>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete
                sequence
          Length = 30731886

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 133/163 (81%), Gaps = 1/163 (0%)
 Strand = Plus / Minus

                                                                            
Query: 217      tttgaagaagagtatggcgtnccagaactcctccacgttgacgtttttctttcggcactc 276
                ||||||||| |||||||| | |||||| ||||||||||| |  |||||||| ||||| ||
Sbjct: 27764374 tttgaagaacagtatggcatcccagaattcctccacgttaatatttttcttccggcattc 27764315

                                                                            
Query: 277      ctcgaaggcttcacaccgtttcgactttgtgcgaaaacggagatgagcatatataccgtg 336
                 || || ||||||||  | ||| ||| | || || || ||||||| ||| || ||||| |
Sbjct: 27764314 ttcaaaagcttcacat-gcttcaactctatgtgagaatggagatgggcagatgtaccggg 27764256

                                                           
Query: 337      ttgtgtcgatcgggtgagcttcgatctcgttgaaagataaatc 379
                |||||||||| ||||||| | | ||||||||| ||||||||||
Sbjct: 27764255 ttgtgtcgattgggtgagttccaatctcgttgcaagataaatc 27764213

>dbj|AP004989.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC
              clone:B1153E06
          Length = 174588

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 133/163 (81%), Gaps = 1/163 (0%)
 Strand = Plus / Minus

                                                                          
Query: 217    tttgaagaagagtatggcgtnccagaactcctccacgttgacgtttttctttcggcactc 276
              ||||||||| |||||||| | |||||| ||||||||||| |  |||||||| ||||| ||
Sbjct: 113629 tttgaagaacagtatggcatcccagaattcctccacgttaatatttttcttccggcattc 113570

                                                                          
Query: 277    ctcgaaggcttcacaccgtttcgactttgtgcgaaaacggagatgagcatatataccgtg 336
               || || ||||||||  | ||| ||| | || || || ||||||| ||| || ||||| |
Sbjct: 113569 ttcaaaagcttcacat-gcttcaactctatgtgagaatggagatgggcagatgtaccggg 113511

                                                         
Query: 337    ttgtgtcgatcgggtgagcttcgatctcgttgaaagataaatc 379
              |||||||||| ||||||| | | ||||||||| ||||||||||
Sbjct: 113510 ttgtgtcgattgggtgagttccaatctcgttgcaagataaatc 113468

>dbj|AP003728.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC
             clone:P0710B08
          Length = 186991

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 133/163 (81%), Gaps = 1/163 (0%)
 Strand = Plus / Minus

                                                                         
Query: 217   tttgaagaagagtatggcgtnccagaactcctccacgttgacgtttttctttcggcactc 276
             ||||||||| |||||||| | |||||| ||||||||||| |  |||||||| ||||| ||
Sbjct: 66883 tttgaagaacagtatggcatcccagaattcctccacgttaatatttttcttccggcattc 66824

                                                                         
Query: 277   ctcgaaggcttcacaccgtttcgactttgtgcgaaaacggagatgagcatatataccgtg 336
              || || ||||||||  | ||| ||| | || || || ||||||| ||| || ||||| |
Sbjct: 66823 ttcaaaagcttcacat-gcttcaactctatgtgagaatggagatgggcagatgtaccggg 66765

                                                        
Query: 337   ttgtgtcgatcgggtgagcttcgatctcgttgaaagataaatc 379
             |||||||||| ||||||| | | ||||||||| ||||||||||
Sbjct: 66764 ttgtgtcgattgggtgagttccaatctcgttgcaagataaatc 66722

>dbj|AK102430.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033093H13, full
            insert sequence
          Length = 2402

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 133/163 (81%), Gaps = 1/163 (0%)
 Strand = Plus / Minus

                                                                        
Query: 217  tttgaagaagagtatggcgtnccagaactcctccacgttgacgtttttctttcggcactc 276
            ||||||||| |||||||| | |||||| ||||||||||| |  |||||||| ||||| ||
Sbjct: 2056 tttgaagaacagtatggcatcccagaattcctccacgttaatatttttcttccggcattc 1997

                                                                        
Query: 277  ctcgaaggcttcacaccgtttcgactttgtgcgaaaacggagatgagcatatataccgtg 336
             || || ||||||||  | ||| ||| | || || || ||||||| ||| || ||||| |
Sbjct: 1996 ttcaaaagcttcacat-gcttcaactctatgtgagaatggagatgggcagatgtaccggg 1938

                                                       
Query: 337  ttgtgtcgatcgggtgagcttcgatctcgttgaaagataaatc 379
            |||||||||| ||||||| | | ||||||||| ||||||||||
Sbjct: 1937 ttgtgtcgattgggtgagttccaatctcgttgcaagataaatc 1895

>ref|XM_749409.1| Aspergillus fumigatus Af293 hypothetical protein (Afu3g11170)
           partial mRNA
          Length = 1944

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 299 gactttgtgcgaaaacggagatga 322
           |||||||||| |||||||||||||
Sbjct: 875 gactttgtgccaaaacggagatga 898

>emb|AL035541.15|HS718J7 Human DNA sequence from clone RP4-718J7 on chromosome 20q13.31-13.33
             Contains the PCK1 gene for soluble phosphoenolpyruvate
             carboxykinase 1, the ZBP1 gene for Z-DNA binding protein
             1, the 3' end of the TMEPAI gene for transmembrane
             prostate androgen induced mRNA, two putative novel genes,
             the 5' end of the CTCFL gene for CCCTC-binding factor
             (zinc finger)-like and a CpG island, complete sequence
          Length = 130435

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 121   cttcagagaagggctgagtg 140
             ||||||||||||||||||||
Sbjct: 19134 cttcagagaagggctgagtg 19115

>emb|AL844609.6| Mouse DNA sequence from clone RP23-356F8 on chromosome 4, complete
             sequence
          Length = 191676

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 121   cttcagagaagggctgagtg 140
             ||||||||||||||||||||
Sbjct: 21159 cttcagagaagggctgagtg 21140


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,975,783
Number of Sequences: 3902068
Number of extensions: 2975783
Number of successful extensions: 48110
Number of sequences better than 10.0: 7
Number of HSP's better than 10.0 without gapping: 7
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 48077
Number of HSP's gapped (non-prelim): 33
length of query: 463
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 441
effective length of database: 17,147,199,772
effective search space: 7561915099452
effective search space used: 7561915099452
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)