| Clone Name | rbags12p24 |
|---|---|
| Clone Library Name | barley_pub |
>emb|X98124.1|HVJIP H.vulgare gene encoding jasmonate-induced protein Length = 2897 Score = 143 bits (72), Expect = 9e-31 Identities = 198/240 (82%) Strand = Plus / Minus Query: 387 aaccagtcgcaggagctgctgctggacgggatcctgctacgatacacaacagcggcagtt 446 ||||| |||||||| ||||||||||| |||||| || ||||||||||||| || ||| | Sbjct: 2545 aaccaatcgcaggacctgctgctggaggggatcttggtacgatacacaacggcaccagct 2486 Query: 447 gaacctttcgcagctgctcttggtttgacgtggagaaatgccccccattgtccattctga 506 ||||| |||||| | ||||| | ||||||||| ||||| |||||||| ||||||||| Sbjct: 2485 gaaccaaccgcagcaccacttgggtggacgtggaggaatgcaccccattgcccattctga 2426 Query: 507 atatccgatgggtagggtgtatcaaagatactgccaatccaattcttgtacgtgacgaaa 566 ||||| ||||||||||| |||||| ||||| ||| ||||| |||||| | | || Sbjct: 2425 atatctgatgggtagggagtatcatagatatggccgtgccaatcgttgtacttagccaag 2366 Query: 567 ctcagattggtaccggtagcattgtagatgaggcattttacagatattccattaccgtac 626 |||| | ||| ||| || ||||||||||||||||||||||||| |||||| ||||||||| Sbjct: 2365 ctcaaagtggcaccagtggcattgtagatgaggcattttacagctattccgttaccgtac 2306
>emb|AL112356.1|CNS01A18 Botrytis cinerea strain T4 cDNA library Length = 660 Score = 48.1 bits (24), Expect = 0.038 Identities = 24/24 (100%) Strand = Plus / Minus Query: 260 tgagtggagatttgaatttgccag 283 |||||||||||||||||||||||| Sbjct: 356 tgagtggagatttgaatttgccag 333
>gb|AC119801.14| Mus musculus, clone RP23-54N13, complete sequence Length = 251756 Score = 44.1 bits (22), Expect = 0.60 Identities = 25/26 (96%) Strand = Plus / Minus Query: 289 cattgtagatataatcccagtgctta 314 |||||||| ||||||||||||||||| Sbjct: 70840 cattgtagctataatcccagtgctta 70815
>gb|AC004779.1| Homo sapiens chromosome 16, cosmid clone 304A10 (LANL), complete sequence Length = 35687 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 298 tataatcccagtgcttaggga 318 ||||||||||||||||||||| Sbjct: 21322 tataatcccagtgcttaggga 21342
>gb|AC005564.1| Homo sapiens chromosome 16, cosmid clone 420F6 (LANL), complete sequence Length = 37930 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 298 tataatcccagtgcttaggga 318 ||||||||||||||||||||| Sbjct: 11608 tataatcccagtgcttaggga 11628
>gb|AY679523.1| Homo sapiens cell division cycle 2-like 5 (cholinesterase-related cell division controller) (CDC2L5) gene, complete cds Length = 148952 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 298 tataatcccagtgcttaggga 318 ||||||||||||||||||||| Sbjct: 138827 tataatcccagtgcttaggga 138807
>gb|AC147677.4| Canis Familiaris, clone XX-25A1, complete sequence Length = 154021 Score = 42.1 bits (21), Expect = 2.4 Identities = 24/25 (96%) Strand = Plus / Plus Query: 175 agggaagctggaaaactgcacgtgc 199 ||||| ||||||||||||||||||| Sbjct: 31185 agggaggctggaaaactgcacgtgc 31209
>emb|AL356240.15| Human DNA sequence from clone RP5-873F21 on chromosome 11 Contains part of a novel gene for brain protein 239, ESTs and GSSs, complete sequence Length = 114144 Score = 42.1 bits (21), Expect = 2.4 Identities = 24/25 (96%) Strand = Plus / Plus Query: 255 tcagttgagtggagatttgaatttg 279 |||||||| |||||||||||||||| Sbjct: 98307 tcagttgattggagatttgaatttg 98331
>emb|AL354712.18| Human DNA sequence from clone RP4-597A16 on chromosome 1p36.13-36.23 Contains the 5' end of a novel leucine rich repeat domain containing protein, a novel gene, a pseudogene similar to part of WD repeat domain, the 5' end of the gene for lung type-I cell membrane-associated glycoprotein (T1A-2) and a CpG island, complete sequence Length = 123288 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 298 tataatcccagtgcttaggga 318 ||||||||||||||||||||| Sbjct: 114834 tataatcccagtgcttaggga 114814
>emb|AL133350.16| Human DNA sequence from clone RP11-155N8 on chromosome 10 Contains GSSs and STSs, complete sequence Length = 89833 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 300 taatcccagtgcttagggaag 320 ||||||||||||||||||||| Sbjct: 3655 taatcccagtgcttagggaag 3675
>gb|AC129803.3| Homo sapiens 3 BAC RP11-15N24 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 185721 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 298 tataatcccagtgcttaggga 318 ||||||||||||||||||||| Sbjct: 106775 tataatcccagtgcttaggga 106795
>gb|AC112212.2| Homo sapiens chromosome 3 clone RP11-185E15, complete sequence Length = 168752 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 298 tataatcccagtgcttaggga 318 ||||||||||||||||||||| Sbjct: 154625 tataatcccagtgcttaggga 154605
>gb|AC078813.13| Homo sapiens 3q BAC RP11-149B11 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 142000 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 298 tataatcccagtgcttaggga 318 ||||||||||||||||||||| Sbjct: 83003 tataatcccagtgcttaggga 82983
>gb|AC099328.2| Homo sapiens chromosome 3 clone RP11-62G11, complete sequence Length = 156066 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 298 tataatcccagtgcttaggga 318 ||||||||||||||||||||| Sbjct: 58842 tataatcccagtgcttaggga 58822
>gb|AC008771.4|AC008771 Homo sapiens chromosome 5 clone CTD-2015H6, complete sequence Length = 123169 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 300 taatcccagtgcttagggaag 320 ||||||||||||||||||||| Sbjct: 77283 taatcccagtgcttagggaag 77263
>gb|AC116738.25| Mus musculus chromosome 5, clone RP23-418D19, complete sequence Length = 193386 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 144 ccactccctgcagctagcaat 164 ||||||||||||||||||||| Sbjct: 78559 ccactccctgcagctagcaat 78539
>gb|AC018764.8| Homo sapiens chromosome 5 clone CTD-2327L5, complete sequence Length = 126052 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 300 taatcccagtgcttagggaag 320 ||||||||||||||||||||| Sbjct: 104277 taatcccagtgcttagggaag 104297
>gb|AC007151.2|AC007151 Homo sapiens clone RPCI-11_95J11, complete sequence Length = 165196 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 298 tataatcccagtgcttaggga 318 ||||||||||||||||||||| Sbjct: 65963 tataatcccagtgcttaggga 65943
>gb|AC006023.2|AC006023 Homo sapiens PAC clone RP5-1147A1 from 7p14-p12, complete sequence Length = 157385 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 298 tataatcccagtgcttaggga 318 ||||||||||||||||||||| Sbjct: 53346 tataatcccagtgcttaggga 53326
>emb|AJ315157.1|HSA315157 Homo sapiens t(8;16)(p11;p13) chimeric CBP/MOZ genomic DNA from acute myeloid leukemia patient (case 4) Length = 419 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 298 tataatcccagtgcttaggga 318 ||||||||||||||||||||| Sbjct: 44 tataatcccagtgcttaggga 64
>gb|AC109276.12| Mus musculus chromosome 1, clone RP23-461J11, complete sequence Length = 173589 Score = 40.1 bits (20), Expect = 9.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 atctccttcctctattattc 77 |||||||||||||||||||| Sbjct: 161622 atctccttcctctattattc 161641
>gb|AC122894.2| Mus musculus BAC clone RP23-69F3 from 1, complete sequence Length = 205318 Score = 40.1 bits (20), Expect = 9.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 atctccttcctctattattc 77 |||||||||||||||||||| Sbjct: 131999 atctccttcctctattattc 131980
>gb|AC073901.5| Homo sapiens BAC clone RP11-222O23 from 7, complete sequence Length = 170654 Score = 40.1 bits (20), Expect = 9.4 Identities = 23/24 (95%) Strand = Plus / Minus Query: 300 taatcccagtgcttagggaagtgt 323 |||||||||||||| ||||||||| Sbjct: 129036 taatcccagtgctttgggaagtgt 129013
>emb|AL355338.33| Human DNA sequence from clone RP11-12G12 on chromosome 13 Contains the gene for zinc finger protein of the cerebellum 5 (ZIC5), the ZIC2 gene for Zic family member 2 (odd-paired homolog Drosophila), a 13kDa differentiation-associated protein (DAP13) pseudogene, an asparagine synthetase (ASNS) pseudogene, the 5' end of the PCCA gene for propionyl Coenzyme A carboxylase alpha polypeptide and seven CpG islands, complete sequence Length = 153762 Score = 40.1 bits (20), Expect = 9.4 Identities = 23/24 (95%) Strand = Plus / Plus Query: 297 atataatcccagtgcttagggaag 320 ||||||||||||||||| |||||| Sbjct: 90136 atataatcccagtgctttgggaag 90159
>emb|AL691470.17| Mouse DNA sequence from clone RP23-160F12 on chromosome 11 Contains the 3' end of gene FLJ13305, a novel gene, a novel gene (1700061J23Rik) and a CpG island, complete sequence Length = 195614 Score = 40.1 bits (20), Expect = 9.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 298 tataatcccagtgcttaggg 317 |||||||||||||||||||| Sbjct: 108099 tataatcccagtgcttaggg 108118
>ref|NM_166340.1| Drosophila melanogaster endophilin B CG9834-RB, transcript variant B (endoB), mRNA Length = 2224 Score = 40.1 bits (20), Expect = 9.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 400 agctgctgctggacgggatc 419 |||||||||||||||||||| Sbjct: 775 agctgctgctggacgggatc 794
>ref|NM_137566.2| Drosophila melanogaster endophilin B CG9834-RA, transcript variant A (endoB), mRNA Length = 2260 Score = 40.1 bits (20), Expect = 9.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 400 agctgctgctggacgggatc 419 |||||||||||||||||||| Sbjct: 811 agctgctgctggacgggatc 830
>gb|AY071608.1| Drosophila melanogaster RE65748 full length cDNA Length = 2269 Score = 40.1 bits (20), Expect = 9.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 400 agctgctgctggacgggatc 419 |||||||||||||||||||| Sbjct: 811 agctgctgctggacgggatc 830
>gb|AC008344.2|AC008344 Drosophila melanogaster, chromosome 2R, region 56C-56D, BAC clone BACR19I21, complete sequence Length = 171981 Score = 40.1 bits (20), Expect = 9.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 400 agctgctgctggacgggatc 419 |||||||||||||||||||| Sbjct: 120643 agctgctgctggacgggatc 120624
>gb|AC008096.3|AC008096 Drosophila melanogaster, chromosome 2R, region 56C-56D, BAC clone BACR21D20, complete sequence Length = 176813 Score = 40.1 bits (20), Expect = 9.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 400 agctgctgctggacgggatc 419 |||||||||||||||||||| Sbjct: 135962 agctgctgctggacgggatc 135981
>gb|AC007448.14| Homo sapiens chromosome 17, clone RP11-401F2, complete sequence Length = 195558 Score = 40.1 bits (20), Expect = 9.4 Identities = 23/24 (95%) Strand = Plus / Plus Query: 298 tataatcccagtgcttagggaagt 321 |||||||||||||||| ||||||| Sbjct: 67044 tataatcccagtgctttgggaagt 67067
>emb|AL953855.9| Zebrafish DNA sequence from clone CH211-239F4 in linkage group 1, complete sequence Length = 146080 Score = 40.1 bits (20), Expect = 9.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 589 tgtagatgaggcattttaca 608 |||||||||||||||||||| Sbjct: 15124 tgtagatgaggcattttaca 15143
>emb|AL445883.3|CNS07EEQ Human chromosome 14 DNA sequence BAC R-908D14 of library RPCI-11 from chromosome 14 of Homo sapiens (Human), complete sequence Length = 169496 Score = 40.1 bits (20), Expect = 9.4 Identities = 23/24 (95%) Strand = Plus / Minus Query: 298 tataatcccagtgcttagggaagt 321 |||||||||||||||| ||||||| Sbjct: 62229 tataatcccagtgctttgggaagt 62206
>gb|AE003796.3| Drosophila melanogaster chromosome 2R, section 54 of 73 of the complete sequence Length = 277421 Score = 40.1 bits (20), Expect = 9.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 400 agctgctgctggacgggatc 419 |||||||||||||||||||| Sbjct: 131096 agctgctgctggacgggatc 131077
>emb|AL355885.4|CNS05TCW Human chromosome 14 DNA sequence BAC R-434O22 of library RPCI-11 from chromosome 14 of Homo sapiens (Human), complete sequence Length = 174442 Score = 40.1 bits (20), Expect = 9.4 Identities = 23/24 (95%) Strand = Plus / Plus Query: 298 tataatcccagtgcttagggaagt 321 |||||||||||||||| ||||||| Sbjct: 19952 tataatcccagtgctttgggaagt 19975
>gb|BT001605.1| Drosophila melanogaster RE31027 full insert cDNA Length = 2191 Score = 40.1 bits (20), Expect = 9.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 400 agctgctgctggacgggatc 419 |||||||||||||||||||| Sbjct: 733 agctgctgctggacgggatc 752
>gb|AC159815.3| Mus musculus BAC clone RP23-324H19 from chromosome 12, complete sequence Length = 213030 Score = 40.1 bits (20), Expect = 9.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 298 tataatcccagtgcttaggg 317 |||||||||||||||||||| Sbjct: 177842 tataatcccagtgcttaggg 177861
>gb|AC155232.1| Mus musculus BAC clone RP24-374P12 from 12, complete sequence Length = 139740 Score = 40.1 bits (20), Expect = 9.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 298 tataatcccagtgcttaggg 317 |||||||||||||||||||| Sbjct: 115804 tataatcccagtgcttaggg 115785
>emb|AL663088.10| Mouse DNA sequence from clone RP23-293H17 on chromosome 11, complete sequence Length = 243290 Score = 40.1 bits (20), Expect = 9.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 297 atataatcccagtgcttagg 316 |||||||||||||||||||| Sbjct: 26890 atataatcccagtgcttagg 26871
>emb|AJ437142.1|DME437142 Drosophila melanogaster mRNA for endophilin B (CG9834 gene) Length = 1319 Score = 40.1 bits (20), Expect = 9.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 400 agctgctgctggacgggatc 419 |||||||||||||||||||| Sbjct: 704 agctgctgctggacgggatc 723
>gb|AC006534.10| Homo sapiens chromosome 17, clone RP11-557B23, complete sequence Length = 216789 Score = 40.1 bits (20), Expect = 9.4 Identities = 23/24 (95%) Strand = Plus / Minus Query: 299 ataatcccagtgcttagggaagtg 322 ||||||||||||||| |||||||| Sbjct: 126100 ataatcccagtgctttgggaagtg 126077 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 4,850,824 Number of Sequences: 3902068 Number of extensions: 4850824 Number of successful extensions: 93471 Number of sequences better than 10.0: 41 Number of HSP's better than 10.0 without gapping: 41 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 93392 Number of HSP's gapped (non-prelim): 78 length of query: 686 length of database: 17,233,045,268 effective HSP length: 23 effective length of query: 663 effective length of database: 17,143,297,704 effective search space: 11366006377752 effective search space used: 11366006377752 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)