| Clone Name | rbags13e15 |
|---|---|
| Clone Library Name | barley_pub |
>dbj|AB164396.1| Hordeum vulgare HvMS mRNA for methionine synthase, complete cds Length = 2558 Score = 664 bits (335), Expect = 0.0 Identities = 368/384 (95%) Strand = Plus / Minus Query: 1 atgaacaattcgccactcaagttnacaatacacactgacaaccgcctcaaaaagccaccg 60 ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| Sbjct: 2522 atgaacaattcgccactcaagtttacaatacacactgacaaccgcctcaaaaagccaccg 2463 Query: 61 aatcaagggatgagcacatcctgccgagaaacaactaccctaataaccaacaagtggaca 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 2462 aatcaagggatgagcacatcctgccgagaaacaactaccctaataaccaacaagtggaca 2403 Query: 121 cgaggtccagattattcaaagtaaaacgccggccatggcaacggngacatcctccttgca 180 |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| Sbjct: 2402 cgaggtccagattattcaaagtaaaacgccggccatggcaacggtgacatcctccttgca 2343 Query: 181 attaaaannnnnnnagagctgctatacgagcactgcttactgcgccttggcgagctcggc 240 ||||||| |||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 2342 attaaaagggggggagagctgctatacgagcactgcttactgcgccttggcgagctcggc 2283 Query: 241 gcggatctgcttggcggcctcgaccatgttggtgagggcggncttgacctnggcgtactt 300 ||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||| Sbjct: 2282 gcggatctgcttggcggcctcgaccatgttggtgagggcgggcttgacctcggcgtactt 2223 Query: 301 gcnggtcttgagaccgcantcggngttcacccataggatgttggtgtcgagcacagngag 360 || ||||||||||||||| |||| ||||||||| |||||||||||||||||||||| ||| Sbjct: 2222 gcgggtcttgagaccgcagtcggggttcacccagaggatgttggtgtcgagcacagcgag 2163 Query: 361 catcttgttgacgcggtcggcaat 384 |||||||||||||||||||||||| Sbjct: 2162 catcttgttgacgcggtcggcaat 2139
>emb|AM039904.1| Hordeum vulgare mRNA for methionine synthase 1 enzyme (ms1 gene) Length = 2642 Score = 656 bits (331), Expect = 0.0 Identities = 367/384 (95%) Strand = Plus / Minus Query: 1 atgaacaattcgccactcaagttnacaatacacactgacaaccgcctcaaaaagccaccg 60 ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| Sbjct: 2567 atgaacaattcgccactcaagtttacaatacacactgacaaccgcctcaaaaagccaccg 2508 Query: 61 aatcaagggatgagcacatcctgccgagaaacaactaccctaataaccaacaagtggaca 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 2507 aatcaagggatgagcacatcctgccgagaaacaactaccctaataaccaacaagtggaca 2448 Query: 121 cgaggtccagattattcaaagtaaaacgccggccatggcaacggngacatcctccttgca 180 |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| Sbjct: 2447 cgaggtccagattattcaaagtaaaacgccggccatggcaacggtgacatcctccttgca 2388 Query: 181 attaaaannnnnnnagagctgctatacgagcactgcttactgcgccttggcgagctcggc 240 ||||||| |||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 2387 attaaaagggggggagagctgctatacgagcactgcttactgcgccttggcgagctcggc 2328 Query: 241 gcggatctgcttggcggcctcgaccatgttggtgagggcggncttgacctnggcgtactt 300 |||||| |||||||||||||||||||||||||||||||||| |||||||| ||||||||| Sbjct: 2327 gcggatttgcttggcggcctcgaccatgttggtgagggcgggcttgacctcggcgtactt 2268 Query: 301 gcnggtcttgagaccgcantcggngttcacccataggatgttggtgtcgagcacagngag 360 || ||||||||||||||| |||| ||||||||| |||||||||||||||||||||| ||| Sbjct: 2267 gcgggtcttgagaccgcagtcggggttcacccagaggatgttggtgtcgagcacagcgag 2208 Query: 361 catcttgttgacgcggtcggcaat 384 |||||||||||||||||||||||| Sbjct: 2207 catcttgttgacgcggtcggcaat 2184
>emb|AM039905.1| Hordeum vulgare mRNA for methionine synthase 2 enzyme (ms2 gene) Length = 2675 Score = 157 bits (79), Expect = 3e-35 Identities = 136/157 (86%) Strand = Plus / Minus Query: 228 tggcgagctcggcgcggatctgcttggcggcctcgaccatgttggtgagggcggncttga 287 ||||||||| || |||||| ||||||| || |||||||||| || ||||||| ||| | Sbjct: 2373 tggcgagctgggtgcggatgagcttggccgcagcgaccatgttagtcagggcgggcttca 2314 Query: 288 cctnggcgtacttgcnggtcttgagaccgcantcggngttcacccataggatgttggtgt 347 ||| || |||||||| ||||||||| ||||| || | ||||||||| ||||||||||||| Sbjct: 2313 cctcggtgtacttgcgggtcttgaggccgcagtcagggttcacccagaggatgttggtgt 2254 Query: 348 cgagcacagngagcatcttgttgacgcggtcggcaat 384 ||||||| | ||||||||||||||||||||||||||| Sbjct: 2253 cgagcaccgcgagcatcttgttgacgcggtcggcaat 2217
>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12, complete sequence Length = 27566993 Score = 149 bits (75), Expect = 8e-33 Identities = 135/157 (85%) Strand = Plus / Minus Query: 228 tggcgagctcggcgcggatctgcttggcggcctcgaccatgttggtgagggcggncttga 287 ||||||||| || |||||| ||||||||||| ||||||||||| ||||||| ||||| Sbjct: 26684320 tggcgagctgggtgcggatgagcttggcggccgaaaccatgttggtaagggcgggcttga 26684261 Query: 288 cctnggcgtacttgcnggtcttgagaccgcantcggngttcacccataggatgttggtgt 347 ||| | |||||||| ||||||||||||||| || | ||||||||| || ||||| |||| Sbjct: 26684260 cctcgttgtacttgcgggtcttgagaccgcagtcagggttcacccagagaatgttagtgt 26684201 Query: 348 cgagcacagngagcatcttgttgacgcggtcggcaat 384 ||||||| | ||||||||||||||||||||| ||||| Sbjct: 26684200 cgagcaccgcgagcatcttgttgacgcggtccgcaat 26684164 Score = 129 bits (65), Expect = 7e-27 Identities = 131/155 (84%) Strand = Plus / Minus Query: 230 gcgagctcggcgcggatctgcttggcggcctcgaccatgttggtgagggcggncttgacc 289 ||||||| || |||||| ||||||||||| ||||||||||||||||| | ||| ||| Sbjct: 26696168 gcgagctgggtgcggatgagcttggcggccaaaaccatgttggtgagggcaggcttcacc 26696109 Query: 290 tnggcgtacttgcnggtcttgagaccgcantcggngttcacccataggatgttggtgtcg 349 | || |||||||| ||||||||||||||| || | ||||||||| || ||||| |||||| Sbjct: 26696108 tcggtgtacttgcgggtcttgagaccgcagtcagggttcacccagagaatgttagtgtcg 26696049 Query: 350 agcacagngagcatcttgttgacgcggtcggcaat 384 ||||| | ||||||||||||| |||||| ||||| Sbjct: 26696048 agcaccgcaagcatcttgttgatgcggtccgcaat 26696014
>dbj|AK099069.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013163D13, full insert sequence Length = 2640 Score = 149 bits (75), Expect = 8e-33 Identities = 135/157 (85%) Strand = Plus / Minus Query: 228 tggcgagctcggcgcggatctgcttggcggcctcgaccatgttggtgagggcggncttga 287 ||||||||| || |||||| ||||||||||| ||||||||||| ||||||| ||||| Sbjct: 2357 tggcgagctgggtgcggatgagcttggcggccgaaaccatgttggtaagggcgggcttga 2298 Query: 288 cctnggcgtacttgcnggtcttgagaccgcantcggngttcacccataggatgttggtgt 347 ||| | |||||||| ||||||||||||||| || | ||||||||| || ||||| |||| Sbjct: 2297 cctcgttgtacttgcgggtcttgagaccgcagtcagggttcacccagagaatgttagtgt 2238 Query: 348 cgagcacagngagcatcttgttgacgcggtcggcaat 384 ||||||| | ||||||||||||||||||||| ||||| Sbjct: 2237 cgagcaccgcgagcatcttgttgacgcggtccgcaat 2201
>dbj|AK067958.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013128E22, full insert sequence Length = 2058 Score = 149 bits (75), Expect = 8e-33 Identities = 135/157 (85%) Strand = Plus / Minus Query: 228 tggcgagctcggcgcggatctgcttggcggcctcgaccatgttggtgagggcggncttga 287 ||||||||| || |||||| ||||||||||| ||||||||||| ||||||| ||||| Sbjct: 1724 tggcgagctgggtgcggatgagcttggcggccgaaaccatgttggtaagggcgggcttga 1665 Query: 288 cctnggcgtacttgcnggtcttgagaccgcantcggngttcacccataggatgttggtgt 347 ||| | |||||||| ||||||||||||||| || | ||||||||| || ||||| |||| Sbjct: 1664 cctcgttgtacttgcgggtcttgagaccgcagtcagggttcacccagagaatgttagtgt 1605 Query: 348 cgagcacagngagcatcttgttgacgcggtcggcaat 384 ||||||| | ||||||||||||||||||||| ||||| Sbjct: 1604 cgagcaccgcgagcatcttgttgacgcggtccgcaat 1568
>dbj|AK065255.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013002J12, full insert sequence Length = 2668 Score = 149 bits (75), Expect = 8e-33 Identities = 135/157 (85%) Strand = Plus / Minus Query: 228 tggcgagctcggcgcggatctgcttggcggcctcgaccatgttggtgagggcggncttga 287 ||||||||| || |||||| ||||||||||| ||||||||||| ||||||| ||||| Sbjct: 2356 tggcgagctgggtgcggatgagcttggcggccgaaaccatgttggtaagggcgggcttga 2297 Query: 288 cctnggcgtacttgcnggtcttgagaccgcantcggngttcacccataggatgttggtgt 347 ||| | |||||||| ||||||||||||||| || | ||||||||| || ||||| |||| Sbjct: 2296 cctcgttgtacttgcgggtcttgagaccgcagtcagggttcacccagagaatgttagtgt 2237 Query: 348 cgagcacagngagcatcttgttgacgcggtcggcaat 384 ||||||| | ||||||||||||||||||||| ||||| Sbjct: 2236 cgagcaccgcgagcatcttgttgacgcggtccgcaat 2200
>dbj|AK062198.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-046-G02, full insert sequence Length = 1064 Score = 149 bits (75), Expect = 8e-33 Identities = 135/157 (85%) Strand = Plus / Minus Query: 228 tggcgagctcggcgcggatctgcttggcggcctcgaccatgttggtgagggcggncttga 287 ||||||||| || |||||| ||||||||||| ||||||||||| ||||||| ||||| Sbjct: 781 tggcgagctgggtgcggatgagcttggcggccgaaaccatgttggtaagggcgggcttga 722 Query: 288 cctnggcgtacttgcnggtcttgagaccgcantcggngttcacccataggatgttggtgt 347 ||| | |||||||| ||||||||||||||| || | ||||||||| || ||||| |||| Sbjct: 721 cctcgttgtacttgcgggtcttgagaccgcagtcagggttcacccagagaatgttagtgt 662 Query: 348 cgagcacagngagcatcttgttgacgcggtcggcaat 384 ||||||| | ||||||||||||||||||||| ||||| Sbjct: 661 cgagcaccgcgagcatcttgttgacgcggtccgcaat 625
>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence Length = 27492551 Score = 149 bits (75), Expect = 8e-33 Identities = 135/157 (85%) Strand = Plus / Minus Query: 228 tggcgagctcggcgcggatctgcttggcggcctcgaccatgttggtgagggcggncttga 287 ||||||||| || |||||| ||||||||||| ||||||||||| ||||||| ||||| Sbjct: 26612489 tggcgagctgggtgcggatgagcttggcggccgaaaccatgttggtaagggcgggcttga 26612430 Query: 288 cctnggcgtacttgcnggtcttgagaccgcantcggngttcacccataggatgttggtgt 347 ||| | |||||||| ||||||||||||||| || | ||||||||| || ||||| |||| Sbjct: 26612429 cctcgttgtacttgcgggtcttgagaccgcagtcagggttcacccagagaatgttagtgt 26612370 Query: 348 cgagcacagngagcatcttgttgacgcggtcggcaat 384 ||||||| | ||||||||||||||||||||| ||||| Sbjct: 26612369 cgagcaccgcgagcatcttgttgacgcggtccgcaat 26612333 Score = 129 bits (65), Expect = 7e-27 Identities = 131/155 (84%) Strand = Plus / Minus Query: 230 gcgagctcggcgcggatctgcttggcggcctcgaccatgttggtgagggcggncttgacc 289 ||||||| || |||||| ||||||||||| ||||||||||||||||| | ||| ||| Sbjct: 26624337 gcgagctgggtgcggatgagcttggcggccaaaaccatgttggtgagggcaggcttcacc 26624278 Query: 290 tnggcgtacttgcnggtcttgagaccgcantcggngttcacccataggatgttggtgtcg 349 | || |||||||| ||||||||||||||| || | ||||||||| || ||||| |||||| Sbjct: 26624277 tcggtgtacttgcgggtcttgagaccgcagtcagggttcacccagagaatgttagtgtcg 26624218 Query: 350 agcacagngagcatcttgttgacgcggtcggcaat 384 ||||| | ||||||||||||| |||||| ||||| Sbjct: 26624217 agcaccgcaagcatcttgttgatgcggtccgcaat 26624183
>emb|BX072547.2|CNS09S4Q Oryza sativa chromosome 12, . Partial sequence from BAC OSJNBb0090N22 of library OSJNBb from chromosome 12 of cultivar Nipponbare of ssp. japonica of Oryza sativa (rice), complete sequence Length = 8623 Score = 149 bits (75), Expect = 8e-33 Identities = 135/157 (85%) Strand = Plus / Minus Query: 228 tggcgagctcggcgcggatctgcttggcggcctcgaccatgttggtgagggcggncttga 287 ||||||||| || |||||| ||||||||||| ||||||||||| ||||||| ||||| Sbjct: 2904 tggcgagctgggtgcggatgagcttggcggccgaaaccatgttggtaagggcgggcttga 2845 Query: 288 cctnggcgtacttgcnggtcttgagaccgcantcggngttcacccataggatgttggtgt 347 ||| | |||||||| ||||||||||||||| || | ||||||||| || ||||| |||| Sbjct: 2844 cctcgttgtacttgcgggtcttgagaccgcagtcagggttcacccagagaatgttagtgt 2785 Query: 348 cgagcacagngagcatcttgttgacgcggtcggcaat 384 ||||||| | ||||||||||||||||||||| ||||| Sbjct: 2784 cgagcaccgcgagcatcttgttgacgcggtccgcaat 2748
>gb|BT009353.1| Triticum aestivum clone wlm96.pk0018.c10:fis, full insert mRNA sequence Length = 2634 Score = 141 bits (71), Expect = 2e-30 Identities = 134/157 (85%) Strand = Plus / Minus Query: 228 tggcgagctcggcgcggatctgcttggcggcctcgaccatgttggtgagggcggncttga 287 ||||||||| || |||||| ||||||| || | ||||||||||| ||||||| ||| | Sbjct: 2364 tggcgagctgggtgcggatgagcttggccgcggcaaccatgttggtcagggcgggcttca 2305 Query: 288 cctnggcgtacttgcnggtcttgagaccgcantcggngttcacccataggatgttggtgt 347 ||| | |||||||| ||||||||| ||||| || | ||||||||| ||||||||||||| Sbjct: 2304 cctccgtgtacttgcgggtcttgaggccgcagtcagggttcacccacaggatgttggtgt 2245 Query: 348 cgagcacagngagcatcttgttgacgcggtcggcaat 384 |||| || | ||||||||||||||||||||||||||| Sbjct: 2244 cgaggaccgcgagcatcttgttgacgcggtcggcaat 2208
>dbj|AK067726.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013116O11, full insert sequence Length = 2783 Score = 129 bits (65), Expect = 7e-27 Identities = 131/155 (84%) Strand = Plus / Minus Query: 230 gcgagctcggcgcggatctgcttggcggcctcgaccatgttggtgagggcggncttgacc 289 ||||||| || |||||| ||||||||||| ||||||||||||||||| | ||| ||| Sbjct: 2474 gcgagctgggtgcggatgagcttggcggccaaaaccatgttggtgagggcaggcttcacc 2415 Query: 290 tnggcgtacttgcnggtcttgagaccgcantcggngttcacccataggatgttggtgtcg 349 | || |||||||| ||||||||||||||| || | ||||||||| || ||||| |||||| Sbjct: 2414 tcggtgtacttgcgggtcttgagaccgcagtcagggttcacccagagaatgttagtgtcg 2355 Query: 350 agcacagngagcatcttgttgacgcggtcggcaat 384 ||||| | ||||||||||||| |||||| ||||| Sbjct: 2354 agcaccgcaagcatcttgttgatgcggtccgcaat 2320
>emb|AL731889.5|CNS08C8T Oryza sativa chromosome 12, . BAC OJ1122_G07 of library Monsanto from chromosome 12 of cultivar Nipponbare of ssp. japonica of Oryza sativa (rice), complete sequence Length = 83015 Score = 129 bits (65), Expect = 7e-27 Identities = 131/155 (84%) Strand = Plus / Plus Query: 230 gcgagctcggcgcggatctgcttggcggcctcgaccatgttggtgagggcggncttgacc 289 ||||||| || |||||| ||||||||||| ||||||||||||||||| | ||| ||| Sbjct: 74959 gcgagctgggtgcggatgagcttggcggccaaaaccatgttggtgagggcaggcttcacc 75018 Query: 290 tnggcgtacttgcnggtcttgagaccgcantcggngttcacccataggatgttggtgtcg 349 | || |||||||| ||||||||||||||| || | ||||||||| || ||||| |||||| Sbjct: 75019 tcggtgtacttgcgggtcttgagaccgcagtcagggttcacccagagaatgttagtgtcg 75078 Query: 350 agcacagngagcatcttgttgacgcggtcggcaat 384 ||||| | ||||||||||||| |||||| ||||| Sbjct: 75079 agcaccgcaagcatcttgttgatgcggtccgcaat 75113
>emb|BX000561.2|CNS08CE7 Oryza sativa chromosome 12, . BAC OJ1014_F06 of library Monsanto from chromosome 12 of cultivar Nipponbare of ssp. japonica of Oryza sativa (rice), complete sequence Length = 104849 Score = 129 bits (65), Expect = 7e-27 Identities = 131/155 (84%) Strand = Plus / Plus Query: 230 gcgagctcggcgcggatctgcttggcggcctcgaccatgttggtgagggcggncttgacc 289 ||||||| || |||||| ||||||||||| ||||||||||||||||| | ||| ||| Sbjct: 102810 gcgagctgggtgcggatgagcttggcggccaaaaccatgttggtgagggcaggcttcacc 102869 Query: 290 tnggcgtacttgcnggtcttgagaccgcantcggngttcacccataggatgttggtgtcg 349 | || |||||||| ||||||||||||||| || | ||||||||| || ||||| |||||| Sbjct: 102870 tcggtgtacttgcgggtcttgagaccgcagtcagggttcacccagagaatgttagtgtcg 102929 Query: 350 agcacagngagcatcttgttgacgcggtcggcaat 384 ||||| | ||||||||||||| |||||| ||||| Sbjct: 102930 agcaccgcaagcatcttgttgatgcggtccgcaat 102964
>gb|AF466201.1| Sorghum bicolor clone SBTXS_0032H17 putative cytochrome P450-like protein, putative DNA-binding protein homolog, TATA-binding protein, hypothetical protein M3E9.200, 3-glucanase, K-exchanger-like protein, small heat shock-like protein, methionine synthase protein, putative far-red impaired response protein, and putative vegetative storage protein genes, complete cds Length = 100773 Score = 127 bits (64), Expect = 3e-26 Identities = 106/122 (86%) Strand = Plus / Plus Query: 263 accatgttggtgagggcggncttgacctnggcgtacttgcnggtcttgagaccgcantcg 322 ||||||||||| ||||||| |||||||| | |||||||| ||||||||||| || || Sbjct: 72721 accatgttggtcagggcgggcttgacctccgtgtacttgcgtgtcttgagaccacagtcc 72780 Query: 323 gngttcacccataggatgttggtgtcgagcacagngagcatcttgttgacgcggtcggca 382 | ||||||||| |||||||||||||| ||||||| |||||||||||||||||||| ||| Sbjct: 72781 gggttcacccagaggatgttggtgtcaagcacagcaagcatcttgttgacgcggtccgca 72840 Query: 383 at 384 || Sbjct: 72841 at 72842
>gb|AY109415.1| Zea mays CL598_2 mRNA sequence Length = 3017 Score = 127 bits (64), Expect = 3e-26 Identities = 130/154 (84%) Strand = Plus / Plus Query: 228 tggcgagctcggcgcggatctgcttggcggcctcgaccatgttggtgagggcggncttga 287 ||||||||| || |||||| |||| ||||| |||||||||||| ||||||| ||||| Sbjct: 641 tggcgagctgggtgcggatgagcttagcggcggagaccatgttggtcagggcgggcttga 700 Query: 288 cctnggcgtacttgcnggtcttgagaccgcantcggngttcacccataggatgttggtgt 347 ||| | |||||||| ||||||||| ||||| |||| ||||||||| ||||||||||||| Sbjct: 701 cctccgtgtacttgcgggtcttgaggccgcagtcggggttcacccagaggatgttggtgt 760 Query: 348 cgagcacagngagcatcttgttgacgcggtcggc 381 | ||||| | |||||||||| || ||||||||| Sbjct: 761 ccagcaccgccagcatcttgtcgatgcggtcggc 794
>gb|AY111481.1| Zea mays CL598_4 mRNA sequence Length = 664 Score = 125 bits (63), Expect = 1e-25 Identities = 102/117 (87%) Strand = Plus / Plus Query: 262 gaccatgttggtgagggcggncttgacctnggcgtacttgcnggtcttgagaccgcantc 321 |||||||||||| ||||| | ||| |||| | |||||||| |||||||||||||| || Sbjct: 334 gaccatgttggtcagggcaggcttcacctccgtgtacttgcgtgtcttgagaccgcagtc 393 Query: 322 ggngttcacccataggatgttggtgtcgagcacagngagcatcttgttgacgcggtc 378 | ||||||||| |||||||||||||||||||| | ||||||||||||||||||||| Sbjct: 394 agggttcacccagaggatgttggtgtcgagcacggcgagcatcttgttgacgcggtc 450
>gb|AF439723.1|AF439723 Zea mays methionine synthase mRNA, partial cds Length = 2300 Score = 123 bits (62), Expect = 4e-25 Identities = 104/120 (86%) Strand = Plus / Minus Query: 262 gaccatgttggtgagggcggncttgacctnggcgtacttgcnggtcttgagaccgcantc 321 |||||||||||| ||||||| |||||||| | |||||||| ||||||||| ||||| || Sbjct: 2256 gaccatgttggtcagggcgggcttgacctccgtgtacttgcgggtcttgaggccgcagtc 2197 Query: 322 ggngttcacccataggatgttggtgtcgagcacagngagcatcttgttgacgcggtcggc 381 || ||||||||| |||||||||||||| ||||| | |||||||||| || ||||||||| Sbjct: 2196 ggggttcacccagaggatgttggtgtccagcaccgccagcatcttgtcgatgcggtcggc 2137
>dbj|AK067757.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013116H17, full insert sequence Length = 2627 Score = 121 bits (61), Expect = 2e-24 Identities = 130/155 (83%) Strand = Plus / Minus Query: 230 gcgagctcggcgcggatctgcttggcggcctcgaccatgttggtgagggcggncttgacc 289 ||||||| || |||||| ||||||||||| ||||||||||||||||| | ||| ||| Sbjct: 2355 gcgagctgggtgcggatgagcttggcggccaaaaccatgttggtgagggcaggcttcacc 2296 Query: 290 tnggcgtacttgcnggtcttgagaccgcantcggngttcacccataggatgttggtgtcg 349 | | |||||||| ||||||||||||||| || | ||||||||| || ||||| |||||| Sbjct: 2295 tctgtgtacttgcgggtcttgagaccgcagtcagggttcacccagagaatgttagtgtcg 2236 Query: 350 agcacagngagcatcttgttgacgcggtcggcaat 384 ||||| | ||||||||||||| |||||| ||||| Sbjct: 2235 agcaccgcaagcatcttgttgatgcggtccgcaat 2201
>gb|AY104793.1| Zea mays PCO079166 mRNA sequence Length = 2720 Score = 121 bits (61), Expect = 2e-24 Identities = 127/151 (84%) Strand = Plus / Minus Query: 228 tggcgagctcggcgcggatctgcttggcggcctcgaccatgttggtgagggcggncttga 287 |||| |||| || |||||| |||||| |||| |||||||||||| ||||||| ||||| Sbjct: 2399 tggcaagctgggtgcggatgagcttggtggccgagaccatgttggtcagggcgggcttga 2340 Query: 288 cctnggcgtacttgcnggtcttgagaccgcantcggngttcacccataggatgttggtgt 347 ||| | |||||||| ||||||||||| || || | ||||||||| ||||||||||||| Sbjct: 2339 cctccgtgtacttgcgtgtcttgagaccacagtcagggttcacccagaggatgttggtgt 2280 Query: 348 cgagcacagngagcatcttgttgacgcggtc 378 ||||||| | ||||||||| | ||||||||| Sbjct: 2279 cgagcacggcgagcatcttctcgacgcggtc 2249
>gb|BT016781.1| Zea mays clone Contig614 mRNA sequence Length = 1759 Score = 117 bits (59), Expect = 3e-23 Identities = 101/117 (86%) Strand = Plus / Minus Query: 262 gaccatgttggtgagggcggncttgacctnggcgtacttgcnggtcttgagaccgcantc 321 |||||||||||| ||||| | ||| |||| | |||||||| |||||||||||||| || Sbjct: 1359 gaccatgttggtcagggcaggcttcacctccgtgtacttgcgtgtcttgagaccgcagtc 1300 Query: 322 ggngttcacccataggatgttggtgtcgagcacagngagcatcttgttgacgcggtc 378 | ||||||||| |||||||||||||| ||||| | ||||||||||||||||||||| Sbjct: 1299 agggttcacccagaggatgttggtgtccagcacggcgagcatcttgttgacgcggtc 1243
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 Length = 36102668 Score = 81.8 bits (41), Expect = 2e-12 Identities = 122/151 (80%) Strand = Plus / Minus Query: 228 tggcgagctcggcgcggatctgcttggcggcctcgaccatgttggtgagggcggncttga 287 |||| |||| || |||||| ||||||| || || ||||||||||| || || | || | Sbjct: 25306437 tggcaagctgggtgcggatgagcttggcagcatctaccatgttggttagtgcaggtttca 25306378 Query: 288 cctnggcgtacttgcnggtcttgagaccgcantcggngttcacccataggatgttggtgt 347 ||| || ||| |||| |||||||||||||| || | ||||||| | ||||||||||||| Sbjct: 25306377 cctcggtgtatttgcgggtcttgagaccgcggtcagggttcacctagaggatgttggtgt 25306318 Query: 348 cgagcacagngagcatcttgttgacgcggtc 378 | ||||| | ||||||||||||| |||||| Sbjct: 25306317 caagcacggcaagcatcttgttgatgcggtc 25306287
>gb|AC133859.4| Oryza sativa chromosome 3 BAC OSJNBa0075A22 genomic sequence, complete sequence Length = 152828 Score = 81.8 bits (41), Expect = 2e-12 Identities = 122/151 (80%) Strand = Plus / Plus Query: 228 tggcgagctcggcgcggatctgcttggcggcctcgaccatgttggtgagggcggncttga 287 |||| |||| || |||||| ||||||| || || ||||||||||| || || | || | Sbjct: 136923 tggcaagctgggtgcggatgagcttggcagcatctaccatgttggttagtgcaggtttca 136982 Query: 288 cctnggcgtacttgcnggtcttgagaccgcantcggngttcacccataggatgttggtgt 347 ||| || ||| |||| |||||||||||||| || | ||||||| | ||||||||||||| Sbjct: 136983 cctcggtgtatttgcgggtcttgagaccgcggtcagggttcacctagaggatgttggtgt 137042 Query: 348 cgagcacagngagcatcttgttgacgcggtc 378 | ||||| | ||||||||||||| |||||| Sbjct: 137043 caagcacggcaagcatcttgttgatgcggtc 137073
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete sequence Length = 36192742 Score = 81.8 bits (41), Expect = 2e-12 Identities = 122/151 (80%) Strand = Plus / Minus Query: 228 tggcgagctcggcgcggatctgcttggcggcctcgaccatgttggtgagggcggncttga 287 |||| |||| || |||||| ||||||| || || ||||||||||| || || | || | Sbjct: 25397746 tggcaagctgggtgcggatgagcttggcagcatctaccatgttggttagtgcaggtttca 25397687 Query: 288 cctnggcgtacttgcnggtcttgagaccgcantcggngttcacccataggatgttggtgt 347 ||| || ||| |||| |||||||||||||| || | ||||||| | ||||||||||||| Sbjct: 25397686 cctcggtgtatttgcgggtcttgagaccgcggtcagggttcacctagaggatgttggtgt 25397627 Query: 348 cgagcacagngagcatcttgttgacgcggtc 378 | ||||| | ||||||||||||| |||||| Sbjct: 25397626 caagcacggcaagcatcttgttgatgcggtc 25397596
>ref|XM_469072.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1149 Score = 73.8 bits (37), Expect = 4e-10 Identities = 77/92 (83%) Strand = Plus / Plus Query: 287 acctnggcgtacttgcnggtcttgagaccgcantcggngttcacccataggatgttggtg 346 |||| || ||| |||| |||||||||||||| || | ||||||| | |||||||||||| Sbjct: 944 acctcggtgtatttgcgggtcttgagaccgcggtcagggttcacctagaggatgttggtg 1003 Query: 347 tcgagcacagngagcatcttgttgacgcggtc 378 || ||||| | ||||||||||||| |||||| Sbjct: 1004 tcaagcacggcaagcatcttgttgatgcggtc 1035
>emb|X83499.1|CRMETS C.roseus MetE mRNA for methionine synthase Length = 2602 Score = 71.9 bits (36), Expect = 1e-09 Identities = 77/92 (83%) Strand = Plus / Minus Query: 293 gcgtacttgcnggtcttgagaccgcantcggngttcacccataggatgttggtgtcgagc 352 |||||||||| |||||||||||| || |||| ||| ||||| | |||||||||||| | | Sbjct: 2272 gcgtacttgcgggtcttgagaccacagtcggggttaacccacaagatgttggtgtccaac 2213 Query: 353 acagngagcatcttgttgacgcggtcggcaat 384 || | ||||||||||||| | ||||||||| Sbjct: 2212 actgcaagcatcttgttgattctgtcggcaat 2181
>gb|AF082893.1| Solanum tuberosum methionine synthase (MS) mRNA, complete cds Length = 2644 Score = 65.9 bits (33), Expect = 9e-08 Identities = 78/95 (82%) Strand = Plus / Minus Query: 275 agggcggncttgacctnggcgtacttgcnggtcttgagaccgcantcggngttcacccat 334 ||||| | ||| |||| || |||||||| ||||||||||| || || | |||||||||| Sbjct: 2296 agggctggcttcacctcggtgtacttgcgagtcttgagaccacagtcagggttcacccat 2237 Query: 335 aggatgttggtgtcgagcacagngagcatcttgtt 369 | |||||||||||| || || | ||||||||||| Sbjct: 2236 aagatgttggtgtcaagaactgcaagcatcttgtt 2202
>gb|AF096261.1|AF096261 Lycopersicon esculentum ethylene-responsive methionine synthase (ER69) mRNA, partial cds Length = 206 Score = 65.9 bits (33), Expect = 9e-08 Identities = 78/95 (82%) Strand = Plus / Minus Query: 275 agggcggncttgacctnggcgtacttgcnggtcttgagaccgcantcggngttcacccat 334 ||||| | ||| |||| || |||||||| ||||||||||| || |||| ||||||||| Sbjct: 171 agggctggcttcacctcggtgtacttgcgagtcttgagaccacagtcggggttcacccac 112 Query: 335 aggatgttggtgtcgagcacagngagcatcttgtt 369 | |||||||||||| || || | ||||||||||| Sbjct: 111 aagatgttggtgtcaaggactgcaagcatcttgtt 77
>gb|AF220054.1|AF220054 Coffea arabica methionine synthase mRNA, partial cds Length = 680 Score = 63.9 bits (32), Expect = 4e-07 Identities = 113/142 (79%) Strand = Plus / Minus Query: 228 tggcgagctcggcgcggatctgcttggcggcctcgaccatgttggtgagggcggncttga 287 |||| |||| || |||||| ||||||||||| | |||||||| |||||| | ||| | Sbjct: 646 tggcaagctgggtgcggatttgcttggcggcggcaaccatgttttggagggccggcttca 587 Query: 288 cctnggcgtacttgcnggtcttgagaccgcantcggngttcacccataggatgttggtgt 347 ||| |||||||||| |||||||||||| || || | ||| ||||| | |||||| || | Sbjct: 586 cctcagcgtacttgcgggtcttgagaccacaatcagggttgacccacaagatgttcgtat 527 Query: 348 cgagcacagngagcatcttgtt 369 | ||||| | ||||||||||| Sbjct: 526 ccagcactgcaagcatcttgtt 505
>emb|Z49150.1|CBKPMETGN C.blumei kinetoplast met gene for cobalamine-independent methionine synthase Length = 2795 Score = 61.9 bits (31), Expect = 1e-06 Identities = 66/79 (83%) Strand = Plus / Minus Query: 293 gcgtacttgcnggtcttgagaccgcantcggngttcacccataggatgttggtgtcgagc 352 ||||| |||| |||||||||||| || || | ||||||||| | ||||||||| || || Sbjct: 2400 gcgtatttgcgggtcttgagaccacagtcagggttcacccacaagatgttggtttcaagg 2341 Query: 353 acagngagcatcttgttga 371 |||| ||||||||||||| Sbjct: 2340 acagcaagcatcttgttga 2322
>ref|NM_121798.2| Arabidopsis thaliana ATCIMS (COBALAMIN-INDEPENDENT METHIONINE SYNTHASE); 5-methyltetrahydropteroyltriglutamate-homocysteine S-methyltransferase AT5G17920 (ATCIMS) mRNA, complete cds Length = 2682 Score = 56.0 bits (28), Expect = 9e-05 Identities = 92/115 (80%) Strand = Plus / Minus Query: 228 tggcgagctcggcgcggatctgcttggcggcctcgaccatgttggtgagggcggncttga 287 ||||||||| || |||||| |||| || || || |||||||| |||| || | ||||| Sbjct: 2379 tggcgagctgggagcggatgagcttagccgcatcaaccatgttcttgagtgcaggcttga 2320 Query: 288 cctnggcgtacttgcnggtcttgagaccgcantcggngttcacccataggatgtt 342 ||| || |||||| | |||||||||||| || || | ||| ||||| |||||||| Sbjct: 2319 cctcggtgtacttacgggtcttgagaccacagtcagggttaacccaaaggatgtt 2265
>gb|BT000691.1| Arabidopsis thaliana clone RAFL08-16-E05 (R11047) putative 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase (At5g17920) mRNA, complete cds Length = 2585 Score = 56.0 bits (28), Expect = 9e-05 Identities = 92/115 (80%) Strand = Plus / Minus Query: 228 tggcgagctcggcgcggatctgcttggcggcctcgaccatgttggtgagggcggncttga 287 ||||||||| || |||||| |||| || || || |||||||| |||| || | ||||| Sbjct: 2372 tggcgagctgggagcggatgagcttagccgcatcaaccatgttcttgagtgcaggcttga 2313 Query: 288 cctnggcgtacttgcnggtcttgagaccgcantcggngttcacccataggatgtt 342 ||| || |||||| | |||||||||||| || || | ||| ||||| |||||||| Sbjct: 2312 cctcggtgtacttacgggtcttgagaccacagtcagggttaacccaaaggatgtt 2258
>gb|AY091692.1| Arabidopsis thaliana AT5g17920/MPI7_60 mRNA, complete cds Length = 2298 Score = 56.0 bits (28), Expect = 9e-05 Identities = 92/115 (80%) Strand = Plus / Minus Query: 228 tggcgagctcggcgcggatctgcttggcggcctcgaccatgttggtgagggcggncttga 287 ||||||||| || |||||| |||| || || || |||||||| |||| || | ||||| Sbjct: 2287 tggcgagctgggagcggatgagcttagccgcatcaaccatgttcttgagtgcaggcttga 2228 Query: 288 cctnggcgtacttgcnggtcttgagaccgcantcggngttcacccataggatgtt 342 ||| || |||||| | |||||||||||| || || | ||| ||||| |||||||| Sbjct: 2227 cctcggtgtacttacgggtcttgagaccacagtcagggttaacccaaaggatgtt 2173
>gb|AY070771.1| Arabidopsis thaliana AT5g17920/MPI7_60 mRNA, complete cds Length = 2648 Score = 56.0 bits (28), Expect = 9e-05 Identities = 92/115 (80%) Strand = Plus / Minus Query: 228 tggcgagctcggcgcggatctgcttggcggcctcgaccatgttggtgagggcggncttga 287 ||||||||| || |||||| |||| || || || |||||||| |||| || | ||||| Sbjct: 2369 tggcgagctgggagcggatgagcttagccgcatcaaccatgttcttgagtgcaggcttga 2310 Query: 288 cctnggcgtacttgcnggtcttgagaccgcantcggngttcacccataggatgtt 342 ||| || |||||| | |||||||||||| || || | ||| ||||| |||||||| Sbjct: 2309 cctcggtgtacttacgggtcttgagaccacagtcagggttaacccaaaggatgtt 2255
>gb|AY069876.1| Arabidopsis thaliana AT5g17920/MPI7_60 mRNA, complete cds Length = 2594 Score = 56.0 bits (28), Expect = 9e-05 Identities = 92/115 (80%) Strand = Plus / Minus Query: 228 tggcgagctcggcgcggatctgcttggcggcctcgaccatgttggtgagggcggncttga 287 ||||||||| || |||||| |||| || || || |||||||| |||| || | ||||| Sbjct: 2369 tggcgagctgggagcggatgagcttagccgcatcaaccatgttcttgagtgcaggcttga 2310 Query: 288 cctnggcgtacttgcnggtcttgagaccgcantcggngttcacccataggatgtt 342 ||| || |||||| | |||||||||||| || || | ||| ||||| |||||||| Sbjct: 2309 cctcggtgtacttacgggtcttgagaccacagtcagggttaacccaaaggatgtt 2255
>emb|AJ608673.1| Arabidopsis thaliana mRNA for cobalamin-independent methionine synthase (atms1 gene) Length = 2326 Score = 56.0 bits (28), Expect = 9e-05 Identities = 92/115 (80%) Strand = Plus / Minus Query: 228 tggcgagctcggcgcggatctgcttggcggcctcgaccatgttggtgagggcggncttga 287 ||||||||| || |||||| |||| || || || |||||||| |||| || | ||||| Sbjct: 2292 tggcgagctgggagcggatgagcttagccgcatcaaccatgttcttgagcgcaggcttga 2233 Query: 288 cctnggcgtacttgcnggtcttgagaccgcantcggngttcacccataggatgtt 342 ||| || |||||| | |||||||||||| || || | ||| ||||| |||||||| Sbjct: 2232 cctcggtgtacttacgggtcttgagaccacagtcagggttaacccaaaggatgtt 2178
>gb|AY057499.1| Arabidopsis thaliana AT5g17920/MPI7_60 mRNA, complete cds Length = 2613 Score = 56.0 bits (28), Expect = 9e-05 Identities = 92/115 (80%) Strand = Plus / Minus Query: 228 tggcgagctcggcgcggatctgcttggcggcctcgaccatgttggtgagggcggncttga 287 ||||||||| || |||||| |||| || || || |||||||| |||| || | ||||| Sbjct: 2369 tggcgagctgggagcggatgagcttagccgcatcaaccatgttcttgagtgcaggcttga 2310 Query: 288 cctnggcgtacttgcnggtcttgagaccgcantcggngttcacccataggatgtt 342 ||| || |||||| | |||||||||||| || || | ||| ||||| |||||||| Sbjct: 2309 cctcggtgtacttacgggtcttgagaccacagtcagggttaacccaaaggatgtt 2255
>gb|AY057478.1| Arabidopsis thaliana AT5g17920/MPI7_60 mRNA, complete cds Length = 2608 Score = 56.0 bits (28), Expect = 9e-05 Identities = 92/115 (80%) Strand = Plus / Minus Query: 228 tggcgagctcggcgcggatctgcttggcggcctcgaccatgttggtgagggcggncttga 287 ||||||||| || |||||| |||| || || || |||||||| |||| || | ||||| Sbjct: 2369 tggcgagctgggagcggatgagcttagccgcatcaaccatgttcttgagtgcaggcttga 2310 Query: 288 cctnggcgtacttgcnggtcttgagaccgcantcggngttcacccataggatgtt 342 ||| || |||||| | |||||||||||| || || | ||| ||||| |||||||| Sbjct: 2309 cctcggtgtacttacgggtcttgagaccacagtcagggttaacccaaaggatgtt 2255
>gb|AY056098.1| Arabidopsis thaliana AT5g17920/MPI7_60 mRNA, complete cds Length = 2460 Score = 56.0 bits (28), Expect = 9e-05 Identities = 92/115 (80%) Strand = Plus / Minus Query: 228 tggcgagctcggcgcggatctgcttggcggcctcgaccatgttggtgagggcggncttga 287 ||||||||| || |||||| |||| || || || |||||||| |||| || | ||||| Sbjct: 2369 tggcgagctgggagcggatgagcttagccgcatcaaccatgttcttgagtgcaggcttga 2310 Query: 288 cctnggcgtacttgcnggtcttgagaccgcantcggngttcacccataggatgtt 342 ||| || |||||| | |||||||||||| || || | ||| ||||| |||||||| Sbjct: 2309 cctcggtgtacttacgggtcttgagaccacagtcagggttaacccaaaggatgtt 2255
>dbj|AK222123.1| Arabidopsis thaliana mRNA for 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase, complete cds, clone: RAFL22-94-C14 Length = 1684 Score = 56.0 bits (28), Expect = 9e-05 Identities = 92/115 (80%) Strand = Plus / Minus Query: 228 tggcgagctcggcgcggatctgcttggcggcctcgaccatgttggtgagggcggncttga 287 ||||||||| || |||||| |||| || || || |||||||| |||| || | ||||| Sbjct: 1397 tggcgagctgggagcggatgagcttagccgcatcaaccatgttcttgagtgcaggcttga 1338 Query: 288 cctnggcgtacttgcnggtcttgagaccgcantcggngttcacccataggatgtt 342 ||| || |||||| | |||||||||||| || || | ||| ||||| |||||||| Sbjct: 1337 cctcggtgtacttacgggtcttgagaccacagtcagggttaacccaaaggatgtt 1283
>gb|AY048201.1| Arabidopsis thaliana AT5g17920/MPI7_60 mRNA, complete cds Length = 2549 Score = 56.0 bits (28), Expect = 9e-05 Identities = 92/115 (80%) Strand = Plus / Minus Query: 228 tggcgagctcggcgcggatctgcttggcggcctcgaccatgttggtgagggcggncttga 287 ||||||||| || |||||| |||| || || || |||||||| |||| || | ||||| Sbjct: 2369 tggcgagctgggagcggatgagcttagccgcatcaaccatgttcttgagtgcaggcttga 2310 Query: 288 cctnggcgtacttgcnggtcttgagaccgcantcggngttcacccataggatgtt 342 ||| || |||||| | |||||||||||| || || | ||| ||||| |||||||| Sbjct: 2309 cctcggtgtacttacgggtcttgagaccacagtcagggttaacccaaaggatgtt 2255
>gb|AF370522.1|AF370522 Arabidopsis thaliana cobalamin-independent methionine synthase (MPI7.9) mRNA, complete cds Length = 2646 Score = 56.0 bits (28), Expect = 9e-05 Identities = 92/115 (80%) Strand = Plus / Minus Query: 228 tggcgagctcggcgcggatctgcttggcggcctcgaccatgttggtgagggcggncttga 287 ||||||||| || |||||| |||| || || || |||||||| |||| || | ||||| Sbjct: 2369 tggcgagctgggagcggatgagcttagccgcatcaaccatgttcttgagtgcaggcttga 2310 Query: 288 cctnggcgtacttgcnggtcttgagaccgcantcggngttcacccataggatgtt 342 ||| || |||||| | |||||||||||| || || | ||| ||||| |||||||| Sbjct: 2309 cctcggtgtacttacgggtcttgagaccacagtcagggttaacccaaaggatgtt 2255
>emb|BX831470.1|CNS0A1W8 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS94ZC02 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1156 Score = 56.0 bits (28), Expect = 9e-05 Identities = 92/115 (80%) Strand = Plus / Minus Query: 228 tggcgagctcggcgcggatctgcttggcggcctcgaccatgttggtgagggcggncttga 287 ||||||||| || |||||| |||| || || || |||||||| |||| || | ||||| Sbjct: 917 tggcgagctgggagcggatgagcttagccgcatcaaccatgttcttgagtgcaggcttga 858 Query: 288 cctnggcgtacttgcnggtcttgagaccgcantcggngttcacccataggatgtt 342 ||| || |||||| | |||||||||||| || || | ||| ||||| |||||||| Sbjct: 857 cctcggtgtacttacgggtcttgagaccacagtcagggttaacccaaaggatgtt 803
>emb|BX833585.1|CNS09Z4M Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTSIL64ZC05 of Silique of strain col-0 of Arabidopsis thaliana (thale cress) Length = 601 Score = 56.0 bits (28), Expect = 9e-05 Identities = 92/115 (80%) Strand = Plus / Minus Query: 228 tggcgagctcggcgcggatctgcttggcggcctcgaccatgttggtgagggcggncttga 287 ||||||||| || |||||| |||| || || || |||||||| |||| || | ||||| Sbjct: 319 tggcgagctgggagcggatgagcttagccgcatcaaccatgttcttgagtgcaggcttga 260 Query: 288 cctnggcgtacttgcnggtcttgagaccgcantcggngttcacccataggatgtt 342 ||| || |||||| | |||||||||||| || || | ||| ||||| |||||||| Sbjct: 259 cctcggtgtacttacgggtcttgagaccacagtcagggttaacccaaaggatgtt 205
>dbj|AB011480.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MPI7 Length = 40548 Score = 56.0 bits (28), Expect = 9e-05 Identities = 92/115 (80%) Strand = Plus / Minus Query: 228 tggcgagctcggcgcggatctgcttggcggcctcgaccatgttggtgagggcggncttga 287 ||||||||| || |||||| |||| || || || |||||||| |||| || | ||||| Sbjct: 39733 tggcgagctgggagcggatgagcttagccgcatcaaccatgttcttgagtgcaggcttga 39674 Query: 288 cctnggcgtacttgcnggtcttgagaccgcantcggngttcacccataggatgtt 342 ||| || |||||| | |||||||||||| || || | ||| ||||| |||||||| Sbjct: 39673 cctcggtgtacttacgggtcttgagaccacagtcagggttaacccaaaggatgtt 39619
>gb|U97200.1|ATU97200 Arabidopsis thaliana cobalamin-independent methionine synthase (ATCIMS) mRNA, complete cds Length = 2595 Score = 56.0 bits (28), Expect = 9e-05 Identities = 92/115 (80%) Strand = Plus / Minus Query: 228 tggcgagctcggcgcggatctgcttggcggcctcgaccatgttggtgagggcggncttga 287 ||||||||| || |||||| |||| || || || |||||||| |||| || | ||||| Sbjct: 2295 tggcgagctgggagcggatgagcttagccgcatcaaccatgttcttgagtgcaggcttga 2236 Query: 288 cctnggcgtacttgcnggtcttgagaccgcantcggngttcacccataggatgtt 342 ||| || |||||| | |||||||||||| || || | ||| ||||| |||||||| Sbjct: 2235 cctcggtgtacttacgggtcttgagaccacagtcagggttaacccaaaggatgtt 2181
>gb|AF518566.1| Glycine max methionine synthase mRNA, complete cds Length = 2695 Score = 54.0 bits (27), Expect = 3e-04 Identities = 87/109 (79%) Strand = Plus / Minus Query: 263 accatgttggtgagggcggncttgacctnggcgtacttgcnggtcttgagaccgcantcg 322 |||||||| |||||||| | ||| |||| | |||||| | ||||||||| || || || Sbjct: 2326 accatgtttgtgagggctggcttcacctcagtgtacttacgggtcttgagcccacagtca 2267 Query: 323 gngttcacccataggatgttggtgtcgagcacagngagcatcttgttga 371 | ||||||||| | |||||| | |||||||| | ||||||||||||| Sbjct: 2266 gggttcacccacaagatgttcttctcgagcactgccagcatcttgttga 2218
>emb|AM158915.1| Plantago major partial mRNA for methionine synthase (met1 gene) Length = 772 Score = 50.1 bits (25), Expect = 0.005 Identities = 55/66 (83%) Strand = Plus / Minus Query: 304 ggtcttgagaccgcantcggngttcacccataggatgttggtgtcgagcacagngagcat 363 |||||| ||||| || || | ||| |||||||| |||||||| |||||||| | ||||| Sbjct: 400 ggtcttcagaccacagtcagggttgacccatagaatgttggtctcgagcacggcaagcat 341 Query: 364 cttgtt 369 |||||| Sbjct: 340 cttgtt 335
>gb|BT012108.1| Arabidopsis thaliana At5g17920 mRNA sequence Length = 2295 Score = 48.1 bits (24), Expect = 0.021 Identities = 91/115 (79%) Strand = Plus / Minus Query: 228 tggcgagctcggcgcggatctgcttggcggcctcgaccatgttggtgagggcggncttga 287 ||||||||| || |||||| |||| || || || |||||||| |||| || | |||| Sbjct: 2284 tggcgagctgggagcggatgagcttagccgcatcaaccatgttcttgagtgcaggcttgg 2225 Query: 288 cctnggcgtacttgcnggtcttgagaccgcantcggngttcacccataggatgtt 342 ||| || |||||| | |||||||||||| || || | ||| ||||| |||||||| Sbjct: 2224 cctcggtgtacttacgggtcttgagaccacagtcagggttaacccaaaggatgtt 2170
>gb|AE017285.1| Desulfovibrio vulgaris subsp. vulgaris str. Hildenborough, complete genome Length = 3570858 Score = 48.1 bits (24), Expect = 0.021 Identities = 27/28 (96%) Strand = Plus / Plus Query: 254 gcggcctcgaccatgttggtgagggcgg 281 ||||||||||||||||||| |||||||| Sbjct: 3542128 gcggcctcgaccatgttggcgagggcgg 3542155
>ref|XM_952059.1| Neurospora crassa OR74A hypothetical protein (NCU06512.1) partial mRNA Length = 2310 Score = 46.1 bits (23), Expect = 0.083 Identities = 63/78 (80%) Strand = Plus / Minus Query: 250 cttggcggcctcgaccatgttggtgagggcggncttgacctnggcgtacttgcnggtctt 309 |||||||||||| ||||||| || |||||| |||||||| | |||||| |||||| Sbjct: 2277 cttggcggcctcaaccatgtgggagagggcacccttgacctcatcccacttgcgggtctt 2218 Query: 310 gagaccgcantcggngtt 327 |||||||| |||| ||| Sbjct: 2217 aagaccgcagtcggggtt 2200
>ref|XM_326366.1| Neurospora crassa OR74A hypothetical protein (NCU06512.1) partial mRNA Length = 2310 Score = 46.1 bits (23), Expect = 0.083 Identities = 63/78 (80%) Strand = Plus / Minus Query: 250 cttggcggcctcgaccatgttggtgagggcggncttgacctnggcgtacttgcnggtctt 309 |||||||||||| ||||||| || |||||| |||||||| | |||||| |||||| Sbjct: 2277 cttggcggcctcaaccatgtgggagagggcacccttgacctcatcccacttgcgggtctt 2218 Query: 310 gagaccgcantcggngtt 327 |||||||| |||| ||| Sbjct: 2217 aagaccgcagtcggggtt 2200
>gb|AF404820.1|AF404820 Neurospora crassa methionine synthase (met-8) gene, complete cds Length = 3269 Score = 46.1 bits (23), Expect = 0.083 Identities = 63/78 (80%) Strand = Plus / Minus Query: 250 cttggcggcctcgaccatgttggtgagggcggncttgacctnggcgtacttgcnggtctt 309 |||||||||||| ||||||| || |||||| |||||||| | |||||| |||||| Sbjct: 2643 cttggcggcctcaaccatgtgggagagggcacccttgacctcatcccacttgcgggtctt 2584 Query: 310 gagaccgcantcggngtt 327 |||||||| |||| ||| Sbjct: 2583 aagaccgcagtcggggtt 2566
>dbj|AK221003.1| Arabidopsis thaliana mRNA for hypothetical protein, complete cds, clone: RAFL22-65-M04 Length = 390 Score = 46.1 bits (23), Expect = 0.083 Identities = 71/88 (80%) Strand = Plus / Minus Query: 228 tggcgagctcggcgcggatctgcttggcggcctcgaccatgttggtgagggcggncttga 287 ||||||||| || |||||| |||| || || || |||||||| |||| || | ||||| Sbjct: 103 tggcgagctgggagcggatgagcttagccgcatcaaccatgttcttgagtgcaggcttga 44 Query: 288 cctnggcgtacttgcnggtcttgagacc 315 ||| || |||||| | |||||||||||| Sbjct: 43 cctcggtgtacttacgggtcttgagacc 16
>ref|NM_208514.1| Eremothecium gossypii ABR212Cp (ABR212C), mRNA Length = 2307 Score = 46.1 bits (23), Expect = 0.083 Identities = 29/31 (93%) Strand = Plus / Minus Query: 248 tgcttggcggcctcgaccatgttggtgaggg 278 ||||||||||| ||||||||||| ||||||| Sbjct: 2276 tgcttggcggcttcgaccatgtttgtgaggg 2246
>gb|U84889.1|MCU84889 Mesembryanthemum crystallinum methionine synthase (MetE) mRNA, complete cds Length = 2734 Score = 46.1 bits (23), Expect = 0.083 Identities = 35/40 (87%) Strand = Plus / Minus Query: 294 cgtacttgcnggtcttgagaccgcantcggngttcaccca 333 ||||||| | |||||||||||| || |||| ||||||||| Sbjct: 2341 cgtacttacgggtcttgagaccacagtcggggttcaccca 2302
>gb|AE016815.2| Ashbya gossypii (= Eremothecium gossypii) ATCC 10895 chromosome II, complete sequence Length = 867699 Score = 46.1 bits (23), Expect = 0.083 Identities = 29/31 (93%) Strand = Plus / Plus Query: 248 tgcttggcggcctcgaccatgttggtgaggg 278 ||||||||||| ||||||||||| ||||||| Sbjct: 802422 tgcttggcggcttcgaccatgtttgtgaggg 802452
>dbj|AK107388.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-127-C09, full insert sequence Length = 2566 Score = 44.1 bits (22), Expect = 0.33 Identities = 33/37 (89%) Strand = Plus / Minus Query: 250 cttggcggcctcgaccatgttggtgagggcggncttg 286 ||||||||| | ||||| |||||||||||||| |||| Sbjct: 2337 cttggcggcgttgaccaagttggtgagggcggtcttg 2301
>gb|CP000010.1| Burkholderia mallei ATCC 23344 chromosome 1, complete sequence Length = 3510148 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 245 atctgcttggcggcctcgacc 265 ||||||||||||||||||||| Sbjct: 428585 atctgcttggcggcctcgacc 428565
>gb|CP000124.1| Burkholderia pseudomallei 1710b chromosome I, complete sequence Length = 4126292 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 245 atctgcttggcggcctcgacc 265 ||||||||||||||||||||| Sbjct: 3276151 atctgcttggcggcctcgacc 3276131
>gb|AC146417.3| Pan troglodytes BAC clone RP43-29B12 from 7, complete sequence Length = 196843 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 127 ccagattattcaaagtaaaac 147 ||||||||||||||||||||| Sbjct: 160771 ccagattattcaaagtaaaac 160791
>emb|AL390766.16| Human DNA sequence from clone RP13-348N17 on chromosome 10 Contains part of the PARD3 gene for par-3 partitioning defective 3 homolog (C.elegans), complete sequence Length = 193131 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 127 ccagattattcaaagtaaaac 147 ||||||||||||||||||||| Sbjct: 157149 ccagattattcaaagtaaaac 157169
>emb|BX571965.1| Burkholderia pseudomallei strain K96243, chromosome 1, complete sequence Length = 4074542 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 245 atctgcttggcggcctcgacc 265 ||||||||||||||||||||| Sbjct: 3007326 atctgcttggcggcctcgacc 3007306
>gb|AE005950.1| Caulobacter crescentus CB15 section 276 of 359 of the complete genome Length = 12754 Score = 42.1 bits (21), Expect = 1.3 Identities = 24/25 (96%) Strand = Plus / Minus Query: 238 ggcgcggatctgcttggcggcctcg 262 ||||||||||| ||||||||||||| Sbjct: 7030 ggcgcggatctccttggcggcctcg 7006
>dbj|AP007255.1| Magnetospirillum magneticum AMB-1 DNA, complete genome Length = 4967148 Score = 42.1 bits (21), Expect = 1.3 Identities = 24/25 (96%) Strand = Plus / Minus Query: 244 gatctgcttggcggcctcgaccatg 268 ||||||||||||||| ||||||||| Sbjct: 4608560 gatctgcttggcggcttcgaccatg 4608536
>gb|AE016958.1| Mycobacterium avium subsp. paratuberculosis str. k10, complete genome Length = 4829781 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 223 cgccttggcgagctcggcgcg 243 ||||||||||||||||||||| Sbjct: 384455 cgccttggcgagctcggcgcg 384475
>emb|BX640448.1| Bordetella bronchiseptica strain RB50, complete genome; segment 12/16 Length = 347137 Score = 40.1 bits (20), Expect = 5.1 Identities = 23/24 (95%) Strand = Plus / Minus Query: 223 cgccttggcgagctcggcgcggat 246 ||||||||||||||||| |||||| Sbjct: 61299 cgccttggcgagctcggggcggat 61276
>emb|BX640432.1| Bordetella parapertussis strain 12822, complete genome; segment 10/14 Length = 346301 Score = 40.1 bits (20), Expect = 5.1 Identities = 23/24 (95%) Strand = Plus / Minus Query: 223 cgccttggcgagctcggcgcggat 246 ||||||||||||||||| |||||| Sbjct: 344059 cgccttggcgagctcggggcggat 344036
>emb|BX640414.1| Bordetella pertussis strain Tohama I, complete genome; segment 4/12 Length = 343243 Score = 40.1 bits (20), Expect = 5.1 Identities = 23/24 (95%) Strand = Plus / Plus Query: 223 cgccttggcgagctcggcgcggat 246 ||||||||||||||||| |||||| Sbjct: 134631 cgccttggcgagctcggggcggat 134654
>gb|CP000133.1| Rhizobium etli CFN 42, complete genome Length = 4381608 Score = 40.1 bits (20), Expect = 5.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 250 cttggcggcctcgaccatgt 269 |||||||||||||||||||| Sbjct: 528455 cttggcggcctcgaccatgt 528436
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete sequence Length = 43261740 Score = 40.1 bits (20), Expect = 5.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 1 atgaacaattcgccactcaa 20 |||||||||||||||||||| Sbjct: 41912770 atgaacaattcgccactcaa 41912751
>dbj|AP003683.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0431G06 Length = 140466 Score = 40.1 bits (20), Expect = 5.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 1 atgaacaattcgccactcaa 20 |||||||||||||||||||| Sbjct: 14847 atgaacaattcgccactcaa 14828 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 1,812,675 Number of Sequences: 3902068 Number of extensions: 1812675 Number of successful extensions: 30466 Number of sequences better than 10.0: 72 Number of HSP's better than 10.0 without gapping: 69 Number of HSP's successfully gapped in prelim test: 3 Number of HSP's that attempted gapping in prelim test: 29998 Number of HSP's gapped (non-prelim): 469 length of query: 384 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 362 effective length of database: 17,147,199,772 effective search space: 6207286317464 effective search space used: 6207286317464 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)