>gb|AC090430.7| Mus Musculus Strain C57BL6/J chromosome 10 BAC, RP23-131G5, complete
              sequence
          Length = 185453

 Score = 40.1 bits (20), Expect = 1.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 46     gttacagcaaatggaaaagc 65
              ||||||||||||||||||||
Sbjct: 172254 gttacagcaaatggaaaagc 172235

>gb|AC130815.4| Mus musculus BAC clone RP23-19E7 from 16, complete sequence
          Length = 195188

 Score = 40.1 bits (20), Expect = 1.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 46     gttacagcaaatggaaaagc 65
              ||||||||||||||||||||
Sbjct: 171451 gttacagcaaatggaaaagc 171470

>ref|XM_414870.1| PREDICTED: Gallus gallus similar to retinoblastoma-binding protein
           6 isoform 2; proliferation potential-related protein;
           RB-binding Q-protein 1; retinoblastoma-binding protein 6
           (LOC416569), mRNA
          Length = 6087

 Score = 38.2 bits (19), Expect = 6.1
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 47  ttacagcaaatggaaaagc 65
           |||||||||||||||||||
Sbjct: 604 ttacagcaaatggaaaagc 622

>emb|AL442635.11| Human DNA sequence from clone RP11-259F16 on chromosome 10 Contains
            the PRG1 gene for proteoglycan 1, secretory granule (PPG,
            PRG, SERGLYCIN), the 5' end of the VPS26 gene for
            vacuolar protein sorting 26 (yeast) (HB58, Hbeta58,
            FLJ12930), a ribosomal protein S12 (RPS12) pseudogene and
            a CpG island, complete sequence
          Length = 143093

 Score = 38.2 bits (19), Expect = 6.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 45   tgttacagcaaatggaaaa 63
            |||||||||||||||||||
Sbjct: 7978 tgttacagcaaatggaaaa 7960


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 512,774
Number of Sequences: 3902068
Number of extensions: 512774
Number of successful extensions: 37153
Number of sequences better than 10.0: 4
Number of HSP's better than 10.0 without gapping: 4
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 37149
Number of HSP's gapped (non-prelim): 4
length of query: 130
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 109
effective length of database: 17,151,101,840
effective search space: 1869470100560
effective search space used: 1869470100560
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)