Clone Name	rbags13h22
Clone Library Name	barley_pub

---

No.	Definition	Score (bits)	E Value
1	gb|AF043094.1|AF043094 Hordeum vulgare dehydrin 9 (dhn9) gene, c...	854	0.0
2	gb|AF181459.1|AF181459 Hordeum vulgare dehydrin (Dhn9) gene, com...	846	0.0
3	gb|AY349271.1| Hordeum vulgare subsp. spontaneum NPGS PI 559559 ...	533	e-148
4	gb|AY349270.1| Hordeum vulgare subsp. spontaneum NPGS PI 559556 ...	533	e-148
5	gb|AY349269.1| Hordeum vulgare subsp. spontaneum NPGS PI 531957 ...	533	e-148
6	gb|AY349268.1| Hordeum vulgare subsp. spontaneum NPGS PI 531853 ...	533	e-148
7	gb|AY349267.1| Hordeum vulgare subsp. spontaneum NPGS PI 531851 ...	533	e-148
8	gb|AY349266.1| Hordeum vulgare subsp. spontaneum NPGS PI 466460 ...	533	e-148
9	gb|AY349265.1| Hordeum vulgare subsp. spontaneum NPGS PI 420916 ...	533	e-148
10	gb|AY349264.1| Hordeum vulgare subsp. spontaneum NPGS PI 420913 ...	533	e-148
11	gb|AY349263.1| Hordeum vulgare subsp. spontaneum NPGS PI 420911 ...	533	e-148
12	gb|AY349262.1| Hordeum vulgare subsp. spontaneum NPGS PI 406276 ...	533	e-148
13	gb|AY349261.1| Hordeum vulgare subsp. spontaneum NPGS PI 401371 ...	533	e-148
14	gb|AY349260.1| Hordeum vulgare subsp. spontaneum NPGS PI 401370 ...	533	e-148
15	gb|AY349259.1| Hordeum vulgare subsp. spontaneum NPGS PI 366446 ...	533	e-148
16	gb|AY349258.1| Hordeum vulgare subsp. spontaneum NPGS PI 296926 ...	533	e-148
17	gb|AY349257.1| Hordeum vulgare subsp. spontaneum NPGS PI 293411 ...	533	e-148
18	gb|AY349256.1| Hordeum vulgare subsp. spontaneum NPGS PI 293409 ...	533	e-148
19	gb|AY349255.1| Hordeum vulgare subsp. spontaneum NPGS PI 293402 ...	533	e-148
20	gb|AY349254.1| Hordeum vulgare subsp. spontaneum NPGS PI 268242 ...	533	e-148
21	gb|AY349253.1| Hordeum vulgare subsp. spontaneum NPGS PI 254894 ...	533	e-148
22	gb|AY349252.1| Hordeum vulgare subsp. spontaneum NPGS PI 253933 ...	533	e-148
23	gb|AY349251.1| Hordeum vulgare subsp. spontaneum NPGS PI 236388 ...	533	e-148
24	gb|AY349250.1| Hordeum vulgare subsp. spontaneum NPGS PI 220523 ...	533	e-148
25	gb|AY349249.1| Hordeum vulgare subsp. spontaneum NPGS PI 219796 ...	533	e-148
26	gb|AY349248.1| Hordeum vulgare subsp. spontaneum NPGS PI 212306 ...	533	e-148
27	gb|AY349247.1| Hordeum vulgare subsp. spontaneum NPGS PI 212305 ...	533	e-148
28	emb|X78431.1|TDDEH27 T.durum Desf. (Siliana) Dehydrin mRNA, clon...	406	e-110
29	emb|X59133.1|TARAB T.aestivum L. mRNA for an ABA responsive gene...	383	e-103
30	gb|AY619566.1| Triticum turgidum subsp. durum dehydrin mRNA, com...	238	2e-59
31	emb|AJ622891.1| Triticum durum partial mRNA for DRP4 protein (dr...	212	9e-52
32	gb|AY177889.1| Sorghum bicolor clone BAC IS_21O3 ABA-induced RAB...	178	1e-41
33	emb|X15290.1|HVDHN3 Zea mays mRNA for dehydrin (dhn1 gene)	178	1e-41
34	gb|U63831.1|SBU63831 Sorghum bicolor dehydrin (DHN2) mRNA, parti...	178	1e-41
35	gb|AY104757.1| Zea mays PCO142314 mRNA sequence	170	3e-39
36	dbj|AK071366.1| Oryza sativa (japonica cultivar-group) cDNA clon...	167	5e-38
37	emb|X62476.1|TARAB15B T.aestivum rab15B mRNA	163	7e-37
38	emb|X15287.1|HVDHN18 Barley mRNA for dehydrin (dhn18)	155	2e-34
39	dbj|AK063517.1| Oryza sativa (japonica cultivar-group) cDNA clon...	153	7e-34
40	gb|AF181456.1|AF181456 Hordeum vulgare dehydrin (Dhn6) mRNA, com...	151	3e-33
41	emb|X15288.1|HVDHN8 Barley mRNA for dehydrin (dhn8)	149	1e-32
42	emb|X98326.1|HVDEHYDRN H.vulgare mRNA for dehydrin	149	1e-32
43	gb|AF181451.1|AF181451 Hordeum vulgare dehydrin (Dhn1) mRNA, com...	149	1e-32
44	dbj|AK109096.1| Oryza sativa (japonica cultivar-group) cDNA clon...	147	4e-32
45	gb|AY266052.1| Deschampsia antarctica dehydrin-like protein pseu...	143	7e-31
46	emb|X15286.1|HVDHN17 Barley mRNA for dehydrin (dhn17)	143	7e-31
47	gb|AY823548.1| Pennisetum glaucum putative RAB protein mRNA, com...	139	1e-29
48	emb|X72748.1|HVDEHYD H.vulgare mRNA for dehydrin	139	1e-29
49	gb|AF453444.1|AF453444 Triticum aestivum dehydrin WZY1-1 mRNA, c...	135	2e-28
50	gb|AF181457.1|AF181457 Hordeum vulgare dehydrin (Dhn7) mRNA, com...	135	2e-28
51	emb|X15289.1|HVDHN9 Barley mRNA for dehydrin (dhn9)	133	6e-28
52	dbj|AK121952.1| Oryza sativa (japonica cultivar-group) cDNA clon...	129	1e-26
53	gb|AY895889.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI...	125	2e-25
54	gb|AY895898.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI...	123	6e-25
55	gb|AY895895.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI...	123	6e-25
56	gb|AY895883.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI...	123	6e-25
57	gb|AF043091.1|AF043091 Hordeum vulgare dehydrin 6 (dhn6) gene, c...	123	6e-25
58	gb|AC145325.3| Oryza sativa (japonica cultivar-group) chromosome...	121	2e-24
59	dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic D...	121	2e-24
60	emb|X15994.1|ZMRAB17G Maize RAB-17 gene	121	2e-24
61	gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome...	121	2e-24
62	gb|AC146946.2| Oryza sativa (japonica cultivar-group) chromosome...	119	1e-23
63	emb|X71362.1|HVDHN7 H.vulgare gene for dehydrin 7	119	1e-23
64	emb|X52423.1|OSRAB16C O.sativa DNA for rab 16C gene	119	1e-23
65	gb|AY895879.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI...	119	1e-23
66	gb|AY895878.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI...	119	1e-23
67	gb|AY895877.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI...	119	1e-23
68	gb|AY895876.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI...	119	1e-23
69	gb|AY895875.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI...	119	1e-23
70	gb|AY895874.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI...	119	1e-23
71	gb|AY895873.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI...	119	1e-23
72	gb|AY895872.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI...	119	1e-23
73	gb|AY895871.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI...	119	1e-23
74	gb|AY895870.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI...	119	1e-23
75	gb|AY895869.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI...	119	1e-23
76	gb|AY895868.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI...	119	1e-23
77	gb|AY895867.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI...	119	1e-23
78	gb|AY895866.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI...	119	1e-23
79	gb|AY895865.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI...	119	1e-23
80	gb|AY895864.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI...	119	1e-23
81	gb|AY895863.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI...	119	1e-23
82	gb|AY895862.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI...	119	1e-23
83	gb|AY895861.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI...	119	1e-23
84	gb|AY895860.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI...	119	1e-23
85	gb|AY895859.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI...	119	1e-23
86	gb|AY895858.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI...	119	1e-23
87	gb|AY895857.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI...	119	1e-23
88	gb|AF043087.1|AF043087 Hordeum vulgare dehydrin 1 (dhn1) gene, c...	119	1e-23
89	gb|AF155129.1|AF155129 Hordeum vulgare dehydrin 12 (Dhn12) gene,...	115	2e-22
90	emb|X52424.1|OSRAB16D O.sativa DNA for rab 16D gene	113	6e-22
91	emb|X52422.1|OSRAB16B O.sativa DNA for rab 16B gene	113	6e-22
92	gb|AF031248.1|AF031248 Lophopyrum elongatum dehydrin-/LEA group ...	109	9e-21
93	gb|AF181453.1|AF181453 Hordeum vulgare dehydrin (Dhn3) gene, com...	109	9e-21
94	gb|AY895927.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI...	109	9e-21
95	gb|AF043089.1|AF043089 Hordeum vulgare dehydrin 3 (dhn3) gene, c...	109	9e-21
96	gb|AF181454.1|AF181454 Hordeum vulgare dehydrin (Dhn4) gene, com...	107	4e-20
97	gb|AY895904.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI...	107	4e-20
98	gb|AY895903.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI...	107	4e-20
99	gb|AY895901.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI...	107	4e-20
100	gb|AY895900.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI...	107	4e-20
101	gb|AY895899.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI...	107	4e-20
102	gb|AY895897.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI...	107	4e-20
103	gb|AY895896.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI...	107	4e-20
104	gb|AY895894.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI...	107	4e-20
105	gb|AY895893.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI...	107	4e-20
106	gb|AY895892.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI...	107	4e-20
107	gb|AY895891.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI...	107	4e-20
108	gb|AY895890.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI...	107	4e-20
109	gb|AY895888.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI...	107	4e-20
110	gb|AY895887.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI...	107	4e-20
111	gb|AY895886.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI...	107	4e-20
112	gb|AY895885.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI...	107	4e-20
113	gb|AY895884.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI...	107	4e-20
114	gb|AY895882.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI...	107	4e-20
115	gb|AY895881.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI...	107	4e-20
116	gb|AY895880.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI...	107	4e-20
117	gb|AF043090.1|AF043090 Hordeum vulgare dehydrin 4 (dhn4) gene, c...	107	4e-20
118	emb|X78429.1|TDDEH16 T.durum Desf. (Siliana) Dehydrin mRNA, clon...	105	1e-19
119	emb|Y00842.1|OSRAB21 Rice rab21 gene for water-stress inducible ...	103	6e-19
120	gb|AF181452.1|AF181452 Hordeum vulgare dehydrin (Dhn2) gene, com...	103	6e-19
121	gb|AF043088.1|AF043088 Hordeum vulgare dehydrin 2 (dhn2) gene, c...	103	6e-19
122	gb|U60097.2|OSU60097 Oryza sativa dehydrin mRNA, complete cds	101	2e-18
123	gb|AY895931.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI...	101	2e-18
124	gb|AY895930.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI...	101	2e-18
125	gb|AY895929.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI...	101	2e-18
126	gb|AY895928.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI...	101	2e-18
127	gb|AY895926.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI...	101	2e-18
128	gb|AY895925.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI...	101	2e-18
129	gb|AY895924.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI...	101	2e-18
130	gb|AY895923.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI...	101	2e-18
131	gb|AY895922.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI...	101	2e-18
132	gb|AY895921.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI...	101	2e-18
133	gb|AY895920.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI...	101	2e-18
134	gb|AY895919.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI...	101	2e-18
135	gb|AY895918.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI...	101	2e-18
136	gb|AY895917.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI...	101	2e-18
137	gb|AY895916.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI...	101	2e-18
138	gb|AY895915.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI...	101	2e-18
139	gb|AY895914.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI...	101	2e-18
140	gb|AY895913.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI...	101	2e-18
141	gb|AY895912.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI...	101	2e-18
142	gb|AY895911.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI...	101	2e-18
143	gb|AY895910.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI...	101	2e-18
144	gb|AY895909.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI...	101	2e-18
145	gb|AY895908.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI...	101	2e-18
146	gb|AY895907.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI...	101	2e-18
147	gb|AY895906.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI...	101	2e-18
148	gb|AY895905.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI...	101	2e-18
149	gb|AF043092.1|AF043092 Hordeum vulgare dehydrin 7 (dhn7) gene, c...	101	2e-18
150	gb|AF181460.1|AF181460 Hordeum vulgare dehydrin (Dhn10) gene, co...	94	6e-16
151	gb|AY895902.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI...	94	6e-16
152	gb|AF043095.1|AF043095 Hordeum vulgare dehydrin 10 (dhn10) gene,...	94	6e-16
153	gb|U11696.1|SBU11696 Sorghum bicolor dehydrin (DHN1) mRNA, compl...	92	2e-15
154	gb|AF236067.1|AF236067 Elaeis guineensis clone pKT5 dehydrin-lik...	90	9e-15
155	gb|AF031247.1|AF031247 Lophopyrum elongatum dehydrin-/LEA group ...	84	5e-13
156	ref|NM_192219.1| Oryza sativa (japonica cultivar-group), predic...	82	2e-12
157	gb|AY243045.1| Boea crassifolia dehydrin-like protein Dh2 mRNA, ...	82	2e-12
158	gb|AY333185.1| Oryza sativa (japonica cultivar-group) drought-re...	82	2e-12
159	gb|M93342.2|WHTCOAC Triticum aestivum cold acclimation protein W...	82	2e-12
160	emb|X57327.1|OSRAB25 Rice rab25 mRNA	82	2e-12
161	gb|AF181455.1|AF181455 Hordeum vulgare dehydrin (Dhn5) gene, com...	82	2e-12
162	dbj|AK063691.1| Oryza sativa (japonica cultivar-group) cDNA clon...	82	2e-12
163	gb|AF058794.1|AF058794 Triticum aestivum COR39 (cor39) mRNA, com...	82	2e-12
164	gb|U73212.1|TAU73212 Triticum aestivum cold acclimation protein ...	82	2e-12
165	gb|M95810.1|BLYDHN5 Hordeum vulgare dehydrin DHN5 (Dhn5) gene, c...	82	2e-12
166	gb|L27516.1|WHTWCS66X Triticum aestivum (Wcs66) gene, complete cds	82	2e-12
167	dbj|AB126059.1| Codonopsis lanceolata mRNA for dehydrin 1, compl...	80	8e-12
168	gb|AF031249.1|AF031249 Lophopyrum elongatum dehydrin-/LEA group ...	78	3e-11
169	gb|AF031250.1|AF031250 Lophopyrum elongatum dehydrin-/LEA group ...	78	3e-11
170	gb|U73213.1|TAU73213 Triticum aestivum cold acclimation protein ...	78	3e-11
171	gb|AY349246.1| Hordeum vulgare subsp. spontaneum NPGS PI 560559 ...	76	1e-10
172	gb|AY349245.1| Hordeum vulgare subsp. spontaneum NPGS PI 560556 ...	76	1e-10
173	gb|AY349244.1| Hordeum vulgare subsp. spontaneum NPGS PI 531957 ...	76	1e-10
174	gb|AY349243.1| Hordeum vulgare subsp. spontaneum NPGS PI 531853 ...	76	1e-10
175	gb|AY349242.1| Hordeum vulgare subsp. spontaneum NPGS PI 531851 ...	76	1e-10
176	gb|AY349241.1| Hordeum vulgare subsp. spontaneum NPGS PI 466460 ...	76	1e-10
177	gb|AY349240.1| Hordeum vulgare subsp. spontaneum NPGS PI 420916 ...	76	1e-10
178	gb|AY349239.1| Hordeum vulgare subsp. spontaneum NPGS PI 420913 ...	76	1e-10
179	gb|AY349238.1| Hordeum vulgare subsp. spontaneum NPGS PI 420911 ...	76	1e-10
180	gb|AY349237.1| Hordeum vulgare subsp. spontaneum NPGS PI 406276 ...	76	1e-10
181	gb|AY349236.1| Hordeum vulgare subsp. spontaneum NPGS PI 401371 ...	76	1e-10
182	gb|AY349235.1| Hordeum vulgare subsp. spontaneum NPGS PI 401371 ...	76	1e-10
183	gb|AY349234.1| Hordeum vulgare subsp. spontaneum NPGS PI 401370 ...	76	1e-10
184	gb|AY349233.1| Hordeum vulgare subsp. spontaneum NPGS PI 366446 ...	76	1e-10
185	gb|AY349232.1| Hordeum vulgare subsp. spontaneum NPGS PI 296926 ...	76	1e-10
186	gb|AY349231.1| Hordeum vulgare subsp. spontaneum NPGS PI 293411 ...	76	1e-10
187	gb|AY349230.1| Hordeum vulgare subsp. spontaneum NPGS PI 293409 ...	76	1e-10
188	gb|AY349229.1| Hordeum vulgare subsp. spontaneum NPGS PI 293402 ...	76	1e-10
189	gb|AY349228.1| Hordeum vulgare subsp. spontaneum NPGS PI 268242 ...	76	1e-10
190	gb|AY349227.1| Hordeum vulgare subsp. spontaneum NPGS PI 254894 ...	76	1e-10
191	gb|AY349226.1| Hordeum vulgare subsp. spontaneum NPGS PI 253933 ...	76	1e-10
192	gb|AY349225.1| Hordeum vulgare subsp. spontaneum NPGS PI 253933 ...	76	1e-10
193	gb|AY349224.1| Hordeum vulgare subsp. spontaneum NPGS PI 236388 ...	76	1e-10
194	gb|AY349223.1| Hordeum vulgare subsp. spontaneum NPGS PI 220523 ...	76	1e-10
195	gb|AY349222.1| Hordeum vulgare subsp. spontaneum NPGS PI 219796 ...	76	1e-10
196	gb|AY349221.1| Hordeum vulgare subsp. spontaneum NPGS PI 212306 ...	76	1e-10
197	gb|AY349220.1| Hordeum vulgare subsp. spontaneum NPGS PI 212305 ...	76	1e-10
198	gb|AF043096.1|AF043096 Hordeum vulgare dehydrin 5 (dhn5) gene, c...	76	1e-10
199	gb|AF181461.1|AF181461 Hordeum vulgare dehydrin (Dhn11) gene, co...	74	5e-10
200	gb|AF043086.1|AF043086 Hordeum vulgare dehydrin 11 (dhn11) gene,...	74	5e-10
201	gb|AY465376.1| Prunus persica dehydrin 2 mRNA, complete cds	72	2e-09
202	gb|AF172263.1| Prunus dulcis abscisic acid response protein (rab...	72	2e-09
203	emb|X78432.1|TDDEH38 T.durum Desf. (Siliana) Dehydrin mRNA, clon...	72	2e-09
204	emb|X78430.1|TDDEH25 T.durum Desf. (Siliana) Dehydrin mRNA, clon...	72	2e-09
205	gb|DQ160121.1| Taraxacum officinale TO101-3 (To101-3) mRNA, part...	70	8e-09
206	dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D...	70	8e-09
207	dbj|AP003245.4| Oryza sativa (japonica cultivar-group) genomic D...	70	8e-09
208	dbj|AB076807.1| Triticum aestivum Wdhn13 mRNA for LEA D-11 dehyd...	66	1e-07
209	emb|X64327.1|LGNPR1 L.gibba gene NPR1 (negatively phytochrome re...	64	5e-07
210	ref|NM_126038.2| Arabidopsis thaliana RAB18 (RESPONSIVE TO ABA 1...	62	2e-06
211	ref|NM_001037085.1| Arabidopsis thaliana RAB18 (RESPONSIVE TO AB...	62	2e-06
212	gb|L04173.1|ATH18RAB Arabidopsis thaliana glycine rich protein (...	62	2e-06
213	emb|X74067.1|CPCDET619 Craterostigma plantagineum CDeT6-19 gene ...	62	2e-06
214	gb|AY093779.1| Arabidopsis thaliana AT5g66400/K1F13_5 mRNA, comp...	62	2e-06
215	gb|AF428458.1|AF428458 Arabidopsis thaliana AT5g66400/K1F13_5 mR...	62	2e-06
216	gb|AY050416.1| Arabidopsis thaliana At1g11360/T23J18_35 mRNA, co...	62	2e-06
217	gb|M62988.1|CRTDESRSB Craterostigma plantagineum dessication-rel...	62	2e-06
218	emb|AJ606474.1| Fagus sylvatica mRNA for dehydrin/response ABA (...	62	2e-06
219	dbj|AB013389.1| Arabidopsis thaliana genomic DNA, chromosome 5, ...	62	2e-06
220	emb|X68042.1|ATRAB18A A.thaliana rab18 gene	62	2e-06
221	gb|BT002226.1| Arabidopsis thaliana At5g66400/K1F13_5 mRNA, comp...	62	2e-06
222	gb|AY425975.1| Streptocarpus primulifolius microsatellite B22 se...	60	8e-06
223	gb|DQ399792.1| Phoenix dactylifera dehydrin mRNA, partial cds	60	8e-06
224	dbj|AB049336.1| Nicotiana tabacum NtERD10B mRNA for dehydrin, co...	60	8e-06
225	gb|AY587109.1| Oryza sativa (japonica cultivar-group) dehydratio...	58	3e-05
226	gb|AY786415.1| Oryza sativa (japonica cultivar-group) SK3-type d...	58	3e-05
227	gb|AY574032.1| Triticum aestivum dehydrin-like gene, partial seq...	58	3e-05
228	emb|AJ890140.1| Triticum turgidum subsp. durum mRNA for dehydrin...	58	3e-05
229	dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D...	58	3e-05
230	gb|L19419.1|LHPESI Lophopyrum elongatum ES135 mRNA sequence	58	3e-05
231	dbj|AP004858.3| Oryza sativa (japonica cultivar-group) genomic D...	58	3e-05
232	dbj|AP005055.2| Oryza sativa (japonica cultivar-group) genomic D...	58	3e-05
233	emb|X84056.1|HVPAF93 H.vulgare paf93 gene	58	3e-05
234	dbj|AK070197.1| Oryza sativa (japonica cultivar-group) cDNA clon...	58	3e-05
235	gb|AF043093.1|AF043093 Hordeum vulgare dehydrin 8 (dhn8) gene, c...	58	3e-05
236	gb|U73211.1|TAU73211 Triticum aestivum cold acclimation protein ...	58	3e-05
237	gb|U73210.1|TAU73210 Triticum aestivum cold acclimation protein ...	58	3e-05
238	gb|L29152.1|WHTWCOR Triticum aestivum cold acclimation protein (...	58	3e-05
239	dbj|AB011367.1| Oryza sativa mRNA for LIP9, partial cds	58	3e-05
240	emb|AJ704825.1| Glycine max partial lea8 gene for putative dehydrin	56	1e-04
241	gb|M62987.1|CRTDESRSA Craterostigma plantagineum dessication-rel...	56	1e-04
242	gb|AY105067.1| Zea mays PCO081051 mRNA sequence	56	1e-04
243	gb|M94012.1|SOYMATSGB Glycine max maturation-associated protein ...	54	5e-04
244	gb|U10111.1|GMU10111 Glycine max Essex dehydrin-like protein mRN...	54	5e-04
245	gb|DQ487110.1| Panax ginseng dehydrin 5 (Dhn5) mRNA, complete cds	52	0.002
246	gb|AF345988.1| Cornus sericea 60 kDa dehydrin-like protein (Rod6...	52	0.002
247	gb|U91970.1|PSU91970 Pisum sativum dehydrin 3 (Dhn3) mRNA, compl...	52	0.002
248	gb|U91969.1|PSU91969 Pisum sativum dehydrin 2 (Dhn2) mRNA, compl...	52	0.002
249	dbj|AB049335.1| Nicotiana tabacum NtERD10A mRNA for dehydrin, pa...	52	0.002
250	emb|X94979.1|BOPC34 B.oleracea mRNA for pollen coat protein (clo...	52	0.002
251	gb|AF181458.1|AF181458 Hordeum vulgare dehydrin (Dhn8) mRNA, com...	52	0.002
252	emb|X63062.1|PSDHN2 P.sativum mRNA for dehydrin DHN2	52	0.002
253	gb|AF044584.1|AF044584 Lavatera thuringiaca cold regulated LTCOR...	52	0.002
254	dbj|AP006422.1| Lotus japonicus genomic DNA, chromosome 2, clone...	52	0.002
255	gb|BT019045.1| Zea mays clone Contig566.F mRNA sequence	50	0.007
256	emb|X83597.1|STDHN1 S.tuberosum dhn1 gene	50	0.007
257	gb|L35913.1|MZELIPASE Zea mays dehydrin (dhn-2) mRNA, complete cds	50	0.007
258	gb|AY111114.1| Zea mays CL2452_1 mRNA sequence	50	0.007
259	dbj|AB010898.1| Daucus carota mRNA for ecpp44, complete cds	50	0.007
260	ref|NM_114958.2| Arabidopsis thaliana unknown protein AT3G50980 ...	48	0.030
261	ref|NM_101894.3| Arabidopsis thaliana COR47 AT1G20440 (COR47) mR...	48	0.030
262	gb|AY607706.1| Quercus robur dehydrin 2 (Dhn2) mRNA, partial cds	48	0.030
263	gb|AY389583.1| Hyacinthus orientalis dehydrin mRNA, partial cds	48	0.030
264	emb|X64199.1|ATXERO A.thaliana XERO gene for dehydrin	48	0.030
265	emb|AL132980.3|ATF24M12 Arabidopsis thaliana DNA chromosome 3, B...	48	0.030
266	emb|X83596.1|SCDHN1 S.commersonii dhn1 gene	48	0.030
267	gb|AY114699.1| Arabidopsis thaliana unknown protein (At1g20440) ...	48	0.030
268	gb|AY072392.1| Arabidopsis thaliana unknown protein (At1g20440) ...	48	0.030
269	gb|AC027665.4|AC027665 Genomic sequence for Arabidopsis thaliana...	48	0.030
270	emb|AJ300525.4|PEU300525 Populus euramericana mRNA for putative ...	48	0.030
271	emb|AJ583799.1| Glycine max lea-D-11 gene for dehydrin, cultivar...	48	0.030
272	dbj|AB004872.1| Arabidopsis thaliana DNA for COR47, complete cds	48	0.030
273	emb|X90959.1|ATCOR47G A.thaliana cor47 gene	48	0.030
274	emb|X59814.1|ATCOR47 A.thaliana cor47 mRNA	48	0.030
275	gb|U19537.1|ATU19537 Arabidopsis thaliana dehydrin (Xero 1) gene...	48	0.030
276	emb|AJ001448.1|FVAJ1448 Fragaria vesca partial mRNA for ripening...	48	0.030
277	gb|AY303803.1| Brassica napus cultivar Q2 dehydrin (DHN1) mRNA, ...	46	0.12
278	gb|AY706990.1| Vitis vinifera dehydrin 1b (DHN1b) gene, complete...	46	0.12
279	gb|AY706989.1| Vitis vinifera dehydrin 1a (DHN1a) gene, complete...	46	0.12
280	gb|AY706988.1| Vitis riparia dehydrin 1b (DHN1b) gene, partial s...	46	0.12
281	gb|AY159329.1| Nicotiana alata haplotype S7 hypothetical pollen ...	46	0.12
282	gb|AY159328.1| Nicotiana alata haplotype S6 hypothetical pollen ...	46	0.12
283	gb|AY159327.1| Nicotiana alata haplotype S3 hypothetical pollen ...	46	0.12
284	gb|AY159326.1| Nicotiana alata haplotype S2 hypothetical pollen ...	46	0.12
285	gb|AY159325.1| Nicotiana alata haplotype S1 hypothetical pollen ...	46	0.12
286	gb|AY351918.1| Glycine max lea protein (ZLDE-2) mRNA, complete cds	46	0.12
287	gb|AY634281.1| Vitis vinifera dehydrin mRNA, complete cds	46	0.12
288	gb|AF190474.2|AF190474 Boea crassifolia bdn1 (bdn1) mRNA, partia...	46	0.12
289	dbj|AB105039.1| Daucus carota CAISE1 mRNA for dehydrin protein, ...	46	0.12
290	emb|AJ583802.1| Glycine max lea-D-11 gene for dehydrin, cultivar...	46	0.12
291	emb|AJ583800.1| Glycine max lea-D-11 gene for dehydrin, cultivar...	46	0.12
292	emb|AJ277643.1|NAL277643 Nicotiana alata 48A gene	46	0.12
293	emb|X56280.1|RSLEAPR R.sativus mRNA for late embryogenesis abund...	46	0.12
294	emb|X13204.1|GHLEA11 Cotton set 5B Lea gene for seed protein D-11	46	0.12
295	gb|AY130999.1| Brassica juncea dehydrin (DHN1) gene, complete cds	46	0.12
296	gb|AY130998.1| Brassica juncea dehydrin (DHN1) mRNA, complete cds	46	0.12
297	dbj|AB090885.1| Aster tripolium mRNA for dehydrin, complete cds	46	0.12
298	gb|M93568.1|SOYMATSGA Glycine max maturation-assocated protein (...	46	0.12
299	gb|L00921.1|SOYMATPRO Soybean maturation protein (MAT1) gene, co...	46	0.12
300	gb|M19379.1|COTSPE G.hirsutum (cotton) storage protein (late emb...	46	0.12
301	gb|M81791.1|COTLEA3C Gossypium hirsutum DNA fragment	46	0.12
302	gb|M81654.1|COTLEA3A Gossypium hirsutum dehydrin (Lea3-D11) gene...	46	0.12
303	ref|NM_180616.2| Arabidopsis thaliana ERD10 AT1G20450 (ERD10) tr...	44	0.46
304	ref|NM_101895.3| Arabidopsis thaliana ERD10 AT1G20450 (ERD10) tr...	44	0.46
305	ref|NM_127721.2| Arabidopsis thaliana unknown protein AT2G21490 ...	44	0.46
306	gb|AY607707.1| Quercus robur dehydrin 3 (Dhn3) mRNA, complete cds	44	0.46
307	gb|AY737725.1| Salvia miltiorrhiza dehydrin mRNA, partial cds	44	0.46
308	gb|AY695932.1| Salvia miltiorrhiza dehydration protein (bdn1) mR...	44	0.46
309	ref|XM_612059.2| PREDICTED: Bos taurus similar to ankyrin repeat...	44	0.46
310	gb|BT012763.1| Lycopersicon esculentum clone 113709F, mRNA sequence	44	0.46
311	gb|AY706987.1| Vitis riparia dehydrin 1a (DHN1a) gene, complete ...	44	0.46
312	gb|BT000900.1| Arabidopsis thaliana clone C105061 putative dehyd...	44	0.46
313	emb|AJ704826.1| Lactuca sativa partial lea1 gene for putative de...	44	0.46
314	ref|XM_759954.1| Theileria parva strain Muguga hypothetical prot...	44	0.46
315	gb|AY142491.1| Arabidopsis thaliana unknown protein (At1g20450) ...	44	0.46
316	gb|AF360351.1| Arabidopsis thaliana unknown protein (At1g20450) ...	44	0.46
317	gb|AY136407.1| Arabidopsis thaliana unknown protein mRNA, comple...	44	0.46
318	gb|AC006841.7| Arabidopsis thaliana chromosome 2 clone F3K23 map...	44	0.46
319	gb|AC097514.3| Homo sapiens BAC clone RP11-425J20 from 4, comple...	44	0.46
320	gb|AY061911.1| Arabidopsis thaliana At2g21490/F3K23.25 mRNA, com...	44	0.46
321	gb|AY052342.1| Arabidopsis thaliana At2g21490/F3K23.25 mRNA, com...	44	0.46
322	gb|AY048208.1| Arabidopsis thaliana At1g20450/F5M15_20 mRNA, com...	44	0.46
323	emb|BX815233.1|CNS0ACV9 Arabidopsis thaliana Full-length cDNA Co...	44	0.46
324	gb|AY697413.1| Anopheles stephensi Akt (Akt) mRNA, partial cds	44	0.46
325	gb|AY088292.1| Arabidopsis thaliana clone 5256 mRNA, complete se...	44	0.46
326	gb|AY170010.1| Cicer pinnatifidum dehydrin 1 mRNA, complete cds	44	0.46
327	dbj|D17714.1|ATHERD10 Arabidopsis thaliana mRNA for ERD10 protei...	44	0.46
328	emb|X63061.1|PSDHN1 P.sativum mRNA for dehydrin DHN1	44	0.46
329	emb|X51904.1|LETAS14 Lycopersicon esculentum TAS14 mRNA inducibl...	44	0.46
330	emb|Y15813.1|SCRNADHN1 Solanum commersonii mRNA for DHN1 protein	44	0.46
331	emb|X92650.1|HADEHYR H.annuus mRNA for dehydrin related protein	44	0.46
332	emb|X90958.1|ATDLTI29G A.thaliana lti29 gene	44	0.46
333	gb|AF220407.1|AF220407 Vitis riparia dehydrin-like protein (Dhn)...	44	0.46
334	emb|X77614.1|ATLTI45 A.thaliana (Landsberg Erecta) lti45 mRNA	44	0.46
335	emb|X91920.1|ATDEHYDRN A.thaliana mRNA for dehydrin protein	44	0.46
336	ref|XM_311128.2| Anopheles gambiae str. PEST ENSANGP00000017337 ...	44	0.46
337	gb|AY555142.1| Zea mays BAC clone c573F08, complete sequence	44	0.46
338	gb|BT002131.1| Arabidopsis thaliana unknown protein mRNA, comple...	44	0.46
339	gb|U26423.1|LEU26423 Lycopersicon esculentum dehydrin TAS14 (tas...	44	0.46
340	emb|X63063.1|PSDHN3 P.sativum mRNA for dehydrin DHN3	44	0.46
341	gb|AC133286.15| Mus musculus chromosome 1, clone RP24-358J4, com...	42	1.8
342	ref|NM_183534.2| Oryza sativa (japonica cultivar-group), mRNA	42	1.8
343	gb|AC101684.13| Mus musculus chromosome 1, clone RP23-187I13, co...	42	1.8
344	ref|NM_007252.2| Homo sapiens POU domain, class 6, transcription...	42	1.8
345	gb|AY376669.1| Brassica napus dehydrin (ERD10) mRNA, complete cds	42	1.8
346	ref|XM_361310.1| Magnaporthe grisea 70-15 hypothetical protein (...	42	1.8
347	gb|DQ487112.1| Panax ginseng dehydrin 7 (Dhn7) mRNA, complete cds	42	1.8
348	gb|DQ487106.1| Panax ginseng dehydrin 1 (Dhn1) mRNA, complete cds	42	1.8
349	ref|NM_001005619.1| Homo sapiens integrin, beta 4 (ITGB4), trans...	42	1.8
350	ref|NM_000213.3| Homo sapiens integrin, beta 4 (ITGB4), transcri...	42	1.8
351	ref|NM_001005731.1| Homo sapiens integrin, beta 4 (ITGB4), trans...	42	1.8
352	ref|XM_655209.1| Aspergillus nidulans FGSC A4 hypothetical prote...	42	1.8
353	gb|AC005483.1| Homo sapiens PAC clone RP4-806A17 from 7, complet...	42	1.8
354	ref|XM_542977.2| PREDICTED: Canis familiaris similar to otoferli...	42	1.8
355	ref|XM_816528.1| Trypanosoma cruzi strain CL Brener hypothetical...	42	1.8
356	emb|CR356243.16| Zebrafish DNA sequence from clone CH211-209O4 i...	42	1.8
357	gb|AC105403.2| Mus musculus BAC clone RP24-111L5 from 3, complet...	42	1.8
358	emb|BX546490.2| Human DNA sequence from clone RP11-336F23 on chr...	42	1.8
359	gb|BC109238.1| Homo sapiens integrin, beta 4, mRNA (cDNA clone I...	42	1.8
360	ref|XM_502020.1| Yarrowia lipolytica CLIB122, YALI0C19668g predi...	42	1.8
361	emb|AL139132.16| Human DNA sequence from clone RP11-177A2 on chr...	42	1.8
362	emb|BX035006.1|CNS08Z6A Single read from an extremity of a full-...	42	1.8
363	emb|BX009946.1|CNS08FU6 Single read from an extremity of a full-...	42	1.8
364	emb|BX007726.1|CNS08E4I Single read from an extremity of a full-...	42	1.8
365	emb|BX007725.1|CNS08E4H Single read from an extremity of a full-...	42	1.8
366	emb|BX006408.1|CNS08D3W Single read from an extremity of a full-...	42	1.8
367	emb|X77528.1|GCTK2ID G.cydonium TK-2 mRNA, immunoglobulin domain	42	1.8
368	emb|X72622.1|GCTK G.cydonium mRNA for sponge receptor tyrosine k...	42	1.8
369	emb|CR339061.13| Zebrafish DNA sequence from clone CH211-235P24 ...	42	1.8
370	ref|NM_167380.1| Drosophila melanogaster CG32628-RA (CG32628), mRNA	42	1.8
371	ref|XM_689816.1| PREDICTED: Danio rerio similar to protein kinas...	42	1.8
372	gb|AY681974.1| Hordeum vulgare subsp. vulgare dehydrin 13 (Dhn13...	42	1.8
373	dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic D...	42	1.8
374	gb|AC011069.7|AC011069 Drosophila melanogaster, chromosome X, re...	42	1.8
375	gb|AC087749.12| Homo sapiens chromosome 17, clone RP11-474I11, c...	42	1.8
376	dbj|AP002882.2| Oryza sativa (japonica cultivar-group) genomic D...	42	1.8
377	ref|XM_319742.2| Anopheles gambiae str. PEST ENSANGP00000017209 ...	42	1.8
378	dbj|AK108587.1| Oryza sativa (japonica cultivar-group) cDNA clon...	42	1.8
379	gb|BT021456.1| Drosophila melanogaster AT21765 full insert cDNA	42	1.8
380	gb|AY228504.1| Xiphorphorus macualtus xmrk gene, partial sequenc...	42	1.8
381	gb|AY106495.1| Zea mays PCO063105 mRNA sequence	42	1.8
382	gb|AE003493.3| Drosophila melanogaster chromosome X, section 45 ...	42	1.8
383	emb|Y11107.3|HSA011107 Homo sapiens ITGB4 gene for integrin beta...	42	1.8
384	emb|AL935204.10| Zebrafish DNA sequence from clone CH211-230K10,...	42	1.8
385	gb|AE015451.1| Pseudomonas putida KT2440 complete genome	42	1.8
386	gb|U66534.1|HSITGBF06 Human beta4-integrin (ITGB4) gene, exon 14...	42	1.8
387	gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome...	42	1.8
388	emb|AL954160.5|CNS08CCY Oryza sativa chromosome 12, . BAC OSJNBb...	42	1.8
389	emb|AL831806.5|CNS08CAJ Oryza sativa chromosome 12, . BAC OSJNBb...	42	1.8
390	gb|AC131790.4| Mus musculus BAC clone RP24-447L18 from 3, comple...	42	1.8
391	gb|AF011375.1|AF011375 Homo sapiens integrin variant beta4E (ITG...	42	1.8
392	emb|CR382129.1| Yarrowia lipolytica chromosome C of strain CLIB1...	42	1.8
393	gb|U91935.1|HSU91935 Human retina-derived POU-domain factor-1 mR...	42	1.8
394	gb|U91934.1|HSU91934 Human retina-derived POU-domain factor-1 mR...	42	1.8
395	dbj|AB208913.1| Homo sapiens mRNA for integrin beta 4 isoform 3 ...	42	1.8
396	gb|U73215.1|TAU73215 Triticum aestivum cold acclimation protein ...	42	1.8
397	emb|X51841.1|HSINB4 Human mRNA for integrin beta(4)subunit	42	1.8
398	emb|X52186.1|HSINTBE4 Human mRNA for integrin beta-4 subunit	42	1.8
399	emb|X53587.1|HSINTB4R Human mRNA for integrin beta 4	42	1.8
400	gb|AC125495.4| Oryza sativa (japonica cultivar-group) chromosome...	40	7.2
401	gb|AC146896.15| Mus musculus chromosome X clone xcat-28-97f16, c...	40	7.2
402	gb|BC025239.1| Homo sapiens low density lipoprotein receptor-rel...	40	7.2
403	ref|NM_116308.3| Arabidopsis thaliana calmodulin binding AT4G008...	40	7.2
404	gb|DQ111949.1| Prunus persica type II SK2 dehydrin (dhn3) mRNA, ...	40	7.2
405	gb|AY458086.1| Mycobacterium mageritense strain CIP 104973 RecA ...	40	7.2
406	gb|AC108759.2| Oryza sativa (Japonica cultiva-group) chromosome ...	40	7.2
407	ref|XM_550089.1| Oryza sativa (japonica cultivar-group), mRNA	40	7.2
408	ref|NM_188401.1| Oryza sativa (japonica cultivar-group), Ozsa812...	40	7.2
409	ref|XM_493949.1| Oryza sativa (japonica cultivar-group), Ozsa801...	40	7.2
410	gb|AC105318.4| Oryza sativa (japonica cultivar-group) chromosome...	40	7.2
411	gb|CP000148.1| Geobacter metallireducens GS-15, complete genome	40	7.2
412	ref|XM_508193.1| PREDICTED: Pan troglodytes LOC450920 (LOC450920...	40	7.2
413	ref|XM_480046.1| Oryza sativa (japonica cultivar-group), mRNA	40	7.2
414	ref|XM_469182.1| Oryza sativa (japonica cultivar-group), mRNA	40	7.2
415	ref|XM_518798.1| PREDICTED: Pan troglodytes similar to low densi...	40	7.2
416	ref|NM_197678.1| Oryza sativa (japonica cultivar-group) hypothet...	40	7.2
417	ref|NM_197532.1| Oryza sativa (japonica cultivar-group) hypothet...	40	7.2
418	ref|NM_196559.1| Oryza sativa (japonica cultivar-group) hypothet...	40	7.2
419	ref|NM_192133.1| Oryza sativa (japonica cultivar-group), predic...	40	7.2
420	ref|NM_189719.1| Oryza sativa (japonica cultivar-group), predic...	40	7.2
421	ref|XM_479309.1| Oryza sativa (japonica cultivar-group), mRNA	40	7.2
422	ref|NM_185882.1| Oryza sativa (japonica cultivar-group), mRNA	40	7.2
423	ref|XM_474607.1| Oryza sativa (japonica cultivar-group), predic...	40	7.2
424	ref|XM_473320.1| Oryza sativa (japonica cultivar-group), predic...	40	7.2
425	ref|XM_473100.1| Oryza sativa (japonica cultivar-group), predic...	40	7.2
426	ref|XM_472023.1| Oryza sativa (japonica cultivar-group), predic...	40	7.2
427	gb|AC136227.2| Oryza sativa (japonica cultivar-group) chromosome...	40	7.2
428	gb|AC136224.2| Oryza sativa (japonica cultivar-group) chromosome...	40	7.2
429	gb|AC108761.2| Oryza sativa (japonica cultivar-group) chromosome...	40	7.2
430	gb|DP000016.1| Pan troglodytes target 1 genomic scaffold	40	7.2
431	gb|AC118682.8| Mus musculus chromosome 1, clone RP23-448B17, com...	40	7.2
432	gb|AE017341.1| Cryptococcus neoformans var. neoformans JEC21 chr...	40	7.2
433	gb|AC135258.2| Oryza sativa (japonica cultivar-group) chromosome...	40	7.2
434	gb|AC079357.3| Oryza sativa (japonica cultivar-group) chromosome...	40	7.2
435	gb|AC121364.2| Oryza sativa (japonica cultivar-group) chromosome...	40	7.2
436	gb|AE016822.1| Leifsonia xyli subsp. xyli str. CTCB07, complete ...	40	7.2
437	ref|NM_010022.1| Mus musculus dihydrolipoamide branched chain tr...	40	7.2
438	gb|BC077602.1| Xenopus laevis hypothetical protein LOC398524, mR...	40	7.2
439	gb|AC135595.5| Oryza sativa chromosome 3 BAC OSJNBa0028F23 genom...	40	7.2
440	gb|AC108753.2| Oryza sativa (japonica cultivar-group) chromosome...	40	7.2
441	ref|NM_001012806.1| Gallus gallus vacuolar protein sorting 53 (S...	40	7.2
442	gb|BC055890.1| Mus musculus dihydrolipoamide branched chain tran...	40	7.2
443	gb|BC046037.1| Danio rerio zgc:56269, mRNA (cDNA clone MGC:56269...	40	7.2
444	ref|XM_323766.1| Neurospora crassa OR74A hypothetical protein (N...	40	7.2
445	ref|XM_952398.1| Neurospora crassa OR74A hypothetical protein (N...	40	7.2
446	gb|AC119292.2| Oryza sativa (japonica cultivar-group) chromosome...	40	7.2
447	gb|BC049470.1| Danio rerio apolipoprotein Eb, mRNA (cDNA clone M...	40	7.2
448	ref|XM_867620.1| PREDICTED: Bos taurus similar to Disco-interact...	40	7.2
449	gb|AC087264.3| Pan troglodytes clone RP43-150N19, complete sequence	40	7.2
450	gb|AC131743.3| Mus musculus BAC clone RP23-68K21 from chromosome...	40	7.2
451	gb|AC131719.5| Mus musculus BAC clone RP23-151H15 from chromosom...	40	7.2
452	gb|AC122283.3| Mus musculus BAC clone RP23-242G6 from chromosome...	40	7.2
453	ref|NM_131098.1| Danio rerio apolipoprotein Eb (apoeb), mRNA	40	7.2
454	gb|DQ017480.1| Plasmodium falciparum leucine-rich repeat protein...	40	7.2
455	gb|DQ226941.1| Boechera divaricarpa isolate AD-C11 mRNA sequence	40	7.2
456	ref|NM_032648.1| Homo sapiens chromosome 1 open reading frame 90...	40	7.2
457	gb|AC129226.2| Oryza sativa (japonica cultivar-group) chromosome...	40	7.2
458	gb|AC123526.2| Oryza sativa japonica cultivar-group chromosome 1...	40	7.2
459	gb|CP000115.1| Nitrobacter winogradskyi Nb-255, complete genome	40	7.2
460	gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3	40	7.2
461	ref|XM_975670.1| PREDICTED: Mus musculus DIP2 disco-interacting ...	40	7.2
462	ref|XM_989504.1| PREDICTED: Mus musculus DIP2 disco-interacting ...	40	7.2
463	ref|XM_896977.2| PREDICTED: Mus musculus DIP2 disco-interacting ...	40	7.2
464	ref|XM_484214.4| PREDICTED: Mus musculus DIP2 disco-interacting ...	40	7.2
465	gb|AC101902.9| Mus musculus chromosome 1, clone RP24-147M23, com...	40	7.2
466	gb|AC113198.15| Mus musculus chromosome 14, clone RP23-248E15, c...	40	7.2
467	gb|AC134923.2| Oryza sativa (japonica cultivar-group) chromosome...	40	7.2
468	gb|AC135792.3| Oryza sativa chromosome 3 BAC OSJNBa0056E06 genom...	40	7.2
469	emb|CT009556.7| Mouse DNA sequence from clone RP23-87H19 on chro...	40	7.2
470	ref|XM_540517.2| PREDICTED: Canis familiaris similar to beta1,4-...	40	7.2
471	ref|XM_567217.1| Cryptococcus neoformans var. neoformans JEC21 h...	40	7.2
472	gb|AC130210.4| Mus musculus BAC clone RP24-344N22 from chromosom...	40	7.2
473	gb|AC127265.4| Mus musculus BAC clone RP24-341O20 from chromosom...	40	7.2
474	gb|AC122932.4| Mus musculus BAC clone RP23-16A20 from 1, complet...	40	7.2
475	ref|NM_178537.3| Homo sapiens beta-1,4-N-acetyl-galactosaminyl t...	40	7.2
476	gb|AC122857.2| Mus musculus BAC clone RP23-125A8 from 2, complet...	40	7.2
477	gb|AC098730.3| Mus musculus BAC clone RP23-3J2 from 1, complete ...	40	7.2
478	ref|XM_546871.2| PREDICTED: Canis familiaris similar to autoanti...	40	7.2
479	ref|XM_546742.2| PREDICTED: Canis familiaris similar to Y54E10A....	40	7.2
480	gb|AC118346.2| Oryza sativa (japonica cultivar-group) chromosome...	40	7.2
481	ref|XM_961017.1| Plasmodium falciparum 3D7 hypothetical protein ...	40	7.2
482	gb|AC004414.1| Homo sapiens PAC clone RP4-724E13 from 7, complet...	40	7.2
483	gb|BC016788.1| Homo sapiens low density lipoprotein receptor-rel...	40	7.2
484	gb|AC142342.1| Pan troglodytes BAC clone RP43-45D19 from 7, comp...	40	7.2
485	gb|AC093447.17| Mus musculus strain 129/Sv clone ct7-25g12 map X...	40	7.2
486	gb|AY268066.1| Drosophila melanogaster UDP-GalNAc:polypeptide N-...	40	7.2
487	ref|NM_032832.3| Homo sapiens low density lipoprotein receptor-r...	40	7.2
488	emb|AL355312.24| Human DNA sequence from clone RP11-350J20 on ch...	40	7.2
489	gb|CP000283.1| Rhodopseudomonas palustris BisB5, complete genome	40	7.2
490	emb|AL356261.23| Human DNA sequence from clone RP11-49J3 on chro...	40	7.2
491	gb|AY178440.1| Brassica rapa subsp. pekinensis cold-regulated pr...	40	7.2
492	emb|AL157709.17| Human DNA sequence from clone RP11-164C1 on chr...	40	7.2
493	gb|AF181898.6| Homo sapiens chromosome 8 clone GS1-402E12 map p2...	40	7.2
494	emb|AL121991.50|HSDJ675E8 Human DNA sequence from clone RP4-675E...	40	7.2
495	emb|AL121928.13|HSBA18I14 Human DNA sequence from clone RP11-18I...	40	7.2
496	gb|AC137507.3| Oryza sativa chromosome 3 BAC OSJNBb0033J23 genom...	40	7.2
497	gb|AC135643.2| Oryza sativa (japonica cultivar-group) chromosome...	40	7.2
498	gb|AC091680.7| Oryza sativa chromosome 10 BAC OSJNBa0034L04 geno...	40	7.2
499	gb|AF411554.1| Medicago sativa dehydrin-like protein mRNA, compl...	40	7.2
500	gb|BC035906.1| Homo sapiens, clone IMAGE:5247129, mRNA, partial cds	40	7.2

---

>gb|AF043094.1|AF043094 Hordeum vulgare dehydrin 9 (dhn9) gene, complete cds
          Length = 1630

 Score =  854 bits (431), Expect = 0.0
 Identities = 431/431 (100%)
 Strand = Plus / Minus

                                                                        
Query: 25   caagaacacacaaacataaacacaacgcacgctgtatacagaaaagtgtccccgacacag 84
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1394 caagaacacacaaacataaacacaacgcacgctgtatacagaaaagtgtccccgacacag 1335

                                                                        
Query: 85   atgaaatcagaggcaacgtttcgttcagcttcatcttattattgaatgaagatcacgtgg 144
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1334 atgaaatcagaggcaacgtttcgttcagcttcatcttattattgaatgaagatcacgtgg 1275

                                                                        
Query: 145  aactggaaggcttcgacgcgtagctatgcaaaggaagcagccagccggagccggcggctc 204
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1274 aactggaaggcttcgacgcgtagctatgcaaaggaagcagccagccggagccggcggctc 1215

                                                                        
Query: 205  agtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccggtgc 264
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1214 agtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccggtgc 1155

                                                                        
Query: 265  cggccattcctgcgtgcccttgctgcccgtaggctccaccagttccagttcccggcccgt 324
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1154 cggccattcctgcgtgcccttgctgcccgtaggctccaccagttccagttcccggcccgt 1095

                                                                        
Query: 325  atgctcctccggttccagtccccgtcgccatgtgctgctggttgtccttgtggccgccgg 384
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1094 atgctcctccggttccagtccccgtcgccatgtgctgctggttgtccttgtggccgccgg 1035

                                                                        
Query: 385  ggagcttctccttgatcttctccttcatgcccttcttcctcctcccgcccatgccgtcgt 444
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1034 ggagcttctccttgatcttctccttcatgcccttcttcctcctcccgcccatgccgtcgt 975

                       
Query: 445  cctcggaggac 455
            |||||||||||
Sbjct: 974  cctcggaggac 964



 Score =  141 bits (71), Expect = 3e-30
 Identities = 78/79 (98%), Gaps = 1/79 (1%)
 Strand = Plus / Minus

                                                                       
Query: 455 cgagctggagctggagctgccggagcgatgcagtatcccacgggtcttgtgcttcctccc 514
           |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||
Sbjct: 864 cgagctggagctggagctgccggagcgatgcagtatcccacgggtcttgtgc-tcctccc 806

                              
Query: 515 tgcgggcctggaactgccc 533
           |||||||||||||||||||
Sbjct: 805 tgcgggcctggaactgccc 787

---

>gb|AF181459.1|AF181459 Hordeum vulgare dehydrin (Dhn9) gene, complete cds
          Length = 1791

 Score =  846 bits (427), Expect = 0.0
 Identities = 430/431 (99%)
 Strand = Plus / Minus

                                                                        
Query: 25   caagaacacacaaacataaacacaacgcacgctgtatacagaaaagtgtccccgacacag 84
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1334 caagaacacacaaacataaacacaacgcacgctgtatacagaaaagtgtccccgacacag 1275

                                                                        
Query: 85   atgaaatcagaggcaacgtttcgttcagcttcatcttattattgaatgaagatcacgtgg 144
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1274 atgaaatcagaggcaacgtttcgttcagcttcatcttattattgaatgaagatcacgtgg 1215

                                                                        
Query: 145  aactggaaggcttcgacgcgtagctatgcaaaggaagcagccagccggagccggcggctc 204
            ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||
Sbjct: 1214 aactggaaggcttcgacgcgtagctatgcaaagaaagcagccagccggagccggcggctc 1155

                                                                        
Query: 205  agtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccggtgc 264
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1154 agtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccggtgc 1095

                                                                        
Query: 265  cggccattcctgcgtgcccttgctgcccgtaggctccaccagttccagttcccggcccgt 324
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1094 cggccattcctgcgtgcccttgctgcccgtaggctccaccagttccagttcccggcccgt 1035

                                                                        
Query: 325  atgctcctccggttccagtccccgtcgccatgtgctgctggttgtccttgtggccgccgg 384
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1034 atgctcctccggttccagtccccgtcgccatgtgctgctggttgtccttgtggccgccgg 975

                                                                        
Query: 385  ggagcttctccttgatcttctccttcatgcccttcttcctcctcccgcccatgccgtcgt 444
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 974  ggagcttctccttgatcttctccttcatgcccttcttcctcctcccgcccatgccgtcgt 915

                       
Query: 445  cctcggaggac 455
            |||||||||||
Sbjct: 914  cctcggaggac 904



 Score =  141 bits (71), Expect = 3e-30
 Identities = 78/79 (98%), Gaps = 1/79 (1%)
 Strand = Plus / Minus

                                                                       
Query: 455 cgagctggagctggagctgccggagcgatgcagtatcccacgggtcttgtgcttcctccc 514
           |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||
Sbjct: 806 cgagctggagctggagctgccggagcgatgcagtatcccacgggtcttgtgc-tcctccc 748

                              
Query: 515 tgcgggcctggaactgccc 533
           |||||||||||||||||||
Sbjct: 747 tgcgggcctggaactgccc 729

---

>gb|AY349271.1| Hordeum vulgare subsp. spontaneum NPGS PI 559559 dehydrin 9 (Dhn9)
            gene, complete cds
          Length = 1005

 Score =  533 bits (269), Expect = e-148
 Identities = 269/269 (100%)
 Strand = Plus / Minus

                                                                        
Query: 187  agccggagccggcggctcagtgctgtcccggcagcttctccttgatcttgtccatgatcc 246
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1005 agccggagccggcggctcagtgctgtcccggcagcttctccttgatcttgtccatgatcc 946

                                                                        
Query: 247  ccttcttctcgccggtgccggccattcctgcgtgcccttgctgcccgtaggctccaccag 306
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 945  ccttcttctcgccggtgccggccattcctgcgtgcccttgctgcccgtaggctccaccag 886

                                                                        
Query: 307  ttccagttcccggcccgtatgctcctccggttccagtccccgtcgccatgtgctgctggt 366
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 885  ttccagttcccggcccgtatgctcctccggttccagtccccgtcgccatgtgctgctggt 826

                                                                        
Query: 367  tgtccttgtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcc 426
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 825  tgtccttgtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcc 766

                                         
Query: 427  tcccgcccatgccgtcgtcctcggaggac 455
            |||||||||||||||||||||||||||||
Sbjct: 765  tcccgcccatgccgtcgtcctcggaggac 737



 Score =  141 bits (71), Expect = 3e-30
 Identities = 78/79 (98%), Gaps = 1/79 (1%)
 Strand = Plus / Minus

                                                                       
Query: 455 cgagctggagctggagctgccggagcgatgcagtatcccacgggtcttgtgcttcctccc 514
           |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||
Sbjct: 639 cgagctggagctggagctgccggagcgatgcagtatcccacgggtcttgtgc-tcctccc 581

                              
Query: 515 tgcgggcctggaactgccc 533
           |||||||||||||||||||
Sbjct: 580 tgcgggcctggaactgccc 562

---

>gb|AY349270.1| Hordeum vulgare subsp. spontaneum NPGS PI 559556 dehydrin 9 (Dhn9)
            gene, complete cds
          Length = 1007

 Score =  533 bits (269), Expect = e-148
 Identities = 269/269 (100%)
 Strand = Plus / Minus

                                                                        
Query: 187  agccggagccggcggctcagtgctgtcccggcagcttctccttgatcttgtccatgatcc 246
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1007 agccggagccggcggctcagtgctgtcccggcagcttctccttgatcttgtccatgatcc 948

                                                                        
Query: 247  ccttcttctcgccggtgccggccattcctgcgtgcccttgctgcccgtaggctccaccag 306
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 947  ccttcttctcgccggtgccggccattcctgcgtgcccttgctgcccgtaggctccaccag 888

                                                                        
Query: 307  ttccagttcccggcccgtatgctcctccggttccagtccccgtcgccatgtgctgctggt 366
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 887  ttccagttcccggcccgtatgctcctccggttccagtccccgtcgccatgtgctgctggt 828

                                                                        
Query: 367  tgtccttgtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcc 426
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 827  tgtccttgtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcc 768

                                         
Query: 427  tcccgcccatgccgtcgtcctcggaggac 455
            |||||||||||||||||||||||||||||
Sbjct: 767  tcccgcccatgccgtcgtcctcggaggac 739



 Score =  141 bits (71), Expect = 3e-30
 Identities = 78/79 (98%), Gaps = 1/79 (1%)
 Strand = Plus / Minus

                                                                       
Query: 455 cgagctggagctggagctgccggagcgatgcagtatcccacgggtcttgtgcttcctccc 514
           |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||
Sbjct: 639 cgagctggagctggagctgccggagcgatgcagtatcccacgggtcttgtgc-tcctccc 581

                              
Query: 515 tgcgggcctggaactgccc 533
           |||||||||||||||||||
Sbjct: 580 tgcgggcctggaactgccc 562

---

>gb|AY349269.1| Hordeum vulgare subsp. spontaneum NPGS PI 531957 dehydrin 9 (Dhn9)
            gene, complete cds
          Length = 1001

 Score =  533 bits (269), Expect = e-148
 Identities = 269/269 (100%)
 Strand = Plus / Minus

                                                                        
Query: 187  agccggagccggcggctcagtgctgtcccggcagcttctccttgatcttgtccatgatcc 246
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1001 agccggagccggcggctcagtgctgtcccggcagcttctccttgatcttgtccatgatcc 942

                                                                        
Query: 247  ccttcttctcgccggtgccggccattcctgcgtgcccttgctgcccgtaggctccaccag 306
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 941  ccttcttctcgccggtgccggccattcctgcgtgcccttgctgcccgtaggctccaccag 882

                                                                        
Query: 307  ttccagttcccggcccgtatgctcctccggttccagtccccgtcgccatgtgctgctggt 366
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 881  ttccagttcccggcccgtatgctcctccggttccagtccccgtcgccatgtgctgctggt 822

                                                                        
Query: 367  tgtccttgtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcc 426
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 821  tgtccttgtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcc 762

                                         
Query: 427  tcccgcccatgccgtcgtcctcggaggac 455
            |||||||||||||||||||||||||||||
Sbjct: 761  tcccgcccatgccgtcgtcctcggaggac 733



 Score =  141 bits (71), Expect = 3e-30
 Identities = 78/79 (98%), Gaps = 1/79 (1%)
 Strand = Plus / Minus

                                                                       
Query: 455 cgagctggagctggagctgccggagcgatgcagtatcccacgggtcttgtgcttcctccc 514
           |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||
Sbjct: 635 cgagctggagctggagctgccggagcgatgcagtatcccacgggtcttgtgc-tcctccc 577

                              
Query: 515 tgcgggcctggaactgccc 533
           |||||||||||||||||||
Sbjct: 576 tgcgggcctggaactgccc 558

---

>gb|AY349268.1| Hordeum vulgare subsp. spontaneum NPGS PI 531853 dehydrin 9 (Dhn9)
            gene, complete cds
          Length = 1005

 Score =  533 bits (269), Expect = e-148
 Identities = 269/269 (100%)
 Strand = Plus / Minus

                                                                        
Query: 187  agccggagccggcggctcagtgctgtcccggcagcttctccttgatcttgtccatgatcc 246
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1005 agccggagccggcggctcagtgctgtcccggcagcttctccttgatcttgtccatgatcc 946

                                                                        
Query: 247  ccttcttctcgccggtgccggccattcctgcgtgcccttgctgcccgtaggctccaccag 306
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 945  ccttcttctcgccggtgccggccattcctgcgtgcccttgctgcccgtaggctccaccag 886

                                                                        
Query: 307  ttccagttcccggcccgtatgctcctccggttccagtccccgtcgccatgtgctgctggt 366
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 885  ttccagttcccggcccgtatgctcctccggttccagtccccgtcgccatgtgctgctggt 826

                                                                        
Query: 367  tgtccttgtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcc 426
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 825  tgtccttgtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcc 766

                                         
Query: 427  tcccgcccatgccgtcgtcctcggaggac 455
            |||||||||||||||||||||||||||||
Sbjct: 765  tcccgcccatgccgtcgtcctcggaggac 737



 Score =  141 bits (71), Expect = 3e-30
 Identities = 78/79 (98%), Gaps = 1/79 (1%)
 Strand = Plus / Minus

                                                                       
Query: 455 cgagctggagctggagctgccggagcgatgcagtatcccacgggtcttgtgcttcctccc 514
           |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||
Sbjct: 639 cgagctggagctggagctgccggagcgatgcagtatcccacgggtcttgtgc-tcctccc 581

                              
Query: 515 tgcgggcctggaactgccc 533
           |||||||||||||||||||
Sbjct: 580 tgcgggcctggaactgccc 562

---

>gb|AY349267.1| Hordeum vulgare subsp. spontaneum NPGS PI 531851 dehydrin 9 (Dhn9)
            gene, complete cds
          Length = 1005

 Score =  533 bits (269), Expect = e-148
 Identities = 269/269 (100%)
 Strand = Plus / Minus

                                                                        
Query: 187  agccggagccggcggctcagtgctgtcccggcagcttctccttgatcttgtccatgatcc 246
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1005 agccggagccggcggctcagtgctgtcccggcagcttctccttgatcttgtccatgatcc 946

                                                                        
Query: 247  ccttcttctcgccggtgccggccattcctgcgtgcccttgctgcccgtaggctccaccag 306
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 945  ccttcttctcgccggtgccggccattcctgcgtgcccttgctgcccgtaggctccaccag 886

                                                                        
Query: 307  ttccagttcccggcccgtatgctcctccggttccagtccccgtcgccatgtgctgctggt 366
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 885  ttccagttcccggcccgtatgctcctccggttccagtccccgtcgccatgtgctgctggt 826

                                                                        
Query: 367  tgtccttgtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcc 426
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 825  tgtccttgtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcc 766

                                         
Query: 427  tcccgcccatgccgtcgtcctcggaggac 455
            |||||||||||||||||||||||||||||
Sbjct: 765  tcccgcccatgccgtcgtcctcggaggac 737



 Score =  133 bits (67), Expect = 6e-28
 Identities = 77/79 (97%), Gaps = 1/79 (1%)
 Strand = Plus / Minus

                                                                       
Query: 455 cgagctggagctggagctgccggagcgatgcagtatcccacgggtcttgtgcttcctccc 514
           |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||
Sbjct: 639 cgagctggagctggagctgccggagcgatgcagtatcccacgggtcttgtgc-tcctccc 581

                              
Query: 515 tgcgggcctggaactgccc 533
           ||||||| |||||||||||
Sbjct: 580 tgcgggcttggaactgccc 562

---

>gb|AY349266.1| Hordeum vulgare subsp. spontaneum NPGS PI 466460 dehydrin 9 (Dhn9)
           gene, complete cds
          Length = 992

 Score =  533 bits (269), Expect = e-148
 Identities = 269/269 (100%)
 Strand = Plus / Minus

                                                                       
Query: 187 agccggagccggcggctcagtgctgtcccggcagcttctccttgatcttgtccatgatcc 246
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 992 agccggagccggcggctcagtgctgtcccggcagcttctccttgatcttgtccatgatcc 933

                                                                       
Query: 247 ccttcttctcgccggtgccggccattcctgcgtgcccttgctgcccgtaggctccaccag 306
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 932 ccttcttctcgccggtgccggccattcctgcgtgcccttgctgcccgtaggctccaccag 873

                                                                       
Query: 307 ttccagttcccggcccgtatgctcctccggttccagtccccgtcgccatgtgctgctggt 366
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 872 ttccagttcccggcccgtatgctcctccggttccagtccccgtcgccatgtgctgctggt 813

                                                                       
Query: 367 tgtccttgtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcc 426
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 812 tgtccttgtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcc 753

                                        
Query: 427 tcccgcccatgccgtcgtcctcggaggac 455
           |||||||||||||||||||||||||||||
Sbjct: 752 tcccgcccatgccgtcgtcctcggaggac 724



 Score =  141 bits (71), Expect = 3e-30
 Identities = 78/79 (98%), Gaps = 1/79 (1%)
 Strand = Plus / Minus

                                                                       
Query: 455 cgagctggagctggagctgccggagcgatgcagtatcccacgggtcttgtgcttcctccc 514
           |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||
Sbjct: 626 cgagctggagctggagctgccggagcgatgcagtatcccacgggtcttgtgc-tcctccc 568

                              
Query: 515 tgcgggcctggaactgccc 533
           |||||||||||||||||||
Sbjct: 567 tgcgggcctggaactgccc 549

---

>gb|AY349265.1| Hordeum vulgare subsp. spontaneum NPGS PI 420916 dehydrin 9 (Dhn9)
           gene, complete cds
          Length = 994

 Score =  533 bits (269), Expect = e-148
 Identities = 269/269 (100%)
 Strand = Plus / Minus

                                                                       
Query: 187 agccggagccggcggctcagtgctgtcccggcagcttctccttgatcttgtccatgatcc 246
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 994 agccggagccggcggctcagtgctgtcccggcagcttctccttgatcttgtccatgatcc 935

                                                                       
Query: 247 ccttcttctcgccggtgccggccattcctgcgtgcccttgctgcccgtaggctccaccag 306
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 934 ccttcttctcgccggtgccggccattcctgcgtgcccttgctgcccgtaggctccaccag 875

                                                                       
Query: 307 ttccagttcccggcccgtatgctcctccggttccagtccccgtcgccatgtgctgctggt 366
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 874 ttccagttcccggcccgtatgctcctccggttccagtccccgtcgccatgtgctgctggt 815

                                                                       
Query: 367 tgtccttgtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcc 426
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 814 tgtccttgtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcc 755

                                        
Query: 427 tcccgcccatgccgtcgtcctcggaggac 455
           |||||||||||||||||||||||||||||
Sbjct: 754 tcccgcccatgccgtcgtcctcggaggac 726



 Score =  141 bits (71), Expect = 3e-30
 Identities = 78/79 (98%), Gaps = 1/79 (1%)
 Strand = Plus / Minus

                                                                       
Query: 455 cgagctggagctggagctgccggagcgatgcagtatcccacgggtcttgtgcttcctccc 514
           |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||
Sbjct: 628 cgagctggagctggagctgccggagcgatgcagtatcccacgggtcttgtgc-tcctccc 570

                              
Query: 515 tgcgggcctggaactgccc 533
           |||||||||||||||||||
Sbjct: 569 tgcgggcctggaactgccc 551

---

>gb|AY349264.1| Hordeum vulgare subsp. spontaneum NPGS PI 420913 dehydrin 9 (Dhn9)
            gene, complete cds
          Length = 1001

 Score =  533 bits (269), Expect = e-148
 Identities = 269/269 (100%)
 Strand = Plus / Minus

                                                                        
Query: 187  agccggagccggcggctcagtgctgtcccggcagcttctccttgatcttgtccatgatcc 246
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1001 agccggagccggcggctcagtgctgtcccggcagcttctccttgatcttgtccatgatcc 942

                                                                        
Query: 247  ccttcttctcgccggtgccggccattcctgcgtgcccttgctgcccgtaggctccaccag 306
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 941  ccttcttctcgccggtgccggccattcctgcgtgcccttgctgcccgtaggctccaccag 882

                                                                        
Query: 307  ttccagttcccggcccgtatgctcctccggttccagtccccgtcgccatgtgctgctggt 366
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 881  ttccagttcccggcccgtatgctcctccggttccagtccccgtcgccatgtgctgctggt 822

                                                                        
Query: 367  tgtccttgtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcc 426
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 821  tgtccttgtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcc 762

                                         
Query: 427  tcccgcccatgccgtcgtcctcggaggac 455
            |||||||||||||||||||||||||||||
Sbjct: 761  tcccgcccatgccgtcgtcctcggaggac 733



 Score =  141 bits (71), Expect = 3e-30
 Identities = 78/79 (98%), Gaps = 1/79 (1%)
 Strand = Plus / Minus

                                                                       
Query: 455 cgagctggagctggagctgccggagcgatgcagtatcccacgggtcttgtgcttcctccc 514
           |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||
Sbjct: 635 cgagctggagctggagctgccggagcgatgcagtatcccacgggtcttgtgc-tcctccc 577

                              
Query: 515 tgcgggcctggaactgccc 533
           |||||||||||||||||||
Sbjct: 576 tgcgggcctggaactgccc 558

---

>gb|AY349263.1| Hordeum vulgare subsp. spontaneum NPGS PI 420911 dehydrin 9 (Dhn9)
            gene, complete cds
          Length = 1005

 Score =  533 bits (269), Expect = e-148
 Identities = 269/269 (100%)
 Strand = Plus / Minus

                                                                        
Query: 187  agccggagccggcggctcagtgctgtcccggcagcttctccttgatcttgtccatgatcc 246
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1005 agccggagccggcggctcagtgctgtcccggcagcttctccttgatcttgtccatgatcc 946

                                                                        
Query: 247  ccttcttctcgccggtgccggccattcctgcgtgcccttgctgcccgtaggctccaccag 306
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 945  ccttcttctcgccggtgccggccattcctgcgtgcccttgctgcccgtaggctccaccag 886

                                                                        
Query: 307  ttccagttcccggcccgtatgctcctccggttccagtccccgtcgccatgtgctgctggt 366
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 885  ttccagttcccggcccgtatgctcctccggttccagtccccgtcgccatgtgctgctggt 826

                                                                        
Query: 367  tgtccttgtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcc 426
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 825  tgtccttgtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcc 766

                                         
Query: 427  tcccgcccatgccgtcgtcctcggaggac 455
            |||||||||||||||||||||||||||||
Sbjct: 765  tcccgcccatgccgtcgtcctcggaggac 737



 Score =  141 bits (71), Expect = 3e-30
 Identities = 78/79 (98%), Gaps = 1/79 (1%)
 Strand = Plus / Minus

                                                                       
Query: 455 cgagctggagctggagctgccggagcgatgcagtatcccacgggtcttgtgcttcctccc 514
           |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||
Sbjct: 639 cgagctggagctggagctgccggagcgatgcagtatcccacgggtcttgtgc-tcctccc 581

                              
Query: 515 tgcgggcctggaactgccc 533
           |||||||||||||||||||
Sbjct: 580 tgcgggcctggaactgccc 562

---

>gb|AY349262.1| Hordeum vulgare subsp. spontaneum NPGS PI 406276 dehydrin 9 (Dhn9)
            gene, complete cds
          Length = 1000

 Score =  533 bits (269), Expect = e-148
 Identities = 269/269 (100%)
 Strand = Plus / Minus

                                                                        
Query: 187  agccggagccggcggctcagtgctgtcccggcagcttctccttgatcttgtccatgatcc 246
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1000 agccggagccggcggctcagtgctgtcccggcagcttctccttgatcttgtccatgatcc 941

                                                                        
Query: 247  ccttcttctcgccggtgccggccattcctgcgtgcccttgctgcccgtaggctccaccag 306
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 940  ccttcttctcgccggtgccggccattcctgcgtgcccttgctgcccgtaggctccaccag 881

                                                                        
Query: 307  ttccagttcccggcccgtatgctcctccggttccagtccccgtcgccatgtgctgctggt 366
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 880  ttccagttcccggcccgtatgctcctccggttccagtccccgtcgccatgtgctgctggt 821

                                                                        
Query: 367  tgtccttgtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcc 426
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 820  tgtccttgtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcc 761

                                         
Query: 427  tcccgcccatgccgtcgtcctcggaggac 455
            |||||||||||||||||||||||||||||
Sbjct: 760  tcccgcccatgccgtcgtcctcggaggac 732



 Score =  141 bits (71), Expect = 3e-30
 Identities = 78/79 (98%), Gaps = 1/79 (1%)
 Strand = Plus / Minus

                                                                       
Query: 455 cgagctggagctggagctgccggagcgatgcagtatcccacgggtcttgtgcttcctccc 514
           |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||
Sbjct: 634 cgagctggagctggagctgccggagcgatgcagtatcccacgggtcttgtgc-tcctccc 576

                              
Query: 515 tgcgggcctggaactgccc 533
           |||||||||||||||||||
Sbjct: 575 tgcgggcctggaactgccc 557

---

>gb|AY349261.1| Hordeum vulgare subsp. spontaneum NPGS PI 401371 dehydrin 9 (Dhn9)
            gene, complete cds
          Length = 1005

 Score =  533 bits (269), Expect = e-148
 Identities = 269/269 (100%)
 Strand = Plus / Minus

                                                                        
Query: 187  agccggagccggcggctcagtgctgtcccggcagcttctccttgatcttgtccatgatcc 246
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1005 agccggagccggcggctcagtgctgtcccggcagcttctccttgatcttgtccatgatcc 946

                                                                        
Query: 247  ccttcttctcgccggtgccggccattcctgcgtgcccttgctgcccgtaggctccaccag 306
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 945  ccttcttctcgccggtgccggccattcctgcgtgcccttgctgcccgtaggctccaccag 886

                                                                        
Query: 307  ttccagttcccggcccgtatgctcctccggttccagtccccgtcgccatgtgctgctggt 366
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 885  ttccagttcccggcccgtatgctcctccggttccagtccccgtcgccatgtgctgctggt 826

                                                                        
Query: 367  tgtccttgtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcc 426
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 825  tgtccttgtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcc 766

                                         
Query: 427  tcccgcccatgccgtcgtcctcggaggac 455
            |||||||||||||||||||||||||||||
Sbjct: 765  tcccgcccatgccgtcgtcctcggaggac 737



 Score =  141 bits (71), Expect = 3e-30
 Identities = 78/79 (98%), Gaps = 1/79 (1%)
 Strand = Plus / Minus

                                                                       
Query: 455 cgagctggagctggagctgccggagcgatgcagtatcccacgggtcttgtgcttcctccc 514
           |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||
Sbjct: 639 cgagctggagctggagctgccggagcgatgcagtatcccacgggtcttgtgc-tcctccc 581

                              
Query: 515 tgcgggcctggaactgccc 533
           |||||||||||||||||||
Sbjct: 580 tgcgggcctggaactgccc 562

---

>gb|AY349260.1| Hordeum vulgare subsp. spontaneum NPGS PI 401370 dehydrin 9 (Dhn9)
            gene, complete cds
          Length = 1001

 Score =  533 bits (269), Expect = e-148
 Identities = 269/269 (100%)
 Strand = Plus / Minus

                                                                        
Query: 187  agccggagccggcggctcagtgctgtcccggcagcttctccttgatcttgtccatgatcc 246
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1001 agccggagccggcggctcagtgctgtcccggcagcttctccttgatcttgtccatgatcc 942

                                                                        
Query: 247  ccttcttctcgccggtgccggccattcctgcgtgcccttgctgcccgtaggctccaccag 306
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 941  ccttcttctcgccggtgccggccattcctgcgtgcccttgctgcccgtaggctccaccag 882

                                                                        
Query: 307  ttccagttcccggcccgtatgctcctccggttccagtccccgtcgccatgtgctgctggt 366
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 881  ttccagttcccggcccgtatgctcctccggttccagtccccgtcgccatgtgctgctggt 822

                                                                        
Query: 367  tgtccttgtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcc 426
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 821  tgtccttgtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcc 762

                                         
Query: 427  tcccgcccatgccgtcgtcctcggaggac 455
            |||||||||||||||||||||||||||||
Sbjct: 761  tcccgcccatgccgtcgtcctcggaggac 733



 Score =  141 bits (71), Expect = 3e-30
 Identities = 78/79 (98%), Gaps = 1/79 (1%)
 Strand = Plus / Minus

                                                                       
Query: 455 cgagctggagctggagctgccggagcgatgcagtatcccacgggtcttgtgcttcctccc 514
           |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||
Sbjct: 635 cgagctggagctggagctgccggagcgatgcagtatcccacgggtcttgtgc-tcctccc 577

                              
Query: 515 tgcgggcctggaactgccc 533
           |||||||||||||||||||
Sbjct: 576 tgcgggcctggaactgccc 558

---

>gb|AY349259.1| Hordeum vulgare subsp. spontaneum NPGS PI 366446 dehydrin 9 (Dhn9)
            gene, complete cds
          Length = 1007

 Score =  533 bits (269), Expect = e-148
 Identities = 269/269 (100%)
 Strand = Plus / Minus

                                                                        
Query: 187  agccggagccggcggctcagtgctgtcccggcagcttctccttgatcttgtccatgatcc 246
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1007 agccggagccggcggctcagtgctgtcccggcagcttctccttgatcttgtccatgatcc 948

                                                                        
Query: 247  ccttcttctcgccggtgccggccattcctgcgtgcccttgctgcccgtaggctccaccag 306
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 947  ccttcttctcgccggtgccggccattcctgcgtgcccttgctgcccgtaggctccaccag 888

                                                                        
Query: 307  ttccagttcccggcccgtatgctcctccggttccagtccccgtcgccatgtgctgctggt 366
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 887  ttccagttcccggcccgtatgctcctccggttccagtccccgtcgccatgtgctgctggt 828

                                                                        
Query: 367  tgtccttgtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcc 426
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 827  tgtccttgtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcc 768

                                         
Query: 427  tcccgcccatgccgtcgtcctcggaggac 455
            |||||||||||||||||||||||||||||
Sbjct: 767  tcccgcccatgccgtcgtcctcggaggac 739



 Score =  141 bits (71), Expect = 3e-30
 Identities = 78/79 (98%), Gaps = 1/79 (1%)
 Strand = Plus / Minus

                                                                       
Query: 455 cgagctggagctggagctgccggagcgatgcagtatcccacgggtcttgtgcttcctccc 514
           |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||
Sbjct: 639 cgagctggagctggagctgccggagcgatgcagtatcccacgggtcttgtgc-tcctccc 581

                              
Query: 515 tgcgggcctggaactgccc 533
           |||||||||||||||||||
Sbjct: 580 tgcgggcctggaactgccc 562

---

>gb|AY349258.1| Hordeum vulgare subsp. spontaneum NPGS PI 296926 dehydrin 9 (Dhn9)
            gene, complete cds
          Length = 1001

 Score =  533 bits (269), Expect = e-148
 Identities = 269/269 (100%)
 Strand = Plus / Minus

                                                                        
Query: 187  agccggagccggcggctcagtgctgtcccggcagcttctccttgatcttgtccatgatcc 246
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1001 agccggagccggcggctcagtgctgtcccggcagcttctccttgatcttgtccatgatcc 942

                                                                        
Query: 247  ccttcttctcgccggtgccggccattcctgcgtgcccttgctgcccgtaggctccaccag 306
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 941  ccttcttctcgccggtgccggccattcctgcgtgcccttgctgcccgtaggctccaccag 882

                                                                        
Query: 307  ttccagttcccggcccgtatgctcctccggttccagtccccgtcgccatgtgctgctggt 366
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 881  ttccagttcccggcccgtatgctcctccggttccagtccccgtcgccatgtgctgctggt 822

                                                                        
Query: 367  tgtccttgtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcc 426
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 821  tgtccttgtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcc 762

                                         
Query: 427  tcccgcccatgccgtcgtcctcggaggac 455
            |||||||||||||||||||||||||||||
Sbjct: 761  tcccgcccatgccgtcgtcctcggaggac 733



 Score =  133 bits (67), Expect = 6e-28
 Identities = 77/79 (97%), Gaps = 1/79 (1%)
 Strand = Plus / Minus

                                                                       
Query: 455 cgagctggagctggagctgccggagcgatgcagtatcccacgggtcttgtgcttcctccc 514
           |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||
Sbjct: 635 cgagctggagctggagctgccggagcgatgcagtatcccacgggtcttgtgc-tcctccc 577

                              
Query: 515 tgcgggcctggaactgccc 533
           ||||||| |||||||||||
Sbjct: 576 tgcgggcttggaactgccc 558

---

>gb|AY349257.1| Hordeum vulgare subsp. spontaneum NPGS PI 293411 dehydrin 9 (Dhn9)
            gene, complete cds
          Length = 1007

 Score =  533 bits (269), Expect = e-148
 Identities = 269/269 (100%)
 Strand = Plus / Minus

                                                                        
Query: 187  agccggagccggcggctcagtgctgtcccggcagcttctccttgatcttgtccatgatcc 246
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1007 agccggagccggcggctcagtgctgtcccggcagcttctccttgatcttgtccatgatcc 948

                                                                        
Query: 247  ccttcttctcgccggtgccggccattcctgcgtgcccttgctgcccgtaggctccaccag 306
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 947  ccttcttctcgccggtgccggccattcctgcgtgcccttgctgcccgtaggctccaccag 888

                                                                        
Query: 307  ttccagttcccggcccgtatgctcctccggttccagtccccgtcgccatgtgctgctggt 366
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 887  ttccagttcccggcccgtatgctcctccggttccagtccccgtcgccatgtgctgctggt 828

                                                                        
Query: 367  tgtccttgtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcc 426
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 827  tgtccttgtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcc 768

                                         
Query: 427  tcccgcccatgccgtcgtcctcggaggac 455
            |||||||||||||||||||||||||||||
Sbjct: 767  tcccgcccatgccgtcgtcctcggaggac 739



 Score =  141 bits (71), Expect = 3e-30
 Identities = 78/79 (98%), Gaps = 1/79 (1%)
 Strand = Plus / Minus

                                                                       
Query: 455 cgagctggagctggagctgccggagcgatgcagtatcccacgggtcttgtgcttcctccc 514
           |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||
Sbjct: 639 cgagctggagctggagctgccggagcgatgcagtatcccacgggtcttgtgc-tcctccc 581

                              
Query: 515 tgcgggcctggaactgccc 533
           |||||||||||||||||||
Sbjct: 580 tgcgggcctggaactgccc 562

---

>gb|AY349256.1| Hordeum vulgare subsp. spontaneum NPGS PI 293409 dehydrin 9 (Dhn9)
            gene, complete cds
          Length = 1001

 Score =  533 bits (269), Expect = e-148
 Identities = 269/269 (100%)
 Strand = Plus / Minus

                                                                        
Query: 187  agccggagccggcggctcagtgctgtcccggcagcttctccttgatcttgtccatgatcc 246
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1001 agccggagccggcggctcagtgctgtcccggcagcttctccttgatcttgtccatgatcc 942

                                                                        
Query: 247  ccttcttctcgccggtgccggccattcctgcgtgcccttgctgcccgtaggctccaccag 306
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 941  ccttcttctcgccggtgccggccattcctgcgtgcccttgctgcccgtaggctccaccag 882

                                                                        
Query: 307  ttccagttcccggcccgtatgctcctccggttccagtccccgtcgccatgtgctgctggt 366
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 881  ttccagttcccggcccgtatgctcctccggttccagtccccgtcgccatgtgctgctggt 822

                                                                        
Query: 367  tgtccttgtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcc 426
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 821  tgtccttgtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcc 762

                                         
Query: 427  tcccgcccatgccgtcgtcctcggaggac 455
            |||||||||||||||||||||||||||||
Sbjct: 761  tcccgcccatgccgtcgtcctcggaggac 733



 Score =  141 bits (71), Expect = 3e-30
 Identities = 78/79 (98%), Gaps = 1/79 (1%)
 Strand = Plus / Minus

                                                                       
Query: 455 cgagctggagctggagctgccggagcgatgcagtatcccacgggtcttgtgcttcctccc 514
           |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||
Sbjct: 635 cgagctggagctggagctgccggagcgatgcagtatcccacgggtcttgtgc-tcctccc 577

                              
Query: 515 tgcgggcctggaactgccc 533
           |||||||||||||||||||
Sbjct: 576 tgcgggcctggaactgccc 558

---

>gb|AY349255.1| Hordeum vulgare subsp. spontaneum NPGS PI 293402 dehydrin 9 (Dhn9)
            gene, complete cds
          Length = 1001

 Score =  533 bits (269), Expect = e-148
 Identities = 269/269 (100%)
 Strand = Plus / Minus

                                                                        
Query: 187  agccggagccggcggctcagtgctgtcccggcagcttctccttgatcttgtccatgatcc 246
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1001 agccggagccggcggctcagtgctgtcccggcagcttctccttgatcttgtccatgatcc 942

                                                                        
Query: 247  ccttcttctcgccggtgccggccattcctgcgtgcccttgctgcccgtaggctccaccag 306
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 941  ccttcttctcgccggtgccggccattcctgcgtgcccttgctgcccgtaggctccaccag 882

                                                                        
Query: 307  ttccagttcccggcccgtatgctcctccggttccagtccccgtcgccatgtgctgctggt 366
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 881  ttccagttcccggcccgtatgctcctccggttccagtccccgtcgccatgtgctgctggt 822

                                                                        
Query: 367  tgtccttgtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcc 426
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 821  tgtccttgtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcc 762

                                         
Query: 427  tcccgcccatgccgtcgtcctcggaggac 455
            |||||||||||||||||||||||||||||
Sbjct: 761  tcccgcccatgccgtcgtcctcggaggac 733



 Score =  141 bits (71), Expect = 3e-30
 Identities = 78/79 (98%), Gaps = 1/79 (1%)
 Strand = Plus / Minus

                                                                       
Query: 455 cgagctggagctggagctgccggagcgatgcagtatcccacgggtcttgtgcttcctccc 514
           |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||
Sbjct: 635 cgagctggagctggagctgccggagcgatgcagtatcccacgggtcttgtgc-tcctccc 577

                              
Query: 515 tgcgggcctggaactgccc 533
           |||||||||||||||||||
Sbjct: 576 tgcgggcctggaactgccc 558

---

>gb|AY349254.1| Hordeum vulgare subsp. spontaneum NPGS PI 268242 dehydrin 9 (Dhn9)
            gene, complete cds
          Length = 1001

 Score =  533 bits (269), Expect = e-148
 Identities = 269/269 (100%)
 Strand = Plus / Minus

                                                                        
Query: 187  agccggagccggcggctcagtgctgtcccggcagcttctccttgatcttgtccatgatcc 246
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1001 agccggagccggcggctcagtgctgtcccggcagcttctccttgatcttgtccatgatcc 942

                                                                        
Query: 247  ccttcttctcgccggtgccggccattcctgcgtgcccttgctgcccgtaggctccaccag 306
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 941  ccttcttctcgccggtgccggccattcctgcgtgcccttgctgcccgtaggctccaccag 882

                                                                        
Query: 307  ttccagttcccggcccgtatgctcctccggttccagtccccgtcgccatgtgctgctggt 366
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 881  ttccagttcccggcccgtatgctcctccggttccagtccccgtcgccatgtgctgctggt 822

                                                                        
Query: 367  tgtccttgtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcc 426
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 821  tgtccttgtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcc 762

                                         
Query: 427  tcccgcccatgccgtcgtcctcggaggac 455
            |||||||||||||||||||||||||||||
Sbjct: 761  tcccgcccatgccgtcgtcctcggaggac 733



 Score =  141 bits (71), Expect = 3e-30
 Identities = 78/79 (98%), Gaps = 1/79 (1%)
 Strand = Plus / Minus

                                                                       
Query: 455 cgagctggagctggagctgccggagcgatgcagtatcccacgggtcttgtgcttcctccc 514
           |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||
Sbjct: 635 cgagctggagctggagctgccggagcgatgcagtatcccacgggtcttgtgc-tcctccc 577

                              
Query: 515 tgcgggcctggaactgccc 533
           |||||||||||||||||||
Sbjct: 576 tgcgggcctggaactgccc 558

---

>gb|AY349253.1| Hordeum vulgare subsp. spontaneum NPGS PI 254894 dehydrin 9 (Dhn9)
            gene, complete cds
          Length = 1001

 Score =  533 bits (269), Expect = e-148
 Identities = 269/269 (100%)
 Strand = Plus / Minus

                                                                        
Query: 187  agccggagccggcggctcagtgctgtcccggcagcttctccttgatcttgtccatgatcc 246
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1001 agccggagccggcggctcagtgctgtcccggcagcttctccttgatcttgtccatgatcc 942

                                                                        
Query: 247  ccttcttctcgccggtgccggccattcctgcgtgcccttgctgcccgtaggctccaccag 306
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 941  ccttcttctcgccggtgccggccattcctgcgtgcccttgctgcccgtaggctccaccag 882

                                                                        
Query: 307  ttccagttcccggcccgtatgctcctccggttccagtccccgtcgccatgtgctgctggt 366
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 881  ttccagttcccggcccgtatgctcctccggttccagtccccgtcgccatgtgctgctggt 822

                                                                        
Query: 367  tgtccttgtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcc 426
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 821  tgtccttgtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcc 762

                                         
Query: 427  tcccgcccatgccgtcgtcctcggaggac 455
            |||||||||||||||||||||||||||||
Sbjct: 761  tcccgcccatgccgtcgtcctcggaggac 733



 Score =  141 bits (71), Expect = 3e-30
 Identities = 78/79 (98%), Gaps = 1/79 (1%)
 Strand = Plus / Minus

                                                                       
Query: 455 cgagctggagctggagctgccggagcgatgcagtatcccacgggtcttgtgcttcctccc 514
           |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||
Sbjct: 635 cgagctggagctggagctgccggagcgatgcagtatcccacgggtcttgtgc-tcctccc 577

                              
Query: 515 tgcgggcctggaactgccc 533
           |||||||||||||||||||
Sbjct: 576 tgcgggcctggaactgccc 558

---

>gb|AY349252.1| Hordeum vulgare subsp. spontaneum NPGS PI 253933 dehydrin 9 (Dhn9)
            gene, complete cds
          Length = 1001

 Score =  533 bits (269), Expect = e-148
 Identities = 269/269 (100%)
 Strand = Plus / Minus

                                                                        
Query: 187  agccggagccggcggctcagtgctgtcccggcagcttctccttgatcttgtccatgatcc 246
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1001 agccggagccggcggctcagtgctgtcccggcagcttctccttgatcttgtccatgatcc 942

                                                                        
Query: 247  ccttcttctcgccggtgccggccattcctgcgtgcccttgctgcccgtaggctccaccag 306
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 941  ccttcttctcgccggtgccggccattcctgcgtgcccttgctgcccgtaggctccaccag 882

                                                                        
Query: 307  ttccagttcccggcccgtatgctcctccggttccagtccccgtcgccatgtgctgctggt 366
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 881  ttccagttcccggcccgtatgctcctccggttccagtccccgtcgccatgtgctgctggt 822

                                                                        
Query: 367  tgtccttgtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcc 426
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 821  tgtccttgtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcc 762

                                         
Query: 427  tcccgcccatgccgtcgtcctcggaggac 455
            |||||||||||||||||||||||||||||
Sbjct: 761  tcccgcccatgccgtcgtcctcggaggac 733



 Score =  141 bits (71), Expect = 3e-30
 Identities = 78/79 (98%), Gaps = 1/79 (1%)
 Strand = Plus / Minus

                                                                       
Query: 455 cgagctggagctggagctgccggagcgatgcagtatcccacgggtcttgtgcttcctccc 514
           |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||
Sbjct: 635 cgagctggagctggagctgccggagcgatgcagtatcccacgggtcttgtgc-tcctccc 577

                              
Query: 515 tgcgggcctggaactgccc 533
           |||||||||||||||||||
Sbjct: 576 tgcgggcctggaactgccc 558

---

>gb|AY349251.1| Hordeum vulgare subsp. spontaneum NPGS PI 236388 dehydrin 9 (Dhn9)
            gene, complete cds
          Length = 1004

 Score =  533 bits (269), Expect = e-148
 Identities = 269/269 (100%)
 Strand = Plus / Minus

                                                                        
Query: 187  agccggagccggcggctcagtgctgtcccggcagcttctccttgatcttgtccatgatcc 246
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1004 agccggagccggcggctcagtgctgtcccggcagcttctccttgatcttgtccatgatcc 945

                                                                        
Query: 247  ccttcttctcgccggtgccggccattcctgcgtgcccttgctgcccgtaggctccaccag 306
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 944  ccttcttctcgccggtgccggccattcctgcgtgcccttgctgcccgtaggctccaccag 885

                                                                        
Query: 307  ttccagttcccggcccgtatgctcctccggttccagtccccgtcgccatgtgctgctggt 366
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 884  ttccagttcccggcccgtatgctcctccggttccagtccccgtcgccatgtgctgctggt 825

                                                                        
Query: 367  tgtccttgtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcc 426
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 824  tgtccttgtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcc 765

                                         
Query: 427  tcccgcccatgccgtcgtcctcggaggac 455
            |||||||||||||||||||||||||||||
Sbjct: 764  tcccgcccatgccgtcgtcctcggaggac 736



 Score =  141 bits (71), Expect = 3e-30
 Identities = 78/79 (98%), Gaps = 1/79 (1%)
 Strand = Plus / Minus

                                                                       
Query: 455 cgagctggagctggagctgccggagcgatgcagtatcccacgggtcttgtgcttcctccc 514
           |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||
Sbjct: 638 cgagctggagctggagctgccggagcgatgcagtatcccacgggtcttgtgc-tcctccc 580

                              
Query: 515 tgcgggcctggaactgccc 533
           |||||||||||||||||||
Sbjct: 579 tgcgggcctggaactgccc 561

---

>gb|AY349250.1| Hordeum vulgare subsp. spontaneum NPGS PI 220523 dehydrin 9 (Dhn9)
            gene, complete cds
          Length = 1001

 Score =  533 bits (269), Expect = e-148
 Identities = 269/269 (100%)
 Strand = Plus / Minus

                                                                        
Query: 187  agccggagccggcggctcagtgctgtcccggcagcttctccttgatcttgtccatgatcc 246
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1001 agccggagccggcggctcagtgctgtcccggcagcttctccttgatcttgtccatgatcc 942

                                                                        
Query: 247  ccttcttctcgccggtgccggccattcctgcgtgcccttgctgcccgtaggctccaccag 306
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 941  ccttcttctcgccggtgccggccattcctgcgtgcccttgctgcccgtaggctccaccag 882

                                                                        
Query: 307  ttccagttcccggcccgtatgctcctccggttccagtccccgtcgccatgtgctgctggt 366
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 881  ttccagttcccggcccgtatgctcctccggttccagtccccgtcgccatgtgctgctggt 822

                                                                        
Query: 367  tgtccttgtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcc 426
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 821  tgtccttgtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcc 762

                                         
Query: 427  tcccgcccatgccgtcgtcctcggaggac 455
            |||||||||||||||||||||||||||||
Sbjct: 761  tcccgcccatgccgtcgtcctcggaggac 733



 Score =  141 bits (71), Expect = 3e-30
 Identities = 78/79 (98%), Gaps = 1/79 (1%)
 Strand = Plus / Minus

                                                                       
Query: 455 cgagctggagctggagctgccggagcgatgcagtatcccacgggtcttgtgcttcctccc 514
           |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||
Sbjct: 635 cgagctggagctggagctgccggagcgatgcagtatcccacgggtcttgtgc-tcctccc 577

                              
Query: 515 tgcgggcctggaactgccc 533
           |||||||||||||||||||
Sbjct: 576 tgcgggcctggaactgccc 558

---

>gb|AY349249.1| Hordeum vulgare subsp. spontaneum NPGS PI 219796 dehydrin 9 (Dhn9)
            gene, complete cds
          Length = 1007

 Score =  533 bits (269), Expect = e-148
 Identities = 269/269 (100%)
 Strand = Plus / Minus

                                                                        
Query: 187  agccggagccggcggctcagtgctgtcccggcagcttctccttgatcttgtccatgatcc 246
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1007 agccggagccggcggctcagtgctgtcccggcagcttctccttgatcttgtccatgatcc 948

                                                                        
Query: 247  ccttcttctcgccggtgccggccattcctgcgtgcccttgctgcccgtaggctccaccag 306
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 947  ccttcttctcgccggtgccggccattcctgcgtgcccttgctgcccgtaggctccaccag 888

                                                                        
Query: 307  ttccagttcccggcccgtatgctcctccggttccagtccccgtcgccatgtgctgctggt 366
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 887  ttccagttcccggcccgtatgctcctccggttccagtccccgtcgccatgtgctgctggt 828

                                                                        
Query: 367  tgtccttgtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcc 426
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 827  tgtccttgtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcc 768

                                         
Query: 427  tcccgcccatgccgtcgtcctcggaggac 455
            |||||||||||||||||||||||||||||
Sbjct: 767  tcccgcccatgccgtcgtcctcggaggac 739



 Score =  141 bits (71), Expect = 3e-30
 Identities = 78/79 (98%), Gaps = 1/79 (1%)
 Strand = Plus / Minus

                                                                       
Query: 455 cgagctggagctggagctgccggagcgatgcagtatcccacgggtcttgtgcttcctccc 514
           |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||
Sbjct: 639 cgagctggagctggagctgccggagcgatgcagtatcccacgggtcttgtgc-tcctccc 581

                              
Query: 515 tgcgggcctggaactgccc 533
           |||||||||||||||||||
Sbjct: 580 tgcgggcctggaactgccc 562

---

>gb|AY349248.1| Hordeum vulgare subsp. spontaneum NPGS PI 212306 dehydrin 9 (Dhn9)
            gene, complete cds
          Length = 1001

 Score =  533 bits (269), Expect = e-148
 Identities = 269/269 (100%)
 Strand = Plus / Minus

                                                                        
Query: 187  agccggagccggcggctcagtgctgtcccggcagcttctccttgatcttgtccatgatcc 246
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1001 agccggagccggcggctcagtgctgtcccggcagcttctccttgatcttgtccatgatcc 942

                                                                        
Query: 247  ccttcttctcgccggtgccggccattcctgcgtgcccttgctgcccgtaggctccaccag 306
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 941  ccttcttctcgccggtgccggccattcctgcgtgcccttgctgcccgtaggctccaccag 882

                                                                        
Query: 307  ttccagttcccggcccgtatgctcctccggttccagtccccgtcgccatgtgctgctggt 366
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 881  ttccagttcccggcccgtatgctcctccggttccagtccccgtcgccatgtgctgctggt 822

                                                                        
Query: 367  tgtccttgtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcc 426
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 821  tgtccttgtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcc 762

                                         
Query: 427  tcccgcccatgccgtcgtcctcggaggac 455
            |||||||||||||||||||||||||||||
Sbjct: 761  tcccgcccatgccgtcgtcctcggaggac 733



 Score =  141 bits (71), Expect = 3e-30
 Identities = 78/79 (98%), Gaps = 1/79 (1%)
 Strand = Plus / Minus

                                                                       
Query: 455 cgagctggagctggagctgccggagcgatgcagtatcccacgggtcttgtgcttcctccc 514
           |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||
Sbjct: 635 cgagctggagctggagctgccggagcgatgcagtatcccacgggtcttgtgc-tcctccc 577

                              
Query: 515 tgcgggcctggaactgccc 533
           |||||||||||||||||||
Sbjct: 576 tgcgggcctggaactgccc 558

---

>gb|AY349247.1| Hordeum vulgare subsp. spontaneum NPGS PI 212305 dehydrin 9 (Dhn9)
            gene, complete cds
          Length = 1007

 Score =  533 bits (269), Expect = e-148
 Identities = 269/269 (100%)
 Strand = Plus / Minus

                                                                        
Query: 187  agccggagccggcggctcagtgctgtcccggcagcttctccttgatcttgtccatgatcc 246
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1007 agccggagccggcggctcagtgctgtcccggcagcttctccttgatcttgtccatgatcc 948

                                                                        
Query: 247  ccttcttctcgccggtgccggccattcctgcgtgcccttgctgcccgtaggctccaccag 306
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 947  ccttcttctcgccggtgccggccattcctgcgtgcccttgctgcccgtaggctccaccag 888

                                                                        
Query: 307  ttccagttcccggcccgtatgctcctccggttccagtccccgtcgccatgtgctgctggt 366
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 887  ttccagttcccggcccgtatgctcctccggttccagtccccgtcgccatgtgctgctggt 828

                                                                        
Query: 367  tgtccttgtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcc 426
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 827  tgtccttgtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcc 768

                                         
Query: 427  tcccgcccatgccgtcgtcctcggaggac 455
            |||||||||||||||||||||||||||||
Sbjct: 767  tcccgcccatgccgtcgtcctcggaggac 739



 Score =  141 bits (71), Expect = 3e-30
 Identities = 78/79 (98%), Gaps = 1/79 (1%)
 Strand = Plus / Minus

                                                                       
Query: 455 cgagctggagctggagctgccggagcgatgcagtatcccacgggtcttgtgcttcctccc 514
           |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||
Sbjct: 639 cgagctggagctggagctgccggagcgatgcagtatcccacgggtcttgtgc-tcctccc 581

                              
Query: 515 tgcgggcctggaactgccc 533
           |||||||||||||||||||
Sbjct: 580 tgcgggcctggaactgccc 562

---

>emb|X78431.1|TDDEH27 T.durum Desf. (Siliana) Dehydrin mRNA, clone pTd27e
          Length = 751

 Score =  406 bits (205), Expect = e-110
 Identities = 260/277 (93%), Gaps = 1/277 (0%)
 Strand = Plus / Minus

                                                                       
Query: 257 gccggtgccggccattcctgcgtgcccttgctgcccgtaggctccaccagttccagttcc 316
           ||||| |||||||||||||||||| |||||||||||||||||||||||||||||||| ||
Sbjct: 439 gccggcgccggccattcctgcgtggccttgctgcccgtaggctccaccagttccagtccc 380

                                                                       
Query: 317 cggcccgtatgctcctccggttccagtccccgtcgccatgtgctgctggttgtccttgtg 376
           ||||||||| |||||||| || || || || |||||||||||||||||||||||||||||
Sbjct: 379 cggcccgtaggctcctccagtccctgtaccagtcgccatgtgctgctggttgtccttgtg 320

                                                                       
Query: 377 gccgccggggagcttctccttgatcttctccttcatgcccttcttcctcctcccgcccat 436
           |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||
Sbjct: 319 gccgccggggagcttctccttgatcttctctttcatgcccttcttcctcctcccgcccat 260

                                                                       
Query: 437 gccgtcgtcctcggaggacgagctggagctggagctgccggagcgatgcagtatcccacg 496
           ||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||| 
Sbjct: 259 gccgtcgtcctcggaagacgagctggagctggagctgccggagcgatgcaggatcccacc 200

                                                
Query: 497 ggtcttgtgcttcctccctgcgggcctggaactgccc 533
           |||||||||| ||  ||||||||||||| ||||||||
Sbjct: 199 ggtcttgtgc-tctcccctgcgggcctgtaactgccc 164



 Score =  260 bits (131), Expect = 4e-66
 Identities = 208/231 (90%), Gaps = 7/231 (3%)
 Strand = Plus / Minus

                                                                       
Query: 42  aaacacaacgcacgctgtatacagaaaagtgtccccgacacagatgaaatcagaggcaac 101
           |||||| |||||||||||||||||||||||||||| |||||||| || ||||||| ||| 
Sbjct: 673 aaacacgacgcacgctgtatacagaaaagtgtccctgacacagacgagatcagagacaag 614

                                                                       
Query: 102 gtttcgttcagcttcatcttattatt---gaatgaa--gatcacgtggaactggaaggct 156
            |||||||| ||||||||||||||||   |||  ||  |||||||||||||| |||||| 
Sbjct: 613 ttttcgttctgcttcatcttattattattgaacaaaaagatcacgtggaactagaaggca 554

                                                                       
Query: 157 tcgacgcgt--agctatgcaaaggaagcagccagccggagccggcggctcagtgctgtcc 214
           | |||||||  ||||||||||||||||| |||||||||||||| ||||||||||||||||
Sbjct: 553 ttgacgcgtgtagctatgcaaaggaagcggccagccggagccgtcggctcagtgctgtcc 494

                                                              
Query: 215 cggcagcttctccttgatcttgtccatgatccccttcttctcgccggtgcc 265
           ||||||||||||||| |||||||||||||||||||||||||||||||||||
Sbjct: 493 cggcagcttctccttaatcttgtccatgatccccttcttctcgccggtgcc 443

---

>emb|X59133.1|TARAB T.aestivum L. mRNA for an ABA responsive gene, rab
          Length = 781

 Score =  383 bits (193), Expect = e-103
 Identities = 258/277 (93%), Gaps = 2/277 (0%)
 Strand = Plus / Minus

                                                                       
Query: 257 gccggtgccggccattcctgcgtgcccttgctgcccgtaggctccaccagttccagttcc 316
           ||||| |||||||||||||| ||| |||||||||||||||||||||||||| ||||||||
Sbjct: 408 gccggcgccggccattcctgtgtggccttgctgcccgtaggctccaccagtcccagttcc 349

                                                                       
Query: 317 cggcccgtatgctcctccggttccagtccccgtcgccatgtgctgctggttgtccttgtg 376
           ||||||||| |||||||| || || |||||||||||||| ||||||||||||||||||||
Sbjct: 348 cggcccgtaggctcctccagtccctgtccccgtcgccatatgctgctggttgtccttgtg 289

                                                                       
Query: 377 gccgccggggagcttctccttgatcttctccttcatgcccttcttcctcctcccgcccat 436
           ||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||
Sbjct: 288 gccaccggggagcttctccttgatcttctccttcatgcccttctttctcctcccgcccat 229

                                                                       
Query: 437 gccgtcgtcctcggaggacgagctggagctggagctgccggagcgatgcagtatcccacg 496
           ||||||||||||||| ||||||||||||||||||||||||||||||||||| || |||| 
Sbjct: 228 gccgtcgtcctcggaagacgagctggagctggagctgccggagcgatgcaggat-ccacc 170

                                                
Query: 497 ggtcttgtgcttcctccctgcgggcctggaactgccc 533
           |||||||||| ||  ||||| ||||||||||||||||
Sbjct: 169 ggtcttgtgc-tctcccctgtgggcctggaactgccc 134



 Score =  264 bits (133), Expect = 3e-67
 Identities = 204/225 (90%), Gaps = 7/225 (3%)
 Strand = Plus / Minus

                                                                       
Query: 44  acacaacgcacgctgtatacagaaaagtgtccccgacacagatgaaatcagaggcaacgt 103
           ||||||||||||||||||||||||||||||||| ||| | ||||  ||||||| |||| |
Sbjct: 632 acacaacgcacgctgtatacagaaaagtgtccctgacgcggatgcgatcagagacaactt 573

                                                                       
Query: 104 ttcgttcagcttcatcttattatt---gaatgaagatcacgtggaactggaaggcttcga 160
           ||||||||||||||||||||||||   |||  ||||||||||||||||||||||||| ||
Sbjct: 572 ttcgttcagcttcatcttattattattgaacaaagatcacgtggaactggaaggctttga 513

                                                                       
Query: 161 cgcgtagctatgcaaaggaagcagccagccggagccggcggctcagtgctgtcccggcag 220
           | ||||||||    ||||||||||||||||||| |||| |||||||||||||||||||||
Sbjct: 512 cccgtagctac---aaggaagcagccagccgga-ccggtggctcagtgctgtcccggcag 457

                                                        
Query: 221 cttctccttgatcttgtccatgatccccttcttctcgccggtgcc 265
           ||||||||||||||||||||||||||||||||||||||| |||||
Sbjct: 456 cttctccttgatcttgtccatgatccccttcttctcgcccgtgcc 412



 Score = 40.1 bits (20), Expect = 7.2
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 387 agcttctccttgatcttctccttcatgcccttcttc 422
           ||||||||||||||||| ||| | || |||||||||
Sbjct: 458 agcttctccttgatcttgtccatgatccccttcttc 423

---

>gb|AY619566.1| Triticum turgidum subsp. durum dehydrin mRNA, complete cds
          Length = 1124

 Score =  238 bits (120), Expect = 2e-59
 Identities = 151/160 (94%), Gaps = 1/160 (0%)
 Strand = Plus / Minus

                                                                       
Query: 374 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcctcccgcc 433
           |||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||
Sbjct: 366 gtggccaccggggagcttctccttgatcttctccttcatgcccttctttctcctcccgcc 307

                                                                       
Query: 434 catgccgtcgtcctcggaggacgagctggagctggagctgccggagcgatgcagtatccc 493
           |||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||
Sbjct: 306 catgccgtcgtcctcggaagacgagctggagctggagctgccggagcgatgcaggatccc 247

                                                   
Query: 494 acgggtcttgtgcttcctccctgcgggcctggaactgccc 533
           || |||||||||| ||  ||||| ||||||||||||||||
Sbjct: 246 accggtcttgtgc-tctcccctgtgggcctggaactgccc 208



 Score = 93.7 bits (47), Expect = 6e-16
 Identities = 59/63 (93%)
 Strand = Plus / Minus

                                                                       
Query: 201 gctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccg 260
           ||||||||||| || || |||||||||||||||||||||||||| |||||||||||||||
Sbjct: 782 gctcagtgctggcctgggagcttctccttgatcttgtccatgatgcccttcttctcgccg 723

              
Query: 261 gtg 263
           |||
Sbjct: 722 gtg 720



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 384 gggagcttctccttgatcttctccttcatgcccttcttc 422
           |||||||||||||||||||| ||| | ||||||||||||
Sbjct: 767 gggagcttctccttgatcttgtccatgatgcccttcttc 729



 Score = 40.1 bits (20), Expect = 7.2
 Identities = 35/40 (87%)
 Strand = Plus / Minus

                                                   
Query: 258 ccggtgccggccattcctgcgtgcccttgctgcccgtagg 297
           |||||||||||||| || | ||| |||||||| |||||||
Sbjct: 608 ccggtgccggccatcccggtgtggccttgctgtccgtagg 569

---

>emb|AJ622891.1| Triticum durum partial mRNA for DRP4 protein (drg4 gene)
          Length = 221

 Score =  212 bits (107), Expect = 9e-52
 Identities = 141/151 (93%), Gaps = 1/151 (0%)
 Strand = Plus / Minus

                                                                       
Query: 383 ggggagcttctccttgatcttctccttcatgcccttcttcctcctcccgcccatgccgtc 442
           |||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||
Sbjct: 221 ggggagcttctccttgatcttctccttcattcccttcttcttcctcccgcccatgccgtc 162

                                                                       
Query: 443 gtcctcggaggacgagctggagctggagctgccggagcgatgcagtatcccacgggtctt 502
           |||||| || ||||||||||||||||||||||||||||||||||| ||||||| ||||||
Sbjct: 161 gtcctccgaagacgagctggagctggagctgccggagcgatgcaggatcccaccggtctt 102

                                          
Query: 503 gtgcttcctccctgcgggcctggaactgccc 533
           |||| ||  ||||| ||||||||||||||||
Sbjct: 101 gtgc-tctcccctgtgggcctggaactgccc 72



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                
Query: 219 agcttctccttgatcttgtccatgatccccttcttct 255
           ||||||||||||||||| ||| | || ||||||||||
Sbjct: 217 agcttctccttgatcttctccttcattcccttcttct 181

---

>gb|AY177889.1| Sorghum bicolor clone BAC IS_21O3 ABA-induced RAB17-like gene,
            partial sequence
          Length = 4636

 Score =  178 bits (90), Expect = 1e-41
 Identities = 119/128 (92%), Gaps = 3/128 (2%)
 Strand = Plus / Minus

                                                                        
Query: 360  tgctggttgtccttgtggccgccggggagcttctccttgatcttctccttcatgcccttc 419
            |||||||||||||||||||| ||||| ||||||||||||||||||||||| || ||||||
Sbjct: 1372 tgctggttgtccttgtggcctccgggcagcttctccttgatcttctccttgattcccttc 1313

                                                                        
Query: 420  ttcctcctcccgcccatgccgtcgtcctcggaggacgagctggagctggagctgccggag 479
            |||||||| ||||||||||||||||||||    |||||||||||||||||||||||||||
Sbjct: 1312 ttcctccttccgcccatgccgtcgtcctc---agacgagctggagctggagctgccggag 1256

                    
Query: 480  cgatgcag 487
            ||||||||
Sbjct: 1255 cgatgcag 1248



 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 58/61 (95%)
 Strand = Plus / Minus

                                                                        
Query: 205  agtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccggtgc 264
            |||||||||| ||||||||||||||||||||||||||||| || ||||||||||||||||
Sbjct: 1509 agtgctgtccgggcagcttctccttgatcttgtccatgatgcctttcttctcgccggtgc 1450

             
Query: 265  c 265
            |
Sbjct: 1449 c 1449



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                   
Query: 216  ggcagcttctccttgatcttgtccatgatccccttcttc 254
            |||||||||||||||||||| ||| |||| |||||||||
Sbjct: 1348 ggcagcttctccttgatcttctccttgattcccttcttc 1310



 Score = 44.1 bits (22), Expect = 0.46
 Identities = 37/42 (88%)
 Strand = Plus / Minus

                                                      
Query: 381  ccggggagcttctccttgatcttctccttcatgcccttcttc 422
            ||||| ||||||||||||||||| ||| | ||||| ||||||
Sbjct: 1501 ccgggcagcttctccttgatcttgtccatgatgcctttcttc 1460

---

>emb|X15290.1|HVDHN3 Zea mays mRNA for dehydrin (dhn1 gene)
          Length = 852

 Score =  178 bits (90), Expect = 1e-41
 Identities = 134/148 (90%), Gaps = 3/148 (2%)
 Strand = Plus / Minus

                                                                       
Query: 360 tgctggttgtccttgtggccgccggggagcttctccttgatcttctccttcatgcccttc 419
           ||||||| |||||||||||| ||||| ||||||||||||||||||||||| || ||||||
Sbjct: 433 tgctggtcgtccttgtggcctccgggcagcttctccttgatcttctccttgattcccttc 374

                                                                       
Query: 420 ttcctcctcccgcccatgccgtcgtcctcggaggacgagctggagctggagctgccggag 479
           |||||||| ||||||||||||||||||||    |||||||||||||||||||||||||||
Sbjct: 373 ttcctccttccgcccatgccgtcgtcctc---cgacgagctggagctggagctgccggag 317

                                       
Query: 480 cgatgcagtatcccacgggtcttgtgct 507
           |||||||| || || | |||||||||||
Sbjct: 316 cgatgcaggatgccgccggtcttgtgct 289



 Score = 89.7 bits (45), Expect = 9e-15
 Identities = 60/65 (92%)
 Strand = Plus / Minus

                                                                       
Query: 201 gctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccg 260
           |||||||||||||| ||||||||||| |||||||||||||| || || ||||||||||||
Sbjct: 601 gctcagtgctgtccgggcagcttctctttgatcttgtccataatgcctttcttctcgccg 542

                
Query: 261 gtgcc 265
           |||||
Sbjct: 541 gtgcc 537



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 216 ggcagcttctccttgatcttgtccatgatccccttcttc 254
           |||||||||||||||||||| ||| |||| |||||||||
Sbjct: 409 ggcagcttctccttgatcttctccttgattcccttcttc 371

---

>gb|U63831.1|SBU63831 Sorghum bicolor dehydrin (DHN2) mRNA, partial cds
          Length = 549

 Score =  178 bits (90), Expect = 1e-41
 Identities = 119/128 (92%), Gaps = 3/128 (2%)
 Strand = Plus / Minus

                                                                       
Query: 360 tgctggttgtccttgtggccgccggggagcttctccttgatcttctccttcatgcccttc 419
           |||||||||||||||||||| ||||| ||||||||||||||||||||||| || ||||||
Sbjct: 186 tgctggttgtccttgtggcctccgggcagcttctccttgatcttctccttgattcccttc 127

                                                                       
Query: 420 ttcctcctcccgcccatgccgtcgtcctcggaggacgagctggagctggagctgccggag 479
           |||||||| ||||||||||||||||||||    |||||||||||||||||||||||||||
Sbjct: 126 ttcctccttccgcccatgccgtcgtcctc---agacgagctggagctggagctgccggag 70

                   
Query: 480 cgatgcag 487
           ||||||||
Sbjct: 69  cgatgcag 62



 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 58/61 (95%)
 Strand = Plus / Minus

                                                                       
Query: 205 agtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccggtgc 264
           |||||||||| ||||||||||||||||||||||||||||| || ||||||||||||||||
Sbjct: 320 agtgctgtccgggcagcttctccttgatcttgtccatgatgcctttcttctcgccggtgc 261

            
Query: 265 c 265
           |
Sbjct: 260 c 260



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 216 ggcagcttctccttgatcttgtccatgatccccttcttc 254
           |||||||||||||||||||| ||| |||| |||||||||
Sbjct: 162 ggcagcttctccttgatcttctccttgattcccttcttc 124



 Score = 44.1 bits (22), Expect = 0.46
 Identities = 37/42 (88%)
 Strand = Plus / Minus

                                                     
Query: 381 ccggggagcttctccttgatcttctccttcatgcccttcttc 422
           ||||| ||||||||||||||||| ||| | ||||| ||||||
Sbjct: 312 ccgggcagcttctccttgatcttgtccatgatgcctttcttc 271

---

>gb|AY104757.1| Zea mays PCO142314 mRNA sequence
          Length = 899

 Score =  170 bits (86), Expect = 3e-39
 Identities = 133/148 (89%), Gaps = 3/148 (2%)
 Strand = Plus / Minus

                                                                       
Query: 360 tgctggttgtccttgtggccgccggggagcttctccttgatcttctccttcatgcccttc 419
           ||||||| |||||||||||| ||||| |||||||| |||||||||||||| || ||||||
Sbjct: 430 tgctggtcgtccttgtggcctccgggcagcttctctttgatcttctccttgattcccttc 371

                                                                       
Query: 420 ttcctcctcccgcccatgccgtcgtcctcggaggacgagctggagctggagctgccggag 479
           |||||||| ||||||||||||||||||||    |||||||||||||||||||||||||||
Sbjct: 370 ttcctccttccgcccatgccgtcgtcctc---cgacgagctggagctggagctgccggag 314

                                       
Query: 480 cgatgcagtatcccacgggtcttgtgct 507
           |||||||| || || | |||||||||||
Sbjct: 313 cgatgcaggatgccgccggtcttgtgct 286



 Score = 89.7 bits (45), Expect = 9e-15
 Identities = 60/65 (92%)
 Strand = Plus / Minus

                                                                       
Query: 201 gctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccg 260
           |||||||||||||| ||||||||||| |||||||||||||| || || ||||||||||||
Sbjct: 598 gctcagtgctgtccgggcagcttctctttgatcttgtccataatgcctttcttctcgccg 539

                
Query: 261 gtgcc 265
           |||||
Sbjct: 538 gtgcc 534



 Score = 46.1 bits (23), Expect = 0.12
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                  
Query: 216 ggcagcttctccttgatcttgtccatgatccccttcttc 254
           ||||||||||| |||||||| ||| |||| |||||||||
Sbjct: 406 ggcagcttctctttgatcttctccttgattcccttcttc 368

---

>dbj|AK071366.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023096D05, full
           insert sequence
          Length = 795

 Score =  167 bits (84), Expect = 5e-38
 Identities = 137/154 (88%), Gaps = 3/154 (1%)
 Strand = Plus / Minus

                                                                       
Query: 357 tgctgctggttgt---ccttgtggccgccggggagcttctccttgatcttctccttcatg 413
           |||||||||||||   |||||| ||||||||||||||||||||||||||||||||| || 
Sbjct: 407 tgctgctggttgttgcccttgttgccgccggggagcttctccttgatcttctccttgatt 348

                                                                       
Query: 414 cccttcttcctcctcccgcccatgccgtcgtcctcggaggacgagctggagctggagctg 473
           ||||||||||||||||| ||||| ||||||||||| || |||||||||||||| ||||||
Sbjct: 347 cccttcttcctcctccctcccatcccgtcgtcctcagacgacgagctggagcttgagctg 288

                                             
Query: 474 ccggagcgatgcagtatcccacgggtcttgtgct 507
           |||||||| || || || || | |||||||||||
Sbjct: 287 ccggagcggtggaggatgccgccggtcttgtgct 254



 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 53/59 (89%)
 Strand = Plus / Minus

                                                                      
Query: 205 agtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccggtg 263
           ||||||| || || ||||| |||||||||||||||||||  ||||||||||||||||||
Sbjct: 571 agtgctggccgggaagcttttccttgatcttgtccatgaagcccttcttctcgccggtg 513



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 219 agcttctccttgatcttgtccatgatccccttcttc 254
           ||||||||||||||||| ||| |||| |||||||||
Sbjct: 374 agcttctccttgatcttctccttgattcccttcttc 339

---

>emb|X62476.1|TARAB15B T.aestivum rab15B mRNA
          Length = 1068

 Score =  163 bits (82), Expect = 7e-37
 Identities = 114/124 (91%), Gaps = 3/124 (2%)
 Strand = Plus / Minus

                                                                       
Query: 374 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcctcccgcc 433
           |||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct: 351 gtggccaccggggagcttctccttgatcttctccttgatgcccttcttcctcctcccgcc 292

                                                                       
Query: 434 catgccgtcgtcctcggaggacgagctggagctggagctgccggagcgatgcagtatccc 493
           |||||| || |||||    ||||||||||||||||||||||||||||| ||||| |||||
Sbjct: 291 catgccatcatcctc---agacgagctggagctggagctgccggagcggtgcaggatccc 235

               
Query: 494 acgg 497
           ||||
Sbjct: 234 acgg 231



 Score = 93.7 bits (47), Expect = 6e-16
 Identities = 59/63 (93%)
 Strand = Plus / Minus

                                                                       
Query: 201 gctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccg 260
           ||||||||||| || || |||||||||||||||||||||||||| |||||||||||||||
Sbjct: 767 gctcagtgctggcctgggagcttctccttgatcttgtccatgatgcccttcttctcgccg 708

              
Query: 261 gtg 263
           |||
Sbjct: 707 gtg 705



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 384 gggagcttctccttgatcttctccttcatgcccttcttc 422
           |||||||||||||||||||| ||| | ||||||||||||
Sbjct: 752 gggagcttctccttgatcttgtccatgatgcccttcttc 714



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 219 agcttctccttgatcttgtccatgatccccttcttc 254
           ||||||||||||||||| ||| |||| |||||||||
Sbjct: 338 agcttctccttgatcttctccttgatgcccttcttc 303



 Score = 40.1 bits (20), Expect = 7.2
 Identities = 35/40 (87%)
 Strand = Plus / Minus

                                                   
Query: 258 ccggtgccggccattcctgcgtgcccttgctgcccgtagg 297
           |||||||||||||| || | ||| |||||||| |||||||
Sbjct: 593 ccggtgccggccatcccggtgtggccttgctgtccgtagg 554

---

>emb|X15287.1|HVDHN18 Barley mRNA for dehydrin (dhn18)
          Length = 1049

 Score =  155 bits (78), Expect = 2e-34
 Identities = 113/124 (91%), Gaps = 3/124 (2%)
 Strand = Plus / Minus

                                                                       
Query: 374 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcctcccgcc 433
           |||||| || |||||||||||||||||||||||||| ||||||||||||||||| || ||
Sbjct: 353 gtggccaccagggagcttctccttgatcttctccttgatgcccttcttcctcctgccacc 294

                                                                       
Query: 434 catgccgtcgtcctcggaggacgagctggagctggagctgccggagcgatgcagtatccc 493
           |||||| ||||||||   |||||||||||||||||||||||||||||| ||||| |||||
Sbjct: 293 catgccatcgtcctc---ggacgagctggagctggagctgccggagcggtgcaggatccc 237

               
Query: 494 acgg 497
           ||||
Sbjct: 236 acgg 233



 Score =  109 bits (55), Expect = 9e-21
 Identities = 61/63 (96%)
 Strand = Plus / Minus

                                                                       
Query: 201 gctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccg 260
           |||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||
Sbjct: 754 gctcagtgctgtccgggcagcttctccttgatcttgtccatgatgcccttcttctcgccg 695

              
Query: 261 gtg 263
           |||
Sbjct: 694 gtg 692



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Minus

                                                     
Query: 381 ccggggagcttctccttgatcttctccttcatgcccttcttc 422
           ||||| ||||||||||||||||| ||| | ||||||||||||
Sbjct: 742 ccgggcagcttctccttgatcttgtccatgatgcccttcttc 701



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 219 agcttctccttgatcttgtccatgatccccttcttc 254
           ||||||||||||||||| ||| |||| |||||||||
Sbjct: 340 agcttctccttgatcttctccttgatgcccttcttc 305



 Score = 40.1 bits (20), Expect = 7.2
 Identities = 35/40 (87%)
 Strand = Plus / Minus

                                                   
Query: 258 ccggtgccggccattcctgcgtgcccttgctgcccgtagg 297
           |||||||||||||| || | ||| |||||||| |||||||
Sbjct: 520 ccggtgccggccatcccagtgtggccttgctgtccgtagg 481

---

>dbj|AK063517.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-116-H03, full
           insert sequence
          Length = 872

 Score =  153 bits (77), Expect = 7e-34
 Identities = 107/117 (91%)
 Strand = Plus / Minus

                                                                       
Query: 365 gttgtccttgtggccgccggggagcttctccttgatcttctccttcatgcccttcttcct 424
           |||| |||||| ||||||||| ||||||||||||||||||||||| || |||||||||||
Sbjct: 459 gttgcccttgttgccgccgggcagcttctccttgatcttctccttgattcccttcttcct 400

                                                                    
Query: 425 cctcccgcccatgccgtcgtcctcggaggacgagctggagctggagctgccggagcg 481
           |||||| ||||| ||||||||||| || |||||||||||||| ||||||||||||||
Sbjct: 399 cctccctcccatcccgtcgtcctcagacgacgagctggagcttgagctgccggagcg 343



 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 53/57 (92%)
 Strand = Plus / Minus

                                                                    
Query: 205 agtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccgg 261
           ||||||| || ||||||||||||||||||||||||||||  ||||||||||||||||
Sbjct: 628 agtgctggccgggcagcttctccttgatcttgtccatgaatcccttcttctcgccgg 572



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 216 ggcagcttctccttgatcttgtccatgatccccttcttc 254
           |||||||||||||||||||| ||| |||| |||||||||
Sbjct: 440 ggcagcttctccttgatcttctccttgattcccttcttc 402



 Score = 40.1 bits (20), Expect = 7.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 380 gccggggagcttctccttgatctt 403
           |||||| |||||||||||||||||
Sbjct: 621 gccgggcagcttctccttgatctt 598

---

>gb|AF181456.1|AF181456 Hordeum vulgare dehydrin (Dhn6) mRNA, complete cds
          Length = 1637

 Score =  151 bits (76), Expect = 3e-33
 Identities = 126/142 (88%), Gaps = 3/142 (2%)
 Strand = Plus / Minus

                                                                        
Query: 369  tccttgtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcctc 428
            |||||||  |||||||||||||||||||||||||||| ||||||||| ||||||||||| 
Sbjct: 1158 tccttgttaccgccggggagcttctccttgatcttctgcttcatgcctttcttcctcctg 1099

                                                                        
Query: 429  ccgcccatgccgtcgtcctcggag---gacgagctggagctggagctgccggagcgatgc 485
            |||||||| |||||||||||||||   ||||||||||||||||| ||||| ||||| || 
Sbjct: 1098 ccgcccatcccgtcgtcctcggaggatgacgagctggagctggaactgccagagcggtgg 1039

                                  
Query: 486  agtatcccacgggtcttgtgct 507
            || || |||| |||||||||||
Sbjct: 1038 aggatgccaccggtcttgtgct 1017



 Score = 89.7 bits (45), Expect = 9e-15
 Identities = 48/49 (97%)
 Strand = Plus / Minus

                                                             
Query: 374  gtggccgccggggagcttctccttgatcttctccttcatgcccttcttc 422
            |||||||||||||||||||||||||||||||||| ||||||||||||||
Sbjct: 1474 gtggccgccggggagcttctccttgatcttctccatcatgcccttcttc 1426



 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 60/68 (88%)
 Strand = Plus / Minus

                                                                        
Query: 355  tgtgctgctggttgtccttgtggccgccggggagcttctccttgatcttctccttcatgc 414
            ||||| || |||||| |||||| ||||| |||||||||||||||||||||||| | | ||
Sbjct: 1316 tgtgcggcgggttgttcttgtgcccgccagggagcttctccttgatcttctccatgacgc 1257

                    
Query: 415  ccttcttc 422
            ||||||||
Sbjct: 1256 ccttcttc 1249



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                   
Query: 219  agcttctccttgatcttgtccatgatccccttcttctcg 257
            ||||||||||||||||| ||||| || ||||||||||||
Sbjct: 1461 agcttctccttgatcttctccatcatgcccttcttctcg 1423



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                   
Query: 219  agcttctccttgatcttgtccatgatccccttcttctcg 257
            ||||||||||||||||| |||||||  ||||||||||||
Sbjct: 1284 agcttctccttgatcttctccatgacgcccttcttctcg 1246

---

>emb|X15288.1|HVDHN8 Barley mRNA for dehydrin (dhn8)
          Length = 683

 Score =  149 bits (75), Expect = 1e-32
 Identities = 95/101 (94%), Gaps = 3/101 (2%)
 Strand = Plus / Minus

                                                                       
Query: 381 ccggggagcttctccttgatcttctccttcatgcccttcttcctcctcccgcccatgccg 440
           |||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||
Sbjct: 348 ccggggagcttctccttgatcttctccttcatccccttcttcctcctcccgcccacgccg 289

                                                    
Query: 441 tcgtcctcggaggacgagctggagctggagctgccggagcg 481
           |||||||| |||   ||||||||||||||||||||||||||
Sbjct: 288 tcgtcctcagag---gagctggagctggagctgccggagcg 251



 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 60/67 (89%), Gaps = 3/67 (4%)
 Strand = Plus / Minus

                                                                       
Query: 200 ggctcagtgctgt---cccggcagcttctccttgatcttgtccatgatccccttcttctc 256
           |||||||||||||   || || |||||||||||||||||||||||||  |||||||||||
Sbjct: 496 ggctcagtgctgtccgccgggaagcttctccttgatcttgtccatgacgcccttcttctc 437

                  
Query: 257 gccggtg 263
           |||||||
Sbjct: 436 gccggtg 430



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 378 ccgccggggagcttctccttgatcttctccttcatgcccttcttc 422
           |||||||| ||||||||||||||||| ||| | | ||||||||||
Sbjct: 483 ccgccgggaagcttctccttgatcttgtccatgacgcccttcttc 439



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 219 agcttctccttgatcttgtccatgatccccttcttc 254
           ||||||||||||||||| ||| | ||||||||||||
Sbjct: 342 agcttctccttgatcttctccttcatccccttcttc 307

---

>emb|X98326.1|HVDEHYDRN H.vulgare mRNA for dehydrin
          Length = 671

 Score =  149 bits (75), Expect = 1e-32
 Identities = 95/101 (94%), Gaps = 3/101 (2%)
 Strand = Plus / Minus

                                                                       
Query: 381 ccggggagcttctccttgatcttctccttcatgcccttcttcctcctcccgcccatgccg 440
           |||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||
Sbjct: 334 ccggggagcttctccttgatcttctccttcatccccttcttcctcctcccgcccacgccg 275

                                                    
Query: 441 tcgtcctcggaggacgagctggagctggagctgccggagcg 481
           |||||||| |||   ||||||||||||||||||||||||||
Sbjct: 274 tcgtcctcagag---gagctggagctggagctgccggagcg 237



 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 60/67 (89%), Gaps = 3/67 (4%)
 Strand = Plus / Minus

                                                                       
Query: 200 ggctcagtgctgt---cccggcagcttctccttgatcttgtccatgatccccttcttctc 256
           |||||||||||||   || || |||||||||||||||||||||||||  |||||||||||
Sbjct: 485 ggctcagtgctgtccgccgggaagcttctccttgatcttgtccatgacgcccttcttctc 426

                  
Query: 257 gccggtg 263
           |||||||
Sbjct: 425 gccggtg 419



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 378 ccgccggggagcttctccttgatcttctccttcatgcccttcttc 422
           |||||||| ||||||||||||||||| ||| | | ||||||||||
Sbjct: 472 ccgccgggaagcttctccttgatcttgtccatgacgcccttcttc 428



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 219 agcttctccttgatcttgtccatgatccccttcttc 254
           ||||||||||||||||| ||| | ||||||||||||
Sbjct: 328 agcttctccttgatcttctccttcatccccttcttc 293

---

>gb|AF181451.1|AF181451 Hordeum vulgare dehydrin (Dhn1) mRNA, complete cds
          Length = 512

 Score =  149 bits (75), Expect = 1e-32
 Identities = 95/101 (94%), Gaps = 3/101 (2%)
 Strand = Plus / Minus

                                                                       
Query: 381 ccggggagcttctccttgatcttctccttcatgcccttcttcctcctcccgcccatgccg 440
           |||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||
Sbjct: 302 ccggggagcttctccttgatcttctccttcatccccttcttcctcctcccgcccacgccg 243

                                                    
Query: 441 tcgtcctcggaggacgagctggagctggagctgccggagcg 481
           |||||||| |||   ||||||||||||||||||||||||||
Sbjct: 242 tcgtcctcagag---gagctggagctggagctgccggagcg 205



 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 60/67 (89%), Gaps = 3/67 (4%)
 Strand = Plus / Minus

                                                                       
Query: 200 ggctcagtgctgt---cccggcagcttctccttgatcttgtccatgatccccttcttctc 256
           |||||||||||||   || || |||||||||||||||||||||||||  |||||||||||
Sbjct: 450 ggctcagtgctgtccgccgggaagcttctccttgatcttgtccatgacgcccttcttctc 391

                  
Query: 257 gccggtg 263
           |||||||
Sbjct: 390 gccggtg 384



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 378 ccgccggggagcttctccttgatcttctccttcatgcccttcttc 422
           |||||||| ||||||||||||||||| ||| | | ||||||||||
Sbjct: 437 ccgccgggaagcttctccttgatcttgtccatgacgcccttcttc 393



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 219 agcttctccttgatcttgtccatgatccccttcttc 254
           ||||||||||||||||| ||| | ||||||||||||
Sbjct: 296 agcttctccttgatcttctccttcatccccttcttc 261

---

>dbj|AK109096.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-155-A09, full
           insert sequence
          Length = 852

 Score =  147 bits (74), Expect = 4e-32
 Identities = 115/128 (89%), Gaps = 3/128 (2%)
 Strand = Plus / Minus

                                                                       
Query: 357 tgctgctggttgt---ccttgtggccgccggggagcttctccttgatcttctccttcatg 413
           |||||||||||||   |||||| |||||| |||||||||||||||||||||||||| || 
Sbjct: 389 tgctgctggttgttgcccttgttgccgcctgggagcttctccttgatcttctccttgatc 330

                                                                       
Query: 414 cccttcttcctcctcccgcccatgccgtcgtcctcggaggacgagctggagctggagctg 473
           |||||||||||||| || ||||| || |||||||| ||||| ||||||||||||||||||
Sbjct: 329 cccttcttcctccttcctcccatcccatcgtcctcagaggatgagctggagctggagctg 270

                   
Query: 474 ccggagcg 481
           ||||||||
Sbjct: 269 ccggagcg 262



 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 55/60 (91%)
 Strand = Plus / Minus

                                                                       
Query: 201 gctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccg 260
           ||||||||||| || || |||||||||||||||||||||| ||| |||||||||||||||
Sbjct: 563 gctcagtgctggccggggagcttctccttgatcttgtccacgatgcccttcttctcgccg 504



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 219 agcttctccttgatcttgtccatgatccccttcttc 254
           ||||||||||||||||| ||| ||||||||||||||
Sbjct: 356 agcttctccttgatcttctccttgatccccttcttc 321



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 39/43 (90%)
 Strand = Plus / Minus

                                                      
Query: 380 gccggggagcttctccttgatcttctccttcatgcccttcttc 422
           |||||||||||||||||||||||| |||   ||||||||||||
Sbjct: 552 gccggggagcttctccttgatcttgtccacgatgcccttcttc 510

---

>gb|AY266052.1| Deschampsia antarctica dehydrin-like protein pseudogene, partial
           sequence
          Length = 454

 Score =  143 bits (72), Expect = 7e-31
 Identities = 99/108 (91%)
 Strand = Plus / Minus

                                                                       
Query: 342 gtccccgtcgccatgtgctgctggttgtccttgtggccgccggggagcttctccttgatc 401
           |||||||| |||||||||||||||||||| |||||||| || || | |||||||||||||
Sbjct: 329 gtccccgtggccatgtgctgctggttgtctttgtggccaccaggaatcttctccttgatc 270

                                                           
Query: 402 ttctccttcatgcccttcttcctcctcccgcccatgccgtcgtcctcg 449
           || || |||||||| |||||||||||||||||||||||||||||||||
Sbjct: 269 ttatctttcatgcctttcttcctcctcccgcccatgccgtcgtcctcg 222



 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 71/78 (91%), Gaps = 1/78 (1%)
 Strand = Plus / Minus

                                                                       
Query: 456 gagctggagctggagctgccggagcgatgcagtatcccacgggtcttgtgcttcctccct 515
           ||||||||||||||||||||||||||||||||||| || | |||||||||| | ||||||
Sbjct: 132 gagctggagctggagctgccggagcgatgcagtatgccgccggtcttgtgc-tgctccct 74

                             
Query: 516 gcgggcctggaactgccc 533
           || || ||||||||||||
Sbjct: 73  gctgggctggaactgccc 56



 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 39/41 (95%)
 Strand = Plus / Minus

                                                    
Query: 257 gccggtgccggccattcctgcgtgcccttgctgcccgtagg 297
           ||||||||||| ||||||| |||||||||||||||||||||
Sbjct: 396 gccggtgccggtcattccttcgtgcccttgctgcccgtagg 356



 Score = 46.1 bits (23), Expect = 0.12
 Identities = 42/47 (89%), Gaps = 1/47 (2%)
 Strand = Plus / Minus

                                                          
Query: 219 agcttctccttgatcttgtccatgatccccttcttctcgccggtgcc 265
           ||||||||||| |||||||||||||  || ||||||||||| |||||
Sbjct: 451 agcttctcctt-atcttgtccatgagtcctttcttctcgcctgtgcc 406

---

>emb|X15286.1|HVDHN17 Barley mRNA for dehydrin (dhn17)
          Length = 812

 Score =  143 bits (72), Expect = 7e-31
 Identities = 119/134 (88%), Gaps = 3/134 (2%)
 Strand = Plus / Minus

                                                                       
Query: 374 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcctcccgcc 433
           |||||| ||||||||||||||||||||||| ||||| | |||||||||||||||||||||
Sbjct: 332 gtggccaccggggagcttctccttgatcttgtccttgaggcccttcttcctcctcccgcc 273

                                                                       
Query: 434 catgccgtcgtcctcggaggacgagctggagctggagctgccggagcgatgcagtatccc 493
           ||||||||| |||||    |||||||||||||| |||||||||||||| ||||| |||||
Sbjct: 272 catgccgtcatcctc---agacgagctggagcttgagctgccggagcgctgcaggatccc 216

                         
Query: 494 acgggtcttgtgct 507
            | || ||||||||
Sbjct: 215 tccggccttgtgct 202



 Score =  103 bits (52), Expect = 6e-19
 Identities = 58/60 (96%)
 Strand = Plus / Minus

                                                                       
Query: 200 ggctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgcc 259
           ||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||
Sbjct: 548 ggctcagtgctgtccgggcagcttctccttgatcttgtccatgatgcccttcttctcgcc 489



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Minus

                                                     
Query: 381 ccggggagcttctccttgatcttctccttcatgcccttcttc 422
           ||||| ||||||||||||||||| ||| | ||||||||||||
Sbjct: 535 ccgggcagcttctccttgatcttgtccatgatgcccttcttc 494



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 219 agcttctccttgatcttgtccatgatccccttcttc 254
           ||||||||||||||||||||| |||  |||||||||
Sbjct: 319 agcttctccttgatcttgtccttgaggcccttcttc 284

---

>gb|AY823548.1| Pennisetum glaucum putative RAB protein mRNA, complete cds
          Length = 616

 Score =  139 bits (70), Expect = 1e-29
 Identities = 116/130 (89%), Gaps = 6/130 (4%)
 Strand = Plus / Minus

                                                                       
Query: 355 tgtgctgctggttg---tccttgtggccgccggggagcttctccttgatcttctccttca 411
           ||||||||||||||   ||||||| ||| ||||||||||||||||||||||||||||| |
Sbjct: 367 tgtgctgctggttgccatccttgttgcctccggggagcttctccttgatcttctccttga 308

                                                                       
Query: 412 tgcccttcttcctcctcccgcccatgccgtcgtcctcggaggacgagctggagctggagc 471
           |||| |||||||||||||||||||||||||| |||||   |||||| || || |||||||
Sbjct: 307 tgcctttcttcctcctcccgcccatgccgtcatcctc---ggacgaactagaactggagc 251

                     
Query: 472 tgccggagcg 481
           ||||||||||
Sbjct: 250 tgccggagcg 241



 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 54/60 (90%)
 Strand = Plus / Minus

                                                                       
Query: 205 agtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccggtgc 264
           ||||||| || || |||||||||||||||||||||||||  ||||||||||| |||||||
Sbjct: 499 agtgctgcccgggaagcttctccttgatcttgtccatgagtcccttcttctctccggtgc 440



 Score = 40.1 bits (20), Expect = 7.2
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 219 agcttctccttgatcttgtccatgatccccttcttc 254
           ||||||||||||||||| ||| |||| || ||||||
Sbjct: 332 agcttctccttgatcttctccttgatgcctttcttc 297

---

>emb|X72748.1|HVDEHYD H.vulgare mRNA for dehydrin
          Length = 1016

 Score =  139 bits (70), Expect = 1e-29
 Identities = 111/124 (89%), Gaps = 3/124 (2%)
 Strand = Plus / Minus

                                                                       
Query: 374 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcctcccgcc 433
           |||||| || |||||||||||||||||||||||||| |||||||||||||||||  | ||
Sbjct: 366 gtggccaccagggagcttctccttgatcttctccttgatgcccttcttcctcctgtcacc 307

                                                                       
Query: 434 catgccgtcgtcctcggaggacgagctggagctggagctgccggagcgatgcagtatccc 493
           |||||| ||||||||   ||| |||||||||||||||||||||||||| ||||| |||||
Sbjct: 306 catgccatcgtcctc---ggatgagctggagctggagctgccggagcggtgcaggatccc 250

               
Query: 494 acgg 497
           ||||
Sbjct: 249 acgg 246



 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 58/63 (92%)
 Strand = Plus / Minus

                                                                       
Query: 201 gctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccg 260
           ||||||||||| ||  | |||||||||||||||||||||||||| |||||||||||||||
Sbjct: 707 gctcagtgctggccaaggagcttctccttgatcttgtccatgatgcccttcttctcgccg 648

              
Query: 261 gtg 263
           |||
Sbjct: 647 gtg 645



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 385 ggagcttctccttgatcttctccttcatgcccttcttc 422
           ||||||||||||||||||| ||| | ||||||||||||
Sbjct: 691 ggagcttctccttgatcttgtccatgatgcccttcttc 654



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 219 agcttctccttgatcttgtccatgatccccttcttc 254
           ||||||||||||||||| ||| |||| |||||||||
Sbjct: 353 agcttctccttgatcttctccttgatgcccttcttc 318



 Score = 40.1 bits (20), Expect = 7.2
 Identities = 35/40 (87%)
 Strand = Plus / Minus

                                                   
Query: 258 ccggtgccggccattcctgcgtgcccttgctgcccgtagg 297
           |||||||||||||| || | ||| |||||||| |||||||
Sbjct: 533 ccggtgccggccatcccagtgtggccttgctgtccgtagg 494

---

>gb|AF453444.1|AF453444 Triticum aestivum dehydrin WZY1-1 mRNA, complete cds
          Length = 483

 Score =  135 bits (68), Expect = 2e-28
 Identities = 118/134 (88%), Gaps = 3/134 (2%)
 Strand = Plus / Minus

                                                                       
Query: 374 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcctcccgcc 433
           |||||| || |||||||||||||||||||| ||||| |||||||||||||||||||||||
Sbjct: 273 gtggccaccagggagcttctccttgatcttatccttgatgcccttcttcctcctcccgcc 214

                                                                       
Query: 434 catgccgtcgtcctcggaggacgagctggagctggagctgccggagcgatgcagtatccc 493
           |||||| || |||||    |||||||||||||| |||||||||||||| ||||| |||||
Sbjct: 213 catgccatcatcctc---agacgagctggagctcgagctgccggagcgctgcaggatccc 157

                         
Query: 494 acgggtcttgtgct 507
            | || ||||||||
Sbjct: 156 gccggccttgtgct 143



 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 55/59 (93%)
 Strand = Plus / Minus

                                                                      
Query: 203 tcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccgg 261
           |||||||||||| |||||||| |||||||||||||||||||| |||||||| |||||||
Sbjct: 483 tcagtgctgtccgggcagcttttccttgatcttgtccatgatgcccttcttttcgccgg 425



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 219 agcttctccttgatcttgtccatgatccccttcttc 254
           ||||||||||||||||| ||| |||| |||||||||
Sbjct: 260 agcttctccttgatcttatccttgatgcccttcttc 225



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 381 ccggggagcttctccttgatcttctccttcatgcccttctt 421
           ||||| ||||| ||||||||||| ||| | |||||||||||
Sbjct: 473 ccgggcagcttttccttgatcttgtccatgatgcccttctt 433

---

>gb|AF181457.1|AF181457 Hordeum vulgare dehydrin (Dhn7) mRNA, complete cds
          Length = 654

 Score =  135 bits (68), Expect = 2e-28
 Identities = 118/134 (88%), Gaps = 3/134 (2%)
 Strand = Plus / Minus

                                                                       
Query: 374 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcctcccgcc 433
           |||||| || |||||||||||||||||||| ||||| || ||||||||||||||||||||
Sbjct: 332 gtggccaccagggagcttctccttgatcttatccttgatacccttcttcctcctcccgcc 273

                                                                       
Query: 434 catgccgtcgtcctcggaggacgagctggagctggagctgccggagcgatgcagtatccc 493
           |||||| ||||||||    |||||||||||||| |||||||||||||| ||||| |||||
Sbjct: 272 catgccatcgtcctc---agacgagctggagcttgagctgccggagcgctgcaggatccc 216

                         
Query: 494 acgggtcttgtgct 507
            | || ||||||||
Sbjct: 215 gccggccttgtgct 202



 Score =  101 bits (51), Expect = 2e-18
 Identities = 63/67 (94%)
 Strand = Plus / Minus

                                                                       
Query: 200 ggctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgcc 259
           ||||||||||||||| ||||||||||||||||| ||||||||||| |||||||| |||||
Sbjct: 590 ggctcagtgctgtccgggcagcttctccttgattttgtccatgatgcccttcttttcgcc 531

                  
Query: 260 ggtgccg 266
           |||||||
Sbjct: 530 ggtgccg 524



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 219 agcttctccttgatcttgtccatgatccccttcttc 254
           ||||||||||||||||| ||| |||| |||||||||
Sbjct: 319 agcttctccttgatcttatccttgatacccttcttc 284



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 381 ccggggagcttctccttgatcttctccttcatgcccttctt 421
           ||||| |||||||||||||| || ||| | |||||||||||
Sbjct: 577 ccgggcagcttctccttgattttgtccatgatgcccttctt 537

---

>emb|X15289.1|HVDHN9 Barley mRNA for dehydrin (dhn9)
          Length = 683

 Score =  133 bits (67), Expect = 6e-28
 Identities = 93/101 (92%), Gaps = 3/101 (2%)
 Strand = Plus / Minus

                                                                       
Query: 381 ccggggagcttctccttgatcttctccttcatgcccttcttcctcctcccgcccatgccg 440
           |||||||||||||||||||||||||||||||| || ||||||||||||||||| | ||||
Sbjct: 339 ccggggagcttctccttgatcttctccttcatccctttcttcctcctcccgccaacgccg 280

                                                    
Query: 441 tcgtcctcggaggacgagctggagctggagctgccggagcg 481
           ||||||||    |||||||||||||||||||||||||||||
Sbjct: 279 tcgtcctc---agacgagctggagctggagctgccggagcg 242



 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 43/45 (95%)
 Strand = Plus / Minus

                                                        
Query: 219 agcttctccttgatcttgtccatgatccccttcttctcgccggtg 263
           |||||||||||||||||||||||||  ||||||||||||||||||
Sbjct: 468 agcttctccttgatcttgtccatgacacccttcttctcgccggtg 424



 Score = 44.1 bits (22), Expect = 0.46
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 378 ccgccggggagcttctccttgatctt 403
           |||||||| |||||||||||||||||
Sbjct: 477 ccgccgggaagcttctccttgatctt 452



 Score = 40.1 bits (20), Expect = 7.2
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 219 agcttctccttgatcttgtccatgatccccttcttc 254
           ||||||||||||||||| ||| | ||||| ||||||
Sbjct: 333 agcttctccttgatcttctccttcatccctttcttc 298

---

>dbj|AK121952.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033107K14, full
           insert sequence
          Length = 709

 Score =  129 bits (65), Expect = 1e-26
 Identities = 130/151 (86%), Gaps = 3/151 (1%)
 Strand = Plus / Minus

                                                                       
Query: 357 tgctgctggttgtccttgtggccgccggggagcttctccttgatcttctccttcatgccc 416
           |||||||| | | |||||| ||||||||||||||||||||||||||||||||| || |||
Sbjct: 454 tgctgctgctcgcccttgttgccgccggggagcttctccttgatcttctccttgatcccc 395

                                                                       
Query: 417 ttcttcctcctcccgcccatgccgtcgtcctcggaggacgagctggagctggagctgccg 476
           |||||||||||||| ||||| || || ||||| ||   |||||| |||||||||||||||
Sbjct: 394 ttcttcctcctccctcccattccatcatcctcaga---cgagcttgagctggagctgccg 338

                                          
Query: 477 gagcgatgcagtatcccacgggtcttgtgct 507
           ||||| ||||| |  || | |||||||||||
Sbjct: 337 gagcgttgcaggacgccgccggtcttgtgct 307



 Score = 93.7 bits (47), Expect = 6e-16
 Identities = 59/63 (93%)
 Strand = Plus / Minus

                                                                       
Query: 201 gctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccg 260
           ||||||||||| || ||||||||||||||||||||||||||||| |||||||||| ||||
Sbjct: 613 gctcagtgctggccgggcagcttctccttgatcttgtccatgatgcccttcttcttgccg 554

              
Query: 261 gtg 263
           |||
Sbjct: 553 gtg 551



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 219 agcttctccttgatcttgtccatgatccccttcttc 254
           ||||||||||||||||| ||| ||||||||||||||
Sbjct: 424 agcttctccttgatcttctccttgatccccttcttc 389



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 39/43 (90%)
 Strand = Plus / Minus

                                                      
Query: 380 gccggggagcttctccttgatcttctccttcatgcccttcttc 422
           |||||| ||||||||||||||||| ||| | ||||||||||||
Sbjct: 602 gccgggcagcttctccttgatcttgtccatgatgcccttcttc 560

---

>gb|AY895889.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 293409 dehydrin 4
           (Dhn4) gene, complete cds
          Length = 921

 Score =  125 bits (63), Expect = 2e-25
 Identities = 75/79 (94%)
 Strand = Plus / Minus

                                                                       
Query: 373 tgtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcctcccgc 432
           ||||||| || |||||||||||||||||||||||||| ||||||||||||||||||||||
Sbjct: 383 tgtggccaccagggagcttctccttgatcttctccttgatgcccttcttcctcctcccgc 324

                              
Query: 433 ccatgccgtcgtcctcgga 451
           ||||||| |||||||||||
Sbjct: 323 ccatgccatcgtcctcgga 305



 Score = 93.7 bits (47), Expect = 6e-16
 Identities = 59/63 (93%)
 Strand = Plus / Minus

                                                                       
Query: 201 gctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccg 260
           ||||||||||| || || |||||||||||||||||||||||||| |||||||||||||||
Sbjct: 783 gctcagtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgccg 724

              
Query: 261 gtg 263
           |||
Sbjct: 723 gtg 721



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 40/43 (93%)
 Strand = Plus / Minus

                                                      
Query: 455 cgagctggagctggagctgccggagcgatgcagtatcccacgg 497
           ||||||||||||||||||||| ||||| ||||| |||||||||
Sbjct: 213 cgagctggagctggagctgccagagcggtgcaggatcccacgg 171



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 384 gggagcttctccttgatcttctccttcatgcccttcttc 422
           |||||||||||||||||||| ||| | ||||||||||||
Sbjct: 768 gggagcttctccttgatcttgtccatgatgcccttcttc 730



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 219 agcttctccttgatcttgtccatgatccccttcttc 254
           ||||||||||||||||| ||| |||| |||||||||
Sbjct: 369 agcttctccttgatcttctccttgatgcccttcttc 334



 Score = 40.1 bits (20), Expect = 7.2
 Identities = 35/40 (87%)
 Strand = Plus / Minus

                                                   
Query: 258 ccggtgccggccattcctgcgtgcccttgctgcccgtagg 297
           |||||||||||||| || | ||| |||||||| |||||||
Sbjct: 549 ccggtgccggccatcccagtgtggccttgctgtccgtagg 510

---

>gb|AY895898.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 420916 dehydrin 4
           (Dhn4) gene, complete cds
          Length = 921

 Score =  123 bits (62), Expect = 6e-25
 Identities = 74/78 (94%)
 Strand = Plus / Minus

                                                                       
Query: 374 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcctcccgcc 433
           |||||| || |||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct: 382 gtggccaccagggagcttctccttgatcttctccttgatgcccttcttcctcctcccgcc 323

                             
Query: 434 catgccgtcgtcctcgga 451
           |||||| |||||||||||
Sbjct: 322 catgccatcgtcctcgga 305



 Score = 93.7 bits (47), Expect = 6e-16
 Identities = 59/63 (93%)
 Strand = Plus / Minus

                                                                       
Query: 201 gctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccg 260
           ||||||||||| || || |||||||||||||||||||||||||| |||||||||||||||
Sbjct: 783 gctcagtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgccg 724

              
Query: 261 gtg 263
           |||
Sbjct: 723 gtg 721



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 40/43 (93%)
 Strand = Plus / Minus

                                                      
Query: 455 cgagctggagctggagctgccggagcgatgcagtatcccacgg 497
           ||||||||||||||||||||| ||||| ||||| |||||||||
Sbjct: 213 cgagctggagctggagctgccagagcggtgcaggatcccacgg 171



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 384 gggagcttctccttgatcttctccttcatgcccttcttc 422
           |||||||||||||||||||| ||| | ||||||||||||
Sbjct: 768 gggagcttctccttgatcttgtccatgatgcccttcttc 730



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 219 agcttctccttgatcttgtccatgatccccttcttc 254
           ||||||||||||||||| ||| |||| |||||||||
Sbjct: 369 agcttctccttgatcttctccttgatgcccttcttc 334



 Score = 40.1 bits (20), Expect = 7.2
 Identities = 35/40 (87%)
 Strand = Plus / Minus

                                                   
Query: 258 ccggtgccggccattcctgcgtgcccttgctgcccgtagg 297
           |||||||||||||| || | ||| |||||||| |||||||
Sbjct: 549 ccggtgccggccatcccagtgtggccttgctgtccgtagg 510

---

>gb|AY895895.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 406276 dehydrin 4
           (Dhn4) gene, complete cds
          Length = 921

 Score =  123 bits (62), Expect = 6e-25
 Identities = 74/78 (94%)
 Strand = Plus / Minus

                                                                       
Query: 374 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcctcccgcc 433
           |||||| || |||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct: 382 gtggccaccagggagcttctccttgatcttctccttgatgcccttcttcctcctcccgcc 323

                             
Query: 434 catgccgtcgtcctcgga 451
           |||||| |||||||||||
Sbjct: 322 catgccatcgtcctcgga 305



 Score = 93.7 bits (47), Expect = 6e-16
 Identities = 59/63 (93%)
 Strand = Plus / Minus

                                                                       
Query: 201 gctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccg 260
           ||||||||||| || || |||||||||||||||||||||||||| |||||||||||||||
Sbjct: 783 gctcagtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgccg 724

              
Query: 261 gtg 263
           |||
Sbjct: 723 gtg 721



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 40/43 (93%)
 Strand = Plus / Minus

                                                      
Query: 455 cgagctggagctggagctgccggagcgatgcagtatcccacgg 497
           ||||||||||||||||||||| ||||| ||||| |||||||||
Sbjct: 213 cgagctggagctggagctgccagagcggtgcaggatcccacgg 171



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 384 gggagcttctccttgatcttctccttcatgcccttcttc 422
           |||||||||||||||||||| ||| | ||||||||||||
Sbjct: 768 gggagcttctccttgatcttgtccatgatgcccttcttc 730



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 219 agcttctccttgatcttgtccatgatccccttcttc 254
           ||||||||||||||||| ||| |||| |||||||||
Sbjct: 369 agcttctccttgatcttctccttgatgcccttcttc 334

---

>gb|AY895883.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 220523 dehydrin 4
           (Dhn4) gene, complete cds
          Length = 906

 Score =  123 bits (62), Expect = 6e-25
 Identities = 74/78 (94%)
 Strand = Plus / Minus

                                                                       
Query: 374 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcctcccgcc 433
           |||||| || |||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct: 382 gtggccaccagggagcttctccttgatcttctccttgatgcccttcttcctcctcccgcc 323

                             
Query: 434 catgccgtcgtcctcgga 451
           |||||| |||||||||||
Sbjct: 322 catgccatcgtcctcgga 305



 Score = 93.7 bits (47), Expect = 6e-16
 Identities = 59/63 (93%)
 Strand = Plus / Minus

                                                                       
Query: 201 gctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccg 260
           ||||||||||| || || |||||||||||||||||||||||||| |||||||||||||||
Sbjct: 768 gctcagtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgccg 709

              
Query: 261 gtg 263
           |||
Sbjct: 708 gtg 706



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 40/43 (93%)
 Strand = Plus / Minus

                                                      
Query: 455 cgagctggagctggagctgccggagcgatgcagtatcccacgg 497
           ||||||||||||||||||||| ||||| ||||| |||||||||
Sbjct: 213 cgagctggagctggagctgccagagcggtgcaggatcccacgg 171



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 384 gggagcttctccttgatcttctccttcatgcccttcttc 422
           |||||||||||||||||||| ||| | ||||||||||||
Sbjct: 753 gggagcttctccttgatcttgtccatgatgcccttcttc 715



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 219 agcttctccttgatcttgtccatgatccccttcttc 254
           ||||||||||||||||| ||| |||| |||||||||
Sbjct: 369 agcttctccttgatcttctccttgatgcccttcttc 334

---

>gb|AF043091.1|AF043091 Hordeum vulgare dehydrin 6 (dhn6) gene, complete cds
          Length = 3086

 Score =  123 bits (62), Expect = 6e-25
 Identities = 80/86 (93%)
 Strand = Plus / Minus

                                                                        
Query: 369  tccttgtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcctc 428
            |||||||  |||||||||||||||||||||||||||| ||||||||| ||||||||||| 
Sbjct: 2073 tccttgttaccgccggggagcttctccttgatcttctgcttcatgcctttcttcctcctg 2014

                                      
Query: 429  ccgcccatgccgtcgtcctcggagga 454
            |||||||| |||||||||||||||||
Sbjct: 2013 ccgcccatcccgtcgtcctcggagga 1988



 Score = 89.7 bits (45), Expect = 9e-15
 Identities = 48/49 (97%)
 Strand = Plus / Minus

                                                             
Query: 374  gtggccgccggggagcttctccttgatcttctccttcatgcccttcttc 422
            |||||||||||||||||||||||||||||||||| ||||||||||||||
Sbjct: 2389 gtggccgccggggagcttctccttgatcttctccatcatgcccttcttc 2341



 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 61/68 (89%)
 Strand = Plus / Minus

                                                                        
Query: 355  tgtgctgctggttgtccttgtggccgccggggagcttctccttgatcttctccttcatgc 414
            ||||| || ||||||||||||| ||||| |||||||||||||||||||||||| | | ||
Sbjct: 2231 tgtgcggcgggttgtccttgtgcccgccagggagcttctccttgatcttctccatgacgc 2172

                    
Query: 415  ccttcttc 422
            ||||||||
Sbjct: 2171 ccttcttc 2164



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                 
Query: 455  cgagctggagctggagctgccggagcgatgcagtatcccacgggtcttgtgct 507
            ||||||||||||||||||||| ||||| || || || |||| |||||||||||
Sbjct: 1892 cgagctggagctggagctgccagagcggtggaggatgccaccggtcttgtgct 1840



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                   
Query: 219  agcttctccttgatcttgtccatgatccccttcttctcg 257
            ||||||||||||||||| ||||| || ||||||||||||
Sbjct: 2376 agcttctccttgatcttctccatcatgcccttcttctcg 2338



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                   
Query: 219  agcttctccttgatcttgtccatgatccccttcttctcg 257
            ||||||||||||||||| |||||||  ||||||||||||
Sbjct: 2199 agcttctccttgatcttctccatgacgcccttcttctcg 2161

---

>gb|AC145325.3| Oryza sativa (japonica cultivar-group) chromosome 11 clone
             OSJNBb0034E03 map near 50283S, complete sequence
          Length = 134074

 Score =  121 bits (61), Expect = 2e-24
 Identities = 87/95 (91%), Gaps = 3/95 (3%)
 Strand = Plus / Minus

                                                                         
Query: 357   tgctgctggttgt---ccttgtggccgccggggagcttctccttgatcttctccttcatg 413
             |||||||||||||   |||||| ||||||||||||||||||||||||||||||||| || 
Sbjct: 75332 tgctgctggttgttgcccttgttgccgccggggagcttctccttgatcttctccttgatt 75273

                                                
Query: 414   cccttcttcctcctcccgcccatgccgtcgtcctc 448
             ||||||||||||||||| ||||| |||||||||||
Sbjct: 75272 cccttcttcctcctccctcccatcccgtcgtcctc 75238



 Score =  111 bits (56), Expect = 2e-21
 Identities = 77/84 (91%)
 Strand = Plus / Minus

                                                                         
Query: 365   gttgtccttgtggccgccggggagcttctccttgatcttctccttcatgcccttcttcct 424
             |||| |||||| ||||||||| ||||||||||||||||||||||| || |||||||||||
Sbjct: 66884 gttgcccttgttgccgccgggcagcttctccttgatcttctccttgattcccttcttcct 66825

                                     
Query: 425   cctcccgcccatgccgtcgtcctc 448
             |||||| ||||| |||||||||||
Sbjct: 66824 cctccctcccatcccgtcgtcctc 66801



 Score =  105 bits (53), Expect = 1e-19
 Identities = 85/95 (89%), Gaps = 3/95 (3%)
 Strand = Plus / Minus

                                                                         
Query: 357   tgctgctggttgt---ccttgtggccgccggggagcttctccttgatcttctccttcatg 413
             |||||||||||||   |||||| ||||||||||||||||||||||||||||||||| || 
Sbjct: 82738 tgctgctggttgttgcccttgttgccgccggggagcttctccttgatcttctccttgatc 82679

                                                
Query: 414   cccttcttcctcctcccgcccatgccgtcgtcctc 448
             |||||||||||||| || ||||| || ||||||||
Sbjct: 82678 cccttcttcctccttcctcccatcccatcgtcctc 82644



 Score =  103 bits (52), Expect = 6e-19
 Identities = 73/80 (91%)
 Strand = Plus / Minus

                                                                         
Query: 357   tgctgctggttgtccttgtggccgccggggagcttctccttgatcttctccttcatgccc 416
             |||||||| | | |||||| ||||||||||||||||||||||||||||||||| || |||
Sbjct: 60357 tgctgctgctcgcccttgttgccgccggggagcttctccttgatcttctccttgatcccc 60298

                                 
Query: 417   ttcttcctcctcccgcccat 436
             |||||||||||||| |||||
Sbjct: 60297 ttcttcctcctccctcccat 60278



 Score =  101 bits (51), Expect = 2e-18
 Identities = 60/63 (95%)
 Strand = Plus / Minus

                                                                         
Query: 201   gctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccg 260
             ||||||||||| || ||||||||||||||||||||||||||||| |||||||||||||||
Sbjct: 60516 gctcagtgctggccgggcagcttctccttgatcttgtccatgatgcccttcttctcgccg 60457

                
Query: 261   gtg 263
             |||
Sbjct: 60456 gtg 60454



 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 53/57 (92%)
 Strand = Plus / Minus

                                                                      
Query: 205   agtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccgg 261
             ||||||| || ||||||||||||||||||||||||||||  ||||||||||||||||
Sbjct: 67053 agtgctggccgggcagcttctccttgatcttgtccatgaatcccttcttctcgccgg 66997



 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 55/60 (91%)
 Strand = Plus / Minus

                                                                         
Query: 201   gctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccg 260
             ||||||||||| || || |||||||||||||||||||||| ||| |||||||||||||||
Sbjct: 82912 gctcagtgctggccggggagcttctccttgatcttgtccacgatgcccttcttctcgccg 82853



 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 53/59 (89%)
 Strand = Plus / Minus

                                                                        
Query: 205   agtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccggtg 263
             ||||||| || || ||||| |||||||||||||||||||  ||||||||||||||||||
Sbjct: 75496 agtgctggccgggaagcttttccttgatcttgtccatgaagcccttcttctcgccggtg 75438



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                                 
Query: 219   agcttctccttgatcttgtccatgatccccttcttc 254
             ||||||||||||||||| ||| ||||||||||||||
Sbjct: 82705 agcttctccttgatcttctccttgatccccttcttc 82670



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                                 
Query: 219   agcttctccttgatcttgtccatgatccccttcttc 254
             ||||||||||||||||| ||| ||||||||||||||
Sbjct: 60327 agcttctccttgatcttctccttgatccccttcttc 60292



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 39/43 (90%)
 Strand = Plus / Minus

                                                        
Query: 380   gccggggagcttctccttgatcttctccttcatgcccttcttc 422
             |||||||||||||||||||||||| |||   ||||||||||||
Sbjct: 82901 gccggggagcttctccttgatcttgtccacgatgcccttcttc 82859



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                    
Query: 216   ggcagcttctccttgatcttgtccatgatccccttcttc 254
             |||||||||||||||||||| ||| |||| |||||||||
Sbjct: 66865 ggcagcttctccttgatcttctccttgattcccttcttc 66827



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 39/43 (90%)
 Strand = Plus / Minus

                                                        
Query: 380   gccggggagcttctccttgatcttctccttcatgcccttcttc 422
             |||||| ||||||||||||||||| ||| | ||||||||||||
Sbjct: 60505 gccgggcagcttctccttgatcttgtccatgatgcccttcttc 60463



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                       
Query: 456   gagctggagctggagctgccggagcg 481
             ||||||||||||||||||||||||||
Sbjct: 82249 gagctggagctggagctgccggagcg 82224



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 46/53 (86%)
 Strand = Plus / Minus

                                                                  
Query: 455   cgagctggagctggagctgccggagcgatgcagtatcccacgggtcttgtgct 507
             |||||||||||| |||||||||||||| || || || || | |||||||||||
Sbjct: 75136 cgagctggagcttgagctgccggagcggtggaggatgccgccggtcttgtgct 75084



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 46/53 (86%)
 Strand = Plus / Minus

                                                                  
Query: 455   cgagctggagctggagctgccggagcgatgcagtatcccacgggtcttgtgct 507
             |||||| |||||||||||||||||||| ||||| |  || | |||||||||||
Sbjct: 60175 cgagcttgagctggagctgccggagcgttgcaggacgccgccggtcttgtgct 60123



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                                 
Query: 219   agcttctccttgatcttgtccatgatccccttcttc 254
             ||||||||||||||||| ||| |||| |||||||||
Sbjct: 75299 agcttctccttgatcttctccttgattcccttcttc 75264



 Score = 46.1 bits (23), Expect = 0.12
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                        
Query: 455   cgagctggagctggagctgccggagcg 481
             |||||||||||| ||||||||||||||
Sbjct: 66699 cgagctggagcttgagctgccggagcg 66673



 Score = 40.1 bits (20), Expect = 7.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 380   gccggggagcttctccttgatctt 403
             |||||| |||||||||||||||||
Sbjct: 67046 gccgggcagcttctccttgatctt 67023

---

>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11, complete
                sequence
          Length = 28386948

 Score =  121 bits (61), Expect = 2e-24
 Identities = 87/95 (91%), Gaps = 3/95 (3%)
 Strand = Plus / Plus

                                                                            
Query: 357      tgctgctggttgt---ccttgtggccgccggggagcttctccttgatcttctccttcatg 413
                |||||||||||||   |||||| ||||||||||||||||||||||||||||||||| || 
Sbjct: 14751728 tgctgctggttgttgcccttgttgccgccggggagcttctccttgatcttctccttgatt 14751787

                                                   
Query: 414      cccttcttcctcctcccgcccatgccgtcgtcctc 448
                ||||||||||||||||| ||||| |||||||||||
Sbjct: 14751788 cccttcttcctcctccctcccatcccgtcgtcctc 14751822



 Score =  119 bits (60), Expect = 1e-23
 Identities = 84/92 (91%)
 Strand = Plus / Plus

                                                                            
Query: 357      tgctgctggttgtccttgtggccgccggggagcttctccttgatcttctccttcatgccc 416
                |||||||||  | |||||| ||||||||||||||||||||||||||||||||| || |||
Sbjct: 14645808 tgctgctggccgcccttgttgccgccggggagcttctccttgatcttctccttgattccc 14645867

                                                
Query: 417      ttcttcctcctcccgcccatgccgtcgtcctc 448
                |||||||||||||| ||||| |||||||||||
Sbjct: 14645868 ttcttcctcctccctcccatcccgtcgtcctc 14645899



 Score =  111 bits (56), Expect = 2e-21
 Identities = 77/84 (91%)
 Strand = Plus / Plus

                                                                            
Query: 365      gttgtccttgtggccgccggggagcttctccttgatcttctccttcatgcccttcttcct 424
                |||| |||||| ||||||||| ||||||||||||||||||||||| || |||||||||||
Sbjct: 14760176 gttgcccttgttgccgccgggcagcttctccttgatcttctccttgattcccttcttcct 14760235

                                        
Query: 425      cctcccgcccatgccgtcgtcctc 448
                |||||| ||||| |||||||||||
Sbjct: 14760236 cctccctcccatcccgtcgtcctc 14760259



 Score =  105 bits (53), Expect = 1e-19
 Identities = 85/95 (89%), Gaps = 3/95 (3%)
 Strand = Plus / Plus

                                                                            
Query: 357      tgctgctggttgt---ccttgtggccgccggggagcttctccttgatcttctccttcatg 413
                |||||||||||||   |||||| ||||||||||||||||||||||||||||||||| || 
Sbjct: 14744322 tgctgctggttgttgcccttgttgccgccggggagcttctccttgatcttctccttgatc 14744381

                                                   
Query: 414      cccttcttcctcctcccgcccatgccgtcgtcctc 448
                |||||||||||||| || ||||| || ||||||||
Sbjct: 14744382 cccttcttcctccttcctcccatcccatcgtcctc 14744416



 Score =  103 bits (52), Expect = 6e-19
 Identities = 73/80 (91%)
 Strand = Plus / Plus

                                                                            
Query: 357      tgctgctggttgtccttgtggccgccggggagcttctccttgatcttctccttcatgccc 416
                |||||||| | | |||||| ||||||||||||||||||||||||||||||||| || |||
Sbjct: 14766703 tgctgctgctcgcccttgttgccgccggggagcttctccttgatcttctccttgatcccc 14766762

                                    
Query: 417      ttcttcctcctcccgcccat 436
                |||||||||||||| |||||
Sbjct: 14766763 ttcttcctcctccctcccat 14766782



 Score =  101 bits (51), Expect = 2e-18
 Identities = 60/63 (95%)
 Strand = Plus / Plus

                                                                            
Query: 201      gctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccg 260
                ||||||||||| || ||||||||||||||||||||||||||||| |||||||||||||||
Sbjct: 14766544 gctcagtgctggccgggcagcttctccttgatcttgtccatgatgcccttcttctcgccg 14766603

                   
Query: 261      gtg 263
                |||
Sbjct: 14766604 gtg 14766606



 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 53/57 (92%)
 Strand = Plus / Plus

                                                                         
Query: 205      agtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccgg 261
                ||||||| || ||||||||||||||||||||||||||||  ||||||||||||||||
Sbjct: 14760007 agtgctggccgggcagcttctccttgatcttgtccatgaatcccttcttctcgccgg 14760063



 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 55/60 (91%)
 Strand = Plus / Plus

                                                                            
Query: 201      gctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccg 260
                ||||||||||| || || |||||||||||||||||||||| ||| |||||||||||||||
Sbjct: 14744148 gctcagtgctggccggggagcttctccttgatcttgtccacgatgcccttcttctcgccg 14744207



 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 53/59 (89%)
 Strand = Plus / Plus

                                                                           
Query: 205      agtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccggtg 263
                ||||||| || || ||||| |||||||||||||||||||  ||||||||||||||||||
Sbjct: 14751564 agtgctggccgggaagcttttccttgatcttgtccatgaagcccttcttctcgccggtg 14751622



 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 40/42 (95%)
 Strand = Plus / Plus

                                                          
Query: 381      ccggggagcttctccttgatcttctccttcatgcccttcttc 422
                ||||||||||||||||||||||||||| |||| |||||||||
Sbjct: 14645646 ccggggagcttctccttgatcttctccatcatacccttcttc 14645687



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                                    
Query: 219      agcttctccttgatcttgtccatgatccccttcttc 254
                ||||||||||||||||| ||| ||||||||||||||
Sbjct: 14766733 agcttctccttgatcttctccttgatccccttcttc 14766768



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                                    
Query: 219      agcttctccttgatcttgtccatgatccccttcttc 254
                ||||||||||||||||| ||| ||||||||||||||
Sbjct: 14744355 agcttctccttgatcttctccttgatccccttcttc 14744390



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 39/43 (90%)
 Strand = Plus / Plus

                                                           
Query: 380      gccggggagcttctccttgatcttctccttcatgcccttcttc 422
                |||||| ||||||||||||||||| ||| | ||||||||||||
Sbjct: 14766555 gccgggcagcttctccttgatcttgtccatgatgcccttcttc 14766597



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 36/39 (92%)
 Strand = Plus / Plus

                                                       
Query: 216      ggcagcttctccttgatcttgtccatgatccccttcttc 254
                |||||||||||||||||||| ||| |||| |||||||||
Sbjct: 14760195 ggcagcttctccttgatcttctccttgattcccttcttc 14760233



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 39/43 (90%)
 Strand = Plus / Plus

                                                           
Query: 380      gccggggagcttctccttgatcttctccttcatgcccttcttc 422
                |||||||||||||||||||||||| |||   ||||||||||||
Sbjct: 14744159 gccggggagcttctccttgatcttgtccacgatgcccttcttc 14744201



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 36/39 (92%)
 Strand = Plus / Plus

                                                       
Query: 219      agcttctccttgatcttgtccatgatccccttcttctcg 257
                ||||||||||||||||| ||||| || ||||||||||||
Sbjct: 14645652 agcttctccttgatcttctccatcatacccttcttctcg 14645690



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                          
Query: 456      gagctggagctggagctgccggagcg 481
                ||||||||||||||||||||||||||
Sbjct: 14744811 gagctggagctggagctgccggagcg 14744836



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 31/33 (93%)
 Strand = Plus / Plus

                                                 
Query: 455      cgagctggagctggagctgccggagcgatgcag 487
                |||||| |||||||||||||||||||| |||||
Sbjct: 14766885 cgagcttgagctggagctgccggagcgttgcag 14766917



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 46/53 (86%)
 Strand = Plus / Plus

                                                                     
Query: 455      cgagctggagctggagctgccggagcgatgcagtatcccacgggtcttgtgct 507
                |||||||||||| |||||||||||||| || || || || | |||||||||||
Sbjct: 14751924 cgagctggagcttgagctgccggagcggtggaggatgccgccggtcttgtgct 14751976



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 33/36 (91%)
 Strand = Plus / Plus

                                                    
Query: 219      agcttctccttgatcttgtccatgatccccttcttc 254
                ||||||||||||||||| ||| |||| |||||||||
Sbjct: 14751761 agcttctccttgatcttctccttgattcccttcttc 14751796



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 33/36 (91%)
 Strand = Plus / Plus

                                                    
Query: 219      agcttctccttgatcttgtccatgatccccttcttc 254
                ||||||||||||||||| ||| |||| |||||||||
Sbjct: 14645838 agcttctccttgatcttctccttgattcccttcttc 14645873



 Score = 46.1 bits (23), Expect = 0.12
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                           
Query: 455      cgagctggagctggagctgccggagcg 481
                |||||||||||| ||||||||||||||
Sbjct: 14760361 cgagctggagcttgagctgccggagcg 14760387



 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 414      cccttcttcctcctcccgcc 433
                ||||||||||||||||||||
Sbjct: 26581429 cccttcttcctcctcccgcc 26581410



 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 414      cccttcttcctcctcccgcc 433
                ||||||||||||||||||||
Sbjct: 26045343 cccttcttcctcctcccgcc 26045324



 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 414      cccttcttcctcctcccgcc 433
                ||||||||||||||||||||
Sbjct: 26038739 cccttcttcctcctcccgcc 26038720



 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 414      cccttcttcctcctcccgcc 433
                ||||||||||||||||||||
Sbjct: 25979411 cccttcttcctcctcccgcc 25979392



 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 414      cccttcttcctcctcccgcc 433
                ||||||||||||||||||||
Sbjct: 24086818 cccttcttcctcctcccgcc 24086837



 Score = 40.1 bits (20), Expect = 7.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                        
Query: 380      gccggggagcttctccttgatctt 403
                |||||| |||||||||||||||||
Sbjct: 14760014 gccgggcagcttctccttgatctt 14760037



 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 414     cccttcttcctcctcccgcc 433
               ||||||||||||||||||||
Sbjct: 7077786 cccttcttcctcctcccgcc 7077805



 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 414     cccttcttcctcctcccgcc 433
               ||||||||||||||||||||
Sbjct: 2024748 cccttcttcctcctcccgcc 2024729



 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 414     cccttcttcctcctcccgcc 433
               ||||||||||||||||||||
Sbjct: 2018061 cccttcttcctcctcccgcc 2018042



 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 414    cccttcttcctcctcccgcc 433
              ||||||||||||||||||||
Sbjct: 555291 cccttcttcctcctcccgcc 555272

---

>emb|X15994.1|ZMRAB17G Maize RAB-17 gene
          Length = 1986

 Score =  121 bits (61), Expect = 2e-24
 Identities = 82/89 (92%)
 Strand = Plus / Minus

                                                                        
Query: 360  tgctggttgtccttgtggccgccggggagcttctccttgatcttctccttcatgcccttc 419
            ||||||| |||||||||||| ||||| |||||||| |||||||||||||| || ||||||
Sbjct: 1131 tgctggtcgtccttgtggcctccgggcagcttctctttgatcttctccttgattcccttc 1072

                                         
Query: 420  ttcctcctcccgcccatgccgtcgtcctc 448
            |||||||| ||||||||||||||||||||
Sbjct: 1071 ttcctccttccgcccatgccgtcgtcctc 1043



 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 61/65 (93%)
 Strand = Plus / Minus

                                                                        
Query: 201  gctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccg 260
            |||||||||||||| |||||||||||||||||||||||||| || || ||||||||||||
Sbjct: 1299 gctcagtgctgtccgggcagcttctccttgatcttgtccataatgcctttcttctcgccg 1240

                 
Query: 261  gtgcc 265
            |||||
Sbjct: 1239 gtgcc 1235



 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 49/53 (92%)
 Strand = Plus / Minus

                                                                
Query: 455 cgagctggagctggagctgccggagcgatgcagtatcccacgggtcttgtgct 507
           ||||||||||||||||||||||||||||||||| || || | |||||||||||
Sbjct: 902 cgagctggagctggagctgccggagcgatgcaggatgccgccggtcttgtgct 850



 Score = 46.1 bits (23), Expect = 0.12
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                   
Query: 216  ggcagcttctccttgatcttgtccatgatccccttcttc 254
            ||||||||||| |||||||| ||| |||| |||||||||
Sbjct: 1107 ggcagcttctctttgatcttctccttgattcccttcttc 1069



 Score = 44.1 bits (22), Expect = 0.46
 Identities = 37/42 (88%)
 Strand = Plus / Minus

                                                      
Query: 381  ccggggagcttctccttgatcttctccttcatgcccttcttc 422
            ||||| ||||||||||||||||| ||| | ||||| ||||||
Sbjct: 1287 ccgggcagcttctccttgatcttgtccataatgcctttcttc 1246

---

>gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome 11, complete sequence
          Length = 28369397

 Score =  121 bits (61), Expect = 2e-24
 Identities = 87/95 (91%), Gaps = 3/95 (3%)
 Strand = Plus / Plus

                                                                            
Query: 357      tgctgctggttgt---ccttgtggccgccggggagcttctccttgatcttctccttcatg 413
                |||||||||||||   |||||| ||||||||||||||||||||||||||||||||| || 
Sbjct: 14832165 tgctgctggttgttgcccttgttgccgccggggagcttctccttgatcttctccttgatt 14832224

                                                   
Query: 414      cccttcttcctcctcccgcccatgccgtcgtcctc 448
                ||||||||||||||||| ||||| |||||||||||
Sbjct: 14832225 cccttcttcctcctccctcccatcccgtcgtcctc 14832259



 Score =  119 bits (60), Expect = 1e-23
 Identities = 84/92 (91%)
 Strand = Plus / Plus

                                                                            
Query: 357      tgctgctggttgtccttgtggccgccggggagcttctccttgatcttctccttcatgccc 416
                |||||||||  | |||||| ||||||||||||||||||||||||||||||||| || |||
Sbjct: 14727809 tgctgctggccgcccttgttgccgccggggagcttctccttgatcttctccttgattccc 14727868

                                                
Query: 417      ttcttcctcctcccgcccatgccgtcgtcctc 448
                |||||||||||||| ||||| |||||||||||
Sbjct: 14727869 ttcttcctcctccctcccatcccgtcgtcctc 14727900



 Score =  111 bits (56), Expect = 2e-21
 Identities = 77/84 (91%)
 Strand = Plus / Plus

                                                                            
Query: 365      gttgtccttgtggccgccggggagcttctccttgatcttctccttcatgcccttcttcct 424
                |||| |||||| ||||||||| ||||||||||||||||||||||| || |||||||||||
Sbjct: 14840613 gttgcccttgttgccgccgggcagcttctccttgatcttctccttgattcccttcttcct 14840672

                                        
Query: 425      cctcccgcccatgccgtcgtcctc 448
                |||||| ||||| |||||||||||
Sbjct: 14840673 cctccctcccatcccgtcgtcctc 14840696



 Score =  105 bits (53), Expect = 1e-19
 Identities = 85/95 (89%), Gaps = 3/95 (3%)
 Strand = Plus / Plus

                                                                            
Query: 357      tgctgctggttgt---ccttgtggccgccggggagcttctccttgatcttctccttcatg 413
                |||||||||||||   |||||| ||||||||||||||||||||||||||||||||| || 
Sbjct: 14824759 tgctgctggttgttgcccttgttgccgccggggagcttctccttgatcttctccttgatc 14824818

                                                   
Query: 414      cccttcttcctcctcccgcccatgccgtcgtcctc 448
                |||||||||||||| || ||||| || ||||||||
Sbjct: 14824819 cccttcttcctccttcctcccatcccatcgtcctc 14824853



 Score =  103 bits (52), Expect = 6e-19
 Identities = 73/80 (91%)
 Strand = Plus / Plus

                                                                            
Query: 357      tgctgctggttgtccttgtggccgccggggagcttctccttgatcttctccttcatgccc 416
                |||||||| | | |||||| ||||||||||||||||||||||||||||||||| || |||
Sbjct: 14847140 tgctgctgctcgcccttgttgccgccggggagcttctccttgatcttctccttgatcccc 14847199

                                    
Query: 417      ttcttcctcctcccgcccat 436
                |||||||||||||| |||||
Sbjct: 14847200 ttcttcctcctccctcccat 14847219



 Score =  101 bits (51), Expect = 2e-18
 Identities = 60/63 (95%)
 Strand = Plus / Plus

                                                                            
Query: 201      gctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccg 260
                ||||||||||| || ||||||||||||||||||||||||||||| |||||||||||||||
Sbjct: 14846981 gctcagtgctggccgggcagcttctccttgatcttgtccatgatgcccttcttctcgccg 14847040

                   
Query: 261      gtg 263
                |||
Sbjct: 14847041 gtg 14847043



 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 53/57 (92%)
 Strand = Plus / Plus

                                                                         
Query: 205      agtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccgg 261
                ||||||| || ||||||||||||||||||||||||||||  ||||||||||||||||
Sbjct: 14840444 agtgctggccgggcagcttctccttgatcttgtccatgaatcccttcttctcgccgg 14840500



 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 55/60 (91%)
 Strand = Plus / Plus

                                                                            
Query: 201      gctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccg 260
                ||||||||||| || || |||||||||||||||||||||| ||| |||||||||||||||
Sbjct: 14824585 gctcagtgctggccggggagcttctccttgatcttgtccacgatgcccttcttctcgccg 14824644



 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 53/59 (89%)
 Strand = Plus / Plus

                                                                           
Query: 205      agtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccggtg 263
                ||||||| || || ||||| |||||||||||||||||||  ||||||||||||||||||
Sbjct: 14832001 agtgctggccgggaagcttttccttgatcttgtccatgaagcccttcttctcgccggtg 14832059



 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 40/42 (95%)
 Strand = Plus / Plus

                                                          
Query: 381      ccggggagcttctccttgatcttctccttcatgcccttcttc 422
                ||||||||||||||||||||||||||| |||| |||||||||
Sbjct: 14727647 ccggggagcttctccttgatcttctccatcatacccttcttc 14727688



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                                    
Query: 219      agcttctccttgatcttgtccatgatccccttcttc 254
                ||||||||||||||||| ||| ||||||||||||||
Sbjct: 14847170 agcttctccttgatcttctccttgatccccttcttc 14847205



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                                    
Query: 219      agcttctccttgatcttgtccatgatccccttcttc 254
                ||||||||||||||||| ||| ||||||||||||||
Sbjct: 14824792 agcttctccttgatcttctccttgatccccttcttc 14824827



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 39/43 (90%)
 Strand = Plus / Plus

                                                           
Query: 380      gccggggagcttctccttgatcttctccttcatgcccttcttc 422
                |||||| ||||||||||||||||| ||| | ||||||||||||
Sbjct: 14846992 gccgggcagcttctccttgatcttgtccatgatgcccttcttc 14847034



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 36/39 (92%)
 Strand = Plus / Plus

                                                       
Query: 216      ggcagcttctccttgatcttgtccatgatccccttcttc 254
                |||||||||||||||||||| ||| |||| |||||||||
Sbjct: 14840632 ggcagcttctccttgatcttctccttgattcccttcttc 14840670



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 39/43 (90%)
 Strand = Plus / Plus

                                                           
Query: 380      gccggggagcttctccttgatcttctccttcatgcccttcttc 422
                |||||||||||||||||||||||| |||   ||||||||||||
Sbjct: 14824596 gccggggagcttctccttgatcttgtccacgatgcccttcttc 14824638



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 36/39 (92%)
 Strand = Plus / Plus

                                                       
Query: 219      agcttctccttgatcttgtccatgatccccttcttctcg 257
                ||||||||||||||||| ||||| || ||||||||||||
Sbjct: 14727653 agcttctccttgatcttctccatcatacccttcttctcg 14727691



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                          
Query: 456      gagctggagctggagctgccggagcg 481
                ||||||||||||||||||||||||||
Sbjct: 14825248 gagctggagctggagctgccggagcg 14825273



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 31/33 (93%)
 Strand = Plus / Plus

                                                 
Query: 455      cgagctggagctggagctgccggagcgatgcag 487
                |||||| |||||||||||||||||||| |||||
Sbjct: 14847322 cgagcttgagctggagctgccggagcgttgcag 14847354



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 46/53 (86%)
 Strand = Plus / Plus

                                                                     
Query: 455      cgagctggagctggagctgccggagcgatgcagtatcccacgggtcttgtgct 507
                |||||||||||| |||||||||||||| || || || || | |||||||||||
Sbjct: 14832361 cgagctggagcttgagctgccggagcggtggaggatgccgccggtcttgtgct 14832413



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 33/36 (91%)
 Strand = Plus / Plus

                                                    
Query: 219      agcttctccttgatcttgtccatgatccccttcttc 254
                ||||||||||||||||| ||| |||| |||||||||
Sbjct: 14832198 agcttctccttgatcttctccttgattcccttcttc 14832233



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 33/36 (91%)
 Strand = Plus / Plus

                                                    
Query: 219      agcttctccttgatcttgtccatgatccccttcttc 254
                ||||||||||||||||| ||| |||| |||||||||
Sbjct: 14727839 agcttctccttgatcttctccttgattcccttcttc 14727874



 Score = 46.1 bits (23), Expect = 0.12
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                           
Query: 455      cgagctggagctggagctgccggagcg 481
                |||||||||||| ||||||||||||||
Sbjct: 14840798 cgagctggagcttgagctgccggagcg 14840824



 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 414      cccttcttcctcctcccgcc 433
                ||||||||||||||||||||
Sbjct: 26906693 cccttcttcctcctcccgcc 26906674



 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 414      cccttcttcctcctcccgcc 433
                ||||||||||||||||||||
Sbjct: 26364039 cccttcttcctcctcccgcc 26364020



 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 414      cccttcttcctcctcccgcc 433
                ||||||||||||||||||||
Sbjct: 26357435 cccttcttcctcctcccgcc 26357416



 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 414      cccttcttcctcctcccgcc 433
                ||||||||||||||||||||
Sbjct: 26298109 cccttcttcctcctcccgcc 26298090



 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 414      cccttcttcctcctcccgcc 433
                ||||||||||||||||||||
Sbjct: 24398487 cccttcttcctcctcccgcc 24398506



 Score = 40.1 bits (20), Expect = 7.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                        
Query: 380      gccggggagcttctccttgatctt 403
                |||||| |||||||||||||||||
Sbjct: 14840451 gccgggcagcttctccttgatctt 14840474



 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 414     cccttcttcctcctcccgcc 433
               ||||||||||||||||||||
Sbjct: 7143757 cccttcttcctcctcccgcc 7143776



 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 414     cccttcttcctcctcccgcc 433
               ||||||||||||||||||||
Sbjct: 2032529 cccttcttcctcctcccgcc 2032510



 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 414     cccttcttcctcctcccgcc 433
               ||||||||||||||||||||
Sbjct: 2025842 cccttcttcctcctcccgcc 2025823



 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 414    cccttcttcctcctcccgcc 433
              ||||||||||||||||||||
Sbjct: 555291 cccttcttcctcctcccgcc 555272

---

>gb|AC146946.2| Oryza sativa (japonica cultivar-group) chromosome 11 clone
             OSJNBa0037B06 map near 50283S, complete sequence
          Length = 149398

 Score =  119 bits (60), Expect = 1e-23
 Identities = 84/92 (91%)
 Strand = Plus / Minus

                                                                         
Query: 357   tgctgctggttgtccttgtggccgccggggagcttctccttgatcttctccttcatgccc 416
             |||||||||  | |||||| ||||||||||||||||||||||||||||||||| || |||
Sbjct: 88908 tgctgctggccgcccttgttgccgccggggagcttctccttgatcttctccttgattccc 88849

                                             
Query: 417   ttcttcctcctcccgcccatgccgtcgtcctc 448
             |||||||||||||| ||||| |||||||||||
Sbjct: 88848 ttcttcctcctccctcccatcccgtcgtcctc 88817



 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 40/42 (95%)
 Strand = Plus / Minus

                                                       
Query: 381   ccggggagcttctccttgatcttctccttcatgcccttcttc 422
             ||||||||||||||||||||||||||| |||| |||||||||
Sbjct: 89070 ccggggagcttctccttgatcttctccatcatacccttcttc 89029



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                    
Query: 219   agcttctccttgatcttgtccatgatccccttcttctcg 257
             ||||||||||||||||| ||||| || ||||||||||||
Sbjct: 89064 agcttctccttgatcttctccatcatacccttcttctcg 89026



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                                 
Query: 219   agcttctccttgatcttgtccatgatccccttcttc 254
             ||||||||||||||||| ||| |||| |||||||||
Sbjct: 88878 agcttctccttgatcttctccttgattcccttcttc 88843

---

>emb|X71362.1|HVDHN7 H.vulgare gene for dehydrin 7
          Length = 2138

 Score =  119 bits (60), Expect = 1e-23
 Identities = 66/68 (97%)
 Strand = Plus / Minus

                                                                        
Query: 381  ccggggagcttctccttgatcttctccttcatgcccttcttcctcctcccgcccatgccg 440
            |||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||
Sbjct: 1375 ccggggagcttctccttgatcttctccttcatccccttcttcctcctcccgcccacgccg 1316

                    
Query: 441  tcgtcctc 448
            ||||||||
Sbjct: 1315 tcgtcctc 1308



 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 60/67 (89%), Gaps = 3/67 (4%)
 Strand = Plus / Minus

                                                                        
Query: 200  ggctcagtgctgt---cccggcagcttctccttgatcttgtccatgatccccttcttctc 256
            |||||||||||||   || || |||||||||||||||||||||||||  |||||||||||
Sbjct: 1523 ggctcagtgctgtccgccgggaagcttctccttgatcttgtccatgacgcccttcttctc 1464

                   
Query: 257  gccggtg 263
            |||||||
Sbjct: 1463 gccggtg 1457



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                         
Query: 378  ccgccggggagcttctccttgatcttctccttcatgcccttcttc 422
            |||||||| ||||||||||||||||| ||| | | ||||||||||
Sbjct: 1510 ccgccgggaagcttctccttgatcttgtccatgacgcccttcttc 1466



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                                
Query: 219  agcttctccttgatcttgtccatgatccccttcttc 254
            ||||||||||||||||| ||| | ||||||||||||
Sbjct: 1369 agcttctccttgatcttctccttcatccccttcttc 1334



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 461  ggagctggagctgccggagcg 481
            |||||||||||||||||||||
Sbjct: 1205 ggagctggagctgccggagcg 1185

---

>emb|X52423.1|OSRAB16C O.sativa DNA for rab 16C gene
          Length = 2493

 Score =  119 bits (60), Expect = 1e-23
 Identities = 78/84 (92%)
 Strand = Plus / Minus

                                                                        
Query: 365  gttgtccttgtggccgccggggagcttctccttgatcttctccttcatgcccttcttcct 424
            |||| |||||| ||||||||||||||||||||||||||||||||| || |||||||||||
Sbjct: 1879 gttggccttgttgccgccggggagcttctccttgatcttctccttgattcccttcttcct 1820

                                    
Query: 425  cctcccgcccatgccgtcgtcctc 448
            |||||| ||||| |||||||||||
Sbjct: 1819 cctccctcccatcccgtcgtcctc 1796



 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 53/59 (89%)
 Strand = Plus / Minus

                                                                       
Query: 205  agtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccggtg 263
            ||||||| || || ||||| |||||||||||||||||||  ||||||||||||||||||
Sbjct: 2054 agtgctggccgggaagcttttccttgatcttgtccatgaagcccttcttctcgccggtg 1996



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 46/53 (86%)
 Strand = Plus / Minus

                                                                 
Query: 455  cgagctggagctggagctgccggagcgatgcagtatcccacgggtcttgtgct 507
            |||||||||||| |||||||||||||| || || || || | |||||||||||
Sbjct: 1704 cgagctggagcttgagctgccggagcggtggaggatgccgccggtcttgtgct 1652



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                                
Query: 219  agcttctccttgatcttgtccatgatccccttcttc 254
            ||||||||||||||||| ||| |||| |||||||||
Sbjct: 1857 agcttctccttgatcttctccttgattcccttcttc 1822

---

>gb|AY895879.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 559556 dehydrin 1
           (Dhn1) gene, partial cds
          Length = 1446

 Score =  119 bits (60), Expect = 1e-23
 Identities = 66/68 (97%)
 Strand = Plus / Minus

                                                                       
Query: 381 ccggggagcttctccttgatcttctccttcatgcccttcttcctcctcccgcccatgccg 440
           |||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||
Sbjct: 356 ccggggagcttctccttgatcttctccttcatccccttcttcctcctcccgcccacgccg 297

                   
Query: 441 tcgtcctc 448
           ||||||||
Sbjct: 296 tcgtcctc 289



 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 60/67 (89%), Gaps = 3/67 (4%)
 Strand = Plus / Minus

                                                                       
Query: 200 ggctcagtgctgt---cccggcagcttctccttgatcttgtccatgatccccttcttctc 256
           |||||||||||||   || || |||||||||||||||||||||||||  |||||||||||
Sbjct: 504 ggctcagtgctgtccgccgggaagcttctccttgatcttgtccatgacgcccttcttctc 445

                  
Query: 257 gccggtg 263
           |||||||
Sbjct: 444 gccggtg 438



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                     
Query: 456 gagctggagctggagctgccggagcg 481
           ||||||||||||||||||||||||||
Sbjct: 185 gagctggagctggagctgccggagcg 160



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 378 ccgccggggagcttctccttgatcttctccttcatgcccttcttc 422
           |||||||| ||||||||||||||||| ||| | | ||||||||||
Sbjct: 491 ccgccgggaagcttctccttgatcttgtccatgacgcccttcttc 447



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 219 agcttctccttgatcttgtccatgatccccttcttc 254
           ||||||||||||||||| ||| | ||||||||||||
Sbjct: 350 agcttctccttgatcttctccttcatccccttcttc 315

---

>gb|AY895878.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 531957 dehydrin 1
           (Dhn1) gene, partial cds
          Length = 1268

 Score =  119 bits (60), Expect = 1e-23
 Identities = 66/68 (97%)
 Strand = Plus / Minus

                                                                       
Query: 381 ccggggagcttctccttgatcttctccttcatgcccttcttcctcctcccgcccatgccg 440
           |||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||
Sbjct: 356 ccggggagcttctccttgatcttctccttcatccccttcttcctcctcccgcccacgccg 297

                   
Query: 441 tcgtcctc 448
           ||||||||
Sbjct: 296 tcgtcctc 289



 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 60/67 (89%), Gaps = 3/67 (4%)
 Strand = Plus / Minus

                                                                       
Query: 200 ggctcagtgctgt---cccggcagcttctccttgatcttgtccatgatccccttcttctc 256
           |||||||||||||   || || |||||||||||||||||||||||||  |||||||||||
Sbjct: 504 ggctcagtgctgtccgccgggaagcttctccttgatcttgtccatgacgcccttcttctc 445

                  
Query: 257 gccggtg 263
           |||||||
Sbjct: 444 gccggtg 438



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                     
Query: 456 gagctggagctggagctgccggagcg 481
           ||||||||||||||||||||||||||
Sbjct: 185 gagctggagctggagctgccggagcg 160



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 378 ccgccggggagcttctccttgatcttctccttcatgcccttcttc 422
           |||||||| ||||||||||||||||| ||| | | ||||||||||
Sbjct: 491 ccgccgggaagcttctccttgatcttgtccatgacgcccttcttc 447



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 219 agcttctccttgatcttgtccatgatccccttcttc 254
           ||||||||||||||||| ||| | ||||||||||||
Sbjct: 350 agcttctccttgatcttctccttcatccccttcttc 315

---

>gb|AY895877.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 531853 dehydrin 1
           (Dhn1) gene, partial cds
          Length = 1268

 Score =  119 bits (60), Expect = 1e-23
 Identities = 66/68 (97%)
 Strand = Plus / Minus

                                                                       
Query: 381 ccggggagcttctccttgatcttctccttcatgcccttcttcctcctcccgcccatgccg 440
           |||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||
Sbjct: 356 ccggggagcttctccttgatcttctccttcatccccttcttcctcctcccgcccacgccg 297

                   
Query: 441 tcgtcctc 448
           ||||||||
Sbjct: 296 tcgtcctc 289



 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 60/67 (89%), Gaps = 3/67 (4%)
 Strand = Plus / Minus

                                                                       
Query: 200 ggctcagtgctgt---cccggcagcttctccttgatcttgtccatgatccccttcttctc 256
           |||||||||||||   || || |||||||||||||||||||||||||  |||||||||||
Sbjct: 504 ggctcagtgctgtccgccgggaagcttctccttgatcttgtccatgacgcccttcttctc 445

                  
Query: 257 gccggtg 263
           |||||||
Sbjct: 444 gccggtg 438



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                     
Query: 456 gagctggagctggagctgccggagcg 481
           ||||||||||||||||||||||||||
Sbjct: 185 gagctggagctggagctgccggagcg 160



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 378 ccgccggggagcttctccttgatcttctccttcatgcccttcttc 422
           |||||||| ||||||||||||||||| ||| | | ||||||||||
Sbjct: 491 ccgccgggaagcttctccttgatcttgtccatgacgcccttcttc 447



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 219 agcttctccttgatcttgtccatgatccccttcttc 254
           ||||||||||||||||| ||| | ||||||||||||
Sbjct: 350 agcttctccttgatcttctccttcatccccttcttc 315

---

>gb|AY895876.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 531851 dehydrin 1
           (Dhn1) gene, partial cds
          Length = 1291

 Score =  119 bits (60), Expect = 1e-23
 Identities = 66/68 (97%)
 Strand = Plus / Minus

                                                                       
Query: 381 ccggggagcttctccttgatcttctccttcatgcccttcttcctcctcccgcccatgccg 440
           |||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||
Sbjct: 356 ccggggagcttctccttgatcttctccttcatccccttcttcctcctcccgcccacgccg 297

                   
Query: 441 tcgtcctc 448
           ||||||||
Sbjct: 296 tcgtcctc 289



 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 60/67 (89%), Gaps = 3/67 (4%)
 Strand = Plus / Minus

                                                                       
Query: 200 ggctcagtgctgt---cccggcagcttctccttgatcttgtccatgatccccttcttctc 256
           |||||||||||||   || || |||||||||||||||||||||||||  |||||||||||
Sbjct: 504 ggctcagtgctgtccgccgggaagcttctccttgatcttgtccatgacgcccttcttctc 445

                  
Query: 257 gccggtg 263
           |||||||
Sbjct: 444 gccggtg 438



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                     
Query: 456 gagctggagctggagctgccggagcg 481
           ||||||||||||||||||||||||||
Sbjct: 185 gagctggagctggagctgccggagcg 160



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 378 ccgccggggagcttctccttgatcttctccttcatgcccttcttc 422
           |||||||| ||||||||||||||||| ||| | | ||||||||||
Sbjct: 491 ccgccgggaagcttctccttgatcttgtccatgacgcccttcttc 447



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 219 agcttctccttgatcttgtccatgatccccttcttc 254
           ||||||||||||||||| ||| | ||||||||||||
Sbjct: 350 agcttctccttgatcttctccttcatccccttcttc 315

---

>gb|AY895875.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 466460 dehydrin 1
           (Dhn1) gene, partial cds
          Length = 1268

 Score =  119 bits (60), Expect = 1e-23
 Identities = 66/68 (97%)
 Strand = Plus / Minus

                                                                       
Query: 381 ccggggagcttctccttgatcttctccttcatgcccttcttcctcctcccgcccatgccg 440
           |||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||
Sbjct: 356 ccggggagcttctccttgatcttctccttcatccccttcttcctcctcccgcccacgccg 297

                   
Query: 441 tcgtcctc 448
           ||||||||
Sbjct: 296 tcgtcctc 289



 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 60/67 (89%), Gaps = 3/67 (4%)
 Strand = Plus / Minus

                                                                       
Query: 200 ggctcagtgctgt---cccggcagcttctccttgatcttgtccatgatccccttcttctc 256
           |||||||||||||   || || |||||||||||||||||||||||||  |||||||||||
Sbjct: 504 ggctcagtgctgtccgccgggaagcttctccttgatcttgtccatgacgcccttcttctc 445

                  
Query: 257 gccggtg 263
           |||||||
Sbjct: 444 gccggtg 438



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                     
Query: 456 gagctggagctggagctgccggagcg 481
           ||||||||||||||||||||||||||
Sbjct: 185 gagctggagctggagctgccggagcg 160



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 378 ccgccggggagcttctccttgatcttctccttcatgcccttcttc 422
           |||||||| ||||||||||||||||| ||| | | ||||||||||
Sbjct: 491 ccgccgggaagcttctccttgatcttgtccatgacgcccttcttc 447



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 219 agcttctccttgatcttgtccatgatccccttcttc 254
           ||||||||||||||||| ||| | ||||||||||||
Sbjct: 350 agcttctccttgatcttctccttcatccccttcttc 315

---

>gb|AY895874.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 420916 dehydrin 1
           (Dhn1) gene, partial cds
          Length = 1249

 Score =  119 bits (60), Expect = 1e-23
 Identities = 66/68 (97%)
 Strand = Plus / Minus

                                                                       
Query: 381 ccggggagcttctccttgatcttctccttcatgcccttcttcctcctcccgcccatgccg 440
           |||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||
Sbjct: 356 ccggggagcttctccttgatcttctccttcatccccttcttcctcctcccgcccacgccg 297

                   
Query: 441 tcgtcctc 448
           ||||||||
Sbjct: 296 tcgtcctc 289



 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 60/67 (89%), Gaps = 3/67 (4%)
 Strand = Plus / Minus

                                                                       
Query: 200 ggctcagtgctgt---cccggcagcttctccttgatcttgtccatgatccccttcttctc 256
           |||||||||||||   || || |||||||||||||||||||||||||  |||||||||||
Sbjct: 504 ggctcagtgctgtccgccgggaagcttctccttgatcttgtccatgacgcccttcttctc 445

                  
Query: 257 gccggtg 263
           |||||||
Sbjct: 444 gccggtg 438



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                     
Query: 456 gagctggagctggagctgccggagcg 481
           ||||||||||||||||||||||||||
Sbjct: 185 gagctggagctggagctgccggagcg 160



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 378 ccgccggggagcttctccttgatcttctccttcatgcccttcttc 422
           |||||||| ||||||||||||||||| ||| | | ||||||||||
Sbjct: 491 ccgccgggaagcttctccttgatcttgtccatgacgcccttcttc 447



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 219 agcttctccttgatcttgtccatgatccccttcttc 254
           ||||||||||||||||| ||| | ||||||||||||
Sbjct: 350 agcttctccttgatcttctccttcatccccttcttc 315

---

>gb|AY895873.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 420913 dehydrin 1
           (Dhn1) gene, partial cds
          Length = 1202

 Score =  119 bits (60), Expect = 1e-23
 Identities = 66/68 (97%)
 Strand = Plus / Minus

                                                                       
Query: 381 ccggggagcttctccttgatcttctccttcatgcccttcttcctcctcccgcccatgccg 440
           |||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||
Sbjct: 356 ccggggagcttctccttgatcttctccttcatccccttcttcctcctcccgcccacgccg 297

                   
Query: 441 tcgtcctc 448
           ||||||||
Sbjct: 296 tcgtcctc 289



 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 60/67 (89%), Gaps = 3/67 (4%)
 Strand = Plus / Minus

                                                                       
Query: 200 ggctcagtgctgt---cccggcagcttctccttgatcttgtccatgatccccttcttctc 256
           |||||||||||||   || || |||||||||||||||||||||||||  |||||||||||
Sbjct: 504 ggctcagtgctgtccgccgggaagcttctccttgatcttgtccatgacgcccttcttctc 445

                  
Query: 257 gccggtg 263
           |||||||
Sbjct: 444 gccggtg 438



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                     
Query: 456 gagctggagctggagctgccggagcg 481
           ||||||||||||||||||||||||||
Sbjct: 185 gagctggagctggagctgccggagcg 160



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 378 ccgccggggagcttctccttgatcttctccttcatgcccttcttc 422
           |||||||| ||||||||||||||||| ||| | | ||||||||||
Sbjct: 491 ccgccgggaagcttctccttgatcttgtccatgacgcccttcttc 447



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 219 agcttctccttgatcttgtccatgatccccttcttc 254
           ||||||||||||||||| ||| | ||||||||||||
Sbjct: 350 agcttctccttgatcttctccttcatccccttcttc 315

---

>gb|AY895872.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 420911 dehydrin 1
           (Dhn1) gene, partial cds
          Length = 1268

 Score =  119 bits (60), Expect = 1e-23
 Identities = 66/68 (97%)
 Strand = Plus / Minus

                                                                       
Query: 381 ccggggagcttctccttgatcttctccttcatgcccttcttcctcctcccgcccatgccg 440
           |||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||
Sbjct: 356 ccggggagcttctccttgatcttctccttcatccccttcttcctcctcccgcccacgccg 297

                   
Query: 441 tcgtcctc 448
           ||||||||
Sbjct: 296 tcgtcctc 289



 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 60/67 (89%), Gaps = 3/67 (4%)
 Strand = Plus / Minus

                                                                       
Query: 200 ggctcagtgctgt---cccggcagcttctccttgatcttgtccatgatccccttcttctc 256
           |||||||||||||   || || |||||||||||||||||||||||||  |||||||||||
Sbjct: 504 ggctcagtgctgtccgccgggaagcttctccttgatcttgtccatgacgcccttcttctc 445

                  
Query: 257 gccggtg 263
           |||||||
Sbjct: 444 gccggtg 438



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                     
Query: 456 gagctggagctggagctgccggagcg 481
           ||||||||||||||||||||||||||
Sbjct: 185 gagctggagctggagctgccggagcg 160



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 378 ccgccggggagcttctccttgatcttctccttcatgcccttcttc 422
           |||||||| ||||||||||||||||| ||| | | ||||||||||
Sbjct: 491 ccgccgggaagcttctccttgatcttgtccatgacgcccttcttc 447



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 219 agcttctccttgatcttgtccatgatccccttcttc 254
           ||||||||||||||||| ||| | ||||||||||||
Sbjct: 350 agcttctccttgatcttctccttcatccccttcttc 315

---

>gb|AY895871.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 406276 dehydrin 1
           (Dhn1) gene, partial cds
          Length = 1330

 Score =  119 bits (60), Expect = 1e-23
 Identities = 66/68 (97%)
 Strand = Plus / Minus

                                                                       
Query: 381 ccggggagcttctccttgatcttctccttcatgcccttcttcctcctcccgcccatgccg 440
           |||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||
Sbjct: 350 ccggggagcttctccttgatcttctccttcatccccttcttcctcctcccgcccacgccg 291

                   
Query: 441 tcgtcctc 448
           ||||||||
Sbjct: 290 tcgtcctc 283



 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 60/67 (89%), Gaps = 3/67 (4%)
 Strand = Plus / Minus

                                                                       
Query: 200 ggctcagtgctgt---cccggcagcttctccttgatcttgtccatgatccccttcttctc 256
           |||||||||||||   || || |||||||||||||||||||||||||  |||||||||||
Sbjct: 498 ggctcagtgctgtccgccgggaagcttctccttgatcttgtccatgacgcccttcttctc 439

                  
Query: 257 gccggtg 263
           |||||||
Sbjct: 438 gccggtg 432



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 378 ccgccggggagcttctccttgatcttctccttcatgcccttcttc 422
           |||||||| ||||||||||||||||| ||| | | ||||||||||
Sbjct: 485 ccgccgggaagcttctccttgatcttgtccatgacgcccttcttc 441



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 219 agcttctccttgatcttgtccatgatccccttcttc 254
           ||||||||||||||||| ||| | ||||||||||||
Sbjct: 344 agcttctccttgatcttctccttcatccccttcttc 309



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 461 ggagctggagctgccggagcg 481
           |||||||||||||||||||||
Sbjct: 180 ggagctggagctgccggagcg 160

---

>gb|AY895870.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 401371 dehydrin 1
           (Dhn1) gene, partial cds
          Length = 1428

 Score =  119 bits (60), Expect = 1e-23
 Identities = 66/68 (97%)
 Strand = Plus / Minus

                                                                       
Query: 381 ccggggagcttctccttgatcttctccttcatgcccttcttcctcctcccgcccatgccg 440
           |||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||
Sbjct: 356 ccggggagcttctccttgatcttctccttcatccccttcttcctcctcccgcccacgccg 297

                   
Query: 441 tcgtcctc 448
           ||||||||
Sbjct: 296 tcgtcctc 289



 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 60/67 (89%), Gaps = 3/67 (4%)
 Strand = Plus / Minus

                                                                       
Query: 200 ggctcagtgctgt---cccggcagcttctccttgatcttgtccatgatccccttcttctc 256
           |||||||||||||   || || |||||||||||||||||||||||||  |||||||||||
Sbjct: 504 ggctcagtgctgtccgccgggaagcttctccttgatcttgtccatgacgcccttcttctc 445

                  
Query: 257 gccggtg 263
           |||||||
Sbjct: 444 gccggtg 438



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                     
Query: 456 gagctggagctggagctgccggagcg 481
           ||||||||||||||||||||||||||
Sbjct: 185 gagctggagctggagctgccggagcg 160



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 378 ccgccggggagcttctccttgatcttctccttcatgcccttcttc 422
           |||||||| ||||||||||||||||| ||| | | ||||||||||
Sbjct: 491 ccgccgggaagcttctccttgatcttgtccatgacgcccttcttc 447



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 219 agcttctccttgatcttgtccatgatccccttcttc 254
           ||||||||||||||||| ||| | ||||||||||||
Sbjct: 350 agcttctccttgatcttctccttcatccccttcttc 315

---

>gb|AY895869.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 401370 dehydrin 1
           (Dhn1) gene, partial cds
          Length = 1269

 Score =  119 bits (60), Expect = 1e-23
 Identities = 66/68 (97%)
 Strand = Plus / Minus

                                                                       
Query: 381 ccggggagcttctccttgatcttctccttcatgcccttcttcctcctcccgcccatgccg 440
           |||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||
Sbjct: 356 ccggggagcttctccttgatcttctccttcatccccttcttcctcctcccgcccacgccg 297

                   
Query: 441 tcgtcctc 448
           ||||||||
Sbjct: 296 tcgtcctc 289



 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 60/67 (89%), Gaps = 3/67 (4%)
 Strand = Plus / Minus

                                                                       
Query: 200 ggctcagtgctgt---cccggcagcttctccttgatcttgtccatgatccccttcttctc 256
           |||||||||||||   || || |||||||||||||||||||||||||  |||||||||||
Sbjct: 504 ggctcagtgctgtccgccgggaagcttctccttgatcttgtccatgacgcccttcttctc 445

                  
Query: 257 gccggtg 263
           |||||||
Sbjct: 444 gccggtg 438



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                     
Query: 456 gagctggagctggagctgccggagcg 481
           ||||||||||||||||||||||||||
Sbjct: 185 gagctggagctggagctgccggagcg 160



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 378 ccgccggggagcttctccttgatcttctccttcatgcccttcttc 422
           |||||||| ||||||||||||||||| ||| | | ||||||||||
Sbjct: 491 ccgccgggaagcttctccttgatcttgtccatgacgcccttcttc 447



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 219 agcttctccttgatcttgtccatgatccccttcttc 254
           ||||||||||||||||| ||| | ||||||||||||
Sbjct: 350 agcttctccttgatcttctccttcatccccttcttc 315

---

>gb|AY895868.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 366446 dehydrin 1
           (Dhn1) gene, partial cds
          Length = 1269

 Score =  119 bits (60), Expect = 1e-23
 Identities = 66/68 (97%)
 Strand = Plus / Minus

                                                                       
Query: 381 ccggggagcttctccttgatcttctccttcatgcccttcttcctcctcccgcccatgccg 440
           |||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||
Sbjct: 356 ccggggagcttctccttgatcttctccttcatccccttcttcctcctcccgcccacgccg 297

                   
Query: 441 tcgtcctc 448
           ||||||||
Sbjct: 296 tcgtcctc 289



 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 60/67 (89%), Gaps = 3/67 (4%)
 Strand = Plus / Minus

                                                                       
Query: 200 ggctcagtgctgt---cccggcagcttctccttgatcttgtccatgatccccttcttctc 256
           |||||||||||||   || || |||||||||||||||||||||||||  |||||||||||
Sbjct: 504 ggctcagtgctgtccgccgggaagcttctccttgatcttgtccatgacgcccttcttctc 445

                  
Query: 257 gccggtg 263
           |||||||
Sbjct: 444 gccggtg 438



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                     
Query: 456 gagctggagctggagctgccggagcg 481
           ||||||||||||||||||||||||||
Sbjct: 185 gagctggagctggagctgccggagcg 160



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 378 ccgccggggagcttctccttgatcttctccttcatgcccttcttc 422
           |||||||| ||||||||||||||||| ||| | | ||||||||||
Sbjct: 491 ccgccgggaagcttctccttgatcttgtccatgacgcccttcttc 447



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 219 agcttctccttgatcttgtccatgatccccttcttc 254
           ||||||||||||||||| ||| | ||||||||||||
Sbjct: 350 agcttctccttgatcttctccttcatccccttcttc 315

---

>gb|AY895867.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 296926 dehydrin 1
           (Dhn1) gene, partial cds
          Length = 1417

 Score =  119 bits (60), Expect = 1e-23
 Identities = 66/68 (97%)
 Strand = Plus / Minus

                                                                       
Query: 381 ccggggagcttctccttgatcttctccttcatgcccttcttcctcctcccgcccatgccg 440
           |||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||
Sbjct: 350 ccggggagcttctccttgatcttctccttcatccccttcttcctcctcccgcccacgccg 291

                   
Query: 441 tcgtcctc 448
           ||||||||
Sbjct: 290 tcgtcctc 283



 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 60/67 (89%), Gaps = 3/67 (4%)
 Strand = Plus / Minus

                                                                       
Query: 200 ggctcagtgctgt---cccggcagcttctccttgatcttgtccatgatccccttcttctc 256
           |||||||||||||   || || |||||||||||||||||||||||||  |||||||||||
Sbjct: 498 ggctcagtgctgtccgccgggaagcttctccttgatcttgtccatgacgcccttcttctc 439

                  
Query: 257 gccggtg 263
           |||||||
Sbjct: 438 gccggtg 432



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 378 ccgccggggagcttctccttgatcttctccttcatgcccttcttc 422
           |||||||| ||||||||||||||||| ||| | | ||||||||||
Sbjct: 485 ccgccgggaagcttctccttgatcttgtccatgacgcccttcttc 441



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 219 agcttctccttgatcttgtccatgatccccttcttc 254
           ||||||||||||||||| ||| | ||||||||||||
Sbjct: 344 agcttctccttgatcttctccttcatccccttcttc 309



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 461 ggagctggagctgccggagcg 481
           |||||||||||||||||||||
Sbjct: 180 ggagctggagctgccggagcg 160

---

>gb|AY895866.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 293411 dehydrin 1
           (Dhn1) gene, partial cds
          Length = 1428

 Score =  119 bits (60), Expect = 1e-23
 Identities = 66/68 (97%)
 Strand = Plus / Minus

                                                                       
Query: 381 ccggggagcttctccttgatcttctccttcatgcccttcttcctcctcccgcccatgccg 440
           |||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||
Sbjct: 356 ccggggagcttctccttgatcttctccttcatccccttcttcctcctcccgcccacgccg 297

                   
Query: 441 tcgtcctc 448
           ||||||||
Sbjct: 296 tcgtcctc 289



 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 60/67 (89%), Gaps = 3/67 (4%)
 Strand = Plus / Minus

                                                                       
Query: 200 ggctcagtgctgt---cccggcagcttctccttgatcttgtccatgatccccttcttctc 256
           |||||||||||||   || || |||||||||||||||||||||||||  |||||||||||
Sbjct: 504 ggctcagtgctgtccgccgggaagcttctccttgatcttgtccatgacgcccttcttctc 445

                  
Query: 257 gccggtg 263
           |||||||
Sbjct: 444 gccggtg 438



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                     
Query: 456 gagctggagctggagctgccggagcg 481
           ||||||||||||||||||||||||||
Sbjct: 185 gagctggagctggagctgccggagcg 160



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 378 ccgccggggagcttctccttgatcttctccttcatgcccttcttc 422
           |||||||| ||||||||||||||||| ||| | | ||||||||||
Sbjct: 491 ccgccgggaagcttctccttgatcttgtccatgacgcccttcttc 447



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 219 agcttctccttgatcttgtccatgatccccttcttc 254
           ||||||||||||||||| ||| | ||||||||||||
Sbjct: 350 agcttctccttgatcttctccttcatccccttcttc 315

---

>gb|AY895865.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 293409 dehydrin 1
           (Dhn1) gene, partial cds
          Length = 1269

 Score =  119 bits (60), Expect = 1e-23
 Identities = 66/68 (97%)
 Strand = Plus / Minus

                                                                       
Query: 381 ccggggagcttctccttgatcttctccttcatgcccttcttcctcctcccgcccatgccg 440
           |||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||
Sbjct: 350 ccggggagcttctccttgatcttctccttcatccccttcttcctcctcccgcccacgccg 291

                   
Query: 441 tcgtcctc 448
           ||||||||
Sbjct: 290 tcgtcctc 283



 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 60/67 (89%), Gaps = 3/67 (4%)
 Strand = Plus / Minus

                                                                       
Query: 200 ggctcagtgctgt---cccggcagcttctccttgatcttgtccatgatccccttcttctc 256
           |||||||||||||   || || |||||||||||||||||||||||||  |||||||||||
Sbjct: 498 ggctcagtgctgtccgccgggaagcttctccttgatcttgtccatgacgcccttcttctc 439

                  
Query: 257 gccggtg 263
           |||||||
Sbjct: 438 gccggtg 432



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 378 ccgccggggagcttctccttgatcttctccttcatgcccttcttc 422
           |||||||| ||||||||||||||||| ||| | | ||||||||||
Sbjct: 485 ccgccgggaagcttctccttgatcttgtccatgacgcccttcttc 441



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 219 agcttctccttgatcttgtccatgatccccttcttc 254
           ||||||||||||||||| ||| | ||||||||||||
Sbjct: 344 agcttctccttgatcttctccttcatccccttcttc 309



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 461 ggagctggagctgccggagcg 481
           |||||||||||||||||||||
Sbjct: 180 ggagctggagctgccggagcg 160

---

>gb|AY895864.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 293402 dehydrin 1
           (Dhn1) gene, partial cds
          Length = 1230

 Score =  119 bits (60), Expect = 1e-23
 Identities = 66/68 (97%)
 Strand = Plus / Minus

                                                                       
Query: 381 ccggggagcttctccttgatcttctccttcatgcccttcttcctcctcccgcccatgccg 440
           |||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||
Sbjct: 356 ccggggagcttctccttgatcttctccttcatccccttcttcctcctcccgcccacgccg 297

                   
Query: 441 tcgtcctc 448
           ||||||||
Sbjct: 296 tcgtcctc 289



 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 43/45 (95%)
 Strand = Plus / Minus

                                                        
Query: 219 agcttctccttgatcttgtccatgatccccttcttctcgccggtg 263
           |||||||||||||||||||||||||  ||||||||||||||||||
Sbjct: 482 agcttctccttgatcttgtccatgacgcccttcttctcgccggtg 438



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                     
Query: 456 gagctggagctggagctgccggagcg 481
           ||||||||||||||||||||||||||
Sbjct: 185 gagctggagctggagctgccggagcg 160



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 378 ccgccggggagcttctccttgatcttctccttcatgcccttcttc 422
           |||||||| ||||||||||||||||| ||| | | ||||||||||
Sbjct: 491 ccgccgggaagcttctccttgatcttgtccatgacgcccttcttc 447



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 219 agcttctccttgatcttgtccatgatccccttcttc 254
           ||||||||||||||||| ||| | ||||||||||||
Sbjct: 350 agcttctccttgatcttctccttcatccccttcttc 315

---

>gb|AY895863.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 268242 dehydrin 1
           (Dhn1) gene, partial cds
          Length = 1269

 Score =  119 bits (60), Expect = 1e-23
 Identities = 66/68 (97%)
 Strand = Plus / Minus

                                                                       
Query: 381 ccggggagcttctccttgatcttctccttcatgcccttcttcctcctcccgcccatgccg 440
           |||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||
Sbjct: 356 ccggggagcttctccttgatcttctccttcatccccttcttcctcctcccgcccacgccg 297

                   
Query: 441 tcgtcctc 448
           ||||||||
Sbjct: 296 tcgtcctc 289



 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 60/67 (89%), Gaps = 3/67 (4%)
 Strand = Plus / Minus

                                                                       
Query: 200 ggctcagtgctgt---cccggcagcttctccttgatcttgtccatgatccccttcttctc 256
           |||||||||||||   || || |||||||||||||||||||||||||  |||||||||||
Sbjct: 504 ggctcagtgctgtccgccgggaagcttctccttgatcttgtccatgacgcccttcttctc 445

                  
Query: 257 gccggtg 263
           |||||||
Sbjct: 444 gccggtg 438



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                     
Query: 456 gagctggagctggagctgccggagcg 481
           ||||||||||||||||||||||||||
Sbjct: 185 gagctggagctggagctgccggagcg 160



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 378 ccgccggggagcttctccttgatcttctccttcatgcccttcttc 422
           |||||||| ||||||||||||||||| ||| | | ||||||||||
Sbjct: 491 ccgccgggaagcttctccttgatcttgtccatgacgcccttcttc 447



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 219 agcttctccttgatcttgtccatgatccccttcttc 254
           ||||||||||||||||| ||| | ||||||||||||
Sbjct: 350 agcttctccttgatcttctccttcatccccttcttc 315

---

>gb|AY895862.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 254894 dehydrin 1
           (Dhn1) gene, partial cds
          Length = 1269

 Score =  119 bits (60), Expect = 1e-23
 Identities = 66/68 (97%)
 Strand = Plus / Minus

                                                                       
Query: 381 ccggggagcttctccttgatcttctccttcatgcccttcttcctcctcccgcccatgccg 440
           |||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||
Sbjct: 356 ccggggagcttctccttgatcttctccttcatccccttcttcctcctcccgcccacgccg 297

                   
Query: 441 tcgtcctc 448
           ||||||||
Sbjct: 296 tcgtcctc 289



 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 60/67 (89%), Gaps = 3/67 (4%)
 Strand = Plus / Minus

                                                                       
Query: 200 ggctcagtgctgt---cccggcagcttctccttgatcttgtccatgatccccttcttctc 256
           |||||||||||||   || || |||||||||||||||||||||||||  |||||||||||
Sbjct: 504 ggctcagtgctgtccgccgggaagcttctccttgatcttgtccatgacgcccttcttctc 445

                  
Query: 257 gccggtg 263
           |||||||
Sbjct: 444 gccggtg 438



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                     
Query: 456 gagctggagctggagctgccggagcg 481
           ||||||||||||||||||||||||||
Sbjct: 185 gagctggagctggagctgccggagcg 160



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 378 ccgccggggagcttctccttgatcttctccttcatgcccttcttc 422
           |||||||| ||||||||||||||||| ||| | | ||||||||||
Sbjct: 491 ccgccgggaagcttctccttgatcttgtccatgacgcccttcttc 447



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 219 agcttctccttgatcttgtccatgatccccttcttc 254
           ||||||||||||||||| ||| | ||||||||||||
Sbjct: 350 agcttctccttgatcttctccttcatccccttcttc 315

---

>gb|AY895861.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 253933 dehydrin 1
           (Dhn1) gene, partial cds
          Length = 1243

 Score =  119 bits (60), Expect = 1e-23
 Identities = 66/68 (97%)
 Strand = Plus / Minus

                                                                       
Query: 381 ccggggagcttctccttgatcttctccttcatgcccttcttcctcctcccgcccatgccg 440
           |||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||
Sbjct: 360 ccggggagcttctccttgatcttctccttcatccccttcttcctcctcccgcccacgccg 301

                   
Query: 441 tcgtcctc 448
           ||||||||
Sbjct: 300 tcgtcctc 293



 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 60/67 (89%), Gaps = 3/67 (4%)
 Strand = Plus / Minus

                                                                       
Query: 200 ggctcagtgctgt---cccggcagcttctccttgatcttgtccatgatccccttcttctc 256
           |||||||||||||   || || |||||||||||||||||||||||||  |||||||||||
Sbjct: 508 ggctcagtgctgtccgccgggaagcttctccttgatcttgtccatgacgcccttcttctc 449

                  
Query: 257 gccggtg 263
           |||||||
Sbjct: 448 gccggtg 442



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                     
Query: 456 gagctggagctggagctgccggagcg 481
           ||||||||||||||||||||||||||
Sbjct: 185 gagctggagctggagctgccggagcg 160



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 378 ccgccggggagcttctccttgatcttctccttcatgcccttcttc 422
           |||||||| ||||||||||||||||| ||| | | ||||||||||
Sbjct: 495 ccgccgggaagcttctccttgatcttgtccatgacgcccttcttc 451



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 219 agcttctccttgatcttgtccatgatccccttcttc 254
           ||||||||||||||||| ||| | ||||||||||||
Sbjct: 354 agcttctccttgatcttctccttcatccccttcttc 319

---

>gb|AY895860.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 220523 dehydrin 1
           (Dhn1) gene, partial cds
          Length = 1249

 Score =  119 bits (60), Expect = 1e-23
 Identities = 66/68 (97%)
 Strand = Plus / Minus

                                                                       
Query: 381 ccggggagcttctccttgatcttctccttcatgcccttcttcctcctcccgcccatgccg 440
           |||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||
Sbjct: 356 ccggggagcttctccttgatcttctccttcatccccttcttcctcctcccgcccacgccg 297

                   
Query: 441 tcgtcctc 448
           ||||||||
Sbjct: 296 tcgtcctc 289



 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 60/67 (89%), Gaps = 3/67 (4%)
 Strand = Plus / Minus

                                                                       
Query: 200 ggctcagtgctgt---cccggcagcttctccttgatcttgtccatgatccccttcttctc 256
           |||||||||||||   || || |||||||||||||||||||||||||  |||||||||||
Sbjct: 504 ggctcagtgctgtccgccgggaagcttctccttgatcttgtccatgacgcccttcttctc 445

                  
Query: 257 gccggtg 263
           |||||||
Sbjct: 444 gccggtg 438



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                     
Query: 456 gagctggagctggagctgccggagcg 481
           ||||||||||||||||||||||||||
Sbjct: 185 gagctggagctggagctgccggagcg 160



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 378 ccgccggggagcttctccttgatcttctccttcatgcccttcttc 422
           |||||||| ||||||||||||||||| ||| | | ||||||||||
Sbjct: 491 ccgccgggaagcttctccttgatcttgtccatgacgcccttcttc 447



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 219 agcttctccttgatcttgtccatgatccccttcttc 254
           ||||||||||||||||| ||| | ||||||||||||
Sbjct: 350 agcttctccttgatcttctccttcatccccttcttc 315

---

>gb|AY895859.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 219796 dehydrin 1
           (Dhn1) gene, partial cds
          Length = 1243

 Score =  119 bits (60), Expect = 1e-23
 Identities = 66/68 (97%)
 Strand = Plus / Minus

                                                                       
Query: 381 ccggggagcttctccttgatcttctccttcatgcccttcttcctcctcccgcccatgccg 440
           |||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||
Sbjct: 360 ccggggagcttctccttgatcttctccttcatccccttcttcctcctcccgcccacgccg 301

                   
Query: 441 tcgtcctc 448
           ||||||||
Sbjct: 300 tcgtcctc 293



 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 60/67 (89%), Gaps = 3/67 (4%)
 Strand = Plus / Minus

                                                                       
Query: 200 ggctcagtgctgt---cccggcagcttctccttgatcttgtccatgatccccttcttctc 256
           |||||||||||||   || || |||||||||||||||||||||||||  |||||||||||
Sbjct: 508 ggctcagtgctgtccgccgggaagcttctccttgatcttgtccatgacgcccttcttctc 449

                  
Query: 257 gccggtg 263
           |||||||
Sbjct: 448 gccggtg 442



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                     
Query: 456 gagctggagctggagctgccggagcg 481
           ||||||||||||||||||||||||||
Sbjct: 185 gagctggagctggagctgccggagcg 160



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 378 ccgccggggagcttctccttgatcttctccttcatgcccttcttc 422
           |||||||| ||||||||||||||||| ||| | | ||||||||||
Sbjct: 495 ccgccgggaagcttctccttgatcttgtccatgacgcccttcttc 451



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 219 agcttctccttgatcttgtccatgatccccttcttc 254
           ||||||||||||||||| ||| | ||||||||||||
Sbjct: 354 agcttctccttgatcttctccttcatccccttcttc 319

---

>gb|AY895858.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 212306 dehydrin 1
           (Dhn1) gene, partial cds
          Length = 1269

 Score =  119 bits (60), Expect = 1e-23
 Identities = 66/68 (97%)
 Strand = Plus / Minus

                                                                       
Query: 381 ccggggagcttctccttgatcttctccttcatgcccttcttcctcctcccgcccatgccg 440
           |||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||
Sbjct: 356 ccggggagcttctccttgatcttctccttcatccccttcttcctcctcccgcccacgccg 297

                   
Query: 441 tcgtcctc 448
           ||||||||
Sbjct: 296 tcgtcctc 289



 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 60/67 (89%), Gaps = 3/67 (4%)
 Strand = Plus / Minus

                                                                       
Query: 200 ggctcagtgctgt---cccggcagcttctccttgatcttgtccatgatccccttcttctc 256
           |||||||||||||   || || |||||||||||||||||||||||||  |||||||||||
Sbjct: 504 ggctcagtgctgtccgccgggaagcttctccttgatcttgtccatgacgcccttcttctc 445

                  
Query: 257 gccggtg 263
           |||||||
Sbjct: 444 gccggtg 438



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                     
Query: 456 gagctggagctggagctgccggagcg 481
           ||||||||||||||||||||||||||
Sbjct: 185 gagctggagctggagctgccggagcg 160



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 378 ccgccggggagcttctccttgatcttctccttcatgcccttcttc 422
           |||||||| ||||||||||||||||| ||| | | ||||||||||
Sbjct: 491 ccgccgggaagcttctccttgatcttgtccatgacgcccttcttc 447



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 219 agcttctccttgatcttgtccatgatccccttcttc 254
           ||||||||||||||||| ||| | ||||||||||||
Sbjct: 350 agcttctccttgatcttctccttcatccccttcttc 315

---

>gb|AY895857.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 212305 dehydrin 1
           (Dhn1) gene, partial cds
          Length = 1249

 Score =  119 bits (60), Expect = 1e-23
 Identities = 66/68 (97%)
 Strand = Plus / Minus

                                                                       
Query: 381 ccggggagcttctccttgatcttctccttcatgcccttcttcctcctcccgcccatgccg 440
           |||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||
Sbjct: 356 ccggggagcttctccttgatcttctccttcatccccttcttcctcctcccgcccacgccg 297

                   
Query: 441 tcgtcctc 448
           ||||||||
Sbjct: 296 tcgtcctc 289



 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 60/67 (89%), Gaps = 3/67 (4%)
 Strand = Plus / Minus

                                                                       
Query: 200 ggctcagtgctgt---cccggcagcttctccttgatcttgtccatgatccccttcttctc 256
           |||||||||||||   || || |||||||||||||||||||||||||  |||||||||||
Sbjct: 504 ggctcagtgctgtccgccgggaagcttctccttgatcttgtccatgacgcccttcttctc 445

                  
Query: 257 gccggtg 263
           |||||||
Sbjct: 444 gccggtg 438



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                     
Query: 456 gagctggagctggagctgccggagcg 481
           ||||||||||||||||||||||||||
Sbjct: 185 gagctggagctggagctgccggagcg 160



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 378 ccgccggggagcttctccttgatcttctccttcatgcccttcttc 422
           |||||||| ||||||||||||||||| ||| | | ||||||||||
Sbjct: 491 ccgccgggaagcttctccttgatcttgtccatgacgcccttcttc 447



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 219 agcttctccttgatcttgtccatgatccccttcttc 254
           ||||||||||||||||| ||| | ||||||||||||
Sbjct: 350 agcttctccttgatcttctccttcatccccttcttc 315

---

>gb|AF043087.1|AF043087 Hordeum vulgare dehydrin 1 (dhn1) gene, complete cds
          Length = 2717

 Score =  119 bits (60), Expect = 1e-23
 Identities = 66/68 (97%)
 Strand = Plus / Minus

                                                                        
Query: 381  ccggggagcttctccttgatcttctccttcatgcccttcttcctcctcccgcccatgccg 440
            |||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||
Sbjct: 1632 ccggggagcttctccttgatcttctccttcatccccttcttcctcctcccgcccacgccg 1573

                    
Query: 441  tcgtcctc 448
            ||||||||
Sbjct: 1572 tcgtcctc 1565



 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 60/67 (89%), Gaps = 3/67 (4%)
 Strand = Plus / Minus

                                                                        
Query: 200  ggctcagtgctgt---cccggcagcttctccttgatcttgtccatgatccccttcttctc 256
            |||||||||||||   || || |||||||||||||||||||||||||  |||||||||||
Sbjct: 1780 ggctcagtgctgtccgccgggaagcttctccttgatcttgtccatgacgcccttcttctc 1721

                   
Query: 257  gccggtg 263
            |||||||
Sbjct: 1720 gccggtg 1714



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                      
Query: 456  gagctggagctggagctgccggagcg 481
            ||||||||||||||||||||||||||
Sbjct: 1461 gagctggagctggagctgccggagcg 1436



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                         
Query: 378  ccgccggggagcttctccttgatcttctccttcatgcccttcttc 422
            |||||||| ||||||||||||||||| ||| | | ||||||||||
Sbjct: 1767 ccgccgggaagcttctccttgatcttgtccatgacgcccttcttc 1723



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                                
Query: 219  agcttctccttgatcttgtccatgatccccttcttc 254
            ||||||||||||||||| ||| | ||||||||||||
Sbjct: 1626 agcttctccttgatcttctccttcatccccttcttc 1591

---

>gb|AF155129.1|AF155129 Hordeum vulgare dehydrin 12 (Dhn12) gene, complete cds
          Length = 2890

 Score =  115 bits (58), Expect = 2e-22
 Identities = 117/137 (85%), Gaps = 6/137 (4%)
 Strand = Plus / Minus

                                                                        
Query: 182  cagccagccggagccggcggctcagtgctgtcccggcagcttctccttgatcttgtccat 241
            ||||||||||| |||||  |||||||||||||| ||||||||||||||||||||||||| 
Sbjct: 1916 cagccagccggggccggtagctcagtgctgtccgggcagcttctccttgatcttgtccac 1857

                                                                        
Query: 242  gatccccttcttctcgccggtgccggccattcctgcgtgcccttgctgcccgtaggctcc 301
            ||  ||||||| |||      ||||||||||||||||| |||||||||||||||| ||||
Sbjct: 1856 gactcccttctcctc------gccggccattcctgcgttcccttgctgcccgtagtctcc 1803

                             
Query: 302  accagttccagttcccg 318
             || |  ||||||||||
Sbjct: 1802 gccggccccagttcccg 1786



 Score =  103 bits (52), Expect = 6e-19
 Identities = 64/68 (94%)
 Strand = Plus / Minus

                                                                        
Query: 381  ccggggagcttctccttgatcttctccttcatgcccttcttcctcctcccgcccatgccg 440
            ||||||||||||||||||| ||||||||||| |||||||| |||||||||||||||||||
Sbjct: 1726 ccggggagcttctccttgaccttctccttcacgcccttctccctcctcccgcccatgccg 1667

                    
Query: 441  tcgtcctc 448
            || |||||
Sbjct: 1666 tcatcctc 1659



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 31/32 (96%)
 Strand = Plus / Minus

                                            
Query: 462  gagctggagctgccggagcgatgcagtatccc 493
            ||||||||||||||||||||| ||||||||||
Sbjct: 1560 gagctggagctgccggagcgacgcagtatccc 1529

---

>emb|X52424.1|OSRAB16D O.sativa DNA for rab 16D gene
          Length = 2459

 Score =  113 bits (57), Expect = 6e-22
 Identities = 86/95 (90%), Gaps = 3/95 (3%)
 Strand = Plus / Minus

                                                                        
Query: 357  tgctgctggttgt---ccttgtggccgccggggagcttctccttgatcttctccttcatg 413
            |||||||||||||   |||||| ||||||||||||||||||||||||||||||||| || 
Sbjct: 1355 tgctgctggttgttgcccttgttgccgccggggagcttctccttgatcttctccttgatc 1296

                                               
Query: 414  cccttcttcctcctcccgcccatgccgtcgtcctc 448
            |||||||||||||| || ||||| |||||||||||
Sbjct: 1295 cccttcttcctccttcctcccatcccgtcgtcctc 1261



 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 55/60 (91%)
 Strand = Plus / Minus

                                                                        
Query: 201  gctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccg 260
            ||||||||||| || || |||||||||||||||||||||| ||| |||||||||||||||
Sbjct: 1529 gctcagtgctggccggggagcttctccttgatcttgtccacgatgcccttcttctcgccg 1470



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                                
Query: 219  agcttctccttgatcttgtccatgatccccttcttc 254
            ||||||||||||||||| ||| ||||||||||||||
Sbjct: 1322 agcttctccttgatcttctccttgatccccttcttc 1287



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 39/43 (90%)
 Strand = Plus / Minus

                                                       
Query: 380  gccggggagcttctccttgatcttctccttcatgcccttcttc 422
            |||||||||||||||||||||||| |||   ||||||||||||
Sbjct: 1518 gccggggagcttctccttgatcttgtccacgatgcccttcttc 1476



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                     
Query: 456 gagctggagctggagctgccggagcg 481
           ||||||||||||||||||||||||||
Sbjct: 867 gagctggagctggagctgccggagcg 842

---

>emb|X52422.1|OSRAB16B O.sativa DNA for rab 16B gene
          Length = 2890

 Score =  113 bits (57), Expect = 6e-22
 Identities = 86/95 (90%), Gaps = 3/95 (3%)
 Strand = Plus / Minus

                                                                        
Query: 357  tgctgctggttgt---ccttgtggccgccggggagcttctccttgatcttctccttcatg 413
            |||||||||||||   |||||| ||||||||| ||||||||||||||||||||||| || 
Sbjct: 1825 tgctgctggttgttgcccttgttgccgccgggcagcttctccttgatcttctccttgatc 1766

                                               
Query: 414  cccttcttcctcctcccgcccatgccgtcgtcctc 448
            ||||||||||||||||| ||||| |||||||||||
Sbjct: 1765 cccttcttcctcctccctcccatcccgtcgtcctc 1731



 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 53/57 (92%)
 Strand = Plus / Minus

                                                                     
Query: 205  agtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccgg 261
            ||||||| || ||||||||||||||||||||||||||||  ||||||||||||||||
Sbjct: 1983 agtgctggccgggcagcttctccttgatcttgtccatgaatcccttcttctcgccgg 1927



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 37/39 (94%)
 Strand = Plus / Minus

                                                   
Query: 216  ggcagcttctccttgatcttgtccatgatccccttcttc 254
            |||||||||||||||||||| ||| ||||||||||||||
Sbjct: 1795 ggcagcttctccttgatcttctccttgatccccttcttc 1757



 Score = 46.1 bits (23), Expect = 0.12
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                       
Query: 455  cgagctggagctggagctgccggagcg 481
            |||||||||||| ||||||||||||||
Sbjct: 1629 cgagctggagcttgagctgccggagcg 1603



 Score = 40.1 bits (20), Expect = 7.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 380  gccggggagcttctccttgatctt 403
            |||||| |||||||||||||||||
Sbjct: 1976 gccgggcagcttctccttgatctt 1953

---

>gb|AF031248.1|AF031248 Lophopyrum elongatum dehydrin-/LEA group 2-like protein (ESI18-3)
           mRNA, complete cds
          Length = 793

 Score =  109 bits (55), Expect = 9e-21
 Identities = 64/67 (95%)
 Strand = Plus / Minus

                                                                       
Query: 200 ggctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgcc 259
           ||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||| ||
Sbjct: 486 ggctcagtgctgtccgggcagcttctccttgatcttgtccatgatgcccttcttctcacc 427

                  
Query: 260 ggtgccg 266
           |||||||
Sbjct: 426 ggtgccg 420



 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 116/137 (84%), Gaps = 6/137 (4%)
 Strand = Plus / Minus

                                                                       
Query: 374 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcctcccgcc 433
           |||||| || || ||||||||||||||||| ||||| || ||||||||||||||||||||
Sbjct: 309 gtggccacccggaagcttctccttgatcttatccttgattcccttcttcctcctcccgcc 250

                                                                       
Query: 434 catgccgtcgtcctcggaggacgagctggag---ctggagctgccggagcgatgcagtat 490
           |||||| || |||||    ||||||||||||   || |||||||||||||| ||||| ||
Sbjct: 249 catgccatcatcctc---agacgagctggagctactagagctgccggagcgctgcaggat 193

                            
Query: 491 cccacgggtcttgtgct 507
           ||| | || ||||||||
Sbjct: 192 ccctccggccttgtgct 176



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Minus

                                                     
Query: 381 ccggggagcttctccttgatcttctccttcatgcccttcttc 422
           ||||| ||||||||||||||||| ||| | ||||||||||||
Sbjct: 473 ccgggcagcttctccttgatcttgtccatgatgcccttcttc 432



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Minus

                                                     
Query: 213 cccggcagcttctccttgatcttgtccatgatccccttcttc 254
           ||||| ||||||||||||||||| ||| |||| |||||||||
Sbjct: 302 cccggaagcttctccttgatcttatccttgattcccttcttc 261



 Score = 44.1 bits (22), Expect = 0.46
 Identities = 37/42 (88%)
 Strand = Plus / Minus

                                                     
Query: 256 cgccggtgccggccattcctgcgtgcccttgctgcccgtagg 297
           ||||||||||||||||||| |  || |||||||| |||||||
Sbjct: 376 cgccggtgccggccattccagtatgaccttgctgtccgtagg 335

---

>gb|AF181453.1|AF181453 Hordeum vulgare dehydrin (Dhn3) gene, complete cds
          Length = 1575

 Score =  109 bits (55), Expect = 9e-21
 Identities = 70/75 (93%)
 Strand = Plus / Minus

                                                                        
Query: 374  gtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcctcccgcc 433
            |||||| ||||||||||||||||||||||| ||||| | |||||||||||||||||||||
Sbjct: 1147 gtggccaccggggagcttctccttgatcttgtccttgaggcccttcttcctcctcccgcc 1088

                           
Query: 434  catgccgtcgtcctc 448
            ||||||||| |||||
Sbjct: 1087 catgccgtcatcctc 1073



 Score =  103 bits (52), Expect = 6e-19
 Identities = 58/60 (96%)
 Strand = Plus / Minus

                                                                        
Query: 200  ggctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgcc 259
            ||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||
Sbjct: 1363 ggctcagtgctgtccgggcagcttctccttgatcttgtccatgatgcccttcttctcgcc 1304



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                
Query: 455 cgagctggagctggagctgccggagcgatgcagtatcccacgggtcttgtgct 507
           |||||||||||| |||||||||||||| ||||| ||||| | || ||||||||
Sbjct: 956 cgagctggagcttgagctgccggagcgctgcaggatccctccggccttgtgct 904



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Minus

                                                      
Query: 381  ccggggagcttctccttgatcttctccttcatgcccttcttc 422
            ||||| ||||||||||||||||| ||| | ||||||||||||
Sbjct: 1350 ccgggcagcttctccttgatcttgtccatgatgcccttcttc 1309



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                                
Query: 219  agcttctccttgatcttgtccatgatccccttcttc 254
            ||||||||||||||||||||| |||  |||||||||
Sbjct: 1134 agcttctccttgatcttgtccttgaggcccttcttc 1099

---

>gb|AY895927.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 531851 dehydrin 7
           (Dhn7) gene, complete cds
          Length = 1357

 Score =  109 bits (55), Expect = 9e-21
 Identities = 70/75 (93%)
 Strand = Plus / Minus

                                                                       
Query: 374 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcctcccgcc 433
           |||||| ||||||||||||||||||||||| ||||| || ||||||||||||||||||||
Sbjct: 583 gtggccaccggggagcttctccttgatcttatccttgatacccttcttcctcctcccgcc 524

                          
Query: 434 catgccgtcgtcctc 448
           |||||| ||||||||
Sbjct: 523 catgccatcgtcctc 509



 Score =  101 bits (51), Expect = 2e-18
 Identities = 63/67 (94%)
 Strand = Plus / Minus

                                                                       
Query: 200 ggctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgcc 259
           ||||||||||||||| ||||||||||||||||| ||||||||||| |||||||| |||||
Sbjct: 841 ggctcagtgctgtccgggcagcttctccttgattttgtccatgatgcccttcttttcgcc 782

                  
Query: 260 ggtgccg 266
           |||||||
Sbjct: 781 ggtgccg 775



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                
Query: 455 cgagctggagctggagctgccggagcgatgcagtatcccacgggtcttgtgct 507
           |||||||||||| |||||||||||||| ||||| ||||| | || ||||||||
Sbjct: 388 cgagctggagcttgagctgccggagcgctgcaggatcccgccggccttgtgct 336



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 219 agcttctccttgatcttgtccatgatccccttcttc 254
           ||||||||||||||||| ||| |||| |||||||||
Sbjct: 570 agcttctccttgatcttatccttgatacccttcttc 535



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 381 ccggggagcttctccttgatcttctccttcatgcccttctt 421
           ||||| |||||||||||||| || ||| | |||||||||||
Sbjct: 828 ccgggcagcttctccttgattttgtccatgatgcccttctt 788

---

>gb|AF043089.1|AF043089 Hordeum vulgare dehydrin 3 (dhn3) gene, complete cds
          Length = 1560

 Score =  109 bits (55), Expect = 9e-21
 Identities = 70/75 (93%)
 Strand = Plus / Minus

                                                                        
Query: 374  gtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcctcccgcc 433
            |||||| ||||||||||||||||||||||| ||||| | |||||||||||||||||||||
Sbjct: 1110 gtggccaccggggagcttctccttgatcttgtccttgaggcccttcttcctcctcccgcc 1051

                           
Query: 434  catgccgtcgtcctc 448
            ||||||||| |||||
Sbjct: 1050 catgccgtcatcctc 1036



 Score =  103 bits (52), Expect = 6e-19
 Identities = 58/60 (96%)
 Strand = Plus / Minus

                                                                        
Query: 200  ggctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgcc 259
            ||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||
Sbjct: 1326 ggctcagtgctgtccgggcagcttctccttgatcttgtccatgatgcccttcttctcgcc 1267



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                
Query: 455 cgagctggagctggagctgccggagcgatgcagtatcccacgggtcttgtgct 507
           |||||||||||| |||||||||||||| ||||| ||||| | || ||||||||
Sbjct: 919 cgagctggagcttgagctgccggagcgctgcaggatccctccggccttgtgct 867



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Minus

                                                      
Query: 381  ccggggagcttctccttgatcttctccttcatgcccttcttc 422
            ||||| ||||||||||||||||| ||| | ||||||||||||
Sbjct: 1313 ccgggcagcttctccttgatcttgtccatgatgcccttcttc 1272



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                                
Query: 219  agcttctccttgatcttgtccatgatccccttcttc 254
            ||||||||||||||||||||| |||  |||||||||
Sbjct: 1097 agcttctccttgatcttgtccttgaggcccttcttc 1062

---

>gb|AF181454.1|AF181454 Hordeum vulgare dehydrin (Dhn4) gene, complete cds
          Length = 2440

 Score =  107 bits (54), Expect = 4e-20
 Identities = 72/78 (92%)
 Strand = Plus / Minus

                                                                        
Query: 374  gtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcctcccgcc 433
            |||||| || |||||||||||||||||||||||||| ||||||||||||||||| || ||
Sbjct: 1216 gtggccaccagggagcttctccttgatcttctccttgatgcccttcttcctcctgccacc 1157

                              
Query: 434  catgccgtcgtcctcgga 451
            |||||| |||||||||||
Sbjct: 1156 catgccatcgtcctcgga 1139



 Score = 93.7 bits (47), Expect = 6e-16
 Identities = 59/63 (93%)
 Strand = Plus / Minus

                                                                        
Query: 201  gctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccg 260
            ||||||||||| || || |||||||||||||||||||||||||| |||||||||||||||
Sbjct: 1557 gctcagtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgccg 1498

               
Query: 261  gtg 263
            |||
Sbjct: 1497 gtg 1495



 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 41/43 (95%)
 Strand = Plus / Minus

                                                       
Query: 455  cgagctggagctggagctgccggagcgatgcagtatcccacgg 497
            ||||||||||||||||||||||||||| ||||| |||||||||
Sbjct: 1046 cgagctggagctggagctgccggagcggtgcaggatcccacgg 1004



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                   
Query: 384  gggagcttctccttgatcttctccttcatgcccttcttc 422
            |||||||||||||||||||| ||| | ||||||||||||
Sbjct: 1542 gggagcttctccttgatcttgtccatgatgcccttcttc 1504



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                                
Query: 219  agcttctccttgatcttgtccatgatccccttcttc 254
            ||||||||||||||||| ||| |||| |||||||||
Sbjct: 1203 agcttctccttgatcttctccttgatgcccttcttc 1168



 Score = 40.1 bits (20), Expect = 7.2
 Identities = 35/40 (87%)
 Strand = Plus / Minus

                                                    
Query: 258  ccggtgccggccattcctgcgtgcccttgctgcccgtagg 297
            |||||||||||||| || | ||| |||||||| |||||||
Sbjct: 1383 ccggtgccggccatcccagtgtggccttgctgtccgtagg 1344

---

>gb|AY895904.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 560559 dehydrin 4
           (Dhn4) gene, complete cds
          Length = 922

 Score =  107 bits (54), Expect = 4e-20
 Identities = 72/78 (92%)
 Strand = Plus / Minus

                                                                       
Query: 374 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcctcccgcc 433
           |||||| || |||||||||||||||||||||||||| ||||||||||||||||| || ||
Sbjct: 383 gtggccaccagggagcttctccttgatcttctccttgatgcccttcttcctcctgccacc 324

                             
Query: 434 catgccgtcgtcctcgga 451
           |||||| |||||||||||
Sbjct: 323 catgccatcgtcctcgga 306



 Score = 93.7 bits (47), Expect = 6e-16
 Identities = 59/63 (93%)
 Strand = Plus / Minus

                                                                       
Query: 201 gctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccg 260
           ||||||||||| || || |||||||||||||||||||||||||| |||||||||||||||
Sbjct: 784 gctcagtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgccg 725

              
Query: 261 gtg 263
           |||
Sbjct: 724 gtg 722



 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 41/43 (95%)
 Strand = Plus / Minus

                                                      
Query: 455 cgagctggagctggagctgccggagcgatgcagtatcccacgg 497
           ||||||||||||||||||||||||||| ||||| |||||||||
Sbjct: 213 cgagctggagctggagctgccggagcggtgcaggatcccacgg 171



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 384 gggagcttctccttgatcttctccttcatgcccttcttc 422
           |||||||||||||||||||| ||| | ||||||||||||
Sbjct: 769 gggagcttctccttgatcttgtccatgatgcccttcttc 731



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 219 agcttctccttgatcttgtccatgatccccttcttc 254
           ||||||||||||||||| ||| |||| |||||||||
Sbjct: 370 agcttctccttgatcttctccttgatgcccttcttc 335



 Score = 40.1 bits (20), Expect = 7.2
 Identities = 35/40 (87%)
 Strand = Plus / Minus

                                                   
Query: 258 ccggtgccggccattcctgcgtgcccttgctgcccgtagg 297
           |||||||||||||| || | ||| |||||||| |||||||
Sbjct: 550 ccggtgccggccatcccagtgtggccttgctgtccgtagg 511

---

>gb|AY895903.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 559556 dehydrin 4
           (Dhn4) gene, complete cds
          Length = 922

 Score =  107 bits (54), Expect = 4e-20
 Identities = 72/78 (92%)
 Strand = Plus / Minus

                                                                       
Query: 374 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcctcccgcc 433
           |||||| || |||||||||||||||||||||||||| ||||||||||||||||| || ||
Sbjct: 383 gtggccaccagggagcttctccttgatcttctccttgatgcccttcttcctcctgccacc 324

                             
Query: 434 catgccgtcgtcctcgga 451
           |||||| |||||||||||
Sbjct: 323 catgccatcgtcctcgga 306



 Score = 93.7 bits (47), Expect = 6e-16
 Identities = 59/63 (93%)
 Strand = Plus / Minus

                                                                       
Query: 201 gctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccg 260
           ||||||||||| || || |||||||||||||||||||||||||| |||||||||||||||
Sbjct: 784 gctcagtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgccg 725

              
Query: 261 gtg 263
           |||
Sbjct: 724 gtg 722



 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 41/43 (95%)
 Strand = Plus / Minus

                                                      
Query: 455 cgagctggagctggagctgccggagcgatgcagtatcccacgg 497
           ||||||||||||||||||||||||||| ||||| |||||||||
Sbjct: 213 cgagctggagctggagctgccggagcggtgcaggatcccacgg 171



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 384 gggagcttctccttgatcttctccttcatgcccttcttc 422
           |||||||||||||||||||| ||| | ||||||||||||
Sbjct: 769 gggagcttctccttgatcttgtccatgatgcccttcttc 731



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 219 agcttctccttgatcttgtccatgatccccttcttc 254
           ||||||||||||||||| ||| |||| |||||||||
Sbjct: 370 agcttctccttgatcttctccttgatgcccttcttc 335



 Score = 40.1 bits (20), Expect = 7.2
 Identities = 35/40 (87%)
 Strand = Plus / Minus

                                                   
Query: 258 ccggtgccggccattcctgcgtgcccttgctgcccgtagg 297
           |||||||||||||| || | ||| |||||||| |||||||
Sbjct: 550 ccggtgccggccatcccagtgtggccttgctgtccgtagg 511

---

>gb|AY895901.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 531853 dehydrin 4
           (Dhn4) gene, complete cds
          Length = 920

 Score =  107 bits (54), Expect = 4e-20
 Identities = 72/78 (92%)
 Strand = Plus / Minus

                                                                       
Query: 374 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcctcccgcc 433
           |||||| || |||||||||||||||||||||||||| ||||||||||||||||| || ||
Sbjct: 381 gtggccaccagggagcttctccttgatcttctccttgatgcccttcttcctcctgccacc 322

                             
Query: 434 catgccgtcgtcctcgga 451
           |||||| |||||||||||
Sbjct: 321 catgccatcgtcctcgga 304



 Score = 93.7 bits (47), Expect = 6e-16
 Identities = 59/63 (93%)
 Strand = Plus / Minus

                                                                       
Query: 201 gctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccg 260
           ||||||||||| || || |||||||||||||||||||||||||| |||||||||||||||
Sbjct: 782 gctcagtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgccg 723

              
Query: 261 gtg 263
           |||
Sbjct: 722 gtg 720



 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 41/43 (95%)
 Strand = Plus / Minus

                                                      
Query: 455 cgagctggagctggagctgccggagcgatgcagtatcccacgg 497
           ||||||||||||||||||||||||||| ||||| |||||||||
Sbjct: 213 cgagctggagctggagctgccggagcggtgcaggatcccacgg 171



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 384 gggagcttctccttgatcttctccttcatgcccttcttc 422
           |||||||||||||||||||| ||| | ||||||||||||
Sbjct: 767 gggagcttctccttgatcttgtccatgatgcccttcttc 729



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 219 agcttctccttgatcttgtccatgatccccttcttc 254
           ||||||||||||||||| ||| |||| |||||||||
Sbjct: 368 agcttctccttgatcttctccttgatgcccttcttc 333



 Score = 40.1 bits (20), Expect = 7.2
 Identities = 35/40 (87%)
 Strand = Plus / Minus

                                                   
Query: 258 ccggtgccggccattcctgcgtgcccttgctgcccgtagg 297
           |||||||||||||| || | ||| |||||||| |||||||
Sbjct: 548 ccggtgccggccatcccagtgtggccttgctgtccgtagg 509

---

>gb|AY895900.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 531851 dehydrin 4
           (Dhn4) gene, complete cds
          Length = 924

 Score =  107 bits (54), Expect = 4e-20
 Identities = 72/78 (92%)
 Strand = Plus / Minus

                                                                       
Query: 374 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcctcccgcc 433
           |||||| || |||||||||||||||||||||||||| ||||||||||||||||| || ||
Sbjct: 383 gtggccaccagggagcttctccttgatcttctccttgatgcccttcttcctcctgccacc 324

                             
Query: 434 catgccgtcgtcctcgga 451
           |||||| |||||||||||
Sbjct: 323 catgccatcgtcctcgga 306



 Score = 93.7 bits (47), Expect = 6e-16
 Identities = 59/63 (93%)
 Strand = Plus / Minus

                                                                       
Query: 201 gctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccg 260
           ||||||||||| || || |||||||||||||||||||||||||| |||||||||||||||
Sbjct: 784 gctcagtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgccg 725

              
Query: 261 gtg 263
           |||
Sbjct: 724 gtg 722



 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 41/43 (95%)
 Strand = Plus / Minus

                                                      
Query: 455 cgagctggagctggagctgccggagcgatgcagtatcccacgg 497
           ||||||||||||||||||||||||||| ||||| |||||||||
Sbjct: 213 cgagctggagctggagctgccggagcggtgcaggatcccacgg 171



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 384 gggagcttctccttgatcttctccttcatgcccttcttc 422
           |||||||||||||||||||| ||| | ||||||||||||
Sbjct: 769 gggagcttctccttgatcttgtccatgatgcccttcttc 731



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 219 agcttctccttgatcttgtccatgatccccttcttc 254
           ||||||||||||||||| ||| |||| |||||||||
Sbjct: 370 agcttctccttgatcttctccttgatgcccttcttc 335



 Score = 40.1 bits (20), Expect = 7.2
 Identities = 35/40 (87%)
 Strand = Plus / Minus

                                                   
Query: 258 ccggtgccggccattcctgcgtgcccttgctgcccgtagg 297
           |||||||||||||| || | ||| |||||||| |||||||
Sbjct: 550 ccggtgccggccatcccagtgtggccttgctgtccgtagg 511

---

>gb|AY895899.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 466460 dehydrin 4
           (Dhn4) gene, complete cds
          Length = 922

 Score =  107 bits (54), Expect = 4e-20
 Identities = 72/78 (92%)
 Strand = Plus / Minus

                                                                       
Query: 374 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcctcccgcc 433
           |||||| || |||||||||||||||||||||||||| ||||||||||||||||| || ||
Sbjct: 383 gtggccaccagggagcttctccttgatcttctccttgatgcccttcttcctcctgccacc 324

                             
Query: 434 catgccgtcgtcctcgga 451
           |||||| |||||||||||
Sbjct: 323 catgccatcgtcctcgga 306



 Score = 93.7 bits (47), Expect = 6e-16
 Identities = 59/63 (93%)
 Strand = Plus / Minus

                                                                       
Query: 201 gctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccg 260
           ||||||||||| || || |||||||||||||||||||||||||| |||||||||||||||
Sbjct: 784 gctcagtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgccg 725

              
Query: 261 gtg 263
           |||
Sbjct: 724 gtg 722



 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 41/43 (95%)
 Strand = Plus / Minus

                                                      
Query: 455 cgagctggagctggagctgccggagcgatgcagtatcccacgg 497
           ||||||||||||||||||||||||||| ||||| |||||||||
Sbjct: 213 cgagctggagctggagctgccggagcggtgcaggatcccacgg 171



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 384 gggagcttctccttgatcttctccttcatgcccttcttc 422
           |||||||||||||||||||| ||| | ||||||||||||
Sbjct: 769 gggagcttctccttgatcttgtccatgatgcccttcttc 731



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 219 agcttctccttgatcttgtccatgatccccttcttc 254
           ||||||||||||||||| ||| |||| |||||||||
Sbjct: 370 agcttctccttgatcttctccttgatgcccttcttc 335



 Score = 40.1 bits (20), Expect = 7.2
 Identities = 35/40 (87%)
 Strand = Plus / Minus

                                                   
Query: 258 ccggtgccggccattcctgcgtgcccttgctgcccgtagg 297
           |||||||||||||| || | ||| |||||||| |||||||
Sbjct: 550 ccggtgccggccatcccagtgtggccttgctgtccgtagg 511

---

>gb|AY895897.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 420913 dehydrin 4
           (Dhn4) gene, complete cds
          Length = 919

 Score =  107 bits (54), Expect = 4e-20
 Identities = 72/78 (92%)
 Strand = Plus / Minus

                                                                       
Query: 374 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcctcccgcc 433
           |||||| || |||||||||||||||||||||||||| ||||||||||||||||| || ||
Sbjct: 380 gtggccaccagggagcttctccttgatcttctccttgatgcccttcttcctcctgccacc 321

                             
Query: 434 catgccgtcgtcctcgga 451
           |||||| |||||||||||
Sbjct: 320 catgccatcgtcctcgga 303



 Score = 93.7 bits (47), Expect = 6e-16
 Identities = 59/63 (93%)
 Strand = Plus / Minus

                                                                       
Query: 201 gctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccg 260
           ||||||||||| || || |||||||||||||||||||||||||| |||||||||||||||
Sbjct: 781 gctcagtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgccg 722

              
Query: 261 gtg 263
           |||
Sbjct: 721 gtg 719



 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 41/43 (95%)
 Strand = Plus / Minus

                                                      
Query: 455 cgagctggagctggagctgccggagcgatgcagtatcccacgg 497
           ||||||||||||||||||||||||||| ||||| |||||||||
Sbjct: 213 cgagctggagctggagctgccggagcggtgcaggatcccacgg 171



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 384 gggagcttctccttgatcttctccttcatgcccttcttc 422
           |||||||||||||||||||| ||| | ||||||||||||
Sbjct: 766 gggagcttctccttgatcttgtccatgatgcccttcttc 728



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 219 agcttctccttgatcttgtccatgatccccttcttc 254
           ||||||||||||||||| ||| |||| |||||||||
Sbjct: 367 agcttctccttgatcttctccttgatgcccttcttc 332



 Score = 40.1 bits (20), Expect = 7.2
 Identities = 35/40 (87%)
 Strand = Plus / Minus

                                                   
Query: 258 ccggtgccggccattcctgcgtgcccttgctgcccgtagg 297
           |||||||||||||| || | ||| |||||||| |||||||
Sbjct: 547 ccggtgccggccatcccagtgtggccttgctgtccgtagg 508

---

>gb|AY895896.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 420911 dehydrin 4
           (Dhn4) gene, complete cds
          Length = 910

 Score =  107 bits (54), Expect = 4e-20
 Identities = 72/78 (92%)
 Strand = Plus / Minus

                                                                       
Query: 374 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcctcccgcc 433
           |||||| || |||||||||||||||||||||||||| ||||||||||||||||| || ||
Sbjct: 386 gtggccaccagggagcttctccttgatcttctccttgatgcccttcttcctcctgccacc 327

                             
Query: 434 catgccgtcgtcctcgga 451
           |||||| |||||||||||
Sbjct: 326 catgccatcgtcctcgga 309



 Score = 93.7 bits (47), Expect = 6e-16
 Identities = 59/63 (93%)
 Strand = Plus / Minus

                                                                       
Query: 201 gctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccg 260
           ||||||||||| || || |||||||||||||||||||||||||| |||||||||||||||
Sbjct: 772 gctcagtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgccg 713

              
Query: 261 gtg 263
           |||
Sbjct: 712 gtg 710



 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 41/43 (95%)
 Strand = Plus / Minus

                                                      
Query: 455 cgagctggagctggagctgccggagcgatgcagtatcccacgg 497
           ||||||||||||||||||||||||||| ||||| |||||||||
Sbjct: 213 cgagctggagctggagctgccggagcggtgcaggatcccacgg 171



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 384 gggagcttctccttgatcttctccttcatgcccttcttc 422
           |||||||||||||||||||| ||| | ||||||||||||
Sbjct: 757 gggagcttctccttgatcttgtccatgatgcccttcttc 719



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 219 agcttctccttgatcttgtccatgatccccttcttc 254
           ||||||||||||||||| ||| |||| |||||||||
Sbjct: 373 agcttctccttgatcttctccttgatgcccttcttc 338

---

>gb|AY895894.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 401371 dehydrin 4
           (Dhn4) gene, complete cds
          Length = 922

 Score =  107 bits (54), Expect = 4e-20
 Identities = 72/78 (92%)
 Strand = Plus / Minus

                                                                       
Query: 374 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcctcccgcc 433
           |||||| || |||||||||||||||||||||||||| ||||||||||||||||| || ||
Sbjct: 383 gtggccaccagggagcttctccttgatcttctccttgatgcccttcttcctcctgccacc 324

                             
Query: 434 catgccgtcgtcctcgga 451
           |||||| |||||||||||
Sbjct: 323 catgccatcgtcctcgga 306



 Score = 93.7 bits (47), Expect = 6e-16
 Identities = 59/63 (93%)
 Strand = Plus / Minus

                                                                       
Query: 201 gctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccg 260
           ||||||||||| || || |||||||||||||||||||||||||| |||||||||||||||
Sbjct: 784 gctcagtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgccg 725

              
Query: 261 gtg 263
           |||
Sbjct: 724 gtg 722



 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 41/43 (95%)
 Strand = Plus / Minus

                                                      
Query: 455 cgagctggagctggagctgccggagcgatgcagtatcccacgg 497
           ||||||||||||||||||||||||||| ||||| |||||||||
Sbjct: 213 cgagctggagctggagctgccggagcggtgcaggatcccacgg 171



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 384 gggagcttctccttgatcttctccttcatgcccttcttc 422
           |||||||||||||||||||| ||| | ||||||||||||
Sbjct: 769 gggagcttctccttgatcttgtccatgatgcccttcttc 731



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 219 agcttctccttgatcttgtccatgatccccttcttc 254
           ||||||||||||||||| ||| |||| |||||||||
Sbjct: 370 agcttctccttgatcttctccttgatgcccttcttc 335



 Score = 40.1 bits (20), Expect = 7.2
 Identities = 35/40 (87%)
 Strand = Plus / Minus

                                                   
Query: 258 ccggtgccggccattcctgcgtgcccttgctgcccgtagg 297
           |||||||||||||| || | ||| |||||||| |||||||
Sbjct: 550 ccggtgccggccatcccagtgtggccttgctgtccgtagg 511

---

>gb|AY895893.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 401370 dehydrin 4
           (Dhn4) gene, complete cds
          Length = 922

 Score =  107 bits (54), Expect = 4e-20
 Identities = 72/78 (92%)
 Strand = Plus / Minus

                                                                       
Query: 374 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcctcccgcc 433
           |||||| || |||||||||||||||||||||||||| ||||||||||||||||| || ||
Sbjct: 383 gtggccaccagggagcttctccttgatcttctccttgatgcccttcttcctcctgccacc 324

                             
Query: 434 catgccgtcgtcctcgga 451
           |||||| |||||||||||
Sbjct: 323 catgccatcgtcctcgga 306



 Score = 93.7 bits (47), Expect = 6e-16
 Identities = 59/63 (93%)
 Strand = Plus / Minus

                                                                       
Query: 201 gctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccg 260
           ||||||||||| || || |||||||||||||||||||||||||| |||||||||||||||
Sbjct: 784 gctcagtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgccg 725

              
Query: 261 gtg 263
           |||
Sbjct: 724 gtg 722



 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 41/43 (95%)
 Strand = Plus / Minus

                                                      
Query: 455 cgagctggagctggagctgccggagcgatgcagtatcccacgg 497
           ||||||||||||||||||||||||||| ||||| |||||||||
Sbjct: 213 cgagctggagctggagctgccggagcggtgcaggatcccacgg 171



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 384 gggagcttctccttgatcttctccttcatgcccttcttc 422
           |||||||||||||||||||| ||| | ||||||||||||
Sbjct: 769 gggagcttctccttgatcttgtccatgatgcccttcttc 731



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 219 agcttctccttgatcttgtccatgatccccttcttc 254
           ||||||||||||||||| ||| |||| |||||||||
Sbjct: 370 agcttctccttgatcttctccttgatgcccttcttc 335



 Score = 40.1 bits (20), Expect = 7.2
 Identities = 35/40 (87%)
 Strand = Plus / Minus

                                                   
Query: 258 ccggtgccggccattcctgcgtgcccttgctgcccgtagg 297
           |||||||||||||| || | ||| |||||||| |||||||
Sbjct: 550 ccggtgccggccatcccagtgtggccttgctgtccgtagg 511

---

>gb|AY895892.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 366446 dehydrin 4
           (Dhn4) gene, complete cds
          Length = 907

 Score =  107 bits (54), Expect = 4e-20
 Identities = 72/78 (92%)
 Strand = Plus / Minus

                                                                       
Query: 374 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcctcccgcc 433
           |||||| || |||||||||||||||||||||||||| ||||||||||||||||| || ||
Sbjct: 383 gtggccaccagggagcttctccttgatcttctccttgatgcccttcttcctcctgccacc 324

                             
Query: 434 catgccgtcgtcctcgga 451
           |||||| |||||||||||
Sbjct: 323 catgccatcgtcctcgga 306



 Score = 93.7 bits (47), Expect = 6e-16
 Identities = 59/63 (93%)
 Strand = Plus / Minus

                                                                       
Query: 201 gctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccg 260
           ||||||||||| || || |||||||||||||||||||||||||| |||||||||||||||
Sbjct: 769 gctcagtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgccg 710

              
Query: 261 gtg 263
           |||
Sbjct: 709 gtg 707



 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 41/43 (95%)
 Strand = Plus / Minus

                                                      
Query: 455 cgagctggagctggagctgccggagcgatgcagtatcccacgg 497
           ||||||||||||||||||||||||||| ||||| |||||||||
Sbjct: 213 cgagctggagctggagctgccggagcggtgcaggatcccacgg 171



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 384 gggagcttctccttgatcttctccttcatgcccttcttc 422
           |||||||||||||||||||| ||| | ||||||||||||
Sbjct: 754 gggagcttctccttgatcttgtccatgatgcccttcttc 716



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 219 agcttctccttgatcttgtccatgatccccttcttc 254
           ||||||||||||||||| ||| |||| |||||||||
Sbjct: 370 agcttctccttgatcttctccttgatgcccttcttc 335

---

>gb|AY895891.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 296926 dehydrin 4
           (Dhn4) gene, complete cds
          Length = 922

 Score =  107 bits (54), Expect = 4e-20
 Identities = 72/78 (92%)
 Strand = Plus / Minus

                                                                       
Query: 374 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcctcccgcc 433
           |||||| || |||||||||||||||||||||||||| ||||||||||||||||| || ||
Sbjct: 383 gtggccaccagggagcttctccttgatcttctccttgatgcccttcttcctcctgccacc 324

                             
Query: 434 catgccgtcgtcctcgga 451
           |||||| |||||||||||
Sbjct: 323 catgccatcgtcctcgga 306



 Score = 93.7 bits (47), Expect = 6e-16
 Identities = 59/63 (93%)
 Strand = Plus / Minus

                                                                       
Query: 201 gctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccg 260
           ||||||||||| || || |||||||||||||||||||||||||| |||||||||||||||
Sbjct: 784 gctcagtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgccg 725

              
Query: 261 gtg 263
           |||
Sbjct: 724 gtg 722



 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 41/43 (95%)
 Strand = Plus / Minus

                                                      
Query: 455 cgagctggagctggagctgccggagcgatgcagtatcccacgg 497
           ||||||||||||||||||||||||||| ||||| |||||||||
Sbjct: 213 cgagctggagctggagctgccggagcggtgcaggatcccacgg 171



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 384 gggagcttctccttgatcttctccttcatgcccttcttc 422
           |||||||||||||||||||| ||| | ||||||||||||
Sbjct: 769 gggagcttctccttgatcttgtccatgatgcccttcttc 731



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 219 agcttctccttgatcttgtccatgatccccttcttc 254
           ||||||||||||||||| ||| |||| |||||||||
Sbjct: 370 agcttctccttgatcttctccttgatgcccttcttc 335



 Score = 40.1 bits (20), Expect = 7.2
 Identities = 35/40 (87%)
 Strand = Plus / Minus

                                                   
Query: 258 ccggtgccggccattcctgcgtgcccttgctgcccgtagg 297
           |||||||||||||| || | ||| |||||||| |||||||
Sbjct: 550 ccggtgccggccatcccagtgtggccttgctgtccgtagg 511

---

>gb|AY895890.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 293411 dehydrin 4
           (Dhn4) gene, complete cds
          Length = 907

 Score =  107 bits (54), Expect = 4e-20
 Identities = 72/78 (92%)
 Strand = Plus / Minus

                                                                       
Query: 374 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcctcccgcc 433
           |||||| || |||||||||||||||||||||||||| ||||||||||||||||| || ||
Sbjct: 383 gtggccaccagggagcttctccttgatcttctccttgatgcccttcttcctcctgccacc 324

                             
Query: 434 catgccgtcgtcctcgga 451
           |||||| |||||||||||
Sbjct: 323 catgccatcgtcctcgga 306



 Score = 93.7 bits (47), Expect = 6e-16
 Identities = 59/63 (93%)
 Strand = Plus / Minus

                                                                       
Query: 201 gctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccg 260
           ||||||||||| || || |||||||||||||||||||||||||| |||||||||||||||
Sbjct: 769 gctcagtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgccg 710

              
Query: 261 gtg 263
           |||
Sbjct: 709 gtg 707



 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 41/43 (95%)
 Strand = Plus / Minus

                                                      
Query: 455 cgagctggagctggagctgccggagcgatgcagtatcccacgg 497
           ||||||||||||||||||||||||||| ||||| |||||||||
Sbjct: 213 cgagctggagctggagctgccggagcggtgcaggatcccacgg 171



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 384 gggagcttctccttgatcttctccttcatgcccttcttc 422
           |||||||||||||||||||| ||| | ||||||||||||
Sbjct: 754 gggagcttctccttgatcttgtccatgatgcccttcttc 716



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 219 agcttctccttgatcttgtccatgatccccttcttc 254
           ||||||||||||||||| ||| |||| |||||||||
Sbjct: 370 agcttctccttgatcttctccttgatgcccttcttc 335

---

>gb|AY895888.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 293402 dehydrin 4
           (Dhn4) gene, complete cds
          Length = 980

 Score =  107 bits (54), Expect = 4e-20
 Identities = 72/78 (92%)
 Strand = Plus / Minus

                                                                       
Query: 374 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcctcccgcc 433
           |||||| || |||||||||||||||||||||||||| ||||||||||||||||| || ||
Sbjct: 381 gtggccaccagggagcttctccttgatcttctccttgatgcccttcttcctcctgccacc 322

                             
Query: 434 catgccgtcgtcctcgga 451
           |||||| |||||||||||
Sbjct: 321 catgccatcgtcctcgga 304



 Score = 93.7 bits (47), Expect = 6e-16
 Identities = 59/63 (93%)
 Strand = Plus / Minus

                                                                       
Query: 201 gctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccg 260
           ||||||||||| || || |||||||||||||||||||||||||| |||||||||||||||
Sbjct: 842 gctcagtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgccg 783

              
Query: 261 gtg 263
           |||
Sbjct: 782 gtg 780



 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 41/43 (95%)
 Strand = Plus / Minus

                                                      
Query: 455 cgagctggagctggagctgccggagcgatgcagtatcccacgg 497
           ||||||||||||||||||||||||||| ||||| |||||||||
Sbjct: 213 cgagctggagctggagctgccggagcggtgcaggatcccacgg 171



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 384 gggagcttctccttgatcttctccttcatgcccttcttc 422
           |||||||||||||||||||| ||| | ||||||||||||
Sbjct: 827 gggagcttctccttgatcttgtccatgatgcccttcttc 789



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 219 agcttctccttgatcttgtccatgatccccttcttc 254
           ||||||||||||||||| ||| |||| |||||||||
Sbjct: 368 agcttctccttgatcttctccttgatgcccttcttc 333



 Score = 40.1 bits (20), Expect = 7.2
 Identities = 35/40 (87%)
 Strand = Plus / Minus

                                                   
Query: 258 ccggtgccggccattcctgcgtgcccttgctgcccgtagg 297
           |||||||||||||| || | ||| |||||||| |||||||
Sbjct: 548 ccggtgccggccatcccagtgtggccttgctgtccgtagg 509

---

>gb|AY895887.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 268242 dehydrin 4
           (Dhn4) gene, complete cds
          Length = 907

 Score =  107 bits (54), Expect = 4e-20
 Identities = 72/78 (92%)
 Strand = Plus / Minus

                                                                       
Query: 374 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcctcccgcc 433
           |||||| || |||||||||||||||||||||||||| ||||||||||||||||| || ||
Sbjct: 383 gtggccaccagggagcttctccttgatcttctccttgatgcccttcttcctcctgccacc 324

                             
Query: 434 catgccgtcgtcctcgga 451
           |||||| |||||||||||
Sbjct: 323 catgccatcgtcctcgga 306



 Score = 93.7 bits (47), Expect = 6e-16
 Identities = 59/63 (93%)
 Strand = Plus / Minus

                                                                       
Query: 201 gctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccg 260
           ||||||||||| || || |||||||||||||||||||||||||| |||||||||||||||
Sbjct: 769 gctcagtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgccg 710

              
Query: 261 gtg 263
           |||
Sbjct: 709 gtg 707



 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 41/43 (95%)
 Strand = Plus / Minus

                                                      
Query: 455 cgagctggagctggagctgccggagcgatgcagtatcccacgg 497
           ||||||||||||||||||||||||||| ||||| |||||||||
Sbjct: 213 cgagctggagctggagctgccggagcggtgcaggatcccacgg 171



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 384 gggagcttctccttgatcttctccttcatgcccttcttc 422
           |||||||||||||||||||| ||| | ||||||||||||
Sbjct: 754 gggagcttctccttgatcttgtccatgatgcccttcttc 716



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 219 agcttctccttgatcttgtccatgatccccttcttc 254
           ||||||||||||||||| ||| |||| |||||||||
Sbjct: 370 agcttctccttgatcttctccttgatgcccttcttc 335

---

>gb|AY895886.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 254894 dehydrin 4
           (Dhn4) gene, complete cds
          Length = 904

 Score =  107 bits (54), Expect = 4e-20
 Identities = 72/78 (92%)
 Strand = Plus / Minus

                                                                       
Query: 374 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcctcccgcc 433
           |||||| || |||||||||||||||||||||||||| ||||||||||||||||| || ||
Sbjct: 380 gtggccaccagggagcttctccttgatcttctccttgatgcccttcttcctcctgccacc 321

                             
Query: 434 catgccgtcgtcctcgga 451
           |||||| |||||||||||
Sbjct: 320 catgccatcgtcctcgga 303



 Score = 93.7 bits (47), Expect = 6e-16
 Identities = 59/63 (93%)
 Strand = Plus / Minus

                                                                       
Query: 201 gctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccg 260
           ||||||||||| || || |||||||||||||||||||||||||| |||||||||||||||
Sbjct: 766 gctcagtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgccg 707

              
Query: 261 gtg 263
           |||
Sbjct: 706 gtg 704



 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 41/43 (95%)
 Strand = Plus / Minus

                                                      
Query: 455 cgagctggagctggagctgccggagcgatgcagtatcccacgg 497
           ||||||||||||||||||||||||||| ||||| |||||||||
Sbjct: 213 cgagctggagctggagctgccggagcggtgcaggatcccacgg 171



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 384 gggagcttctccttgatcttctccttcatgcccttcttc 422
           |||||||||||||||||||| ||| | ||||||||||||
Sbjct: 751 gggagcttctccttgatcttgtccatgatgcccttcttc 713



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 219 agcttctccttgatcttgtccatgatccccttcttc 254
           ||||||||||||||||| ||| |||| |||||||||
Sbjct: 367 agcttctccttgatcttctccttgatgcccttcttc 332

---

>gb|AY895885.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 253933 dehydrin 4
           (Dhn4) gene, complete cds
          Length = 922

 Score =  107 bits (54), Expect = 4e-20
 Identities = 72/78 (92%)
 Strand = Plus / Minus

                                                                       
Query: 374 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcctcccgcc 433
           |||||| || |||||||||||||||||||||||||| ||||||||||||||||| || ||
Sbjct: 383 gtggccaccagggagcttctccttgatcttctccttgatgcccttcttcctcctgccacc 324

                             
Query: 434 catgccgtcgtcctcgga 451
           |||||| |||||||||||
Sbjct: 323 catgccatcgtcctcgga 306



 Score = 93.7 bits (47), Expect = 6e-16
 Identities = 59/63 (93%)
 Strand = Plus / Minus

                                                                       
Query: 201 gctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccg 260
           ||||||||||| || || |||||||||||||||||||||||||| |||||||||||||||
Sbjct: 784 gctcagtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgccg 725

              
Query: 261 gtg 263
           |||
Sbjct: 724 gtg 722



 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 41/43 (95%)
 Strand = Plus / Minus

                                                      
Query: 455 cgagctggagctggagctgccggagcgatgcagtatcccacgg 497
           ||||||||||||||||||||||||||| ||||| |||||||||
Sbjct: 213 cgagctggagctggagctgccggagcggtgcaggatcccacgg 171



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 384 gggagcttctccttgatcttctccttcatgcccttcttc 422
           |||||||||||||||||||| ||| | ||||||||||||
Sbjct: 769 gggagcttctccttgatcttgtccatgatgcccttcttc 731



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 219 agcttctccttgatcttgtccatgatccccttcttc 254
           ||||||||||||||||| ||| |||| |||||||||
Sbjct: 370 agcttctccttgatcttctccttgatgcccttcttc 335



 Score = 40.1 bits (20), Expect = 7.2
 Identities = 35/40 (87%)
 Strand = Plus / Minus

                                                   
Query: 258 ccggtgccggccattcctgcgtgcccttgctgcccgtagg 297
           |||||||||||||| || | ||| |||||||| |||||||
Sbjct: 550 ccggtgccggccatcccagtgtggccttgctgtccgtagg 511

---

>gb|AY895884.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 236388 dehydrin 4
           (Dhn4) gene, complete cds
          Length = 916

 Score =  107 bits (54), Expect = 4e-20
 Identities = 72/78 (92%)
 Strand = Plus / Minus

                                                                       
Query: 374 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcctcccgcc 433
           |||||| || |||||||||||||||||||||||||| ||||||||||||||||| || ||
Sbjct: 377 gtggccaccagggagcttctccttgatcttctccttgatgcccttcttcctcctgccacc 318

                             
Query: 434 catgccgtcgtcctcgga 451
           |||||| |||||||||||
Sbjct: 317 catgccatcgtcctcgga 300



 Score = 93.7 bits (47), Expect = 6e-16
 Identities = 59/63 (93%)
 Strand = Plus / Minus

                                                                       
Query: 201 gctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccg 260
           ||||||||||| || || |||||||||||||||||||||||||| |||||||||||||||
Sbjct: 778 gctcagtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgccg 719

              
Query: 261 gtg 263
           |||
Sbjct: 718 gtg 716



 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 41/43 (95%)
 Strand = Plus / Minus

                                                      
Query: 455 cgagctggagctggagctgccggagcgatgcagtatcccacgg 497
           ||||||||||||||||||||||||||| ||||| |||||||||
Sbjct: 207 cgagctggagctggagctgccggagcggtgcaggatcccacgg 165



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 384 gggagcttctccttgatcttctccttcatgcccttcttc 422
           |||||||||||||||||||| ||| | ||||||||||||
Sbjct: 763 gggagcttctccttgatcttgtccatgatgcccttcttc 725



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 219 agcttctccttgatcttgtccatgatccccttcttc 254
           ||||||||||||||||| ||| |||| |||||||||
Sbjct: 364 agcttctccttgatcttctccttgatgcccttcttc 329



 Score = 40.1 bits (20), Expect = 7.2
 Identities = 35/40 (87%)
 Strand = Plus / Minus

                                                   
Query: 258 ccggtgccggccattcctgcgtgcccttgctgcccgtagg 297
           |||||||||||||| || | ||| |||||||| |||||||
Sbjct: 544 ccggtgccggccatcccagtgtggccttgctgtccgtagg 505

---

>gb|AY895882.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 219796 dehydrin 4
           (Dhn4) gene, complete cds
          Length = 908

 Score =  107 bits (54), Expect = 4e-20
 Identities = 72/78 (92%)
 Strand = Plus / Minus

                                                                       
Query: 374 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcctcccgcc 433
           |||||| || |||||||||||||||||||||||||| ||||||||||||||||| || ||
Sbjct: 383 gtggccaccagggagcttctccttgatcttctccttgatgcccttcttcctcctgccacc 324

                             
Query: 434 catgccgtcgtcctcgga 451
           |||||| |||||||||||
Sbjct: 323 catgccatcgtcctcgga 306



 Score = 93.7 bits (47), Expect = 6e-16
 Identities = 59/63 (93%)
 Strand = Plus / Minus

                                                                       
Query: 201 gctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccg 260
           ||||||||||| || || |||||||||||||||||||||||||| |||||||||||||||
Sbjct: 769 gctcagtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgccg 710

              
Query: 261 gtg 263
           |||
Sbjct: 709 gtg 707



 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 41/43 (95%)
 Strand = Plus / Minus

                                                      
Query: 455 cgagctggagctggagctgccggagcgatgcagtatcccacgg 497
           ||||||||||||||||||||||||||| ||||| |||||||||
Sbjct: 213 cgagctggagctggagctgccggagcggtgcaggatcccacgg 171



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 384 gggagcttctccttgatcttctccttcatgcccttcttc 422
           |||||||||||||||||||| ||| | ||||||||||||
Sbjct: 754 gggagcttctccttgatcttgtccatgatgcccttcttc 716



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 219 agcttctccttgatcttgtccatgatccccttcttc 254
           ||||||||||||||||| ||| |||| |||||||||
Sbjct: 370 agcttctccttgatcttctccttgatgcccttcttc 335

---

>gb|AY895881.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 212306 dehydrin 4
           (Dhn4) gene, complete cds
          Length = 907

 Score =  107 bits (54), Expect = 4e-20
 Identities = 72/78 (92%)
 Strand = Plus / Minus

                                                                       
Query: 374 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcctcccgcc 433
           |||||| || |||||||||||||||||||||||||| ||||||||||||||||| || ||
Sbjct: 383 gtggccaccagggagcttctccttgatcttctccttgatgcccttcttcctcctgccacc 324

                             
Query: 434 catgccgtcgtcctcgga 451
           |||||| |||||||||||
Sbjct: 323 catgccatcgtcctcgga 306



 Score = 93.7 bits (47), Expect = 6e-16
 Identities = 59/63 (93%)
 Strand = Plus / Minus

                                                                       
Query: 201 gctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccg 260
           ||||||||||| || || |||||||||||||||||||||||||| |||||||||||||||
Sbjct: 769 gctcagtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgccg 710

              
Query: 261 gtg 263
           |||
Sbjct: 709 gtg 707



 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 41/43 (95%)
 Strand = Plus / Minus

                                                      
Query: 455 cgagctggagctggagctgccggagcgatgcagtatcccacgg 497
           ||||||||||||||||||||||||||| ||||| |||||||||
Sbjct: 213 cgagctggagctggagctgccggagcggtgcaggatcccacgg 171



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 384 gggagcttctccttgatcttctccttcatgcccttcttc 422
           |||||||||||||||||||| ||| | ||||||||||||
Sbjct: 754 gggagcttctccttgatcttgtccatgatgcccttcttc 716



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 219 agcttctccttgatcttgtccatgatccccttcttc 254
           ||||||||||||||||| ||| |||| |||||||||
Sbjct: 370 agcttctccttgatcttctccttgatgcccttcttc 335

---

>gb|AY895880.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 212305 dehydrin 4
           (Dhn4) gene, complete cds
          Length = 922

 Score =  107 bits (54), Expect = 4e-20
 Identities = 72/78 (92%)
 Strand = Plus / Minus

                                                                       
Query: 374 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcctcccgcc 433
           |||||| || |||||||||||||||||||||||||| ||||||||||||||||| || ||
Sbjct: 383 gtggccaccagggagcttctccttgatcttctccttgatgcccttcttcctcctgccacc 324

                             
Query: 434 catgccgtcgtcctcgga 451
           |||||| |||||||||||
Sbjct: 323 catgccatcgtcctcgga 306



 Score = 93.7 bits (47), Expect = 6e-16
 Identities = 59/63 (93%)
 Strand = Plus / Minus

                                                                       
Query: 201 gctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccg 260
           ||||||||||| || || |||||||||||||||||||||||||| |||||||||||||||
Sbjct: 784 gctcagtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgccg 725

              
Query: 261 gtg 263
           |||
Sbjct: 724 gtg 722



 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 41/43 (95%)
 Strand = Plus / Minus

                                                      
Query: 455 cgagctggagctggagctgccggagcgatgcagtatcccacgg 497
           ||||||||||||||||||||||||||| ||||| |||||||||
Sbjct: 213 cgagctggagctggagctgccggagcggtgcaggatcccacgg 171



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 384 gggagcttctccttgatcttctccttcatgcccttcttc 422
           |||||||||||||||||||| ||| | ||||||||||||
Sbjct: 769 gggagcttctccttgatcttgtccatgatgcccttcttc 731



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 219 agcttctccttgatcttgtccatgatccccttcttc 254
           ||||||||||||||||| ||| |||| |||||||||
Sbjct: 370 agcttctccttgatcttctccttgatgcccttcttc 335



 Score = 40.1 bits (20), Expect = 7.2
 Identities = 35/40 (87%)
 Strand = Plus / Minus

                                                   
Query: 258 ccggtgccggccattcctgcgtgcccttgctgcccgtagg 297
           |||||||||||||| || | ||| |||||||| |||||||
Sbjct: 550 ccggtgccggccatcccagtgtggccttgctgtccgtagg 511

---

>gb|AF043090.1|AF043090 Hordeum vulgare dehydrin 4 (dhn4) gene, complete cds
          Length = 2790

 Score =  107 bits (54), Expect = 4e-20
 Identities = 72/78 (92%)
 Strand = Plus / Minus

                                                                        
Query: 374  gtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcctcccgcc 433
            |||||| || |||||||||||||||||||||||||| ||||||||||||||||| || ||
Sbjct: 1744 gtggccaccagggagcttctccttgatcttctccttgatgcccttcttcctcctgccacc 1685

                              
Query: 434  catgccgtcgtcctcgga 451
            |||||| |||||||||||
Sbjct: 1684 catgccatcgtcctcgga 1667



 Score = 93.7 bits (47), Expect = 6e-16
 Identities = 59/63 (93%)
 Strand = Plus / Minus

                                                                        
Query: 201  gctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccg 260
            ||||||||||| || || |||||||||||||||||||||||||| |||||||||||||||
Sbjct: 2205 gctcagtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgccg 2146

               
Query: 261  gtg 263
            |||
Sbjct: 2145 gtg 2143



 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 41/43 (95%)
 Strand = Plus / Minus

                                                       
Query: 455  cgagctggagctggagctgccggagcgatgcagtatcccacgg 497
            ||||||||||||||||||||||||||| ||||| |||||||||
Sbjct: 1576 cgagctggagctggagctgccggagcggtgcaggatcccacgg 1534



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                   
Query: 384  gggagcttctccttgatcttctccttcatgcccttcttc 422
            |||||||||||||||||||| ||| | ||||||||||||
Sbjct: 2190 gggagcttctccttgatcttgtccatgatgcccttcttc 2152



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                                
Query: 219  agcttctccttgatcttgtccatgatccccttcttc 254
            ||||||||||||||||| ||| |||| |||||||||
Sbjct: 1731 agcttctccttgatcttctccttgatgcccttcttc 1696



 Score = 40.1 bits (20), Expect = 7.2
 Identities = 35/40 (87%)
 Strand = Plus / Minus

                                                    
Query: 258  ccggtgccggccattcctgcgtgcccttgctgcccgtagg 297
            |||||||||||||| || | ||| |||||||| |||||||
Sbjct: 1911 ccggtgccggccatcccagtgtggccttgctgtccgtagg 1872

---

>emb|X78429.1|TDDEH16 T.durum Desf. (Siliana) Dehydrin mRNA, clone pTd16
          Length = 814

 Score =  105 bits (53), Expect = 1e-19
 Identities = 62/65 (95%)
 Strand = Plus / Minus

                                                                       
Query: 200 ggctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgcc 259
           ||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||| ||
Sbjct: 518 ggctcagtgctgtccgggcagcttctccttgatcttgtccatgatgcccttcttctcacc 459

                
Query: 260 ggtgc 264
           |||||
Sbjct: 458 ggtgc 454



 Score = 89.7 bits (45), Expect = 9e-15
 Identities = 115/137 (83%), Gaps = 6/137 (4%)
 Strand = Plus / Minus

                                                                       
Query: 374 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcctcccgcc 433
           |||||| || || |||||||| |||||||| ||||| |||||||||||| ||||||||||
Sbjct: 341 gtggccacccggaagcttctctttgatcttatccttgatgcccttcttcttcctcccgcc 282

                                                                       
Query: 434 catgccgtcgtcctcggaggacgagctggag---ctggagctgccggagcgatgcagtat 490
           |||||| || |||||    ||||| ||||||   ||||||||||||||||| ||||| ||
Sbjct: 281 catgccatcatcctc---agacgaactggagctactggagctgccggagcgctgcaggat 225

                            
Query: 491 cccacgggtcttgtgct 507
           ||| | || ||||||||
Sbjct: 224 ccctccggccttgtgct 208



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Minus

                                                     
Query: 381 ccggggagcttctccttgatcttctccttcatgcccttcttc 422
           ||||| ||||||||||||||||| ||| | ||||||||||||
Sbjct: 505 ccgggcagcttctccttgatcttgtccatgatgcccttcttc 464

---

>emb|Y00842.1|OSRAB21 Rice rab21 gene for water-stress inducible protein RAB21
          Length = 2537

 Score =  103 bits (52), Expect = 6e-19
 Identities = 73/80 (91%)
 Strand = Plus / Minus

                                                                        
Query: 357  tgctgctggttgtccttgtggccgccggggagcttctccttgatcttctccttcatgccc 416
            |||||||| | | |||||| ||||||||||||||||||||||||||||||||| || |||
Sbjct: 1986 tgctgctgctcgcccttgttgccgccggggagcttctccttgatcttctccttgatcccc 1927

                                
Query: 417  ttcttcctcctcccgcccat 436
            |||||||||||||| |||||
Sbjct: 1926 ttcttcctcctccctcccat 1907



 Score =  101 bits (51), Expect = 2e-18
 Identities = 60/63 (95%)
 Strand = Plus / Minus

                                                                        
Query: 201  gctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccg 260
            ||||||||||| || ||||||||||||||||||||||||||||| |||||||||||||||
Sbjct: 2175 gctcagtgctggccgggcagcttctccttgatcttgtccatgatgcccttcttctcgccg 2116

               
Query: 261  gtg 263
            |||
Sbjct: 2115 gtg 2113



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                                
Query: 219  agcttctccttgatcttgtccatgatccccttcttc 254
            ||||||||||||||||| ||| ||||||||||||||
Sbjct: 1956 agcttctccttgatcttctccttgatccccttcttc 1921



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 39/43 (90%)
 Strand = Plus / Minus

                                                       
Query: 380  gccggggagcttctccttgatcttctccttcatgcccttcttc 422
            |||||| ||||||||||||||||| ||| | ||||||||||||
Sbjct: 2164 gccgggcagcttctccttgatcttgtccatgatgcccttcttc 2122



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 46/53 (86%)
 Strand = Plus / Minus

                                                                 
Query: 455  cgagctggagctggagctgccggagcgatgcagtatcccacgggtcttgtgct 507
            |||||| |||||||||||||||||||| ||||| |  || | |||||||||||
Sbjct: 1808 cgagcttgagctggagctgccggagcgttgcaggacgccgccggtcttgtgct 1756

---

>gb|AF181452.1|AF181452 Hordeum vulgare dehydrin (Dhn2) gene, complete cds
          Length = 1294

 Score =  103 bits (52), Expect = 6e-19
 Identities = 64/68 (94%)
 Strand = Plus / Minus

                                                                        
Query: 381  ccggggagcttctccttgatcttctccttcatgcccttcttcctcctcccgcccatgccg 440
            |||||||||||||||||||||||||||||||| || ||||||||||||||||| | ||||
Sbjct: 1032 ccggggagcttctccttgatcttctccttcatccctttcttcctcctcccgccaacgccg 973

                    
Query: 441  tcgtcctc 448
            ||||||||
Sbjct: 972  tcgtcctc 965



 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 43/45 (95%)
 Strand = Plus / Minus

                                                         
Query: 219  agcttctccttgatcttgtccatgatccccttcttctcgccggtg 263
            |||||||||||||||||||||||||  ||||||||||||||||||
Sbjct: 1161 agcttctccttgatcttgtccatgacacccttcttctcgccggtg 1117



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 27/27 (100%)
 Strand = Plus / Minus

                                      
Query: 455 cgagctggagctggagctgccggagcg 481
           |||||||||||||||||||||||||||
Sbjct: 862 cgagctggagctggagctgccggagcg 836



 Score = 44.1 bits (22), Expect = 0.46
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                      
Query: 378  ccgccggggagcttctccttgatctt 403
            |||||||| |||||||||||||||||
Sbjct: 1170 ccgccgggaagcttctccttgatctt 1145



 Score = 40.1 bits (20), Expect = 7.2
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                                
Query: 219  agcttctccttgatcttgtccatgatccccttcttc 254
            ||||||||||||||||| ||| | ||||| ||||||
Sbjct: 1026 agcttctccttgatcttctccttcatccctttcttc 991

---

>gb|AF043088.1|AF043088 Hordeum vulgare dehydrin 2 (dhn2) gene, complete cds
          Length = 1849

 Score =  103 bits (52), Expect = 6e-19
 Identities = 64/68 (94%)
 Strand = Plus / Minus

                                                                        
Query: 381  ccggggagcttctccttgatcttctccttcatgcccttcttcctcctcccgcccatgccg 440
            |||||||||||||||||||||||||||||||| || ||||||||||||||||| | ||||
Sbjct: 1040 ccggggagcttctccttgatcttctccttcatccctttcttcctcctcccgccaacgccg 981

                    
Query: 441  tcgtcctc 448
            ||||||||
Sbjct: 980  tcgtcctc 973



 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 43/45 (95%)
 Strand = Plus / Minus

                                                         
Query: 219  agcttctccttgatcttgtccatgatccccttcttctcgccggtg 263
            |||||||||||||||||||||||||  ||||||||||||||||||
Sbjct: 1169 agcttctccttgatcttgtccatgacacccttcttctcgccggtg 1125



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 27/27 (100%)
 Strand = Plus / Minus

                                      
Query: 455 cgagctggagctggagctgccggagcg 481
           |||||||||||||||||||||||||||
Sbjct: 874 cgagctggagctggagctgccggagcg 848



 Score = 44.1 bits (22), Expect = 0.46
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                      
Query: 378  ccgccggggagcttctccttgatctt 403
            |||||||| |||||||||||||||||
Sbjct: 1178 ccgccgggaagcttctccttgatctt 1153



 Score = 40.1 bits (20), Expect = 7.2
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                                
Query: 219  agcttctccttgatcttgtccatgatccccttcttc 254
            ||||||||||||||||| ||| | ||||| ||||||
Sbjct: 1034 agcttctccttgatcttctccttcatccctttcttc 999

---

>gb|U60097.2|OSU60097 Oryza sativa dehydrin mRNA, complete cds
          Length = 864

 Score =  101 bits (51), Expect = 2e-18
 Identities = 60/63 (95%)
 Strand = Plus / Minus

                                                                       
Query: 201 gctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccg 260
           ||||||||||| || ||||||||||||||||||||||||||||| |||||||||||||||
Sbjct: 584 gctcagtgctggccgggcagcttctccttgatcttgtccatgatgcccttcttctcgccg 525

              
Query: 261 gtg 263
           |||
Sbjct: 524 gtg 522



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 39/43 (90%)
 Strand = Plus / Minus

                                                      
Query: 380 gccggggagcttctccttgatcttctccttcatgcccttcttc 422
           |||||| ||||||||||||||||| ||| | ||||||||||||
Sbjct: 573 gccgggcagcttctccttgatcttgtccatgatgcccttcttc 531



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 48/55 (87%)
 Strand = Plus / Minus

                                                                  
Query: 453 gacgagctggagctggagctgccggagcgatgcagtatcccacgggtcttgtgct 507
           |||||||| |||||||||||||||||||| ||||| |  || | |||||||||||
Sbjct: 299 gacgagcttgagctggagctgccggagcgttgcaggacgccgccggtcttgtgct 245

---

>gb|AY895931.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 560559 dehydrin 7
           (Dhn7) gene, complete cds
          Length = 1371

 Score =  101 bits (51), Expect = 2e-18
 Identities = 63/67 (94%)
 Strand = Plus / Minus

                                                                       
Query: 200 ggctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgcc 259
           ||||||||||||||| ||||||||||||||||| ||||||||||| |||||||| |||||
Sbjct: 857 ggctcagtgctgtccgggcagcttctccttgattttgtccatgatgcccttcttttcgcc 798

                  
Query: 260 ggtgccg 266
           |||||||
Sbjct: 797 ggtgccg 791



 Score =  101 bits (51), Expect = 2e-18
 Identities = 69/75 (92%)
 Strand = Plus / Minus

                                                                       
Query: 374 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcctcccgcc 433
           |||||| || |||||||||||||||||||| ||||| || ||||||||||||||||||||
Sbjct: 599 gtggccaccagggagcttctccttgatcttatccttgatacccttcttcctcctcccgcc 540

                          
Query: 434 catgccgtcgtcctc 448
           |||||| ||||||||
Sbjct: 539 catgccatcgtcctc 525



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                
Query: 455 cgagctggagctggagctgccggagcgatgcagtatcccacgggtcttgtgct 507
           |||||||||||| |||||||||||||| ||||| ||||| | || ||||||||
Sbjct: 406 cgagctggagcttgagctgccggagcgctgcaggatcccgccggccttgtgct 354



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 219 agcttctccttgatcttgtccatgatccccttcttc 254
           ||||||||||||||||| ||| |||| |||||||||
Sbjct: 586 agcttctccttgatcttatccttgatacccttcttc 551



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 381 ccggggagcttctccttgatcttctccttcatgcccttctt 421
           ||||| |||||||||||||| || ||| | |||||||||||
Sbjct: 844 ccgggcagcttctccttgattttgtccatgatgcccttctt 804

---

>gb|AY895930.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 559556 dehydrin 7
           (Dhn7) gene, complete cds
          Length = 1370

 Score =  101 bits (51), Expect = 2e-18
 Identities = 63/67 (94%)
 Strand = Plus / Minus

                                                                       
Query: 200 ggctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgcc 259
           ||||||||||||||| ||||||||||||||||| ||||||||||| |||||||| |||||
Sbjct: 854 ggctcagtgctgtccgggcagcttctccttgattttgtccatgatgcccttcttttcgcc 795

                  
Query: 260 ggtgccg 266
           |||||||
Sbjct: 794 ggtgccg 788



 Score =  101 bits (51), Expect = 2e-18
 Identities = 69/75 (92%)
 Strand = Plus / Minus

                                                                       
Query: 374 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcctcccgcc 433
           |||||| || |||||||||||||||||||| ||||| || ||||||||||||||||||||
Sbjct: 596 gtggccaccagggagcttctccttgatcttatccttgatacccttcttcctcctcccgcc 537

                          
Query: 434 catgccgtcgtcctc 448
           |||||| ||||||||
Sbjct: 536 catgccatcgtcctc 522



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                
Query: 455 cgagctggagctggagctgccggagcgatgcagtatcccacgggtcttgtgct 507
           |||||||||||| |||||||||||||| ||||| ||||| | || ||||||||
Sbjct: 401 cgagctggagcttgagctgccggagcgctgcaggatcccgccggccttgtgct 349



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 219 agcttctccttgatcttgtccatgatccccttcttc 254
           ||||||||||||||||| ||| |||| |||||||||
Sbjct: 583 agcttctccttgatcttatccttgatacccttcttc 548



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 381 ccggggagcttctccttgatcttctccttcatgcccttctt 421
           ||||| |||||||||||||| || ||| | |||||||||||
Sbjct: 841 ccgggcagcttctccttgattttgtccatgatgcccttctt 801

---

>gb|AY895929.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 531957 dehydrin 7
           (Dhn7) gene, complete cds
          Length = 1370

 Score =  101 bits (51), Expect = 2e-18
 Identities = 63/67 (94%)
 Strand = Plus / Minus

                                                                       
Query: 200 ggctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgcc 259
           ||||||||||||||| ||||||||||||||||| ||||||||||| |||||||| |||||
Sbjct: 854 ggctcagtgctgtccgggcagcttctccttgattttgtccatgatgcccttcttttcgcc 795

                  
Query: 260 ggtgccg 266
           |||||||
Sbjct: 794 ggtgccg 788



 Score =  101 bits (51), Expect = 2e-18
 Identities = 69/75 (92%)
 Strand = Plus / Minus

                                                                       
Query: 374 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcctcccgcc 433
           |||||| || |||||||||||||||||||| ||||| || ||||||||||||||||||||
Sbjct: 596 gtggccaccagggagcttctccttgatcttatccttgatacccttcttcctcctcccgcc 537

                          
Query: 434 catgccgtcgtcctc 448
           |||||| ||||||||
Sbjct: 536 catgccatcgtcctc 522



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                
Query: 455 cgagctggagctggagctgccggagcgatgcagtatcccacgggtcttgtgct 507
           |||||||||||| |||||||||||||| ||||| ||||| | || ||||||||
Sbjct: 401 cgagctggagcttgagctgccggagcgctgcaggatcccgccggccttgtgct 349



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 219 agcttctccttgatcttgtccatgatccccttcttc 254
           ||||||||||||||||| ||| |||| |||||||||
Sbjct: 583 agcttctccttgatcttatccttgatacccttcttc 548



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 381 ccggggagcttctccttgatcttctccttcatgcccttctt 421
           ||||| |||||||||||||| || ||| | |||||||||||
Sbjct: 841 ccgggcagcttctccttgattttgtccatgatgcccttctt 801

---

>gb|AY895928.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 531853 dehydrin 7
           (Dhn7) gene, complete cds
          Length = 1332

 Score =  101 bits (51), Expect = 2e-18
 Identities = 63/67 (94%)
 Strand = Plus / Minus

                                                                       
Query: 200 ggctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgcc 259
           ||||||||||||||| ||||||||||||||||| ||||||||||| |||||||| |||||
Sbjct: 816 ggctcagtgctgtccgggcagcttctccttgattttgtccatgatgcccttcttttcgcc 757

                  
Query: 260 ggtgccg 266
           |||||||
Sbjct: 756 ggtgccg 750



 Score =  101 bits (51), Expect = 2e-18
 Identities = 69/75 (92%)
 Strand = Plus / Minus

                                                                       
Query: 374 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcctcccgcc 433
           |||||| || |||||||||||||||||||| ||||| || ||||||||||||||||||||
Sbjct: 558 gtggccaccagggagcttctccttgatcttatccttgatacccttcttcctcctcccgcc 499

                          
Query: 434 catgccgtcgtcctc 448
           |||||| ||||||||
Sbjct: 498 catgccatcgtcctc 484



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 455 cgagctggagctggagctgccggagcgatgcagtatccc 493
           |||||||||||| |||||||||||||| ||||| |||||
Sbjct: 367 cgagctggagcttgagctgccggagcgctgcaggatccc 329



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 219 agcttctccttgatcttgtccatgatccccttcttc 254
           ||||||||||||||||| ||| |||| |||||||||
Sbjct: 545 agcttctccttgatcttatccttgatacccttcttc 510



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 381 ccggggagcttctccttgatcttctccttcatgcccttctt 421
           ||||| |||||||||||||| || ||| | |||||||||||
Sbjct: 803 ccgggcagcttctccttgattttgtccatgatgcccttctt 763

---

>gb|AY895926.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 466460 dehydrin 7
           (Dhn7) gene, complete cds
          Length = 1370

 Score =  101 bits (51), Expect = 2e-18
 Identities = 63/67 (94%)
 Strand = Plus / Minus

                                                                       
Query: 200 ggctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgcc 259
           ||||||||||||||| ||||||||||||||||| ||||||||||| |||||||| |||||
Sbjct: 854 ggctcagtgctgtccgggcagcttctccttgattttgtccatgatgcccttcttttcgcc 795

                  
Query: 260 ggtgccg 266
           |||||||
Sbjct: 794 ggtgccg 788



 Score =  101 bits (51), Expect = 2e-18
 Identities = 69/75 (92%)
 Strand = Plus / Minus

                                                                       
Query: 374 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcctcccgcc 433
           |||||| || |||||||||||||||||||| ||||| || ||||||||||||||||||||
Sbjct: 596 gtggccaccagggagcttctccttgatcttatccttgatacccttcttcctcctcccgcc 537

                          
Query: 434 catgccgtcgtcctc 448
           |||||| ||||||||
Sbjct: 536 catgccatcgtcctc 522



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                
Query: 455 cgagctggagctggagctgccggagcgatgcagtatcccacgggtcttgtgct 507
           |||||||||||| |||||||||||||| ||||| ||||| | || ||||||||
Sbjct: 401 cgagctggagcttgagctgccggagcgctgcaggatcccgccggccttgtgct 349



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 219 agcttctccttgatcttgtccatgatccccttcttc 254
           ||||||||||||||||| ||| |||| |||||||||
Sbjct: 583 agcttctccttgatcttatccttgatacccttcttc 548



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 381 ccggggagcttctccttgatcttctccttcatgcccttctt 421
           ||||| |||||||||||||| || ||| | |||||||||||
Sbjct: 841 ccgggcagcttctccttgattttgtccatgatgcccttctt 801

---

>gb|AY895925.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 420916 dehydrin 7
           (Dhn7) gene, complete cds
          Length = 1373

 Score =  101 bits (51), Expect = 2e-18
 Identities = 63/67 (94%)
 Strand = Plus / Minus

                                                                       
Query: 200 ggctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgcc 259
           ||||||||||||||| ||||||||||||||||| ||||||||||| |||||||| |||||
Sbjct: 857 ggctcagtgctgtccgggcagcttctccttgattttgtccatgatgcccttcttttcgcc 798

                  
Query: 260 ggtgccg 266
           |||||||
Sbjct: 797 ggtgccg 791



 Score =  101 bits (51), Expect = 2e-18
 Identities = 69/75 (92%)
 Strand = Plus / Minus

                                                                       
Query: 374 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcctcccgcc 433
           |||||| || |||||||||||||||||||| ||||| || ||||||||||||||||||||
Sbjct: 599 gtggccaccagggagcttctccttgatcttatccttgatacccttcttcctcctcccgcc 540

                          
Query: 434 catgccgtcgtcctc 448
           |||||| ||||||||
Sbjct: 539 catgccatcgtcctc 525



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                
Query: 455 cgagctggagctggagctgccggagcgatgcagtatcccacgggtcttgtgct 507
           |||||||||||| |||||||||||||| ||||| ||||| | || ||||||||
Sbjct: 406 cgagctggagcttgagctgccggagcgctgcaggatcccgccggccttgtgct 354



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 219 agcttctccttgatcttgtccatgatccccttcttc 254
           ||||||||||||||||| ||| |||| |||||||||
Sbjct: 586 agcttctccttgatcttatccttgatacccttcttc 551



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 381 ccggggagcttctccttgatcttctccttcatgcccttctt 421
           ||||| |||||||||||||| || ||| | |||||||||||
Sbjct: 844 ccgggcagcttctccttgattttgtccatgatgcccttctt 804

---

>gb|AY895924.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 420913 dehydrin 7
           (Dhn7) gene, complete cds
          Length = 1375

 Score =  101 bits (51), Expect = 2e-18
 Identities = 63/67 (94%)
 Strand = Plus / Minus

                                                                       
Query: 200 ggctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgcc 259
           ||||||||||||||| ||||||||||||||||| ||||||||||| |||||||| |||||
Sbjct: 859 ggctcagtgctgtccgggcagcttctccttgattttgtccatgatgcccttcttttcgcc 800

                  
Query: 260 ggtgccg 266
           |||||||
Sbjct: 799 ggtgccg 793



 Score =  101 bits (51), Expect = 2e-18
 Identities = 69/75 (92%)
 Strand = Plus / Minus

                                                                       
Query: 374 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcctcccgcc 433
           |||||| || |||||||||||||||||||| ||||| || ||||||||||||||||||||
Sbjct: 601 gtggccaccagggagcttctccttgatcttatccttgatacccttcttcctcctcccgcc 542

                          
Query: 434 catgccgtcgtcctc 448
           |||||| ||||||||
Sbjct: 541 catgccatcgtcctc 527



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                
Query: 455 cgagctggagctggagctgccggagcgatgcagtatcccacgggtcttgtgct 507
           |||||||||||| |||||||||||||| ||||| ||||| | || ||||||||
Sbjct: 406 cgagctggagcttgagctgccggagcgctgcaggatcccgccggccttgtgct 354



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 219 agcttctccttgatcttgtccatgatccccttcttc 254
           ||||||||||||||||| ||| |||| |||||||||
Sbjct: 588 agcttctccttgatcttatccttgatacccttcttc 553



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 381 ccggggagcttctccttgatcttctccttcatgcccttctt 421
           ||||| |||||||||||||| || ||| | |||||||||||
Sbjct: 846 ccgggcagcttctccttgattttgtccatgatgcccttctt 806

---

>gb|AY895923.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 420911 dehydrin 7
           (Dhn7) gene, complete cds
          Length = 1364

 Score =  101 bits (51), Expect = 2e-18
 Identities = 63/67 (94%)
 Strand = Plus / Minus

                                                                       
Query: 200 ggctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgcc 259
           ||||||||||||||| ||||||||||||||||| ||||||||||| |||||||| |||||
Sbjct: 850 ggctcagtgctgtccgggcagcttctccttgattttgtccatgatgcccttcttttcgcc 791

                  
Query: 260 ggtgccg 266
           |||||||
Sbjct: 790 ggtgccg 784



 Score =  101 bits (51), Expect = 2e-18
 Identities = 69/75 (92%)
 Strand = Plus / Minus

                                                                       
Query: 374 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcctcccgcc 433
           |||||| || |||||||||||||||||||| ||||| || ||||||||||||||||||||
Sbjct: 592 gtggccaccagggagcttctccttgatcttatccttgatacccttcttcctcctcccgcc 533

                          
Query: 434 catgccgtcgtcctc 448
           |||||| ||||||||
Sbjct: 532 catgccatcgtcctc 518



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                
Query: 455 cgagctggagctggagctgccggagcgatgcagtatcccacgggtcttgtgct 507
           |||||||||||| |||||||||||||| ||||| ||||| | || ||||||||
Sbjct: 397 cgagctggagcttgagctgccggagcgctgcaggatcccgccggccttgtgct 345



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 219 agcttctccttgatcttgtccatgatccccttcttc 254
           ||||||||||||||||| ||| |||| |||||||||
Sbjct: 579 agcttctccttgatcttatccttgatacccttcttc 544



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 381 ccggggagcttctccttgatcttctccttcatgcccttctt 421
           ||||| |||||||||||||| || ||| | |||||||||||
Sbjct: 837 ccgggcagcttctccttgattttgtccatgatgcccttctt 797

---

>gb|AY895922.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 420911 dehydrin 7
           (Dhn7) gene, complete cds
          Length = 1364

 Score =  101 bits (51), Expect = 2e-18
 Identities = 63/67 (94%)
 Strand = Plus / Minus

                                                                       
Query: 200 ggctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgcc 259
           ||||||||||||||| ||||||||||||||||| ||||||||||| |||||||| |||||
Sbjct: 850 ggctcagtgctgtccgggcagcttctccttgattttgtccatgatgcccttcttttcgcc 791

                  
Query: 260 ggtgccg 266
           |||||||
Sbjct: 790 ggtgccg 784



 Score =  101 bits (51), Expect = 2e-18
 Identities = 69/75 (92%)
 Strand = Plus / Minus

                                                                       
Query: 374 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcctcccgcc 433
           |||||| || |||||||||||||||||||| ||||| || ||||||||||||||||||||
Sbjct: 592 gtggccaccagggagcttctccttgatcttatccttgatacccttcttcctcctcccgcc 533

                          
Query: 434 catgccgtcgtcctc 448
           |||||| ||||||||
Sbjct: 532 catgccatcgtcctc 518



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                
Query: 455 cgagctggagctggagctgccggagcgatgcagtatcccacgggtcttgtgct 507
           |||||||||||| |||||||||||||| ||||| ||||| | || ||||||||
Sbjct: 397 cgagctggagcttgagctgccggagcgctgcaggatcccgccggccttgtgct 345



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 219 agcttctccttgatcttgtccatgatccccttcttc 254
           ||||||||||||||||| ||| |||| |||||||||
Sbjct: 579 agcttctccttgatcttatccttgatacccttcttc 544



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 381 ccggggagcttctccttgatcttctccttcatgcccttctt 421
           ||||| |||||||||||||| || ||| | |||||||||||
Sbjct: 837 ccgggcagcttctccttgattttgtccatgatgcccttctt 797

---

>gb|AY895921.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 406276 dehydrin 7
           (Dhn7) gene, complete cds
          Length = 1373

 Score =  101 bits (51), Expect = 2e-18
 Identities = 63/67 (94%)
 Strand = Plus / Minus

                                                                       
Query: 200 ggctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgcc 259
           ||||||||||||||| ||||||||||||||||| ||||||||||| |||||||| |||||
Sbjct: 857 ggctcagtgctgtccgggcagcttctccttgattttgtccatgatgcccttcttttcgcc 798

                  
Query: 260 ggtgccg 266
           |||||||
Sbjct: 797 ggtgccg 791



 Score =  101 bits (51), Expect = 2e-18
 Identities = 69/75 (92%)
 Strand = Plus / Minus

                                                                       
Query: 374 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcctcccgcc 433
           |||||| || |||||||||||||||||||| ||||| || ||||||||||||||||||||
Sbjct: 599 gtggccaccagggagcttctccttgatcttatccttgatacccttcttcctcctcccgcc 540

                          
Query: 434 catgccgtcgtcctc 448
           |||||| ||||||||
Sbjct: 539 catgccatcgtcctc 525



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                
Query: 455 cgagctggagctggagctgccggagcgatgcagtatcccacgggtcttgtgct 507
           |||||||||||| |||||||||||||| ||||| ||||| | || ||||||||
Sbjct: 406 cgagctggagcttgagctgccggagcgctgcaggatcccgccggccttgtgct 354



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 219 agcttctccttgatcttgtccatgatccccttcttc 254
           ||||||||||||||||| ||| |||| |||||||||
Sbjct: 586 agcttctccttgatcttatccttgatacccttcttc 551



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 381 ccggggagcttctccttgatcttctccttcatgcccttctt 421
           ||||| |||||||||||||| || ||| | |||||||||||
Sbjct: 844 ccgggcagcttctccttgattttgtccatgatgcccttctt 804

---

>gb|AY895920.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 401371 dehydrin 7
           (Dhn7) gene, complete cds
          Length = 1363

 Score =  101 bits (51), Expect = 2e-18
 Identities = 63/67 (94%)
 Strand = Plus / Minus

                                                                       
Query: 200 ggctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgcc 259
           ||||||||||||||| ||||||||||||||||| ||||||||||| |||||||| |||||
Sbjct: 847 ggctcagtgctgtccgggcagcttctccttgattttgtccatgatgcccttcttttcgcc 788

                  
Query: 260 ggtgccg 266
           |||||||
Sbjct: 787 ggtgccg 781



 Score =  101 bits (51), Expect = 2e-18
 Identities = 69/75 (92%)
 Strand = Plus / Minus

                                                                       
Query: 374 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcctcccgcc 433
           |||||| || |||||||||||||||||||| ||||| || ||||||||||||||||||||
Sbjct: 589 gtggccaccagggagcttctccttgatcttatccttgatacccttcttcctcctcccgcc 530

                          
Query: 434 catgccgtcgtcctc 448
           |||||| ||||||||
Sbjct: 529 catgccatcgtcctc 515



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                
Query: 455 cgagctggagctggagctgccggagcgatgcagtatcccacgggtcttgtgct 507
           |||||||||||| |||||||||||||| ||||| ||||| | || ||||||||
Sbjct: 394 cgagctggagcttgagctgccggagcgctgcaggatcccgccggccttgtgct 342



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 219 agcttctccttgatcttgtccatgatccccttcttc 254
           ||||||||||||||||| ||| |||| |||||||||
Sbjct: 576 agcttctccttgatcttatccttgatacccttcttc 541



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 381 ccggggagcttctccttgatcttctccttcatgcccttctt 421
           ||||| |||||||||||||| || ||| | |||||||||||
Sbjct: 834 ccgggcagcttctccttgattttgtccatgatgcccttctt 794

---

>gb|AY895919.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 401370 dehydrin 7
           (Dhn7) gene, complete cds
          Length = 1366

 Score =  101 bits (51), Expect = 2e-18
 Identities = 63/67 (94%)
 Strand = Plus / Minus

                                                                       
Query: 200 ggctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgcc 259
           ||||||||||||||| ||||||||||||||||| ||||||||||| |||||||| |||||
Sbjct: 850 ggctcagtgctgtccgggcagcttctccttgattttgtccatgatgcccttcttttcgcc 791

                  
Query: 260 ggtgccg 266
           |||||||
Sbjct: 790 ggtgccg 784



 Score =  101 bits (51), Expect = 2e-18
 Identities = 69/75 (92%)
 Strand = Plus / Minus

                                                                       
Query: 374 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcctcccgcc 433
           |||||| || |||||||||||||||||||| ||||| || ||||||||||||||||||||
Sbjct: 592 gtggccaccagggagcttctccttgatcttatccttgatacccttcttcctcctcccgcc 533

                          
Query: 434 catgccgtcgtcctc 448
           |||||| ||||||||
Sbjct: 532 catgccatcgtcctc 518



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                
Query: 455 cgagctggagctggagctgccggagcgatgcagtatcccacgggtcttgtgct 507
           |||||||||||| |||||||||||||| ||||| ||||| | || ||||||||
Sbjct: 397 cgagctggagcttgagctgccggagcgctgcaggatcccgccggccttgtgct 345



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 219 agcttctccttgatcttgtccatgatccccttcttc 254
           ||||||||||||||||| ||| |||| |||||||||
Sbjct: 579 agcttctccttgatcttatccttgatacccttcttc 544



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 381 ccggggagcttctccttgatcttctccttcatgcccttctt 421
           ||||| |||||||||||||| || ||| | |||||||||||
Sbjct: 837 ccgggcagcttctccttgattttgtccatgatgcccttctt 797

---

>gb|AY895918.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 366446 dehydrin 7
           (Dhn7) gene, complete cds
          Length = 1343

 Score =  101 bits (51), Expect = 2e-18
 Identities = 63/67 (94%)
 Strand = Plus / Minus

                                                                       
Query: 200 ggctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgcc 259
           ||||||||||||||| ||||||||||||||||| ||||||||||| |||||||| |||||
Sbjct: 827 ggctcagtgctgtccgggcagcttctccttgattttgtccatgatgcccttcttttcgcc 768

                  
Query: 260 ggtgccg 266
           |||||||
Sbjct: 767 ggtgccg 761



 Score =  101 bits (51), Expect = 2e-18
 Identities = 69/75 (92%)
 Strand = Plus / Minus

                                                                       
Query: 374 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcctcccgcc 433
           |||||| || |||||||||||||||||||| ||||| || ||||||||||||||||||||
Sbjct: 569 gtggccaccagggagcttctccttgatcttatccttgatacccttcttcctcctcccgcc 510

                          
Query: 434 catgccgtcgtcctc 448
           |||||| ||||||||
Sbjct: 509 catgccatcgtcctc 495



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                
Query: 455 cgagctggagctggagctgccggagcgatgcagtatcccacgggtcttgtgct 507
           |||||||||||| |||||||||||||| ||||| ||||| | || ||||||||
Sbjct: 376 cgagctggagcttgagctgccggagcgctgcaggatcccgccggccttgtgct 324



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 219 agcttctccttgatcttgtccatgatccccttcttc 254
           ||||||||||||||||| ||| |||| |||||||||
Sbjct: 556 agcttctccttgatcttatccttgatacccttcttc 521



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 381 ccggggagcttctccttgatcttctccttcatgcccttctt 421
           ||||| |||||||||||||| || ||| | |||||||||||
Sbjct: 814 ccgggcagcttctccttgattttgtccatgatgcccttctt 774

---

>gb|AY895917.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 296926 dehydrin 7
           (Dhn7) gene, complete cds
          Length = 1370

 Score =  101 bits (51), Expect = 2e-18
 Identities = 63/67 (94%)
 Strand = Plus / Minus

                                                                       
Query: 200 ggctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgcc 259
           ||||||||||||||| ||||||||||||||||| ||||||||||| |||||||| |||||
Sbjct: 854 ggctcagtgctgtccgggcagcttctccttgattttgtccatgatgcccttcttttcgcc 795

                  
Query: 260 ggtgccg 266
           |||||||
Sbjct: 794 ggtgccg 788



 Score =  101 bits (51), Expect = 2e-18
 Identities = 69/75 (92%)
 Strand = Plus / Minus

                                                                       
Query: 374 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcctcccgcc 433
           |||||| || |||||||||||||||||||| ||||| || ||||||||||||||||||||
Sbjct: 596 gtggccaccagggagcttctccttgatcttatccttgatacccttcttcctcctcccgcc 537

                          
Query: 434 catgccgtcgtcctc 448
           |||||| ||||||||
Sbjct: 536 catgccatcgtcctc 522



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                
Query: 455 cgagctggagctggagctgccggagcgatgcagtatcccacgggtcttgtgct 507
           |||||||||||| |||||||||||||| ||||| ||||| | || ||||||||
Sbjct: 401 cgagctggagcttgagctgccggagcgctgcaggatcccgccggccttgtgct 349



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 219 agcttctccttgatcttgtccatgatccccttcttc 254
           ||||||||||||||||| ||| |||| |||||||||
Sbjct: 583 agcttctccttgatcttatccttgatacccttcttc 548



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 381 ccggggagcttctccttgatcttctccttcatgcccttctt 421
           ||||| |||||||||||||| || ||| | |||||||||||
Sbjct: 841 ccgggcagcttctccttgattttgtccatgatgcccttctt 801

---

>gb|AY895916.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 293411 dehydrin 7
           (Dhn7) gene, complete cds
          Length = 1343

 Score =  101 bits (51), Expect = 2e-18
 Identities = 63/67 (94%)
 Strand = Plus / Minus

                                                                       
Query: 200 ggctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgcc 259
           ||||||||||||||| ||||||||||||||||| ||||||||||| |||||||| |||||
Sbjct: 827 ggctcagtgctgtccgggcagcttctccttgattttgtccatgatgcccttcttttcgcc 768

                  
Query: 260 ggtgccg 266
           |||||||
Sbjct: 767 ggtgccg 761



 Score =  101 bits (51), Expect = 2e-18
 Identities = 69/75 (92%)
 Strand = Plus / Minus

                                                                       
Query: 374 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcctcccgcc 433
           |||||| || |||||||||||||||||||| ||||| || ||||||||||||||||||||
Sbjct: 569 gtggccaccagggagcttctccttgatcttatccttgatacccttcttcctcctcccgcc 510

                          
Query: 434 catgccgtcgtcctc 448
           |||||| ||||||||
Sbjct: 509 catgccatcgtcctc 495



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                
Query: 455 cgagctggagctggagctgccggagcgatgcagtatcccacgggtcttgtgct 507
           |||||||||||| |||||||||||||| ||||| ||||| | || ||||||||
Sbjct: 376 cgagctggagcttgagctgccggagcgctgcaggatcccgccggccttgtgct 324



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 219 agcttctccttgatcttgtccatgatccccttcttc 254
           ||||||||||||||||| ||| |||| |||||||||
Sbjct: 556 agcttctccttgatcttatccttgatacccttcttc 521



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 381 ccggggagcttctccttgatcttctccttcatgcccttctt 421
           ||||| |||||||||||||| || ||| | |||||||||||
Sbjct: 814 ccgggcagcttctccttgattttgtccatgatgcccttctt 774

---

>gb|AY895915.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 293409 dehydrin 7
           (Dhn7) gene, complete cds
          Length = 1366

 Score =  101 bits (51), Expect = 2e-18
 Identities = 63/67 (94%)
 Strand = Plus / Minus

                                                                       
Query: 200 ggctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgcc 259
           ||||||||||||||| ||||||||||||||||| ||||||||||| |||||||| |||||
Sbjct: 850 ggctcagtgctgtccgggcagcttctccttgattttgtccatgatgcccttcttttcgcc 791

                  
Query: 260 ggtgccg 266
           |||||||
Sbjct: 790 ggtgccg 784



 Score =  101 bits (51), Expect = 2e-18
 Identities = 69/75 (92%)
 Strand = Plus / Minus

                                                                       
Query: 374 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcctcccgcc 433
           |||||| || |||||||||||||||||||| ||||| || ||||||||||||||||||||
Sbjct: 592 gtggccaccagggagcttctccttgatcttatccttgatacccttcttcctcctcccgcc 533

                          
Query: 434 catgccgtcgtcctc 448
           |||||| ||||||||
Sbjct: 532 catgccatcgtcctc 518



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                
Query: 455 cgagctggagctggagctgccggagcgatgcagtatcccacgggtcttgtgct 507
           |||||||||||| |||||||||||||| ||||| ||||| | || ||||||||
Sbjct: 397 cgagctggagcttgagctgccggagcgctgcaggatcccgccggccttgtgct 345



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 219 agcttctccttgatcttgtccatgatccccttcttc 254
           ||||||||||||||||| ||| |||| |||||||||
Sbjct: 579 agcttctccttgatcttatccttgatacccttcttc 544



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 381 ccggggagcttctccttgatcttctccttcatgcccttctt 421
           ||||| |||||||||||||| || ||| | |||||||||||
Sbjct: 837 ccgggcagcttctccttgattttgtccatgatgcccttctt 797

---

>gb|AY895914.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 293402 dehydrin 7
           (Dhn7) gene, complete cds
          Length = 1366

 Score =  101 bits (51), Expect = 2e-18
 Identities = 63/67 (94%)
 Strand = Plus / Minus

                                                                       
Query: 200 ggctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgcc 259
           ||||||||||||||| ||||||||||||||||| ||||||||||| |||||||| |||||
Sbjct: 850 ggctcagtgctgtccgggcagcttctccttgattttgtccatgatgcccttcttttcgcc 791

                  
Query: 260 ggtgccg 266
           |||||||
Sbjct: 790 ggtgccg 784



 Score =  101 bits (51), Expect = 2e-18
 Identities = 69/75 (92%)
 Strand = Plus / Minus

                                                                       
Query: 374 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcctcccgcc 433
           |||||| || |||||||||||||||||||| ||||| || ||||||||||||||||||||
Sbjct: 592 gtggccaccagggagcttctccttgatcttatccttgatacccttcttcctcctcccgcc 533

                          
Query: 434 catgccgtcgtcctc 448
           |||||| ||||||||
Sbjct: 532 catgccatcgtcctc 518



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                
Query: 455 cgagctggagctggagctgccggagcgatgcagtatcccacgggtcttgtgct 507
           |||||||||||| |||||||||||||| ||||| ||||| | || ||||||||
Sbjct: 397 cgagctggagcttgagctgccggagcgctgcaggatcccgccggccttgtgct 345



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 219 agcttctccttgatcttgtccatgatccccttcttc 254
           ||||||||||||||||| ||| |||| |||||||||
Sbjct: 579 agcttctccttgatcttatccttgatacccttcttc 544



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 381 ccggggagcttctccttgatcttctccttcatgcccttctt 421
           ||||| |||||||||||||| || ||| | |||||||||||
Sbjct: 837 ccgggcagcttctccttgattttgtccatgatgcccttctt 797

---

>gb|AY895913.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 268242 dehydrin 7
           (Dhn7) gene, complete cds
          Length = 1344

 Score =  101 bits (51), Expect = 2e-18
 Identities = 63/67 (94%)
 Strand = Plus / Minus

                                                                       
Query: 200 ggctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgcc 259
           ||||||||||||||| ||||||||||||||||| ||||||||||| |||||||| |||||
Sbjct: 828 ggctcagtgctgtccgggcagcttctccttgattttgtccatgatgcccttcttttcgcc 769

                  
Query: 260 ggtgccg 266
           |||||||
Sbjct: 768 ggtgccg 762



 Score =  101 bits (51), Expect = 2e-18
 Identities = 69/75 (92%)
 Strand = Plus / Minus

                                                                       
Query: 374 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcctcccgcc 433
           |||||| || |||||||||||||||||||| ||||| || ||||||||||||||||||||
Sbjct: 570 gtggccaccagggagcttctccttgatcttatccttgatacccttcttcctcctcccgcc 511

                          
Query: 434 catgccgtcgtcctc 448
           |||||| ||||||||
Sbjct: 510 catgccatcgtcctc 496



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                
Query: 455 cgagctggagctggagctgccggagcgatgcagtatcccacgggtcttgtgct 507
           |||||||||||| |||||||||||||| ||||| ||||| | || ||||||||
Sbjct: 376 cgagctggagcttgagctgccggagcgctgcaggatcccgccggccttgtgct 324



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 219 agcttctccttgatcttgtccatgatccccttcttc 254
           ||||||||||||||||| ||| |||| |||||||||
Sbjct: 557 agcttctccttgatcttatccttgatacccttcttc 522



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 381 ccggggagcttctccttgatcttctccttcatgcccttctt 421
           ||||| |||||||||||||| || ||| | |||||||||||
Sbjct: 815 ccgggcagcttctccttgattttgtccatgatgcccttctt 775

---

>gb|AY895912.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 268242 dehydrin 7
           (Dhn7) gene, complete cds
          Length = 1343

 Score =  101 bits (51), Expect = 2e-18
 Identities = 63/67 (94%)
 Strand = Plus / Minus

                                                                       
Query: 200 ggctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgcc 259
           ||||||||||||||| ||||||||||||||||| ||||||||||| |||||||| |||||
Sbjct: 827 ggctcagtgctgtccgggcagcttctccttgattttgtccatgatgcccttcttttcgcc 768

                  
Query: 260 ggtgccg 266
           |||||||
Sbjct: 767 ggtgccg 761



 Score =  101 bits (51), Expect = 2e-18
 Identities = 69/75 (92%)
 Strand = Plus / Minus

                                                                       
Query: 374 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcctcccgcc 433
           |||||| || |||||||||||||||||||| ||||| || ||||||||||||||||||||
Sbjct: 569 gtggccaccagggagcttctccttgatcttatccttgatacccttcttcctcctcccgcc 510

                          
Query: 434 catgccgtcgtcctc 448
           |||||| ||||||||
Sbjct: 509 catgccatcgtcctc 495



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 46/53 (86%)
 Strand = Plus / Minus

                                                                
Query: 455 cgagctggagctggagctgccggagcgatgcagtatcccacgggtcttgtgct 507
           |||||||||||| |||||||||| ||| ||||| ||||| | || ||||||||
Sbjct: 376 cgagctggagcttgagctgccggggcgctgcaggatcccgccggccttgtgct 324



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 219 agcttctccttgatcttgtccatgatccccttcttc 254
           ||||||||||||||||| ||| |||| |||||||||
Sbjct: 556 agcttctccttgatcttatccttgatacccttcttc 521



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 381 ccggggagcttctccttgatcttctccttcatgcccttctt 421
           ||||| |||||||||||||| || ||| | |||||||||||
Sbjct: 814 ccgggcagcttctccttgattttgtccatgatgcccttctt 774

---

>gb|AY895911.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 254894 dehydrin 7
           (Dhn7) gene, complete cds
          Length = 1343

 Score =  101 bits (51), Expect = 2e-18
 Identities = 63/67 (94%)
 Strand = Plus / Minus

                                                                       
Query: 200 ggctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgcc 259
           ||||||||||||||| ||||||||||||||||| ||||||||||| |||||||| |||||
Sbjct: 827 ggctcagtgctgtccgggcagcttctccttgattttgtccatgatgcccttcttttcgcc 768

                  
Query: 260 ggtgccg 266
           |||||||
Sbjct: 767 ggtgccg 761



 Score =  101 bits (51), Expect = 2e-18
 Identities = 69/75 (92%)
 Strand = Plus / Minus

                                                                       
Query: 374 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcctcccgcc 433
           |||||| || |||||||||||||||||||| ||||| || ||||||||||||||||||||
Sbjct: 569 gtggccaccagggagcttctccttgatcttatccttgatacccttcttcctcctcccgcc 510

                          
Query: 434 catgccgtcgtcctc 448
           |||||| ||||||||
Sbjct: 509 catgccatcgtcctc 495



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                
Query: 455 cgagctggagctggagctgccggagcgatgcagtatcccacgggtcttgtgct 507
           |||||||||||| |||||||||||||| ||||| ||||| | || ||||||||
Sbjct: 376 cgagctggagcttgagctgccggagcgctgcaggatcccgccggccttgtgct 324



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 219 agcttctccttgatcttgtccatgatccccttcttc 254
           ||||||||||||||||| ||| |||| |||||||||
Sbjct: 556 agcttctccttgatcttatccttgatacccttcttc 521



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 381 ccggggagcttctccttgatcttctccttcatgcccttctt 421
           ||||| |||||||||||||| || ||| | |||||||||||
Sbjct: 814 ccgggcagcttctccttgattttgtccatgatgcccttctt 774

---

>gb|AY895910.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 253933 dehydrin 7
           (Dhn7) gene, complete cds
          Length = 1363

 Score =  101 bits (51), Expect = 2e-18
 Identities = 63/67 (94%)
 Strand = Plus / Minus

                                                                       
Query: 200 ggctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgcc 259
           ||||||||||||||| ||||||||||||||||| ||||||||||| |||||||| |||||
Sbjct: 847 ggctcagtgctgtccgggcagcttctccttgattttgtccatgatgcccttcttttcgcc 788

                  
Query: 260 ggtgccg 266
           |||||||
Sbjct: 787 ggtgccg 781



 Score =  101 bits (51), Expect = 2e-18
 Identities = 69/75 (92%)
 Strand = Plus / Minus

                                                                       
Query: 374 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcctcccgcc 433
           |||||| || |||||||||||||||||||| ||||| || ||||||||||||||||||||
Sbjct: 589 gtggccaccagggagcttctccttgatcttatccttgatacccttcttcctcctcccgcc 530

                          
Query: 434 catgccgtcgtcctc 448
           |||||| ||||||||
Sbjct: 529 catgccatcgtcctc 515



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                
Query: 455 cgagctggagctggagctgccggagcgatgcagtatcccacgggtcttgtgct 507
           |||||||||||| |||||||||||||| ||||| ||||| | || ||||||||
Sbjct: 394 cgagctggagcttgagctgccggagcgctgcaggatcccgccggccttgtgct 342



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 219 agcttctccttgatcttgtccatgatccccttcttc 254
           ||||||||||||||||| ||| |||| |||||||||
Sbjct: 576 agcttctccttgatcttatccttgatacccttcttc 541



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 381 ccggggagcttctccttgatcttctccttcatgcccttctt 421
           ||||| |||||||||||||| || ||| | |||||||||||
Sbjct: 834 ccgggcagcttctccttgattttgtccatgatgcccttctt 794

---

>gb|AY895909.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 236388 dehydrin 7
           (Dhn7) gene, complete cds
          Length = 1369

 Score =  101 bits (51), Expect = 2e-18
 Identities = 63/67 (94%)
 Strand = Plus / Minus

                                                                       
Query: 200 ggctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgcc 259
           ||||||||||||||| ||||||||||||||||| ||||||||||| |||||||| |||||
Sbjct: 853 ggctcagtgctgtccgggcagcttctccttgattttgtccatgatgcccttcttttcgcc 794

                  
Query: 260 ggtgccg 266
           |||||||
Sbjct: 793 ggtgccg 787



 Score = 93.7 bits (47), Expect = 6e-16
 Identities = 68/75 (90%)
 Strand = Plus / Minus

                                                                       
Query: 374 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcctcccgcc 433
           |||||| || |||||||||||||||||||| ||||| || |||||||||||||| |||||
Sbjct: 595 gtggccaccagggagcttctccttgatcttatccttgatacccttcttcctcctaccgcc 536

                          
Query: 434 catgccgtcgtcctc 448
           |||||| ||||||||
Sbjct: 535 catgccatcgtcctc 521



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                
Query: 455 cgagctggagctggagctgccggagcgatgcagtatcccacgggtcttgtgct 507
           |||||||||||| |||||||||||||| ||||| ||||| | || ||||||||
Sbjct: 401 cgagctggagcttgagctgccggagcgctgcaggatcccgccggccttgtgct 349



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 219 agcttctccttgatcttgtccatgatccccttcttc 254
           ||||||||||||||||| ||| |||| |||||||||
Sbjct: 582 agcttctccttgatcttatccttgatacccttcttc 547



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 381 ccggggagcttctccttgatcttctccttcatgcccttctt 421
           ||||| |||||||||||||| || ||| | |||||||||||
Sbjct: 840 ccgggcagcttctccttgattttgtccatgatgcccttctt 800

---

>gb|AY895908.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 220523 dehydrin 7
           (Dhn7) gene, complete cds
          Length = 1337

 Score =  101 bits (51), Expect = 2e-18
 Identities = 63/67 (94%)
 Strand = Plus / Minus

                                                                       
Query: 200 ggctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgcc 259
           ||||||||||||||| ||||||||||||||||| ||||||||||| |||||||| |||||
Sbjct: 823 ggctcagtgctgtccgggcagcttctccttgattttgtccatgatgcccttcttttcgcc 764

                  
Query: 260 ggtgccg 266
           |||||||
Sbjct: 763 ggtgccg 757



 Score =  101 bits (51), Expect = 2e-18
 Identities = 69/75 (92%)
 Strand = Plus / Minus

                                                                       
Query: 374 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcctcccgcc 433
           |||||| || |||||||||||||||||||| ||||| || ||||||||||||||||||||
Sbjct: 565 gtggccaccagggagcttctccttgatcttatccttgatacccttcttcctcctcccgcc 506

                          
Query: 434 catgccgtcgtcctc 448
           |||||| ||||||||
Sbjct: 505 catgccatcgtcctc 491



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                
Query: 455 cgagctggagctggagctgccggagcgatgcagtatcccacgggtcttgtgct 507
           |||||||||||| |||||||||||||| ||||| ||||| | || ||||||||
Sbjct: 371 cgagctggagcttgagctgccggagcgctgcaggatcccgccggccttgtgct 319



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 219 agcttctccttgatcttgtccatgatccccttcttc 254
           ||||||||||||||||| ||| |||| |||||||||
Sbjct: 552 agcttctccttgatcttatccttgatacccttcttc 517



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 381 ccggggagcttctccttgatcttctccttcatgcccttctt 421
           ||||| |||||||||||||| || ||| | |||||||||||
Sbjct: 810 ccgggcagcttctccttgattttgtccatgatgcccttctt 770

---

>gb|AY895907.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 219796 dehydrin 7
           (Dhn7) gene, complete cds
          Length = 1343

 Score =  101 bits (51), Expect = 2e-18
 Identities = 63/67 (94%)
 Strand = Plus / Minus

                                                                       
Query: 200 ggctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgcc 259
           ||||||||||||||| ||||||||||||||||| ||||||||||| |||||||| |||||
Sbjct: 827 ggctcagtgctgtccgggcagcttctccttgattttgtccatgatgcccttcttttcgcc 768

                  
Query: 260 ggtgccg 266
           |||||||
Sbjct: 767 ggtgccg 761



 Score =  101 bits (51), Expect = 2e-18
 Identities = 69/75 (92%)
 Strand = Plus / Minus

                                                                       
Query: 374 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcctcccgcc 433
           |||||| || |||||||||||||||||||| ||||| || ||||||||||||||||||||
Sbjct: 569 gtggccaccagggagcttctccttgatcttatccttgatacccttcttcctcctcccgcc 510

                          
Query: 434 catgccgtcgtcctc 448
           |||||| ||||||||
Sbjct: 509 catgccatcgtcctc 495



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                
Query: 455 cgagctggagctggagctgccggagcgatgcagtatcccacgggtcttgtgct 507
           |||||||||||| |||||||||||||| ||||| ||||| | || ||||||||
Sbjct: 376 cgagctggagcttgagctgccggagcgctgcaggatcccgccggccttgtgct 324



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 219 agcttctccttgatcttgtccatgatccccttcttc 254
           ||||||||||||||||| ||| |||| |||||||||
Sbjct: 556 agcttctccttgatcttatccttgatacccttcttc 521



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 381 ccggggagcttctccttgatcttctccttcatgcccttctt 421
           ||||| |||||||||||||| || ||| | |||||||||||
Sbjct: 814 ccgggcagcttctccttgattttgtccatgatgcccttctt 774

---

>gb|AY895906.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 212306 dehydrin 7
           (Dhn7) gene, complete cds
          Length = 1342

 Score =  101 bits (51), Expect = 2e-18
 Identities = 63/67 (94%)
 Strand = Plus / Minus

                                                                       
Query: 200 ggctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgcc 259
           ||||||||||||||| ||||||||||||||||| ||||||||||| |||||||| |||||
Sbjct: 827 ggctcagtgctgtccgggcagcttctccttgattttgtccatgatgcccttcttttcgcc 768

                  
Query: 260 ggtgccg 266
           |||||||
Sbjct: 767 ggtgccg 761



 Score =  101 bits (51), Expect = 2e-18
 Identities = 69/75 (92%)
 Strand = Plus / Minus

                                                                       
Query: 374 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcctcccgcc 433
           |||||| || |||||||||||||||||||| ||||| || ||||||||||||||||||||
Sbjct: 569 gtggccaccagggagcttctccttgatcttatccttgatacccttcttcctcctcccgcc 510

                          
Query: 434 catgccgtcgtcctc 448
           |||||| ||||||||
Sbjct: 509 catgccatcgtcctc 495



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                
Query: 455 cgagctggagctggagctgccggagcgatgcagtatcccacgggtcttgtgct 507
           |||||||||||| |||||||||||||| ||||| ||||| | || ||||||||
Sbjct: 376 cgagctggagcttgagctgccggagcgctgcaggatcccgccggccttgtgct 324



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 219 agcttctccttgatcttgtccatgatccccttcttc 254
           ||||||||||||||||| ||| |||| |||||||||
Sbjct: 556 agcttctccttgatcttatccttgatacccttcttc 521



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 381 ccggggagcttctccttgatcttctccttcatgcccttctt 421
           ||||| |||||||||||||| || ||| | |||||||||||
Sbjct: 814 ccgggcagcttctccttgattttgtccatgatgcccttctt 774

---

>gb|AY895905.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 212305 dehydrin 7
           (Dhn7) gene, complete cds
          Length = 1363

 Score =  101 bits (51), Expect = 2e-18
 Identities = 63/67 (94%)
 Strand = Plus / Minus

                                                                       
Query: 200 ggctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgcc 259
           ||||||||||||||| ||||||||||||||||| ||||||||||| |||||||| |||||
Sbjct: 847 ggctcagtgctgtccgggcagcttctccttgattttgtccatgatgcccttcttttcgcc 788

                  
Query: 260 ggtgccg 266
           |||||||
Sbjct: 787 ggtgccg 781



 Score =  101 bits (51), Expect = 2e-18
 Identities = 69/75 (92%)
 Strand = Plus / Minus

                                                                       
Query: 374 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcctcccgcc 433
           |||||| || |||||||||||||||||||| ||||| || ||||||||||||||||||||
Sbjct: 589 gtggccaccagggagcttctccttgatcttatccttgatacccttcttcctcctcccgcc 530

                          
Query: 434 catgccgtcgtcctc 448
           |||||| ||||||||
Sbjct: 529 catgccatcgtcctc 515



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                
Query: 455 cgagctggagctggagctgccggagcgatgcagtatcccacgggtcttgtgct 507
           |||||||||||| |||||||||||||| ||||| ||||| | || ||||||||
Sbjct: 394 cgagctggagcttgagctgccggagcgctgcaggatcccgccggccttgtgct 342



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 219 agcttctccttgatcttgtccatgatccccttcttc 254
           ||||||||||||||||| ||| |||| |||||||||
Sbjct: 576 agcttctccttgatcttatccttgatacccttcttc 541



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 381 ccggggagcttctccttgatcttctccttcatgcccttctt 421
           ||||| |||||||||||||| || ||| | |||||||||||
Sbjct: 834 ccgggcagcttctccttgattttgtccatgatgcccttctt 794

---

>gb|AF043092.1|AF043092 Hordeum vulgare dehydrin 7 (dhn7) gene, complete cds
          Length = 2127

 Score =  101 bits (51), Expect = 2e-18
 Identities = 63/67 (94%)
 Strand = Plus / Minus

                                                                        
Query: 200  ggctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgcc 259
            ||||||||||||||| ||||||||||||||||| ||||||||||| |||||||| |||||
Sbjct: 1183 ggctcagtgctgtccgggcagcttctccttgattttgtccatgatgcccttcttttcgcc 1124

                   
Query: 260  ggtgccg 266
            |||||||
Sbjct: 1123 ggtgccg 1117



 Score =  101 bits (51), Expect = 2e-18
 Identities = 69/75 (92%)
 Strand = Plus / Minus

                                                                       
Query: 374 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcctcccgcc 433
           |||||| || |||||||||||||||||||| ||||| || ||||||||||||||||||||
Sbjct: 925 gtggccaccagggagcttctccttgatcttatccttgatacccttcttcctcctcccgcc 866

                          
Query: 434 catgccgtcgtcctc 448
           |||||| ||||||||
Sbjct: 865 catgccatcgtcctc 851



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 455 cgagctggagctggagctgccggagcgatgcagtatccc 493
           |||||||||||| |||||||||||||| ||||| |||||
Sbjct: 734 cgagctggagcttgagctgccggagcgctgcaggatccc 696



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 219 agcttctccttgatcttgtccatgatccccttcttc 254
           ||||||||||||||||| ||| |||| |||||||||
Sbjct: 912 agcttctccttgatcttatccttgatacccttcttc 877



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                     
Query: 381  ccggggagcttctccttgatcttctccttcatgcccttctt 421
            ||||| |||||||||||||| || ||| | |||||||||||
Sbjct: 1170 ccgggcagcttctccttgattttgtccatgatgcccttctt 1130

---

>gb|AF181460.1|AF181460 Hordeum vulgare dehydrin (Dhn10) gene, complete cds
          Length = 2501

 Score = 93.7 bits (47), Expect = 6e-16
 Identities = 65/71 (91%)
 Strand = Plus / Minus

                                                                        
Query: 381  ccggggagcttctccttgatcttctccttcatgcccttcttcctcctcccgcccatgccg 440
            ||||| ||||||||||||||||||||||| ||||||||||||||||  || |||||||| 
Sbjct: 1267 ccgggaagcttctccttgatcttctccttgatgcccttcttcctccgtccacccatgcca 1208

                       
Query: 441  tcgtcctcgga 451
            |||||||||||
Sbjct: 1207 tcgtcctcgga 1197



 Score = 89.7 bits (45), Expect = 9e-15
 Identities = 75/85 (88%)
 Strand = Plus / Minus

                                                                        
Query: 205  agtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccggtgc 264
            ||||||| || |||||||| ||||||||||||||||| || ||||||||||||||||| |
Sbjct: 1896 agtgctggccaggcagcttttccttgatcttgtccataatacccttcttctcgccggtac 1837

                                     
Query: 265  cggccattcctgcgtgcccttgctg 289
            ||||||  || ||||| ||||||||
Sbjct: 1836 cggccagcccggcgtgaccttgctg 1812



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                             
Query: 390  ttctccttgatcttctccttcatgcccttcttc 422
            |||||| ||||||| ||||||||||||||||||
Sbjct: 1561 ttctccatgatcttgtccttcatgcccttcttc 1529



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                                
Query: 219  agcttctccttgatcttgtccatgatccccttcttc 254
            ||||||||||||||||| ||| |||| |||||||||
Sbjct: 1261 agcttctccttgatcttctccttgatgcccttcttc 1226



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 57/66 (86%), Gaps = 4/66 (6%)
 Strand = Plus / Minus

                                                                        
Query: 455  cgagctggagctggagctgccgga---gcgatgcagtatcccacgggtcttgtgcttcct 511
            |||||||||||||||||||| |||   ||| || ||||| || |||||||||||| ||||
Sbjct: 1045 cgagctggagctggagctgctggaccggcggtggagtatgccgcgggtcttgtgc-tcct 987

                  
Query: 512  ccctgc 517
            ||||||
Sbjct: 986  ccctgc 981



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 39/45 (86%)
 Strand = Plus / Minus

                                                         
Query: 212  tcccggcagcttctccttgatcttgtccatgatccccttcttctc 256
            |||||| || |||||| ||||||||||| | || |||||||||||
Sbjct: 1571 tcccggaagtttctccatgatcttgtccttcatgcccttcttctc 1527

---

>gb|AY895902.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 531957 dehydrin
           4-like (Dhn4) gene, partial sequence
          Length = 422

 Score = 93.7 bits (47), Expect = 6e-16
 Identities = 59/63 (93%)
 Strand = Plus / Minus

                                                                       
Query: 201 gctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccg 260
           ||||||||||| || || |||||||||||||||||||||||||| |||||||||||||||
Sbjct: 359 gctcagtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgccg 300

              
Query: 261 gtg 263
           |||
Sbjct: 299 gtg 297



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 384 gggagcttctccttgatcttctccttcatgcccttcttc 422
           |||||||||||||||||||| ||| | ||||||||||||
Sbjct: 344 gggagcttctccttgatcttgtccatgatgcccttcttc 306



 Score = 40.1 bits (20), Expect = 7.2
 Identities = 35/40 (87%)
 Strand = Plus / Minus

                                                   
Query: 258 ccggtgccggccattcctgcgtgcccttgctgcccgtagg 297
           |||||||||||||| || | ||| |||||||| |||||||
Sbjct: 125 ccggtgccggccatcccagtgtggccttgctgtccgtagg 86

---

>gb|AF043095.1|AF043095 Hordeum vulgare dehydrin 10 (dhn10) gene, complete cds
          Length = 2984

 Score = 93.7 bits (47), Expect = 6e-16
 Identities = 65/71 (91%)
 Strand = Plus / Minus

                                                                        
Query: 381  ccggggagcttctccttgatcttctccttcatgcccttcttcctcctcccgcccatgccg 440
            ||||| ||||||||||||||||||||||| ||||||||||||||||  || |||||||| 
Sbjct: 1665 ccgggaagcttctccttgatcttctccttgatgcccttcttcctccgtccacccatgcca 1606

                       
Query: 441  tcgtcctcgga 451
            |||||||||||
Sbjct: 1605 tcgtcctcgga 1595



 Score = 89.7 bits (45), Expect = 9e-15
 Identities = 75/85 (88%)
 Strand = Plus / Minus

                                                                        
Query: 205  agtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccggtgc 264
            ||||||| || |||||||| ||||||||||||||||| || ||||||||||||||||| |
Sbjct: 2294 agtgctggccaggcagcttttccttgatcttgtccataatacccttcttctcgccggtac 2235

                                     
Query: 265  cggccattcctgcgtgcccttgctg 289
            ||||||  || ||||| ||||||||
Sbjct: 2234 cggccagcccggcgtgaccttgctg 2210



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                             
Query: 390  ttctccttgatcttctccttcatgcccttcttc 422
            |||||| ||||||| ||||||||||||||||||
Sbjct: 1959 ttctccatgatcttgtccttcatgcccttcttc 1927



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                                
Query: 219  agcttctccttgatcttgtccatgatccccttcttc 254
            ||||||||||||||||| ||| |||| |||||||||
Sbjct: 1659 agcttctccttgatcttctccttgatgcccttcttc 1624



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 57/66 (86%), Gaps = 4/66 (6%)
 Strand = Plus / Minus

                                                                        
Query: 455  cgagctggagctggagctgccgga---gcgatgcagtatcccacgggtcttgtgcttcct 511
            |||||||||||||||||||| |||   ||| || ||||| || |||||||||||| ||||
Sbjct: 1443 cgagctggagctggagctgctggaccggcggtggagtatgccgcgggtcttgtgc-tcct 1385

                  
Query: 512  ccctgc 517
            ||||||
Sbjct: 1384 ccctgc 1379



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 39/45 (86%)
 Strand = Plus / Minus

                                                         
Query: 212  tcccggcagcttctccttgatcttgtccatgatccccttcttctc 256
            |||||| || |||||| ||||||||||| | || |||||||||||
Sbjct: 1969 tcccggaagtttctccatgatcttgtccttcatgcccttcttctc 1925

---

>gb|U11696.1|SBU11696 Sorghum bicolor dehydrin (DHN1) mRNA, complete cds
          Length = 748

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 108/128 (84%), Gaps = 3/128 (2%)
 Strand = Plus / Minus

                                                                       
Query: 360 tgctggttgtccttgtggccgccggggagcttctccttgatcttctccttcatgcccttc 419
           |||||||||||||||||| | ||||| ||||||||||||||||| ||    || ||||||
Sbjct: 364 tgctggttgtccttgtgggctccgggcagcttctccttgatcttttctccgattcccttc 305

                                                                       
Query: 420 ttcctcctcccgcccatgccgtcgtcctcggaggacgagctggagctggagctgccggag 479
           |||||||| |||||||| |||||   ||| |||     ||||||||||||||||||||||
Sbjct: 304 ttcctccttccgcccataccgtcagtctcagag---ctgctggagctggagctgccggag 248

                   
Query: 480 cgatgcag 487
           ||||||||
Sbjct: 247 cgatgcag 240



 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 49/52 (94%)
 Strand = Plus / Minus

                                                               
Query: 205 agtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctc 256
           |||||||||| ||||||||||||||||||||||||||||| || ||||||||
Sbjct: 498 agtgctgtccgggcagcttctccttgatcttgtccatgatgcctttcttctc 447



 Score = 44.1 bits (22), Expect = 0.46
 Identities = 37/42 (88%)
 Strand = Plus / Minus

                                                     
Query: 381 ccggggagcttctccttgatcttctccttcatgcccttcttc 422
           ||||| ||||||||||||||||| ||| | ||||| ||||||
Sbjct: 490 ccgggcagcttctccttgatcttgtccatgatgcctttcttc 449



 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 216 ggcagcttctccttgatctt 235
           ||||||||||||||||||||
Sbjct: 340 ggcagcttctccttgatctt 321

---

>gb|AF236067.1|AF236067 Elaeis guineensis clone pKT5 dehydrin-like protein mRNA, complete
           cds
          Length = 775

 Score = 89.7 bits (45), Expect = 9e-15
 Identities = 90/105 (85%)
 Strand = Plus / Minus

                                                                       
Query: 377 gccgccggggagcttctccttgatcttctccttcatgcccttcttcctcctcccgcccat 436
           |||||| || ||||||||||| |||||||||||||  ||||||||||||| |||||||  
Sbjct: 379 gccgcccggaagcttctcctttatcttctccttcagtcccttcttcctccgcccgccctg 320

                                                        
Query: 437 gccgtcgtcctcggaggacgagctggagctggagctgccggagcg 481
            ||||| ||||| || ||   ||||||||||||||||||||||||
Sbjct: 319 cccgtcatcctccgacgagctgctggagctggagctgccggagcg 275



 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 36/38 (94%)
 Strand = Plus / Minus

                                                 
Query: 219 agcttctccttgatcttgtccatgatccccttcttctc 256
           ||||||||||||||||| ||||| ||||||||||||||
Sbjct: 462 agcttctccttgatcttttccatcatccccttcttctc 425



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 387 agcttctccttgatcttctccttcatgcccttcttc 422
           ||||||||||||||||| ||| |||| |||||||||
Sbjct: 462 agcttctccttgatcttttccatcatccccttcttc 427

---

>gb|AF031247.1|AF031247 Lophopyrum elongatum dehydrin-/LEA group 2-like protein (ESI18-2)
            mRNA, complete cds
          Length = 1518

 Score = 83.8 bits (42), Expect = 5e-13
 Identities = 57/62 (91%)
 Strand = Plus / Minus

                                                                        
Query: 205  agtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccggtgc 264
            |||||||||| |||||||| |||||||||||||||||||  | |||||||||||||||||
Sbjct: 1293 agtgctgtccaggcagcttgtccttgatcttgtccatgaggctcttcttctcgccggtgc 1234

              
Query: 265  cg 266
            ||
Sbjct: 1233 cg 1232



 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 47/49 (95%)
 Strand = Plus / Minus

                                                            
Query: 374 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttc 422
           |||||||||||||||||||||||||||||||||| | ||||||||||||
Sbjct: 131 gtggccgccggggagcttctccttgatcttctccatgatgcccttcttc 83



 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 45/48 (93%)
 Strand = Plus / Minus

                                                           
Query: 219 agcttctccttgatcttgtccatgatccccttcttctcgccggtgccg 266
           ||||||||||||||||| |||||||| |||||||||||||||| ||||
Sbjct: 118 agcttctccttgatcttctccatgatgcccttcttctcgccggcgccg 71



 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 44/48 (91%)
 Strand = Plus / Minus

                                                            
Query: 219  agcttctccttgatcttgtccatgatccccttcttctcgccggtgccg 266
            |||||||||||||| || |||||||  |||||||||||||||||||||
Sbjct: 1069 agcttctccttgatgttttccatgacgcccttcttctcgccggtgccg 1022



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 55/64 (85%)
 Strand = Plus / Minus

                                                                        
Query: 359  ctgctggttgtccttgtggccgccggggagcttctccttgatcttctccttcatgccctt 418
            |||||||| |||  ||||||| |||||||||||||||||||| || ||| | | ||||||
Sbjct: 1097 ctgctggtggtcactgtggccaccggggagcttctccttgatgttttccatgacgccctt 1038

                
Query: 419  cttc 422
            ||||
Sbjct: 1037 cttc 1034



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                           
Query: 219 agcttctccttgatcttgtccatgatccccttcttctcgccggtgccg 266
           |||||||||||||| || |||||||  |||||||||||||| ||||||
Sbjct: 685 agcttctccttgatgttctccatgacacccttcttctcgcctgtgccg 638



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                             
Query: 219 agcttctccttgatcttgtccatgatccccttcttctcgccggtgccggc 268
           ||||| |||||||| || |||||||  |||||||||||||||||| ||||
Sbjct: 487 agcttgtccttgatgttctccatgacgcccttcttctcgccggtgtcggc 438



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                            
Query: 375 tggccgccggggagcttctccttgatcttctcc 407
           ||||| |||||||||||||||||||| ||||||
Sbjct: 697 tggccaccggggagcttctccttgatgttctcc 665



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 42/48 (87%)
 Strand = Plus / Minus

                                                           
Query: 219 agcttctccttgatcttgtccatgatccccttcttctcgccggtgccg 266
           ||||| |||||||| || |||||||  || ||||||||||||||||||
Sbjct: 877 agcttgtccttgatgttctccatgacgcctttcttctcgccggtgccg 830



 Score = 44.1 bits (22), Expect = 0.46
 Identities = 31/34 (91%)
 Strand = Plus / Minus

                                             
Query: 374 gtggccgccggggagcttctccttgatcttctcc 407
           |||||| ||||||||||| |||||||| ||||||
Sbjct: 890 gtggccaccggggagcttgtccttgatgttctcc 857



 Score = 44.1 bits (22), Expect = 0.46
 Identities = 31/34 (91%)
 Strand = Plus / Minus

                                             
Query: 374 gtggccgccggggagcttctccttgatcttctcc 407
           |||||| ||||||||||| |||||||| ||||||
Sbjct: 302 gtggccaccggggagcttgtccttgatgttctcc 269

---

>ref|NM_192219.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 687

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 93/107 (86%), Gaps = 5/107 (4%)
 Strand = Plus / Minus

                                                                       
Query: 371 cttgtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcctccc 430
           |||||||| |||||| ||||||||||| ||||||||||| |||| ||||||| |||| ||
Sbjct: 543 cttgtggctgccgggaagcttctcctttatcttctccttgatgctcttcttcttcct-cc 485

                                                          
Query: 431 gccca---tg-ccgtcgtcctcggaggacgagctggagctggagctg 473
           |||||   || ||||| ||||| || |||||||||||||||||||||
Sbjct: 484 gcccaccttgcccgtcatcctccgacgacgagctggagctggagctg 438



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 40/43 (93%)
 Strand = Plus / Minus

                                                      
Query: 380 gccggggagcttctccttgatcttctccttcatgcccttcttc 422
           ||||||||||||||||||||||||||||   ||||||||||||
Sbjct: 672 gccggggagcttctccttgatcttctccacgatgcccttcttc 630



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 219 agcttctccttgatcttgtccatgatccccttcttctcg 257
           ||||||||||||||||| |||| ||| ||||||||||||
Sbjct: 665 agcttctccttgatcttctccacgatgcccttcttctcg 627

---

>gb|AY243045.1| Boea crassifolia dehydrin-like protein Dh2 mRNA, complete cds
          Length = 697

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 86/101 (85%)
 Strand = Plus / Minus

                                                                       
Query: 361 gctggttgtccttgtggccgccggggagcttctccttgatcttctccttcatgcccttct 420
           |||||||||| |||||||||||||| ||||||||||||| ||| ||||| || |||||||
Sbjct: 373 gctggttgtctttgtggccgccgggtagcttctccttgaccttgtccttgatccccttct 314

                                                    
Query: 421 tcctcctcccgcccatgccgtcgtcctcggaggacgagctg 461
           | ||||| || ||    ||||||||||| || |||||||||
Sbjct: 313 ttctcctaccaccttgcccgtcgtcctcagaagacgagctg 273



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 38/41 (92%)
 Strand = Plus / Minus

                                                    
Query: 216 ggcagcttctccttgatcttgtccatgatccccttcttctc 256
           ||||| ||||||||||| |||||||| ||||||||||||||
Sbjct: 464 ggcagtttctccttgattttgtccatcatccccttcttctc 424



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                              
Query: 219 agcttctccttgatcttgtccatgatccccttctt 253
           ||||||||||||| ||||||| |||||||||||||
Sbjct: 347 agcttctccttgaccttgtccttgatccccttctt 313



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 42/49 (85%)
 Strand = Plus / Minus

                                                            
Query: 374 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttc 422
           ||||||||| || || ||||||||||| || ||| |||| |||||||||
Sbjct: 474 gtggccgccaggcagtttctccttgattttgtccatcatccccttcttc 426

---

>gb|AY333185.1| Oryza sativa (japonica cultivar-group) drought-resistant protein
           mRNA, complete cds
          Length = 1021

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 93/107 (86%), Gaps = 5/107 (4%)
 Strand = Plus / Minus

                                                                       
Query: 371 cttgtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcctccc 430
           |||||||| |||||| ||||||||||| ||||||||||| |||| ||||||| |||| ||
Sbjct: 632 cttgtggctgccgggaagcttctcctttatcttctccttgatgctcttcttcttcct-cc 574

                                                          
Query: 431 gccca---tg-ccgtcgtcctcggaggacgagctggagctggagctg 473
           |||||   || ||||| ||||| || |||||||||||||||||||||
Sbjct: 573 gcccaccttgcccgtcatcctccgacgacgagctggagctggagctg 527



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 40/43 (93%)
 Strand = Plus / Minus

                                                      
Query: 380 gccggggagcttctccttgatcttctccttcatgcccttcttc 422
           ||||||||||||||||||||||||||||   ||||||||||||
Sbjct: 761 gccggggagcttctccttgatcttctccacgatgcccttcttc 719



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 219 agcttctccttgatcttgtccatgatccccttcttctcg 257
           ||||||||||||||||| |||| ||| ||||||||||||
Sbjct: 754 agcttctccttgatcttctccacgatgcccttcttctcg 716

---

>gb|M93342.2|WHTCOAC Triticum aestivum cold acclimation protein WCS120 (WCS120) mRNA,
            complete cds
          Length = 1504

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 56/61 (91%)
 Strand = Plus / Minus

                                                                        
Query: 200  ggctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgcc 259
            ||||||||||||||| |||||||| |||||||||||||||||||  | ||||||||||||
Sbjct: 1201 ggctcagtgctgtccaggcagcttatccttgatcttgtccatgaggctcttcttctcgcc 1142

             
Query: 260  g 260
            |
Sbjct: 1141 g 1141



 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 47/49 (95%)
 Strand = Plus / Minus

                                                            
Query: 374 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttc 422
           |||||||||||||||||||||||||||||||||| | ||||||||||||
Sbjct: 100 gtggccgccggggagcttctccttgatcttctccatgatgcccttcttc 52



 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 41/43 (95%)
 Strand = Plus / Minus

                                                      
Query: 219 agcttctccttgatcttgtccatgatccccttcttctcgccgg 261
           ||||||||||||||||| |||||||| ||||||||||||||||
Sbjct: 87  agcttctccttgatcttctccatgatgcccttcttctcgccgg 45



 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 44/48 (91%)
 Strand = Plus / Minus

                                                           
Query: 219 agcttctccttgatcttgtccatgatccccttcttctcgccggtgccg 266
           |||||||||||||| || |||||||  |||||||||||||||||||||
Sbjct: 528 agcttctccttgatgttctccatgacgcccttcttctcgccggtgccg 481



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                            
Query: 374 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttc 422
           |||||| || ||||||||||||||||| |||||| | | ||||||||||
Sbjct: 541 gtggccaccagggagcttctccttgatgttctccatgacgcccttcttc 493



 Score = 46.1 bits (23), Expect = 0.12
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 219 agcttctccttgatcttgtccatgatccccttcttctcgccgg 261
           ||||| |||||||| || |||||||  ||||||||||||||||
Sbjct: 276 agcttgtccttgatgttctccatgacgcccttcttctcgccgg 234



 Score = 44.1 bits (22), Expect = 0.46
 Identities = 40/46 (86%)
 Strand = Plus / Minus

                                                         
Query: 219 agcttctccttgatcttgtccatgatccccttcttctcgccggtgc 264
           ||||| |||||||| || |||||||  |||||||||||||| ||||
Sbjct: 912 agcttttccttgatgttctccatgacgcccttcttctcgccagtgc 867



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                
Query: 271 ttcctgcgtgcccttgctgcccgtaggctccaccagt 307
           |||| ||||| || |||||||||||||| ||||||||
Sbjct: 203 ttccagcgtgaccctgctgcccgtaggcaccaccagt 167



 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 285 tgctgcccgtaggctccacc 304
           ||||||||||||||||||||
Sbjct: 963 tgctgcccgtaggctccacc 944



 Score = 40.1 bits (20), Expect = 7.2
 Identities = 41/48 (85%)
 Strand = Plus / Minus

                                                           
Query: 219 agcttctccttgatcttgtccatgatccccttcttctcgccggtgccg 266
           ||||| |||||||| || |||||||  || ||||||||||| ||||||
Sbjct: 720 agcttgtccttgatgttctccatgacgcctttcttctcgccagtgccg 673

---

>emb|X57327.1|OSRAB25 Rice rab25 mRNA
          Length = 920

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 93/107 (86%), Gaps = 5/107 (4%)
 Strand = Plus / Minus

                                                                       
Query: 371 cttgtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcctccc 430
           |||||||| |||||| ||||||||||| ||||||||||| |||| ||||||| |||| ||
Sbjct: 603 cttgtggctgccgggaagcttctcctttatcttctccttgatgctcttcttcttcct-cc 545

                                                          
Query: 431 gccca---tg-ccgtcgtcctcggaggacgagctggagctggagctg 473
           |||||   || ||||| ||||| || |||||||||||||||||||||
Sbjct: 544 gcccaccttgcccgtcatcctccgacgacgagctggagctggagctg 498



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 40/43 (93%)
 Strand = Plus / Minus

                                                      
Query: 380 gccggggagcttctccttgatcttctccttcatgcccttcttc 422
           ||||||||||||||||||||||||||||   ||||||||||||
Sbjct: 732 gccggggagcttctccttgatcttctccacgatgcccttcttc 690



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 219 agcttctccttgatcttgtccatgatccccttcttctcg 257
           ||||||||||||||||| |||| ||| ||||||||||||
Sbjct: 725 agcttctccttgatcttctccacgatgcccttcttctcg 687

---

>gb|AF181455.1|AF181455 Hordeum vulgare dehydrin (Dhn5) gene, complete cds
          Length = 3447

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 47/49 (95%)
 Strand = Plus / Minus

                                                            
Query: 374 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttc 422
           |||||||||||||||||||||||||||||||||| | ||||||||||||
Sbjct: 676 gtggccgccggggagcttctccttgatcttctccatgatgcccttcttc 628



 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 56/62 (90%)
 Strand = Plus / Minus

                                                                        
Query: 205  agtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccggtgc 264
            |||||||||| |||||||| |||||||||||||||||||  | |||||||||||| ||||
Sbjct: 2324 agtgctgtccaggcagcttgtccttgatcttgtccatgaggctcttcttctcgcccgtgc 2265

              
Query: 265  cg 266
            ||
Sbjct: 2264 cg 2263



 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 41/43 (95%)
 Strand = Plus / Minus

                                                      
Query: 219 agcttctccttgatcttgtccatgatccccttcttctcgccgg 261
           ||||||||||||||||| |||||||| ||||||||||||||||
Sbjct: 663 agcttctccttgatcttctccatgatgcccttcttctcgccgg 621



 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 44/48 (91%)
 Strand = Plus / Minus

                                                            
Query: 219  agcttctccttgatcttgtccatgatccccttcttctcgccggtgccg 266
            |||||||||||||| || |||||||  |||||||||||||||||||||
Sbjct: 2100 agcttctccttgatgttctccatgacacccttcttctcgccggtgccg 2053



 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 44/48 (91%)
 Strand = Plus / Minus

                                                            
Query: 219  agcttctccttgatcttgtccatgatccccttcttctcgccggtgccg 266
            |||||||||||||| || |||||||| |||||||||||||| ||||||
Sbjct: 1515 agcttctccttgatgttctccatgatgcccttcttctcgccagtgccg 1468



 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 42/46 (91%)
 Strand = Plus / Minus

                                                          
Query: 219  agcttctccttgatcttgtccatgatccccttcttctcgccggtgc 264
            |||||||||||||| || |||||||  |||||||||||||||||||
Sbjct: 1908 agcttctccttgatgttttccatgacgcccttcttctcgccggtgc 1863



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 44/49 (89%)
 Strand = Plus / Minus

                                                             
Query: 374  gtggccgccggggagcttctccttgatcttctccttcatgcccttcttc 422
            |||||| || ||||||||||||||||| |||||| | ||||||||||||
Sbjct: 1528 gtggccaccagggagcttctccttgatgttctccatgatgcccttcttc 1480



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                            
Query: 360  tgctggttgtccttgtggccgccggggagcttctccttgatcttctcc 407
            ||||||| |||  ||||||| |||||||||||||||||||| ||||||
Sbjct: 2127 tgctggtggtcactgtggccaccggggagcttctccttgatgttctcc 2080



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 39/43 (90%)
 Strand = Plus / Minus

                                                      
Query: 219 agcttctccttgatcttgtccatgatccccttcttctcgccgg 261
           ||||| ||||||||||| |||||||  ||||||||||||||||
Sbjct: 861 agcttgtccttgatcttctccatgaggcccttcttctcgccgg 819



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                             
Query: 374  gtggccgccggggagcttctccttgatcttctccttcatgcccttcttc 422
            |||||| |||||||||||||||||||| || ||| | | ||||||||||
Sbjct: 1921 gtggccaccggggagcttctccttgatgttttccatgacgcccttcttc 1873



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                            
Query: 374 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttc 422
           |||||| || |||||||| ||||||||||||||| | | ||||||||||
Sbjct: 874 gtggccaccagggagcttgtccttgatcttctccatgaggcccttcttc 826



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 42/48 (87%)
 Strand = Plus / Minus

                                                            
Query: 219  agcttctccttgatcttgtccatgatccccttcttctcgccggtgccg 266
            ||||| |||||||| || ||||| |  |||||||||||||||||||||
Sbjct: 1323 agcttatccttgatgttctccattacacccttcttctcgccggtgccg 1276



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                        
Query: 219  agcttctccttgatcttgtccatgatccccttcttctcgccggt 262
            ||||| |||||||| || |||||||  |||||||||||||||||
Sbjct: 1122 agcttgtccttgatgttctccatgacgcccttcttctcgccggt 1079



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 246  cccttcttctcgccggtgccg 266
            |||||||||||||||||||||
Sbjct: 1689 cccttcttctcgccggtgccg 1669

---

>dbj|AK063691.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-119-F09, full
           insert sequence
          Length = 761

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 93/107 (86%), Gaps = 5/107 (4%)
 Strand = Plus / Minus

                                                                       
Query: 371 cttgtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcctccc 430
           |||||||| |||||| ||||||||||| ||||||||||| |||| ||||||| |||| ||
Sbjct: 424 cttgtggctgccgggaagcttctcctttatcttctccttgatgctcttcttcttcct-cc 366

                                                          
Query: 431 gccca---tg-ccgtcgtcctcggaggacgagctggagctggagctg 473
           |||||   || ||||| ||||| || |||||||||||||||||||||
Sbjct: 365 gcccaccttgcccgtcatcctccgacgacgagctggagctggagctg 319



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 40/43 (93%)
 Strand = Plus / Minus

                                                      
Query: 380 gccggggagcttctccttgatcttctccttcatgcccttcttc 422
           ||||||||||||||||||||||||||||   ||||||||||||
Sbjct: 553 gccggggagcttctccttgatcttctccacgatgcccttcttc 511



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 219 agcttctccttgatcttgtccatgatccccttcttctcg 257
           ||||||||||||||||| |||| ||| ||||||||||||
Sbjct: 546 agcttctccttgatcttctccacgatgcccttcttctcg 508

---

>gb|AF058794.1|AF058794 Triticum aestivum COR39 (cor39) mRNA, complete cds
          Length = 1243

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 47/49 (95%)
 Strand = Plus / Minus

                                                            
Query: 374 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttc 422
           |||||||||||||||||||||||||||||||||| | ||||||||||||
Sbjct: 128 gtggccgccggggagcttctccttgatcttctccatgatgcccttcttc 80



 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 55/60 (91%)
 Strand = Plus / Minus

                                                                        
Query: 200  ggctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgcc 259
            ||||||||||||||| |||||||| |||||||||||||||||||  | ||||||||||||
Sbjct: 1229 ggctcagtgctgtccaggcagcttgtccttgatcttgtccatgaggctcttcttctcgcc 1170



 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 41/43 (95%)
 Strand = Plus / Minus

                                                      
Query: 219 agcttctccttgatcttgtccatgatccccttcttctcgccgg 261
           ||||||||||||||||| |||||||| ||||||||||||||||
Sbjct: 115 agcttctccttgatcttctccatgatgcccttcttctcgccgg 73



 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 44/48 (91%)
 Strand = Plus / Minus

                                                           
Query: 219 agcttctccttgatcttgtccatgatccccttcttctcgccggtgccg 266
           |||||||||||||| || |||||||  |||||||||||||||||||||
Sbjct: 940 agcttctccttgatgttctccatgacgcccttcttctcgccggtgccg 893



 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 44/48 (91%)
 Strand = Plus / Minus

                                                           
Query: 219 agcttctccttgatcttgtccatgatccccttcttctcgccggtgccg 266
           |||||||||||||| || |||||||  |||||||||||||||||||||
Sbjct: 556 agcttctccttgatgttctccatgaggcccttcttctcgccggtgccg 509



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 44/49 (89%)
 Strand = Plus / Minus

                                                            
Query: 374 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttc 422
           |||||| |||||||||||||||||||| |||||| | | ||||||||||
Sbjct: 953 gtggccaccggggagcttctccttgatgttctccatgacgcccttcttc 905



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                           
Query: 219 agcttctccttgatcttgtccatgatccccttcttctcgccggtgccg 266
           ||||| |||||||| || |||||||  |||||||||||||||||||||
Sbjct: 748 agcttgtccttgatgttctccatgacgcccttcttctcgccggtgccg 701



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 42/48 (87%)
 Strand = Plus / Minus

                                                           
Query: 375 tggccgccggggagcttctccttgatcttctccttcatgcccttcttc 422
           ||||| || ||||||||||||||||| |||||| | | ||||||||||
Sbjct: 568 tggccaccagggagcttctccttgatgttctccatgaggcccttcttc 521



 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 285 tgctgcccgtaggctccacc 304
           ||||||||||||||||||||
Sbjct: 991 tgctgcccgtaggctccacc 972

---

>gb|U73212.1|TAU73212 Triticum aestivum cold acclimation protein WCOR80 (Wcor80) mRNA,
           complete cds
          Length = 465

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 62/69 (89%)
 Strand = Plus / Minus

                                                                       
Query: 200 ggctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgcc 259
           |||| |||||||||| |||||||||||||||| |||||||||||  | ||||||||||||
Sbjct: 332 ggcttagtgctgtccaggcagcttctccttgaccttgtccatgaggctcttcttctcgcc 273

                    
Query: 260 ggtgccggc 268
           ||| |||||
Sbjct: 272 ggtcccggc 264



 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 44/48 (91%)
 Strand = Plus / Minus

                                                           
Query: 219 agcttctccttgatcttgtccatgatccccttcttctcgccggtgccg 266
           |||||||||||||| || |||||||| || ||||||||||||||||||
Sbjct: 112 agcttctccttgatgttctccatgatgcctttcttctcgccggtgccg 65



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 44/49 (89%)
 Strand = Plus / Minus

                                                            
Query: 374 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttc 422
           |||||| |||||||||||||||||||| |||||| | ||||| ||||||
Sbjct: 125 gtggccaccggggagcttctccttgatgttctccatgatgcctttcttc 77

---

>gb|M95810.1|BLYDHN5 Hordeum vulgare dehydrin DHN5 (Dhn5) gene, complete cds
          Length = 2432

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 47/49 (95%)
 Strand = Plus / Minus

                                                            
Query: 374 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttc 422
           |||||||||||||||||||||||||||||||||| | ||||||||||||
Sbjct: 669 gtggccgccggggagcttctccttgatcttctccatgatgcccttcttc 621



 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 56/62 (90%)
 Strand = Plus / Minus

                                                                        
Query: 205  agtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccggtgc 264
            |||||||||| |||||||| |||||||||||||||||||  | |||||||||||| ||||
Sbjct: 2317 agtgctgtccaggcagcttgtccttgatcttgtccatgaggctcttcttctcgcccgtgc 2258

              
Query: 265  cg 266
            ||
Sbjct: 2257 cg 2256



 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 41/43 (95%)
 Strand = Plus / Minus

                                                      
Query: 219 agcttctccttgatcttgtccatgatccccttcttctcgccgg 261
           ||||||||||||||||| |||||||| ||||||||||||||||
Sbjct: 656 agcttctccttgatcttctccatgatgcccttcttctcgccgg 614



 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 44/48 (91%)
 Strand = Plus / Minus

                                                            
Query: 219  agcttctccttgatcttgtccatgatccccttcttctcgccggtgccg 266
            |||||||||||||| || |||||||  |||||||||||||||||||||
Sbjct: 2093 agcttctccttgatgttctccatgacacccttcttctcgccggtgccg 2046



 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 44/48 (91%)
 Strand = Plus / Minus

                                                            
Query: 219  agcttctccttgatcttgtccatgatccccttcttctcgccggtgccg 266
            |||||||||||||| || |||||||| |||||||||||||| ||||||
Sbjct: 1508 agcttctccttgatgttctccatgatgcccttcttctcgccagtgccg 1461



 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 42/46 (91%)
 Strand = Plus / Minus

                                                          
Query: 219  agcttctccttgatcttgtccatgatccccttcttctcgccggtgc 264
            |||||||||||||| || |||||||  |||||||||||||||||||
Sbjct: 1901 agcttctccttgatgttttccatgacgcccttcttctcgccggtgc 1856



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 44/49 (89%)
 Strand = Plus / Minus

                                                             
Query: 374  gtggccgccggggagcttctccttgatcttctccttcatgcccttcttc 422
            |||||| || ||||||||||||||||| |||||| | ||||||||||||
Sbjct: 1521 gtggccaccagggagcttctccttgatgttctccatgatgcccttcttc 1473



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                            
Query: 360  tgctggttgtccttgtggccgccggggagcttctccttgatcttctcc 407
            ||||||| |||  ||||||| |||||||||||||||||||| ||||||
Sbjct: 2120 tgctggtggtcactgtggccaccggggagcttctccttgatgttctcc 2073



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 39/43 (90%)
 Strand = Plus / Minus

                                                      
Query: 219 agcttctccttgatcttgtccatgatccccttcttctcgccgg 261
           ||||| ||||||||||| |||||||  ||||||||||||||||
Sbjct: 854 agcttgtccttgatcttctccatgaggcccttcttctcgccgg 812



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                             
Query: 374  gtggccgccggggagcttctccttgatcttctccttcatgcccttcttc 422
            |||||| |||||||||||||||||||| || ||| | | ||||||||||
Sbjct: 1914 gtggccaccggggagcttctccttgatgttttccatgacgcccttcttc 1866



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                            
Query: 374 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttc 422
           |||||| || |||||||| ||||||||||||||| | | ||||||||||
Sbjct: 867 gtggccaccagggagcttgtccttgatcttctccatgaggcccttcttc 819



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 42/48 (87%)
 Strand = Plus / Minus

                                                            
Query: 219  agcttctccttgatcttgtccatgatccccttcttctcgccggtgccg 266
            ||||| |||||||| || ||||| |  |||||||||||||||||||||
Sbjct: 1709 agcttttccttgatgttctccattacacccttcttctcgccggtgccg 1662



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 42/48 (87%)
 Strand = Plus / Minus

                                                            
Query: 219  agcttctccttgatcttgtccatgatccccttcttctcgccggtgccg 266
            ||||| |||||||| || ||||| |  |||||||||||||||||||||
Sbjct: 1316 agcttatccttgatgttctccattacacccttcttctcgccggtgccg 1269



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                        
Query: 219  agcttctccttgatcttgtccatgatccccttcttctcgccggt 262
            ||||| |||||||| || |||||||  |||||||||||||||||
Sbjct: 1115 agcttgtccttgatgttctccatgacgcccttcttctcgccggt 1072

---

>gb|L27516.1|WHTWCS66X Triticum aestivum (Wcs66) gene, complete cds
          Length = 1629

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 47/49 (95%)
 Strand = Plus / Minus

                                                            
Query: 374 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttc 422
           |||||||||||||||||||||||||||||||||| | ||||||||||||
Sbjct: 154 gtggccgccggggagcttctccttgatcttctccatgatgcccttcttc 106



 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 55/61 (90%)
 Strand = Plus / Minus

                                                                        
Query: 200  ggctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgcc 259
            ||||||||||||||| || ||||| |||||||||||||||||||  | ||||||||||||
Sbjct: 1489 ggctcagtgctgtccaggtagcttgtccttgatcttgtccatgaggctcttcttctcgcc 1430

             
Query: 260  g 260
            |
Sbjct: 1429 g 1429



 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 45/48 (93%)
 Strand = Plus / Minus

                                                           
Query: 219 agcttctccttgatcttgtccatgatccccttcttctcgccggtgccg 266
           ||||||||||||||||| |||||||| |||||||||||||||| ||||
Sbjct: 141 agcttctccttgatcttctccatgatgcccttcttctcgccggcgccg 94



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 56/65 (86%)
 Strand = Plus / Minus

                                                                        
Query: 359  ctgctggttgtccttgtggccgccggggagcttctccttgatcttctccttcatgccctt 418
            ||||||||||||  ||||||| || |||||||| |||||||| |||||| | | ||||||
Sbjct: 1036 ctgctggttgtcactgtggccaccagggagcttgtccttgatgttctccatgacgccctt 977

                 
Query: 419  cttcc 423
            |||||
Sbjct: 976  cttcc 972



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                           
Query: 219 agcttctccttgatcttgtccatgatccccttcttctcgccggtgccg 266
           ||||| |||||||| || |||||||  |||||||||||||||||||||
Sbjct: 816 agcttgtccttgatgttctccatgaggcccttcttctcgccggtgccg 769



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 42/48 (87%)
 Strand = Plus / Minus

                                                           
Query: 375 tggccgccggggagcttctccttgatcttctccttcatgcccttcttc 422
           ||||| ||||||||||| |||||||| |||||| | | ||||||||||
Sbjct: 342 tggccaccggggagcttgtccttgatgttctccatgacgcccttcttc 295



 Score = 46.1 bits (23), Expect = 0.12
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 219 agcttctccttgatcttgtccatgatccccttcttctcgccgg 261
           ||||| |||||||| || |||||||  ||||||||||||||||
Sbjct: 330 agcttgtccttgatgttctccatgacgcccttcttctcgccgg 288



 Score = 44.1 bits (22), Expect = 0.46
 Identities = 37/42 (88%)
 Strand = Plus / Minus

                                                     
Query: 219 agcttctccttgatcttgtccatgatccccttcttctcgccg 260
           |||||||||||||| || |||||||  | |||||||||||||
Sbjct: 624 agcttctccttgatgttctccatgaggctcttcttctcgccg 583



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                            
Query: 375 tggccgccggggagcttctccttgatcttctcc 407
           ||||| || ||||||||||||||||| ||||||
Sbjct: 636 tggccaccagggagcttctccttgatgttctcc 604



 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 285  tgctgcccgtaggctccacc 304
            ||||||||||||||||||||
Sbjct: 1251 tgctgcccgtaggctccacc 1232



 Score = 40.1 bits (20), Expect = 7.2
 Identities = 41/48 (85%)
 Strand = Plus / Minus

                                                            
Query: 219  agcttctccttgatcttgtccatgatccccttcttctcgccggtgccg 266
            ||||| |||||||| || |||||||   ||||||||||||| ||||||
Sbjct: 1200 agcttgtccttgatgttctccatgacggccttcttctcgccagtgccg 1153

---

>dbj|AB126059.1| Codonopsis lanceolata mRNA for dehydrin 1, complete cds
          Length = 813

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 84/98 (85%), Gaps = 3/98 (3%)
 Strand = Plus / Minus

                                                                       
Query: 387 agcttctccttgatcttctccttcatgcccttcttcctcctcccgcccatgccgtcgtcc 446
           |||||||||||||| || ||||| || |||||||||||||| || ||||| || ||||||
Sbjct: 419 agcttctccttgattttttcctttatccccttcttcctccttccacccatcccatcgtcc 360

                                                 
Query: 447 tcggaggacgagctggagctggagctgccggagcgatg 484
           ||    || ||||||||||||||||||||||| |||||
Sbjct: 359 tc---cgaagagctggagctggagctgccggaacgatg 325



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Minus

                                                     
Query: 213 cccggcagcttctccttgatcttgtccatgatccccttcttc 254
           |||||||||||||||||||| || ||| | ||||||||||||
Sbjct: 425 cccggcagcttctccttgattttttcctttatccccttcttc 384

---

>gb|AF031249.1|AF031249 Lophopyrum elongatum dehydrin-/LEA group 2-like protein (ESI18-4)
           mRNA, complete cds
          Length = 680

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 60/67 (89%)
 Strand = Plus / Minus

                                                                       
Query: 200 ggctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgcc 259
           |||| |||||||||| |||||||| |||||||||||||||||||| | ||| ||||| ||
Sbjct: 397 ggcttagtgctgtccaggcagcttgtccttgatcttgtccatgatgctcttgttctcacc 338

                  
Query: 260 ggtgccg 266
           |||||||
Sbjct: 337 ggtgccg 331



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                            
Query: 374 gtggccgccggggagcttctccttgatcttctc 406
           |||||| |||||||||||||||||||| |||||
Sbjct: 229 gtggccaccggggagcttctccttgatgttctc 197



 Score = 46.1 bits (23), Expect = 0.12
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                          
Query: 219 agcttctccttgatcttgtccatgatccccttcttctcgccggtgcc 265
           |||||||||||||| || || | ||  ||||||||||||||||||||
Sbjct: 216 agcttctccttgatgttctcgacgacacccttcttctcgccggtgcc 170



 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 246 cccttcttctcgccggtgcc 265
           ||||||||||||||||||||
Sbjct: 63  cccttcttctcgccggtgcc 44

---

>gb|AF031250.1|AF031250 Lophopyrum elongatum dehydrin-/LEA group 2-like protein (ESI18-5)
           mRNA, complete cds
          Length = 697

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 60/67 (89%)
 Strand = Plus / Minus

                                                                       
Query: 200 ggctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgcc 259
           |||| |||||||||| |||||||| |||||||||||||||||||| | ||| ||||| ||
Sbjct: 421 ggcttagtgctgtccaggcagcttgtccttgatcttgtccatgatgctcttgttctcacc 362

                  
Query: 260 ggtgccg 266
           |||||||
Sbjct: 361 ggtgccg 355



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                            
Query: 374 gtggccgccggggagcttctccttgatcttctc 406
           |||||| |||||||||||||||||||| |||||
Sbjct: 253 gtggccaccggggagcttctccttgatgttctc 221



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                            
Query: 219 agcttctccttgatcttgtccatgatccccttcttctcgccggtgccgg 267
           |||||||||||||| || || | ||  ||||||||||||||||||||||
Sbjct: 240 agcttctccttgatgttctcgacgacgcccttcttctcgccggtgccgg 192

---

>gb|U73213.1|TAU73213 Triticum aestivum cold acclimation protein WCOR726 (Wcor726) mRNA,
           complete cds
          Length = 667

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 60/67 (89%)
 Strand = Plus / Minus

                                                                       
Query: 200 ggctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgcc 259
           |||| |||||||||| |||||||| |||||||||||||||||||| | ||| ||||| ||
Sbjct: 441 ggcttagtgctgtccaggcagcttgtccttgatcttgtccatgatgctcttgttctcacc 382

                  
Query: 260 ggtgccg 266
           |||||||
Sbjct: 381 ggtgccg 375



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                            
Query: 374 gtggccgccggggagcttctccttgatcttctc 406
           |||||| |||||||||||||||||||| |||||
Sbjct: 273 gtggccaccggggagcttctccttgatgttctc 241



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                            
Query: 219 agcttctccttgatcttgtccatgatccccttcttctcgccggtgccgg 267
           |||||||||||||| || || ||||  ||||||||||||| ||||||||
Sbjct: 260 agcttctccttgatgttctcgatgacgcccttcttctcgctggtgccgg 212

---

>gb|AY349246.1| Hordeum vulgare subsp. spontaneum NPGS PI 560559 dehydrin 5 (Dhn5)
            gene, partial cds
          Length = 1049

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 56/62 (90%)
 Strand = Plus / Minus

                                                                        
Query: 205  agtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccggtgc 264
            |||||||||| |||||||| |||||||||||||||||||  | |||||||||||| ||||
Sbjct: 1002 agtgctgtccaggcagcttgtccttgatcttgtccatgaggctcttcttctcgcccgtgc 943

              
Query: 265  cg 266
            ||
Sbjct: 942  cg 941



 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 44/48 (91%)
 Strand = Plus / Minus

                                                           
Query: 219 agcttctccttgatcttgtccatgatccccttcttctcgccggtgccg 266
           |||||||||||||| || |||||||  |||||||||||||||||||||
Sbjct: 778 agcttctccttgatgttctccatgacacccttcttctcgccggtgccg 731



 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 44/48 (91%)
 Strand = Plus / Minus

                                                           
Query: 219 agcttctccttgatcttgtccatgatccccttcttctcgccggtgccg 266
           |||||||||||||| || |||||||| |||||||||||||| ||||||
Sbjct: 193 agcttctccttgatgttctccatgatgcccttcttctcgccagtgccg 146



 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 42/46 (91%)
 Strand = Plus / Minus

                                                         
Query: 219 agcttctccttgatcttgtccatgatccccttcttctcgccggtgc 264
           |||||||||||||| || |||||||  |||||||||||||||||||
Sbjct: 586 agcttctccttgatgttttccatgacgcccttcttctcgccggtgc 541



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 44/49 (89%)
 Strand = Plus / Minus

                                                            
Query: 374 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttc 422
           |||||| || ||||||||||||||||| |||||| | ||||||||||||
Sbjct: 206 gtggccaccagggagcttctccttgatgttctccatgatgcccttcttc 158



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                           
Query: 360 tgctggttgtccttgtggccgccggggagcttctccttgatcttctcc 407
           ||||||| |||  ||||||| |||||||||||||||||||| ||||||
Sbjct: 805 tgctggtggtcactgtggccaccggggagcttctccttgatgttctcc 758



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                            
Query: 374 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttc 422
           |||||| |||||||||||||||||||| || ||| | | ||||||||||
Sbjct: 599 gtggccaccggggagcttctccttgatgttttccatgacgcccttcttc 551



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 42/48 (87%)
 Strand = Plus / Minus

                                                           
Query: 219 agcttctccttgatcttgtccatgatccccttcttctcgccggtgccg 266
           ||||| |||||||| || ||||| |  |||||||||||||||||||||
Sbjct: 394 agcttttccttgatgttctccattacacccttcttctcgccggtgccg 347

---

>gb|AY349245.1| Hordeum vulgare subsp. spontaneum NPGS PI 560556 dehydrin 5 (Dhn5)
            gene, partial cds
          Length = 1049

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 56/62 (90%)
 Strand = Plus / Minus

                                                                        
Query: 205  agtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccggtgc 264
            |||||||||| |||||||| |||||||||||||||||||  | |||||||||||| ||||
Sbjct: 1002 agtgctgtccaggcagcttgtccttgatcttgtccatgaggctcttcttctcgcccgtgc 943

              
Query: 265  cg 266
            ||
Sbjct: 942  cg 941



 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 44/48 (91%)
 Strand = Plus / Minus

                                                           
Query: 219 agcttctccttgatcttgtccatgatccccttcttctcgccggtgccg 266
           |||||||||||||| || |||||||  |||||||||||||||||||||
Sbjct: 778 agcttctccttgatgttctccatgacacccttcttctcgccggtgccg 731



 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 44/48 (91%)
 Strand = Plus / Minus

                                                           
Query: 219 agcttctccttgatcttgtccatgatccccttcttctcgccggtgccg 266
           |||||||||||||| || |||||||| |||||||||||||| ||||||
Sbjct: 193 agcttctccttgatgttctccatgatgcccttcttctcgccagtgccg 146



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 44/49 (89%)
 Strand = Plus / Minus

                                                            
Query: 374 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttc 422
           |||||| || ||||||||||||||||| |||||| | ||||||||||||
Sbjct: 206 gtggccaccagggagcttctccttgatgttctccatgatgcccttcttc 158



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                           
Query: 360 tgctggttgtccttgtggccgccggggagcttctccttgatcttctcc 407
           ||||||| |||  ||||||| |||||||||||||||||||| ||||||
Sbjct: 805 tgctggtggtcactgtggccaccggggagcttctccttgatgttctcc 758



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 41/46 (89%)
 Strand = Plus / Minus

                                                         
Query: 219 agcttctccttgatcttgtccatgatccccttcttctcgccggtgc 264
           ||||| |||||||| || |||||||  |||||||||||||||||||
Sbjct: 586 agcttatccttgatgttttccatgacgcccttcttctcgccggtgc 541



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 42/48 (87%)
 Strand = Plus / Minus

                                                           
Query: 219 agcttctccttgatcttgtccatgatccccttcttctcgccggtgccg 266
           ||||| |||||||| || ||||| |  |||||||||||||||||||||
Sbjct: 394 agcttttccttgatgttctccattacacccttcttctcgccggtgccg 347



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 42/49 (85%)
 Strand = Plus / Minus

                                                            
Query: 374 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttc 422
           |||||| ||||||||||| |||||||| || ||| | | ||||||||||
Sbjct: 599 gtggccaccggggagcttatccttgatgttttccatgacgcccttcttc 551

---

>gb|AY349244.1| Hordeum vulgare subsp. spontaneum NPGS PI 531957 dehydrin 5 (Dhn5)
            gene, partial cds
          Length = 1049

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 56/62 (90%)
 Strand = Plus / Minus

                                                                        
Query: 205  agtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccggtgc 264
            |||||||||| |||||||| |||||||||||||||||||  | |||||||||||| ||||
Sbjct: 1002 agtgctgtccaggcagcttgtccttgatcttgtccatgaggctcttcttctcgcccgtgc 943

              
Query: 265  cg 266
            ||
Sbjct: 942  cg 941



 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 44/48 (91%)
 Strand = Plus / Minus

                                                           
Query: 219 agcttctccttgatcttgtccatgatccccttcttctcgccggtgccg 266
           |||||||||||||| || |||||||  |||||||||||||||||||||
Sbjct: 778 agcttctccttgatgttctccatgacacccttcttctcgccggtgccg 731



 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 44/48 (91%)
 Strand = Plus / Minus

                                                           
Query: 219 agcttctccttgatcttgtccatgatccccttcttctcgccggtgccg 266
           |||||||||||||| || |||||||| |||||||||||||| ||||||
Sbjct: 193 agcttctccttgatgttctccatgatgcccttcttctcgccagtgccg 146



 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 42/46 (91%)
 Strand = Plus / Minus

                                                         
Query: 219 agcttctccttgatcttgtccatgatccccttcttctcgccggtgc 264
           |||||||||||||| || |||||||  |||||||||||||||||||
Sbjct: 586 agcttctccttgatgttttccatgacgcccttcttctcgccggtgc 541



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 44/49 (89%)
 Strand = Plus / Minus

                                                            
Query: 374 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttc 422
           |||||| || ||||||||||||||||| |||||| | ||||||||||||
Sbjct: 206 gtggccaccagggagcttctccttgatgttctccatgatgcccttcttc 158



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                           
Query: 360 tgctggttgtccttgtggccgccggggagcttctccttgatcttctcc 407
           ||||||| |||  ||||||| |||||||||||||||||||| ||||||
Sbjct: 805 tgctggtggtcactgtggccaccggggagcttctccttgatgttctcc 758



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                            
Query: 374 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttc 422
           |||||| |||||||||||||||||||| || ||| | | ||||||||||
Sbjct: 599 gtggccaccggggagcttctccttgatgttttccatgacgcccttcttc 551



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 42/48 (87%)
 Strand = Plus / Minus

                                                           
Query: 219 agcttctccttgatcttgtccatgatccccttcttctcgccggtgccg 266
           ||||| |||||||| || ||||| |  |||||||||||||||||||||
Sbjct: 394 agcttttccttgatgttctccattacacccttcttctcgccggtgccg 347

---

>gb|AY349243.1| Hordeum vulgare subsp. spontaneum NPGS PI 531853 dehydrin 5 (Dhn5)
            gene, partial cds
          Length = 1049

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 56/62 (90%)
 Strand = Plus / Minus

                                                                        
Query: 205  agtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccggtgc 264
            |||||||||| |||||||| |||||||||||||||||||  | |||||||||||| ||||
Sbjct: 1002 agtgctgtccaggcagcttgtccttgatcttgtccatgaggctcttcttctcgcccgtgc 943

              
Query: 265  cg 266
            ||
Sbjct: 942  cg 941



 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 44/48 (91%)
 Strand = Plus / Minus

                                                           
Query: 219 agcttctccttgatcttgtccatgatccccttcttctcgccggtgccg 266
           |||||||||||||| || |||||||  |||||||||||||||||||||
Sbjct: 778 agcttctccttgatgttctccatgacacccttcttctcgccggtgccg 731



 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 44/48 (91%)
 Strand = Plus / Minus

                                                           
Query: 219 agcttctccttgatcttgtccatgatccccttcttctcgccggtgccg 266
           |||||||||||||| || |||||||| |||||||||||||| ||||||
Sbjct: 193 agcttctccttgatgttctccatgatgcccttcttctcgccagtgccg 146



 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 42/46 (91%)
 Strand = Plus / Minus

                                                         
Query: 219 agcttctccttgatcttgtccatgatccccttcttctcgccggtgc 264
           |||||||||||||| || |||||||  |||||||||||||||||||
Sbjct: 586 agcttctccttgatgttttccatgacgcccttcttctcgccggtgc 541



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 44/49 (89%)
 Strand = Plus / Minus

                                                            
Query: 374 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttc 422
           |||||| || ||||||||||||||||| |||||| | ||||||||||||
Sbjct: 206 gtggccaccagggagcttctccttgatgttctccatgatgcccttcttc 158



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                           
Query: 360 tgctggttgtccttgtggccgccggggagcttctccttgatcttctcc 407
           ||||||| |||  ||||||| |||||||||||||||||||| ||||||
Sbjct: 805 tgctggtggtcactgtggccaccggggagcttctccttgatgttctcc 758



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                            
Query: 374 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttc 422
           |||||| |||||||||||||||||||| || ||| | | ||||||||||
Sbjct: 599 gtggccaccggggagcttctccttgatgttttccatgacgcccttcttc 551



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 42/48 (87%)
 Strand = Plus / Minus

                                                           
Query: 219 agcttctccttgatcttgtccatgatccccttcttctcgccggtgccg 266
           ||||| |||||||| || ||||| |  |||||||||||||||||||||
Sbjct: 394 agcttttccttgatgttctccattacacccttcttctcgccggtgccg 347

---

>gb|AY349242.1| Hordeum vulgare subsp. spontaneum NPGS PI 531851 dehydrin 5 (Dhn5)
            gene, partial cds
          Length = 1049

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 56/62 (90%)
 Strand = Plus / Minus

                                                                        
Query: 205  agtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccggtgc 264
            |||||||||| |||||||| |||||||||||||||||||  | |||||||||||| ||||
Sbjct: 1002 agtgctgtccaggcagcttgtccttgatcttgtccatgaggctcttcttctcgcccgtgc 943

              
Query: 265  cg 266
            ||
Sbjct: 942  cg 941



 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 44/48 (91%)
 Strand = Plus / Minus

                                                           
Query: 219 agcttctccttgatcttgtccatgatccccttcttctcgccggtgccg 266
           |||||||||||||| || |||||||| |||||||||||||| ||||||
Sbjct: 193 agcttctccttgatgttctccatgatgcccttcttctcgccagtgccg 146



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 44/49 (89%)
 Strand = Plus / Minus

                                                            
Query: 374 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttc 422
           |||||| || ||||||||||||||||| |||||| | ||||||||||||
Sbjct: 206 gtggccaccagggagcttctccttgatgttctccatgatgcccttcttc 158



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 41/46 (89%)
 Strand = Plus / Minus

                                                         
Query: 219 agcttctccttgatcttgtccatgatccccttcttctcgccggtgc 264
           ||||| |||||||| || |||||||  |||||||||||||||||||
Sbjct: 586 agcttatccttgatgttttccatgacgcccttcttctcgccggtgc 541



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 42/48 (87%)
 Strand = Plus / Minus

                                                           
Query: 219 agcttctccttgatcttgtccatgatccccttcttctcgccggtgccg 266
           |||||||||||||| || ||||||   ||||||||||| |||||||||
Sbjct: 778 agcttctccttgatgttctccatggcacccttcttctcaccggtgccg 731



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 42/48 (87%)
 Strand = Plus / Minus

                                                           
Query: 219 agcttctccttgatcttgtccatgatccccttcttctcgccggtgccg 266
           ||||| |||||||| || ||||| |  |||||||||||||||||||||
Sbjct: 394 agcttttccttgatgttctccattacacccttcttctcgccggtgccg 347



 Score = 46.1 bits (23), Expect = 0.12
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 373 tgtggccgccggggagcttctccttgatcttctcc 407
           ||||||| ||||| |||||||||||||| ||||||
Sbjct: 792 tgtggccaccgggaagcttctccttgatgttctcc 758



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 42/49 (85%)
 Strand = Plus / Minus

                                                            
Query: 374 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttc 422
           |||||| ||||||||||| |||||||| || ||| | | ||||||||||
Sbjct: 599 gtggccaccggggagcttatccttgatgttttccatgacgcccttcttc 551

---

>gb|AY349241.1| Hordeum vulgare subsp. spontaneum NPGS PI 466460 dehydrin 5 (Dhn5)
            gene, partial cds
          Length = 1049

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 56/62 (90%)
 Strand = Plus / Minus

                                                                        
Query: 205  agtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccggtgc 264
            |||||||||| |||||||| |||||||||||||||||||  | |||||||||||| ||||
Sbjct: 1002 agtgctgtccaggcagcttgtccttgatcttgtccatgaggctcttcttctcgcccgtgc 943

              
Query: 265  cg 266
            ||
Sbjct: 942  cg 941



 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 44/48 (91%)
 Strand = Plus / Minus

                                                           
Query: 219 agcttctccttgatcttgtccatgatccccttcttctcgccggtgccg 266
           |||||||||||||| || |||||||  |||||||||||||||||||||
Sbjct: 778 agcttctccttgatgttctccatgacacccttcttctcgccggtgccg 731



 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 44/48 (91%)
 Strand = Plus / Minus

                                                           
Query: 219 agcttctccttgatcttgtccatgatccccttcttctcgccggtgccg 266
           |||||||||||||| || |||||||| |||||||||||||| ||||||
Sbjct: 193 agcttctccttgatgttctccatgatgcccttcttctcgccagtgccg 146



 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 42/46 (91%)
 Strand = Plus / Minus

                                                         
Query: 219 agcttctccttgatcttgtccatgatccccttcttctcgccggtgc 264
           |||||||||||||| || |||||||  |||||||||||||||||||
Sbjct: 586 agcttctccttgatgttttccatgacgcccttcttctcgccggtgc 541



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 44/49 (89%)
 Strand = Plus / Minus

                                                            
Query: 374 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttc 422
           |||||| || ||||||||||||||||| |||||| | ||||||||||||
Sbjct: 206 gtggccaccagggagcttctccttgatgttctccatgatgcccttcttc 158



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                           
Query: 360 tgctggttgtccttgtggccgccggggagcttctccttgatcttctcc 407
           ||||||| |||  ||||||| |||||||||||||||||||| ||||||
Sbjct: 805 tgctggtggtcactgtggccaccggggagcttctccttgatgttctcc 758



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                            
Query: 374 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttc 422
           |||||| |||||||||||||||||||| || ||| | | ||||||||||
Sbjct: 599 gtggccaccggggagcttctccttgatgttttccatgacgcccttcttc 551



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 42/48 (87%)
 Strand = Plus / Minus

                                                           
Query: 219 agcttctccttgatcttgtccatgatccccttcttctcgccggtgccg 266
           ||||| |||||||| || ||||| |  |||||||||||||||||||||
Sbjct: 394 agcttttccttgatgttctccattacacccttcttctcgccggtgccg 347

---

>gb|AY349240.1| Hordeum vulgare subsp. spontaneum NPGS PI 420916 dehydrin 5 (Dhn5)
            gene, partial cds
          Length = 1049

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 56/62 (90%)
 Strand = Plus / Minus

                                                                        
Query: 205  agtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccggtgc 264
            |||||||||| |||||||| |||||||||||||||||||  | |||||||||||| ||||
Sbjct: 1002 agtgctgtccaggcagcttgtccttgatcttgtccatgaggctcttcttctcgcccgtgc 943

              
Query: 265  cg 266
            ||
Sbjct: 942  cg 941



 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 44/48 (91%)
 Strand = Plus / Minus

                                                           
Query: 219 agcttctccttgatcttgtccatgatccccttcttctcgccggtgccg 266
           |||||||||||||| || |||||||  |||||||||||||||||||||
Sbjct: 778 agcttctccttgatgttctccatgacacccttcttctcgccggtgccg 731



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                           
Query: 360 tgctggttgtccttgtggccgccggggagcttctccttgatcttctcc 407
           ||||||| |||  ||||||| |||||||||||||||||||| ||||||
Sbjct: 805 tgctggtggtcactgtggccaccggggagcttctccttgatgttctcc 758



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                           
Query: 219 agcttctccttgatcttgtccatgatccccttcttctcgccggtgccg 266
           ||||| |||||||| || |||||||| |||||||||||||| ||||||
Sbjct: 193 agcttgtccttgatgttctccatgatgcccttcttctcgccagtgccg 146



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 41/46 (89%)
 Strand = Plus / Minus

                                                         
Query: 219 agcttctccttgatcttgtccatgatccccttcttctcgccggtgc 264
           ||||| |||||||| || |||||||  |||||||||||||||||||
Sbjct: 586 agcttatccttgatgttttccatgacgcccttcttctcgccggtgc 541



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                            
Query: 374 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttc 422
           |||||| || |||||||| |||||||| |||||| | ||||||||||||
Sbjct: 206 gtggccaccagggagcttgtccttgatgttctccatgatgcccttcttc 158



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 42/48 (87%)
 Strand = Plus / Minus

                                                           
Query: 219 agcttctccttgatcttgtccatgatccccttcttctcgccggtgccg 266
           ||||| |||||||| || ||||| |  |||||||||||||||||||||
Sbjct: 394 agcttttccttgatgttctccattacacccttcttctcgccggtgccg 347



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 42/49 (85%)
 Strand = Plus / Minus

                                                            
Query: 374 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttc 422
           |||||| ||||||||||| |||||||| || ||| | | ||||||||||
Sbjct: 599 gtggccaccggggagcttatccttgatgttttccatgacgcccttcttc 551

---

>gb|AY349239.1| Hordeum vulgare subsp. spontaneum NPGS PI 420913 dehydrin 5 (Dhn5)
            gene, partial cds
          Length = 1049

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 56/62 (90%)
 Strand = Plus / Minus

                                                                        
Query: 205  agtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccggtgc 264
            |||||||||| |||||||| |||||||||||||||||||  | |||||||||||| ||||
Sbjct: 1002 agtgctgtccaggcagcttgtccttgatcttgtccatgaggctcttcttctcgcccgtgc 943

              
Query: 265  cg 266
            ||
Sbjct: 942  cg 941



 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 44/48 (91%)
 Strand = Plus / Minus

                                                           
Query: 219 agcttctccttgatcttgtccatgatccccttcttctcgccggtgccg 266
           |||||||||||||| || |||||||  |||||||||||||||||||||
Sbjct: 778 agcttctccttgatgttctccatgacacccttcttctcgccggtgccg 731



 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 44/48 (91%)
 Strand = Plus / Minus

                                                           
Query: 219 agcttctccttgatcttgtccatgatccccttcttctcgccggtgccg 266
           |||||||||||||| || |||||||| |||||||||||||| ||||||
Sbjct: 193 agcttctccttgatgttctccatgatgcccttcttctcgccagtgccg 146



 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 42/46 (91%)
 Strand = Plus / Minus

                                                         
Query: 219 agcttctccttgatcttgtccatgatccccttcttctcgccggtgc 264
           |||||||||||||| || |||||||  |||||||||||||||||||
Sbjct: 586 agcttctccttgatgttttccatgacgcccttcttctcgccggtgc 541



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 44/49 (89%)
 Strand = Plus / Minus

                                                            
Query: 374 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttc 422
           |||||| || ||||||||||||||||| |||||| | ||||||||||||
Sbjct: 206 gtggccaccagggagcttctccttgatgttctccatgatgcccttcttc 158



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                           
Query: 360 tgctggttgtccttgtggccgccggggagcttctccttgatcttctcc 407
           ||||||| |||  ||||||| |||||||||||||||||||| ||||||
Sbjct: 805 tgctggtggtcactgtggccaccggggagcttctccttgatgttctcc 758



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                            
Query: 374 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttc 422
           |||||| |||||||||||||||||||| || ||| | | ||||||||||
Sbjct: 599 gtggccaccggggagcttctccttgatgttttccatgacgcccttcttc 551



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 42/48 (87%)
 Strand = Plus / Minus

                                                           
Query: 219 agcttctccttgatcttgtccatgatccccttcttctcgccggtgccg 266
           ||||| |||||||| || ||||| |  |||||||||||||||||||||
Sbjct: 394 agcttttccttgatgttctccattacacccttcttctcgccggtgccg 347

---

>gb|AY349238.1| Hordeum vulgare subsp. spontaneum NPGS PI 420911 dehydrin 5 (Dhn5)
            gene, partial cds
          Length = 1049

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 56/62 (90%)
 Strand = Plus / Minus

                                                                        
Query: 205  agtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccggtgc 264
            |||||||||| |||||||| |||||||||||||||||||  | |||||||||||| ||||
Sbjct: 1002 agtgctgtccaggcagcttgtccttgatcttgtccatgaggctcttcttctcgcccgtgc 943

              
Query: 265  cg 266
            ||
Sbjct: 942  cg 941



 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 44/48 (91%)
 Strand = Plus / Minus

                                                           
Query: 219 agcttctccttgatcttgtccatgatccccttcttctcgccggtgccg 266
           |||||||||||||| || |||||||  |||||||||||||||||||||
Sbjct: 778 agcttctccttgatgttctccatgacacccttcttctcgccggtgccg 731



 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 44/48 (91%)
 Strand = Plus / Minus

                                                           
Query: 219 agcttctccttgatcttgtccatgatccccttcttctcgccggtgccg 266
           |||||||||||||| || |||||||| |||||||||||||| ||||||
Sbjct: 193 agcttctccttgatgttctccatgatgcccttcttctcgccagtgccg 146



 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 42/46 (91%)
 Strand = Plus / Minus

                                                         
Query: 219 agcttctccttgatcttgtccatgatccccttcttctcgccggtgc 264
           |||||||||||||| || |||||||  |||||||||||||||||||
Sbjct: 586 agcttctccttgatgttttccatgacgcccttcttctcgccggtgc 541



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 44/49 (89%)
 Strand = Plus / Minus

                                                            
Query: 374 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttc 422
           |||||| || ||||||||||||||||| |||||| | ||||||||||||
Sbjct: 206 gtggccaccagggagcttctccttgatgttctccatgatgcccttcttc 158



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                           
Query: 360 tgctggttgtccttgtggccgccggggagcttctccttgatcttctcc 407
           ||||||| |||  ||||||| |||||||||||||||||||| ||||||
Sbjct: 805 tgctggtggtcactgtggccaccggggagcttctccttgatgttctcc 758



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                            
Query: 374 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttc 422
           |||||| |||||||||||||||||||| || ||| | | ||||||||||
Sbjct: 599 gtggccaccggggagcttctccttgatgttttccatgacgcccttcttc 551



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 42/48 (87%)
 Strand = Plus / Minus

                                                           
Query: 219 agcttctccttgatcttgtccatgatccccttcttctcgccggtgccg 266
           ||||| |||||||| || ||||| |  |||||||||||||||||||||
Sbjct: 394 agcttttccttgatgttctccattacacccttcttctcgccggtgccg 347

---

>gb|AY349237.1| Hordeum vulgare subsp. spontaneum NPGS PI 406276 dehydrin 5 (Dhn5)
            gene, partial cds
          Length = 1055

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 56/62 (90%)
 Strand = Plus / Minus

                                                                        
Query: 205  agtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccggtgc 264
            |||||||||| |||||||| |||||||||||||||||||  | |||||||||||| ||||
Sbjct: 1008 agtgctgtccaggcagcttgtccttgatcttgtccatgaggctcttcttctcgcccgtgc 949

              
Query: 265  cg 266
            ||
Sbjct: 948  cg 947



 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 44/48 (91%)
 Strand = Plus / Minus

                                                           
Query: 219 agcttctccttgatcttgtccatgatccccttcttctcgccggtgccg 266
           |||||||||||||| || |||||||  |||||||||||||||||||||
Sbjct: 778 agcttctccttgatgttctccatgacacccttcttctcgccggtgccg 731



 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 44/48 (91%)
 Strand = Plus / Minus

                                                           
Query: 219 agcttctccttgatcttgtccatgatccccttcttctcgccggtgccg 266
           |||||||||||||| || |||||||| |||||||||||||| ||||||
Sbjct: 193 agcttctccttgatgttctccatgatgcccttcttctcgccagtgccg 146



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 44/49 (89%)
 Strand = Plus / Minus

                                                            
Query: 374 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttc 422
           |||||| || ||||||||||||||||| |||||| | ||||||||||||
Sbjct: 206 gtggccaccagggagcttctccttgatgttctccatgatgcccttcttc 158



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 41/46 (89%)
 Strand = Plus / Minus

                                                         
Query: 219 agcttctccttgatcttgtccatgatccccttcttctcgccggtgc 264
           ||||| |||||||| || |||||||  |||||||||||||||||||
Sbjct: 586 agcttatccttgatgttttccatgacgcccttcttctcgccggtgc 541



 Score = 46.1 bits (23), Expect = 0.12
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 373 tgtggccgccggggagcttctccttgatcttctcc 407
           ||||||| ||||| |||||||||||||| ||||||
Sbjct: 792 tgtggccaccgggaagcttctccttgatgttctcc 758



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 42/49 (85%)
 Strand = Plus / Minus

                                                            
Query: 374 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttc 422
           |||||| ||||||||||| |||||||| || ||| | | ||||||||||
Sbjct: 599 gtggccaccggggagcttatccttgatgttttccatgacgcccttcttc 551



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 246 cccttcttctcgccggtgccg 266
           |||||||||||||||||||||
Sbjct: 367 cccttcttctcgccggtgccg 347

---

>gb|AY349236.1| Hordeum vulgare subsp. spontaneum NPGS PI 401371 dehydrin 5 (Dhn5)
           gene, partial cds
          Length = 446

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 56/62 (90%)
 Strand = Plus / Minus

                                                                       
Query: 205 agtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccggtgc 264
           |||||||||| |||||||| |||||||||||||||||||  | |||||||||||| ||||
Sbjct: 399 agtgctgtccaggcagcttgtccttgatcttgtccatgaggctcttcttctcgcccgtgc 340

             
Query: 265 cg 266
           ||
Sbjct: 339 cg 338



 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 44/48 (91%)
 Strand = Plus / Minus

                                                           
Query: 219 agcttctccttgatcttgtccatgatccccttcttctcgccggtgccg 266
           |||||||||||||| || |||||||  |||||||||||||||||||||
Sbjct: 169 agcttctccttgatgttctccatgacacccttcttctcgccggtgccg 122



 Score = 46.1 bits (23), Expect = 0.12
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 373 tgtggccgccggggagcttctccttgatcttctcc 407
           ||||||| ||||| |||||||||||||| ||||||
Sbjct: 183 tgtggccaccgggaagcttctccttgatgttctcc 149

---

>gb|AY349235.1| Hordeum vulgare subsp. spontaneum NPGS PI 401371 dehydrin 5 (Dhn5)
           gene, partial cds
          Length = 446

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 56/62 (90%)
 Strand = Plus / Minus

                                                                       
Query: 205 agtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccggtgc 264
           |||||||||| |||||||| |||||||||||||||||||  | |||||||||||| ||||
Sbjct: 399 agtgctgtccaggcagcttgtccttgatcttgtccatgaggctcttcttctcgcccgtgc 340

             
Query: 265 cg 266
           ||
Sbjct: 339 cg 338



 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 44/48 (91%)
 Strand = Plus / Minus

                                                           
Query: 219 agcttctccttgatcttgtccatgatccccttcttctcgccggtgccg 266
           |||||||||||||| || |||||||  |||||||||||||||||||||
Sbjct: 169 agcttctccttgatgttctccatgacacccttcttctcgccggtgccg 122



 Score = 46.1 bits (23), Expect = 0.12
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 373 tgtggccgccggggagcttctccttgatcttctcc 407
           ||||||| ||||| |||||||||||||| ||||||
Sbjct: 183 tgtggccaccgggaagcttctccttgatgttctcc 149

---

>gb|AY349234.1| Hordeum vulgare subsp. spontaneum NPGS PI 401370 dehydrin 5 (Dhn5)
            gene, partial cds
          Length = 1055

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 56/62 (90%)
 Strand = Plus / Minus

                                                                        
Query: 205  agtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccggtgc 264
            |||||||||| |||||||| |||||||||||||||||||  | |||||||||||| ||||
Sbjct: 1008 agtgctgtccaggcagcttgtccttgatcttgtccatgaggctcttcttctcgcccgtgc 949

              
Query: 265  cg 266
            ||
Sbjct: 948  cg 947



 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 44/48 (91%)
 Strand = Plus / Minus

                                                           
Query: 219 agcttctccttgatcttgtccatgatccccttcttctcgccggtgccg 266
           |||||||||||||| || |||||||  |||||||||||||||||||||
Sbjct: 778 agcttctccttgatgttctccatgacacccttcttctcgccggtgccg 731



 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 44/48 (91%)
 Strand = Plus / Minus

                                                           
Query: 219 agcttctccttgatcttgtccatgatccccttcttctcgccggtgccg 266
           |||||||||||||| || |||||||| |||||||||||||| ||||||
Sbjct: 193 agcttctccttgatgttctccatgatgcccttcttctcgccagtgccg 146



 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 42/46 (91%)
 Strand = Plus / Minus

                                                         
Query: 219 agcttctccttgatcttgtccatgatccccttcttctcgccggtgc 264
           |||||||||||||| || |||||||  |||||||||||||||||||
Sbjct: 586 agcttctccttgatgttttccatgacgcccttcttctcgccggtgc 541



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 44/49 (89%)
 Strand = Plus / Minus

                                                            
Query: 374 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttc 422
           |||||| || ||||||||||||||||| |||||| | ||||||||||||
Sbjct: 206 gtggccaccagggagcttctccttgatgttctccatgatgcccttcttc 158



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                           
Query: 360 tgctggttgtccttgtggccgccggggagcttctccttgatcttctcc 407
           ||||||| |||  ||||||| |||||||||||||||||||| ||||||
Sbjct: 805 tgctggtggtcactgtggccaccggggagcttctccttgatgttctcc 758



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                            
Query: 374 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttc 422
           |||||| |||||||||||||||||||| || ||| | | ||||||||||
Sbjct: 599 gtggccaccggggagcttctccttgatgttttccatgacgcccttcttc 551



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 42/48 (87%)
 Strand = Plus / Minus

                                                           
Query: 219 agcttctccttgatcttgtccatgatccccttcttctcgccggtgccg 266
           ||||| |||||||| || ||||| |  |||||||||||||||||||||
Sbjct: 394 agcttttccttgatgttctccattacacccttcttctcgccggtgccg 347

---

>gb|AY349233.1| Hordeum vulgare subsp. spontaneum NPGS PI 366446 dehydrin 5 (Dhn5)
            gene, partial cds
          Length = 1049

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 56/62 (90%)
 Strand = Plus / Minus

                                                                        
Query: 205  agtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccggtgc 264
            |||||||||| |||||||| |||||||||||||||||||  | |||||||||||| ||||
Sbjct: 1002 agtgctgtccaggcagcttgtccttgatcttgtccatgaggctcttcttctcgcccgtgc 943

              
Query: 265  cg 266
            ||
Sbjct: 942  cg 941



 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 44/48 (91%)
 Strand = Plus / Minus

                                                           
Query: 219 agcttctccttgatcttgtccatgatccccttcttctcgccggtgccg 266
           |||||||||||||| || |||||||  |||||||||||||||||||||
Sbjct: 778 agcttctccttgatgttctccatgacacccttcttctcgccggtgccg 731



 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 42/46 (91%)
 Strand = Plus / Minus

                                                         
Query: 219 agcttctccttgatcttgtccatgatccccttcttctcgccggtgc 264
           |||||||||||||| || |||||||  |||||||||||||||||||
Sbjct: 586 agcttctccttgatgttttccatgacgcccttcttctcgccggtgc 541



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                           
Query: 360 tgctggttgtccttgtggccgccggggagcttctccttgatcttctcc 407
           ||||||| |||  ||||||| |||||||||||||||||||| ||||||
Sbjct: 805 tgctggtggtcactgtggccaccggggagcttctccttgatgttctcc 758



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                           
Query: 219 agcttctccttgatcttgtccatgatccccttcttctcgccggtgccg 266
           ||||| |||||||| || |||||||| |||||||||||||| ||||||
Sbjct: 193 agcttgtccttgatgttctccatgatgcccttcttctcgccagtgccg 146



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                            
Query: 374 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttc 422
           |||||| |||||||||||||||||||| || ||| | | ||||||||||
Sbjct: 599 gtggccaccggggagcttctccttgatgttttccatgacgcccttcttc 551



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                            
Query: 374 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttc 422
           |||||| || |||||||| |||||||| |||||| | ||||||||||||
Sbjct: 206 gtggccaccagggagcttgtccttgatgttctccatgatgcccttcttc 158



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 42/48 (87%)
 Strand = Plus / Minus

                                                           
Query: 219 agcttctccttgatcttgtccatgatccccttcttctcgccggtgccg 266
           ||||| |||||||| || ||||| |  |||||||||||||||||||||
Sbjct: 394 agcttttccttgatgttctccattacacccttcttctcgccggtgccg 347

---

>gb|AY349232.1| Hordeum vulgare subsp. spontaneum NPGS PI 296926 dehydrin 5 (Dhn5)
            gene, partial cds
          Length = 1049

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 56/62 (90%)
 Strand = Plus / Minus

                                                                        
Query: 205  agtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccggtgc 264
            |||||||||| |||||||| |||||||||||||||||||  | |||||||||||| ||||
Sbjct: 1002 agtgctgtccaggcagcttgtccttgatcttgtccatgaggctcttcttctcgcccgtgc 943

              
Query: 265  cg 266
            ||
Sbjct: 942  cg 941



 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 44/48 (91%)
 Strand = Plus / Minus

                                                           
Query: 219 agcttctccttgatcttgtccatgatccccttcttctcgccggtgccg 266
           |||||||||||||| || |||||||  |||||||||||||||||||||
Sbjct: 778 agcttctccttgatgttctccatgacacccttcttctcgccggtgccg 731



 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 44/48 (91%)
 Strand = Plus / Minus

                                                           
Query: 219 agcttctccttgatcttgtccatgatccccttcttctcgccggtgccg 266
           |||||||||||||| || |||||||| |||||||||||||| ||||||
Sbjct: 193 agcttctccttgatgttctccatgatgcccttcttctcgccagtgccg 146



 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 42/46 (91%)
 Strand = Plus / Minus

                                                         
Query: 219 agcttctccttgatcttgtccatgatccccttcttctcgccggtgc 264
           |||||||||||||| || |||||||  |||||||||||||||||||
Sbjct: 586 agcttctccttgatgttttccatgacgcccttcttctcgccggtgc 541



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 44/49 (89%)
 Strand = Plus / Minus

                                                            
Query: 374 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttc 422
           |||||| || ||||||||||||||||| |||||| | ||||||||||||
Sbjct: 206 gtggccaccagggagcttctccttgatgttctccatgatgcccttcttc 158



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                           
Query: 360 tgctggttgtccttgtggccgccggggagcttctccttgatcttctcc 407
           ||||||| |||  ||||||| |||||||||||||||||||| ||||||
Sbjct: 805 tgctggtggtcactgtggccaccggggagcttctccttgatgttctcc 758



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                            
Query: 374 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttc 422
           |||||| |||||||||||||||||||| || ||| | | ||||||||||
Sbjct: 599 gtggccaccggggagcttctccttgatgttttccatgacgcccttcttc 551



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 42/48 (87%)
 Strand = Plus / Minus

                                                           
Query: 219 agcttctccttgatcttgtccatgatccccttcttctcgccggtgccg 266
           ||||| |||||||| || ||||| |  |||||||||||||||||||||
Sbjct: 394 agcttttccttgatgttctccattacacccttcttctcgccggtgccg 347

---

>gb|AY349231.1| Hordeum vulgare subsp. spontaneum NPGS PI 293411 dehydrin 5 (Dhn5)
            gene, partial cds
          Length = 1049

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 56/62 (90%)
 Strand = Plus / Minus

                                                                        
Query: 205  agtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccggtgc 264
            |||||||||| |||||||| |||||||||||||||||||  | |||||||||||| ||||
Sbjct: 1002 agtgctgtccaggcagcttgtccttgatcttgtccatgaggctcttcttctcgcccgtgc 943

              
Query: 265  cg 266
            ||
Sbjct: 942  cg 941



 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 44/48 (91%)
 Strand = Plus / Minus

                                                           
Query: 219 agcttctccttgatcttgtccatgatccccttcttctcgccggtgccg 266
           |||||||||||||| || |||||||  |||||||||||||||||||||
Sbjct: 778 agcttctccttgatgttctccatgacacccttcttctcgccggtgccg 731



 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 42/46 (91%)
 Strand = Plus / Minus

                                                         
Query: 219 agcttctccttgatcttgtccatgatccccttcttctcgccggtgc 264
           |||||||||||||| || |||||||  |||||||||||||||||||
Sbjct: 586 agcttctccttgatgttttccatgacgcccttcttctcgccggtgc 541



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                           
Query: 360 tgctggttgtccttgtggccgccggggagcttctccttgatcttctcc 407
           ||||||| |||  ||||||| |||||||||||||||||||| ||||||
Sbjct: 805 tgctggtggtcactgtggccaccggggagcttctccttgatgttctcc 758



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                           
Query: 219 agcttctccttgatcttgtccatgatccccttcttctcgccggtgccg 266
           ||||| |||||||| || |||||||| |||||||||||||| ||||||
Sbjct: 193 agcttgtccttgatgttctccatgatgcccttcttctcgccagtgccg 146



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                            
Query: 374 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttc 422
           |||||| |||||||||||||||||||| || ||| | | ||||||||||
Sbjct: 599 gtggccaccggggagcttctccttgatgttttccatgacgcccttcttc 551



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                            
Query: 374 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttc 422
           |||||| || |||||||| |||||||| |||||| | ||||||||||||
Sbjct: 206 gtggccaccagggagcttgtccttgatgttctccatgatgcccttcttc 158



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 42/48 (87%)
 Strand = Plus / Minus

                                                           
Query: 219 agcttctccttgatcttgtccatgatccccttcttctcgccggtgccg 266
           ||||| |||||||| || ||||| |  |||||||||||||||||||||
Sbjct: 394 agcttttccttgatgttctccattacacccttcttctcgccggtgccg 347

---

>gb|AY349230.1| Hordeum vulgare subsp. spontaneum NPGS PI 293409 dehydrin 5 (Dhn5)
            gene, partial cds
          Length = 1061

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 56/62 (90%)
 Strand = Plus / Minus

                                                                        
Query: 205  agtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccggtgc 264
            |||||||||| |||||||| |||||||||||||||||||  | |||||||||||| ||||
Sbjct: 1014 agtgctgtccaggcagcttgtccttgatcttgtccatgaggctcttcttctcgcccgtgc 955

              
Query: 265  cg 266
            ||
Sbjct: 954  cg 953



 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 44/48 (91%)
 Strand = Plus / Minus

                                                           
Query: 219 agcttctccttgatcttgtccatgatccccttcttctcgccggtgccg 266
           |||||||||||||| || |||||||  |||||||||||||||||||||
Sbjct: 778 agcttctccttgatgttctccatgacacccttcttctcgccggtgccg 731



 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 44/48 (91%)
 Strand = Plus / Minus

                                                           
Query: 219 agcttctccttgatcttgtccatgatccccttcttctcgccggtgccg 266
           |||||||||||||| || |||||||| |||||||||||||| ||||||
Sbjct: 193 agcttctccttgatgttctccatgatgcccttcttctcgccagtgccg 146



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 44/49 (89%)
 Strand = Plus / Minus

                                                            
Query: 374 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttc 422
           |||||| || ||||||||||||||||| |||||| | ||||||||||||
Sbjct: 206 gtggccaccagggagcttctccttgatgttctccatgatgcccttcttc 158



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 41/46 (89%)
 Strand = Plus / Minus

                                                         
Query: 219 agcttctccttgatcttgtccatgatccccttcttctcgccggtgc 264
           ||||| |||||||| || |||||||  |||||||||||||||||||
Sbjct: 586 agcttatccttgatgttttccatgacgcccttcttctcgccggtgc 541



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 42/48 (87%)
 Strand = Plus / Minus

                                                           
Query: 219 agcttctccttgatcttgtccatgatccccttcttctcgccggtgccg 266
           ||||| |||||||| || ||||| |  |||||||||||||||||||||
Sbjct: 394 agcttttccttgatgttctccattacacccttcttctcgccggtgccg 347



 Score = 46.1 bits (23), Expect = 0.12
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 373 tgtggccgccggggagcttctccttgatcttctcc 407
           ||||||| ||||| |||||||||||||| ||||||
Sbjct: 792 tgtggccaccgggaagcttctccttgatgttctcc 758



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 42/49 (85%)
 Strand = Plus / Minus

                                                            
Query: 374 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttc 422
           |||||| ||||||||||| |||||||| || ||| | | ||||||||||
Sbjct: 599 gtggccaccggggagcttatccttgatgttttccatgacgcccttcttc 551

---

>gb|AY349229.1| Hordeum vulgare subsp. spontaneum NPGS PI 293402 dehydrin 5 (Dhn5)
            gene, partial cds
          Length = 1049

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 56/62 (90%)
 Strand = Plus / Minus

                                                                        
Query: 205  agtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccggtgc 264
            |||||||||| |||||||| |||||||||||||||||||  | |||||||||||| ||||
Sbjct: 1002 agtgctgtccaggcagcttgtccttgatcttgtccatgaggctcttcttctcgcccgtgc 943

              
Query: 265  cg 266
            ||
Sbjct: 942  cg 941



 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 44/48 (91%)
 Strand = Plus / Minus

                                                           
Query: 219 agcttctccttgatcttgtccatgatccccttcttctcgccggtgccg 266
           |||||||||||||| || |||||||  |||||||||||||||||||||
Sbjct: 778 agcttctccttgatgttctccatgacacccttcttctcgccggtgccg 731



 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 44/48 (91%)
 Strand = Plus / Minus

                                                           
Query: 219 agcttctccttgatcttgtccatgatccccttcttctcgccggtgccg 266
           |||||||||||||| || |||||||| |||||||||||||| ||||||
Sbjct: 193 agcttctccttgatgttctccatgatgcccttcttctcgccagtgccg 146



 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 42/46 (91%)
 Strand = Plus / Minus

                                                         
Query: 219 agcttctccttgatcttgtccatgatccccttcttctcgccggtgc 264
           |||||||||||||| || |||||||  |||||||||||||||||||
Sbjct: 586 agcttctccttgatgttttccatgacgcccttcttctcgccggtgc 541



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 44/49 (89%)
 Strand = Plus / Minus

                                                            
Query: 374 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttc 422
           |||||| || ||||||||||||||||| |||||| | ||||||||||||
Sbjct: 206 gtggccaccagggagcttctccttgatgttctccatgatgcccttcttc 158



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                           
Query: 360 tgctggttgtccttgtggccgccggggagcttctccttgatcttctcc 407
           ||||||| |||  ||||||| |||||||||||||||||||| ||||||
Sbjct: 805 tgctggtggtcactgtggccaccggggagcttctccttgatgttctcc 758



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                            
Query: 374 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttc 422
           |||||| |||||||||||||||||||| || ||| | | ||||||||||
Sbjct: 599 gtggccaccggggagcttctccttgatgttttccatgacgcccttcttc 551



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 42/48 (87%)
 Strand = Plus / Minus

                                                           
Query: 219 agcttctccttgatcttgtccatgatccccttcttctcgccggtgccg 266
           ||||| |||||||| || ||||| |  |||||||||||||||||||||
Sbjct: 394 agcttttccttgatgttctccattacacccttcttctcgccggtgccg 347

---

>gb|AY349228.1| Hordeum vulgare subsp. spontaneum NPGS PI 268242 dehydrin 5 (Dhn5)
            gene, partial cds
          Length = 1055

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 56/62 (90%)
 Strand = Plus / Minus

                                                                        
Query: 205  agtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccggtgc 264
            |||||||||| |||||||| |||||||||||||||||||  | |||||||||||| ||||
Sbjct: 1008 agtgctgtccaggcagcttgtccttgatcttgtccatgaggctcttcttctcgcccgtgc 949

              
Query: 265  cg 266
            ||
Sbjct: 948  cg 947



 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 44/48 (91%)
 Strand = Plus / Minus

                                                           
Query: 219 agcttctccttgatcttgtccatgatccccttcttctcgccggtgccg 266
           |||||||||||||| || |||||||  |||||||||||||||||||||
Sbjct: 778 agcttctccttgatgttctccatgacacccttcttctcgccggtgccg 731



 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 42/46 (91%)
 Strand = Plus / Minus

                                                         
Query: 219 agcttctccttgatcttgtccatgatccccttcttctcgccggtgc 264
           |||||||||||||| || |||||||  |||||||||||||||||||
Sbjct: 586 agcttctccttgatgttttccatgacgcccttcttctcgccggtgc 541



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                           
Query: 360 tgctggttgtccttgtggccgccggggagcttctccttgatcttctcc 407
           ||||||| |||  ||||||| |||||||||||||||||||| ||||||
Sbjct: 805 tgctggtggtcactgtggccaccggggagcttctccttgatgttctcc 758



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                           
Query: 219 agcttctccttgatcttgtccatgatccccttcttctcgccggtgccg 266
           ||||| |||||||| || |||||||| |||||||||||||| ||||||
Sbjct: 193 agcttgtccttgatgttctccatgatgcccttcttctcgccagtgccg 146



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                            
Query: 374 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttc 422
           |||||| |||||||||||||||||||| || ||| | | ||||||||||
Sbjct: 599 gtggccaccggggagcttctccttgatgttttccatgacgcccttcttc 551



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                            
Query: 374 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttc 422
           |||||| || |||||||| |||||||| |||||| | ||||||||||||
Sbjct: 206 gtggccaccagggagcttgtccttgatgttctccatgatgcccttcttc 158



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 42/48 (87%)
 Strand = Plus / Minus

                                                           
Query: 219 agcttctccttgatcttgtccatgatccccttcttctcgccggtgccg 266
           ||||| |||||||| || ||||| |  |||||||||||||||||||||
Sbjct: 394 agcttttccttgatgttctccattacacccttcttctcgccggtgccg 347

---

>gb|AY349227.1| Hordeum vulgare subsp. spontaneum NPGS PI 254894 dehydrin 5 (Dhn5)
            gene, partial cds
          Length = 1049

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 56/62 (90%)
 Strand = Plus / Minus

                                                                        
Query: 205  agtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccggtgc 264
            |||||||||| |||||||| |||||||||||||||||||  | |||||||||||| ||||
Sbjct: 1002 agtgctgtccaggcagcttgtccttgatcttgtccatgaggctcttcttctcgcccgtgc 943

              
Query: 265  cg 266
            ||
Sbjct: 942  cg 941



 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 44/48 (91%)
 Strand = Plus / Minus

                                                           
Query: 219 agcttctccttgatcttgtccatgatccccttcttctcgccggtgccg 266
           |||||||||||||| || |||||||  |||||||||||||||||||||
Sbjct: 778 agcttctccttgatgttctccatgacacccttcttctcgccggtgccg 731



 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 42/46 (91%)
 Strand = Plus / Minus

                                                         
Query: 219 agcttctccttgatcttgtccatgatccccttcttctcgccggtgc 264
           |||||||||||||| || |||||||  |||||||||||||||||||
Sbjct: 586 agcttctccttgatgttttccatgacgcccttcttctcgccggtgc 541



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                           
Query: 360 tgctggttgtccttgtggccgccggggagcttctccttgatcttctcc 407
           ||||||| |||  ||||||| |||||||||||||||||||| ||||||
Sbjct: 805 tgctggtggtcactgtggccaccggggagcttctccttgatgttctcc 758



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                           
Query: 219 agcttctccttgatcttgtccatgatccccttcttctcgccggtgccg 266
           ||||| |||||||| || |||||||| |||||||||||||| ||||||
Sbjct: 193 agcttgtccttgatgttctccatgatgcccttcttctcgccagtgccg 146



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                            
Query: 374 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttc 422
           |||||| |||||||||||||||||||| || ||| | | ||||||||||
Sbjct: 599 gtggccaccggggagcttctccttgatgttttccatgacgcccttcttc 551



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                            
Query: 374 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttc 422
           |||||| || |||||||| |||||||| |||||| | ||||||||||||
Sbjct: 206 gtggccaccagggagcttgtccttgatgttctccatgatgcccttcttc 158



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 42/48 (87%)
 Strand = Plus / Minus

                                                           
Query: 219 agcttctccttgatcttgtccatgatccccttcttctcgccggtgccg 266
           ||||| |||||||| || ||||| |  |||||||||||||||||||||
Sbjct: 394 agcttttccttgatgttctccattacacccttcttctcgccggtgccg 347

---

>gb|AY349226.1| Hordeum vulgare subsp. spontaneum NPGS PI 253933 dehydrin 5 (Dhn5)
           gene, partial cds
          Length = 446

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 56/62 (90%)
 Strand = Plus / Minus

                                                                       
Query: 205 agtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccggtgc 264
           |||||||||| |||||||| |||||||||||||||||||  | |||||||||||| ||||
Sbjct: 399 agtgctgtccaggcagcttgtccttgatcttgtccatgaggctcttcttctcgcccgtgc 340

             
Query: 265 cg 266
           ||
Sbjct: 339 cg 338



 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 44/48 (91%)
 Strand = Plus / Minus

                                                           
Query: 219 agcttctccttgatcttgtccatgatccccttcttctcgccggtgccg 266
           |||||||||||||| || |||||||  |||||||||||||||||||||
Sbjct: 169 agcttctccttgatgttctccatgacacccttcttctcgccggtgccg 122



 Score = 46.1 bits (23), Expect = 0.12
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 373 tgtggccgccggggagcttctccttgatcttctcc 407
           ||||||| ||||| |||||||||||||| ||||||
Sbjct: 183 tgtggccaccgggaagcttctccttgatgttctcc 149

---

>gb|AY349225.1| Hordeum vulgare subsp. spontaneum NPGS PI 253933 dehydrin 5 (Dhn5)
           gene, partial cds
          Length = 446

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 56/62 (90%)
 Strand = Plus / Minus

                                                                       
Query: 205 agtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccggtgc 264
           |||||||||| |||||||| |||||||||||||||||||  | |||||||||||| ||||
Sbjct: 399 agtgctgtccaggcagcttgtccttgatcttgtccatgaggctcttcttctcgcccgtgc 340

             
Query: 265 cg 266
           ||
Sbjct: 339 cg 338



 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 44/48 (91%)
 Strand = Plus / Minus

                                                           
Query: 219 agcttctccttgatcttgtccatgatccccttcttctcgccggtgccg 266
           |||||||||||||| || |||||||  |||||||||||||||||||||
Sbjct: 169 agcttctccttgatgttctccatgacacccttcttctcgccggtgccg 122



 Score = 46.1 bits (23), Expect = 0.12
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 373 tgtggccgccggggagcttctccttgatcttctcc 407
           ||||||| ||||| |||||||||||||| ||||||
Sbjct: 183 tgtggccaccgggaagcttctccttgatgttctcc 149

---

>gb|AY349224.1| Hordeum vulgare subsp. spontaneum NPGS PI 236388 dehydrin 5 (Dhn5)
            gene, partial cds
          Length = 1049

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 56/62 (90%)
 Strand = Plus / Minus

                                                                        
Query: 205  agtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccggtgc 264
            |||||||||| |||||||| |||||||||||||||||||  | |||||||||||| ||||
Sbjct: 1002 agtgctgtccaggcagcttgtccttgatcttgtccatgaggctcttcttctcgcccgtgc 943

              
Query: 265  cg 266
            ||
Sbjct: 942  cg 941



 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 44/48 (91%)
 Strand = Plus / Minus

                                                           
Query: 219 agcttctccttgatcttgtccatgatccccttcttctcgccggtgccg 266
           |||||||||||||| || |||||||  |||||||||||||||||||||
Sbjct: 778 agcttctccttgatgttctccatgacacccttcttctcgccggtgccg 731



 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 44/48 (91%)
 Strand = Plus / Minus

                                                           
Query: 219 agcttctccttgatcttgtccatgatccccttcttctcgccggtgccg 266
           |||||||||||||| || |||||||| |||||||||||||| ||||||
Sbjct: 193 agcttctccttgatgttctccatgatgcccttcttctcgccagtgccg 146



 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 42/46 (91%)
 Strand = Plus / Minus

                                                         
Query: 219 agcttctccttgatcttgtccatgatccccttcttctcgccggtgc 264
           |||||||||||||| || |||||||  |||||||||||||||||||
Sbjct: 586 agcttctccttgatgttttccatgacgcccttcttctcgccggtgc 541



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 44/49 (89%)
 Strand = Plus / Minus

                                                            
Query: 374 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttc 422
           |||||| || ||||||||||||||||| |||||| | ||||||||||||
Sbjct: 206 gtggccaccagggagcttctccttgatgttctccatgatgcccttcttc 158



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                           
Query: 360 tgctggttgtccttgtggccgccggggagcttctccttgatcttctcc 407
           ||||||| |||  ||||||| |||||||||||||||||||| ||||||
Sbjct: 805 tgctggtggtcactgtggccaccggggagcttctccttgatgttctcc 758



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                            
Query: 374 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttc 422
           |||||| |||||||||||||||||||| || ||| | | ||||||||||
Sbjct: 599 gtggccaccggggagcttctccttgatgttttccatgacgcccttcttc 551



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 42/48 (87%)
 Strand = Plus / Minus

                                                           
Query: 219 agcttctccttgatcttgtccatgatccccttcttctcgccggtgccg 266
           ||||| |||||||| || ||||| |  |||||||||||||||||||||
Sbjct: 394 agcttttccttgatgttctccattacacccttcttctcgccggtgccg 347

---

>gb|AY349223.1| Hordeum vulgare subsp. spontaneum NPGS PI 220523 dehydrin 5 (Dhn5)
            gene, partial cds
          Length = 1055

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 56/62 (90%)
 Strand = Plus / Minus

                                                                        
Query: 205  agtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccggtgc 264
            |||||||||| |||||||| |||||||||||||||||||  | |||||||||||| ||||
Sbjct: 1008 agtgctgtccaggcagcttgtccttgatcttgtccatgaggctcttcttctcgcccgtgc 949

              
Query: 265  cg 266
            ||
Sbjct: 948  cg 947



 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 44/48 (91%)
 Strand = Plus / Minus

                                                           
Query: 219 agcttctccttgatcttgtccatgatccccttcttctcgccggtgccg 266
           |||||||||||||| || |||||||  |||||||||||||||||||||
Sbjct: 778 agcttctccttgatgttctccatgacacccttcttctcgccggtgccg 731



 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 44/48 (91%)
 Strand = Plus / Minus

                                                           
Query: 219 agcttctccttgatcttgtccatgatccccttcttctcgccggtgccg 266
           |||||||||||||| || |||||||| |||||||||||||| ||||||
Sbjct: 193 agcttctccttgatgttctccatgatgcccttcttctcgccagtgccg 146



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 44/49 (89%)
 Strand = Plus / Minus

                                                            
Query: 374 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttc 422
           |||||| || ||||||||||||||||| |||||| | ||||||||||||
Sbjct: 206 gtggccaccagggagcttctccttgatgttctccatgatgcccttcttc 158



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 41/46 (89%)
 Strand = Plus / Minus

                                                         
Query: 219 agcttctccttgatcttgtccatgatccccttcttctcgccggtgc 264
           ||||| |||||||| || |||||||  |||||||||||||||||||
Sbjct: 586 agcttatccttgatgttttccatgacgcccttcttctcgccggtgc 541



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 42/48 (87%)
 Strand = Plus / Minus

                                                           
Query: 219 agcttctccttgatcttgtccatgatccccttcttctcgccggtgccg 266
           ||||| |||||||| || ||||| |  |||||||||||||||||||||
Sbjct: 394 agcttttccttgatgttctccattacacccttcttctcgccggtgccg 347



 Score = 46.1 bits (23), Expect = 0.12
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 373 tgtggccgccggggagcttctccttgatcttctcc 407
           ||||||| ||||| |||||||||||||| ||||||
Sbjct: 792 tgtggccaccgggaagcttctccttgatgttctcc 758



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 42/49 (85%)
 Strand = Plus / Minus

                                                            
Query: 374 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttc 422
           |||||| ||||||||||| |||||||| || ||| | | ||||||||||
Sbjct: 599 gtggccaccggggagcttatccttgatgttttccatgacgcccttcttc 551

---

>gb|AY349222.1| Hordeum vulgare subsp. spontaneum NPGS PI 219796 dehydrin 5 (Dhn5)
            gene, partial cds
          Length = 1049

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 56/62 (90%)
 Strand = Plus / Minus

                                                                        
Query: 205  agtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccggtgc 264
            |||||||||| |||||||| |||||||||||||||||||  | |||||||||||| ||||
Sbjct: 1002 agtgctgtccaggcagcttgtccttgatcttgtccatgaggctcttcttctcgcccgtgc 943

              
Query: 265  cg 266
            ||
Sbjct: 942  cg 941



 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 44/48 (91%)
 Strand = Plus / Minus

                                                           
Query: 219 agcttctccttgatcttgtccatgatccccttcttctcgccggtgccg 266
           |||||||||||||| || |||||||  |||||||||||||||||||||
Sbjct: 778 agcttctccttgatgttctccatgacacccttcttctcgccggtgccg 731



 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 42/46 (91%)
 Strand = Plus / Minus

                                                         
Query: 219 agcttctccttgatcttgtccatgatccccttcttctcgccggtgc 264
           |||||||||||||| || |||||||  |||||||||||||||||||
Sbjct: 586 agcttctccttgatgttttccatgacgcccttcttctcgccggtgc 541



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                           
Query: 360 tgctggttgtccttgtggccgccggggagcttctccttgatcttctcc 407
           ||||||| |||  ||||||| |||||||||||||||||||| ||||||
Sbjct: 805 tgctggtggtcactgtggccaccggggagcttctccttgatgttctcc 758



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                           
Query: 219 agcttctccttgatcttgtccatgatccccttcttctcgccggtgccg 266
           ||||| |||||||| || |||||||| |||||||||||||| ||||||
Sbjct: 193 agcttgtccttgatgttctccatgatgcccttcttctcgccagtgccg 146



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                            
Query: 374 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttc 422
           |||||| |||||||||||||||||||| || ||| | | ||||||||||
Sbjct: 599 gtggccaccggggagcttctccttgatgttttccatgacgcccttcttc 551



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                            
Query: 374 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttc 422
           |||||| || |||||||| |||||||| |||||| | ||||||||||||
Sbjct: 206 gtggccaccagggagcttgtccttgatgttctccatgatgcccttcttc 158



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 42/48 (87%)
 Strand = Plus / Minus

                                                           
Query: 219 agcttctccttgatcttgtccatgatccccttcttctcgccggtgccg 266
           ||||| |||||||| || ||||| |  |||||||||||||||||||||
Sbjct: 394 agcttttccttgatgttctccattacacccttcttctcgccggtgccg 347

---

>gb|AY349221.1| Hordeum vulgare subsp. spontaneum NPGS PI 212306 dehydrin 5 (Dhn5)
            gene, partial cds
          Length = 1049

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 56/62 (90%)
 Strand = Plus / Minus

                                                                        
Query: 205  agtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccggtgc 264
            |||||||||| |||||||| |||||||||||||||||||  | |||||||||||| ||||
Sbjct: 1002 agtgctgtccaggcagcttgtccttgatcttgtccatgaggctcttcttctcgcccgtgc 943

              
Query: 265  cg 266
            ||
Sbjct: 942  cg 941



 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 44/48 (91%)
 Strand = Plus / Minus

                                                           
Query: 219 agcttctccttgatcttgtccatgatccccttcttctcgccggtgccg 266
           |||||||||||||| || |||||||  |||||||||||||||||||||
Sbjct: 778 agcttctccttgatgttctccatgacacccttcttctcgccggtgccg 731



 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 42/46 (91%)
 Strand = Plus / Minus

                                                         
Query: 219 agcttctccttgatcttgtccatgatccccttcttctcgccggtgc 264
           |||||||||||||| || |||||||  |||||||||||||||||||
Sbjct: 586 agcttctccttgatgttttccatgacgcccttcttctcgccggtgc 541



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                           
Query: 360 tgctggttgtccttgtggccgccggggagcttctccttgatcttctcc 407
           ||||||| |||  ||||||| |||||||||||||||||||| ||||||
Sbjct: 805 tgctggtggtcactgtggccaccggggagcttctccttgatgttctcc 758



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                           
Query: 219 agcttctccttgatcttgtccatgatccccttcttctcgccggtgccg 266
           ||||| |||||||| || |||||||| |||||||||||||| ||||||
Sbjct: 193 agcttgtccttgatgttctccatgatgcccttcttctcgccagtgccg 146



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                            
Query: 374 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttc 422
           |||||| |||||||||||||||||||| || ||| | | ||||||||||
Sbjct: 599 gtggccaccggggagcttctccttgatgttttccatgacgcccttcttc 551



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                            
Query: 374 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttc 422
           |||||| || |||||||| |||||||| |||||| | ||||||||||||
Sbjct: 206 gtggccaccagggagcttgtccttgatgttctccatgatgcccttcttc 158



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 42/48 (87%)
 Strand = Plus / Minus

                                                           
Query: 219 agcttctccttgatcttgtccatgatccccttcttctcgccggtgccg 266
           ||||| |||||||| || ||||| |  |||||||||||||||||||||
Sbjct: 394 agcttttccttgatgttctccattacacccttcttctcgccggtgccg 347

---

>gb|AY349220.1| Hordeum vulgare subsp. spontaneum NPGS PI 212305 dehydrin 5 (Dhn5)
            gene, partial cds
          Length = 1055

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 56/62 (90%)
 Strand = Plus / Minus

                                                                        
Query: 205  agtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccggtgc 264
            |||||||||| |||||||| |||||||||||||||||||  | |||||||||||| ||||
Sbjct: 1008 agtgctgtccaggcagcttgtccttgatcttgtccatgaggctcttcttctcgcccgtgc 949

              
Query: 265  cg 266
            ||
Sbjct: 948  cg 947



 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 45/48 (93%)
 Strand = Plus / Minus

                                                           
Query: 219 agcttctccttgatcttgtccatgatccccttcttctcgccggtgccg 266
           |||||||||||||| || |||||||| |||||||||||||||||||||
Sbjct: 193 agcttctccttgatgttctccatgatgcccttcttctcgccggtgccg 146



 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 44/48 (91%)
 Strand = Plus / Minus

                                                           
Query: 219 agcttctccttgatcttgtccatgatccccttcttctcgccggtgccg 266
           |||||||||||||| || |||||||  |||||||||||||||||||||
Sbjct: 778 agcttctccttgatgttctccatgacacccttcttctcgccggtgccg 731



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 44/49 (89%)
 Strand = Plus / Minus

                                                            
Query: 374 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttc 422
           |||||| || ||||||||||||||||| |||||| | ||||||||||||
Sbjct: 206 gtggccaccagggagcttctccttgatgttctccatgatgcccttcttc 158



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 41/46 (89%)
 Strand = Plus / Minus

                                                         
Query: 219 agcttctccttgatcttgtccatgatccccttcttctcgccggtgc 264
           ||||| |||||||| || |||||||  |||||||||||||||||||
Sbjct: 586 agcttatccttgatgttttccatgacgcccttcttctcgccggtgc 541



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 42/48 (87%)
 Strand = Plus / Minus

                                                           
Query: 219 agcttctccttgatcttgtccatgatccccttcttctcgccggtgccg 266
           ||||| |||||||| || ||||| |  |||||||||||||||||||||
Sbjct: 394 agcttttccttgatgttctccattacacccttcttctcgccggtgccg 347



 Score = 46.1 bits (23), Expect = 0.12
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 373 tgtggccgccggggagcttctccttgatcttctcc 407
           ||||||| ||||| |||||||||||||| ||||||
Sbjct: 792 tgtggccaccgggaagcttctccttgatgttctcc 758



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 42/49 (85%)
 Strand = Plus / Minus

                                                            
Query: 374 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttc 422
           |||||| ||||||||||| |||||||| || ||| | | ||||||||||
Sbjct: 599 gtggccaccggggagcttatccttgatgttttccatgacgcccttcttc 551



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                            
Query: 375 tggccgccggggagcttctccttgatcttctcc 407
           ||||| ||||||||||| |||||||| ||||||
Sbjct: 406 tggccaccggggagcttttccttgatgttctcc 374

---

>gb|AF043096.1|AF043096 Hordeum vulgare dehydrin 5 (dhn5) gene, complete cds
          Length = 2814

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 56/62 (90%)
 Strand = Plus / Minus

                                                                        
Query: 205  agtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccggtgc 264
            |||||||||| |||||||| |||||||||||||||||||  | |||||||||||| ||||
Sbjct: 2322 agtgctgtccaggcagcttgtccttgatcttgtccatgaggctcttcttctcgcccgtgc 2263

              
Query: 265  cg 266
            ||
Sbjct: 2262 cg 2261



 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 46/49 (93%)
 Strand = Plus / Minus

                                                            
Query: 374 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttc 422
           ||||||||||||||| |||||||||||||||||| | ||||||||||||
Sbjct: 674 gtggccgccggggagtttctccttgatcttctccatgatgcccttcttc 626



 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 44/48 (91%)
 Strand = Plus / Minus

                                                            
Query: 219  agcttctccttgatcttgtccatgatccccttcttctcgccggtgccg 266
            |||||||||||||| || |||||||  |||||||||||||||||||||
Sbjct: 2098 agcttctccttgatgttctccatgacacccttcttctcgccggtgccg 2051



 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 44/48 (91%)
 Strand = Plus / Minus

                                                            
Query: 219  agcttctccttgatcttgtccatgatccccttcttctcgccggtgccg 266
            |||||||||||||| || |||||||| |||||||||||||| ||||||
Sbjct: 1513 agcttctccttgatgttctccatgatgcccttcttctcgccagtgccg 1466



 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 38/40 (95%)
 Strand = Plus / Minus

                                                   
Query: 222 ttctccttgatcttgtccatgatccccttcttctcgccgg 261
           |||||||||||||| |||||||| ||||||||||||||||
Sbjct: 658 ttctccttgatcttctccatgatgcccttcttctcgccgg 619



 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 42/46 (91%)
 Strand = Plus / Minus

                                                          
Query: 219  agcttctccttgatcttgtccatgatccccttcttctcgccggtgc 264
            |||||||||||||| || |||||||  |||||||||||||||||||
Sbjct: 1906 agcttctccttgatgttttccatgacgcccttcttctcgccggtgc 1861



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 44/49 (89%)
 Strand = Plus / Minus

                                                             
Query: 374  gtggccgccggggagcttctccttgatcttctccttcatgcccttcttc 422
            |||||| || ||||||||||||||||| |||||| | ||||||||||||
Sbjct: 1526 gtggccaccagggagcttctccttgatgttctccatgatgcccttcttc 1478



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                            
Query: 360  tgctggttgtccttgtggccgccggggagcttctccttgatcttctcc 407
            ||||||| |||  ||||||| |||||||||||||||||||| ||||||
Sbjct: 2125 tgctggtggtcactgtggccaccggggagcttctccttgatgttctcc 2078



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                            
Query: 219  agcttctccttgatcttgtccatgatccccttcttctcgccggtgccg 266
            ||||| |||||||| || |||||||  |||||||||||||||||||||
Sbjct: 1120 agcttgtccttgatgttctccatgacgcccttcttctcgccggtgccg 1073



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 39/43 (90%)
 Strand = Plus / Minus

                                                      
Query: 219 agcttctccttgatcttgtccatgatccccttcttctcgccgg 261
           ||||| ||||||||||| |||||||  ||||||||||||||||
Sbjct: 859 agcttgtccttgatcttctccatgaggcccttcttctcgccgg 817



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                             
Query: 374  gtggccgccggggagcttctccttgatcttctccttcatgcccttcttc 422
            |||||| |||||||||||||||||||| || ||| | | ||||||||||
Sbjct: 1919 gtggccaccggggagcttctccttgatgttttccatgacgcccttcttc 1871



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                            
Query: 374 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttc 422
           |||||| || |||||||| ||||||||||||||| | | ||||||||||
Sbjct: 872 gtggccaccagggagcttgtccttgatcttctccatgaggcccttcttc 824



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 42/48 (87%)
 Strand = Plus / Minus

                                                            
Query: 219  agcttctccttgatcttgtccatgatccccttcttctcgccggtgccg 266
            ||||| |||||||| || ||||| |  |||||||||||||||||||||
Sbjct: 1714 agcttttccttgatgttctccattacacccttcttctcgccggtgccg 1667



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 42/48 (87%)
 Strand = Plus / Minus

                                                            
Query: 219  agcttctccttgatcttgtccatgatccccttcttctcgccggtgccg 266
            ||||| |||||||| || ||||| |  |||||||||||||||||||||
Sbjct: 1321 agcttatccttgatgttctccattacacccttcttctcgccggtgccg 1274

---

>gb|AF181461.1|AF181461 Hordeum vulgare dehydrin (Dhn11) gene, complete cds
          Length = 2009

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 52/57 (91%)
 Strand = Plus / Minus

                                                                     
Query: 201  gctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcg 257
            |||||||| ||||| || ||||||||||||||||| |||||||| ||||||||||||
Sbjct: 1641 gctcagtggtgtccagggagcttctccttgatcttctccatgatacccttcttctcg 1585



 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 39/42 (92%)
 Strand = Plus / Minus

                                                      
Query: 387  agcttctccttgatcttctccttcatgcccttcttcctcctc 428
            ||||||||||| ||||||||||| |||||||||||| |||||
Sbjct: 1512 agcttctcctttatcttctccttgatgcccttcttcttcctc 1471



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                   
Query: 384  gggagcttctccttgatcttctccttcatgcccttcttc 422
            |||||||||||||||||||||||| | || |||||||||
Sbjct: 1626 gggagcttctccttgatcttctccatgatacccttcttc 1588



 Score = 46.1 bits (23), Expect = 0.12
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                       
Query: 213  cccggcagcttctccttgatcttgtccatgatccccttcttct 255
            ||||| ||||||||||| ||||| ||| |||| ||||||||||
Sbjct: 1518 cccggaagcttctcctttatcttctccttgatgcccttcttct 1476



 Score = 44.1 bits (22), Expect = 0.46
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                      
Query: 456  gagctggagctggagctgccggagcg 481
            |||||||| |||||||||||||||||
Sbjct: 1326 gagctggaactggagctgccggagcg 1301

---

>gb|AF043086.1|AF043086 Hordeum vulgare dehydrin 11 (dhn11) gene, complete cds
          Length = 2420

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 52/57 (91%)
 Strand = Plus / Minus

                                                                     
Query: 201  gctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcg 257
            |||||||| ||||| || ||||||||||||||||| |||||||| ||||||||||||
Sbjct: 1649 gctcagtggtgtccagggagcttctccttgatcttctccatgatacccttcttctcg 1593



 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 39/42 (92%)
 Strand = Plus / Minus

                                                      
Query: 387  agcttctccttgatcttctccttcatgcccttcttcctcctc 428
            ||||||||||| ||||||||||| |||||||||||| |||||
Sbjct: 1520 agcttctcctttatcttctccttgatgcccttcttcttcctc 1479



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                   
Query: 384  gggagcttctccttgatcttctccttcatgcccttcttc 422
            |||||||||||||||||||||||| | || |||||||||
Sbjct: 1634 gggagcttctccttgatcttctccatgatacccttcttc 1596



 Score = 46.1 bits (23), Expect = 0.12
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                       
Query: 213  cccggcagcttctccttgatcttgtccatgatccccttcttct 255
            ||||| ||||||||||| ||||| ||| |||| ||||||||||
Sbjct: 1526 cccggaagcttctcctttatcttctccttgatgcccttcttct 1484



 Score = 44.1 bits (22), Expect = 0.46
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                      
Query: 456  gagctggagctggagctgccggagcg 481
            |||||||| |||||||||||||||||
Sbjct: 1334 gagctggaactggagctgccggagcg 1309

---

>gb|AY465376.1| Prunus persica dehydrin 2 mRNA, complete cds
          Length = 829

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 48/52 (92%)
 Strand = Plus / Minus

                                                               
Query: 205 agtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctc 256
           |||| ||||| || || |||||||||||||||||||||||||||||||||||
Sbjct: 699 agtgttgtccgggaagtttctccttgatcttgtccatgatccccttcttctc 648



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 35/37 (94%)
 Strand = Plus / Minus

                                                
Query: 216 ggcagcttctccttgatcttgtccatgatccccttct 252
           ||||||||||||||||||||||||||  |||||||||
Sbjct: 544 ggcagcttctccttgatcttgtccatcgtccccttct 508



 Score = 46.1 bits (23), Expect = 0.12
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 387 agcttctccttgatcttctccttcatgcccttcttcctcctcc 429
           ||||||||||| | |||||||||||  ||||||||| ||||||
Sbjct: 442 agcttctcctttaccttctccttcaaccccttcttcttcctcc 400

---

>gb|AF172263.1| Prunus dulcis abscisic acid response protein (rab21) mRNA, complete
           cds
          Length = 897

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 48/52 (92%)
 Strand = Plus / Minus

                                                               
Query: 205 agtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctc 256
           |||| ||||| || || |||||||||||||||||||||||||||||||||||
Sbjct: 693 agtgttgtccgggaagtttctccttgatcttgtccatgatccccttcttctc 642



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 35/37 (94%)
 Strand = Plus / Minus

                                                
Query: 216 ggcagcttctccttgatcttgtccatgatccccttct 252
           ||||||||||||||||||||||||||  |||||||||
Sbjct: 538 ggcagcttctccttgatcttgtccatcgtccccttct 502



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 387 agcttctccttgatcttctccttcatgcccttcttcctcct 427
           ||||||| ||| |||||||||||||  ||||||||| ||||
Sbjct: 436 agcttcttctttatcttctccttcaaccccttcttcttcct 396

---

>emb|X78432.1|TDDEH38 T.durum Desf. (Siliana) Dehydrin mRNA, clone pTd38
          Length = 555

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 45/48 (93%)
 Strand = Plus / Minus

                                                           
Query: 219 agcttctccttgatcttgtccatgatccccttcttctcgccggtgccg 266
           |||||||||||||| || |||||||| |||||||||||||||||||||
Sbjct: 128 agcttctccttgatgttctccatgatgcccttcttctcgccggtgccg 81



 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 55/62 (88%)
 Strand = Plus / Minus

                                                                       
Query: 205 agtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccggtgc 264
           |||||||||| |||||||||||||| | |||||||||||  | ||||||||| |||||||
Sbjct: 343 agtgctgtccaggcagcttctccttcaccttgtccatgaggctcttcttctcaccggtgc 284

             
Query: 265 cg 266
           ||
Sbjct: 283 cg 282



 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 44/48 (91%)
 Strand = Plus / Minus

                                                           
Query: 375 tggccgccggggagcttctccttgatcttctccttcatgcccttcttc 422
           ||||| |||||||||||||||||||| |||||| | ||||||||||||
Sbjct: 140 tggccaccggggagcttctccttgatgttctccatgatgcccttcttc 93

---

>emb|X78430.1|TDDEH25 T.durum Desf. (Siliana) Dehydrin mRNA, clone pTd25a
          Length = 565

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 45/48 (93%)
 Strand = Plus / Minus

                                                           
Query: 219 agcttctccttgatcttgtccatgatccccttcttctcgccggtgccg 266
           |||||||||||||| || |||||||| |||||||||||||||||||||
Sbjct: 134 agcttctccttgatgttctccatgatgcccttcttctcgccggtgccg 87



 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 55/62 (88%)
 Strand = Plus / Minus

                                                                       
Query: 205 agtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccggtgc 264
           |||||||||| |||||||||||||| | |||||||||||  | ||||||||| |||||||
Sbjct: 349 agtgctgtccaggcagcttctccttcaccttgtccatgaggctcttcttctcaccggtgc 290

             
Query: 265 cg 266
           ||
Sbjct: 289 cg 288



 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 44/48 (91%)
 Strand = Plus / Minus

                                                           
Query: 375 tggccgccggggagcttctccttgatcttctccttcatgcccttcttc 422
           ||||| |||||||||||||||||||| |||||| | ||||||||||||
Sbjct: 146 tggccaccggggagcttctccttgatgttctccatgatgcccttcttc 99

---

>gb|DQ160121.1| Taraxacum officinale TO101-3 (To101-3) mRNA, partial cds
          Length = 322

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 38/39 (97%)
 Strand = Plus / Minus

                                                  
Query: 369 tccttgtggccgccggggagcttctccttgatcttctcc 407
           ||||||||||||||||| |||||||||||||||||||||
Sbjct: 224 tccttgtggccgccgggaagcttctccttgatcttctcc 186



 Score = 44.1 bits (22), Expect = 0.46
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 219 agcttctccttgatcttgtccatgatccccttcttctc 256
           ||||||||||||||||| ||||| | |||||| |||||
Sbjct: 206 agcttctccttgatcttctccataaacccctttttctc 169

---

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 53/59 (89%)
 Strand = Plus / Minus

                                                                           
Query: 371      cttgtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcctcc 429
                |||||||| |||||| ||||||||||| ||||||||||| |||| ||||||| ||||||
Sbjct: 29117510 cttgtggctgccgggaagcttctcctttatcttctccttgatgctcttcttcttcctcc 29117452



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 40/43 (93%)
 Strand = Plus / Minus

                                                           
Query: 380      gccggggagcttctccttgatcttctccttcatgcccttcttc 422
                ||||||||||||||||||||||||||||   ||||||||||||
Sbjct: 29117639 gccggggagcttctccttgatcttctccacgatgcccttcttc 29117597



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                       
Query: 219      agcttctccttgatcttgtccatgatccccttcttctcg 257
                ||||||||||||||||| |||| ||| ||||||||||||
Sbjct: 29117632 agcttctccttgatcttctccacgatgcccttcttctcg 29117594



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 453    gacgagctggagctggagctg 473
              |||||||||||||||||||||
Sbjct: 604245 gacgagctggagctggagctg 604265



 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 414      cccttcttcctcctcccgcc 433
                ||||||||||||||||||||
Sbjct: 41371466 cccttcttcctcctcccgcc 41371485



 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 414      cccttcttcctcctcccgcc 433
                ||||||||||||||||||||
Sbjct: 28500087 cccttcttcctcctcccgcc 28500106



 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 414     cccttcttcctcctcccgcc 433
               ||||||||||||||||||||
Sbjct: 6067964 cccttcttcctcctcccgcc 6067945



 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 414     cccttcttcctcctcccgcc 433
               ||||||||||||||||||||
Sbjct: 2233342 cccttcttcctcctcccgcc 2233361

---

>dbj|AP003245.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0421H07
          Length = 158126

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 53/59 (89%)
 Strand = Plus / Minus

                                                                        
Query: 371   cttgtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcctcc 429
             |||||||| |||||| ||||||||||| ||||||||||| |||| ||||||| ||||||
Sbjct: 77876 cttgtggctgccgggaagcttctcctttatcttctccttgatgctcttcttcttcctcc 77818



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 40/43 (93%)
 Strand = Plus / Minus

                                                        
Query: 380   gccggggagcttctccttgatcttctccttcatgcccttcttc 422
             ||||||||||||||||||||||||||||   ||||||||||||
Sbjct: 78005 gccggggagcttctccttgatcttctccacgatgcccttcttc 77963



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                    
Query: 219   agcttctccttgatcttgtccatgatccccttcttctcg 257
             ||||||||||||||||| |||| ||| ||||||||||||
Sbjct: 77998 agcttctccttgatcttctccacgatgcccttcttctcg 77960

---

>dbj|AB076807.1| Triticum aestivum Wdhn13 mRNA for LEA D-11 dehydrin, complete cds
          Length = 657

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 57/65 (87%)
 Strand = Plus / Minus

                                                                       
Query: 200 ggctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgcc 259
           |||| |||||||||| |||||||| ||||||||||||||||| || | ||| ||||| ||
Sbjct: 388 ggcttagtgctgtccaggcagcttgtccttgatcttgtccatcatgctcttgttctcacc 329

                
Query: 260 ggtgc 264
           |||||
Sbjct: 328 ggtgc 324



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                            
Query: 219 agcttctccttgatcttgtccatgatccccttcttctcgccggtgccgg 267
           |||||||||||||| || || | ||  ||||||||||||||||||||||
Sbjct: 207 agcttctccttgatgttctcgacgacgcccttcttctcgccggtgccgg 159

---

>emb|X64327.1|LGNPR1 L.gibba gene NPR1 (negatively phytochrome regulated 1)
          Length = 1573

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 41/44 (93%)
 Strand = Plus / Minus

                                                        
Query: 213  cccggcagcttctccttgatcttgtccatgatccccttcttctc 256
            ||||||||||||||||| ||||| ||||| ||||||||||||||
Sbjct: 1479 cccggcagcttctcctttatcttctccattatccccttcttctc 1436



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 39/43 (90%)
 Strand = Plus / Minus

                                                       
Query: 213  cccggcagcttctccttgatcttgtccatgatccccttcttct 255
            ||||||| ||| ||||||||||| |||||||| ||||||||||
Sbjct: 1368 cccggcatcttatccttgatcttctccatgatgcccttcttct 1326



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 51/59 (86%), Gaps = 3/59 (5%)
 Strand = Plus / Minus

                                                                       
Query: 393  tccttgatcttctccttcatgcccttctt---cctcctcccgcccatgccgtcgtcctc 448
            ||||||||||||||| | |||||||||||   ||||||||| ||||| ||||| |||||
Sbjct: 1356 tccttgatcttctccatgatgcccttcttcttcctcctccctcccatcccgtcatcctc 1298



 Score = 40.1 bits (20), Expect = 7.2
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                                
Query: 387  agcttctccttgatcttctccttcatgcccttcttc 422
            ||||||||||| ||||||||| | || |||||||||
Sbjct: 1473 agcttctcctttatcttctccattatccccttcttc 1438

---

>ref|NM_126038.2| Arabidopsis thaliana RAB18 (RESPONSIVE TO ABA 18) AT5G66400 (RAB18)
           transcript variant AT5G66400.1 mRNA, complete cds
          Length = 864

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 37/39 (94%)
 Strand = Plus / Minus

                                                  
Query: 219 agcttctccttgatcttgtccatgatccccttcttctcg 257
           ||||| ||||||||||||||||| |||||||||||||||
Sbjct: 631 agcttttccttgatcttgtccatcatccccttcttctcg 593



 Score = 44.1 bits (22), Expect = 0.46
 Identities = 37/42 (88%)
 Strand = Plus / Minus

                                                     
Query: 381 ccggggagcttctccttgatcttctccttcatgcccttcttc 422
           ||||| ||||| ||||||||||| ||| |||| |||||||||
Sbjct: 637 ccgggaagcttttccttgatcttgtccatcatccccttcttc 596

---

>ref|NM_001037085.1| Arabidopsis thaliana RAB18 (RESPONSIVE TO ABA 18) AT5G66400 (RAB18)
           transcript variant AT5G66400.2 mRNA, complete cds
          Length = 881

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 37/39 (94%)
 Strand = Plus / Minus

                                                  
Query: 219 agcttctccttgatcttgtccatgatccccttcttctcg 257
           ||||| ||||||||||||||||| |||||||||||||||
Sbjct: 628 agcttttccttgatcttgtccatcatccccttcttctcg 590



 Score = 44.1 bits (22), Expect = 0.46
 Identities = 37/42 (88%)
 Strand = Plus / Minus

                                                     
Query: 381 ccggggagcttctccttgatcttctccttcatgcccttcttc 422
           ||||| ||||| ||||||||||| ||| |||| |||||||||
Sbjct: 634 ccgggaagcttttccttgatcttgtccatcatccccttcttc 593

---

>gb|L04173.1|ATH18RAB Arabidopsis thaliana glycine rich protein (RAB18) gene, complete cds
          Length = 1676

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 37/39 (94%)
 Strand = Plus / Minus

                                                   
Query: 219  agcttctccttgatcttgtccatgatccccttcttctcg 257
            ||||| ||||||||||||||||| |||||||||||||||
Sbjct: 1381 agcttttccttgatcttgtccatcatccccttcttctcg 1343



 Score = 44.1 bits (22), Expect = 0.46
 Identities = 37/42 (88%)
 Strand = Plus / Minus

                                                      
Query: 381  ccggggagcttctccttgatcttctccttcatgcccttcttc 422
            ||||| ||||| ||||||||||| ||| |||| |||||||||
Sbjct: 1387 ccgggaagcttttccttgatcttgtccatcatccccttcttc 1346

---

>emb|X74067.1|CPCDET619 Craterostigma plantagineum CDeT6-19 gene for dessication-related
            protein
          Length = 1742

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 43/47 (91%)
 Strand = Plus / Minus

                                                           
Query: 375  tggccgccggggagcttctccttgatcttctccttcatgcccttctt 421
            ||||||||||| ||||||||||| ||||| |||||||| ||||||||
Sbjct: 1415 tggccgccgggaagcttctccttcatcttgtccttcatccccttctt 1369



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                  
Query: 219  agcttctccttgatcttgtccatgatccccttcttctc 256
            |||||||| ||||||||||||||||| ||||| |||||
Sbjct: 1517 agcttctctttgatcttgtccatgatgccctttttctc 1480



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                        
Query: 375  tggccgccggggagcttctccttgatcttctccttcatgccctt 418
            ||||||||||| |||||||| |||||||| ||| | ||||||||
Sbjct: 1529 tggccgccgggaagcttctctttgatcttgtccatgatgccctt 1486



 Score = 46.1 bits (23), Expect = 0.12
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                               
Query: 219  agcttctccttgatcttgtccatgatccccttctt 253
            ||||||||||| ||||||||| | |||||||||||
Sbjct: 1403 agcttctccttcatcttgtccttcatccccttctt 1369

---

>gb|AY093779.1| Arabidopsis thaliana AT5g66400/K1F13_5 mRNA, complete cds
          Length = 798

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 37/39 (94%)
 Strand = Plus / Minus

                                                  
Query: 219 agcttctccttgatcttgtccatgatccccttcttctcg 257
           ||||| ||||||||||||||||| |||||||||||||||
Sbjct: 624 agcttttccttgatcttgtccatcatccccttcttctcg 586



 Score = 44.1 bits (22), Expect = 0.46
 Identities = 37/42 (88%)
 Strand = Plus / Minus

                                                     
Query: 381 ccggggagcttctccttgatcttctccttcatgcccttcttc 422
           ||||| ||||| ||||||||||| ||| |||| |||||||||
Sbjct: 630 ccgggaagcttttccttgatcttgtccatcatccccttcttc 589

---

>gb|AF428458.1|AF428458 Arabidopsis thaliana AT5g66400/K1F13_5 mRNA, complete cds
          Length = 861

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 37/39 (94%)
 Strand = Plus / Minus

                                                  
Query: 219 agcttctccttgatcttgtccatgatccccttcttctcg 257
           ||||| ||||||||||||||||| |||||||||||||||
Sbjct: 631 agcttttccttgatcttgtccatcatccccttcttctcg 593



 Score = 44.1 bits (22), Expect = 0.46
 Identities = 37/42 (88%)
 Strand = Plus / Minus

                                                     
Query: 381 ccggggagcttctccttgatcttctccttcatgcccttcttc 422
           ||||| ||||| ||||||||||| ||| |||| |||||||||
Sbjct: 637 ccgggaagcttttccttgatcttgtccatcatccccttcttc 596

---

>gb|AY050416.1| Arabidopsis thaliana At1g11360/T23J18_35 mRNA, complete cds
          Length = 1018

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 37/39 (94%)
 Strand = Plus / Plus

                                                  
Query: 219 agcttctccttgatcttgtccatgatccccttcttctcg 257
           ||||| ||||||||||||||||| |||||||||||||||
Sbjct: 235 agcttttccttgatcttgtccatcatccccttcttctcg 273



 Score = 44.1 bits (22), Expect = 0.46
 Identities = 37/42 (88%)
 Strand = Plus / Plus

                                                     
Query: 381 ccggggagcttctccttgatcttctccttcatgcccttcttc 422
           ||||| ||||| ||||||||||| ||| |||| |||||||||
Sbjct: 229 ccgggaagcttttccttgatcttgtccatcatccccttcttc 270

---

>gb|M62988.1|CRTDESRSB Craterostigma plantagineum dessication-related protein mRNA,
           complete cds
          Length = 741

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 43/47 (91%)
 Strand = Plus / Minus

                                                          
Query: 375 tggccgccggggagcttctccttgatcttctccttcatgcccttctt 421
           ||||||||||| ||||||||||| ||||| |||||||| ||||||||
Sbjct: 414 tggccgccgggaagcttctccttcatcttgtccttcatccccttctt 368



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 219 agcttctccttgatcttgtccatgatccccttcttctc 256
           |||||||| ||||||||||||||||| ||||| |||||
Sbjct: 516 agcttctctttgatcttgtccatgatgccctttttctc 479



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 375 tggccgccggggagcttctccttgatcttctccttcatgccctt 418
           ||||||||||| |||||||| |||||||| ||| | ||||||||
Sbjct: 528 tggccgccgggaagcttctctttgatcttgtccatgatgccctt 485



 Score = 46.1 bits (23), Expect = 0.12
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 219 agcttctccttgatcttgtccatgatccccttctt 253
           ||||||||||| ||||||||| | |||||||||||
Sbjct: 402 agcttctccttcatcttgtccttcatccccttctt 368

---

>emb|AJ606474.1| Fagus sylvatica mRNA for dehydrin/response ABA (rab1 gene)
          Length = 952

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 43/47 (91%)
 Strand = Plus / Minus

                                                          
Query: 210 tgtcccggcagcttctccttgatcttgtccatgatccccttcttctc 256
           ||||| || ||||||||||| ||||| ||||||||||||||||||||
Sbjct: 764 tgtccaggaagcttctcctttatcttttccatgatccccttcttctc 718

---

>dbj|AB013389.1| Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K1F13
          Length = 83511

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 37/39 (94%)
 Strand = Plus / Plus

                                                   
Query: 219  agcttctccttgatcttgtccatgatccccttcttctcg 257
            ||||| ||||||||||||||||| |||||||||||||||
Sbjct: 7446 agcttttccttgatcttgtccatcatccccttcttctcg 7484



 Score = 44.1 bits (22), Expect = 0.46
 Identities = 37/42 (88%)
 Strand = Plus / Plus

                                                      
Query: 381  ccggggagcttctccttgatcttctccttcatgcccttcttc 422
            ||||| ||||| ||||||||||| ||| |||| |||||||||
Sbjct: 7440 ccgggaagcttttccttgatcttgtccatcatccccttcttc 7481

---

>emb|X68042.1|ATRAB18A A.thaliana rab18 gene
          Length = 1528

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 37/39 (94%)
 Strand = Plus / Minus

                                                   
Query: 219  agcttctccttgatcttgtccatgatccccttcttctcg 257
            ||||| ||||||||||||||||| |||||||||||||||
Sbjct: 1237 agcttttccttgatcttgtccatcatccccttcttctcg 1199



 Score = 44.1 bits (22), Expect = 0.46
 Identities = 37/42 (88%)
 Strand = Plus / Minus

                                                      
Query: 381  ccggggagcttctccttgatcttctccttcatgcccttcttc 422
            ||||| ||||| ||||||||||| ||| |||| |||||||||
Sbjct: 1243 ccgggaagcttttccttgatcttgtccatcatccccttcttc 1202

---

>gb|BT002226.1| Arabidopsis thaliana At5g66400/K1F13_5 mRNA, complete cds
          Length = 561

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 37/39 (94%)
 Strand = Plus / Minus

                                                  
Query: 219 agcttctccttgatcttgtccatgatccccttcttctcg 257
           ||||| ||||||||||||||||| |||||||||||||||
Sbjct: 542 agcttttccttgatcttgtccatcatccccttcttctcg 504



 Score = 44.1 bits (22), Expect = 0.46
 Identities = 37/42 (88%)
 Strand = Plus / Minus

                                                     
Query: 381 ccggggagcttctccttgatcttctccttcatgcccttcttc 422
           ||||| ||||| ||||||||||| ||| |||| |||||||||
Sbjct: 548 ccgggaagcttttccttgatcttgtccatcatccccttcttc 507

---

>gb|AY425975.1| Streptocarpus primulifolius microsatellite B22 sequence
          Length = 646

 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 51/58 (87%)
 Strand = Plus / Minus

                                                                     
Query: 369 tccttgtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcc 426
           ||||| |||||||| || || |||||||||||||| |||||||| |||||||| ||||
Sbjct: 252 tccttatggccgcctggtagtttctccttgatcttatccttcatccccttctttctcc 195



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                            
Query: 390 ttctccttgatcttctccttcatgcccttcttc 422
           |||||||||||||| ||| ||||||||||||||
Sbjct: 399 ttctccttgatcttatccatcatgcccttcttc 367



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 222 ttctccttgatcttgtccatgatccccttcttctcg 257
           |||||||||||||| ||||| || ||||||||||||
Sbjct: 399 ttctccttgatcttatccatcatgcccttcttctcg 364



 Score = 40.1 bits (20), Expect = 7.2
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 222 ttctccttgatcttgtccatgatccccttctt 253
           |||||||||||||| ||| | |||||||||||
Sbjct: 231 ttctccttgatcttatccttcatccccttctt 200

---

>gb|DQ399792.1| Phoenix dactylifera dehydrin mRNA, partial cds
          Length = 351

 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 80/94 (85%), Gaps = 2/94 (2%)
 Strand = Plus / Minus

                                                                       
Query: 389 cttctccttgatcttctccttcatgcccttcttcctcctcccgcccatg-ccgtcgtcct 447
           ||||||||| |||||||||||||  ||||||||||| |  ||| ||||| ||||| ||||
Sbjct: 270 cttctcctttatcttctccttcaatcccttcttccttcgtccg-ccatgcccgtcatcct 212

                                             
Query: 448 cggaggacgagctggagctggagctgccggagcg 481
           | || ||   ||||||||||||||||||||||||
Sbjct: 211 ccgacgagctgctggagctggagctgccggagcg 178

---

>dbj|AB049336.1| Nicotiana tabacum NtERD10B mRNA for dehydrin, complete cds
          Length = 796

 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 36/38 (94%)
 Strand = Plus / Minus

                                                 
Query: 219 agcttctccttgatcttgtccatgatccccttcttctc 256
           ||||||||||| |||||||||||||| |||||||||||
Sbjct: 530 agcttctccttaatcttgtccatgattcccttcttctc 493



 Score = 44.1 bits (22), Expect = 0.46
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 390 ttctccttgatcttctccttcatgcccttcttcctcct 427
           |||||||| |||||||||||||| || |||||| ||||
Sbjct: 404 ttctccttaatcttctccttcatccctttcttcttcct 367

---

>gb|AY587109.1| Oryza sativa (japonica cultivar-group) dehydration-stress inducible
           protein 1 mRNA, complete cds
          Length = 1315

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 32/33 (96%)
 Strand = Plus / Minus

                                            
Query: 371 cttgtggccgccggggagcttctccttgatctt 403
           ||||||||||||||| |||||||||||||||||
Sbjct: 744 cttgtggccgccgggcagcttctccttgatctt 712



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 37/40 (92%)
 Strand = Plus / Minus

                                                   
Query: 216 ggcagcttctccttgatcttgtccatgatccccttcttct 255
           |||||||||||||||||||| ||| ||| |||||||||||
Sbjct: 470 ggcagcttctccttgatcttctccttgagccccttcttct 431



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 39/43 (90%)
 Strand = Plus / Minus

                                                      
Query: 380 gccggggagcttctccttgatcttctccttcatgcccttcttc 422
           |||||| ||||||||||||||||||||||| |  |||||||||
Sbjct: 474 gccgggcagcttctccttgatcttctccttgagccccttcttc 432



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                    
Query: 216 ggcagcttctccttgatcttgtccatgatccccttcttctc 256
           ||||||||||||||||||||||| | ||  |||||||||||
Sbjct: 731 ggcagcttctccttgatcttgtcgaggaagcccttcttctc 691



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 453 gacgagctggagctggagctg 473
           |||||||||||||||||||||
Sbjct: 374 gacgagctggagctggagctg 354

---

>gb|AY786415.1| Oryza sativa (japonica cultivar-group) SK3-type dehydrin 1 (Dhn1)
           mRNA, complete cds
          Length = 1117

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 32/33 (96%)
 Strand = Plus / Minus

                                            
Query: 371 cttgtggccgccggggagcttctccttgatctt 403
           ||||||||||||||| |||||||||||||||||
Sbjct: 734 cttgtggccgccgggcagcttctccttgatctt 702



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 37/40 (92%)
 Strand = Plus / Minus

                                                   
Query: 216 ggcagcttctccttgatcttgtccatgatccccttcttct 255
           |||||||||||||||||||| ||| ||| |||||||||||
Sbjct: 460 ggcagcttctccttgatcttctccttgagccccttcttct 421



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 39/43 (90%)
 Strand = Plus / Minus

                                                      
Query: 380 gccggggagcttctccttgatcttctccttcatgcccttcttc 422
           |||||| ||||||||||||||||||||||| |  |||||||||
Sbjct: 464 gccgggcagcttctccttgatcttctccttgagccccttcttc 422



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                    
Query: 216 ggcagcttctccttgatcttgtccatgatccccttcttctc 256
           ||||||||||||||||||||||| | ||  |||||||||||
Sbjct: 721 ggcagcttctccttgatcttgtcgaggaagcccttcttctc 681



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 453 gacgagctggagctggagctg 473
           |||||||||||||||||||||
Sbjct: 364 gacgagctggagctggagctg 344

---

>gb|AY574032.1| Triticum aestivum dehydrin-like gene, partial sequence
          Length = 391

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 32/33 (96%)
 Strand = Plus / Minus

                                            
Query: 371 cttgtggccgccggggagcttctccttgatctt 403
           ||||||||||||||| |||||||||||||||||
Sbjct: 252 cttgtggccgccgggcagcttctccttgatctt 220



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 216 ggcagcttctccttgatcttgtcca 240
           |||||||||||||||||||| ||||
Sbjct: 239 ggcagcttctccttgatcttttcca 215

---

>emb|AJ890140.1| Triticum turgidum subsp. durum mRNA for dehydrin (dhn11 gene)
          Length = 1127

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 32/33 (96%)
 Strand = Plus / Minus

                                            
Query: 371 cttgtggccgccggggagcttctccttgatctt 403
           ||||||||||||||| |||||||||||||||||
Sbjct: 659 cttgtggccgccgggcagcttctccttgatctt 627



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 216 ggcagcttctccttgatcttgtcca 240
           |||||||||||||||||||| ||||
Sbjct: 646 ggcagcttctccttgatcttttcca 622



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 453 gacgagctggagctggagctg 473
           |||||||||||||||||||||
Sbjct: 352 gacgagctggagctggagctg 332

---

>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
                sequence
          Length = 35954743

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 32/33 (96%)
 Strand = Plus / Plus

                                                 
Query: 371      cttgtggccgccggggagcttctccttgatctt 403
                ||||||||||||||| |||||||||||||||||
Sbjct: 27184543 cttgtggccgccgggcagcttctccttgatctt 27184575



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 37/40 (92%)
 Strand = Plus / Plus

                                                        
Query: 216      ggcagcttctccttgatcttgtccatgatccccttcttct 255
                |||||||||||||||||||| ||| ||| |||||||||||
Sbjct: 27184817 ggcagcttctccttgatcttctccttgagccccttcttct 27184856



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 39/43 (90%)
 Strand = Plus / Plus

                                                           
Query: 380      gccggggagcttctccttgatcttctccttcatgcccttcttc 422
                |||||| ||||||||||||||||||||||| |  |||||||||
Sbjct: 27184813 gccgggcagcttctccttgatcttctccttgagccccttcttc 27184855



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 37/41 (90%)
 Strand = Plus / Plus

                                                         
Query: 216      ggcagcttctccttgatcttgtccatgatccccttcttctc 256
                ||||||||||||||||||||||| | ||  |||||||||||
Sbjct: 27184556 ggcagcttctccttgatcttgtcgaggaagcccttcttctc 27184596



 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 414      cccttcttcctcctcccgcc 433
                ||||||||||||||||||||
Sbjct: 34736311 cccttcttcctcctcccgcc 34736330



 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 390      ttctccttgatcttctcctt 409
                ||||||||||||||||||||
Sbjct: 34288041 ttctccttgatcttctcctt 34288060

---

>gb|L19419.1|LHPESI Lophopyrum elongatum ES135 mRNA sequence
          Length = 1130

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 32/33 (96%)
 Strand = Plus / Minus

                                            
Query: 371 cttgtggccgccggggagcttctccttgatctt 403
           ||||||||||||||| |||||||||||||||||
Sbjct: 640 cttgtggccgccgggcagcttctccttgatctt 608



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                    
Query: 216 ggcagcttctccttgatcttgtccatgatccccttcttctc 256
           |||||||||||||||||||| |||||||  || ||||||||
Sbjct: 627 ggcagcttctccttgatcttttccatgaagcctttcttctc 587



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 453 gacgagctggagctggagctg 473
           |||||||||||||||||||||
Sbjct: 348 gacgagctggagctggagctg 328

---

>dbj|AP004858.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OJ1725_H08
          Length = 155431

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 32/33 (96%)
 Strand = Plus / Plus

                                              
Query: 371   cttgtggccgccggggagcttctccttgatctt 403
             ||||||||||||||| |||||||||||||||||
Sbjct: 80992 cttgtggccgccgggcagcttctccttgatctt 81024



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 37/40 (92%)
 Strand = Plus / Plus

                                                     
Query: 216   ggcagcttctccttgatcttgtccatgatccccttcttct 255
             |||||||||||||||||||| ||| ||| |||||||||||
Sbjct: 81266 ggcagcttctccttgatcttctccttgagccccttcttct 81305



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 39/43 (90%)
 Strand = Plus / Plus

                                                        
Query: 380   gccggggagcttctccttgatcttctccttcatgcccttcttc 422
             |||||| ||||||||||||||||||||||| |  |||||||||
Sbjct: 81262 gccgggcagcttctccttgatcttctccttgagccccttcttc 81304



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 37/41 (90%)
 Strand = Plus / Plus

                                                      
Query: 216   ggcagcttctccttgatcttgtccatgatccccttcttctc 256
             ||||||||||||||||||||||| | ||  |||||||||||
Sbjct: 81005 ggcagcttctccttgatcttgtcgaggaagcccttcttctc 81045

---

>dbj|AP005055.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC
             clone:P0684A08
          Length = 137841

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 32/33 (96%)
 Strand = Plus / Plus

                                              
Query: 371   cttgtggccgccggggagcttctccttgatctt 403
             ||||||||||||||| |||||||||||||||||
Sbjct: 35214 cttgtggccgccgggcagcttctccttgatctt 35246



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 37/40 (92%)
 Strand = Plus / Plus

                                                     
Query: 216   ggcagcttctccttgatcttgtccatgatccccttcttct 255
             |||||||||||||||||||| ||| ||| |||||||||||
Sbjct: 35488 ggcagcttctccttgatcttctccttgagccccttcttct 35527



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 39/43 (90%)
 Strand = Plus / Plus

                                                        
Query: 380   gccggggagcttctccttgatcttctccttcatgcccttcttc 422
             |||||| ||||||||||||||||||||||| |  |||||||||
Sbjct: 35484 gccgggcagcttctccttgatcttctccttgagccccttcttc 35526



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 37/41 (90%)
 Strand = Plus / Plus

                                                      
Query: 216   ggcagcttctccttgatcttgtccatgatccccttcttctc 256
             ||||||||||||||||||||||| | ||  |||||||||||
Sbjct: 35227 ggcagcttctccttgatcttgtcgaggaagcccttcttctc 35267

---

>emb|X84056.1|HVPAF93 H.vulgare paf93 gene
          Length = 1154

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 32/33 (96%)
 Strand = Plus / Minus

                                            
Query: 371 cttgtggccgccggggagcttctccttgatctt 403
           ||||||||||||||| |||||||||||||||||
Sbjct: 650 cttgtggccgccgggcagcttctccttgatctt 618



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 50/58 (86%), Gaps = 3/58 (5%)
 Strand = Plus / Minus

                                                                     
Query: 365 gttgtccttgtggccgccggggagcttctccttgatcttctccttcatgcccttcttc 422
           ||||||||||||||||   || ||||||||||||| ||||||||| |  |||||||||
Sbjct: 461 gttgtccttgtggccg---ggcagcttctccttgagcttctccttgagacccttcttc 407



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 216 ggcagcttctccttgatcttgtcca 240
           |||||||||||||||||||| ||||
Sbjct: 637 ggcagcttctccttgatcttttcca 613



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 453 gacgagctggagctggagctg 473
           |||||||||||||||||||||
Sbjct: 343 gacgagctggagctggagctg 323



 Score = 40.1 bits (20), Expect = 7.2
 Identities = 35/40 (87%)
 Strand = Plus / Minus

                                                   
Query: 216 ggcagcttctccttgatcttgtccatgatccccttcttct 255
           |||||||||||||||| ||| ||| |||  ||||||||||
Sbjct: 445 ggcagcttctccttgagcttctccttgagacccttcttct 406

---

>dbj|AK070197.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023042N13, full
           insert sequence
          Length = 1292

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 32/33 (96%)
 Strand = Plus / Minus

                                            
Query: 371 cttgtggccgccggggagcttctccttgatctt 403
           ||||||||||||||| |||||||||||||||||
Sbjct: 756 cttgtggccgccgggcagcttctccttgatctt 724



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 37/40 (92%)
 Strand = Plus / Minus

                                                   
Query: 216 ggcagcttctccttgatcttgtccatgatccccttcttct 255
           |||||||||||||||||||| ||| ||| |||||||||||
Sbjct: 482 ggcagcttctccttgatcttctccttgagccccttcttct 443



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 39/43 (90%)
 Strand = Plus / Minus

                                                      
Query: 380 gccggggagcttctccttgatcttctccttcatgcccttcttc 422
           |||||| ||||||||||||||||||||||| |  |||||||||
Sbjct: 486 gccgggcagcttctccttgatcttctccttgagccccttcttc 444



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                    
Query: 216 ggcagcttctccttgatcttgtccatgatccccttcttctc 256
           ||||||||||||||||||||||| | ||  |||||||||||
Sbjct: 743 ggcagcttctccttgatcttgtcgaggaagcccttcttctc 703



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 453 gacgagctggagctggagctg 473
           |||||||||||||||||||||
Sbjct: 386 gacgagctggagctggagctg 366

---

>gb|AF043093.1|AF043093 Hordeum vulgare dehydrin 8 (dhn8) gene, complete cds
          Length = 2254

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 32/33 (96%)
 Strand = Plus / Minus

                                             
Query: 371  cttgtggccgccggggagcttctccttgatctt 403
            ||||||||||||||| |||||||||||||||||
Sbjct: 1930 cttgtggccgccgggcagcttctccttgatctt 1898



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 50/58 (86%), Gaps = 3/58 (5%)
 Strand = Plus / Minus

                                                                      
Query: 365  gttgtccttgtggccgccggggagcttctccttgatcttctccttcatgcccttcttc 422
            ||||||||||||||||   || ||||||||||||| ||||||||| |  |||||||||
Sbjct: 1741 gttgtccttgtggccg---ggcagcttctccttgagcttctccttgagacccttcttc 1687



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 216  ggcagcttctccttgatcttgtcca 240
            |||||||||||||||||||| ||||
Sbjct: 1917 ggcagcttctccttgatcttttcca 1893



 Score = 40.1 bits (20), Expect = 7.2
 Identities = 35/40 (87%)
 Strand = Plus / Minus

                                                    
Query: 216  ggcagcttctccttgatcttgtccatgatccccttcttct 255
            |||||||||||||||| ||| ||| |||  ||||||||||
Sbjct: 1725 ggcagcttctccttgagcttctccttgagacccttcttct 1686

---

>gb|U73211.1|TAU73211 Triticum aestivum cold acclimation protein WCOR410c (Wcor410c)
           mRNA, complete cds
          Length = 1242

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 32/33 (96%)
 Strand = Plus / Minus

                                            
Query: 371 cttgtggccgccggggagcttctccttgatctt 403
           ||||||||||||||| |||||||||||||||||
Sbjct: 662 cttgtggccgccgggcagcttctccttgatctt 630



 Score = 46.1 bits (23), Expect = 0.12
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 380 gccggggagcttctccttgatcttctccttcatgcccttcttc 422
           |||||| ||||||||||||| ||||||||| |  |||||||||
Sbjct: 461 gccgggcagcttctccttgagcttctccttgagacccttcttc 419



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 216 ggcagcttctccttgatcttgtcca 240
           |||||||||||||||||||| ||||
Sbjct: 649 ggcagcttctccttgatcttttcca 625



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 453 gacgagctggagctggagctg 473
           |||||||||||||||||||||
Sbjct: 358 gacgagctggagctggagctg 338



 Score = 40.1 bits (20), Expect = 7.2
 Identities = 35/40 (87%)
 Strand = Plus / Minus

                                                   
Query: 216 ggcagcttctccttgatcttgtccatgatccccttcttct 255
           |||||||||||||||| ||| ||| |||  ||||||||||
Sbjct: 457 ggcagcttctccttgagcttctccttgagacccttcttct 418

---

>gb|U73210.1|TAU73210 Triticum aestivum cold acclimation protein WCOR410b (Wcor410b)
           mRNA, complete cds
          Length = 1181

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 32/33 (96%)
 Strand = Plus / Minus

                                            
Query: 371 cttgtggccgccggggagcttctccttgatctt 403
           ||||||||||||||| |||||||||||||||||
Sbjct: 647 cttgtggccgccgggcagcttctccttgatctt 615



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 216 ggcagcttctccttgatcttgtcca 240
           |||||||||||||||||||| ||||
Sbjct: 634 ggcagcttctccttgatcttttcca 610



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 453 gacgagctggagctggagctg 473
           |||||||||||||||||||||
Sbjct: 343 gacgagctggagctggagctg 323

---

>gb|L29152.1|WHTWCOR Triticum aestivum cold acclimation protein (WCOR410) mRNA, complete
           cds
          Length = 1136

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 32/33 (96%)
 Strand = Plus / Minus

                                            
Query: 371 cttgtggccgccggggagcttctccttgatctt 403
           ||||||||||||||| |||||||||||||||||
Sbjct: 662 cttgtggccgccgggcagcttctccttgatctt 630



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 216 ggcagcttctccttgatcttgtcca 240
           |||||||||||||||||||| ||||
Sbjct: 649 ggcagcttctccttgatcttttcca 625



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 453 gacgagctggagctggagctg 473
           |||||||||||||||||||||
Sbjct: 349 gacgagctggagctggagctg 329

---

>dbj|AB011367.1| Oryza sativa mRNA for LIP9, partial cds
          Length = 680

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 32/33 (96%)
 Strand = Plus / Minus

                                            
Query: 371 cttgtggccgccggggagcttctccttgatctt 403
           ||||||||||||||| |||||||||||||||||
Sbjct: 177 cttgtggccgccgggcagcttctccttgatctt 145



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                    
Query: 216 ggcagcttctccttgatcttgtccatgatccccttcttctc 256
           ||||||||||||||||||||||| | ||  |||||||||||
Sbjct: 164 ggcagcttctccttgatcttgtcgaggaagcccttcttctc 124

---

>emb|AJ704825.1| Glycine max partial lea8 gene for putative dehydrin
          Length = 591

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 222 ttctccttgatcttgtccatgatccccttcttctcg 257
           |||||||||||||||||||| ||||| |||||||||
Sbjct: 581 ttctccttgatcttgtccataatccctttcttctcg 546

---

>gb|M62987.1|CRTDESRSA Craterostigma plantagineum dessication-related protein mRNA,
           complete cds
          Length = 634

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 28/28 (100%)
 Strand = Plus / Minus

                                       
Query: 380 gccggggagcttctccttgatcttctcc 407
           ||||||||||||||||||||||||||||
Sbjct: 406 gccggggagcttctccttgatcttctcc 379



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 47/54 (87%)
 Strand = Plus / Minus

                                                                 
Query: 203 tcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctc 256
           ||||||||| || || ||||||||||||||||| ||||| | ||| ||||||||
Sbjct: 415 tcagtgctggccggggagcttctccttgatcttctccatcacccctttcttctc 362

---

>gb|AY105067.1| Zea mays PCO081051 mRNA sequence
          Length = 1398

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 31/32 (96%)
 Strand = Plus / Minus

                                           
Query: 372 ttgtggccgccggggagcttctccttgatctt 403
           |||||||| |||||||||||||||||||||||
Sbjct: 773 ttgtggccaccggggagcttctccttgatctt 742



 Score = 44.1 bits (22), Expect = 0.46
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 219 agcttctccttgatcttgtcca 240
           ||||||||||||||||||||||
Sbjct: 758 agcttctccttgatcttgtcca 737



 Score = 40.1 bits (20), Expect = 7.2
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 387 agcttctccttgatcttctccttcatgcccttcttc 422
           ||||||||||||| ||||||||| | |||| |||||
Sbjct: 509 agcttctccttgagcttctccttgaggcccatcttc 474

---

>gb|M94012.1|SOYMATSGB Glycine max maturation-associated protein (MAT9) mRNA, complete cds
          Length = 947

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 219 agcttctccttgatcttgtccatgatccccttcttctcg 257
           ||||||||||| ||||||||||| ||||| |||||||||
Sbjct: 695 agcttctccttaatcttgtccataatccctttcttctcg 657

---

>gb|U10111.1|GMU10111 Glycine max Essex dehydrin-like protein mRNA, complete cds
          Length = 958

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 219 agcttctccttgatcttgtccatgatccccttcttctcg 257
           ||||||||||| ||||||||||| ||||| |||||||||
Sbjct: 685 agcttctccttaatcttgtccataatccctttcttctcg 647

---

>gb|DQ487110.1| Panax ginseng dehydrin 5 (Dhn5) mRNA, complete cds
          Length = 853

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Minus

                                                     
Query: 381 ccggggagcttctccttgatcttctccttcatgcccttcttc 422
           ||||| ||||||||||||||||||||| |||| || ||||||
Sbjct: 536 ccgggcagcttctccttgatcttctccatcattcctttcttc 495



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                    
Query: 216 ggcagcttctccttgatcttgtccatgatccccttcttctc 256
           |||||||||||||||||||| ||||| || || ||||||||
Sbjct: 533 ggcagcttctccttgatcttctccatcattcctttcttctc 493

---

>gb|AF345988.1| Cornus sericea 60 kDa dehydrin-like protein (Rod60) mRNA, complete
            cds
          Length = 1921

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                              
Query: 207  tgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctc 256
            |||||||| || ||||||||||||||||| |||||||  || ||||||||
Sbjct: 1751 tgctgtccaggaagcttctccttgatcttctccatgactcctttcttctc 1702



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 387  agcttctccttgatcttctcc 407
            |||||||||||||||||||||
Sbjct: 1739 agcttctccttgatcttctcc 1719

---

>gb|U91970.1|PSU91970 Pisum sativum dehydrin 3 (Dhn3) mRNA, complete cds
          Length = 809

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 219 agcttctccttgatcttgtccatgatccccttcttctc 256
           ||||||||||| ||||||||||| ||||| ||||||||
Sbjct: 614 agcttctccttaatcttgtccataatccctttcttctc 577

---

>gb|U91969.1|PSU91969 Pisum sativum dehydrin 2 (Dhn2) mRNA, complete cds
          Length = 1125

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 219 agcttctccttgatcttgtccatgatccccttcttctc 256
           ||||||||||| ||||||||||| ||||| ||||||||
Sbjct: 834 agcttctccttaatcttgtccataatccctttcttctc 797

---

>dbj|AB049335.1| Nicotiana tabacum NtERD10A mRNA for dehydrin, partial cds
          Length = 342

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 219 agcttctccttgatcttgtccatgatccccttcttctc 256
           ||||||||||| ||||||||||| || |||||||||||
Sbjct: 65  agcttctccttaatcttgtccataattcccttcttctc 28

---

>emb|X94979.1|BOPC34 B.oleracea mRNA for pollen coat protein (clone bopc34)
          Length = 882

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 219 agcttctccttgatcttgtccatgatccccttcttctc 256
           ||||||||||| ||||| |||| |||||||||||||||
Sbjct: 609 agcttctccttaatcttctccaagatccccttcttctc 572


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 5,576,961
Number of Sequences: 3902068
Number of extensions: 5576961
Number of successful extensions: 175758
Number of sequences better than 10.0: 673
Number of HSP's better than 10.0 without gapping: 708
Number of HSP's successfully gapped in prelim test: 1
Number of HSP's that attempted gapping in prelim test: 167553
Number of HSP's gapped (non-prelim): 8070
length of query: 533
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 510
effective length of database: 17,143,297,704
effective search space: 8743081829040
effective search space used: 8743081829040
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)

---