ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbags12p11
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1emb|X75778.1|ASTCPP1A A.sativa (Pewi) ASTCP-K36 mRNA for t compl... 607 e-170
2emb|X75777.1|ASTCPP1 A.sativa (Pewi) ASTCP-K19 mRNA for t comple... 595 e-167
3dbj|AK105701.1| Oryza sativa (japonica cultivar-group) cDNA clon... 385 e-103
4dbj|AK067114.1| Oryza sativa (japonica cultivar-group) cDNA clon... 385 e-103
5gb|AY103729.1| Zea mays PCO099347 mRNA sequence 297 2e-77
6gb|BT017463.1| Zea mays clone EL01N0407F08.c mRNA sequence 293 4e-76
7dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic D... 141 3e-30
8dbj|AP003714.2| Oryza sativa (japonica cultivar-group) genomic D... 141 3e-30
9gb|AF097668.1|AF097668 Mesembryanthemum crystallinum T-complex p... 119 1e-23
10gb|AC141435.28| Medicago truncatula clone mth2-21i11, complete s... 94 7e-16
11emb|CT030174.3| M.truncatula DNA sequence from clone MTH2-71J12 ... 94 7e-16
12emb|X85013.1|CSRNATCP1 C.sativus mRNA for T-complex polypeptide 1 78 4e-11
13ref|NM_102295.3| Arabidopsis thaliana ATP binding / protein bind... 70 1e-08
14ref|NM_202178.1| Arabidopsis thaliana ATP binding / protein bind... 70 1e-08
15gb|BT000818.1| Arabidopsis thaliana T-complex chaperonin protein... 70 1e-08
16gb|AY075611.1| Arabidopsis thaliana At1g24510/F21J9_150 mRNA, co... 70 1e-08
17emb|BX815337.1|CNS0AAT9 Arabidopsis thaliana Full-length cDNA Co... 70 1e-08
18gb|AC077693.19| Oryza sativa chromosome 10 BAC OSJNBa0095C07 gen... 66 2e-07
19dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic D... 66 2e-07
20dbj|AK070073.1| Oryza sativa (japonica cultivar-group) cDNA clon... 66 2e-07
21dbj|AK063744.1| Oryza sativa (japonica cultivar-group) cDNA clon... 66 2e-07
22gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome... 66 2e-07
23emb|CR734406.2|CNS0GTG5 Tetraodon nigroviridis full-length cDNA 58 4e-05
24emb|CR734368.2|CNS0GTF3 Tetraodon nigroviridis full-length cDNA 58 4e-05
25emb|CR704636.2|CNS0G6NC Tetraodon nigroviridis full-length cDNA 58 4e-05
26emb|CR702647.2|CNS0G543 Tetraodon nigroviridis full-length cDNA 58 4e-05
27emb|CR693702.2|CNS0FY7M Tetraodon nigroviridis full-length cDNA 58 4e-05
28emb|CR693121.2|CNS0FXRH Tetraodon nigroviridis full-length cDNA 58 4e-05
29emb|CR692993.2|CNS0FXNX Tetraodon nigroviridis full-length cDNA 58 4e-05
30emb|CR682065.2|CNS0FP8D Tetraodon nigroviridis full-length cDNA 58 4e-05
31emb|CR664385.2|CNS0FBLZ Tetraodon nigroviridis full-length cDNA 58 4e-05
32emb|CR659491.2|CNS0F7U1 Tetraodon nigroviridis full-length cDNA 58 4e-05
33ref|XM_774923.1| PREDICTED: Strongylocentrotus purpuratus simila... 56 2e-04
34ref|XM_796613.1| PREDICTED: Strongylocentrotus purpuratus simila... 56 2e-04
35dbj|AK106739.1| Oryza sativa (japonica cultivar-group) cDNA clon... 56 2e-04
36ref|XM_635364.1| Dictyostelium discoideum hypothetical protein (... 54 6e-04
37emb|BX064596.1|CNS09M08 Single read from an extremity of a full-... 54 6e-04
38emb|BX059609.1|CNS09I5P Single read from an extremity of a full-... 54 6e-04
39emb|BX058534.1|CNS09HBU Single read from an extremity of a full-... 54 6e-04
40emb|BX058090.1|CNS09GZI Single read from an extremity of a full-... 54 6e-04
41emb|BX047036.1|CNS098GG Single read from an extremity of a full-... 54 6e-04
42emb|BX042897.1|CNS0959H Single read from an extremity of a full-... 54 6e-04
43emb|BX037203.1|CNS090VB Single read from an extremity of a full-... 54 6e-04
44emb|BX032800.1|CNS08XH0 Single read from an extremity of a full-... 54 6e-04
45emb|BX022454.1|CNS08PHM Single read from an extremity of a full-... 54 6e-04
46emb|BX025429.1|CNS08RS9 Single read from an extremity of a full-... 54 6e-04
47emb|BX025374.1|CNS08RQQ Single read from an extremity of a full-... 54 6e-04
48emb|BX025373.1|CNS08RQP Single read from an extremity of a full-... 54 6e-04
49emb|BX015203.1|CNS08JW7 Single read from an extremity of a full-... 54 6e-04
50emb|BX013195.1|CNS08ICF Single read from an extremity of a full-... 54 6e-04
51emb|BX010233.1|CNS08G25 Single read from an extremity of a full-... 54 6e-04
52emb|BX009560.1|CNS08FJG Single read from an extremity of a full-... 54 6e-04
53ref|XM_317219.2| Anopheles gambiae str. PEST ENSANGP00000012024 ... 54 6e-04
54ref|XM_307323.1| Anopheles gambiae str. PEST ENSANGP00000001996 ... 54 6e-04
55gb|AY398321.1| Danio rerio clone RK074A2D01 chaperonin containin... 52 0.002
56gb|AY648807.1| Danio rerio TCP-1 epsilon mRNA, complete cds 52 0.002
57gb|BC068037.1| Danio rerio chaperonin containing TCP1, subunit 5... 52 0.002
58emb|BX469922.12| Zebrafish DNA sequence from clone DKEY-30N5 in ... 52 0.002
59ref|NM_212613.1| Danio rerio chaperonin containing TCP1, subunit... 52 0.002
60emb|BX010234.1|CNS08G26 Single read from an extremity of a full-... 50 0.009
61ref|XM_762836.1| Giardia lamblia ATCC 50803 hypothetical protein... 46 0.15
62ref|XM_762838.1| Giardia lamblia ATCC 50803 chaperonin subunit e... 46 0.15
63emb|BX024353.1|CNS08QYD Single read from an extremity of a full-... 46 0.15
64emb|AJ851489.1| Gallus gallus mRNA for hypothetical protein, clo... 46 0.15
65gb|AF226724.1|AF226724 Giardia intestinalis chaperonin subunit e... 46 0.15
66ref|NM_001012563.1| Gallus gallus chaperonin containing TCP1, su... 46 0.15
67emb|CR699738.2|CNS0G2VA Tetraodon nigroviridis full-length cDNA 44 0.58
68emb|AL031429.11|HS333A15 Human DNA sequence from clone RP3-333A1... 44 0.58
69emb|BX033735.1|CNS08Y6Z Single read from an extremity of a full-... 44 0.58
70emb|BX025983.1|CNS08S7N Single read from an extremity of a full-... 44 0.58
71gb|AE000516.2| Mycobacterium tuberculosis CDC1551, complete genome 42 2.3
72gb|CP000124.1| Burkholderia pseudomallei 1710b chromosome I, com... 42 2.3
73emb|AL135789.18| Human DNA sequence from clone RP11-412H14 on ch... 42 2.3
74emb|BX842584.1| Mycobacterium tuberculosis H37Rv complete genome... 42 2.3
75emb|BX248347.1| Mycobacterium bovis subsp. bovis AF2122/97 compl... 42 2.3
76dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 42 2.3
77gb|AC092660.2| Homo sapiens BAC clone RP11-502A5 from 2, complet... 42 2.3
78dbj|AP005848.3| Oryza sativa (japonica cultivar-group) genomic D... 42 2.3
79gb|AD000017.1|MSGY409 Mycobacterium tuberculosis sequence from c... 42 2.3
80gb|AY377120.1| Liparthrum semidegener isolate sem-Madeira elonga... 40 9.1
81gb|AY377081.1| Liparthrum canum isolate can-LaGomera elongation ... 40 9.1
82gb|AY377073.1| Liparthrum artemisiae isolate art-Tenerife elonga... 40 9.1
83gb|AY377072.1| Liparthrum artemisiae isolate art-LaGomera elonga... 40 9.1
84gb|AY377067.1| Liparthrum bartschti elongation factor 1-alpha (E... 40 9.1
85gb|DQ141315.1| Xyleborus amputatus elongation factor 1-alpha (EF... 40 9.1
86emb|AL772262.4| Human DNA sequence from clone RP11-444C24 on chr... 40 9.1
87emb|AL590138.7| Human DNA sequence from clone RP11-243A2 on chro... 40 9.1
88gb|AY131133.1| Diocalandra frumenti elongation factor 1-alpha ge... 40 9.1
89gb|AF508886.1| Xylosandrus sp. nov (cf. ursa) elongation factor ... 40 9.1
90gb|AF508882.1| Webbia cf. platypoides elongation factor 1-alpha ... 40 9.1
91gb|AF508869.1| Ambrosiodmus compressus elongation factor 1-alpha... 40 9.1
92emb|AJ243431.1|ALW243431 Acinetobacter lwoffii wzc, wzb, wza, we... 40 9.1
93gb|AF444076.1| Coccotrypes advena isolate Dry20 elongation facto... 40 9.1
94gb|AF444074.1| Coccotrypes cyperi elongation factor 1-alpha (EF-... 40 9.1
95gb|AF444071.1| Coccotrypes cf. rhizophorae elongation factor 1-a... 40 9.1
96gb|AF439740.1| Ozopemon uniseriatus elongation factor 1-alpha (E... 40 9.1
97gb|AF308414.1| Liparthrum nigrescens elongation factor 1 alpha (... 40 9.1
98gb|AF308412.1| Hylesinopsis sp. HLH11 elongation factor 1 alpha ... 40 9.1
99gb|AF308411.1| Alniphagus aspericollis elongation factor 1 alpha... 40 9.1
100gb|AF186693.2| Xylosandrus mancus elongation factor 1 alpha (ef-... 40 9.1
101gb|AF186675.1| Ips perturbatus elongation factor 1 alpha (ef-1a)... 40 9.1
102gb|AF186673.1| Pityokteines minutus elongation factor 1 alpha (e... 40 9.1
103gb|AF186671.1| Araptus sp. SCH05 elongation factor 1 alpha (ef-1... 40 9.1
104gb|AF186661.2| Dryocoetes affaber elongation factor 1 alpha (ef-... 40 9.1
105gb|AF186660.2| Dryoxylon onoharaensum elongation factor 1 alpha ... 40 9.1
106gb|AC007155.16| Arabidopsis thaliana chromosome 2 clone T18E17 m... 40 9.1
107gb|AC006437.5| Arabidopsis thaliana chromosome 2 clone T19K21 ma... 40 9.1
108gb|AF397647.1| Pityokteines sparsus elongation factor 1 alpha (E... 40 9.1
109gb|AF397640.1| Ips woodi elongation factor 1 alpha (EF-1alpha) g... 40 9.1
110gb|AF397638.1| Ips tridens elongation factor 1 alpha (EF-1alpha)... 40 9.1
111gb|AF397636.1| Ips pini elongation factor 1 alpha (EF-1alpha) ge... 40 9.1
112gb|AF397635.1| Ips pilifrons elongation factor 1 alpha (EF-1alph... 40 9.1
113gb|AF397634.1| Ips plastographus elongation factor 1 alpha (EF-1... 40 9.1
114gb|AF397633.1| Ips perturbatus elongation factor 1 alpha (EF-1al... 40 9.1
115gb|AF397632.1| Ips perroti elongation factor 1 alpha (EF-1alpha)... 40 9.1
116gb|AF397631.1| Ips paraconfusus elongation factor 1 alpha (EF-1a... 40 9.1
117gb|AF397630.1| Ips montanus elongation factor 1 alpha (EF-1alpha... 40 9.1
118gb|AF397629.1| Ips lecontei elongation factor 1 alpha (EF-1alpha... 40 9.1
119gb|AF397627.1| Ips integer elongation factor 1 alpha (EF-1alpha)... 40 9.1
120gb|AF397626.1| Ips hunteri elongation factor 1 alpha (EF-1alpha)... 40 9.1
121gb|AF397624.1| Ips grandicollis elongation factor 1 alpha (EF-1a... 40 9.1
122gb|AF397621.1| Ips cribricollis elongation factor 1 alpha (EF-1a... 40 9.1
123gb|AF397620.1| Ips confusus elongation factor 1 alpha (EF-1alpha... 40 9.1
124gb|AF397619.1| Ips cembrae elongation factor 1 alpha (EF-1alpha)... 40 9.1
125gb|AF397618.1| Ips calligraphus elongation factor 1 alpha (EF-1a... 40 9.1
126gb|AF397617.1| Ips borealis elongation factor 1 alpha (EF-1alpha... 40 9.1
127gb|AF397615.1| Ips avulsus elongation factor 1 alpha (EF-1alpha)... 40 9.1
128gb|AF397614.1| Ips apache elongation factor 1 alpha (EF-1alpha) ... 40 9.1
129gb|AF397613.1| Ips amitinus elongation factor 1 alpha (EF-1alpha... 40 9.1
130gb|AF397612.1| Ips acuminatus elongation factor 1 alpha (EF-1alp... 40 9.1
131gb|AF259884.1| Webbia bicornis elongation factor 1 alpha (ef-1a)... 40 9.1
132gb|AF259882.1| Webbia quattuordecimspinatus elongation factor 1 ... 40 9.1
133gb|AF259877.1| Ambrosiodmus aegir elongation factor 1 alpha (ef-... 40 9.1
134gb|AF259875.1| Coccotrypes medius elongation factor 1 alpha (ef-... 40 9.1
135gb|AF259873.1| Dryocoetes autographus elongation factor 1 alpha ... 40 9.1
136gb|AF259871.1| Coccotrypes longior elongation factor 1 alpha (ef... 40 9.1
137gb|AF259870.1| Ozopemon brownei elongation factor 1 alpha (ef-1a... 40 9.1
138gb|AF259868.1| Coccotrypes advena elongation factor 1 alpha (ef-... 40 9.1
139gb|AF259867.1| Coccotrypes gedeanus elongation factor 1 alpha (e... 40 9.1
140gb|AF308432.1| Scolytodes parvulus elongation factor 1 alpha (ef... 40 9.1
141gb|AF308428.1| Dendroctonus ponderosae elongation factor 1 alpha... 40 9.1
142gb|AF308427.1| Dendroctonus murrayanae elongation factor 1 alpha... 40 9.1
143gb|AF308425.1| Dendroctonus jeffreyi elongation factor 1 alpha (... 40 9.1
144gb|AF308423.1| Dendroctonus adjunctus isolate hlt12 elongation f... 40 9.1
145gb|AF308401.1| Hylesinopsis sp. HLD02 elongation factor 1 alpha ... 40 9.1
146gb|AF375274.1| Gnathotrupes sp. SCL07 elongation factor-1 alpha ... 40 9.1
147gb|AF375273.1| Gnathotrupes sp. SCL06 elongation factor-1 alpha ... 40 9.1
148gb|AF375264.1| Stenancylus sp. COR01 elongation factor 1-alpha (... 40 9.1
149gb|AC027323.5| Homo sapiens chromosome 5 clone CTD-2034A10, comp... 40 9.1
150dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 40 9.1
151dbj|AP000039.1| Homo sapiens genomic DNA, chromosome 21q22.1, se... 40 9.1
152gb|CP000251.1| Anaeromyxobacter dehalogenans 2CP-C, complete genome 40 9.1
153dbj|AP002882.2| Oryza sativa (japonica cultivar-group) genomic D... 40 9.1
154emb|AL954212.1| Pan troglodytes chromosome 22 clone RP43-043L10 ... 40 9.1
155emb|AL954211.1| Pan troglodytes chromosome 22 clone PTB-034G05 m... 40 9.1
156gb|AY500988.1| Coleobothrus luridus voucher Co12lurT elongation ... 40 9.1
157gb|AY500987.1| Coleobothrus luridus voucher Co11lurLP elongation... 40 9.1
158gb|AY500986.1| Coleobothrus luridus voucher Co10lurLG elongation... 40 9.1
159gb|AY500985.1| Coleobothrus luridus voucher Co09lurGC elongation... 40 9.1
160gb|AY500982.1| Cisurgus wollastoni voucher Ci11wolLP elongation ... 40 9.1
161gb|AY500981.1| Cisurgus wollastoni voucher Ci09wolEH elongation ... 40 9.1
162gb|AY500980.1| Cisurgus occidentalis voucher Ci07occMo elongatio... 40 9.1
163gb|AY500977.1| Cisurgus wollastoni voucher Ci01wolT elongation f... 40 9.1
164gb|AY500952.1| Aphanarthrum canariense voucher A61carLP elongati... 40 9.1
165gb|AY500926.1| Aphanarthrum mairei voucher A29maiMo elongation f... 40 9.1
166gb|AY500925.1| Aphanarthrum mairei voucher A28maiMo elongation f... 40 9.1
167gb|AY500922.1| Aphanarthrum mairei voucher A25maiMo elongation f... 40 9.1
168gb|AY500920.1| Aphanarthrum canariense voucher A23carLP elongati... 40 9.1
169emb|BX005105.6| Zebrafish DNA sequence from clone DKEY-37M8 in l... 40 9.1
170dbj|AP000999.6| Homo sapiens genomic DNA, chromosome 11 clone:RP... 40 9.1
171dbj|AP002853.4| Homo sapiens genomic DNA, chromosome 11 clone:RP... 40 9.1
172dbj|AP001715.1| Homo sapiens genomic DNA, chromosome 21q, sectio... 40 9.1
173gb|AC138027.3| Mus musculus BAC clone RP24-100L8 from 12, comple... 40 9.1
174emb|CT030194.5| Mouse DNA sequence from clone RP23-463F7 on chro... 40 9.1
175dbj|AP000281.1| Homo sapiens genomic DNA, chromosome 21q22.1, D2... 40 9.1
176dbj|AP000183.1| Homo sapiens genomic DNA, chromosome 21q22.1, D2... 40 9.1
177dbj|AP000107.1| Homo sapiens genomic DNA of 21q22.1, GART and AM... 40 9.1

>emb|X75778.1|ASTCPP1A A.sativa (Pewi) ASTCP-K36 mRNA for t complex polypeptide 1
          Length = 2022

 Score =  607 bits (306), Expect = e-170
 Identities = 384/410 (93%)
 Strand = Plus / Minus

                                                                        
Query: 259  gaaggcgttataacatcatcgatcttgaggatcatcttgacaacctgtgttgccagcaag 318
            |||||||| |||||||||||||||||||||||||||||||| ||||| ||||||||||||
Sbjct: 1730 gaaggcgtgataacatcatcgatcttgaggatcatcttgacgacctgggttgccagcaag 1671

                                                                        
Query: 319  atctgctgctgcttgccgatcagagtctcgaaaacattctgctctttcatgtcgttggta 378
            ||||||||||||||||| |||||||| |||||||||||||||||||||||||| ||||||
Sbjct: 1670 atctgctgctgcttgccaatcagagtttcgaaaacattctgctctttcatgtcattggta 1611

                                                                        
Query: 379  ccaacatcattgcaatcgatgccacagcgggaattgttctccttgacgtgttgagatttt 438
            || |||||||||||||| ||||| || || ||||||||||||||||| ||||||||||||
Sbjct: 1610 cccacatcattgcaatcaatgccgcaacgagaattgttctccttgacatgttgagatttt 1551

                                                                        
Query: 439  acgacggtgagagtatcaataggtgccaaaccactgttttcagctaaagctagtggaatg 498
            || ||||| |||||||||||||||| |||||||||||||||||||||||| | |||||| 
Sbjct: 1550 accacggtcagagtatcaataggtggcaaaccactgttttcagctaaagccaatggaata 1491

                                                                        
Query: 499  gcatccaaagcatcagcaaatgccctgattgcatactgctcaactccaggatgccgatct 558
            |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||
Sbjct: 1490 gcatccaaagcatcagcaaatgccctgattgcatactgttcaactccaggatgccgatct 1431

                                                                        
Query: 559  gctgcagcgtcaacagcaattgagcaagatatttctgctgagccaccaccatacacaatt 618
            || ||||| ||||||||||| ||||||||||| |||||||||||||||||||||||||||
Sbjct: 1430 gcagcagcttcaacagcaatcgagcaagatatctctgctgagccaccaccatacacaatt 1371

                                                              
Query: 619  gagttgttgatgatcagattccttgcaacacatagagcatcatgaatact 668
            |||||||||||||| ||||||||||||||||| || ||||||||||||||
Sbjct: 1370 gagttgttgatgatgagattccttgcaacacaaagcgcatcatgaatact 1321



to top

>emb|X75777.1|ASTCPP1 A.sativa (Pewi) ASTCP-K19 mRNA for t complex polypeptide 1
          Length = 2039

 Score =  595 bits (300), Expect = e-167
 Identities = 390/420 (92%)
 Strand = Plus / Minus

                                                                        
Query: 249  tcaatactcggaaggcgttataacatcatcgatcttgaggatcatcttgacaacctgtgt 308
            |||||| ||||||||||| |||||||||||||||||||||||||||||||| ||||| ||
Sbjct: 1715 tcaatattcggaaggcgtgataacatcatcgatcttgaggatcatcttgacgacctgggt 1656

                                                                        
Query: 309  tgccagcaagatctgctgctgcttgccgatcagagtctcgaaaacattctgctctttcat 368
            ||||||||||||||||||||||||||| |||||||| || ||||||||||||||||||||
Sbjct: 1655 tgccagcaagatctgctgctgcttgccaatcagagtttcaaaaacattctgctctttcat 1596

                                                                        
Query: 369  gtcgttggtaccaacatcattgcaatcgatgccacagcgggaattgttctccttgacgtg 428
            ||| |||||||| ||||| ||||| || ||||| ||||||||||||||||||||||| ||
Sbjct: 1595 gtcattggtacccacatcgttgcagtcaatgccgcagcgggaattgttctccttgacatg 1536

                                                                        
Query: 429  ttgagattttacgacggtgagagtatcaataggtgccaaaccactgttttcagctaaagc 488
            ||| |||||||| || || |||||||||||||||| ||||||||||||||||||||||||
Sbjct: 1535 ttgggattttaccactgtcagagtatcaataggtggcaaaccactgttttcagctaaagc 1476

                                                                        
Query: 489  tagtggaatggcatccaaagcatcagcaaatgccctgattgcatactgctcaactccagg 548
             |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1475 cagtggaatagcatccaaagcatcagcaaatgccctgattgcatactgctcaactccagg 1416

                                                                        
Query: 549  atgccgatctgctgcagcgtcaacagcaattgagcaagatatttctgctgagccaccacc 608
            ||||||||| || ||||| ||||||||||| ||||||||||| |||||||| ||||||||
Sbjct: 1415 atgccgatcagcagcagcttcaacagcaatcgagcaagatatctctgctgaaccaccacc 1356

                                                                        
Query: 609  atacacaattgagttgttgatgatcagattccttgcaacacatagagcatcatgaatact 668
            |||||| ||||||||||||||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 1355 atacacgattgagttgttgatgatgagattccttgcaacacaaagagcatcatgaatact 1296



to top

>dbj|AK105701.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-201-D07, full
            insert sequence
          Length = 2088

 Score =  385 bits (194), Expect = e-103
 Identities = 362/418 (86%)
 Strand = Plus / Minus

                                                                        
Query: 247  catcaatactcggaaggcgttataacatcatcgatcttgaggatcatcttgacaacctgt 306
            |||||||| || |||||||  |||||||||||||||||||| |||||||| || ||||| 
Sbjct: 1703 catcaatagtcagaaggcgagataacatcatcgatcttgagaatcatcttcaccacctgg 1644

                                                                        
Query: 307  gttgccagcaagatctgctgctgcttgccgatcagagtctcgaaaacattctgctctttc 366
            |||||||| |||||||||||||||||||| ||||| || || |||||||| || || |||
Sbjct: 1643 gttgccagtaagatctgctgctgcttgcctatcagtgtttcaaaaacattttgttccttc 1584

                                                                        
Query: 367  atgtcgttggtaccaacatcattgcaatcgatgccacagcgggaattgttctccttgacg 426
            |||| ||| || |||||||| ||||| || ||||||||| | | |||| ||||||| || 
Sbjct: 1583 atgtggtttgtcccaacatcgttgcagtcaatgccacagtgaggattgctctcctttact 1524

                                                                        
Query: 427  tgttgagattttacgacggtgagagtatcaataggtgccaaaccactgttttcagctaaa 486
            ||||||||||||||  | || || ||||||||||| | ||||||||||||||| || || 
Sbjct: 1523 tgttgagattttactgctgtcagtgtatcaataggagacaaaccactgttttcggccaag 1464

                                                                        
Query: 487  gctagtggaatggcatccaaagcatcagcaaatgccctgattgcatactgctcaactcca 546
            ||||||||||| |||||||| ||||||||||||| ||||||||||||||| |||||||| 
Sbjct: 1463 gctagtggaatagcatccaacgcatcagcaaatgacctgattgcatactgttcaactcct 1404

                                                                        
Query: 547  ggatgccgatctgctgcagcgtcaacagcaattgagcaagatatttctgctgagccacca 606
            || | ||||||||| ||||| |||||||||| ||||||||||||||||||||| ||||||
Sbjct: 1403 gggtaccgatctgcagcagcttcaacagcaactgagcaagatatttctgctgaaccacca 1344

                                                                      
Query: 607  ccatacacaattgagttgttgatgatcagattccttgcaacacatagagcatcatgaa 664
            |||||||||||||| || ||   ||| ||||||||||||||||| |||||||||||||
Sbjct: 1343 ccatacacaattgaattattacggataagattccttgcaacacaaagagcatcatgaa 1286



to top

>dbj|AK067114.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013095K16, full
            insert sequence
          Length = 2100

 Score =  385 bits (194), Expect = e-103
 Identities = 362/418 (86%)
 Strand = Plus / Minus

                                                                        
Query: 247  catcaatactcggaaggcgttataacatcatcgatcttgaggatcatcttgacaacctgt 306
            |||||||| || |||||||  |||||||||||||||||||| |||||||| || ||||| 
Sbjct: 1717 catcaatagtcagaaggcgagataacatcatcgatcttgagaatcatcttcaccacctgg 1658

                                                                        
Query: 307  gttgccagcaagatctgctgctgcttgccgatcagagtctcgaaaacattctgctctttc 366
            |||||||| |||||||||||||||||||| ||||| || || |||||||| || || |||
Sbjct: 1657 gttgccagtaagatctgctgctgcttgcctatcagtgtttcaaaaacattttgttccttc 1598

                                                                        
Query: 367  atgtcgttggtaccaacatcattgcaatcgatgccacagcgggaattgttctccttgacg 426
            |||| ||| || |||||||| ||||| || ||||||||| | | |||| ||||||| || 
Sbjct: 1597 atgtggtttgtcccaacatcgttgcagtcaatgccacagtgaggattgctctcctttact 1538

                                                                        
Query: 427  tgttgagattttacgacggtgagagtatcaataggtgccaaaccactgttttcagctaaa 486
            ||||||||||||||  | || || ||||||||||| | ||||||||||||||| || || 
Sbjct: 1537 tgttgagattttactgctgtcagtgtatcaataggagacaaaccactgttttcggccaag 1478

                                                                        
Query: 487  gctagtggaatggcatccaaagcatcagcaaatgccctgattgcatactgctcaactcca 546
            ||||||||||| |||||||| ||||||||||||| ||||||||||||||| |||||||| 
Sbjct: 1477 gctagtggaatagcatccaacgcatcagcaaatgacctgattgcatactgttcaactcct 1418

                                                                        
Query: 547  ggatgccgatctgctgcagcgtcaacagcaattgagcaagatatttctgctgagccacca 606
            || | ||||||||| ||||| |||||||||| ||||||||||||||||||||| ||||||
Sbjct: 1417 gggtaccgatctgcagcagcttcaacagcaactgagcaagatatttctgctgaaccacca 1358

                                                                      
Query: 607  ccatacacaattgagttgttgatgatcagattccttgcaacacatagagcatcatgaa 664
            |||||||||||||| || ||   ||| ||||||||||||||||| |||||||||||||
Sbjct: 1357 ccatacacaattgaattattacggataagattccttgcaacacaaagagcatcatgaa 1300



to top

>gb|AY103729.1| Zea mays PCO099347 mRNA sequence
          Length = 2083

 Score =  297 bits (150), Expect = 2e-77
 Identities = 333/394 (84%)
 Strand = Plus / Minus

                                                                        
Query: 271  acatcatcgatcttgaggatcatcttgacaacctgtgttgccagcaagatctgctgctgc 330
            ||||| |||||||| ||||||||||| || ||||| || || ||||||||||| ||||||
Sbjct: 1706 acatcgtcgatcttcaggatcatcttcaccacctgggtggcaagcaagatctgttgctgc 1647

                                                                        
Query: 331  ttgccgatcagagtctcgaaaacattctgctctttcatgtcgttggtaccaacatcattg 390
            ||||| ||||| |||||||| || ||||| |||||||||||| |||| ||||| || |||
Sbjct: 1646 ttgccaatcagggtctcgaagacgttctgttctttcatgtcggtggtgccaacgtcgttg 1587

                                                                        
Query: 391  caatcgatgccacagcgggaattgttctccttgacgtgttgagattttacgacggtgaga 450
            || || ||||| ||| |||  ||| |||||||||| ||||||| ||||||  | || |  
Sbjct: 1586 cagtctatgccgcagtgggggttgctctccttgacttgttgagcttttaccgcagttaag 1527

                                                                        
Query: 451  gtatcaataggtgccaaaccactgttttcagctaaagctagtggaatggcatccaaagca 510
            |||||||| |||| ||||||||||||||| || || ||||||||||  ||||| || |||
Sbjct: 1526 gtatcaattggtgacaaaccactgttttcggccaacgctagtggaacagcatctaatgca 1467

                                                                        
Query: 511  tcagcaaatgccctgattgcatactgctcaactccaggatgccgatctgctgcagcgtca 570
            ||||| |||| |||||| ||||||||||||||||| || |||| |||||| ||||  |||
Sbjct: 1466 tcagcgaatgacctgatagcatactgctcaactcccgggtgcctatctgcagcagtttca 1407

                                                                        
Query: 571  acagcaattgagcaagatatttctgctgagccaccaccatacacaattgagttgttgatg 630
            |||||||||||||||||||| || |||||||| ||||| |||||||||||||| ||   |
Sbjct: 1406 acagcaattgagcaagatatctcggctgagccgccaccgtacacaattgagttattccgg 1347

                                              
Query: 631  atcagattccttgcaacacatagagcatcatgaa 664
            |||||||||||||| || || |||||||||||||
Sbjct: 1346 atcagattccttgccacgcaaagagcatcatgaa 1313



to top

>gb|BT017463.1| Zea mays clone EL01N0407F08.c mRNA sequence
          Length = 710

 Score =  293 bits (148), Expect = 4e-76
 Identities = 313/368 (85%)
 Strand = Plus / Minus

                                                                       
Query: 277 tcgatcttgaggatcatcttgacaacctgtgttgccagcaagatctgctgctgcttgccg 336
           |||||||| ||||||||||| || ||||| ||||| |||| |||||||||||||||||| 
Sbjct: 379 tcgatcttcaggatcatcttcaccacctgagttgctagcaggatctgctgctgcttgcca 320

                                                                       
Query: 337 atcagagtctcgaaaacattctgctctttcatgtcgttggtaccaacatcattgcaatcg 396
           ||||| ||||| || || ||||||||||||||||||||||| || ||||| ||||| || 
Sbjct: 319 atcagggtctcaaagacgttctgctctttcatgtcgttggtgcctacatcgttgcagtct 260

                                                                       
Query: 397 atgccacagcgggaattgttctccttgacgtgttgagattttacgacggtgagagtatca 456
           ||||| ||| |||  ||| ||||||| || || |||| ||||||  | || |  ||||||
Sbjct: 259 atgccgcagtgggggttgctctccttaacttgctgagcttttaccgccgtcaaggtatca 200

                                                                       
Query: 457 ataggtgccaaaccactgttttcagctaaagctagtggaatggcatccaaagcatcagca 516
           || || | |||||||||||||||||| || ||||||||||  ||||| || |||||||| 
Sbjct: 199 attggcgacaaaccactgttttcagccaaggctagtggaacagcatctaatgcatcagcg 140

                                                                       
Query: 517 aatgccctgattgcatactgctcaactccaggatgccgatctgctgcagcgtcaacagca 576
           |||| |||||| || ||||||||||||||||| ||||||||||| ||||  |||||||||
Sbjct: 139 aatgacctgatagcgtactgctcaactccagggtgccgatctgcagcagtttcaacagca 80

                                                                       
Query: 577 attgagcaagatatttctgctgagccaccaccatacacaattgagttgttgatgatcaga 636
           |||||||||||||| |||||||||||||| || ||||| |||||||||||   |||||||
Sbjct: 79  attgagcaagatatctctgctgagccaccgccgtacacgattgagttgttccggatcaga 20

                   
Query: 637 ttccttgc 644
           ||||||||
Sbjct: 19  ttccttgc 12



to top

>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete
                sequence
          Length = 30731886

 Score =  141 bits (71), Expect = 3e-30
 Identities = 113/127 (88%)
 Strand = Plus / Plus

                                                                            
Query: 538      tcaactccaggatgccgatctgctgcagcgtcaacagcaattgagcaagatatttctgct 597
                |||||||| || | ||||||||| ||||| |||||||||| |||||||||||||||||||
Sbjct: 21251451 tcaactcctgggtaccgatctgcagcagcttcaacagcaactgagcaagatatttctgct 21251510

                                                                            
Query: 598      gagccaccaccatacacaattgagttgttgatgatcagattccttgcaacacatagagca 657
                || |||||||||||||||||||| || ||   ||| ||||||||||||||||| ||||||
Sbjct: 21251511 gaaccaccaccatacacaattgaattattacggataagattccttgcaacacaaagagca 21251570

                       
Query: 658      tcatgaa 664
                |||||||
Sbjct: 21251571 tcatgaa 21251577



 Score =  141 bits (71), Expect = 3e-30
 Identities = 137/159 (86%)
 Strand = Plus / Plus

                                                                            
Query: 247      catcaatactcggaaggcgttataacatcatcgatcttgaggatcatcttgacaacctgt 306
                |||||||| || |||||||  |||||||||||||||||||| |||||||| || ||||| 
Sbjct: 21250809 catcaatagtcagaaggcgagataacatcatcgatcttgagaatcatcttcaccacctgg 21250868

                                                                            
Query: 307      gttgccagcaagatctgctgctgcttgccgatcagagtctcgaaaacattctgctctttc 366
                |||||||| |||||||||||||||||||| ||||| || || |||||||| || || |||
Sbjct: 21250869 gttgccagtaagatctgctgctgcttgcctatcagtgtttcaaaaacattttgttccttc 21250928

                                                       
Query: 367      atgtcgttggtaccaacatcattgcaatcgatgccacag 405
                |||| ||| || |||||||| ||||| || |||||||||
Sbjct: 21250929 atgtggtttgtcccaacatcgttgcagtcaatgccacag 21250967



 Score =  117 bits (59), Expect = 5e-23
 Identities = 98/111 (88%)
 Strand = Plus / Plus

                                                                            
Query: 427      tgttgagattttacgacggtgagagtatcaataggtgccaaaccactgttttcagctaaa 486
                ||||||||||||||  | || || ||||||||||| | ||||||||||||||| || || 
Sbjct: 21251268 tgttgagattttactgctgtcagtgtatcaataggagacaaaccactgttttcggccaag 21251327

                                                                   
Query: 487      gctagtggaatggcatccaaagcatcagcaaatgccctgattgcatactgc 537
                ||||||||||| |||||||| ||||||||||||| ||||||||||||||||
Sbjct: 21251328 gctagtggaatagcatccaacgcatcagcaaatgacctgattgcatactgc 21251378



to top

>dbj|AP003714.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC
             clone:P0656E03
          Length = 181786

 Score =  141 bits (71), Expect = 3e-30
 Identities = 113/127 (88%)
 Strand = Plus / Plus

                                                                         
Query: 538   tcaactccaggatgccgatctgctgcagcgtcaacagcaattgagcaagatatttctgct 597
             |||||||| || | ||||||||| ||||| |||||||||| |||||||||||||||||||
Sbjct: 46827 tcaactcctgggtaccgatctgcagcagcttcaacagcaactgagcaagatatttctgct 46886

                                                                         
Query: 598   gagccaccaccatacacaattgagttgttgatgatcagattccttgcaacacatagagca 657
             || |||||||||||||||||||| || ||   ||| ||||||||||||||||| ||||||
Sbjct: 46887 gaaccaccaccatacacaattgaattattacggataagattccttgcaacacaaagagca 46946

                    
Query: 658   tcatgaa 664
             |||||||
Sbjct: 46947 tcatgaa 46953



 Score =  141 bits (71), Expect = 3e-30
 Identities = 137/159 (86%)
 Strand = Plus / Plus

                                                                         
Query: 247   catcaatactcggaaggcgttataacatcatcgatcttgaggatcatcttgacaacctgt 306
             |||||||| || |||||||  |||||||||||||||||||| |||||||| || ||||| 
Sbjct: 46185 catcaatagtcagaaggcgagataacatcatcgatcttgagaatcatcttcaccacctgg 46244

                                                                         
Query: 307   gttgccagcaagatctgctgctgcttgccgatcagagtctcgaaaacattctgctctttc 366
             |||||||| |||||||||||||||||||| ||||| || || |||||||| || || |||
Sbjct: 46245 gttgccagtaagatctgctgctgcttgcctatcagtgtttcaaaaacattttgttccttc 46304

                                                    
Query: 367   atgtcgttggtaccaacatcattgcaatcgatgccacag 405
             |||| ||| || |||||||| ||||| || |||||||||
Sbjct: 46305 atgtggtttgtcccaacatcgttgcagtcaatgccacag 46343



 Score =  117 bits (59), Expect = 5e-23
 Identities = 98/111 (88%)
 Strand = Plus / Plus

                                                                         
Query: 427   tgttgagattttacgacggtgagagtatcaataggtgccaaaccactgttttcagctaaa 486
             ||||||||||||||  | || || ||||||||||| | ||||||||||||||| || || 
Sbjct: 46644 tgttgagattttactgctgtcagtgtatcaataggagacaaaccactgttttcggccaag 46703

                                                                
Query: 487   gctagtggaatggcatccaaagcatcagcaaatgccctgattgcatactgc 537
             ||||||||||| |||||||| ||||||||||||| ||||||||||||||||
Sbjct: 46704 gctagtggaatagcatccaacgcatcagcaaatgacctgattgcatactgc 46754



to top

>gb|AF097668.1|AF097668 Mesembryanthemum crystallinum T-complex protein 1 epsilon subunit
            (TCP-1-EPSILON) mRNA, partial cds
          Length = 1458

 Score =  119 bits (60), Expect = 1e-23
 Identities = 138/164 (84%)
 Strand = Plus / Minus

                                                                        
Query: 502  tccaaagcatcagcaaatgccctgattgcatactgctcaactccaggatgccgatctgct 561
            ||||||||||||||||| |||||||| ||||| ||||||||||| || |  || || || 
Sbjct: 1004 tccaaagcatcagcaaaggccctgatggcatattgctcaactcctgggtatcggtcagca 945

                                                                        
Query: 562  gcagcgtcaacagcaattgagcaagatatttctgctgagccaccaccatacacaattgag 621
            || || || |||||||  |||||||  |||||||| |||||||||||||||||||| || 
Sbjct: 944  gcggcctctacagcaagagagcaagcaatttctgcagagccaccaccatacacaatagaa 885

                                                        
Query: 622  ttgttgatgatcagattccttgcaacacatagagcatcatgaat 665
            || |||  |||||||||||| |||||||| || |||||||||||
Sbjct: 884  ttattgcggatcagattcctagcaacacaaagtgcatcatgaat 841



 Score =  107 bits (54), Expect = 5e-20
 Identities = 141/170 (82%)
 Strand = Plus / Minus

                                                                        
Query: 268  ataacatcatcgatcttgaggatcatcttgacaacctgtgttgccagcaagatctgctgc 327
            ||||||||||||||||| |  |||||||| |||||||| || |||||||| | ||| |||
Sbjct: 1238 ataacatcatcgatcttcaaaatcatcttcacaacctgagtagccagcaaaagctgttgc 1179

                                                                        
Query: 328  tgcttgccgatcagagtctcgaaaacattctgctctttcatgtcgttggtaccaacatca 387
            | ||| || ||||  ||||||||||||||||||||   ||||||||| || |||||||| 
Sbjct: 1178 ttctttccaatcaatgtctcgaaaacattctgctcacgcatgtcgtttgtgccaacatcg 1119

                                                              
Query: 388  ttgcaatcgatgccacagcgggaattgttctccttgacgtgttgagattt 437
            ||||| || || |||||||  | |||||||||||| || || ||||||||
Sbjct: 1118 ttgcagtctataccacagcatggattgttctccttaacttgctgagattt 1069



to top

>gb|AC141435.28| Medicago truncatula clone mth2-21i11, complete sequence
          Length = 132497

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 113/135 (83%)
 Strand = Plus / Minus

                                                                          
Query: 268    ataacatcatcgatcttgaggatcatcttgacaacctgtgttgccagcaagatctgctgc 327
              ||||||||||| || || |  |||||||||||||| || || || ||||||||||| |||
Sbjct: 107610 ataacatcatcaatttttaatatcatcttgacaacttgagtagcaagcaagatctgttgc 107551

                                                                          
Query: 328    tgcttgccgatcagagtctcgaaaacattctgctctttcatgtcgttggtaccaacatca 387
              ||||| ||||||| ||| || || || || |||||  ||||||| ||||| |||||||||
Sbjct: 107550 tgctttccgatcaaagtttcaaagacgttttgctccctcatgtcattggtgccaacatca 107491

                             
Query: 388    ttgcaatcgatgcca 402
              |||||||| ||||||
Sbjct: 107490 ttgcaatcaatgcca 107476



 Score = 44.1 bits (22), Expect = 0.58
 Identities = 61/74 (82%)
 Strand = Plus / Minus

                                                                          
Query: 595    gctgagccaccaccatacacaattgagttgttgatgatcagattccttgcaacacataga 654
              ||||| || ||||||||||||||||| || |||   || |||||||| || ||||| |  
Sbjct: 106066 gctgaaccgccaccatacacaattgaattattgcgaataagattcctagccacacacaat 106007

                            
Query: 655    gcatcatgaatact 668
              ||||||||||||||
Sbjct: 106006 gcatcatgaatact 105993



 Score = 40.1 bits (20), Expect = 9.1
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                                  
Query: 502    tccaaagcatcagcaaatgccctgattgcatactgc 537
              |||||||||||  ||||||| || ||||||||||||
Sbjct: 107245 tccaaagcatccccaaatgctctaattgcatactgc 107210



to top

>emb|CT030174.3| M.truncatula DNA sequence from clone MTH2-71J12 on chromosome 3,
             complete sequence
          Length = 133240

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 113/135 (83%)
 Strand = Plus / Plus

                                                                         
Query: 268   ataacatcatcgatcttgaggatcatcttgacaacctgtgttgccagcaagatctgctgc 327
             ||||||||||| || || |  |||||||||||||| || || || ||||||||||| |||
Sbjct: 96253 ataacatcatcaatttttaatatcatcttgacaacttgagtagcaagcaagatctgttgc 96312

                                                                         
Query: 328   tgcttgccgatcagagtctcgaaaacattctgctctttcatgtcgttggtaccaacatca 387
             ||||| ||||||| ||| || || || || |||||  ||||||| ||||| |||||||||
Sbjct: 96313 tgctttccgatcaaagtttcaaagacgttttgctccctcatgtcattggtgccaacatca 96372

                            
Query: 388   ttgcaatcgatgcca 402
             |||||||| ||||||
Sbjct: 96373 ttgcaatcaatgcca 96387



 Score = 44.1 bits (22), Expect = 0.58
 Identities = 61/74 (82%)
 Strand = Plus / Plus

                                                                         
Query: 595   gctgagccaccaccatacacaattgagttgttgatgatcagattccttgcaacacataga 654
             ||||| || ||||||||||||||||| || |||   || |||||||| || ||||| |  
Sbjct: 97797 gctgaaccgccaccatacacaattgaattattgcgaataagattcctagccacacacaat 97856

                           
Query: 655   gcatcatgaatact 668
             ||||||||||||||
Sbjct: 97857 gcatcatgaatact 97870



 Score = 40.1 bits (20), Expect = 9.1
 Identities = 32/36 (88%)
 Strand = Plus / Plus

                                                 
Query: 502   tccaaagcatcagcaaatgccctgattgcatactgc 537
             |||||||||||  ||||||| || ||||||||||||
Sbjct: 96618 tccaaagcatccccaaatgctctaattgcatactgc 96653



to top

>emb|X85013.1|CSRNATCP1 C.sativus mRNA for T-complex polypeptide 1
          Length = 2030

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 135/167 (80%)
 Strand = Plus / Minus

                                                                        
Query: 502  tccaaagcatcagcaaatgccctgattgcatactgctcaactccaggatgccgatctgct 561
            |||| |||||||||||||||||| || |||||||||||||||||||| |    ||| || 
Sbjct: 1399 tccagagcatcagcaaatgccctaatagcatactgctcaactccagggtatttatcagca 1340

                                                                        
Query: 562  gcagcgtcaacagcaattgagcaagatatttctgctgagccaccaccatacacaattgag 621
            || |  |||||||||| ||| ||||| || || |||||||||||||| || || || |||
Sbjct: 1339 gctgtctcaacagcaactgaacaagaaatctcagctgagccaccaccgtatactatggag 1280

                                                           
Query: 622  ttgttgatgatcagattccttgcaacacatagagcatcatgaatact 668
            || |||   || ||||| || || ||||||| ||||||||| |||||
Sbjct: 1279 ttattgcgaatgagatttctagccacacataaagcatcatggatact 1233



 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 136/170 (80%)
 Strand = Plus / Minus

                                                                        
Query: 271  acatcatcgatcttgaggatcatcttgacaacctgtgttgccagcaagatctgctgctgc 330
            |||||||| ||||| || |||||||| || ||||| |||||||| || ||||| || |||
Sbjct: 1630 acatcatcaatcttcagaatcatcttcacgacctgagttgccagtaaaatctgttgttgc 1571

                                                                        
Query: 331  ttgccgatcagagtctcgaaaacattctgctctttcatgtcgttggtaccaacatcattg 390
            || ||||||| |||||| || || || |||||  ||||||| || || |||| |||||||
Sbjct: 1570 ttaccgatcaaagtctcaaatacgttttgctccctcatgtcatttgtgccaatatcattg 1511

                                                              
Query: 391  caatcgatgccacagcgggaattgttctccttgacgtgttgagattttac 440
            || || || |||||    | |||||||||||| |  || |||||||||||
Sbjct: 1510 cagtcaattccacaataaggattgttctccttaatttgctgagattttac 1461



to top

>ref|NM_102295.3| Arabidopsis thaliana ATP binding / protein binding AT1G24510
            transcript variant AT1G24510.1 mRNA, complete cds
          Length = 1906

 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 134/167 (80%)
 Strand = Plus / Minus

                                                                        
Query: 502  tccaaagcatcagcaaatgccctgattgcatactgctcaactccaggatgccgatctgct 561
            |||||||| || ||||| ||||| |||||||||||||| || ||||| |    ||| || 
Sbjct: 1459 tccaaagcttctgcaaacgccctaattgcatactgctccacgccagggtatttatcagca 1400

                                                                        
Query: 562  gcagcgtcaacagcaattgagcaagatatttctgctgagccaccaccatacacaattgag 621
            || || ||||| |||| ||||||||  ||||| ||||  ||||| ||||| |||||||| 
Sbjct: 1399 gctgcatcaaccgcaagtgagcaagcgatttcagctgccccacctccataaacaattgat 1340

                                                           
Query: 622  ttgttgatgatcagattccttgcaacacatagagcatcatgaatact 668
            ||||||  ||| |||||||| || ||||| |||||||| || |||||
Sbjct: 1339 ttgttgcggatgagattcctagccacacacagagcatcgtggatact 1293



to top

>ref|NM_202178.1| Arabidopsis thaliana ATP binding / protein binding AT1G24510
            transcript variant AT1G24510.2 mRNA, complete cds
          Length = 2157

 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 134/167 (80%)
 Strand = Plus / Minus

                                                                        
Query: 502  tccaaagcatcagcaaatgccctgattgcatactgctcaactccaggatgccgatctgct 561
            |||||||| || ||||| ||||| |||||||||||||| || ||||| |    ||| || 
Sbjct: 1710 tccaaagcttctgcaaacgccctaattgcatactgctccacgccagggtatttatcagca 1651

                                                                        
Query: 562  gcagcgtcaacagcaattgagcaagatatttctgctgagccaccaccatacacaattgag 621
            || || ||||| |||| ||||||||  ||||| ||||  ||||| ||||| |||||||| 
Sbjct: 1650 gctgcatcaaccgcaagtgagcaagcgatttcagctgccccacctccataaacaattgat 1591

                                                           
Query: 622  ttgttgatgatcagattccttgcaacacatagagcatcatgaatact 668
            ||||||  ||| |||||||| || ||||| |||||||| || |||||
Sbjct: 1590 ttgttgcggatgagattcctagccacacacagagcatcgtggatact 1544



to top

>gb|BT000818.1| Arabidopsis thaliana T-complex chaperonin protein , epsilon subunit
            (At1g24510/F21J9_150) mRNA, complete cds
          Length = 1608

 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 134/167 (80%)
 Strand = Plus / Minus

                                                                        
Query: 502  tccaaagcatcagcaaatgccctgattgcatactgctcaactccaggatgccgatctgct 561
            |||||||| || ||||| ||||| |||||||||||||| || ||||| |    ||| || 
Sbjct: 1355 tccaaagcttctgcaaacgccctaattgcatactgctccacgccagggtatttatcagca 1296

                                                                        
Query: 562  gcagcgtcaacagcaattgagcaagatatttctgctgagccaccaccatacacaattgag 621
            || || ||||| |||| ||||||||  ||||| ||||  ||||| ||||| |||||||| 
Sbjct: 1295 gctgcatcaaccgcaagtgagcaagcgatttcagctgccccacctccataaacaattgat 1236

                                                           
Query: 622  ttgttgatgatcagattccttgcaacacatagagcatcatgaatact 668
            ||||||  ||| |||||||| || ||||| |||||||| || |||||
Sbjct: 1235 ttgttgcggatgagattcctagccacacacagagcatcgtggatact 1189



to top

>gb|AY075611.1| Arabidopsis thaliana At1g24510/F21J9_150 mRNA, complete cds
          Length = 1885

 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 134/167 (80%)
 Strand = Plus / Minus

                                                                        
Query: 502  tccaaagcatcagcaaatgccctgattgcatactgctcaactccaggatgccgatctgct 561
            |||||||| || ||||| ||||| |||||||||||||| || ||||| |    ||| || 
Sbjct: 1459 tccaaagcttctgcaaacgccctaattgcatactgctccacgccagggtatttatcagca 1400

                                                                        
Query: 562  gcagcgtcaacagcaattgagcaagatatttctgctgagccaccaccatacacaattgag 621
            || || ||||| |||| ||||||||  ||||| ||||  ||||| ||||| |||||||| 
Sbjct: 1399 gctgcatcaaccgcaagtgagcaagcgatttcagctgccccacctccataaacaattgat 1340

                                                           
Query: 622  ttgttgatgatcagattccttgcaacacatagagcatcatgaatact 668
            ||||||  ||| |||||||| || ||||| |||||||| || |||||
Sbjct: 1339 ttgttgcggatgagattcctagccacacacagagcatcgtggatact 1293



to top

>emb|BX815337.1|CNS0AAT9 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
            GSLTLS53ZC04 of Adult vegetative tissue of strain col-0
            of Arabidopsis thaliana (thale cress)
          Length = 2067

 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 134/167 (80%)
 Strand = Plus / Minus

                                                                        
Query: 502  tccaaagcatcagcaaatgccctgattgcatactgctcaactccaggatgccgatctgct 561
            |||||||| || ||||| ||||| |||||||||||||| || ||||| |    ||| || 
Sbjct: 1714 tccaaagcttctgcaaacgccctaattgcatactgctccacgccagggtatttatcagca 1655

                                                                        
Query: 562  gcagcgtcaacagcaattgagcaagatatttctgctgagccaccaccatacacaattgag 621
            || || ||||| |||| ||||||||  ||||| ||||  ||||| ||||| |||||||| 
Sbjct: 1654 gctgcatcaaccgcaagtgagcaagcgatttcagctgccccacctccataaacaattgat 1595

                                                           
Query: 622  ttgttgatgatcagattccttgcaacacatagagcatcatgaatact 668
            ||||||  ||| |||||||| || ||||| |||||||| || |||||
Sbjct: 1594 ttgttgcggatgagattcctagccacacacagagcatcgtggatact 1548



to top

>gb|AC077693.19| Oryza sativa chromosome 10 BAC OSJNBa0095C07 genomic sequence, complete
             sequence
          Length = 187707

 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 78/92 (84%), Gaps = 2/92 (2%)
 Strand = Plus / Minus

                                                                         
Query: 577   attgagcaagatatttctgctgagccaccaccatacacaattgagttgttgatgatcaga 636
             |||||||| ||||| |  ||||||||||||||||| ||||| ||||| |||   ||||||
Sbjct: 13788 attgagcatgatatctgagctgagccaccaccataaacaatagagttcttgcgaatcaga 13729

                                             
Query: 637   ttccttgcaacacatagagcatcatgaatact 668
             ||||| ||  |||| |||||||||||||||||
Sbjct: 13728 ttcctagc--cacacagagcatcatgaatact 13699



 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 52/60 (86%)
 Strand = Plus / Minus

                                                                         
Query: 274   tcatcgatcttgaggatcatcttgacaacctgtgttgccagcaagatctgctgctgcttg 333
             ||||| |||||||| ||||| || || ||||| |||| ||||| ||||||||||||||||
Sbjct: 15677 tcatcaatcttgagaatcattttcaccacctgagttgtcagcacgatctgctgctgcttg 15618



 Score = 48.1 bits (24), Expect = 0.037
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                         
Query: 451   gtatcaataggtgccaaaccactgttttcagctaaagctagtgg 494
             ||||||| ||| | ||||||||||||||||||||  ||||||||
Sbjct: 15159 gtatcaaaagggggcaaaccactgttttcagctagggctagtgg 15116



to top

>dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 10, complete
                sequence
          Length = 22685906

 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 78/92 (84%), Gaps = 2/92 (2%)
 Strand = Plus / Minus

                                                                            
Query: 577      attgagcaagatatttctgctgagccaccaccatacacaattgagttgttgatgatcaga 636
                |||||||| ||||| |  ||||||||||||||||| ||||| ||||| |||   ||||||
Sbjct: 22009244 attgagcatgatatctgagctgagccaccaccataaacaatagagttcttgcgaatcaga 22009185

                                                
Query: 637      ttccttgcaacacatagagcatcatgaatact 668
                ||||| ||  |||| |||||||||||||||||
Sbjct: 22009184 ttcctagc--cacacagagcatcatgaatact 22009155



 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 52/60 (86%)
 Strand = Plus / Minus

                                                                            
Query: 274      tcatcgatcttgaggatcatcttgacaacctgtgttgccagcaagatctgctgctgcttg 333
                ||||| |||||||| ||||| || || ||||| |||| ||||| ||||||||||||||||
Sbjct: 22011133 tcatcaatcttgagaatcattttcaccacctgagttgtcagcacgatctgctgctgcttg 22011074



 Score = 48.1 bits (24), Expect = 0.037
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                            
Query: 451      gtatcaataggtgccaaaccactgttttcagctaaagctagtgg 494
                ||||||| ||| | ||||||||||||||||||||  ||||||||
Sbjct: 22010615 gtatcaaaagggggcaaaccactgttttcagctagggctagtgg 22010572



to top

>dbj|AK070073.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023043F15, full
           insert sequence
          Length = 3156

 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 78/92 (84%), Gaps = 2/92 (2%)
 Strand = Plus / Minus

                                                                       
Query: 577 attgagcaagatatttctgctgagccaccaccatacacaattgagttgttgatgatcaga 636
           |||||||| ||||| |  ||||||||||||||||| ||||| ||||| |||   ||||||
Sbjct: 584 attgagcatgatatctgagctgagccaccaccataaacaatagagttcttgcgaatcaga 525

                                           
Query: 637 ttccttgcaacacatagagcatcatgaatact 668
           ||||| ||  |||| |||||||||||||||||
Sbjct: 524 ttcctagc--cacacagagcatcatgaatact 495



 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 52/60 (86%)
 Strand = Plus / Minus

                                                                        
Query: 274  tcatcgatcttgaggatcatcttgacaacctgtgttgccagcaagatctgctgctgcttg 333
            ||||| |||||||| ||||| || || ||||| |||| ||||| ||||||||||||||||
Sbjct: 2027 tcatcaatcttgagaatcattttcaccacctgagttgtcagcacgatctgctgctgcttg 1968



 Score = 48.1 bits (24), Expect = 0.037
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                        
Query: 451  gtatcaataggtgccaaaccactgttttcagctaaagctagtgg 494
            ||||||| ||| | ||||||||||||||||||||  ||||||||
Sbjct: 1835 gtatcaaaagggggcaaaccactgttttcagctagggctagtgg 1792



to top

>dbj|AK063744.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-120-G02, full
           insert sequence
          Length = 977

 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 78/92 (84%), Gaps = 2/92 (2%)
 Strand = Plus / Minus

                                                                       
Query: 577 attgagcaagatatttctgctgagccaccaccatacacaattgagttgttgatgatcaga 636
           |||||||| ||||| |  ||||||||||||||||| ||||| ||||| |||   ||||||
Sbjct: 901 attgagcatgatatctgagctgagccaccaccataaacaatagagttcttgcgaatcaga 842

                                           
Query: 637 ttccttgcaacacatagagcatcatgaatact 668
           ||||| ||  |||| |||||||||||||||||
Sbjct: 841 ttcctagc--cacacagagcatcatgaatact 812



to top

>gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence
          Length = 22698374

 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 78/92 (84%), Gaps = 2/92 (2%)
 Strand = Plus / Minus

                                                                            
Query: 577      attgagcaagatatttctgctgagccaccaccatacacaattgagttgttgatgatcaga 636
                |||||||| ||||| |  ||||||||||||||||| ||||| ||||| |||   ||||||
Sbjct: 22020907 attgagcatgatatctgagctgagccaccaccataaacaatagagttcttgcgaatcaga 22020848

                                                
Query: 637      ttccttgcaacacatagagcatcatgaatact 668
                ||||| || |||||  ||||||||||||||||
Sbjct: 22020847 ttcctagccacaca--gagcatcatgaatact 22020818



 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 52/60 (86%)
 Strand = Plus / Minus

                                                                            
Query: 274      tcatcgatcttgaggatcatcttgacaacctgtgttgccagcaagatctgctgctgcttg 333
                ||||| |||||||| ||||| || || ||||| |||| ||||| ||||||||||||||||
Sbjct: 22022796 tcatcaatcttgagaatcattttcaccacctgagttgtcagcacgatctgctgctgcttg 22022737



 Score = 48.1 bits (24), Expect = 0.037
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                            
Query: 451      gtatcaataggtgccaaaccactgttttcagctaaagctagtgg 494
                ||||||| ||| | ||||||||||||||||||||  ||||||||
Sbjct: 22022278 gtatcaaaagggggcaaaccactgttttcagctagggctagtgg 22022235



to top

>emb|CR734406.2|CNS0GTG5 Tetraodon nigroviridis full-length cDNA
          Length = 275

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 62/73 (84%)
 Strand = Plus / Minus

                                                                       
Query: 277 tcgatcttgaggatcatcttgacaacctgtgttgccagcaagatctgctgctgcttgccg 336
           |||||||| |||||||||||||| || || || || |||| ||| |||||||  ||||||
Sbjct: 95  tcgatctttaggatcatcttgacgacttgggtggcgagcaggatttgctgctttttgccg 36

                        
Query: 337 atcagagtctcga 349
           ||||| |||||||
Sbjct: 35  atcagggtctcga 23



to top

>emb|CR734368.2|CNS0GTF3 Tetraodon nigroviridis full-length cDNA
          Length = 1888

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 62/73 (84%)
 Strand = Plus / Minus

                                                                        
Query: 277  tcgatcttgaggatcatcttgacaacctgtgttgccagcaagatctgctgctgcttgccg 336
            |||||||| |||||||||||||| || || || || |||| ||| |||||||  ||||||
Sbjct: 1708 tcgatctttaggatcatcttgacgacttgggtggcgagcaggatttgctgctttttgccg 1649

                         
Query: 337  atcagagtctcga 349
            ||||| |||||||
Sbjct: 1648 atcagggtctcga 1636



to top

>emb|CR704636.2|CNS0G6NC Tetraodon nigroviridis full-length cDNA
          Length = 1816

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 62/73 (84%)
 Strand = Plus / Minus

                                                                        
Query: 277  tcgatcttgaggatcatcttgacaacctgtgttgccagcaagatctgctgctgcttgccg 336
            |||||||| |||||||||||||| || || || || |||| ||| |||||||  ||||||
Sbjct: 1697 tcgatctttaggatcatcttgacgacttgggtggcgagcaggatttgctgctttttgccg 1638

                         
Query: 337  atcagagtctcga 349
            ||||| |||||||
Sbjct: 1637 atcagggtctcga 1625



to top

>emb|CR702647.2|CNS0G543 Tetraodon nigroviridis full-length cDNA
          Length = 1848

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 62/73 (84%)
 Strand = Plus / Minus

                                                                        
Query: 277  tcgatcttgaggatcatcttgacaacctgtgttgccagcaagatctgctgctgcttgccg 336
            |||||||| |||||||||||||| || || || || |||| ||| |||||||  ||||||
Sbjct: 1676 tcgatctttaggatcatcttgacgacttgggtggcgagcaggatttgctgctttttgccg 1617

                         
Query: 337  atcagagtctcga 349
            ||||| |||||||
Sbjct: 1616 atcagggtctcga 1604



to top

>emb|CR693702.2|CNS0FY7M Tetraodon nigroviridis full-length cDNA
          Length = 1102

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 62/73 (84%)
 Strand = Plus / Minus

                                                                       
Query: 277 tcgatcttgaggatcatcttgacaacctgtgttgccagcaagatctgctgctgcttgccg 336
           |||||||| |||||||||||||| || || || || |||| ||| |||||||  ||||||
Sbjct: 918 tcgatctttaggatcatcttgacgacttgggtggcgagcaggatttgctgctttttgccg 859

                        
Query: 337 atcagagtctcga 349
           ||||| |||||||
Sbjct: 858 atcagggtctcga 846



to top

>emb|CR693121.2|CNS0FXRH Tetraodon nigroviridis full-length cDNA
          Length = 1851

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 62/73 (84%)
 Strand = Plus / Minus

                                                                        
Query: 277  tcgatcttgaggatcatcttgacaacctgtgttgccagcaagatctgctgctgcttgccg 336
            |||||||| |||||||||||||| || || || || |||| ||| |||||||  ||||||
Sbjct: 1691 tcgatctttaggatcatcttgacgacttgggtggcgagcaggatttgctgctttttgccg 1632

                         
Query: 337  atcagagtctcga 349
            ||||| |||||||
Sbjct: 1631 atcagggtctcga 1619



to top

>emb|CR692993.2|CNS0FXNX Tetraodon nigroviridis full-length cDNA
          Length = 1013

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 62/73 (84%)
 Strand = Plus / Minus

                                                                       
Query: 277 tcgatcttgaggatcatcttgacaacctgtgttgccagcaagatctgctgctgcttgccg 336
           |||||||| |||||||||||||| || || || || |||| ||| |||||||  ||||||
Sbjct: 830 tcgatctttaggatcatcttgacgacttgggtggcgagcaggatttgctgctttttgccg 771

                        
Query: 337 atcagagtctcga 349
           ||||| |||||||
Sbjct: 770 atcagggtctcga 758



to top

>emb|CR682065.2|CNS0FP8D Tetraodon nigroviridis full-length cDNA
          Length = 1001

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 62/73 (84%)
 Strand = Plus / Minus

                                                                       
Query: 277 tcgatcttgaggatcatcttgacaacctgtgttgccagcaagatctgctgctgcttgccg 336
           |||||||| |||||||||||||| || || || || |||| ||| |||||||  ||||||
Sbjct: 824 tcgatctttaggatcatcttgacgacttgggtggcgagcaggatttgctgctttttgccg 765

                        
Query: 337 atcagagtctcga 349
           ||||| |||||||
Sbjct: 764 atcagggtctcga 752



to top

>emb|CR664385.2|CNS0FBLZ Tetraodon nigroviridis full-length cDNA
          Length = 1196

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 62/73 (84%)
 Strand = Plus / Minus

                                                                        
Query: 277  tcgatcttgaggatcatcttgacaacctgtgttgccagcaagatctgctgctgcttgccg 336
            |||||||| |||||||||||||| || || || || |||| ||| |||||||  ||||||
Sbjct: 1013 tcgatctttaggatcatcttgacgacttgggtggcgagcaggatttgctgctttttgccg 954

                         
Query: 337  atcagagtctcga 349
            ||||| |||||||
Sbjct: 953  atcagggtctcga 941



to top

>emb|CR659491.2|CNS0F7U1 Tetraodon nigroviridis full-length cDNA
          Length = 1879

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 62/73 (84%)
 Strand = Plus / Minus

                                                                        
Query: 277  tcgatcttgaggatcatcttgacaacctgtgttgccagcaagatctgctgctgcttgccg 336
            |||||||| |||||||||||||| || || || || |||| ||| |||||||  ||||||
Sbjct: 1703 tcgatctttaggatcatcttgacgacttgggtggcgagcaggatttgctgctttttgccg 1644

                         
Query: 337  atcagagtctcga 349
            ||||| |||||||
Sbjct: 1643 atcagggtctcga 1631



to top

>ref|XM_774923.1| PREDICTED: Strongylocentrotus purpuratus similar to chaperonin
            containing TCP1, subunit 5 (epsilon), transcript variant
            1 (LOC575808), mRNA
          Length = 2235

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 52/60 (86%)
 Strand = Plus / Minus

                                                                        
Query: 318  gatctgctgctgcttgccgatcagagtctcgaaaacattctgctctttcatgtcgttggt 377
            |||||| |||| |||||| ||||||||||| || |||| |||||| |||||||| |||||
Sbjct: 1650 gatctgttgcttcttgccaatcagagtctcaaacacatgctgctccttcatgtcattggt 1591



to top

>ref|XM_796613.1| PREDICTED: Strongylocentrotus purpuratus similar to chaperonin
            containing TCP1, subunit 5 (epsilon), transcript variant
            2 (LOC575808), mRNA
          Length = 2250

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 52/60 (86%)
 Strand = Plus / Minus

                                                                        
Query: 318  gatctgctgctgcttgccgatcagagtctcgaaaacattctgctctttcatgtcgttggt 377
            |||||| |||| |||||| ||||||||||| || |||| |||||| |||||||| |||||
Sbjct: 1665 gatctgttgcttcttgccaatcagagtctcaaacacatgctgctccttcatgtcattggt 1606



to top

>dbj|AK106739.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-115-B02, full
           insert sequence
          Length = 1961

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 52/60 (86%)
 Strand = Plus / Minus

                                                                       
Query: 274 tcatcgatcttgaggatcatcttgacaacctgtgttgccagcaagatctgctgctgcttg 333
           ||||| |||||||| ||||| || || ||||| |||| ||||| ||||||||||||||||
Sbjct: 388 tcatcaatcttgagaatcattttcaccacctgagttgtcagcacgatctgctgctgcttg 329



 Score = 48.1 bits (24), Expect = 0.037
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 451 gtatcaataggtgccaaaccactgttttcagctaaagctagtgg 494
           ||||||| ||| | ||||||||||||||||||||  ||||||||
Sbjct: 196 gtatcaaaagggggcaaaccactgttttcagctagggctagtgg 153



to top

>ref|XM_635364.1| Dictyostelium discoideum hypothetical protein (DDB0204244), partial
            mRNA
          Length = 1617

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                               
Query: 468  accactgttttcagctaaagctagtggaatggcatccaaagcatcagcaaa 518
            |||||| |||||||| || |||| |||||| ||||| ||||||||||||||
Sbjct: 1389 accactattttcagccaatgctaatggaatagcatctaaagcatcagcaaa 1339



to top

>emb|BX064596.1|CNS09M08 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC46DG05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 888

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 48/55 (87%)
 Strand = Plus / Plus

                                                                  
Query: 274 tcatcgatcttgaggatcatcttgacaacctgtgttgccagcaagatctgctgct 328
           |||||||||||||| ||||||||||| | ||| || || |||| |||||||||||
Sbjct: 345 tcatcgatcttgagaatcatcttgacgagctgggtggcgagcacgatctgctgct 399



to top

>emb|BX059609.1|CNS09I5P Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC4CB08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 668

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 48/55 (87%)
 Strand = Plus / Minus

                                                                  
Query: 274 tcatcgatcttgaggatcatcttgacaacctgtgttgccagcaagatctgctgct 328
           |||||||||||||| ||||||||||| | ||| || || |||| |||||||||||
Sbjct: 544 tcatcgatcttgagaatcatcttgacgagctgggtggcgagcacgatctgctgct 490



to top

>emb|BX058534.1|CNS09HBU Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC39AA01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1000

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 48/55 (87%)
 Strand = Plus / Plus

                                                                  
Query: 274 tcatcgatcttgaggatcatcttgacaacctgtgttgccagcaagatctgctgct 328
           |||||||||||||| ||||||||||| | ||| || || |||| |||||||||||
Sbjct: 384 tcatcgatcttgagaatcatcttgacgagctgggtggcgagcacgatctgctgct 438



to top

>emb|BX058090.1|CNS09GZI Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC38BC04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 862

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 48/55 (87%)
 Strand = Plus / Plus

                                                                  
Query: 274 tcatcgatcttgaggatcatcttgacaacctgtgttgccagcaagatctgctgct 328
           |||||||||||||| ||||||||||| | ||| || || |||| |||||||||||
Sbjct: 416 tcatcgatcttgagaatcatcttgacgagctgggtggcgagcacgatctgctgct 470



to top

>emb|BX047036.1|CNS098GG Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC21AB01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 592

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 48/55 (87%)
 Strand = Plus / Plus

                                                                  
Query: 274 tcatcgatcttgaggatcatcttgacaacctgtgttgccagcaagatctgctgct 328
           |||||||||||||| ||||||||||| | ||| || || |||| |||||||||||
Sbjct: 351 tcatcgatcttgagaatcatcttgacgagctgggtggcgagcacgatctgctgct 405



to top

>emb|BX042897.1|CNS0959H Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC15AE11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 686

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 48/55 (87%)
 Strand = Plus / Plus

                                                                  
Query: 274 tcatcgatcttgaggatcatcttgacaacctgtgttgccagcaagatctgctgct 328
           |||||||||||||| ||||||||||| | ||| || || |||| |||||||||||
Sbjct: 358 tcatcgatcttgagaatcatcttgacgagctgggtggcgagcacgatctgctgct 412



to top

>emb|BX037203.1|CNS090VB Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA9CC07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 615

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 48/55 (87%)
 Strand = Plus / Plus

                                                                  
Query: 274 tcatcgatcttgaggatcatcttgacaacctgtgttgccagcaagatctgctgct 328
           |||||||||||||| ||||||||||| | ||| || || |||| |||||||||||
Sbjct: 404 tcatcgatcttgagaatcatcttgacgagctgggtggcgagcacgatctgctgct 458



to top

>emb|BX032800.1|CNS08XH0 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA48DF12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 470

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 48/55 (87%)
 Strand = Plus / Plus

                                                                  
Query: 274 tcatcgatcttgaggatcatcttgacaacctgtgttgccagcaagatctgctgct 328
           |||||||||||||| ||||||||||| | ||| || || |||| |||||||||||
Sbjct: 341 tcatcgatcttgagaatcatcttgacgagctgggtggcgagcacgatctgctgct 395



to top

>emb|BX022454.1|CNS08PHM Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA34BE07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 896

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 48/55 (87%)
 Strand = Plus / Plus

                                                                  
Query: 274 tcatcgatcttgaggatcatcttgacaacctgtgttgccagcaagatctgctgct 328
           |||||||||||||| ||||||||||| | ||| || || |||| |||||||||||
Sbjct: 360 tcatcgatcttgagaatcatcttgacgagctgggtggcgagcacgatctgctgct 414



to top

>emb|BX025429.1|CNS08RS9 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA39AA11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 889

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 48/55 (87%)
 Strand = Plus / Plus

                                                                  
Query: 274 tcatcgatcttgaggatcatcttgacaacctgtgttgccagcaagatctgctgct 328
           |||||||||||||| ||||||||||| | ||| || || |||| |||||||||||
Sbjct: 161 tcatcgatcttgagaatcatcttgacgagctgggtggcgagcacgatctgctgct 215



to top

>emb|BX025374.1|CNS08RQQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA38DF11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 977

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 48/55 (87%)
 Strand = Plus / Plus

                                                                  
Query: 274 tcatcgatcttgaggatcatcttgacaacctgtgttgccagcaagatctgctgct 328
           |||||||||||||| ||||||||||| | ||| || || |||| |||||||||||
Sbjct: 402 tcatcgatcttgagaatcatcttgacgagctgggtggcgagcacgatctgctgct 456



to top

>emb|BX025373.1|CNS08RQP Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA38DF11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1012

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 48/55 (87%)
 Strand = Plus / Minus

                                                                  
Query: 274 tcatcgatcttgaggatcatcttgacaacctgtgttgccagcaagatctgctgct 328
           |||||||||||||| ||||||||||| | ||| || || |||| |||||||||||
Sbjct: 671 tcatcgatcttgagaatcatcttgacgagctgggtggcgagcacgatctgctgct 617



to top

>emb|BX015203.1|CNS08JW7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA22DD06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 984

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 48/55 (87%)
 Strand = Plus / Plus

                                                                  
Query: 274 tcatcgatcttgaggatcatcttgacaacctgtgttgccagcaagatctgctgct 328
           |||||||||||||| ||||||||||| | ||| || || |||| |||||||||||
Sbjct: 329 tcatcgatcttgagaatcatcttgacgagctgggtggcgagcacgatctgctgct 383



to top

>emb|BX013195.1|CNS08ICF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA2DE08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 985

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 48/55 (87%)
 Strand = Plus / Plus

                                                                  
Query: 274 tcatcgatcttgaggatcatcttgacaacctgtgttgccagcaagatctgctgct 328
           |||||||||||||| ||||||||||| | ||| || || |||| |||||||||||
Sbjct: 347 tcatcgatcttgagaatcatcttgacgagctgggtggcgagcacgatctgctgct 401



to top

>emb|BX010233.1|CNS08G25 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA16BH08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 692

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 48/55 (87%)
 Strand = Plus / Minus

                                                                  
Query: 274 tcatcgatcttgaggatcatcttgacaacctgtgttgccagcaagatctgctgct 328
           |||||||||||||| ||||||||||| | ||| || || |||| |||||||||||
Sbjct: 670 tcatcgatcttgagaatcatcttgacgagctgggtggcgagcacgatctgctgct 616



to top

>emb|BX009560.1|CNS08FJG Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA15BH08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 972

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 48/55 (87%)
 Strand = Plus / Plus

                                                                  
Query: 274 tcatcgatcttgaggatcatcttgacaacctgtgttgccagcaagatctgctgct 328
           |||||||||||||| ||||||||||| | ||| || || |||| |||||||||||
Sbjct: 325 tcatcgatcttgagaatcatcttgacgagctgggtggcgagcacgatctgctgct 379



to top

>ref|XM_317219.2| Anopheles gambiae str. PEST ENSANGP00000012024 (ENSANGG00000009535),
            partial mRNA
          Length = 1779

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 48/55 (87%)
 Strand = Plus / Minus

                                                                   
Query: 274  tcatcgatcttgaggatcatcttgacaacctgtgttgccagcaagatctgctgct 328
            |||||||||||||| ||||||||||| | ||| || || |||| |||||||||||
Sbjct: 1769 tcatcgatcttgagaatcatcttgacgagctgggtggcgagcacgatctgctgct 1715



to top

>ref|XM_307323.1| Anopheles gambiae str. PEST ENSANGP00000001996 (ENSANGG00000001693),
            partial mRNA
          Length = 1515

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 48/55 (87%)
 Strand = Plus / Minus

                                                                   
Query: 274  tcatcgatcttgaggatcatcttgacaacctgtgttgccagcaagatctgctgct 328
            |||||||||||||| ||||||||||| | ||| || || |||| |||||||||||
Sbjct: 1505 tcatcgatcttgagaatcatcttgacgagctgggtggcgagcacgatctgctgct 1451



to top

>gb|AY398321.1| Danio rerio clone RK074A2D01 chaperonin containing TCP1, subunit 5
            (epsilon) (CCT5) mRNA, complete cds
          Length = 1896

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 80/98 (81%)
 Strand = Plus / Minus

                                                                        
Query: 274  tcatcgatcttgaggatcatcttgacaacctgtgttgccagcaagatctgctgctgcttg 333
            ||||| ||||| || |||||||| ||||| || || |||||  |||||||||||| ||| 
Sbjct: 1709 tcatcaatcttcagaatcatctttacaacttgagtggccagagagatctgctgcttcttc 1650

                                                  
Query: 334  ccgatcagagtctcgaaaacattctgctctttcatgtc 371
            ||||| || |||||||  |||| |||||  ||||||||
Sbjct: 1649 ccgataagggtctcgattacatgctgctgcttcatgtc 1612



to top

>gb|AY648807.1| Danio rerio TCP-1 epsilon mRNA, complete cds
          Length = 1853

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 80/98 (81%)
 Strand = Plus / Minus

                                                                        
Query: 274  tcatcgatcttgaggatcatcttgacaacctgtgttgccagcaagatctgctgctgcttg 333
            ||||| ||||| || |||||||| ||||| || || |||||  |||||||||||| ||| 
Sbjct: 1684 tcatcaatcttcagaatcatctttacaacttgagtggccagagagatctgctgcttcttc 1625

                                                  
Query: 334  ccgatcagagtctcgaaaacattctgctctttcatgtc 371
            ||||| || |||||||  |||| |||||  ||||||||
Sbjct: 1624 ccgataagggtctcgattacatgctgctgcttcatgtc 1587



to top

>gb|BC068037.1| Danio rerio chaperonin containing TCP1, subunit 5 (epsilon), mRNA
            (cDNA clone MGC:77639 IMAGE:6996933), complete cds
          Length = 1879

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 80/98 (81%)
 Strand = Plus / Minus

                                                                        
Query: 274  tcatcgatcttgaggatcatcttgacaacctgtgttgccagcaagatctgctgctgcttg 333
            ||||| ||||| || |||||||| ||||| || || |||||  |||||||||||| ||| 
Sbjct: 1694 tcatcaatcttcagaatcatctttacaacttgagtggccagagagatctgctgcttcttc 1635

                                                  
Query: 334  ccgatcagagtctcgaaaacattctgctctttcatgtc 371
            ||||| || |||||||  |||| |||||  ||||||||
Sbjct: 1634 ccgataagggtctcgattacatgctgctgcttcatgtc 1597



to top

>emb|BX469922.12| Zebrafish DNA sequence from clone DKEY-30N5 in linkage group 24, complete
              sequence
          Length = 200409

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 80/98 (81%)
 Strand = Plus / Plus

                                                                          
Query: 274    tcatcgatcttgaggatcatcttgacaacctgtgttgccagcaagatctgctgctgcttg 333
              ||||| ||||| || |||||||| ||||| || || |||||  |||||||||||| ||| 
Sbjct: 165976 tcatcaatcttcagaatcatctttacaacttgagtggccagagagatctgctgcttcttc 166035

                                                    
Query: 334    ccgatcagagtctcgaaaacattctgctctttcatgtc 371
              ||||| || |||||||  |||| |||||  ||||||||
Sbjct: 166036 ccgataagggtctcgattacatgctgctgcttcatgtc 166073



to top

>ref|NM_212613.1| Danio rerio chaperonin containing TCP1, subunit 5 (epsilon) (cct5),
            mRNA
          Length = 1896

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 80/98 (81%)
 Strand = Plus / Minus

                                                                        
Query: 274  tcatcgatcttgaggatcatcttgacaacctgtgttgccagcaagatctgctgctgcttg 333
            ||||| ||||| || |||||||| ||||| || || |||||  |||||||||||| ||| 
Sbjct: 1709 tcatcaatcttcagaatcatctttacaacttgagtggccagagagatctgctgcttcttc 1650

                                                  
Query: 334  ccgatcagagtctcgaaaacattctgctctttcatgtc 371
            ||||| || |||||||  |||| |||||  ||||||||
Sbjct: 1649 ccgataagggtctcgattacatgctgctgcttcatgtc 1612



to top

>emb|BX010234.1|CNS08G26 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA16BH08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 685

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 46/53 (86%)
 Strand = Plus / Plus

                                                                
Query: 276 atcgatcttgaggatcatcttgacaacctgtgttgccagcaagatctgctgct 328
           |||||||||||| ||||||||||| | ||| || || |||| |||||||||||
Sbjct: 407 atcgatcttgagaatcatcttgacgagctgggtggcgagcacgatctgctgct 459



to top

>ref|XM_762836.1| Giardia lamblia ATCC 50803 hypothetical protein (GLP_549_7513_8304)
           partial mRNA
          Length = 792

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 38/43 (88%)
 Strand = Plus / Plus

                                                      
Query: 274 tcatcgatcttgaggatcatcttgacaacctgtgttgccagca 316
           ||||||||||||||||||||   ||| |||||||| |||||||
Sbjct: 593 tcatcgatcttgaggatcatgcggacgacctgtgtggccagca 635



to top

>ref|XM_762838.1| Giardia lamblia ATCC 50803 chaperonin subunit epsilon
            (GLP_549_9744_8083) partial mRNA
          Length = 1662

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                       
Query: 274  tcatcgatcttgaggatcatcttgacaacctgtgttgccagca 316
            ||||||||||||||||||||   ||| |||||||| |||||||
Sbjct: 1640 tcatcgatcttgaggatcatgcggacgacctgtgtggccagca 1598



to top

>emb|BX024353.1|CNS08QYD Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA37AE10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 608

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 47/55 (85%)
 Strand = Plus / Plus

                                                                  
Query: 274 tcatcgatcttgaggatcatcttgacaacctgtgttgccagcaagatctgctgct 328
           |||||||||||||| ||||||||||| | ||| || || |||| | |||||||||
Sbjct: 339 tcatcgatcttgagaatcatcttgacgagctgggtggcgagcacgttctgctgct 393



to top

>emb|AJ851489.1| Gallus gallus mRNA for hypothetical protein, clone 3n20
          Length = 1819

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                               
Query: 502  tccaaagcatcagcaaatgccctgattgcatactg 536
            ||||| ||||| ||||||||||| |||||||||||
Sbjct: 1399 tccaaggcatctgcaaatgccctcattgcatactg 1365



to top

>gb|AF226724.1|AF226724 Giardia intestinalis chaperonin subunit epsilon CCTepsilon (Ccte)
            gene, complete cds
          Length = 1829

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                       
Query: 274  tcatcgatcttgaggatcatcttgacaacctgtgttgccagca 316
            ||||||||||||||||||||   ||| |||||||| |||||||
Sbjct: 1730 tcatcgatcttgaggatcatgcggacgacctgtgtggccagca 1688



to top

>ref|NM_001012563.1| Gallus gallus chaperonin containing TCP1, subunit 5 (epsilon) (CCT5),
            mRNA
          Length = 1819

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                               
Query: 502  tccaaagcatcagcaaatgccctgattgcatactg 536
            ||||| ||||| ||||||||||| |||||||||||
Sbjct: 1399 tccaaggcatctgcaaatgccctcattgcatactg 1365



to top

>emb|CR699738.2|CNS0G2VA Tetraodon nigroviridis full-length cDNA
          Length = 1834

 Score = 44.1 bits (22), Expect = 0.58
 Identities = 62/74 (83%), Gaps = 1/74 (1%)
 Strand = Plus / Minus

                                                                        
Query: 277  tcgatcttgaggatcatct-tgacaacctgtgttgccagcaagatctgctgctgcttgcc 335
            |||||||| |||||||||| |||| || || || || |||| ||| |||||||  |||||
Sbjct: 1669 tcgatcttaaggatcatctatgacgacttgggtggcgagcaggatttgctgctttttgcc 1610

                          
Query: 336  gatcagagtctcga 349
            |||||| |||||||
Sbjct: 1609 gatcagggtctcga 1596



to top

>emb|AL031429.11|HS333A15 Human DNA sequence from clone RP3-333A15 on chromosome 1p31.1-31.3
              Contains the 5' end of the PTGER3 gene for prostaglandin E
              receptor 3 (subtype EP3), part of a novel gene and a CpG
              island, complete sequence
          Length = 133221

 Score = 44.1 bits (22), Expect = 0.58
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 525    gattgcatactgctcaactcca 546
              ||||||||||||||||||||||
Sbjct: 113672 gattgcatactgctcaactcca 113693



to top

>emb|BX033735.1|CNS08Y6Z Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA5BD07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 707

 Score = 44.1 bits (22), Expect = 0.58
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 274 tcatcgatcttgaggatcatcttgac 299
           |||||||||||||| |||||||||||
Sbjct: 330 tcatcgatcttgagaatcatcttgac 355



to top

>emb|BX025983.1|CNS08S7N Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA4AC06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 148

 Score = 44.1 bits (22), Expect = 0.58
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 274 tcatcgatcttgaggatcatcttgac 299
           |||||||||||||| |||||||||||
Sbjct: 79  tcatcgatcttgagaatcatcttgac 104



to top

>gb|AE000516.2| Mycobacterium tuberculosis CDC1551, complete genome
          Length = 4403837

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 551     gccgatctgctgcagcgtcaa 571
               |||||||||||||||||||||
Sbjct: 4299699 gccgatctgctgcagcgtcaa 4299679



to top

>gb|CP000124.1| Burkholderia pseudomallei 1710b chromosome I, complete sequence
          Length = 4126292

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 364     ttcatgtcgttggtaccaaca 384
               |||||||||||||||||||||
Sbjct: 4018074 ttcatgtcgttggtaccaaca 4018094



to top

>emb|AL135789.18| Human DNA sequence from clone RP11-412H14 on chromosome 9q32-33.3
             Contains the 5' end of one variant of the AKAP2 (PALM2)
             gene for A kinase (PRKA) anchor protein 2 (paralemmin 2)
             and a CpG island, complete sequence
          Length = 133394

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 507   agcatcagcaaatgccctgat 527
             |||||||||||||||||||||
Sbjct: 25332 agcatcagcaaatgccctgat 25352



to top

>emb|BX842584.1| Mycobacterium tuberculosis H37Rv complete genome; segment 13/13
          Length = 244800

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 551    gccgatctgctgcagcgtcaa 571
              |||||||||||||||||||||
Sbjct: 140644 gccgatctgctgcagcgtcaa 140624



to top

>emb|BX248347.1| Mycobacterium bovis subsp. bovis AF2122/97 complete genome; segment 14/14
          Length = 278492

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 551    gccgatctgctgcagcgtcaa 571
              |||||||||||||||||||||
Sbjct: 176649 gccgatctgctgcagcgtcaa 176629



to top

>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
                sequence
          Length = 35954743

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                     
Query: 321      ctgctgctgcttgccgatcag 341
                |||||||||||||||||||||
Sbjct: 31442963 ctgctgctgcttgccgatcag 31442983



to top

>gb|AC092660.2| Homo sapiens BAC clone RP11-502A5 from 2, complete sequence
          Length = 154704

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 306    tgttgccagcaagatctgctg 326
              |||||||||||||||||||||
Sbjct: 104641 tgttgccagcaagatctgctg 104621



to top

>dbj|AP005848.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OSJNBa0078N11
          Length = 155168

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 321   ctgctgctgcttgccgatcag 341
             |||||||||||||||||||||
Sbjct: 78360 ctgctgctgcttgccgatcag 78380



to top

>gb|AD000017.1|MSGY409 Mycobacterium tuberculosis sequence from clone y409
          Length = 41321

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 551   gccgatctgctgcagcgtcaa 571
             |||||||||||||||||||||
Sbjct: 10824 gccgatctgctgcagcgtcaa 10844



to top

>gb|AY377120.1| Liparthrum semidegener isolate sem-Madeira elongation factor
           1-alpha (EF-1alpha) gene, partial cds
          Length = 889

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 494 gaatggcatccaaagcatca 513
           ||||||||||||||||||||
Sbjct: 526 gaatggcatccaaagcatca 507



to top

>gb|AY377081.1| Liparthrum canum isolate can-LaGomera elongation factor 1-alpha
           (EF-1alpha) gene, partial cds
          Length = 885

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 494 gaatggcatccaaagcatca 513
           ||||||||||||||||||||
Sbjct: 526 gaatggcatccaaagcatca 507



to top

>gb|AY377073.1| Liparthrum artemisiae isolate art-Tenerife elongation factor
           1-alpha (EF-1alpha) gene, partial cds
          Length = 890

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 494 gaatggcatccaaagcatca 513
           ||||||||||||||||||||
Sbjct: 526 gaatggcatccaaagcatca 507



to top

>gb|AY377072.1| Liparthrum artemisiae isolate art-LaGomera elongation factor
           1-alpha (EF-1alpha) gene, partial cds
          Length = 890

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 494 gaatggcatccaaagcatca 513
           ||||||||||||||||||||
Sbjct: 526 gaatggcatccaaagcatca 507



to top

>gb|AY377067.1| Liparthrum bartschti elongation factor 1-alpha (EF-1alpha) gene,
           partial cds
          Length = 762

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 494 gaatggcatccaaagcatca 513
           ||||||||||||||||||||
Sbjct: 474 gaatggcatccaaagcatca 455



to top

>gb|DQ141315.1| Xyleborus amputatus elongation factor 1-alpha (EF-1a) gene, partial
           cds
          Length = 716

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 494 gaatggcatccaaagcatca 513
           ||||||||||||||||||||
Sbjct: 592 gaatggcatccaaagcatca 573



to top

>emb|AL772262.4| Human DNA sequence from clone RP11-444C24 on chromosome X, complete
             sequence
          Length = 147079

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 603   accaccatacacaattgagttgtt 626
             ||||||||| ||||||||||||||
Sbjct: 18188 accaccatagacaattgagttgtt 18165



to top

>emb|AL590138.7| Human DNA sequence from clone RP11-243A2 on chromosome 1 Contains part of
              the PLXNA2 gene for plexin A2, complete sequence
          Length = 164057

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 311    ccagcaagatctgctgctgcttgc 334
              ||||||| ||||||||||||||||
Sbjct: 116407 ccagcaacatctgctgctgcttgc 116430



to top

>gb|AY131133.1| Diocalandra frumenti elongation factor 1-alpha gene, partial cds
          Length = 906

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 494 gaatggcatccaaagcatca 513
           ||||||||||||||||||||
Sbjct: 538 gaatggcatccaaagcatca 519



to top

>gb|AF508886.1| Xylosandrus sp. nov (cf. ursa) elongation factor 1-alpha (EF-1a)
           gene, partial cds
          Length = 949

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 494 gaatggcatccaaagcatca 513
           ||||||||||||||||||||
Sbjct: 555 gaatggcatccaaagcatca 536



to top

>gb|AF508882.1| Webbia cf. platypoides elongation factor 1-alpha (EF-1a) gene,
           partial cds
          Length = 933

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 494 gaatggcatccaaagcatca 513
           ||||||||||||||||||||
Sbjct: 539 gaatggcatccaaagcatca 520



to top

>gb|AF508869.1| Ambrosiodmus compressus elongation factor 1-alpha (EF-1a) gene,
           partial cds
          Length = 863

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 494 gaatggcatccaaagcatca 513
           ||||||||||||||||||||
Sbjct: 497 gaatggcatccaaagcatca 478



to top

>emb|AJ243431.1|ALW243431 Acinetobacter lwoffii wzc, wzb, wza, weeA, weeB, wceC, wzx, wzy, weeD,
             weeE, weeF, weeG, weeH, weeI, weeJ, weeK, galU, ugd, pgi,
             galE, pgm (partial) and mip (partial) genes (emulsan
             biosynthetic gene cluster), strain RAG-1
          Length = 26953

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 502   tccaaagcatcagcaaatgc 521
             ||||||||||||||||||||
Sbjct: 16544 tccaaagcatcagcaaatgc 16525



to top

>gb|AF444076.1| Coccotrypes advena isolate Dry20 elongation factor 1-alpha (EF-1a)
           gene, partial cds
          Length = 937

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 494 gaatggcatccaaagcatca 513
           ||||||||||||||||||||
Sbjct: 556 gaatggcatccaaagcatca 537



to top

>gb|AF444074.1| Coccotrypes cyperi elongation factor 1-alpha (EF-1a) gene, partial
           cds
          Length = 945

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 494 gaatggcatccaaagcatca 513
           ||||||||||||||||||||
Sbjct: 555 gaatggcatccaaagcatca 536



to top

>gb|AF444071.1| Coccotrypes cf. rhizophorae elongation factor 1-alpha (EF-1a) gene,
           partial cds
          Length = 922

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 494 gaatggcatccaaagcatca 513
           ||||||||||||||||||||
Sbjct: 534 gaatggcatccaaagcatca 515



to top

>gb|AF439740.1| Ozopemon uniseriatus elongation factor 1-alpha (EF-1a) gene,
           partial cds
          Length = 912

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 494 gaatggcatccaaagcatca 513
           ||||||||||||||||||||
Sbjct: 535 gaatggcatccaaagcatca 516



to top

>gb|AF308414.1| Liparthrum nigrescens elongation factor 1 alpha (ef-1a) gene,
           partial cds
          Length = 955

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 494 gaatggcatccaaagcatca 513
           ||||||||||||||||||||
Sbjct: 532 gaatggcatccaaagcatca 513



to top

>gb|AF308412.1| Hylesinopsis sp. HLH11 elongation factor 1 alpha (ef-1a) gene,
           partial cds
          Length = 910

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 494 gaatggcatccaaagcatca 513
           ||||||||||||||||||||
Sbjct: 551 gaatggcatccaaagcatca 532



to top

>gb|AF308411.1| Alniphagus aspericollis elongation factor 1 alpha (ef-1a) gene,
           partial cds
          Length = 746

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 494 gaatggcatccaaagcatca 513
           ||||||||||||||||||||
Sbjct: 412 gaatggcatccaaagcatca 393



to top

>gb|AF186693.2| Xylosandrus mancus elongation factor 1 alpha (ef-1a) gene, partial
           cds
          Length = 921

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 494 gaatggcatccaaagcatca 513
           ||||||||||||||||||||
Sbjct: 541 gaatggcatccaaagcatca 522



to top

>gb|AF186675.1| Ips perturbatus elongation factor 1 alpha (ef-1a) gene, partial cds
          Length = 914

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 494 gaatggcatccaaagcatca 513
           ||||||||||||||||||||
Sbjct: 529 gaatggcatccaaagcatca 510



to top

>gb|AF186673.1| Pityokteines minutus elongation factor 1 alpha (ef-1a) gene,
           partial cds
          Length = 913

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 494 gaatggcatccaaagcatca 513
           ||||||||||||||||||||
Sbjct: 529 gaatggcatccaaagcatca 510



to top

>gb|AF186671.1| Araptus sp. SCH05 elongation factor 1 alpha (ef-1a) gene, partial
           cds
          Length = 909

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 494 gaatggcatccaaagcatca 513
           ||||||||||||||||||||
Sbjct: 529 gaatggcatccaaagcatca 510



to top

>gb|AF186661.2| Dryocoetes affaber elongation factor 1 alpha (ef-1a) gene, partial
           cds
          Length = 889

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 494 gaatggcatccaaagcatca 513
           ||||||||||||||||||||
Sbjct: 535 gaatggcatccaaagcatca 516



to top

>gb|AF186660.2| Dryoxylon onoharaensum elongation factor 1 alpha (ef-1a) gene,
           partial cds
          Length = 754

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 494 gaatggcatccaaagcatca 513
           ||||||||||||||||||||
Sbjct: 514 gaatggcatccaaagcatca 495



to top

>gb|AC007155.16| Arabidopsis thaliana chromosome 2 clone T18E17 map PR1, complete
             sequence
          Length = 96095

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 317   agatctgctgctgcttgccgatca 340
             ||||||||||||||| ||||||||
Sbjct: 27576 agatctgctgctgctcgccgatca 27553



to top

>gb|AC006437.5| Arabidopsis thaliana chromosome 2 clone T19K21 map mi421, complete
             sequence
          Length = 76713

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 317   agatctgctgctgcttgccgatca 340
             ||||||||||||||| ||||||||
Sbjct: 71220 agatctgctgctgctcgccgatca 71197



to top

>gb|AF397647.1| Pityokteines sparsus elongation factor 1 alpha (EF-1alpha) gene,
           partial cds
          Length = 688

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 494 gaatggcatccaaagcatca 513
           ||||||||||||||||||||
Sbjct: 500 gaatggcatccaaagcatca 481



to top

>gb|AF397640.1| Ips woodi elongation factor 1 alpha (EF-1alpha) gene, partial cds
          Length = 687

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 494 gaatggcatccaaagcatca 513
           ||||||||||||||||||||
Sbjct: 500 gaatggcatccaaagcatca 481



to top

>gb|AF397638.1| Ips tridens elongation factor 1 alpha (EF-1alpha) gene, partial cds
          Length = 689

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 494 gaatggcatccaaagcatca 513
           ||||||||||||||||||||
Sbjct: 500 gaatggcatccaaagcatca 481



to top

>gb|AF397636.1| Ips pini elongation factor 1 alpha (EF-1alpha) gene, partial cds
          Length = 686

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 494 gaatggcatccaaagcatca 513
           ||||||||||||||||||||
Sbjct: 500 gaatggcatccaaagcatca 481



to top

>gb|AF397635.1| Ips pilifrons elongation factor 1 alpha (EF-1alpha) gene, partial
           cds
          Length = 689

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 494 gaatggcatccaaagcatca 513
           ||||||||||||||||||||
Sbjct: 500 gaatggcatccaaagcatca 481



to top

>gb|AF397634.1| Ips plastographus elongation factor 1 alpha (EF-1alpha) gene,
           partial cds
          Length = 687

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 494 gaatggcatccaaagcatca 513
           ||||||||||||||||||||
Sbjct: 500 gaatggcatccaaagcatca 481



to top

>gb|AF397633.1| Ips perturbatus elongation factor 1 alpha (EF-1alpha) gene, partial
           cds
          Length = 689

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 494 gaatggcatccaaagcatca 513
           ||||||||||||||||||||
Sbjct: 500 gaatggcatccaaagcatca 481



to top

>gb|AF397632.1| Ips perroti elongation factor 1 alpha (EF-1alpha) gene, partial cds
          Length = 689

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 494 gaatggcatccaaagcatca 513
           ||||||||||||||||||||
Sbjct: 500 gaatggcatccaaagcatca 481



to top

>gb|AF397631.1| Ips paraconfusus elongation factor 1 alpha (EF-1alpha) gene,
           partial cds
          Length = 689

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 494 gaatggcatccaaagcatca 513
           ||||||||||||||||||||
Sbjct: 500 gaatggcatccaaagcatca 481



to top

>gb|AF397630.1| Ips montanus elongation factor 1 alpha (EF-1alpha) gene, partial
           cds
          Length = 689

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 494 gaatggcatccaaagcatca 513
           ||||||||||||||||||||
Sbjct: 500 gaatggcatccaaagcatca 481



to top

>gb|AF397629.1| Ips lecontei elongation factor 1 alpha (EF-1alpha) gene, partial
           cds
          Length = 691

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 494 gaatggcatccaaagcatca 513
           ||||||||||||||||||||
Sbjct: 500 gaatggcatccaaagcatca 481



to top

>gb|AF397627.1| Ips integer elongation factor 1 alpha (EF-1alpha) gene, partial cds
          Length = 687

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 494 gaatggcatccaaagcatca 513
           ||||||||||||||||||||
Sbjct: 500 gaatggcatccaaagcatca 481



to top

>gb|AF397626.1| Ips hunteri elongation factor 1 alpha (EF-1alpha) gene, partial cds
          Length = 689

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 494 gaatggcatccaaagcatca 513
           ||||||||||||||||||||
Sbjct: 500 gaatggcatccaaagcatca 481



to top

>gb|AF397624.1| Ips grandicollis elongation factor 1 alpha (EF-1alpha) gene,
           partial cds
          Length = 689

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 494 gaatggcatccaaagcatca 513
           ||||||||||||||||||||
Sbjct: 500 gaatggcatccaaagcatca 481



to top

>gb|AF397621.1| Ips cribricollis elongation factor 1 alpha (EF-1alpha) gene,
           partial cds
          Length = 688

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 494 gaatggcatccaaagcatca 513
           ||||||||||||||||||||
Sbjct: 500 gaatggcatccaaagcatca 481



to top

>gb|AF397620.1| Ips confusus elongation factor 1 alpha (EF-1alpha) gene, partial
           cds
          Length = 689

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 494 gaatggcatccaaagcatca 513
           ||||||||||||||||||||
Sbjct: 500 gaatggcatccaaagcatca 481



to top

>gb|AF397619.1| Ips cembrae elongation factor 1 alpha (EF-1alpha) gene, partial cds
          Length = 687

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 494 gaatggcatccaaagcatca 513
           ||||||||||||||||||||
Sbjct: 500 gaatggcatccaaagcatca 481



to top

>gb|AF397618.1| Ips calligraphus elongation factor 1 alpha (EF-1alpha) gene,
           partial cds
          Length = 688

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 494 gaatggcatccaaagcatca 513
           ||||||||||||||||||||
Sbjct: 500 gaatggcatccaaagcatca 481



to top

>gb|AF397617.1| Ips borealis elongation factor 1 alpha (EF-1alpha) gene, partial
           cds
          Length = 687

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 494 gaatggcatccaaagcatca 513
           ||||||||||||||||||||
Sbjct: 500 gaatggcatccaaagcatca 481



to top

>gb|AF397615.1| Ips avulsus elongation factor 1 alpha (EF-1alpha) gene, partial cds
          Length = 687

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 494 gaatggcatccaaagcatca 513
           ||||||||||||||||||||
Sbjct: 500 gaatggcatccaaagcatca 481



to top

>gb|AF397614.1| Ips apache elongation factor 1 alpha (EF-1alpha) gene, partial cds
          Length = 688

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 494 gaatggcatccaaagcatca 513
           ||||||||||||||||||||
Sbjct: 500 gaatggcatccaaagcatca 481



to top

>gb|AF397613.1| Ips amitinus elongation factor 1 alpha (EF-1alpha) gene, partial
           cds
          Length = 420

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 494 gaatggcatccaaagcatca 513
           ||||||||||||||||||||
Sbjct: 228 gaatggcatccaaagcatca 209



to top

>gb|AF397612.1| Ips acuminatus elongation factor 1 alpha (EF-1alpha) gene, partial
           cds
          Length = 689

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 494 gaatggcatccaaagcatca 513
           ||||||||||||||||||||
Sbjct: 500 gaatggcatccaaagcatca 481



to top

>gb|AF259884.1| Webbia bicornis elongation factor 1 alpha (ef-1a) gene, partial cds
          Length = 915

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 494 gaatggcatccaaagcatca 513
           ||||||||||||||||||||
Sbjct: 529 gaatggcatccaaagcatca 510



to top

>gb|AF259882.1| Webbia quattuordecimspinatus elongation factor 1 alpha (ef-1a)
           gene, partial cds
          Length = 862

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 494 gaatggcatccaaagcatca 513
           ||||||||||||||||||||
Sbjct: 550 gaatggcatccaaagcatca 531



to top

>gb|AF259877.1| Ambrosiodmus aegir elongation factor 1 alpha (ef-1a) gene, partial
           cds
          Length = 931

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 494 gaatggcatccaaagcatca 513
           ||||||||||||||||||||
Sbjct: 550 gaatggcatccaaagcatca 531



to top

>gb|AF259875.1| Coccotrypes medius elongation factor 1 alpha (ef-1a) gene, partial
           cds
          Length = 885

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 494 gaatggcatccaaagcatca 513
           ||||||||||||||||||||
Sbjct: 502 gaatggcatccaaagcatca 483



to top

>gb|AF259873.1| Dryocoetes autographus elongation factor 1 alpha (ef-1a) gene,
           partial cds
          Length = 889

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 494 gaatggcatccaaagcatca 513
           ||||||||||||||||||||
Sbjct: 508 gaatggcatccaaagcatca 489



to top

>gb|AF259871.1| Coccotrypes longior elongation factor 1 alpha (ef-1a) gene, partial
           cds
          Length = 922

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 494 gaatggcatccaaagcatca 513
           ||||||||||||||||||||
Sbjct: 538 gaatggcatccaaagcatca 519



to top

>gb|AF259870.1| Ozopemon brownei elongation factor 1 alpha (ef-1a) gene, partial
           cds
          Length = 933

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 494 gaatggcatccaaagcatca 513
           ||||||||||||||||||||
Sbjct: 550 gaatggcatccaaagcatca 531



to top

>gb|AF259868.1| Coccotrypes advena elongation factor 1 alpha (ef-1a) gene, partial
           cds
          Length = 933

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 494 gaatggcatccaaagcatca 513
           ||||||||||||||||||||
Sbjct: 550 gaatggcatccaaagcatca 531



to top

>gb|AF259867.1| Coccotrypes gedeanus elongation factor 1 alpha (ef-1a) gene,
           partial cds
          Length = 925

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 494 gaatggcatccaaagcatca 513
           ||||||||||||||||||||
Sbjct: 550 gaatggcatccaaagcatca 531



to top

>gb|AF308432.1| Scolytodes parvulus elongation factor 1 alpha (ef-1a) gene, partial
           cds
          Length = 962

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 494 gaatggcatccaaagcatca 513
           ||||||||||||||||||||
Sbjct: 541 gaatggcatccaaagcatca 522



to top

>gb|AF308428.1| Dendroctonus ponderosae elongation factor 1 alpha (ef-1a) gene,
           partial cds
          Length = 922

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 494 gaatggcatccaaagcatca 513
           ||||||||||||||||||||
Sbjct: 553 gaatggcatccaaagcatca 534



to top

>gb|AF308427.1| Dendroctonus murrayanae elongation factor 1 alpha (ef-1a) gene,
           partial cds
          Length = 890

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 494 gaatggcatccaaagcatca 513
           ||||||||||||||||||||
Sbjct: 526 gaatggcatccaaagcatca 507



to top

>gb|AF308425.1| Dendroctonus jeffreyi elongation factor 1 alpha (ef-1a) gene,
           partial cds
          Length = 944

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 494 gaatggcatccaaagcatca 513
           ||||||||||||||||||||
Sbjct: 556 gaatggcatccaaagcatca 537



to top

>gb|AF308423.1| Dendroctonus adjunctus isolate hlt12 elongation factor 1 alpha
           (ef-1a) gene, partial cds
          Length = 925

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 494 gaatggcatccaaagcatca 513
           ||||||||||||||||||||
Sbjct: 547 gaatggcatccaaagcatca 528



to top

>gb|AF308401.1| Hylesinopsis sp. HLD02 elongation factor 1 alpha (ef-1a) gene,
           partial cds
          Length = 927

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 494 gaatggcatccaaagcatca 513
           ||||||||||||||||||||
Sbjct: 541 gaatggcatccaaagcatca 522



to top

>gb|AF375274.1| Gnathotrupes sp. SCL07 elongation factor-1 alpha (ef-1a) gene,
           partial cds
          Length = 1004

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 494 gaatggcatccaaagcatca 513
           ||||||||||||||||||||
Sbjct: 579 gaatggcatccaaagcatca 560



to top

>gb|AF375273.1| Gnathotrupes sp. SCL06 elongation factor-1 alpha (ef-1a) gene,
           partial cds
          Length = 1029

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 494 gaatggcatccaaagcatca 513
           ||||||||||||||||||||
Sbjct: 553 gaatggcatccaaagcatca 534



to top

>gb|AF375264.1| Stenancylus sp. COR01 elongation factor 1-alpha (ef1a) gene,
           partial cds
          Length = 693

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 494 gaatggcatccaaagcatca 513
           ||||||||||||||||||||
Sbjct: 568 gaatggcatccaaagcatca 549



to top

>gb|AC027323.5| Homo sapiens chromosome 5 clone CTD-2034A10, complete sequence
          Length = 140016

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 591   ttctgctgagccaccaccat 610
             ||||||||||||||||||||
Sbjct: 16267 ttctgctgagccaccaccat 16286



to top

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1,
              complete sequence
          Length = 43261740

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 434    attttacgacggtgagagta 453
              ||||||||||||||||||||
Sbjct: 610014 attttacgacggtgagagta 610033



to top

>dbj|AP000039.1| Homo sapiens genomic DNA, chromosome 21q22.1, segment 10/28, complete
             sequence
          Length = 100000

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 624   gttgatgatcagattccttg 643
             ||||||||||||||||||||
Sbjct: 88251 gttgatgatcagattccttg 88232



to top

>gb|CP000251.1| Anaeromyxobacter dehalogenans 2CP-C, complete genome
          Length = 5013479

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                       
Query: 547     ggatgccgatctgctgcagcgtca 570
               ||||||||||||||||| ||||||
Sbjct: 3752709 ggatgccgatctgctgccgcgtca 3752686



to top

>dbj|AP002882.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0439B06
          Length = 135991

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 434   attttacgacggtgagagta 453
             ||||||||||||||||||||
Sbjct: 84619 attttacgacggtgagagta 84638



to top

>emb|AL954212.1| Pan troglodytes chromosome 22 clone RP43-043L10 map 22q22.11, complete
             sequence
          Length = 192328

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 624   gttgatgatcagattccttg 643
             ||||||||||||||||||||
Sbjct: 24474 gttgatgatcagattccttg 24455



to top

>emb|AL954211.1| Pan troglodytes chromosome 22 clone PTB-034G05 map 22q22.11, complete
              sequence
          Length = 138573

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 624    gttgatgatcagattccttg 643
              ||||||||||||||||||||
Sbjct: 120921 gttgatgatcagattccttg 120902



to top

>gb|AY500988.1| Coleobothrus luridus voucher Co12lurT elongation factor 1 alpha
           (EF1a) gene, partial cds
          Length = 899

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 494 gaatggcatccaaagcatca 513
           ||||||||||||||||||||
Sbjct: 541 gaatggcatccaaagcatca 522



to top

>gb|AY500987.1| Coleobothrus luridus voucher Co11lurLP elongation factor 1 alpha
           (EF1a) gene, partial cds
          Length = 899

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 494 gaatggcatccaaagcatca 513
           ||||||||||||||||||||
Sbjct: 541 gaatggcatccaaagcatca 522



to top

>gb|AY500986.1| Coleobothrus luridus voucher Co10lurLG elongation factor 1 alpha
           (EF1a) gene, partial cds
          Length = 899

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 494 gaatggcatccaaagcatca 513
           ||||||||||||||||||||
Sbjct: 541 gaatggcatccaaagcatca 522



to top

>gb|AY500985.1| Coleobothrus luridus voucher Co09lurGC elongation factor 1 alpha
           (EF1a) gene, partial cds
          Length = 899

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 494 gaatggcatccaaagcatca 513
           ||||||||||||||||||||
Sbjct: 541 gaatggcatccaaagcatca 522



to top

>gb|AY500982.1| Cisurgus wollastoni voucher Ci11wolLP elongation factor 1 alpha
           (EF1a) gene, partial cds
          Length = 899

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 494 gaatggcatccaaagcatca 513
           ||||||||||||||||||||
Sbjct: 541 gaatggcatccaaagcatca 522



to top

>gb|AY500981.1| Cisurgus wollastoni voucher Ci09wolEH elongation factor 1 alpha
           (EF1a) gene, partial cds
          Length = 899

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 494 gaatggcatccaaagcatca 513
           ||||||||||||||||||||
Sbjct: 541 gaatggcatccaaagcatca 522



to top

>gb|AY500980.1| Cisurgus occidentalis voucher Ci07occMo elongation factor 1 alpha
           (EF1a) gene, partial cds
          Length = 901

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 494 gaatggcatccaaagcatca 513
           ||||||||||||||||||||
Sbjct: 541 gaatggcatccaaagcatca 522



to top

>gb|AY500977.1| Cisurgus wollastoni voucher Ci01wolT elongation factor 1 alpha
           (EF1a) gene, partial cds
          Length = 899

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 494 gaatggcatccaaagcatca 513
           ||||||||||||||||||||
Sbjct: 541 gaatggcatccaaagcatca 522



to top

>gb|AY500952.1| Aphanarthrum canariense voucher A61carLP elongation factor 1 alpha
           (EF1a) gene, partial cds
          Length = 901

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 494 gaatggcatccaaagcatca 513
           ||||||||||||||||||||
Sbjct: 541 gaatggcatccaaagcatca 522



to top

>gb|AY500926.1| Aphanarthrum mairei voucher A29maiMo elongation factor 1 alpha
           (EF1a) gene, partial cds
          Length = 903

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 494 gaatggcatccaaagcatca 513
           ||||||||||||||||||||
Sbjct: 541 gaatggcatccaaagcatca 522



to top

>gb|AY500925.1| Aphanarthrum mairei voucher A28maiMo elongation factor 1 alpha
           (EF1a) gene, partial cds
          Length = 903

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 494 gaatggcatccaaagcatca 513
           ||||||||||||||||||||
Sbjct: 541 gaatggcatccaaagcatca 522



to top

>gb|AY500922.1| Aphanarthrum mairei voucher A25maiMo elongation factor 1 alpha
           (EF1a) gene, partial cds
          Length = 903

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 494 gaatggcatccaaagcatca 513
           ||||||||||||||||||||
Sbjct: 541 gaatggcatccaaagcatca 522



to top

>gb|AY500920.1| Aphanarthrum canariense voucher A23carLP elongation factor 1 alpha
           (EF1a) gene, partial cds
          Length = 917

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 494 gaatggcatccaaagcatca 513
           ||||||||||||||||||||
Sbjct: 541 gaatggcatccaaagcatca 522



to top

>emb|BX005105.6| Zebrafish DNA sequence from clone DKEY-37M8 in linkage group 22,
             complete sequence
          Length = 171403

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 616   attgagttgttgatgatcag 635
             ||||||||||||||||||||
Sbjct: 58384 attgagttgttgatgatcag 58365



 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 616   attgagttgttgatgatcag 635
             ||||||||||||||||||||
Sbjct: 36929 attgagttgttgatgatcag 36948



to top

>dbj|AP000999.6| Homo sapiens genomic DNA, chromosome 11 clone:RP11-667I23, complete
              sequence
          Length = 189892

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 176    taacacaataaatgtgcacc 195
              ||||||||||||||||||||
Sbjct: 100507 taacacaataaatgtgcacc 100488



to top

>dbj|AP002853.4| Homo sapiens genomic DNA, chromosome 11 clone:RP11-46K15, complete
             sequence
          Length = 177463

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 176   taacacaataaatgtgcacc 195
             ||||||||||||||||||||
Sbjct: 18067 taacacaataaatgtgcacc 18048



to top

>dbj|AP001715.1| Homo sapiens genomic DNA, chromosome 21q, section 59/105
          Length = 340000

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 624    gttgatgatcagattccttg 643
              ||||||||||||||||||||
Sbjct: 153401 gttgatgatcagattccttg 153382



to top

>gb|AC138027.3| Mus musculus BAC clone RP24-100L8 from 12, complete sequence
          Length = 201839

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 176    taacacaataaatgtgcacc 195
              ||||||||||||||||||||
Sbjct: 111526 taacacaataaatgtgcacc 111545



to top

>emb|CT030194.5| Mouse DNA sequence from clone RP23-463F7 on chromosome 13, complete
             sequence
          Length = 195497

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 629   tgatcagattccttgcaaca 648
             ||||||||||||||||||||
Sbjct: 57608 tgatcagattccttgcaaca 57627



to top

>dbj|AP000281.1| Homo sapiens genomic DNA, chromosome 21q22.1, D21S226-AML region,
             clone:T1588, complete sequence
          Length = 66129

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 624   gttgatgatcagattccttg 643
             ||||||||||||||||||||
Sbjct: 32310 gttgatgatcagattccttg 32291



to top

>dbj|AP000183.1| Homo sapiens genomic DNA, chromosome 21q22.1, D21S226-AML region, clone
             Q78C10-f32E9, segment 10/21, complete sequence
          Length = 100000

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 624   gttgatgatcagattccttg 643
             ||||||||||||||||||||
Sbjct: 94227 gttgatgatcagattccttg 94208



to top

>dbj|AP000107.1| Homo sapiens genomic DNA of 21q22.1, GART and AML related,
             Q78C10-149C3 region, segment 10/20, complete sequence
          Length = 100000

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 624   gttgatgatcagattccttg 643
             ||||||||||||||||||||
Sbjct: 94227 gttgatgatcagattccttg 94208


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 5,614,020
Number of Sequences: 3902068
Number of extensions: 5614020
Number of successful extensions: 92004
Number of sequences better than 10.0: 178
Number of HSP's better than 10.0 without gapping: 177
Number of HSP's successfully gapped in prelim test: 1
Number of HSP's that attempted gapping in prelim test: 91530
Number of HSP's gapped (non-prelim): 467
length of query: 668
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 645
effective length of database: 17,143,297,704
effective search space: 11057427019080
effective search space used: 11057427019080
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top