct: 659 tcggtggctgagaagacggtgtagactaggatgaaggtgcc 619
>gb|DQ235182.1| Solanum tuberosum clone 163E01 major intrinsic protein 2-like mRNA, complete cds Length = 1277 Score = 105 bits (53), Expect = 2e-19 Identities = 170/209 (81%) Strand = Plus / Minus Query: 371 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcc 430 ||||||||||| ||||| || |||||||| |||||||| |||| | || ||||| ||| Sbjct: 828 ccgacccagaaaatccagtgttcatcccacgccttgtcgccgttgaaaatcacggccgcc 769 Query: 431 cccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggacc 490 || | ||||| ||||||||||| ||||| ||||||||||| || ||||| ||||| ||| Sbjct: 768 ccgaaactcctcgccgggttgattccggtaccggtgatcggaatagtggcaaggtgaacc 709 Query: 491 atgaacacggcgaagccgatcgggaggggcgccaacaccgggacgtgagagtcgcgtgcg 550 ||||| |||||||| || || || || || ||||| || || || |||||||| | ||| Sbjct: 708 atgaatacggcgaatccaatgggaagtggggccaatacaggaacatgagagtctctggcg 649 Query: 551 ctgcgcttggggtcggtggcggagaagac 579 || | |||||||||||||| |||||||| Sbjct: 648 cttcttttggggtcggtggcagagaagac 620
>emb|X75883.1|ATPIP2A A.thaliana mRNA for plasma membrane intrinsic protein 2a Length = 1112 Score = 105 bits (53), Expect = 2e-19 Identities = 197/245 (80%) Strand = Plus / Minus Query: 374 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 433 ||||| || ||||| || |||||||| | |||| |||||||||||| ||||| || || Sbjct: 797 acccaaaatatccagtggtcatcccatggcttgctcttgttgtagattacggcagctccg 738 Query: 434 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 493 | ||||| |||||||| || ||||| ||||| || || ||||| |||| || |||||| Sbjct: 737 aaactccttgccgggttaattccggttccggtaatgggaatggtagccaaatgtaccatg 678 Query: 494 aacacggcgaagccgatcgggaggggcgccaacaccgggacgtgagagtcgcgtgcgctg 553 |||||||| || ||||| || || |||||||||||||| ||||| ||||| | || || Sbjct: 677 aacacggcaaatccgattggaagtggcgccaacaccggaacgtgggagtctctagcacta 618 Query: 554 cgcttggggtcggtggcggagaagacggtgtagacgagcacgaaggtgccgatgatctcc 613 || |||||||| || || |||||||| |||||||| || ||||| || || |||||||| Sbjct: 617 cgtttggggtcagtagcagagaagacagtgtagacaagaacgaaagtaccaatgatctct 558 Query: 614 gcggc 618 ||||| Sbjct: 557 gcggc 553
>emb|AJ849327.1| Populus tremula x Populus tremuloides mRNA for putative plasma membrane intrinsic protein (pip2.4 gene) Length = 1135 Score = 105 bits (53), Expect = 2e-19 Identities = 107/125 (85%) Strand = Plus / Minus Query: 374 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 433 |||||||||||||| || | |||||||||||||| | ||||||||| || ||||| ||| Sbjct: 771 acccagaagatccagtggtggtcccaggccttgtcttggttgtagataacagcggctccc 712 Query: 434 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 493 || ||||| || ||||||||||| || || ||||| ||||||||||||| ||| |||||| Sbjct: 711 agactcctagcagggttgatgccagttccagtgatggggatggtggccaagtgaaccatg 652 Query: 494 aacac 498 ||||| Sbjct: 651 aacac 647
>gb|DQ202709.1| Olea europaea plasma membrane intrinsic protein (pip2) mRNA, complete cds Length = 1260 Score = 101 bits (51), Expect = 3e-18 Identities = 174/215 (80%) Strand = Plus / Minus Query: 374 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 433 ||||| || ||||| || |||||||||| |||||| | |||||||||||| || || || Sbjct: 843 acccaaaaaatccaatggtcatcccagggcttgtcttcgttgtagatgacagcagctcca 784 Query: 434 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 493 | |||||| || ||||||||||| || |||||||| ||||||||||| ||||| |||||| Sbjct: 783 aagctcctagcagggttgatgccagttccggtgatggggatggtggcaaggtgaaccatg 724 Query: 494 aacacggcgaagccgatcgggaggggcgccaacaccgggacgtgagagtcgcgtgcgctg 553 ||||| || || ||||| || || || ||||| || ||||| || ||||| | || | Sbjct: 723 aacacagcaaatccgatgggaagtggagccaagacagggacatgggagtctctggcattc 664 Query: 554 cgcttggggtcggtggcggagaagacggtgtagac 588 | ||| || || ||||| ||||||||||||||||| Sbjct: 663 ctcttaggatcagtggctgagaagacggtgtagac 629 Score = 40.1 bits (20), Expect = 9.1 Identities = 35/40 (87%) Strand = Plus / Minus Query: 302 gccttgatggcgccggccctgagtatgtactggtggtaga 341 ||||||||||| || ||||| || ||||| |||||||||| Sbjct: 915 gccttgatggctcctgcccttaggatgtattggtggtaga 876
>gb|AF314656.1|AF314656 Brassica oleracea aquaporin (PIP3) mRNA, complete cds Length = 909 Score = 101 bits (51), Expect = 3e-18 Identities = 192/239 (80%) Strand = Plus / Minus Query: 374 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 433 |||||||||||||| || |||||||| ||||| || ||||||||||| || || || || Sbjct: 740 acccagaagatccaatggtcatcccacgccttctcgttgttgtagataacagcagcacca 681 Query: 434 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 493 | ||| || || ||||| || || || ||||| || ||||| || |||| || |||||| Sbjct: 680 aagcttctcgctgggttaattccagttccggtaatggggatagtagccaaatgcaccatg 621 Query: 494 aacacggcgaagccgatcgggaggggcgccaacaccgggacgtgagagtcgcgtgcgctg 553 ||||| ||||| || || || || || ||||| || |||| ||||||||| || ||||| Sbjct: 620 aacacagcgaatccaattggaagtggagccaaaacagggatgtgagagtcacgagcgctt 561 Query: 554 cgcttggggtcggtggcggagaagacggtgtagacgagcacgaaggtgccgatgatctc 612 | ||| ||||| || ||||||||||||||||| ||||| ||||| || || |||||||| Sbjct: 560 ctcttagggtcagtcgcggagaagacggtgtaaacgaggacgaaagttccaatgatctc 502
>gb|AF118382.1|AF118382 Brassica napus plasma membrane intrinsic protein 1 (PIP1) mRNA, complete cds Length = 1093 Score = 101 bits (51), Expect = 3e-18 Identities = 156/191 (81%) Strand = Plus / Minus Query: 437 ctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatgaac 496 ||||| ||||||||||| || || || ||||| || ||||| |||| ||| ||||||||| Sbjct: 705 ctccttgccgggttgattccagttccagtgatgggaatggtagccaagtgcaccatgaac 646 Query: 497 acggcgaagccgatcgggaggggcgccaacaccgggacgtgagagtcgcgtgcgctgcgc 556 || || || || || || || ||||||||||| |||||||| ||||| | || || || Sbjct: 645 accgcaaatccaatgggaagtggcgccaacactgggacgtgggagtctctggcactacgt 586 Query: 557 ttggggtcggtggcggagaagacggtgtagacgagcacgaaggtgccgatgatctccgcg 616 || ||||| ||||||||||||||||||||||| || ||||| || || |||||||| ||| Sbjct: 585 ttagggtcagtggcggagaagacggtgtagacaagaacgaaagtaccaatgatctctgcg 526 Query: 617 gcgaggccggt 627 || || ||||| Sbjct: 525 gctagtccggt 515
>emb|BX819407.1|CNS0A8TU Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB75ZE10 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1128 Score = 99.6 bits (50), Expect = 1e-17 Identities = 110/130 (84%) Strand = Plus / Minus Query: 371 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcc 430 ||||||||||||||||||||||||||||| ||||| | ||||||||||||||||| || Sbjct: 819 ccgacccagaagatccactgatcatcccaagccttttgattgttgtagatgacggcagct 760 Query: 431 cccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggacc 490 || | ||||| |||||||| || |||||||| ||||| || || ||||| | || ||| Sbjct: 759 ccaaaactcctagccgggtttattccggtgccagtgattggaattgtggctaaatgaacc 700 Query: 491 atgaacacgg 500 |||||||||| Sbjct: 699 atgaacacgg 690 Score = 61.9 bits (31), Expect = 2e-06 Identities = 43/47 (91%) Strand = Plus / Minus Query: 560 gggtcggtggcggagaagacggtgtagacgagcacgaaggtgccgat 606 |||||||| ||||||||||||||||||||||| || || |||||||| Sbjct: 630 gggtcggtagcggagaagacggtgtagacgaggacaaaagtgccgat 584
>gb|U87981.1|SBU87981 Sorghum bicolor membrane intrinsic protein (Mip1) mRNA, partial cds Length = 539 Score = 99.6 bits (50), Expect = 1e-17 Identities = 116/138 (84%) Strand = Plus / Minus Query: 367 ggggccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggc 426 ||||||||||||||||||||| || || |||||| | ||| |||||||||||| ||| Sbjct: 280 ggggccgacccagaagatccaatggtcgctccaggcatgatccctgttgtagatgatggc 221 Query: 427 ggcccccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtg 486 || || |||||||| || ||||||||||| ||||| || || ||||||||||| ||||| Sbjct: 220 agcgccaaggctcctagctgggttgatgccagtgccagtaatggggatggtggcaaggtg 161 Query: 487 gaccatgaacacggcgaa 504 ||||| |||||| ||||| Sbjct: 160 gaccaggaacaccgcgaa 143 Score = 46.1 bits (23), Expect = 0.15 Identities = 41/47 (87%) Strand = Plus / Minus Query: 566 gtggcggagaagacggtgtagacgagcacgaaggtgccgatgatctc 612 ||||| ||||||||||||||||| || | ||||||||| | |||||| Sbjct: 81 gtggccgagaagacggtgtagaccaggatgaaggtgccaacgatctc 35
>gb|AY189974.1| Juglans regia plasma intrinsic protein 2,2 mRNA, complete cds Length = 1278 Score = 97.6 bits (49), Expect = 4e-17 Identities = 232/293 (79%) Strand = Plus / Minus Query: 326 atgtactggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatc 385 ||||||||||| ||||| || || || || || || || | ||| ||||||||||| ||| Sbjct: 937 atgtactggtgatagaatgcagctattgcggcaccaatgaagggtccgacccagaaaatc 878 Query: 386 cactgatcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggcc 445 || || |||||||| ||||| |||||| ||||| || || || || | ||| | ||| Sbjct: 877 cattggtcatcccatgccttatccttgccatagatcacagcagctccgaagcttcgagcc 818 Query: 446 gggttgatgccggtgccggtgatcgggatggtggccaggtggaccatgaacacggcgaag 505 || || || || || |||||||| || |||||||||||||| |||||||||||||| || Sbjct: 817 ggattaataccagttccggtgattggaatggtggccaggtgaaccatgaacacggcaaat 758 Query: 506 ccgatcgggaggggcgccaacaccgggacgtgagagtcgcgtgcgctgcgcttggggtcg 565 ||||| || || || ||||| || || || || || || | || | | |||||| ||| Sbjct: 757 ccgattggaagtggtgccaatacaggaacatgggaatctctggcatttctcttgggatcg 698 Query: 566 gtggcggagaagacggtgtagacgagcacgaaggtgccgatgatctccgcggc 618 ||||| ||||||||||||||||| || || ||||||||||||||||| ||||| Sbjct: 697 gtggcagagaagacggtgtagacaaggacaaaggtgccgatgatctcagcggc 645
>emb|AJ001293.1|CPPIPB Craterostigma plantagineum mRNA for major intrinsic protein PIPb Length = 1179 Score = 97.6 bits (49), Expect = 4e-17 Identities = 211/265 (79%) Strand = Plus / Minus Query: 371 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcc 430 ||||||||||| | ||| || |||||||| || | || |||||||| |||| ||| || Sbjct: 843 ccgacccagaaaacccagtggtcatcccaagcatgatctttgttgtaaatgatggctgca 784 Query: 431 cccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggacc 490 || || || | ||| ||||||||||| || || |||||||| ||||| ||||||||||| Sbjct: 783 ccaagactacgggcggggttgatgcccgtcccagtgatcggaatggtcgccaggtggact 724 Query: 491 atgaacacggcgaagccgatcgggaggggcgccaacaccgggacgtgagagtcgcgtgcg 550 | |||||||||||| ||||| || || || || | | ||||| |||||||| | ||| Sbjct: 723 aagaacacggcgaatccgatgggaagaggagcaagaattgggacatgagagtctctagcg 664 Query: 551 ctgcgcttggggtcggtggcggagaagacggtgtagacgagcacgaaggtgccgatgatc 610 || | ||||| || || || ||||||||||||||||| || || || |||||||||||| Sbjct: 663 cttctcttggcatcagtagcagagaagacggtgtagacaagtacaaaagtgccgatgatc 604 Query: 611 tccgcggcgaggccggtgcccttgg 635 || ||| | ||||||| |||||||| Sbjct: 603 tcagcgccaaggccggcgcccttgg 579
>gb|AY714380.1| Aegiceras corniculatum aquaporin 1 mRNA, partial cds Length = 534 Score = 97.6 bits (49), Expect = 4e-17 Identities = 94/109 (86%) Strand = Plus / Minus Query: 374 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 433 |||||||| ||||| || ||||||||||| | |||||||||||||||| ||||| || Sbjct: 458 acccagaatatccaatgttcatcccaggcttgatccttgttgtagatgattgcggcacca 399 Query: 434 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggcca 482 ||||||||||| |||||||| ||||| || ||||| ||||||||||||| Sbjct: 398 aggctcctggcggggttgataccggtacctgtgattgggatggtggcca 350
>gb|AY671949.1| Aegiceras corniculatum aquaporin 1 (PIP1) mRNA, complete cds Length = 867 Score = 97.6 bits (49), Expect = 4e-17 Identities = 94/109 (86%) Strand = Plus / Minus Query: 374 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 433 |||||||| ||||| || ||||||||||| | |||||||||||||||| ||||| || Sbjct: 788 acccagaatatccaatgttcatcccaggcttgatccttgttgtagatgattgcggcacca 729 Query: 434 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggcca 482 ||||||||||| |||||||| ||||| || ||||| ||||||||||||| Sbjct: 728 aggctcctggcggggttgataccggtacctgtgattgggatggtggcca 680
>gb|AF188843.1|AF188843 Vitis vinifera cultivar Pinot Noir plasma membrane aquaporin (PIP1a) mRNA, complete cds Length = 1129 Score = 97.6 bits (49), Expect = 4e-17 Identities = 106/125 (84%) Strand = Plus / Minus Query: 374 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 433 |||||||| |||||| ||||||||||| | || |||||||||||| |||||||||| Sbjct: 833 acccagaaaatccacatgtcatcccaggcatgctctctgttgtagatgatggcggccccc 774 Query: 434 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 493 || ||||| || |||||||||||||| |||||||| |||||||| ||||| || |||| | Sbjct: 773 agactcctagcagggttgatgccggttccggtgatggggatggttgccagatgaaccaag 714 Query: 494 aacac 498 ||||| Sbjct: 713 aacac 709
>gb|AF141898.1|AF141898 Vitis berlandieri x Vitis rupestris putative aquaporin PIP1-2 (PIP1-2) mRNA, complete cds Length = 1154 Score = 95.6 bits (48), Expect = 2e-16 Identities = 126/152 (82%) Strand = Plus / Minus Query: 374 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 433 |||||||| |||||| ||||||||||| | || |||||||||| || |||||||||| Sbjct: 841 acccagaaaatccacatgtcatcccaggcatgctctttgttgtagacgatggcggccccc 782 Query: 434 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 493 || ||||| || |||||||||||||| || ||||| |||||||| ||||| || |||| | Sbjct: 781 agactcctagcagggttgatgccggttccagtgatggggatggttgccagatgaaccaag 722 Query: 494 aacacggcgaagccgatcgggaggggcgccaa 525 ||||| || || || |||||||| || ||||| Sbjct: 721 aacactgcaaacccaatcgggagaggagccaa 690
>ref|NM_125459.2| Arabidopsis thaliana PIP2;4/PIP2F; water channel AT5G60660 (PIP2;4/PIP2F) mRNA, complete cds Length = 1139 Score = 93.7 bits (47), Expect = 7e-16 Identities = 182/227 (80%) Strand = Plus / Minus Query: 359 ccgatcatggggccgacccagaagatccactgatcatcccaggccttgtccttgttgtag 418 |||||||| || || ||||| || ||||| || || ||||||||||| || |||||||| Sbjct: 823 ccgatcatcggtccaacccaaaaaatccattggtcgtcccaggccttttcgttgttgtaa 764 Query: 419 atgacggcggcccccaggctcctggccgggttgatgccggtgccggtgatcgggatggtg 478 || ||||| || || | ||| | ||||||||||| ||||| |||||||| || |||||| Sbjct: 763 ataacggcagctccaaagctacgagccgggttgataccggttccggtgatgggaatggtg 704 Query: 479 gccaggtggaccatgaacacggcgaagccgatcgggaggggcgccaacaccgggacgtga 538 || | || |||||||| ||||| ||||| || || || || ||||| || || |||||| Sbjct: 703 gctaaatgaaccatgaagacggcaaagccaatgggaagtggagccaaaactggcacgtga 644 Query: 539 gagtcgcgtgcgctgcgcttggggtcggtggcggagaagacggtgta 585 ||||| || || | |||||||| ||||| || |||||||||||||| Sbjct: 643 gagtcacgagcatttcgcttgggatcggttgccgagaagacggtgta 597
>gb|BT013307.1| Lycopersicon esculentum clone 134975R, mRNA sequence Length = 1260 Score = 93.7 bits (47), Expect = 7e-16 Identities = 119/143 (83%) Strand = Plus / Minus Query: 437 ctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatgaac 496 ||||| ||||||||||| ||||| ||||||||||| || ||||| ||||| |||||||| Sbjct: 791 ctcctcgccgggttgattccggtaccggtgatcggaatagtggcaaggtgaaccatgaat 732 Query: 497 acggcgaagccgatcgggaggggcgccaacaccgggacgtgagagtcgcgtgcgctgcgc 556 ||||| || || || ||||| || ||||| || ||||| |||||||| | ||||| || Sbjct: 731 acggcaaatccaatggggagtggggccaagacagggacatgagagtctctggcgcttcgt 672 Query: 557 ttggggtcggtggcggagaagac 579 || ||||||||||| |||||||| Sbjct: 671 ttagggtcggtggcagagaagac 649
>emb|AJ849324.1| Populus tremula x Populus tremuloides mRNA for putative plasma membrane intrinsic protein (pip2.1 gene) Length = 1295 Score = 93.7 bits (47), Expect = 7e-16 Identities = 191/239 (79%) Strand = Plus / Minus Query: 374 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 433 |||||||| ||||| |||||||||||||| || | | |||| |||||| || || || Sbjct: 780 acccagaaaatccaatgatcatcccaggctttcttatcgttgatgatgacagcagcacca 721 Query: 434 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 493 | |||||| || ||||| ||||| || || || || ||||| ||||| |||||||||||| Sbjct: 720 aagctcctagcagggttaatgccagtaccagtaatagggattgtggctaggtggaccatg 661 Query: 494 aacacggcgaagccgatcgggaggggcgccaacaccgggacgtgagagtcgcgtgcgctg 553 ||||| || || || || || ||||| ||||| || |||| |||||||| ||||| || Sbjct: 660 aacacagcaaacccaattggaaggggagccaagacagggatatgagagtcacgtgcactt 601 Query: 554 cgcttggggtcggtggcggagaagacggtgtagacgagcacgaaggtgccgatgatctc 612 | ||||||||| || || |||||||| |||| || ||||| || |||||||||||||| Sbjct: 600 ctcttggggtcagttgcagagaagacagtgtttacaagcacaaaagtgccgatgatctc 542
>gb|AY087245.1| Arabidopsis thaliana clone 33231 mRNA, complete sequence Length = 1120 Score = 93.7 bits (47), Expect = 7e-16 Identities = 182/227 (80%) Strand = Plus / Minus Query: 359 ccgatcatggggccgacccagaagatccactgatcatcccaggccttgtccttgttgtag 418 |||||||| || || ||||| || ||||| || || ||||||||||| || |||||||| Sbjct: 823 ccgatcatcggtccaacccaaaaaatccattggtcgtcccaggccttttcgttgttgtaa 764 Query: 419 atgacggcggcccccaggctcctggccgggttgatgccggtgccggtgatcgggatggtg 478 || ||||| || || | ||| | ||||||||||| ||||| |||||||| || |||||| Sbjct: 763 ataacggcagctccaaagctacgagccgggttgataccggttccggtgatgggaatggtg 704 Query: 479 gccaggtggaccatgaacacggcgaagccgatcgggaggggcgccaacaccgggacgtga 538 || | || |||||||| ||||| ||||| || || || || ||||| || || |||||| Sbjct: 703 gctaaatgaaccatgaagacggcaaagccaatgggaagtggagccaaaactggcacgtga 644 Query: 539 gagtcgcgtgcgctgcgcttggggtcggtggcggagaagacggtgta 585 ||||| || || | |||||||| ||||| || |||||||||||||| Sbjct: 643 gagtcacgagcatttcgcttgggatcggttgccgagaagacggtgta 597
>dbj|AB002149.1| Nicotiana excelsior mRNA for water channel protein, complete cds Length = 1064 Score = 93.7 bits (47), Expect = 7e-16 Identities = 110/131 (83%) Strand = Plus / Minus Query: 374 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 433 |||||||||||||| ||||||||||| |||| ||| | |||| |||||| || || || Sbjct: 815 acccagaagatccagtgatcatcccatgcctggtcgtggttgaagatgatagcagctcca 756 Query: 434 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 493 ||||||| ||| |||||||||||||| || ||||| ||||||||||||| || |||| | Sbjct: 755 aggctccgggcggggttgatgccggttccagtgatagggatggtggccaaatgaaccaag 696 Query: 494 aacacggcgaa 504 ||||| ||||| Sbjct: 695 aacaccgcgaa 685
>dbj|AB206098.1| Mimosa pudica pip1;1 mRNA for plasma membrane intrinsic protein 1;1, complete cds Length = 1096 Score = 91.7 bits (46), Expect = 3e-15 Identities = 130/158 (82%) Strand = Plus / Minus Query: 446 gggttgatgccggtgccggtgatcgggatggtggccaggtggaccatgaacacggcgaag 505 |||||||| ||||| |||||||| |||||||| |||| ||| |||| ||||| ||||| Sbjct: 792 gggttgataccggttccggtgattgggatggtagccaagtgaaccaaaaacacagcgaac 733 Query: 506 ccgatcgggaggggcgccaacaccgggacgtgagagtcgcgtgcgctgcgcttggggtcg 565 || || || | || ||||| | |||||||| ||||| || ||||| ||||||| ||| Sbjct: 732 ccaataggcaatggtgccaaaatggggacgtgggagtcacgggcgctacgcttggcatcg 673 Query: 566 gtggcggagaagacggtgtagacgagcacgaaggtgcc 603 ||||||||||||||||||||||| || | ||||||||| Sbjct: 672 gtggcggagaagacggtgtagacaaggatgaaggtgcc 635
>emb|Y18312.1|STU18312 Solanum tuberosum mRNA for major intrinsic protein 2 Length = 1214 Score = 89.7 bits (45), Expect = 1e-14 Identities = 168/209 (80%) Strand = Plus / Minus Query: 371 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcc 430 ||||||||||| ||||| || || ||||| |||||||| |||| | || ||||| ||| Sbjct: 794 ccgacccagaaaatccagtgttcgtcccatgccttgtcgccgttgaaaatcacggccgcc 735 Query: 431 cccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggacc 490 || | ||||| ||||||||||| ||||| |||||||| || || ||||| ||||| ||| Sbjct: 734 ccgaaactcctcgccgggttgattccggtaccggtgattggaatagtggcaaggtgaacc 675 Query: 491 atgaacacggcgaagccgatcgggaggggcgccaacaccgggacgtgagagtcgcgtgcg 550 ||||| |||||||| || || || || || ||||| || || || |||||||| | ||| Sbjct: 674 atgaatacggcgaatccaatgggaagtggggccaagacaggaacatgagagtctctggcg 615 Query: 551 ctgcgcttggggtcggtggcggagaagac 579 || | |||||||||||||| |||||||| Sbjct: 614 cttcttttggggtcggtggcagagaagac 586
>dbj|AB218716.1| Prunus mume Pm3 mRNA for aquaporin, complete cds Length = 1278 Score = 89.7 bits (45), Expect = 1e-14 Identities = 189/237 (79%) Strand = Plus / Minus Query: 376 ccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcccccag 435 |||||||||||| || |||||||| || ||||||||||||||||| || || || || | Sbjct: 768 ccagaagatccattggtcatcccaagctttgtccttgttgtagatcacagcagctccaaa 709 Query: 436 gctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatgaa 495 || || || |||||||| || || || ||||| ||||||||||||||||| || ||||| Sbjct: 708 acttctagcagggttgataccagttccagtgattgggatggtggccaggtgaacgatgaa 649 Query: 496 cacggcgaagccgatcgggaggggcgccaacaccgggacgtgagagtcgcgtgcgctgcg 555 || || || || || || || || ||||| || ||||| || ||||| | ||| | | Sbjct: 648 aacagcaaatccaatgggaagtggtgccaagacagggacatgggagtctctggcgtttct 589 Query: 556 cttggggtcggtggcggagaagacggtgtagacgagcacgaaggtgccgatgatctc 612 ||||||||| ||||| |||||||| |||||||| || || ||||| || |||||||| Sbjct: 588 cttggggtcagtggcagagaagacagtgtagacaagaacaaaggtaccaatgatctc 532
>emb|AJ249384.1|SOL249384 Spinacia oleracea mRNA for PM28B protein (pm28b gene) Length = 913 Score = 87.7 bits (44), Expect = 4e-14 Identities = 125/152 (82%) Strand = Plus / Minus Query: 374 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 433 |||||||| ||||| |||| |||||| || | |||||||||| |||| | || || ||| Sbjct: 809 acccagaaaatccaatgatgatcccaagcatggtccttgttgaagataatagcagcaccc 750 Query: 434 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 493 || |||||||| |||||||| ||||| || ||||| ||||||||||||| ||| |||| | Sbjct: 749 agactcctggctgggttgattccggtacctgtgatggggatggtggccaagtgaaccagg 690 Query: 494 aacacggcgaagccgatcgggaggggcgccaa 525 ||||| || || ||||| || || |||||||| Sbjct: 689 aacaccgcaaatccgataggcagtggcgccaa 658
>gb|DQ445128.1| Striga asiatica isolate St489 major intrinsic protein 1-like protein mRNA, partial cds Length = 474 Score = 87.7 bits (44), Expect = 4e-14 Identities = 143/176 (81%) Strand = Plus / Minus Query: 434 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 493 ||||||||||| ||||||||||| ||||||||||| || |||||||||| || |||| | Sbjct: 380 aggctcctggcagggttgatgccagtgccggtgataggtatggtggccaaatgaaccaag 321 Query: 494 aacacggcgaagccgatcgggaggggcgccaacaccgggacgtgagagtcgcgtgcgctg 553 || || || || || || || || || ||||| | ||||| |||||||| | |||||| Sbjct: 320 aagacagcaaacccaattggaagaggagccaaaatggggacatgagagtctcttgcgctt 261 Query: 554 cgcttggggtcggtggcggagaagacggtgtagacgagcacgaaggtgccgatgat 609 | ||||| ||||| || ||||||||||||||||| || || |||||||| ||||| Sbjct: 260 ctcttggcatcggtagccgagaagacggtgtagacaagaacaaaggtgccaatgat 205
>ref|NM_202760.1| Arabidopsis thaliana TMP-C AT4G00430 (TMP-C) transcript variant AT4G00430.2 mRNA, complete cds Length = 1367 Score = 85.7 bits (43), Expect = 2e-13 Identities = 73/83 (87%) Strand = Plus / Minus Query: 527 accgggacgtgagagtcgcgtgcgctgcgcttggggtcggtggcggagaagacggtgtag 586 ||||||||||| ||||| || ||||| | ||||| |||||||||||||||||| |||||| Sbjct: 715 accgggacgtgtgagtcacgggcgcttctcttggcgtcggtggcggagaagacagtgtag 656 Query: 587 acgagcacgaaggtgccgatgat 609 ||||| ||||| || |||||||| Sbjct: 655 acgagaacgaatgttccgatgat 633 Score = 71.9 bits (36), Expect = 3e-09 Identities = 123/152 (80%) Strand = Plus / Minus Query: 374 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 433 |||||||| ||||| || |||||||| | | ||||||||||||||| | ||||| || Sbjct: 996 acccagaaaatccaatggtcatcccaagagtggtccttgttgtagataattgcggctcca 937 Query: 434 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 493 || || || || |||||||| ||||| ||||||||||| || || |||| ||| |||| | Sbjct: 936 agacttctagctgggttgattccggtcccggtgatcggtattgttgccaagtgtaccaag 877 Query: 494 aacacggcgaagccgatcgggaggggcgccaa 525 ||||| || || ||||| ||||| |||||||| Sbjct: 876 aacactgcaaatccgattgggagcggcgccaa 845
>gb|DQ228330.1| Solanum tuberosum clone 137E08 major intrinsic protein 1-like protein mRNA, complete cds Length = 1086 Score = 85.7 bits (43), Expect = 2e-13 Identities = 109/131 (83%) Strand = Plus / Minus Query: 374 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 433 |||||||| ||||| || |||||||| |||| ||| ||||||||||||| || || || Sbjct: 815 acccagaaaatccagtggtcatcccatgcctcgtctttgttgtagatgatagcagctcca 756 Query: 434 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 493 || |||||||| |||||||| || || |||||||| ||||||||||||| || |||| | Sbjct: 755 agactcctggcagggttgataccagttccggtgattgggatggtggccaaatgaaccaag 696 Query: 494 aacacggcgaa 504 ||||| ||||| Sbjct: 695 aacaccgcgaa 685
>emb|AL161471.2|ATCHRIV1 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 1 Length = 197119 Score = 85.7 bits (43), Expect = 2e-13 Identities = 73/83 (87%) Strand = Plus / Plus Query: 527 accgggacgtgagagtcgcgtgcgctgcgcttggggtcggtggcggagaagacggtgtag 586 ||||||||||| ||||| || ||||| | ||||| |||||||||||||||||| |||||| Sbjct: 185600 accgggacgtgtgagtcacgggcgcttctcttggcgtcggtggcggagaagacagtgtag 185659 Query: 587 acgagcacgaaggtgccgatgat 609 ||||| ||||| || |||||||| Sbjct: 185660 acgagaacgaatgttccgatgat 185682 Score = 63.9 bits (32), Expect = 6e-07 Identities = 98/120 (81%) Strand = Plus / Plus Query: 406 gtccttgttgtagatgacggcggcccccaggctcctggccgggttgatgccggtgccggt 465 ||||||||||||||| | ||||| || || || || || |||||||| ||||| ||||| Sbjct: 185351 gtccttgttgtagataattgcggctccaagacttctagctgggttgattccggtcccggt 185410 Query: 466 gatcgggatggtggccaggtggaccatgaacacggcgaagccgatcgggaggggcgccaa 525 |||||| || || |||| ||| |||| |||||| || || ||||| ||||| |||||||| Sbjct: 185411 gatcggtattgttgccaagtgtaccaagaacactgcaaatccgattgggagcggcgccaa 185470
>gb|AF299050.1|AF299050 Brassica oleracea aquaporin PIP1b1 mRNA, complete cds Length = 1084 Score = 85.7 bits (43), Expect = 2e-13 Identities = 190/239 (79%) Strand = Plus / Minus Query: 374 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 433 |||||||||| ||| || |||||||| || |||||||||||| |||||| ||| || || Sbjct: 815 acccagaagacccaatggtcatcccaagcgttgtccttgttgaagatgatggcagcacca 756 Query: 434 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 493 || || || || |||||||| || || || ||||| |||||||| |||| |||||||| | Sbjct: 755 agacttcttgctgggttgattccagttccagtgatggggatggttgccaagtggaccaag 696 Query: 494 aacacggcgaagccgatcgggaggggcgccaacaccgggacgtgagagtcgcgtgcgctg 553 ||||| ||||| || || ||||| || || | | ||| || |||||||| || ||| | Sbjct: 695 aacacagcgaatccaatagggagaggtgcaagaatcggaacatgagagtcacgagcgttt 636 Query: 554 cgcttggggtcggtggcggagaagacggtgtagacgagcacgaaggtgccgatgatctc 612 | ||| | || || ||||||||||||||||| ||||| || ||||| || |||||||| Sbjct: 635 ctcttagcatcagtagcggagaagacggtgtaaacgaggacaaaggttccaatgatctc 577
>emb|BX827573.1|CNS0A3MW Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS77ZD01 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1155 Score = 85.7 bits (43), Expect = 2e-13 Identities = 73/83 (87%) Strand = Plus / Minus Query: 527 accgggacgtgagagtcgcgtgcgctgcgcttggggtcggtggcggagaagacggtgtag 586 ||||||||||| ||||| || ||||| | ||||| |||||||||||||||||| |||||| Sbjct: 693 accgggacgtgtgagtcacgggcgcttctcttggcgtcggtggcggagaagacagtgtag 634 Query: 587 acgagcacgaaggtgccgatgat 609 ||||| ||||| || |||||||| Sbjct: 633 acgagaacgaatgttccgatgat 611 Score = 71.9 bits (36), Expect = 3e-09 Identities = 123/152 (80%) Strand = Plus / Minus Query: 374 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 433 |||||||| ||||| || |||||||| | | ||||||||||||||| | ||||| || Sbjct: 975 acccagaaaatccaatggtcatcccaagagtggtccttgttgtagataattgcggctcca 916 Query: 434 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 493 || || || || |||||||| ||||| ||||||||||| || || |||| ||| |||| | Sbjct: 915 agacttctagctgggttgattccggtcccggtgatcggtattgttgccaagtgtaccaag 856 Query: 494 aacacggcgaagccgatcgggaggggcgccaa 525 ||||| || || ||||| ||||| |||||||| Sbjct: 855 aacactgcaaatccgattgggagcggcgccaa 824
>dbj|AB005246.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MUP24 Length = 77999 Score = 85.7 bits (43), Expect = 2e-13 Identities = 154/191 (80%) Strand = Plus / Plus Query: 395 tcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttgatg 454 ||||||||||| || |||||||| || ||||| || || | ||| | ||||||||||| Sbjct: 19109 tcccaggccttttcgttgttgtaaataacggcagctccaaagctacgagccgggttgata 19168 Query: 455 ccggtgccggtgatcgggatggtggccaggtggaccatgaacacggcgaagccgatcggg 514 ||||| |||||||| || |||||||| | || |||||||| ||||| ||||| || || Sbjct: 19169 ccggttccggtgatgggaatggtggctaaatgaaccatgaagacggcaaagccaatggga 19228 Query: 515 aggggcgccaacaccgggacgtgagagtcgcgtgcgctgcgcttggggtcggtggcggag 574 || || ||||| || || ||||||||||| || || | |||||||| ||||| || ||| Sbjct: 19229 agtggagccaaaactggcacgtgagagtcacgagcatttcgcttgggatcggttgccgag 19288 Query: 575 aagacggtgta 585 ||||||||||| Sbjct: 19289 aagacggtgta 19299
>gb|AF195115.1|F5I10 Arabidopsis thaliana BAC F5I10 Length = 111906 Score = 85.7 bits (43), Expect = 2e-13 Identities = 73/83 (87%) Strand = Plus / Plus Query: 527 accgggacgtgagagtcgcgtgcgctgcgcttggggtcggtggcggagaagacggtgtag 586 ||||||||||| ||||| || ||||| | ||||| |||||||||||||||||| |||||| Sbjct: 86119 accgggacgtgtgagtcacgggcgcttctcttggcgtcggtggcggagaagacagtgtag 86178 Query: 587 acgagcacgaaggtgccgatgat 609 ||||| ||||| || |||||||| Sbjct: 86179 acgagaacgaatgttccgatgat 86201 Score = 63.9 bits (32), Expect = 6e-07 Identities = 98/120 (81%) Strand = Plus / Plus Query: 406 gtccttgttgtagatgacggcggcccccaggctcctggccgggttgatgccggtgccggt 465 ||||||||||||||| | ||||| || || || || || |||||||| ||||| ||||| Sbjct: 85870 gtccttgttgtagataattgcggctccaagacttctagctgggttgattccggtcccggt 85929 Query: 466 gatcgggatggtggccaggtggaccatgaacacggcgaagccgatcgggaggggcgccaa 525 |||||| || || |||| ||| |||| |||||| || || ||||| ||||| |||||||| Sbjct: 85930 gatcggtattgttgccaagtgtaccaagaacactgcaaatccgattgggagcggcgccaa 85989
>gb|DQ294260.1| Solanum tuberosum clone 108A04 major intrinsic protein 1-like protein mRNA, complete cds Length = 1153 Score = 85.7 bits (43), Expect = 2e-13 Identities = 109/131 (83%) Strand = Plus / Minus Query: 374 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 433 |||||||||||||| || |||| ||| |||| ||| ||||||||||||| || || || Sbjct: 825 acccagaagatccagtggtcattccatgcctcgtctttgttgtagatgatagcagctcca 766 Query: 434 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 493 || |||||||| |||||||| || || |||||||| ||||||||||||| || |||| | Sbjct: 765 agactcctggcagggttgataccagttccggtgattgggatggtggccaaatgaaccaag 706 Query: 494 aacacggcgaa 504 ||||| ||||| Sbjct: 705 aacaccgcgaa 695
>gb|AF013293.1|IG005I10 Arabidopsis thaliana BAC IG005I10 Length = 111906 Score = 85.7 bits (43), Expect = 2e-13 Identities = 73/83 (87%) Strand = Plus / Minus Query: 527 accgggacgtgagagtcgcgtgcgctgcgcttggggtcggtggcggagaagacggtgtag 586 ||||||||||| ||||| || ||||| | ||||| |||||||||||||||||| |||||| Sbjct: 25788 accgggacgtgtgagtcacgggcgcttctcttggcgtcggtggcggagaagacagtgtag 25729 Query: 587 acgagcacgaaggtgccgatgat 609 ||||| ||||| || |||||||| Sbjct: 25728 acgagaacgaatgttccgatgat 25706 Score = 63.9 bits (32), Expect = 6e-07 Identities = 98/120 (81%) Strand = Plus / Minus Query: 406 gtccttgttgtagatgacggcggcccccaggctcctggccgggttgatgccggtgccggt 465 ||||||||||||||| | ||||| || || || || || |||||||| ||||| ||||| Sbjct: 26037 gtccttgttgtagataattgcggctccaagacttctagctgggttgattccggtcccggt 25978 Query: 466 gatcgggatggtggccaggtggaccatgaacacggcgaagccgatcgggaggggcgccaa 525 |||||| || || |||| ||| |||| |||||| || || ||||| ||||| |||||||| Sbjct: 25977 gatcggtattgttgccaagtgtaccaagaacactgcaaatccgattgggagcggcgccaa 25918
>emb|AJ849326.1| Populus tremula x Populus tremuloides mRNA for putative plasma membrane intrinsic protein (pip2.3 gene) Length = 1187 Score = 83.8 bits (42), Expect = 7e-13 Identities = 102/122 (83%) Strand = Plus / Minus Query: 374 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 433 |||||||| ||||| || |||||||| ||||| |||||||||||||| || || || || Sbjct: 800 acccagaaaatccagtggtcatcccatgccttttccttgttgtagatcaccgcagctccg 741 Query: 434 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 493 | |||||| || |||||||| || || |||||||| || |||||||||| ||| |||||| Sbjct: 740 aagctcctagcagggttgataccagtaccggtgattggaatggtggccaagtgaaccatg 681 Query: 494 aa 495 || Sbjct: 680 aa 679
>emb|AJ299449.1|PTR299449 Populus tremula x Populus tremuloides mRNA for major intrinsic protein 1 (mip1 gene) Length = 1187 Score = 83.8 bits (42), Expect = 7e-13 Identities = 102/122 (83%) Strand = Plus / Minus Query: 374 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 433 |||||||| ||||| || |||||||| ||||| |||||||||||||| || || || || Sbjct: 800 acccagaaaatccagtggtcatcccatgccttttccttgttgtagatcaccgcagctccg 741 Query: 434 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 493 | |||||| || |||||||| || || |||||||| || |||||||||| ||| |||||| Sbjct: 740 aagctcctagcagggttgataccagtaccggtgattggaatggtggccaagtgaaccatg 681 Query: 494 aa 495 || Sbjct: 680 aa 679
>gb|AF452014.1|AF452014 Petunia x hybrida aquaporin-like protein (PIP2;3) mRNA, complete cds Length = 1279 Score = 83.8 bits (42), Expect = 7e-13 Identities = 138/170 (81%) Strand = Plus / Minus Query: 374 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 433 ||||| |||||||| || || | ||| || ||||| | |||| |||| ||||| || || Sbjct: 797 acccaaaagatccaatggtctttccaagctttgtcttggttgaagataacggcagctcca 738 Query: 434 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 493 || ||||| || |||||||||||||||||||| ||||| |||||||| | ||| |||||| Sbjct: 737 agactccttgctgggttgatgccggtgccggtaatcggaatggtggctaagtgaaccatg 678 Query: 494 aacacggcgaagccgatcgggaggggcgccaacaccgggacgtgagagtc 543 ||||| || || || || || || || |||||||| ||||| |||||||| Sbjct: 677 aacactgcaaatccaattggaagtggtgccaacacagggacatgagagtc 628
>gb|L77969.2|SPIAQUA Spinacia oleracea aquaporin mRNA, complete cds Length = 1101 Score = 83.8 bits (42), Expect = 7e-13 Identities = 192/242 (79%) Strand = Plus / Minus Query: 371 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcc 430 ||||||||||| ||||| || |||||||| |||||| ||||| |||| || || || Sbjct: 797 ccgacccagaatatccattggtcatcccaaaccttgttgctgttgaagataacagcagcg 738 Query: 431 cccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggacc 490 || | ||| || || |||||||| || ||||| ||||| || || ||||||| ||| ||| Sbjct: 737 ccaaagcttctagcagggttgataccagtgccagtgatgggaatagtggccaagtgaacc 678 Query: 491 atgaacacggcgaagccgatcgggaggggcgccaacaccgggacgtgagagtcgcgtgcg 550 |||||||| || || || || || || || ||||| | || ||||||||||| |||||| Sbjct: 677 atgaacacagcaaaaccaatgggaagtggggccaagataggcacgtgagagtcacgtgcg 618 Query: 551 ctgcgcttggggtcggtggcggagaagacggtgtagacgagcacgaaggtgccgatgatc 610 || | ||| ||||| || || |||||||||||||| || || || ||||||||||| ||| Sbjct: 617 ctcctcttagggtcagtagcagagaagacggtgtacacaagaacaaaggtgccgataatc 558 Query: 611 tc 612 || Sbjct: 557 tc 556
>ref|NM_118469.2| Arabidopsis thaliana PIP1;5/PIP1D; water channel AT4G23400 (PIP1;5/PIP1D) mRNA, complete cds Length = 1128 Score = 81.8 bits (41), Expect = 3e-12 Identities = 101/121 (83%) Strand = Plus / Minus Query: 371 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcc 430 ||||||||||||||||| || |||||||| || | |||||||||||||||| ||| || Sbjct: 834 ccgacccagaagatccaatggtcatcccaagcatgatccttgttgtagatgatggcagct 775 Query: 431 cccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggacc 490 || || |||||||||||||| ||||| || || || || |||||||| |||| ||| ||| Sbjct: 774 ccgagactcctggccgggttaatgccagttccagtaattgggatggtagccaagtgcacc 715 Query: 491 a 491 | Sbjct: 714 a 714
>gb|DQ202708.1| Olea europaea plasma membrane intrinsic protein (pip1) mRNA, complete cds Length = 1152 Score = 81.8 bits (41), Expect = 3e-12 Identities = 104/125 (83%) Strand = Plus / Minus Query: 374 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 433 |||||||| ||||| ||||||||||| |||||||| ||||||||||||| || || || Sbjct: 799 acccagaatatccagtgatcatcccatgccttgtctttgttgtagatgattgctgcacca 740 Query: 434 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 493 || |||||||| ||||| || || || ||||| || |||||||| |||| ||| |||| | Sbjct: 739 agactcctggcggggttaatacctgtaccggtaatagggatggttgccaagtgcaccaag 680 Query: 494 aacac 498 ||||| Sbjct: 679 aacac 675
>gb|AY189973.1| Juglans regia plasma intrinsic protein 2,1 mRNA, complete cds Length = 1278 Score = 81.8 bits (41), Expect = 3e-12 Identities = 194/245 (79%) Strand = Plus / Minus Query: 374 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 433 |||||||| ||||| || |||| ||| |||||||||||| ||||||||| || || || Sbjct: 838 acccagaaaatccattggtcattccatgccttgtccttgccgtagatgacagcagctccg 779 Query: 434 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 493 | ||| | ||||| ||||| || || |||||||| || ||||| ||||| || ||||| Sbjct: 778 aagcttcgagccggattgataccagttccggtgattggaatggtagccagatgaaccata 719 Query: 494 aacacggcgaagccgatcgggaggggcgccaacaccgggacgtgagagtcgcgtgcgctg 553 ||||| || || ||||| || || || ||||| || || || || || || | || | Sbjct: 718 aacacagcaaacccgattggaagtggtgccaagacaggtacatgggaatctctggcattt 659 Query: 554 cgcttggggtcggtggcggagaagacggtgtagacgagcacgaaggtgccgatgatctcc 613 | |||||| |||||||| ||||||||||||||||| || || ||||||||||||||||| Sbjct: 658 ctcttgggatcggtggcagagaagacggtgtagacaaggacaaaggtgccgatgatctca 599 Query: 614 gcggc 618 ||||| Sbjct: 598 gcggc 594
>gb|AY081593.1| Arabidopsis thaliana water channel-like protein (At4g23400) mRNA, complete cds Length = 956 Score = 81.8 bits (41), Expect = 3e-12 Identities = 101/121 (83%) Strand = Plus / Minus Query: 371 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcc 430 ||||||||||||||||| || |||||||| || | |||||||||||||||| ||| || Sbjct: 785 ccgacccagaagatccaatggtcatcccaagcatgatccttgttgtagatgatggcagct 726 Query: 431 cccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggacc 490 || || |||||||||||||| ||||| || || || || |||||||| |||| ||| ||| Sbjct: 725 ccgagactcctggccgggttaatgccagttccagtaattgggatggtagccaagtgcacc 666 Query: 491 a 491 | Sbjct: 665 a 665
>gb|AY059948.1| Arabidopsis thaliana water channel - like protein (At4g23400; F16G20.100) mRNA, complete cds Length = 1125 Score = 81.8 bits (41), Expect = 3e-12 Identities = 101/121 (83%) Strand = Plus / Minus Query: 371 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcc 430 ||||||||||||||||| || |||||||| || | |||||||||||||||| ||| || Sbjct: 834 ccgacccagaagatccaatggtcatcccaagcatgatccttgttgtagatgatggcagct 775 Query: 431 cccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggacc 490 || || |||||||||||||| ||||| || || || || |||||||| |||| ||| ||| Sbjct: 774 ccgagactcctggccgggttaatgccagttccagtaattgggatggtagccaagtgcacc 715 Query: 491 a 491 | Sbjct: 714 a 714
>emb|BX826565.1|CNS0A4GR Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB41ZD01 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 454 Score = 81.8 bits (41), Expect = 3e-12 Identities = 101/121 (83%) Strand = Plus / Minus Query: 371 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcc 430 ||||||||||||||||| || |||||||| || | |||||||||||||||| ||| || Sbjct: 158 ccgacccagaagatccaatggtcatcccaagcatgatccttgttgtagatgatggcagct 99 Query: 431 cccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggacc 490 || || |||||||||||||| ||||| || || || || |||||||| |||| ||| ||| Sbjct: 98 ccgagactcctggccgggttaatgccagttccagtaattgggatggtagccaagtgcacc 39 Query: 491 a 491 | Sbjct: 38 a 38
>emb|BX826657.1|CNS0A38E Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB51ZF11 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 710 Score = 81.8 bits (41), Expect = 3e-12 Identities = 101/121 (83%) Strand = Plus / Minus Query: 371 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcc 430 ||||||||||||||||| || |||||||| || | |||||||||||||||| ||| || Sbjct: 417 ccgacccagaagatccaatggtcatcccaagcatgatccttgttgtagatgatggcagct 358 Query: 431 cccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggacc 490 || || |||||||||||||| ||||| || || || || |||||||| |||| ||| ||| Sbjct: 357 ccgagactcctggccgggttaatgccagttccagtaattgggatggtagccaagtgcacc 298 Query: 491 a 491 | Sbjct: 297 a 297
>emb|BX827146.1|CNS0A2UM Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS16ZB08 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1066 Score = 81.8 bits (41), Expect = 3e-12 Identities = 101/121 (83%) Strand = Plus / Minus Query: 371 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcc 430 ||||||||||||||||| || |||||||| || | |||||||||||||||| ||| || Sbjct: 823 ccgacccagaagatccaatggtcatcccaagcatgatccttgttgtagatgatggcagct 764 Query: 431 cccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggacc 490 || || |||||||||||||| ||||| || || || || |||||||| |||| ||| ||| Sbjct: 763 ccgagactcctggccgggttaatgccagttccagtaattgggatggtagccaagtgcacc 704 Query: 491 a 491 | Sbjct: 703 a 703
>emb|BX827200.1|CNS0A2RC Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS21ZB06 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1078 Score = 81.8 bits (41), Expect = 3e-12 Identities = 101/121 (83%) Strand = Plus / Minus Query: 371 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcc 430 ||||||||||||||||| || |||||||| || | |||||||||||||||| ||| || Sbjct: 798 ccgacccagaagatccaatggtcatcccaagcatgatccttgttgtagatgatggcagct 739 Query: 431 cccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggacc 490 || || |||||||||||||| ||||| || || || || |||||||| |||| ||| ||| Sbjct: 738 ccgagactcctggccgggttaatgccagttccagtaattgggatggtagccaagtgcacc 679 Query: 491 a 491 | Sbjct: 678 a 678
>gb|AY087945.1| Arabidopsis thaliana clone 3982 mRNA, complete sequence Length = 1089 Score = 81.8 bits (41), Expect = 3e-12 Identities = 101/121 (83%) Strand = Plus / Minus Query: 371 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcc 430 ||||||||||||||||| || |||||||| || | |||||||||||||||| ||| || Sbjct: 832 ccgacccagaagatccaatggtcatcccaagcatgatccttgttgtagatgatggcagct 773 Query: 431 cccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggacc 490 || || |||||||||||||| ||||| || || || || |||||||| |||| ||| ||| Sbjct: 772 ccgagactcctggccgggttaatgccagttccagtaattgggatggtagccaagtgcacc 713 Query: 491 a 491 | Sbjct: 712 a 712
>gb|L36095.1|CIPMIPA Mesembryanthemum crystallinum mipA mRNA, complete cds Length = 1278 Score = 79.8 bits (40), Expect = 1e-11 Identities = 142/176 (80%) Strand = Plus / Minus Query: 437 ctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatgaac 496 |||||||| ||||||||||| ||||| || | ||||||||||||| ||| |||| |||| Sbjct: 934 ctcctggctgggttgatgccagtgccagtaacggggatggtggccaagtgaaccaagaac 875 Query: 497 acggcgaagccgatcgggaggggcgccaacaccgggacgtgagagtcgcgtgcgctgcgc 556 || ||||| || || || | || ||||| | || || || ||||| | ||||| ||| Sbjct: 874 acagcgaacccaattggcaatggagccaagataggaacatgggagtccctagcgcttcgc 815 Query: 557 ttggggtcggtggcggagaagacggtgtagacgagcacgaaggtgccgatgatctc 612 |||| ||| ||||||||||||||||||||||| || || || |||||||| ||||| Sbjct: 814 ttggcgtcagtggcggagaagacggtgtagacaagaacaaaagtgccgataatctc 759
>gb|AY494191.1| Physcomitrella patens plasma membrane aquaporin (PIP2;1) gene, complete cds Length = 1486 Score = 77.8 bits (39), Expect = 4e-11 Identities = 60/67 (89%) Strand = Plus / Minus Query: 552 tgcgcttggggtcggtggcggagaagacggtgtagacgagcacgaaggtgccgatgatct 611 ||||||||||||||||||| ||||| |||||||| || || ||||| ||||||||||||| Sbjct: 836 tgcgcttggggtcggtggcagagaacacggtgtataccagaacgaaagtgccgatgatct 777 Query: 612 ccgcggc 618 | ||||| Sbjct: 776 cagcggc 770 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 371 ccgacccagaagatccactg 390 |||||||||||||||||||| Sbjct: 1380 ccgacccagaagatccactg 1361
>emb|X95639.1|BOMIPATCP B.oleracea mRNA for transmembrane channel protein (mipA) Length = 1104 Score = 77.8 bits (39), Expect = 4e-11 Identities = 189/239 (79%) Strand = Plus / Minus Query: 374 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 433 |||||||||| ||| || |||||||| || ||||||||||| |||||| ||| || || Sbjct: 816 acccagaagacccaatggtcatcccaagcgttgtccttgttcaagatgatggcagcacca 757 Query: 434 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 493 || || || || |||||||| || || || ||||| |||||||| |||| |||||||| | Sbjct: 756 agacttcttgctgggttgattccagttccagtgatggggatggttgccaagtggaccaag 697 Query: 494 aacacggcgaagccgatcgggaggggcgccaacaccgggacgtgagagtcgcgtgcgctg 553 ||||| ||||| || || ||||| || || | | ||| || |||||||| || ||| | Sbjct: 696 aacacagcgaatccaatagggagaggtgcaagaatcggaacatgagagtcacgagcgttt 637 Query: 554 cgcttggggtcggtggcggagaagacggtgtagacgagcacgaaggtgccgatgatctc 612 | ||| | || || ||||||||||||||||| ||||| || ||||| || |||||||| Sbjct: 636 ctcttagcatcagtagcggagaagacggtgtaaacgaggacaaaggttccaatgatctc 578
>emb|AJ843992.1| Plantago major partial mRNA for aquaporin 2 (aqp2 gene) Length = 1089 Score = 77.8 bits (39), Expect = 4e-11 Identities = 189/239 (79%) Strand = Plus / Minus Query: 374 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 433 |||||||||||||| || ||||||||||| | |||| |||||||||||| ||||| || Sbjct: 770 acccagaagatccagtggtcatcccaggcgtggtccctgttgtagatgattgcggcacca 711 Query: 434 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 493 || || | || ||||| || || || |||||||| |||||||| |||| ||| |||| | Sbjct: 710 agactacgtgcggggttaatacctgtaccggtgattgggatggtagccaagtgcaccaag 651 Query: 494 aacacggcgaagccgatcgggaggggcgccaacaccgggacgtgagagtcgcgtgcgctg 553 || |||||||| || || || | || ||||| | ||||| || ||||| | || || Sbjct: 650 aatacggcgaatccaataggcaatggtgccaagatggggacatgggagtctctagcacta 591 Query: 554 cgcttggggtcggtggcggagaagacggtgtagacgagcacgaaggtgccgatgatctc 612 ||||||| || ||||| |||||||||||||| || |||||||| ||||| || ||||| Sbjct: 590 cgcttggcatcagtggcagagaagacggtgtacacaagcacgaaagtgccaataatctc 532
>emb|AJ937963.1| Lactuca sativa partial mRNA for putative PIP2 aquaporin (pip2 gene) Length = 331 Score = 77.8 bits (39), Expect = 4e-11 Identities = 81/95 (85%) Strand = Plus / Minus Query: 539 gagtcgcgtgcgctgcgcttggggtcggtggcggagaagacggtgtagacgagcacgaag 598 ||||| ||||| || | |||||| |||||||| |||||||| ||||| || || |||||| Sbjct: 281 gagtctcgtgcactcctcttgggatcggtggcagagaagacagtgtaaacaaggacgaag 222 Query: 599 gtgccgatgatctccgcggcgaggccggtgccctt 633 |||||||||||||| || |||| ||||||||||| Sbjct: 221 gtgccgatgatctcagcaccgagtccggtgccctt 187
>gb|U62280.1|NTU62280 Nicotiana tabacum aquaporin (NT2) mRNA, complete cds Length = 1049 Score = 77.8 bits (39), Expect = 4e-11 Identities = 108/131 (82%) Strand = Plus / Minus Query: 374 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 433 |||||||||||||| ||||||||||| ||| ||| | |||| |||||| || || || Sbjct: 797 acccagaagatccagtgatcatcccatgcccggtcttggttgaagatgatagcagctcca 738 Query: 434 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 493 ||||||| ||| ||| |||| ||||| |||||||| ||||||||||||| || |||| | Sbjct: 737 aggctccgggcgggggtgataccggttccggtgattgggatggtggccaaatgaaccaag 678 Query: 494 aacacggcgaa 504 ||||| ||||| Sbjct: 677 aacaccgcgaa 667
>gb|L36097.1|CIPMIPB Mesembryanthemum crystallinum aquaporin (mipB) mRNA, complete cds Length = 1217 Score = 77.8 bits (39), Expect = 4e-11 Identities = 108/131 (82%) Strand = Plus / Minus Query: 374 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 433 |||||||| ||||| ||||||||||| || | | |||||||| |||||| || || || Sbjct: 805 acccagaaaatccagtgatcatcccaagcgtggcccttgttgaagatgatagcagcaccg 746 Query: 434 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 493 || ||||| || |||||||||||||| || ||||| |||||||| |||| ||| |||| | Sbjct: 745 agactccttgctgggttgatgccggttccagtgattgggatggttgccaagtgaaccaag 686 Query: 494 aacacggcgaa 504 ||||| ||||| Sbjct: 685 aacactgcgaa 675
>dbj|AB030695.1| Raphanus sativus PAQ1b mRNA for plasma membrane aquaporin 1b, complete cds Length = 1053 Score = 77.8 bits (39), Expect = 4e-11 Identities = 153/191 (80%) Strand = Plus / Minus Query: 395 tcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttgatg 454 ||||| || |||||||||||| |||||| || || || || ||||| || ||||||||| Sbjct: 779 tcccaagcgttgtccttgttgaagatgattgcagctccaagactccttgctgggttgatg 720 Query: 455 ccggtgccggtgatcgggatggtggccaggtggaccatgaacacggcgaagccgatcggg 514 || || || ||||| |||||||| || | |||||||| |||||| ||||| ||||| ||| Sbjct: 719 ccagtaccagtgatggggatggttgctaagtggaccaagaacacagcgaatccgataggg 660 Query: 515 aggggcgccaacaccgggacgtgagagtcgcgtgcgctgcgcttggggtcggtggcggag 574 || || || | | || || |||||||| || ||| | | ||||| ||| ||||||||| Sbjct: 659 agaggtgcaagaatgggaacatgagagtcacgagcgttcctcttggcgtcagtggcggag 600 Query: 575 aagacggtgta 585 ||||||||||| Sbjct: 599 aagacggtgta 589
>gb|AY489268.1| Physcomitrella patens aquaporin PIP 2 mRNA, complete cds Length = 1223 Score = 75.8 bits (38), Expect = 2e-10 Identities = 146/182 (80%) Strand = Plus / Minus Query: 437 ctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatgaac 496 ||||| || ||||||||||| || ||||| || || ||||| || || || |||||||| Sbjct: 740 ctcctcgcagggttgatgccagttccggtaatgggaatggtagcaagatgaaccatgaag 681 Query: 497 acggcgaagccgatcgggaggggcgccaacaccgggacgtgagagtcgcgtgcgctgcgc 556 || || || || || || || || ||||| |||||||| |||||||| || || ||||| Sbjct: 680 actgcaaatcctataggaagaggagccaataccgggacatgagagtcacgggcattgcgc 621 Query: 557 ttggggtcggtggcggagaagacggtgtagacgagcacgaaggtgccgatgatctccgcg 616 ||||| || ||||| |||||||||||||| || || || || || ||||||||||| ||| Sbjct: 620 ttgggatcagtggcagagaagacggtgtacactagaacaaacgttccgatgatctcggcg 561 Query: 617 gc 618 || Sbjct: 560 gc 559
>gb|AY781788.1| Glycyrrhiza uralensis plasma membrane intrinsic protein (PIP) mRNA, complete cds Length = 1254 Score = 75.8 bits (38), Expect = 2e-10 Identities = 128/158 (81%) Strand = Plus / Minus Query: 446 gggttgatgccggtgccggtgatcgggatggtggccaggtggaccatgaacacggcgaag 505 |||||||| || || |||||||| ||||||||||||| | | |||| |||||| ||||| Sbjct: 803 gggttgataccagttccggtgattgggatggtggccaagcgcaccaagaacacagcgaac 744 Query: 506 ccgatcgggaggggcgccaacaccgggacgtgagagtcgcgtgcgctgcgcttggggtcg 565 || || || | || ||||| | |||||||||||||| | ||||| ||||||| ||| Sbjct: 743 ccaattggcaacggtgccaaaatagggacgtgagagtctctggcgctacgcttggcatcg 684 Query: 566 gtggcggagaagacggtgtagacgagcacgaaggtgcc 603 ||||| ||||| ||||||||||| || || |||||||| Sbjct: 683 gtggctgagaaaacggtgtagacaagaacaaaggtgcc 646
>emb|Y08962.1|OSTRAMBPR O.sativa mRNA for transmembrane protein Length = 1179 Score = 75.8 bits (38), Expect = 2e-10 Identities = 47/50 (94%) Strand = Plus / Minus Query: 556 cttggggtcggtggcggagaagacggtgtagacgagcacgaaggtgccga 605 ||||| |||||||||||||||||||||||||||||| | ||||||||||| Sbjct: 668 cttggcgtcggtggcggagaagacggtgtagacgaggatgaaggtgccga 619 Score = 73.8 bits (37), Expect = 6e-10 Identities = 49/53 (92%) Strand = Plus / Minus Query: 446 gggttgatgccggtgccggtgatcgggatggtggccaggtggaccatgaacac 498 |||||||| |||||||||||||| ||||||||||||||||| |||| |||||| Sbjct: 778 gggttgattccggtgccggtgatggggatggtggccaggtgaaccaagaacac 726
>emb|AJ849323.1| Populus tremula x Populus tremuloides mRNA for putative plasma membrane intrinsic protein (pip1.1 gene) Length = 943 Score = 75.8 bits (38), Expect = 2e-10 Identities = 113/138 (81%) Strand = Plus / Minus Query: 367 ggggccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggc 426 |||||| |||||||| ||||| |||||||||||||| ||||||||||| |||||| || Sbjct: 883 ggggccaacccagaaaatccagtgatcatcccaggcgctgtccttgttgaagatgattgc 824 Query: 427 ggcccccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtg 486 || ||||| |||| || |||||||| || || || || || ||||| ||||||| ||| Sbjct: 823 agcacccagactccgagctgggttgatcccagttcctgtaattgggattgtggccaagtg 764 Query: 487 gaccatgaacacggcgaa 504 |||| |||||| ||||| Sbjct: 763 caccaagaacacagcgaa 746
>emb|AJ222973.1|LAAJ2973 Lupinus albus mRNA for aquaporin, partial Length = 1051 Score = 75.8 bits (38), Expect = 2e-10 Identities = 128/158 (81%) Strand = Plus / Minus Query: 446 gggttgatgccggtgccggtgatcgggatggtggccaggtggaccatgaacacggcgaag 505 |||||||| ||||| |||||||| ||||||||||||| ||| |||| ||| || ||||| Sbjct: 714 gggttgataccggttccggtgatggggatggtggccaagtgtaccaagaatacagcgaac 655 Query: 506 ccgatcgggaggggcgccaacaccgggacgtgagagtcgcgtgcgctgcgcttggggtcg 565 || || || | ||| ||||| | |||||||||||||| | ||||| || |||| ||| Sbjct: 654 ccaataggcaagggtgccaaaatagggacgtgagagtctctagcgctacgtttggcatcg 595 Query: 566 gtggcggagaagacggtgtagacgagcacgaaggtgcc 603 ||||| ||||| ||||| ||||| || || |||||||| Sbjct: 594 gtggctgagaaaacggtatagacaagaacaaaggtgcc 557
>gb|AF367460.1| Prunus persica clone Mip3 membrane intrinsic protein (mip3) mRNA, partial cds Length = 495 Score = 75.8 bits (38), Expect = 2e-10 Identities = 173/218 (79%) Strand = Plus / Minus Query: 395 tcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttgatg 454 |||||||||||||| ||||||||||| || || || || ||||| || || ||||| ||| Sbjct: 485 tcccaggccttgtcattgttgtagatcactgcagctccaaggcttcttgctgggtttatg 426 Query: 455 ccggtgccggtgatcgggatggtggccaggtggaccatgaacacggcgaagccgatcggg 514 || ||||| ||||| ||||| ||||| ||||| || || ||||| || || || || || Sbjct: 425 ccagtgccagtgattgggattgtggcaaggtgcacaataaacacagcaaacccaattggc 366 Query: 515 aggggcgccaacaccgggacgtgagagtcgcgtgcgctgcgcttggggtcggtggcggag 574 || || ||||| || ||||| || || || | ||| | | ||||||||| ||||| ||| Sbjct: 365 agtggtgccaaaactgggacatgtgaatcccttgcatttctcttggggtcagtggcagag 306 Query: 575 aagacggtgtagacgagcacgaaggtgccgatgatctc 612 ||||| |||||||| || || |||||||| || ||||| Sbjct: 305 aagacagtgtagacaagaacaaaggtgccaataatctc 268
>dbj|AK221275.1| Arabidopsis thaliana mRNA for water channel - like protein, partial cds, clone: RAFL24-17-A12 Length = 392 Score = 75.8 bits (38), Expect = 2e-10 Identities = 74/86 (86%) Strand = Plus / Minus Query: 371 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcc 430 ||||||||||||||||| || |||||||| || | |||||||||||||||| ||| || Sbjct: 90 ccgacccagaagatccaatggtcatcccaagcatgatccttgttgtagatgatggcagct 31 Query: 431 cccaggctcctggccgggttgatgcc 456 || || |||||||||||||| ||||| Sbjct: 30 ccgagactcctggccgggttaatgcc 5
>dbj|AB206101.1| Mimosa pudica pip2;3 mRNA for plasma membrane intrinsic protein 2;3, complete cds Length = 1218 Score = 75.8 bits (38), Expect = 2e-10 Identities = 56/62 (90%) Strand = Plus / Minus Query: 437 ctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatgaac 496 |||||||||||||| |||||||| ||||||| ||||||||||||| ||| ||||||||| Sbjct: 790 ctcctggccgggttaatgccggtaccggtgactgggatggtggccaagtgaaccatgaac 731 Query: 497 ac 498 || Sbjct: 730 ac 729
>gb|AF145706.1|AF145706 Zea mays plasma membrane intrinsic protein homolog (pip) mRNA, partial cds Length = 528 Score = 75.8 bits (38), Expect = 2e-10 Identities = 56/62 (90%) Strand = Plus / Minus Query: 530 gggacgtgagagtcgcgtgcgctgcgcttggggtcggtggcggagaagacggtgtagacg 589 |||||||| ||||| || ||||| ||||||| ||||||||||||||||||||||||||| Sbjct: 512 gggacgtgggagtcacgagcgctacgcttggcatcggtggcggagaagacggtgtagacg 453 Query: 590 ag 591 || Sbjct: 452 ag 451 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 4,838,394 Number of Sequences: 3902068 Number of extensions: 4838394 Number of successful extensions: 94662 Number of sequences better than 10.0: 501 Number of HSP's better than 10.0 without gapping: 502 Number of HSP's successfully gapped in prelim test: 6 Number of HSP's that attempted gapping in prelim test: 91272 Number of HSP's gapped (non-prelim): 3299 length of query: 663 length of database: 17,233,045,268 effective HSP length: 23 effective length of query: 640 effective length of database: 17,143,297,704 effective search space: 10971710530560 effective search space used: 10971710530560 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)
