ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbags13e15
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1dbj|AB164396.1| Hordeum vulgare HvMS mRNA for methionine synthas... 664 0.0
2emb|AM039904.1| Hordeum vulgare mRNA for methionine synthase 1 e... 656 0.0
3emb|AM039905.1| Hordeum vulgare mRNA for methionine synthase 2 e... 157 3e-35
4dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic D... 149 8e-33
5dbj|AK099069.1| Oryza sativa (japonica cultivar-group) cDNA clon... 149 8e-33
6dbj|AK067958.1| Oryza sativa (japonica cultivar-group) cDNA clon... 149 8e-33
7dbj|AK065255.1| Oryza sativa (japonica cultivar-group) cDNA clon... 149 8e-33
8dbj|AK062198.1| Oryza sativa (japonica cultivar-group) cDNA clon... 149 8e-33
9gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome... 149 8e-33
10emb|BX072547.2|CNS09S4Q Oryza sativa chromosome 12, . Partial se... 149 8e-33
11gb|BT009353.1| Triticum aestivum clone wlm96.pk0018.c10:fis, ful... 141 2e-30
12dbj|AK067726.1| Oryza sativa (japonica cultivar-group) cDNA clon... 129 7e-27
13emb|AL731889.5|CNS08C8T Oryza sativa chromosome 12, . BAC OJ1122... 129 7e-27
14emb|BX000561.2|CNS08CE7 Oryza sativa chromosome 12, . BAC OJ1014... 129 7e-27
15gb|AF466201.1| Sorghum bicolor clone SBTXS_0032H17 putative cyto... 127 3e-26
16gb|AY109415.1| Zea mays CL598_2 mRNA sequence 127 3e-26
17gb|AY111481.1| Zea mays CL598_4 mRNA sequence 125 1e-25
18gb|AF439723.1|AF439723 Zea mays methionine synthase mRNA, partia... 123 4e-25
19dbj|AK067757.1| Oryza sativa (japonica cultivar-group) cDNA clon... 121 2e-24
20gb|AY104793.1| Zea mays PCO079166 mRNA sequence 121 2e-24
21gb|BT016781.1| Zea mays clone Contig614 mRNA sequence 117 3e-23
22gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 82 2e-12
23gb|AC133859.4| Oryza sativa chromosome 3 BAC OSJNBa0075A22 genom... 82 2e-12
24dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 82 2e-12
25ref|XM_469072.1| Oryza sativa (japonica cultivar-group), mRNA 74 4e-10
26emb|X83499.1|CRMETS C.roseus MetE mRNA for methionine synthase 72 1e-09
27gb|AF082893.1| Solanum tuberosum methionine synthase (MS) mRNA, ... 66 9e-08
28gb|AF096261.1|AF096261 Lycopersicon esculentum ethylene-responsi... 66 9e-08
29gb|AF220054.1|AF220054 Coffea arabica methionine synthase mRNA, ... 64 4e-07
30emb|Z49150.1|CBKPMETGN C.blumei kinetoplast met gene for cobalam... 62 1e-06
31ref|NM_121798.2| Arabidopsis thaliana ATCIMS (COBALAMIN-INDEPEND... 56 9e-05
32gb|BT000691.1| Arabidopsis thaliana clone RAFL08-16-E05 (R11047)... 56 9e-05
33gb|AY091692.1| Arabidopsis thaliana AT5g17920/MPI7_60 mRNA, comp... 56 9e-05
34gb|AY070771.1| Arabidopsis thaliana AT5g17920/MPI7_60 mRNA, comp... 56 9e-05
35gb|AY069876.1| Arabidopsis thaliana AT5g17920/MPI7_60 mRNA, comp... 56 9e-05
36emb|AJ608673.1| Arabidopsis thaliana mRNA for cobalamin-independ... 56 9e-05
37gb|AY057499.1| Arabidopsis thaliana AT5g17920/MPI7_60 mRNA, comp... 56 9e-05
38gb|AY057478.1| Arabidopsis thaliana AT5g17920/MPI7_60 mRNA, comp... 56 9e-05
39gb|AY056098.1| Arabidopsis thaliana AT5g17920/MPI7_60 mRNA, comp... 56 9e-05
40dbj|AK222123.1| Arabidopsis thaliana mRNA for 5-methyltetrahydro... 56 9e-05
41gb|AY048201.1| Arabidopsis thaliana AT5g17920/MPI7_60 mRNA, comp... 56 9e-05
42gb|AF370522.1|AF370522 Arabidopsis thaliana cobalamin-independen... 56 9e-05
43emb|BX831470.1|CNS0A1W8 Arabidopsis thaliana Full-length cDNA Co... 56 9e-05
44emb|BX833585.1|CNS09Z4M Arabidopsis thaliana Full-length cDNA Co... 56 9e-05
45dbj|AB011480.1| Arabidopsis thaliana genomic DNA, chromosome 5, ... 56 9e-05
46gb|U97200.1|ATU97200 Arabidopsis thaliana cobalamin-independent ... 56 9e-05
47gb|AF518566.1| Glycine max methionine synthase mRNA, complete cds 54 3e-04
48emb|AM158915.1| Plantago major partial mRNA for methionine synth... 50 0.005
49gb|BT012108.1| Arabidopsis thaliana At5g17920 mRNA sequence 48 0.021
50gb|AE017285.1| Desulfovibrio vulgaris subsp. vulgaris str. Hilde... 48 0.021
51ref|XM_952059.1| Neurospora crassa OR74A hypothetical protein (N... 46 0.083
52ref|XM_326366.1| Neurospora crassa OR74A hypothetical protein (N... 46 0.083
53gb|AF404820.1|AF404820 Neurospora crassa methionine synthase (me... 46 0.083
54dbj|AK221003.1| Arabidopsis thaliana mRNA for hypothetical prote... 46 0.083
55ref|NM_208514.1| Eremothecium gossypii ABR212Cp (ABR212C), mRNA 46 0.083
56gb|U84889.1|MCU84889 Mesembryanthemum crystallinum methionine sy... 46 0.083
57gb|AE016815.2| Ashbya gossypii (= Eremothecium gossypii) ATCC 10... 46 0.083
58dbj|AK107388.1| Oryza sativa (japonica cultivar-group) cDNA clon... 44 0.33
59gb|CP000010.1| Burkholderia mallei ATCC 23344 chromosome 1, comp... 42 1.3
60gb|CP000124.1| Burkholderia pseudomallei 1710b chromosome I, com... 42 1.3
61gb|AC146417.3| Pan troglodytes BAC clone RP43-29B12 from 7, comp... 42 1.3
62emb|AL390766.16| Human DNA sequence from clone RP13-348N17 on ch... 42 1.3
63emb|BX571965.1| Burkholderia pseudomallei strain K96243, chromos... 42 1.3
64gb|AE005950.1| Caulobacter crescentus CB15 section 276 of 359 of... 42 1.3
65dbj|AP007255.1| Magnetospirillum magneticum AMB-1 DNA, complete ... 42 1.3
66gb|AE016958.1| Mycobacterium avium subsp. paratuberculosis str. ... 42 1.3
67emb|BX640448.1| Bordetella bronchiseptica strain RB50, complete ... 40 5.1
68emb|BX640432.1| Bordetella parapertussis strain 12822, complete ... 40 5.1
69emb|BX640414.1| Bordetella pertussis strain Tohama I, complete g... 40 5.1
70gb|CP000133.1| Rhizobium etli CFN 42, complete genome 40 5.1
71dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 40 5.1
72dbj|AP003683.3| Oryza sativa (japonica cultivar-group) genomic D... 40 5.1

>dbj|AB164396.1| Hordeum vulgare HvMS mRNA for methionine synthase, complete cds
          Length = 2558

 Score =  664 bits (335), Expect = 0.0
 Identities = 368/384 (95%)
 Strand = Plus / Minus

                                                                        
Query: 1    atgaacaattcgccactcaagttnacaatacacactgacaaccgcctcaaaaagccaccg 60
            ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 2522 atgaacaattcgccactcaagtttacaatacacactgacaaccgcctcaaaaagccaccg 2463

                                                                        
Query: 61   aatcaagggatgagcacatcctgccgagaaacaactaccctaataaccaacaagtggaca 120
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2462 aatcaagggatgagcacatcctgccgagaaacaactaccctaataaccaacaagtggaca 2403

                                                                        
Query: 121  cgaggtccagattattcaaagtaaaacgccggccatggcaacggngacatcctccttgca 180
            |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||
Sbjct: 2402 cgaggtccagattattcaaagtaaaacgccggccatggcaacggtgacatcctccttgca 2343

                                                                        
Query: 181  attaaaannnnnnnagagctgctatacgagcactgcttactgcgccttggcgagctcggc 240
            |||||||       ||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2342 attaaaagggggggagagctgctatacgagcactgcttactgcgccttggcgagctcggc 2283

                                                                        
Query: 241  gcggatctgcttggcggcctcgaccatgttggtgagggcggncttgacctnggcgtactt 300
            ||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||
Sbjct: 2282 gcggatctgcttggcggcctcgaccatgttggtgagggcgggcttgacctcggcgtactt 2223

                                                                        
Query: 301  gcnggtcttgagaccgcantcggngttcacccataggatgttggtgtcgagcacagngag 360
            || ||||||||||||||| |||| ||||||||| |||||||||||||||||||||| |||
Sbjct: 2222 gcgggtcttgagaccgcagtcggggttcacccagaggatgttggtgtcgagcacagcgag 2163

                                    
Query: 361  catcttgttgacgcggtcggcaat 384
            ||||||||||||||||||||||||
Sbjct: 2162 catcttgttgacgcggtcggcaat 2139



to top

>emb|AM039904.1| Hordeum vulgare mRNA for methionine synthase 1 enzyme (ms1 gene)
          Length = 2642

 Score =  656 bits (331), Expect = 0.0
 Identities = 367/384 (95%)
 Strand = Plus / Minus

                                                                        
Query: 1    atgaacaattcgccactcaagttnacaatacacactgacaaccgcctcaaaaagccaccg 60
            ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 2567 atgaacaattcgccactcaagtttacaatacacactgacaaccgcctcaaaaagccaccg 2508

                                                                        
Query: 61   aatcaagggatgagcacatcctgccgagaaacaactaccctaataaccaacaagtggaca 120
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2507 aatcaagggatgagcacatcctgccgagaaacaactaccctaataaccaacaagtggaca 2448

                                                                        
Query: 121  cgaggtccagattattcaaagtaaaacgccggccatggcaacggngacatcctccttgca 180
            |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||
Sbjct: 2447 cgaggtccagattattcaaagtaaaacgccggccatggcaacggtgacatcctccttgca 2388

                                                                        
Query: 181  attaaaannnnnnnagagctgctatacgagcactgcttactgcgccttggcgagctcggc 240
            |||||||       ||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2387 attaaaagggggggagagctgctatacgagcactgcttactgcgccttggcgagctcggc 2328

                                                                        
Query: 241  gcggatctgcttggcggcctcgaccatgttggtgagggcggncttgacctnggcgtactt 300
            |||||| |||||||||||||||||||||||||||||||||| |||||||| |||||||||
Sbjct: 2327 gcggatttgcttggcggcctcgaccatgttggtgagggcgggcttgacctcggcgtactt 2268

                                                                        
Query: 301  gcnggtcttgagaccgcantcggngttcacccataggatgttggtgtcgagcacagngag 360
            || ||||||||||||||| |||| ||||||||| |||||||||||||||||||||| |||
Sbjct: 2267 gcgggtcttgagaccgcagtcggggttcacccagaggatgttggtgtcgagcacagcgag 2208

                                    
Query: 361  catcttgttgacgcggtcggcaat 384
            ||||||||||||||||||||||||
Sbjct: 2207 catcttgttgacgcggtcggcaat 2184



to top

>emb|AM039905.1| Hordeum vulgare mRNA for methionine synthase 2 enzyme (ms2 gene)
          Length = 2675

 Score =  157 bits (79), Expect = 3e-35
 Identities = 136/157 (86%)
 Strand = Plus / Minus

                                                                        
Query: 228  tggcgagctcggcgcggatctgcttggcggcctcgaccatgttggtgagggcggncttga 287
            ||||||||| || ||||||  ||||||| ||  |||||||||| || ||||||| ||| |
Sbjct: 2373 tggcgagctgggtgcggatgagcttggccgcagcgaccatgttagtcagggcgggcttca 2314

                                                                        
Query: 288  cctnggcgtacttgcnggtcttgagaccgcantcggngttcacccataggatgttggtgt 347
            ||| || |||||||| ||||||||| ||||| || | ||||||||| |||||||||||||
Sbjct: 2313 cctcggtgtacttgcgggtcttgaggccgcagtcagggttcacccagaggatgttggtgt 2254

                                                 
Query: 348  cgagcacagngagcatcttgttgacgcggtcggcaat 384
            ||||||| | |||||||||||||||||||||||||||
Sbjct: 2253 cgagcaccgcgagcatcttgttgacgcggtcggcaat 2217



to top

>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12, complete
                sequence
          Length = 27566993

 Score =  149 bits (75), Expect = 8e-33
 Identities = 135/157 (85%)
 Strand = Plus / Minus

                                                                            
Query: 228      tggcgagctcggcgcggatctgcttggcggcctcgaccatgttggtgagggcggncttga 287
                ||||||||| || ||||||  |||||||||||   ||||||||||| ||||||| |||||
Sbjct: 26684320 tggcgagctgggtgcggatgagcttggcggccgaaaccatgttggtaagggcgggcttga 26684261

                                                                            
Query: 288      cctnggcgtacttgcnggtcttgagaccgcantcggngttcacccataggatgttggtgt 347
                ||| |  |||||||| ||||||||||||||| || | ||||||||| || ||||| ||||
Sbjct: 26684260 cctcgttgtacttgcgggtcttgagaccgcagtcagggttcacccagagaatgttagtgt 26684201

                                                     
Query: 348      cgagcacagngagcatcttgttgacgcggtcggcaat 384
                ||||||| | ||||||||||||||||||||| |||||
Sbjct: 26684200 cgagcaccgcgagcatcttgttgacgcggtccgcaat 26684164



 Score =  129 bits (65), Expect = 7e-27
 Identities = 131/155 (84%)
 Strand = Plus / Minus

                                                                            
Query: 230      gcgagctcggcgcggatctgcttggcggcctcgaccatgttggtgagggcggncttgacc 289
                ||||||| || ||||||  |||||||||||   ||||||||||||||||| | ||| |||
Sbjct: 26696168 gcgagctgggtgcggatgagcttggcggccaaaaccatgttggtgagggcaggcttcacc 26696109

                                                                            
Query: 290      tnggcgtacttgcnggtcttgagaccgcantcggngttcacccataggatgttggtgtcg 349
                | || |||||||| ||||||||||||||| || | ||||||||| || ||||| ||||||
Sbjct: 26696108 tcggtgtacttgcgggtcttgagaccgcagtcagggttcacccagagaatgttagtgtcg 26696049

                                                   
Query: 350      agcacagngagcatcttgttgacgcggtcggcaat 384
                ||||| |  ||||||||||||| |||||| |||||
Sbjct: 26696048 agcaccgcaagcatcttgttgatgcggtccgcaat 26696014



to top

>dbj|AK099069.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013163D13, full
            insert sequence
          Length = 2640

 Score =  149 bits (75), Expect = 8e-33
 Identities = 135/157 (85%)
 Strand = Plus / Minus

                                                                        
Query: 228  tggcgagctcggcgcggatctgcttggcggcctcgaccatgttggtgagggcggncttga 287
            ||||||||| || ||||||  |||||||||||   ||||||||||| ||||||| |||||
Sbjct: 2357 tggcgagctgggtgcggatgagcttggcggccgaaaccatgttggtaagggcgggcttga 2298

                                                                        
Query: 288  cctnggcgtacttgcnggtcttgagaccgcantcggngttcacccataggatgttggtgt 347
            ||| |  |||||||| ||||||||||||||| || | ||||||||| || ||||| ||||
Sbjct: 2297 cctcgttgtacttgcgggtcttgagaccgcagtcagggttcacccagagaatgttagtgt 2238

                                                 
Query: 348  cgagcacagngagcatcttgttgacgcggtcggcaat 384
            ||||||| | ||||||||||||||||||||| |||||
Sbjct: 2237 cgagcaccgcgagcatcttgttgacgcggtccgcaat 2201



to top

>dbj|AK067958.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013128E22, full
            insert sequence
          Length = 2058

 Score =  149 bits (75), Expect = 8e-33
 Identities = 135/157 (85%)
 Strand = Plus / Minus

                                                                        
Query: 228  tggcgagctcggcgcggatctgcttggcggcctcgaccatgttggtgagggcggncttga 287
            ||||||||| || ||||||  |||||||||||   ||||||||||| ||||||| |||||
Sbjct: 1724 tggcgagctgggtgcggatgagcttggcggccgaaaccatgttggtaagggcgggcttga 1665

                                                                        
Query: 288  cctnggcgtacttgcnggtcttgagaccgcantcggngttcacccataggatgttggtgt 347
            ||| |  |||||||| ||||||||||||||| || | ||||||||| || ||||| ||||
Sbjct: 1664 cctcgttgtacttgcgggtcttgagaccgcagtcagggttcacccagagaatgttagtgt 1605

                                                 
Query: 348  cgagcacagngagcatcttgttgacgcggtcggcaat 384
            ||||||| | ||||||||||||||||||||| |||||
Sbjct: 1604 cgagcaccgcgagcatcttgttgacgcggtccgcaat 1568



to top

>dbj|AK065255.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013002J12, full
            insert sequence
          Length = 2668

 Score =  149 bits (75), Expect = 8e-33
 Identities = 135/157 (85%)
 Strand = Plus / Minus

                                                                        
Query: 228  tggcgagctcggcgcggatctgcttggcggcctcgaccatgttggtgagggcggncttga 287
            ||||||||| || ||||||  |||||||||||   ||||||||||| ||||||| |||||
Sbjct: 2356 tggcgagctgggtgcggatgagcttggcggccgaaaccatgttggtaagggcgggcttga 2297

                                                                        
Query: 288  cctnggcgtacttgcnggtcttgagaccgcantcggngttcacccataggatgttggtgt 347
            ||| |  |||||||| ||||||||||||||| || | ||||||||| || ||||| ||||
Sbjct: 2296 cctcgttgtacttgcgggtcttgagaccgcagtcagggttcacccagagaatgttagtgt 2237

                                                 
Query: 348  cgagcacagngagcatcttgttgacgcggtcggcaat 384
            ||||||| | ||||||||||||||||||||| |||||
Sbjct: 2236 cgagcaccgcgagcatcttgttgacgcggtccgcaat 2200



to top

>dbj|AK062198.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-046-G02, full
           insert sequence
          Length = 1064

 Score =  149 bits (75), Expect = 8e-33
 Identities = 135/157 (85%)
 Strand = Plus / Minus

                                                                       
Query: 228 tggcgagctcggcgcggatctgcttggcggcctcgaccatgttggtgagggcggncttga 287
           ||||||||| || ||||||  |||||||||||   ||||||||||| ||||||| |||||
Sbjct: 781 tggcgagctgggtgcggatgagcttggcggccgaaaccatgttggtaagggcgggcttga 722

                                                                       
Query: 288 cctnggcgtacttgcnggtcttgagaccgcantcggngttcacccataggatgttggtgt 347
           ||| |  |||||||| ||||||||||||||| || | ||||||||| || ||||| ||||
Sbjct: 721 cctcgttgtacttgcgggtcttgagaccgcagtcagggttcacccagagaatgttagtgt 662

                                                
Query: 348 cgagcacagngagcatcttgttgacgcggtcggcaat 384
           ||||||| | ||||||||||||||||||||| |||||
Sbjct: 661 cgagcaccgcgagcatcttgttgacgcggtccgcaat 625



to top

>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence
          Length = 27492551

 Score =  149 bits (75), Expect = 8e-33
 Identities = 135/157 (85%)
 Strand = Plus / Minus

                                                                            
Query: 228      tggcgagctcggcgcggatctgcttggcggcctcgaccatgttggtgagggcggncttga 287
                ||||||||| || ||||||  |||||||||||   ||||||||||| ||||||| |||||
Sbjct: 26612489 tggcgagctgggtgcggatgagcttggcggccgaaaccatgttggtaagggcgggcttga 26612430

                                                                            
Query: 288      cctnggcgtacttgcnggtcttgagaccgcantcggngttcacccataggatgttggtgt 347
                ||| |  |||||||| ||||||||||||||| || | ||||||||| || ||||| ||||
Sbjct: 26612429 cctcgttgtacttgcgggtcttgagaccgcagtcagggttcacccagagaatgttagtgt 26612370

                                                     
Query: 348      cgagcacagngagcatcttgttgacgcggtcggcaat 384
                ||||||| | ||||||||||||||||||||| |||||
Sbjct: 26612369 cgagcaccgcgagcatcttgttgacgcggtccgcaat 26612333



 Score =  129 bits (65), Expect = 7e-27
 Identities = 131/155 (84%)
 Strand = Plus / Minus

                                                                            
Query: 230      gcgagctcggcgcggatctgcttggcggcctcgaccatgttggtgagggcggncttgacc 289
                ||||||| || ||||||  |||||||||||   ||||||||||||||||| | ||| |||
Sbjct: 26624337 gcgagctgggtgcggatgagcttggcggccaaaaccatgttggtgagggcaggcttcacc 26624278

                                                                            
Query: 290      tnggcgtacttgcnggtcttgagaccgcantcggngttcacccataggatgttggtgtcg 349
                | || |||||||| ||||||||||||||| || | ||||||||| || ||||| ||||||
Sbjct: 26624277 tcggtgtacttgcgggtcttgagaccgcagtcagggttcacccagagaatgttagtgtcg 26624218

                                                   
Query: 350      agcacagngagcatcttgttgacgcggtcggcaat 384
                ||||| |  ||||||||||||| |||||| |||||
Sbjct: 26624217 agcaccgcaagcatcttgttgatgcggtccgcaat 26624183



to top

>emb|BX072547.2|CNS09S4Q Oryza sativa chromosome 12, . Partial sequence from BAC OSJNBb0090N22
            of library OSJNBb from chromosome 12 of cultivar
            Nipponbare of ssp. japonica of Oryza sativa (rice),
            complete sequence
          Length = 8623

 Score =  149 bits (75), Expect = 8e-33
 Identities = 135/157 (85%)
 Strand = Plus / Minus

                                                                        
Query: 228  tggcgagctcggcgcggatctgcttggcggcctcgaccatgttggtgagggcggncttga 287
            ||||||||| || ||||||  |||||||||||   ||||||||||| ||||||| |||||
Sbjct: 2904 tggcgagctgggtgcggatgagcttggcggccgaaaccatgttggtaagggcgggcttga 2845

                                                                        
Query: 288  cctnggcgtacttgcnggtcttgagaccgcantcggngttcacccataggatgttggtgt 347
            ||| |  |||||||| ||||||||||||||| || | ||||||||| || ||||| ||||
Sbjct: 2844 cctcgttgtacttgcgggtcttgagaccgcagtcagggttcacccagagaatgttagtgt 2785

                                                 
Query: 348  cgagcacagngagcatcttgttgacgcggtcggcaat 384
            ||||||| | ||||||||||||||||||||| |||||
Sbjct: 2784 cgagcaccgcgagcatcttgttgacgcggtccgcaat 2748



to top

>gb|BT009353.1| Triticum aestivum clone wlm96.pk0018.c10:fis, full insert mRNA
            sequence
          Length = 2634

 Score =  141 bits (71), Expect = 2e-30
 Identities = 134/157 (85%)
 Strand = Plus / Minus

                                                                        
Query: 228  tggcgagctcggcgcggatctgcttggcggcctcgaccatgttggtgagggcggncttga 287
            ||||||||| || ||||||  ||||||| ||  | ||||||||||| ||||||| ||| |
Sbjct: 2364 tggcgagctgggtgcggatgagcttggccgcggcaaccatgttggtcagggcgggcttca 2305

                                                                        
Query: 288  cctnggcgtacttgcnggtcttgagaccgcantcggngttcacccataggatgttggtgt 347
            |||  | |||||||| ||||||||| ||||| || | ||||||||| |||||||||||||
Sbjct: 2304 cctccgtgtacttgcgggtcttgaggccgcagtcagggttcacccacaggatgttggtgt 2245

                                                 
Query: 348  cgagcacagngagcatcttgttgacgcggtcggcaat 384
            |||| || | |||||||||||||||||||||||||||
Sbjct: 2244 cgaggaccgcgagcatcttgttgacgcggtcggcaat 2208



to top

>dbj|AK067726.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013116O11, full
            insert sequence
          Length = 2783

 Score =  129 bits (65), Expect = 7e-27
 Identities = 131/155 (84%)
 Strand = Plus / Minus

                                                                        
Query: 230  gcgagctcggcgcggatctgcttggcggcctcgaccatgttggtgagggcggncttgacc 289
            ||||||| || ||||||  |||||||||||   ||||||||||||||||| | ||| |||
Sbjct: 2474 gcgagctgggtgcggatgagcttggcggccaaaaccatgttggtgagggcaggcttcacc 2415

                                                                        
Query: 290  tnggcgtacttgcnggtcttgagaccgcantcggngttcacccataggatgttggtgtcg 349
            | || |||||||| ||||||||||||||| || | ||||||||| || ||||| ||||||
Sbjct: 2414 tcggtgtacttgcgggtcttgagaccgcagtcagggttcacccagagaatgttagtgtcg 2355

                                               
Query: 350  agcacagngagcatcttgttgacgcggtcggcaat 384
            ||||| |  ||||||||||||| |||||| |||||
Sbjct: 2354 agcaccgcaagcatcttgttgatgcggtccgcaat 2320



to top

>emb|AL731889.5|CNS08C8T Oryza sativa chromosome 12, . BAC OJ1122_G07 of library Monsanto from
             chromosome 12 of cultivar Nipponbare of ssp. japonica of
             Oryza sativa (rice), complete sequence
          Length = 83015

 Score =  129 bits (65), Expect = 7e-27
 Identities = 131/155 (84%)
 Strand = Plus / Plus

                                                                         
Query: 230   gcgagctcggcgcggatctgcttggcggcctcgaccatgttggtgagggcggncttgacc 289
             ||||||| || ||||||  |||||||||||   ||||||||||||||||| | ||| |||
Sbjct: 74959 gcgagctgggtgcggatgagcttggcggccaaaaccatgttggtgagggcaggcttcacc 75018

                                                                         
Query: 290   tnggcgtacttgcnggtcttgagaccgcantcggngttcacccataggatgttggtgtcg 349
             | || |||||||| ||||||||||||||| || | ||||||||| || ||||| ||||||
Sbjct: 75019 tcggtgtacttgcgggtcttgagaccgcagtcagggttcacccagagaatgttagtgtcg 75078

                                                
Query: 350   agcacagngagcatcttgttgacgcggtcggcaat 384
             ||||| |  ||||||||||||| |||||| |||||
Sbjct: 75079 agcaccgcaagcatcttgttgatgcggtccgcaat 75113



to top

>emb|BX000561.2|CNS08CE7 Oryza sativa chromosome 12, . BAC OJ1014_F06 of library Monsanto from
              chromosome 12 of cultivar Nipponbare of ssp. japonica of
              Oryza sativa (rice), complete sequence
          Length = 104849

 Score =  129 bits (65), Expect = 7e-27
 Identities = 131/155 (84%)
 Strand = Plus / Plus

                                                                          
Query: 230    gcgagctcggcgcggatctgcttggcggcctcgaccatgttggtgagggcggncttgacc 289
              ||||||| || ||||||  |||||||||||   ||||||||||||||||| | ||| |||
Sbjct: 102810 gcgagctgggtgcggatgagcttggcggccaaaaccatgttggtgagggcaggcttcacc 102869

                                                                          
Query: 290    tnggcgtacttgcnggtcttgagaccgcantcggngttcacccataggatgttggtgtcg 349
              | || |||||||| ||||||||||||||| || | ||||||||| || ||||| ||||||
Sbjct: 102870 tcggtgtacttgcgggtcttgagaccgcagtcagggttcacccagagaatgttagtgtcg 102929

                                                 
Query: 350    agcacagngagcatcttgttgacgcggtcggcaat 384
              ||||| |  ||||||||||||| |||||| |||||
Sbjct: 102930 agcaccgcaagcatcttgttgatgcggtccgcaat 102964



to top

>gb|AF466201.1| Sorghum bicolor clone SBTXS_0032H17 putative cytochrome P450-like
             protein, putative DNA-binding protein homolog,
             TATA-binding protein, hypothetical protein M3E9.200,
             3-glucanase, K-exchanger-like protein, small heat
             shock-like protein, methionine synthase protein, putative
             far-red impaired response protein, and putative vegetative
             storage protein genes, complete cds
          Length = 100773

 Score =  127 bits (64), Expect = 3e-26
 Identities = 106/122 (86%)
 Strand = Plus / Plus

                                                                         
Query: 263   accatgttggtgagggcggncttgacctnggcgtacttgcnggtcttgagaccgcantcg 322
             ||||||||||| ||||||| ||||||||  | ||||||||  ||||||||||| || || 
Sbjct: 72721 accatgttggtcagggcgggcttgacctccgtgtacttgcgtgtcttgagaccacagtcc 72780

                                                                         
Query: 323   gngttcacccataggatgttggtgtcgagcacagngagcatcttgttgacgcggtcggca 382
             | ||||||||| |||||||||||||| |||||||  |||||||||||||||||||| |||
Sbjct: 72781 gggttcacccagaggatgttggtgtcaagcacagcaagcatcttgttgacgcggtccgca 72840

               
Query: 383   at 384
             ||
Sbjct: 72841 at 72842



to top

>gb|AY109415.1| Zea mays CL598_2 mRNA sequence
          Length = 3017

 Score =  127 bits (64), Expect = 3e-26
 Identities = 130/154 (84%)
 Strand = Plus / Plus

                                                                       
Query: 228 tggcgagctcggcgcggatctgcttggcggcctcgaccatgttggtgagggcggncttga 287
           ||||||||| || ||||||  |||| |||||   |||||||||||| ||||||| |||||
Sbjct: 641 tggcgagctgggtgcggatgagcttagcggcggagaccatgttggtcagggcgggcttga 700

                                                                       
Query: 288 cctnggcgtacttgcnggtcttgagaccgcantcggngttcacccataggatgttggtgt 347
           |||  | |||||||| ||||||||| ||||| |||| ||||||||| |||||||||||||
Sbjct: 701 cctccgtgtacttgcgggtcttgaggccgcagtcggggttcacccagaggatgttggtgt 760

                                             
Query: 348 cgagcacagngagcatcttgttgacgcggtcggc 381
           | ||||| |  |||||||||| || |||||||||
Sbjct: 761 ccagcaccgccagcatcttgtcgatgcggtcggc 794



to top

>gb|AY111481.1| Zea mays CL598_4 mRNA sequence
          Length = 664

 Score =  125 bits (63), Expect = 1e-25
 Identities = 102/117 (87%)
 Strand = Plus / Plus

                                                                       
Query: 262 gaccatgttggtgagggcggncttgacctnggcgtacttgcnggtcttgagaccgcantc 321
           |||||||||||| ||||| | ||| ||||  | ||||||||  |||||||||||||| ||
Sbjct: 334 gaccatgttggtcagggcaggcttcacctccgtgtacttgcgtgtcttgagaccgcagtc 393

                                                                    
Query: 322 ggngttcacccataggatgttggtgtcgagcacagngagcatcttgttgacgcggtc 378
            | ||||||||| |||||||||||||||||||| | |||||||||||||||||||||
Sbjct: 394 agggttcacccagaggatgttggtgtcgagcacggcgagcatcttgttgacgcggtc 450



to top

>gb|AF439723.1|AF439723 Zea mays methionine synthase mRNA, partial cds
          Length = 2300

 Score =  123 bits (62), Expect = 4e-25
 Identities = 104/120 (86%)
 Strand = Plus / Minus

                                                                        
Query: 262  gaccatgttggtgagggcggncttgacctnggcgtacttgcnggtcttgagaccgcantc 321
            |||||||||||| ||||||| ||||||||  | |||||||| ||||||||| ||||| ||
Sbjct: 2256 gaccatgttggtcagggcgggcttgacctccgtgtacttgcgggtcttgaggccgcagtc 2197

                                                                        
Query: 322  ggngttcacccataggatgttggtgtcgagcacagngagcatcttgttgacgcggtcggc 381
            || ||||||||| |||||||||||||| ||||| |  |||||||||| || |||||||||
Sbjct: 2196 ggggttcacccagaggatgttggtgtccagcaccgccagcatcttgtcgatgcggtcggc 2137



to top

>dbj|AK067757.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013116H17, full
            insert sequence
          Length = 2627

 Score =  121 bits (61), Expect = 2e-24
 Identities = 130/155 (83%)
 Strand = Plus / Minus

                                                                        
Query: 230  gcgagctcggcgcggatctgcttggcggcctcgaccatgttggtgagggcggncttgacc 289
            ||||||| || ||||||  |||||||||||   ||||||||||||||||| | ||| |||
Sbjct: 2355 gcgagctgggtgcggatgagcttggcggccaaaaccatgttggtgagggcaggcttcacc 2296

                                                                        
Query: 290  tnggcgtacttgcnggtcttgagaccgcantcggngttcacccataggatgttggtgtcg 349
            |  | |||||||| ||||||||||||||| || | ||||||||| || ||||| ||||||
Sbjct: 2295 tctgtgtacttgcgggtcttgagaccgcagtcagggttcacccagagaatgttagtgtcg 2236

                                               
Query: 350  agcacagngagcatcttgttgacgcggtcggcaat 384
            ||||| |  ||||||||||||| |||||| |||||
Sbjct: 2235 agcaccgcaagcatcttgttgatgcggtccgcaat 2201



to top

>gb|AY104793.1| Zea mays PCO079166 mRNA sequence
          Length = 2720

 Score =  121 bits (61), Expect = 2e-24
 Identities = 127/151 (84%)
 Strand = Plus / Minus

                                                                        
Query: 228  tggcgagctcggcgcggatctgcttggcggcctcgaccatgttggtgagggcggncttga 287
            |||| |||| || ||||||  |||||| ||||  |||||||||||| ||||||| |||||
Sbjct: 2399 tggcaagctgggtgcggatgagcttggtggccgagaccatgttggtcagggcgggcttga 2340

                                                                        
Query: 288  cctnggcgtacttgcnggtcttgagaccgcantcggngttcacccataggatgttggtgt 347
            |||  | ||||||||  ||||||||||| || || | ||||||||| |||||||||||||
Sbjct: 2339 cctccgtgtacttgcgtgtcttgagaccacagtcagggttcacccagaggatgttggtgt 2280

                                           
Query: 348  cgagcacagngagcatcttgttgacgcggtc 378
            ||||||| | ||||||||| | |||||||||
Sbjct: 2279 cgagcacggcgagcatcttctcgacgcggtc 2249



to top

>gb|BT016781.1| Zea mays clone Contig614 mRNA sequence
          Length = 1759

 Score =  117 bits (59), Expect = 3e-23
 Identities = 101/117 (86%)
 Strand = Plus / Minus

                                                                        
Query: 262  gaccatgttggtgagggcggncttgacctnggcgtacttgcnggtcttgagaccgcantc 321
            |||||||||||| ||||| | ||| ||||  | ||||||||  |||||||||||||| ||
Sbjct: 1359 gaccatgttggtcagggcaggcttcacctccgtgtacttgcgtgtcttgagaccgcagtc 1300

                                                                     
Query: 322  ggngttcacccataggatgttggtgtcgagcacagngagcatcttgttgacgcggtc 378
             | ||||||||| |||||||||||||| ||||| | |||||||||||||||||||||
Sbjct: 1299 agggttcacccagaggatgttggtgtccagcacggcgagcatcttgttgacgcggtc 1243



to top

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 122/151 (80%)
 Strand = Plus / Minus

                                                                            
Query: 228      tggcgagctcggcgcggatctgcttggcggcctcgaccatgttggtgagggcggncttga 287
                |||| |||| || ||||||  ||||||| || || ||||||||||| || || |  || |
Sbjct: 25306437 tggcaagctgggtgcggatgagcttggcagcatctaccatgttggttagtgcaggtttca 25306378

                                                                            
Query: 288      cctnggcgtacttgcnggtcttgagaccgcantcggngttcacccataggatgttggtgt 347
                ||| || ||| |||| ||||||||||||||  || | ||||||| | |||||||||||||
Sbjct: 25306377 cctcggtgtatttgcgggtcttgagaccgcggtcagggttcacctagaggatgttggtgt 25306318

                                               
Query: 348      cgagcacagngagcatcttgttgacgcggtc 378
                | ||||| |  ||||||||||||| ||||||
Sbjct: 25306317 caagcacggcaagcatcttgttgatgcggtc 25306287



to top

>gb|AC133859.4| Oryza sativa chromosome 3 BAC OSJNBa0075A22 genomic sequence, complete
              sequence
          Length = 152828

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 122/151 (80%)
 Strand = Plus / Plus

                                                                          
Query: 228    tggcgagctcggcgcggatctgcttggcggcctcgaccatgttggtgagggcggncttga 287
              |||| |||| || ||||||  ||||||| || || ||||||||||| || || |  || |
Sbjct: 136923 tggcaagctgggtgcggatgagcttggcagcatctaccatgttggttagtgcaggtttca 136982

                                                                          
Query: 288    cctnggcgtacttgcnggtcttgagaccgcantcggngttcacccataggatgttggtgt 347
              ||| || ||| |||| ||||||||||||||  || | ||||||| | |||||||||||||
Sbjct: 136983 cctcggtgtatttgcgggtcttgagaccgcggtcagggttcacctagaggatgttggtgt 137042

                                             
Query: 348    cgagcacagngagcatcttgttgacgcggtc 378
              | ||||| |  ||||||||||||| ||||||
Sbjct: 137043 caagcacggcaagcatcttgttgatgcggtc 137073



to top

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
                sequence
          Length = 36192742

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 122/151 (80%)
 Strand = Plus / Minus

                                                                            
Query: 228      tggcgagctcggcgcggatctgcttggcggcctcgaccatgttggtgagggcggncttga 287
                |||| |||| || ||||||  ||||||| || || ||||||||||| || || |  || |
Sbjct: 25397746 tggcaagctgggtgcggatgagcttggcagcatctaccatgttggttagtgcaggtttca 25397687

                                                                            
Query: 288      cctnggcgtacttgcnggtcttgagaccgcantcggngttcacccataggatgttggtgt 347
                ||| || ||| |||| ||||||||||||||  || | ||||||| | |||||||||||||
Sbjct: 25397686 cctcggtgtatttgcgggtcttgagaccgcggtcagggttcacctagaggatgttggtgt 25397627

                                               
Query: 348      cgagcacagngagcatcttgttgacgcggtc 378
                | ||||| |  ||||||||||||| ||||||
Sbjct: 25397626 caagcacggcaagcatcttgttgatgcggtc 25397596



to top

>ref|XM_469072.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1149

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 77/92 (83%)
 Strand = Plus / Plus

                                                                        
Query: 287  acctnggcgtacttgcnggtcttgagaccgcantcggngttcacccataggatgttggtg 346
            |||| || ||| |||| ||||||||||||||  || | ||||||| | ||||||||||||
Sbjct: 944  acctcggtgtatttgcgggtcttgagaccgcggtcagggttcacctagaggatgttggtg 1003

                                            
Query: 347  tcgagcacagngagcatcttgttgacgcggtc 378
            || ||||| |  ||||||||||||| ||||||
Sbjct: 1004 tcaagcacggcaagcatcttgttgatgcggtc 1035



to top

>emb|X83499.1|CRMETS C.roseus MetE mRNA for methionine synthase
          Length = 2602

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 77/92 (83%)
 Strand = Plus / Minus

                                                                        
Query: 293  gcgtacttgcnggtcttgagaccgcantcggngttcacccataggatgttggtgtcgagc 352
            |||||||||| |||||||||||| || |||| ||| ||||| | |||||||||||| | |
Sbjct: 2272 gcgtacttgcgggtcttgagaccacagtcggggttaacccacaagatgttggtgtccaac 2213

                                            
Query: 353  acagngagcatcttgttgacgcggtcggcaat 384
            || |  |||||||||||||  | |||||||||
Sbjct: 2212 actgcaagcatcttgttgattctgtcggcaat 2181



to top

>gb|AF082893.1| Solanum tuberosum methionine synthase (MS) mRNA, complete cds
          Length = 2644

 Score = 65.9 bits (33), Expect = 9e-08
 Identities = 78/95 (82%)
 Strand = Plus / Minus

                                                                        
Query: 275  agggcggncttgacctnggcgtacttgcnggtcttgagaccgcantcggngttcacccat 334
            ||||| | ||| |||| || ||||||||  ||||||||||| || || | ||||||||||
Sbjct: 2296 agggctggcttcacctcggtgtacttgcgagtcttgagaccacagtcagggttcacccat 2237

                                               
Query: 335  aggatgttggtgtcgagcacagngagcatcttgtt 369
            | |||||||||||| || || |  |||||||||||
Sbjct: 2236 aagatgttggtgtcaagaactgcaagcatcttgtt 2202



to top

>gb|AF096261.1|AF096261 Lycopersicon esculentum ethylene-responsive methionine synthase
           (ER69) mRNA, partial cds
          Length = 206

 Score = 65.9 bits (33), Expect = 9e-08
 Identities = 78/95 (82%)
 Strand = Plus / Minus

                                                                       
Query: 275 agggcggncttgacctnggcgtacttgcnggtcttgagaccgcantcggngttcacccat 334
           ||||| | ||| |||| || ||||||||  ||||||||||| || |||| ||||||||| 
Sbjct: 171 agggctggcttcacctcggtgtacttgcgagtcttgagaccacagtcggggttcacccac 112

                                              
Query: 335 aggatgttggtgtcgagcacagngagcatcttgtt 369
           | |||||||||||| || || |  |||||||||||
Sbjct: 111 aagatgttggtgtcaaggactgcaagcatcttgtt 77



to top

>gb|AF220054.1|AF220054 Coffea arabica methionine synthase mRNA, partial cds
          Length = 680

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 113/142 (79%)
 Strand = Plus / Minus

                                                                       
Query: 228 tggcgagctcggcgcggatctgcttggcggcctcgaccatgttggtgagggcggncttga 287
           |||| |||| || |||||| |||||||||||  | ||||||||   |||||| | ||| |
Sbjct: 646 tggcaagctgggtgcggatttgcttggcggcggcaaccatgttttggagggccggcttca 587

                                                                       
Query: 288 cctnggcgtacttgcnggtcttgagaccgcantcggngttcacccataggatgttggtgt 347
           |||  |||||||||| |||||||||||| || || | ||| ||||| | |||||| || |
Sbjct: 586 cctcagcgtacttgcgggtcttgagaccacaatcagggttgacccacaagatgttcgtat 527

                                 
Query: 348 cgagcacagngagcatcttgtt 369
           | ||||| |  |||||||||||
Sbjct: 526 ccagcactgcaagcatcttgtt 505



to top

>emb|Z49150.1|CBKPMETGN C.blumei kinetoplast met gene for cobalamine-independent methionine
            synthase
          Length = 2795

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 66/79 (83%)
 Strand = Plus / Minus

                                                                        
Query: 293  gcgtacttgcnggtcttgagaccgcantcggngttcacccataggatgttggtgtcgagc 352
            ||||| |||| |||||||||||| || || | ||||||||| | ||||||||| || || 
Sbjct: 2400 gcgtatttgcgggtcttgagaccacagtcagggttcacccacaagatgttggtttcaagg 2341

                               
Query: 353  acagngagcatcttgttga 371
            ||||  |||||||||||||
Sbjct: 2340 acagcaagcatcttgttga 2322



to top

>ref|NM_121798.2| Arabidopsis thaliana ATCIMS (COBALAMIN-INDEPENDENT METHIONINE
            SYNTHASE);
            5-methyltetrahydropteroyltriglutamate-homocysteine
            S-methyltransferase AT5G17920 (ATCIMS) mRNA, complete cds
          Length = 2682

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 92/115 (80%)
 Strand = Plus / Minus

                                                                        
Query: 228  tggcgagctcggcgcggatctgcttggcggcctcgaccatgttggtgagggcggncttga 287
            ||||||||| || ||||||  |||| || || || ||||||||  |||| || | |||||
Sbjct: 2379 tggcgagctgggagcggatgagcttagccgcatcaaccatgttcttgagtgcaggcttga 2320

                                                                   
Query: 288  cctnggcgtacttgcnggtcttgagaccgcantcggngttcacccataggatgtt 342
            ||| || |||||| | |||||||||||| || || | ||| ||||| ||||||||
Sbjct: 2319 cctcggtgtacttacgggtcttgagaccacagtcagggttaacccaaaggatgtt 2265



to top

>gb|BT000691.1| Arabidopsis thaliana clone RAFL08-16-E05 (R11047) putative
            5-methyltetrahydropteroyltriglutamate--homocysteine
            S-methyltransferase (At5g17920) mRNA, complete cds
          Length = 2585

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 92/115 (80%)
 Strand = Plus / Minus

                                                                        
Query: 228  tggcgagctcggcgcggatctgcttggcggcctcgaccatgttggtgagggcggncttga 287
            ||||||||| || ||||||  |||| || || || ||||||||  |||| || | |||||
Sbjct: 2372 tggcgagctgggagcggatgagcttagccgcatcaaccatgttcttgagtgcaggcttga 2313

                                                                   
Query: 288  cctnggcgtacttgcnggtcttgagaccgcantcggngttcacccataggatgtt 342
            ||| || |||||| | |||||||||||| || || | ||| ||||| ||||||||
Sbjct: 2312 cctcggtgtacttacgggtcttgagaccacagtcagggttaacccaaaggatgtt 2258



to top

>gb|AY091692.1| Arabidopsis thaliana AT5g17920/MPI7_60 mRNA, complete cds
          Length = 2298

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 92/115 (80%)
 Strand = Plus / Minus

                                                                        
Query: 228  tggcgagctcggcgcggatctgcttggcggcctcgaccatgttggtgagggcggncttga 287
            ||||||||| || ||||||  |||| || || || ||||||||  |||| || | |||||
Sbjct: 2287 tggcgagctgggagcggatgagcttagccgcatcaaccatgttcttgagtgcaggcttga 2228

                                                                   
Query: 288  cctnggcgtacttgcnggtcttgagaccgcantcggngttcacccataggatgtt 342
            ||| || |||||| | |||||||||||| || || | ||| ||||| ||||||||
Sbjct: 2227 cctcggtgtacttacgggtcttgagaccacagtcagggttaacccaaaggatgtt 2173



to top

>gb|AY070771.1| Arabidopsis thaliana AT5g17920/MPI7_60 mRNA, complete cds
          Length = 2648

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 92/115 (80%)
 Strand = Plus / Minus

                                                                        
Query: 228  tggcgagctcggcgcggatctgcttggcggcctcgaccatgttggtgagggcggncttga 287
            ||||||||| || ||||||  |||| || || || ||||||||  |||| || | |||||
Sbjct: 2369 tggcgagctgggagcggatgagcttagccgcatcaaccatgttcttgagtgcaggcttga 2310

                                                                   
Query: 288  cctnggcgtacttgcnggtcttgagaccgcantcggngttcacccataggatgtt 342
            ||| || |||||| | |||||||||||| || || | ||| ||||| ||||||||
Sbjct: 2309 cctcggtgtacttacgggtcttgagaccacagtcagggttaacccaaaggatgtt 2255



to top

>gb|AY069876.1| Arabidopsis thaliana AT5g17920/MPI7_60 mRNA, complete cds
          Length = 2594

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 92/115 (80%)
 Strand = Plus / Minus

                                                                        
Query: 228  tggcgagctcggcgcggatctgcttggcggcctcgaccatgttggtgagggcggncttga 287
            ||||||||| || ||||||  |||| || || || ||||||||  |||| || | |||||
Sbjct: 2369 tggcgagctgggagcggatgagcttagccgcatcaaccatgttcttgagtgcaggcttga 2310

                                                                   
Query: 288  cctnggcgtacttgcnggtcttgagaccgcantcggngttcacccataggatgtt 342
            ||| || |||||| | |||||||||||| || || | ||| ||||| ||||||||
Sbjct: 2309 cctcggtgtacttacgggtcttgagaccacagtcagggttaacccaaaggatgtt 2255



to top

>emb|AJ608673.1| Arabidopsis thaliana mRNA for cobalamin-independent methionine
            synthase (atms1 gene)
          Length = 2326

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 92/115 (80%)
 Strand = Plus / Minus

                                                                        
Query: 228  tggcgagctcggcgcggatctgcttggcggcctcgaccatgttggtgagggcggncttga 287
            ||||||||| || ||||||  |||| || || || ||||||||  |||| || | |||||
Sbjct: 2292 tggcgagctgggagcggatgagcttagccgcatcaaccatgttcttgagcgcaggcttga 2233

                                                                   
Query: 288  cctnggcgtacttgcnggtcttgagaccgcantcggngttcacccataggatgtt 342
            ||| || |||||| | |||||||||||| || || | ||| ||||| ||||||||
Sbjct: 2232 cctcggtgtacttacgggtcttgagaccacagtcagggttaacccaaaggatgtt 2178



to top

>gb|AY057499.1| Arabidopsis thaliana AT5g17920/MPI7_60 mRNA, complete cds
          Length = 2613

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 92/115 (80%)
 Strand = Plus / Minus

                                                                        
Query: 228  tggcgagctcggcgcggatctgcttggcggcctcgaccatgttggtgagggcggncttga 287
            ||||||||| || ||||||  |||| || || || ||||||||  |||| || | |||||
Sbjct: 2369 tggcgagctgggagcggatgagcttagccgcatcaaccatgttcttgagtgcaggcttga 2310

                                                                   
Query: 288  cctnggcgtacttgcnggtcttgagaccgcantcggngttcacccataggatgtt 342
            ||| || |||||| | |||||||||||| || || | ||| ||||| ||||||||
Sbjct: 2309 cctcggtgtacttacgggtcttgagaccacagtcagggttaacccaaaggatgtt 2255



to top

>gb|AY057478.1| Arabidopsis thaliana AT5g17920/MPI7_60 mRNA, complete cds
          Length = 2608

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 92/115 (80%)
 Strand = Plus / Minus

                                                                        
Query: 228  tggcgagctcggcgcggatctgcttggcggcctcgaccatgttggtgagggcggncttga 287
            ||||||||| || ||||||  |||| || || || ||||||||  |||| || | |||||
Sbjct: 2369 tggcgagctgggagcggatgagcttagccgcatcaaccatgttcttgagtgcaggcttga 2310

                                                                   
Query: 288  cctnggcgtacttgcnggtcttgagaccgcantcggngttcacccataggatgtt 342
            ||| || |||||| | |||||||||||| || || | ||| ||||| ||||||||
Sbjct: 2309 cctcggtgtacttacgggtcttgagaccacagtcagggttaacccaaaggatgtt 2255



to top

>gb|AY056098.1| Arabidopsis thaliana AT5g17920/MPI7_60 mRNA, complete cds
          Length = 2460

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 92/115 (80%)
 Strand = Plus / Minus

                                                                        
Query: 228  tggcgagctcggcgcggatctgcttggcggcctcgaccatgttggtgagggcggncttga 287
            ||||||||| || ||||||  |||| || || || ||||||||  |||| || | |||||
Sbjct: 2369 tggcgagctgggagcggatgagcttagccgcatcaaccatgttcttgagtgcaggcttga 2310

                                                                   
Query: 288  cctnggcgtacttgcnggtcttgagaccgcantcggngttcacccataggatgtt 342
            ||| || |||||| | |||||||||||| || || | ||| ||||| ||||||||
Sbjct: 2309 cctcggtgtacttacgggtcttgagaccacagtcagggttaacccaaaggatgtt 2255



to top

>dbj|AK222123.1| Arabidopsis thaliana mRNA for
            5-methyltetrahydropteroyltriglutamate--homocysteine
            S-methyltransferase, complete cds, clone: RAFL22-94-C14
          Length = 1684

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 92/115 (80%)
 Strand = Plus / Minus

                                                                        
Query: 228  tggcgagctcggcgcggatctgcttggcggcctcgaccatgttggtgagggcggncttga 287
            ||||||||| || ||||||  |||| || || || ||||||||  |||| || | |||||
Sbjct: 1397 tggcgagctgggagcggatgagcttagccgcatcaaccatgttcttgagtgcaggcttga 1338

                                                                   
Query: 288  cctnggcgtacttgcnggtcttgagaccgcantcggngttcacccataggatgtt 342
            ||| || |||||| | |||||||||||| || || | ||| ||||| ||||||||
Sbjct: 1337 cctcggtgtacttacgggtcttgagaccacagtcagggttaacccaaaggatgtt 1283



to top

>gb|AY048201.1| Arabidopsis thaliana AT5g17920/MPI7_60 mRNA, complete cds
          Length = 2549

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 92/115 (80%)
 Strand = Plus / Minus

                                                                        
Query: 228  tggcgagctcggcgcggatctgcttggcggcctcgaccatgttggtgagggcggncttga 287
            ||||||||| || ||||||  |||| || || || ||||||||  |||| || | |||||
Sbjct: 2369 tggcgagctgggagcggatgagcttagccgcatcaaccatgttcttgagtgcaggcttga 2310

                                                                   
Query: 288  cctnggcgtacttgcnggtcttgagaccgcantcggngttcacccataggatgtt 342
            ||| || |||||| | |||||||||||| || || | ||| ||||| ||||||||
Sbjct: 2309 cctcggtgtacttacgggtcttgagaccacagtcagggttaacccaaaggatgtt 2255



to top

>gb|AF370522.1|AF370522 Arabidopsis thaliana cobalamin-independent methionine synthase
            (MPI7.9) mRNA, complete cds
          Length = 2646

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 92/115 (80%)
 Strand = Plus / Minus

                                                                        
Query: 228  tggcgagctcggcgcggatctgcttggcggcctcgaccatgttggtgagggcggncttga 287
            ||||||||| || ||||||  |||| || || || ||||||||  |||| || | |||||
Sbjct: 2369 tggcgagctgggagcggatgagcttagccgcatcaaccatgttcttgagtgcaggcttga 2310

                                                                   
Query: 288  cctnggcgtacttgcnggtcttgagaccgcantcggngttcacccataggatgtt 342
            ||| || |||||| | |||||||||||| || || | ||| ||||| ||||||||
Sbjct: 2309 cctcggtgtacttacgggtcttgagaccacagtcagggttaacccaaaggatgtt 2255



to top

>emb|BX831470.1|CNS0A1W8 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS94ZC02 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1156

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 92/115 (80%)
 Strand = Plus / Minus

                                                                       
Query: 228 tggcgagctcggcgcggatctgcttggcggcctcgaccatgttggtgagggcggncttga 287
           ||||||||| || ||||||  |||| || || || ||||||||  |||| || | |||||
Sbjct: 917 tggcgagctgggagcggatgagcttagccgcatcaaccatgttcttgagtgcaggcttga 858

                                                                  
Query: 288 cctnggcgtacttgcnggtcttgagaccgcantcggngttcacccataggatgtt 342
           ||| || |||||| | |||||||||||| || || | ||| ||||| ||||||||
Sbjct: 857 cctcggtgtacttacgggtcttgagaccacagtcagggttaacccaaaggatgtt 803



to top

>emb|BX833585.1|CNS09Z4M Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL64ZC05 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 601

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 92/115 (80%)
 Strand = Plus / Minus

                                                                       
Query: 228 tggcgagctcggcgcggatctgcttggcggcctcgaccatgttggtgagggcggncttga 287
           ||||||||| || ||||||  |||| || || || ||||||||  |||| || | |||||
Sbjct: 319 tggcgagctgggagcggatgagcttagccgcatcaaccatgttcttgagtgcaggcttga 260

                                                                  
Query: 288 cctnggcgtacttgcnggtcttgagaccgcantcggngttcacccataggatgtt 342
           ||| || |||||| | |||||||||||| || || | ||| ||||| ||||||||
Sbjct: 259 cctcggtgtacttacgggtcttgagaccacagtcagggttaacccaaaggatgtt 205



to top

>dbj|AB011480.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MPI7
          Length = 40548

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 92/115 (80%)
 Strand = Plus / Minus

                                                                         
Query: 228   tggcgagctcggcgcggatctgcttggcggcctcgaccatgttggtgagggcggncttga 287
             ||||||||| || ||||||  |||| || || || ||||||||  |||| || | |||||
Sbjct: 39733 tggcgagctgggagcggatgagcttagccgcatcaaccatgttcttgagtgcaggcttga 39674

                                                                    
Query: 288   cctnggcgtacttgcnggtcttgagaccgcantcggngttcacccataggatgtt 342
             ||| || |||||| | |||||||||||| || || | ||| ||||| ||||||||
Sbjct: 39673 cctcggtgtacttacgggtcttgagaccacagtcagggttaacccaaaggatgtt 39619



to top

>gb|U97200.1|ATU97200 Arabidopsis thaliana cobalamin-independent methionine synthase
            (ATCIMS) mRNA, complete cds
          Length = 2595

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 92/115 (80%)
 Strand = Plus / Minus

                                                                        
Query: 228  tggcgagctcggcgcggatctgcttggcggcctcgaccatgttggtgagggcggncttga 287
            ||||||||| || ||||||  |||| || || || ||||||||  |||| || | |||||
Sbjct: 2295 tggcgagctgggagcggatgagcttagccgcatcaaccatgttcttgagtgcaggcttga 2236

                                                                   
Query: 288  cctnggcgtacttgcnggtcttgagaccgcantcggngttcacccataggatgtt 342
            ||| || |||||| | |||||||||||| || || | ||| ||||| ||||||||
Sbjct: 2235 cctcggtgtacttacgggtcttgagaccacagtcagggttaacccaaaggatgtt 2181



to top

>gb|AF518566.1| Glycine max methionine synthase mRNA, complete cds
          Length = 2695

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 87/109 (79%)
 Strand = Plus / Minus

                                                                        
Query: 263  accatgttggtgagggcggncttgacctnggcgtacttgcnggtcttgagaccgcantcg 322
            |||||||| |||||||| | ||| ||||  | |||||| | ||||||||| || || || 
Sbjct: 2326 accatgtttgtgagggctggcttcacctcagtgtacttacgggtcttgagcccacagtca 2267

                                                             
Query: 323  gngttcacccataggatgttggtgtcgagcacagngagcatcttgttga 371
            | ||||||||| | ||||||  | |||||||| |  |||||||||||||
Sbjct: 2266 gggttcacccacaagatgttcttctcgagcactgccagcatcttgttga 2218



to top

>emb|AM158915.1| Plantago major partial mRNA for methionine synthase (met1 gene)
          Length = 772

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 55/66 (83%)
 Strand = Plus / Minus

                                                                       
Query: 304 ggtcttgagaccgcantcggngttcacccataggatgttggtgtcgagcacagngagcat 363
           |||||| ||||| || || | ||| |||||||| |||||||| |||||||| |  |||||
Sbjct: 400 ggtcttcagaccacagtcagggttgacccatagaatgttggtctcgagcacggcaagcat 341

                 
Query: 364 cttgtt 369
           ||||||
Sbjct: 340 cttgtt 335



to top

>gb|BT012108.1| Arabidopsis thaliana At5g17920 mRNA sequence
          Length = 2295

 Score = 48.1 bits (24), Expect = 0.021
 Identities = 91/115 (79%)
 Strand = Plus / Minus

                                                                        
Query: 228  tggcgagctcggcgcggatctgcttggcggcctcgaccatgttggtgagggcggncttga 287
            ||||||||| || ||||||  |||| || || || ||||||||  |||| || | |||| 
Sbjct: 2284 tggcgagctgggagcggatgagcttagccgcatcaaccatgttcttgagtgcaggcttgg 2225

                                                                   
Query: 288  cctnggcgtacttgcnggtcttgagaccgcantcggngttcacccataggatgtt 342
            ||| || |||||| | |||||||||||| || || | ||| ||||| ||||||||
Sbjct: 2224 cctcggtgtacttacgggtcttgagaccacagtcagggttaacccaaaggatgtt 2170



to top

>gb|AE017285.1| Desulfovibrio vulgaris subsp. vulgaris str. Hildenborough, complete genome
          Length = 3570858

 Score = 48.1 bits (24), Expect = 0.021
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                           
Query: 254     gcggcctcgaccatgttggtgagggcgg 281
               ||||||||||||||||||| ||||||||
Sbjct: 3542128 gcggcctcgaccatgttggcgagggcgg 3542155



to top

>ref|XM_952059.1| Neurospora crassa OR74A hypothetical protein (NCU06512.1) partial
            mRNA
          Length = 2310

 Score = 46.1 bits (23), Expect = 0.083
 Identities = 63/78 (80%)
 Strand = Plus / Minus

                                                                        
Query: 250  cttggcggcctcgaccatgttggtgagggcggncttgacctnggcgtacttgcnggtctt 309
            |||||||||||| ||||||| || ||||||   ||||||||   |  |||||| ||||||
Sbjct: 2277 cttggcggcctcaaccatgtgggagagggcacccttgacctcatcccacttgcgggtctt 2218

                              
Query: 310  gagaccgcantcggngtt 327
             |||||||| |||| |||
Sbjct: 2217 aagaccgcagtcggggtt 2200



to top

>ref|XM_326366.1| Neurospora crassa OR74A hypothetical protein (NCU06512.1) partial
            mRNA
          Length = 2310

 Score = 46.1 bits (23), Expect = 0.083
 Identities = 63/78 (80%)
 Strand = Plus / Minus

                                                                        
Query: 250  cttggcggcctcgaccatgttggtgagggcggncttgacctnggcgtacttgcnggtctt 309
            |||||||||||| ||||||| || ||||||   ||||||||   |  |||||| ||||||
Sbjct: 2277 cttggcggcctcaaccatgtgggagagggcacccttgacctcatcccacttgcgggtctt 2218

                              
Query: 310  gagaccgcantcggngtt 327
             |||||||| |||| |||
Sbjct: 2217 aagaccgcagtcggggtt 2200



to top

>gb|AF404820.1|AF404820 Neurospora crassa methionine synthase (met-8) gene, complete cds
          Length = 3269

 Score = 46.1 bits (23), Expect = 0.083
 Identities = 63/78 (80%)
 Strand = Plus / Minus

                                                                        
Query: 250  cttggcggcctcgaccatgttggtgagggcggncttgacctnggcgtacttgcnggtctt 309
            |||||||||||| ||||||| || ||||||   ||||||||   |  |||||| ||||||
Sbjct: 2643 cttggcggcctcaaccatgtgggagagggcacccttgacctcatcccacttgcgggtctt 2584

                              
Query: 310  gagaccgcantcggngtt 327
             |||||||| |||| |||
Sbjct: 2583 aagaccgcagtcggggtt 2566



to top

>dbj|AK221003.1| Arabidopsis thaliana mRNA for hypothetical protein, complete cds,
           clone: RAFL22-65-M04
          Length = 390

 Score = 46.1 bits (23), Expect = 0.083
 Identities = 71/88 (80%)
 Strand = Plus / Minus

                                                                       
Query: 228 tggcgagctcggcgcggatctgcttggcggcctcgaccatgttggtgagggcggncttga 287
           ||||||||| || ||||||  |||| || || || ||||||||  |||| || | |||||
Sbjct: 103 tggcgagctgggagcggatgagcttagccgcatcaaccatgttcttgagtgcaggcttga 44

                                       
Query: 288 cctnggcgtacttgcnggtcttgagacc 315
           ||| || |||||| | ||||||||||||
Sbjct: 43  cctcggtgtacttacgggtcttgagacc 16



to top

>ref|NM_208514.1| Eremothecium gossypii ABR212Cp (ABR212C), mRNA
          Length = 2307

 Score = 46.1 bits (23), Expect = 0.083
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                           
Query: 248  tgcttggcggcctcgaccatgttggtgaggg 278
            ||||||||||| ||||||||||| |||||||
Sbjct: 2276 tgcttggcggcttcgaccatgtttgtgaggg 2246



to top

>gb|U84889.1|MCU84889 Mesembryanthemum crystallinum methionine synthase (MetE) mRNA,
            complete cds
          Length = 2734

 Score = 46.1 bits (23), Expect = 0.083
 Identities = 35/40 (87%)
 Strand = Plus / Minus

                                                    
Query: 294  cgtacttgcnggtcttgagaccgcantcggngttcaccca 333
            ||||||| | |||||||||||| || |||| |||||||||
Sbjct: 2341 cgtacttacgggtcttgagaccacagtcggggttcaccca 2302



to top

>gb|AE016815.2| Ashbya gossypii (= Eremothecium gossypii) ATCC 10895 chromosome II,
              complete sequence
          Length = 867699

 Score = 46.1 bits (23), Expect = 0.083
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                             
Query: 248    tgcttggcggcctcgaccatgttggtgaggg 278
              ||||||||||| ||||||||||| |||||||
Sbjct: 802422 tgcttggcggcttcgaccatgtttgtgaggg 802452



to top

>dbj|AK107388.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-127-C09, full
            insert sequence
          Length = 2566

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                 
Query: 250  cttggcggcctcgaccatgttggtgagggcggncttg 286
            ||||||||| | ||||| |||||||||||||| ||||
Sbjct: 2337 cttggcggcgttgaccaagttggtgagggcggtcttg 2301



to top

>gb|CP000010.1| Burkholderia mallei ATCC 23344 chromosome 1, complete sequence
          Length = 3510148

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 245    atctgcttggcggcctcgacc 265
              |||||||||||||||||||||
Sbjct: 428585 atctgcttggcggcctcgacc 428565



to top

>gb|CP000124.1| Burkholderia pseudomallei 1710b chromosome I, complete sequence
          Length = 4126292

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 245     atctgcttggcggcctcgacc 265
               |||||||||||||||||||||
Sbjct: 3276151 atctgcttggcggcctcgacc 3276131



to top

>gb|AC146417.3| Pan troglodytes BAC clone RP43-29B12 from 7, complete sequence
          Length = 196843

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 127    ccagattattcaaagtaaaac 147
              |||||||||||||||||||||
Sbjct: 160771 ccagattattcaaagtaaaac 160791



to top

>emb|AL390766.16| Human DNA sequence from clone RP13-348N17 on chromosome 10 Contains part
              of the PARD3 gene for par-3 partitioning defective 3
              homolog (C.elegans), complete sequence
          Length = 193131

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 127    ccagattattcaaagtaaaac 147
              |||||||||||||||||||||
Sbjct: 157149 ccagattattcaaagtaaaac 157169



to top

>emb|BX571965.1| Burkholderia pseudomallei strain K96243, chromosome 1, complete sequence
          Length = 4074542

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 245     atctgcttggcggcctcgacc 265
               |||||||||||||||||||||
Sbjct: 3007326 atctgcttggcggcctcgacc 3007306



to top

>gb|AE005950.1| Caulobacter crescentus CB15 section 276 of 359 of the complete genome
          Length = 12754

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 238  ggcgcggatctgcttggcggcctcg 262
            ||||||||||| |||||||||||||
Sbjct: 7030 ggcgcggatctccttggcggcctcg 7006



to top

>dbj|AP007255.1| Magnetospirillum magneticum AMB-1 DNA, complete genome
          Length = 4967148

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                        
Query: 244     gatctgcttggcggcctcgaccatg 268
               ||||||||||||||| |||||||||
Sbjct: 4608560 gatctgcttggcggcttcgaccatg 4608536



to top

>gb|AE016958.1| Mycobacterium avium subsp. paratuberculosis str. k10, complete genome
          Length = 4829781

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 223    cgccttggcgagctcggcgcg 243
              |||||||||||||||||||||
Sbjct: 384455 cgccttggcgagctcggcgcg 384475



to top

>emb|BX640448.1| Bordetella bronchiseptica strain RB50, complete genome; segment 12/16
          Length = 347137

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 223   cgccttggcgagctcggcgcggat 246
             ||||||||||||||||| ||||||
Sbjct: 61299 cgccttggcgagctcggggcggat 61276



to top

>emb|BX640432.1| Bordetella parapertussis strain 12822, complete genome; segment 10/14
          Length = 346301

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 223    cgccttggcgagctcggcgcggat 246
              ||||||||||||||||| ||||||
Sbjct: 344059 cgccttggcgagctcggggcggat 344036



to top

>emb|BX640414.1| Bordetella pertussis strain Tohama I, complete genome; segment 4/12
          Length = 343243

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 223    cgccttggcgagctcggcgcggat 246
              ||||||||||||||||| ||||||
Sbjct: 134631 cgccttggcgagctcggggcggat 134654



to top

>gb|CP000133.1| Rhizobium etli CFN 42, complete genome
          Length = 4381608

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 250    cttggcggcctcgaccatgt 269
              ||||||||||||||||||||
Sbjct: 528455 cttggcggcctcgaccatgt 528436



to top

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 1        atgaacaattcgccactcaa 20
                ||||||||||||||||||||
Sbjct: 41912770 atgaacaattcgccactcaa 41912751



to top

>dbj|AP003683.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0431G06
          Length = 140466

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 1     atgaacaattcgccactcaa 20
             ||||||||||||||||||||
Sbjct: 14847 atgaacaattcgccactcaa 14828


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,812,675
Number of Sequences: 3902068
Number of extensions: 1812675
Number of successful extensions: 30466
Number of sequences better than 10.0: 72
Number of HSP's better than 10.0 without gapping: 69
Number of HSP's successfully gapped in prelim test: 3
Number of HSP's that attempted gapping in prelim test: 29998
Number of HSP's gapped (non-prelim): 469
length of query: 384
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 362
effective length of database: 17,147,199,772
effective search space: 6207286317464
effective search space used: 6207286317464
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top